Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
HPS6	79803	broad.mit.edu	36	10	103817278	103817278	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:103817278C>T	uc001kuj.1	+	c.2057C>T	c.(2056-2058)GCT>GTT	p.A686V		NM_024747	NP_079023	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome-6	686						cytosol|early endosome membrane|endoplasmic reticulum|microsome					0		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)										0.333333	12.638773	13.084203	6	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	103817278	103817278	7635	10	C	T	T	28	28	HPS6	T	2	2
FAM107B	83641	broad.mit.edu	36	10	14612354	14612354	+	Silent	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:14612354A>T	uc001ina.1	-	c.636T>A	c.(634-636)CTT>CTA	p.L212L	FAM107B_uc001imy.1_Silent_p.L37L|FAM107B_uc001imz.1_Silent_p.L37L|FAM107B_uc001imx.1_Silent_p.L37L|FAM107B_uc009xjg.1_Silent_p.L37L	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641	37										breast(4)	4														0.179487	8.998511	12.778157	7	32	AA		KEEP	---	---	---	---	capture			Silent	SNP	14612354	14612354	5587	10	A	T	T	9	9	FAM107B	T	4	4
C10orf18	54906	broad.mit.edu	36	10	5821804	5821804	+	Silent	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:5821804A>G	uc001iij.2	+	c.1665A>G	c.(1663-1665)AGA>AGG	p.R555R	C10orf18_uc001iik.2_Intron	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	555										ovary(1)|central_nervous_system(1)	2														0.266667	13.077949	14.561776	8	22	AA		KEEP	---	---	---	---	capture			Silent	SNP	5821804	5821804	1633	10	A	G	G	9	9	C10orf18	G	4	4
TET1	80312	broad.mit.edu	36	10	70003202	70003202	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:70003202G>T	uc001jok.2	+	c.1101G>T	c.(1099-1101)CAG>CAT	p.Q367H		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	367					DNA demethylation|inner cell mass cell differentiation|oxidation-reduction process|stem cell maintenance	nucleus	iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)	5										280				0.25	7.916275	9.302288	6	18	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70003202	70003202	16296	10	G	T	T	35	35	TET1	T	3	3
TET1	80312	broad.mit.edu	36	10	70003325	70003325	+	Silent	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:70003325C>T	uc001jok.2	+	c.1224C>T	c.(1222-1224)GTC>GTT	p.V408V		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	408					DNA demethylation|inner cell mass cell differentiation|oxidation-reduction process|stem cell maintenance	nucleus	iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)	5										280				0.444444	7.2913	7.316227	4	5	CC		KEEP	---	---	---	---	capture			Silent	SNP	70003325	70003325	16296	10	C	T	T	32	32	TET1	T	2	2
MYOZ1	58529	broad.mit.edu	36	10	75061774	75061774	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:75061774G>A	uc001jur.1	-	c.820C>T	c.(820-822)CCC>TCC	p.P274S		NM_021245	NP_067068	Q9NP98	MYOZ1_HUMAN	myozenin 1	274					myofibril assembly	nucleus|pseudopodium	FATZ binding			ovary(2)	2	Prostate(51;0.0112)													0.404908	167.991593	169.284213	66	97	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75061774	75061774	10490	10	G	A	A	41	41	MYOZ1	A	2	2
CAMK2G	818	broad.mit.edu	36	10	75244878	75244878	+	Silent	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:75244878G>C	uc001jvm.1	-	c.1572C>G	c.(1570-1572)ACC>ACG	p.T524T	CAMK2G_uc001jvo.1_Silent_p.T495T|CAMK2G_uc001jvq.1_Silent_p.T472T|CAMK2G_uc001jvr.1_Silent_p.T463T|CAMK2G_uc001jvp.1_Silent_p.T486T|CAMK2G_uc001jvs.1_Silent_p.T507T|CAMK2G_uc001jvt.1_Non-coding_Transcript|CAMK2G_uc001jvu.1_Silent_p.T464T|CAMK2G_uc009xrp.1_Silent_p.T113T	NM_172171	NP_751911	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II	526					insulin secretion|interferon-gamma-mediated signaling pathway|protein phosphorylation|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)	1	Prostate(51;0.0112)									423				0.210526	10.973135	13.929689	8	30	GG		KEEP	---	---	---	---	capture			Silent	SNP	75244878	75244878	2719	10	G	C	C	47	47	CAMK2G	C	3	3
SH2D4B	387694	broad.mit.edu	36	10	82393751	82393751	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:82393751G>T	uc001kck.1	+	c.1008G>T	c.(1006-1008)AGG>AGT	p.R336S	SH2D4B_uc001kcl.1_Missense_Mutation_p.R288S|SH2D4B_uc001kcm.1_Missense_Mutation_p.G157V|SH2D4B_uc001kcn.1_Non-coding_Transcript	NM_207372	NP_997255	Q5SQS7	SH24B_HUMAN	SH2 domain containing 4B	Error:Variant_position_missing_in_Q5SQS7_after_alignment											0			Colorectal(32;0.229)											0.1625	23.525296	32.19227	13	67	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	82393751	82393751	14727	10	G	T	T	41	41	SH2D4B	T	3	3
KIF20B	9585	broad.mit.edu	36	10	91460782	91460782	+	Missense_Mutation	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:91460782A>T	uc001kgs.1	+	c.575A>T	c.(574-576)AAC>ATC	p.N192I	KIF20B_uc001kgr.1_Missense_Mutation_p.N192I	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	192	Kinesin-motor.				cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)	2														0.357143	8.257855	8.514814	5	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	91460782	91460782	8598	10	A	T	T	2	2	KIF20B	T	4	4
C10orf12	26148	broad.mit.edu	36	10	98734403	98734403	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:98734403G>C	uc001kmv.1	+	c.3266G>C	c.(3265-3267)CGC>CCC	p.R1089P		NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	1089											0		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)										0.4	11.536884	11.670491	6	9	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	98734403	98734403	1624	10	G	C	C	38	38	C10orf12	C	3	3
SLIT1	6585	broad.mit.edu	36	10	98752698	98752698	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:98752698G>C	uc001kmw.2	-	c.3907C>G	c.(3907-3909)CAG>GAG	p.Q1303E		NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1	1303	Laminin G-like.				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)										0.5	6.922036	6.922036	3	3	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	98752698	98752698	15237	10	G	C	C	46	46	SLIT1	C	3	3
SLIT1	6585	broad.mit.edu	36	10	98810423	98810423	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:98810423G>A	uc001kmw.2	-	c.905C>T	c.(904-906)GCC>GTC	p.A302V	SLIT1_uc009xvh.1_Missense_Mutation_p.A302V	NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1	302	LRRNT 2.				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)										0.571429	50.100281	50.224353	16	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	98810423	98810423	15237	10	G	A	A	42	42	SLIT1	A	2	2
CRTAC1	55118	broad.mit.edu	36	10	99654522	99654522	+	Missense_Mutation	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:99654522A>T	uc001kou.1	-	c.890T>A	c.(889-891)CTG>CAG	p.L297Q	CRTAC1_uc001kov.2_Missense_Mutation_p.L286Q|CRTAC1_uc001kot.1_Missense_Mutation_p.L87Q	NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	297	FG-GAP 3; atypical.					proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)										0.261905	14.578354	16.758515	11	31	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99654522	99654522	4035	10	A	T	T	7	7	CRTAC1	T	4	4
EXPH5	23086	broad.mit.edu	36	11	107887366	107887366	+	Nonsense_Mutation	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:107887366C>A	uc001pkk.1	-	c.4078G>T	c.(4078-4080)GAA>TAA	p.E1360*		NM_015065	NP_055880	Q149M6	Q149M6_HUMAN	exophilin 5 isoform a	1360					intracellular protein transport		Rab GTPase binding			ovary(2)	2		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)										0.263158	7.658988	8.629969	5	14	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	107887366	107887366	5516	11	C	A	A	30	30	EXPH5	A	5	3
CHEK1	1111	broad.mit.edu	36	11	125010583	125010583	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:125010583G>A	uc009zbo.1	+	c.663G>A	c.(661-663)TGG>TGA	p.W221*	CHEK1_uc001qcf.2_Nonsense_Mutation_p.W221*|CHEK1_uc009zbp.1_Nonsense_Mutation_p.W221*|CHEK1_uc001qcg.2_Nonsense_Mutation_p.W221*|CHEK1_uc009zbq.1_Nonsense_Mutation_p.W221*|CHEK1_uc001qch.2_Nonsense_Mutation_p.W127*|CHEK1_uc001qci.1_Non-coding_Transcript	NM_001114122	NP_001107594	O14757	CHK1_HUMAN	CHK1 checkpoint homolog	221	Protein kinase.				cellular response to mechanical stimulus|DNA repair|DNA replication|gamete generation|negative regulation of cell proliferation|reciprocal meiotic recombination|regulation of cyclin-dependent protein kinase activity|replicative senescence	condensed nuclear chromosome|microtubule organizing center|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(1)	4	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)						124				0.542857	59.418357	59.473579	19	16	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	125010583	125010583	3468	11	G	A	A	41	41	CHEK1	A	5	2
OR52I2	143502	broad.mit.edu	36	11	4565517	4565517	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:4565517C>T	uc001lzd.1	+	c.899C>T	c.(898-900)CCC>CTC	p.P300L		NM_001005170	NP_001005170	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I,	300	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)										0.160494	10.415487	19.346024	13	68	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4565517	4565517	11531	11	C	T	T	22	22	OR52I2	T	2	2
LRP4	4038	broad.mit.edu	36	11	46854723	46854723	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:46854723G>A	uc001ndn.2	-	c.3406C>T	c.(3406-3408)CGG>TGG	p.R1136W		NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	1136	Extracellular (Potential).|LDL-receptor class B 12.				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			ovary(1)	1				Lung(87;0.159)										0.222222	21.883361	24.436557	8	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46854723	46854723	9332	11	G	A	A	39	39	LRP4	A	1	1
GLYATL1	92292	broad.mit.edu	36	11	58478915	58478915	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:58478915G>A	uc001nnh.1	+	c.376G>A	c.(376-378)GTA>ATA	p.V126I	GLYATL1_uc001nnf.1_Missense_Mutation_p.V95I|GLYATL1_uc001nni.1_Missense_Mutation_p.V95I|GLYATL1_uc001nnj.1_Missense_Mutation_p.V95I	NM_080661	NP_542392	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	95						mitochondrion	glycine N-acyltransferase activity			ovary(1)	1					Glycine(DB00145)									0.206897	24.260888	28.888328	12	46	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	58478915	58478915	6748	11	G	A	A	40	40	GLYATL1	A	1	1
EHD1	10938	broad.mit.edu	36	11	64398524	64398524	+	Silent	SNP	G	T	T			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:64398524G>T	uc001obu.1	-	c.447C>A	c.(445-447)ATC>ATA	p.I149I	EHD1_uc001obv.1_Silent_p.I149I	NM_006795	NP_006786	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	149					blood coagulation|cholesterol homeostasis|endocytic recycling|intracellular protein transport|low-density lipoprotein particle clearance|positive regulation of cholesterol storage|protein homooligomerization	early endosome membrane|lipid particle|plasma membrane|platelet dense tubular network membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|protein binding				0														0.5	7.117922	7.117922	3	3	GG		KEEP	---	---	---	---	capture			Silent	SNP	64398524	64398524	5166	11	G	T	T	45	45	EHD1	T	3	3
ILK	3611	broad.mit.edu	36	11	6586536	6586537	+	Missense_Mutation	DNP	AA	CC	CC			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:6586536_6586537AA>CC	uc001mee.1	+	c.388_389AA>CC	c.(388-390)AAC>CCC	p.N130P	ILK_uc001mef.1_Missense_Mutation_p.N130P|ILK_uc001meg.1_5'UTR|ILK_uc001meh.1_Missense_Mutation_p.N130P|ILK_uc001mei.1_5'Flank	NM_001014794	NP_004508	Q13418	ILK_HUMAN	integrin-linked kinase	130	Interaction with LIMS1.|ANK 5.				cell junction assembly|cell proliferation|cell-matrix adhesion|integrin-mediated signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of transcription, DNA-dependent	cytosol|focal adhesion	ATP binding|protein serine/threonine kinase activity|transcription activator activity			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)						83				0.4	12.841809	12.974202	6	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	6586536	6586537	8014	11	AA	CC	CC	13	13	ILK	CC	4	4
NPAS4	266743	broad.mit.edu	36	11	65949268	65949268	+	Silent	SNP	T	C	C			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:65949268T>C	uc001ohx.1	+	c.2331T>C	c.(2329-2331)ACT>ACC	p.T777T		NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	777				T -> A (in Ref. 2; BAC04271).	transcription, DNA-dependent		DNA binding|signal transducer activity				0														0.238095	6.755695	8.081915	5	16	TT		KEEP	---	---	---	---	capture			Silent	SNP	65949268	65949268	10969	11	T	C	C	55	55	NPAS4	C	4	4
LRFN4	78999	broad.mit.edu	36	11	66382138	66382138	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:66382138T>G	uc001ojr.1	+	c.347T>G	c.(346-348)CTC>CGC	p.L116R	PC_uc001ojo.1_Intron|PC_uc001ojp.1_Intron|PC_uc001ojn.1_Intron|LRFN4_uc001ojq.1_Missense_Mutation_p.L116R|LRFN4_uc001ojs.2_Missense_Mutation_p.L116R	NM_024036	NP_076941	Q6PJG9	LRFN4_HUMAN	leucine rich repeat and fibronectin type III	116	LRR 3.|Extracellular (Potential).					integral to membrane					0														0.857143	13.558268	14.396593	6	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66382138	66382138	9313	11	T	G	G	54	54	LRFN4	G	4	4
TYR	7299	broad.mit.edu	36	11	88550883	88550883	+	Silent	SNP	G	C	C	rs1939261	unknown	TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:88550883G>C	uc001pcs.1	+	c.114G>C	c.(112-114)CCG>CCC	p.P38P		NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor	38	Lumenal, melanosome (Potential).				eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|oxidation-reduction process|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)									0.159091	24.500196	34.243811	14	74	GG		KEEP	---	---	---	---	capture			Silent	SNP	88550883	88550883	17370	11	G	C	C	40	40	TYR	C	3	3
GABARAPL1	23710	broad.mit.edu	36	12	10261949	10261949	+	Silent	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:10261949A>G	uc001qxs.1	+	c.111A>G	c.(109-111)CCA>CCG	p.P37P	GABARAPL1_uc001qxt.1_Non-coding_Transcript|GABARAPL1_uc001qxu.1_Non-coding_Transcript	NM_031412	NP_113600	Q9H0R8	GBRL1_HUMAN	GABA(A) receptor-associated protein like 1	37	Interaction with GABRG2 (By similarity).					autophagic vacuole|endoplasmic reticulum|Golgi apparatus|membrane|microtubule	beta-tubulin binding|GABA receptor binding				0						Melanoma(3;46 76 4652 22680 42285)								0.108434	7.413765	20.043527	9	74	AA		KEEP	---	---	---	---	capture			Silent	SNP	10261949	10261949	6404	12	A	G	G	5	5	GABARAPL1	G	4	4
MED13L	23389	broad.mit.edu	36	12	114929627	114929627	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:114929627G>A	uc001tvw.1	-	c.2210C>T	c.(2209-2211)ACG>ATG	p.T737M		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	737					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		RNA polymerase II transcription mediator activity			skin(3)|ovary(1)|lung(1)	5	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)						497				0.240741	37.258846	40.562848	13	41	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	114929627	114929627	9820	12	G	A	A	40	40	MED13L	A	1	1
KDM2B	84678	broad.mit.edu	36	12	120364380	120364381	+	Missense_Mutation	DNP	AC	TG	TG			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:120364380_120364381AC>TG	uc001uat.1	-	c.3246_3247GT>CA	c.(3244-3249)CTGTGT>CTCAGT	p.C1083S	KDM2B_uc001uas.1_Missense_Mutation_p.C1014S|KDM2B_uc009zxe.1_Missense_Mutation_p.C1014S|KDM2B_uc001uau.1_Intron|KDM2B_uc009zxf.1_Missense_Mutation_p.C1083S|KDM2B_uc001uao.1_Missense_Mutation_p.C331S|KDM2B_uc001uap.1_Non-coding_Transcript|KDM2B_uc001uaq.1_Missense_Mutation_p.C523S|KDM2B_uc001uar.1_Missense_Mutation_p.C674S	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform	1083	F-box.				oxidation-reduction process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)	1														0.37037	16.268895	16.694088	10	17	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	120364380	120364381	8431	12	AC	TG	TG	6	6	KDM2B	TG	4	4
NCOR2	9612	broad.mit.edu	36	12	123390887	123390887	+	Silent	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:123390887T>G	uc009zyd.1	-	c.5415A>C	c.(5413-5415)CGA>CGC	p.R1805R	NCOR2_uc009zye.1_Silent_p.R1789R|NCOR2_uc001ugh.2_Silent_p.R1798R|NCOR2_uc001ugi.2_Silent_p.R1788R	NM_006312	NP_006303	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 1	1806					cellular lipid metabolic process|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity|transcription repressor activity			ovary(1)|skin(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)										0.5	6.520827	6.520827	3	3	TT		KEEP	---	---	---	---	capture			Silent	SNP	123390887	123390887	10635	12	T	G	G	54	54	NCOR2	G	4	4
MANSC1	54682	broad.mit.edu	36	12	12374495	12374495	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:12374495C>A	uc001rai.1	-	c.1029G>T	c.(1027-1029)ATG>ATT	p.M343I	MANSC1_uc001raj.1_Missense_Mutation_p.M309I|MANSC1_uc009zht.1_Missense_Mutation_p.M262I	NM_018050	NP_060520	Q9H8J5	MANS1_HUMAN	MANSC domain containing 1	343	Extracellular (Potential).					integral to membrane					0		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)										0.096045	16.348369	45.302952	17	160	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12374495	12374495	9607	12	C	A	A	17	17	MANSC1	A	3	3
ARHGDIB	397	broad.mit.edu	36	12	14986824	14986824	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:14986824G>A	uc001rcq.1	-	c.505C>T	c.(505-507)CGA>TGA	p.R169*	ARHGDIB_uc001rcp.1_Non-coding_Transcript	NM_001175	NP_001166	P52566	GDIR2_HUMAN	Rho GDP dissociation inhibitor (GDI) beta	169				RG -> QD (in Ref. 3; L07916).	actin cytoskeleton organization|cellular component movement|immune response|multicellular organismal development|negative regulation of cell adhesion|regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytoplasmic membrane-bounded vesicle|cytoskeleton|cytosol	GTPase activator activity|Rho GDP-dissociation inhibitor activity				0										108				0.301887	78.748758	82.47149	32	74	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	14986824	14986824	905	12	G	A	A	38	38	ARHGDIB	A	5	1
DCP1B	196513	broad.mit.edu	36	12	1932291	1932291	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:1932291A>G	uc001qjx.1	-	c.1076T>C	c.(1075-1077)CTT>CCT	p.L359P		NM_152640	NP_689853	Q8IZD4	DCP1B_HUMAN	decapping enzyme Dcp1b	359					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	hydrolase activity|protein binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00193)											0.159091	6.890565	11.778849	7	37	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1932291	1932291	4470	12	A	G	G	3	3	DCP1B	G	4	4
ETNK1	55500	broad.mit.edu	36	12	22703307	22703307	+	Missense_Mutation	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:22703307A>T	uc001rft.1	+	c.776A>T	c.(775-777)TAT>TTT	p.Y259F	ETNK1_uc009ziz.1_Missense_Mutation_p.Y259F	NM_018638	NP_061108	Q9HBU6	EKI1_HUMAN	ethanolamine kinase 1 isoform A	259					phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|ethanolamine kinase activity				0						Esophageal Squamous(42;87 913 3224 6226 43339)								0.194444	7.595257	10.748564	7	29	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22703307	22703307	5466	12	A	T	T	16	16	ETNK1	T	4	4
DIP2B	57609	broad.mit.edu	36	12	49354652	49354652	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:49354652A>G	uc001rwv.1	+	c.769A>G	c.(769-771)AGG>GGG	p.R257G	DIP2B_uc001rwu.2_Missense_Mutation_p.R257G|DIP2B_uc009zls.1_Missense_Mutation_p.R139G	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B	257						nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6														0.266667	7.692503	8.431341	4	11	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49354652	49354652	4707	12	A	G	G	7	7	DIP2B	G	4	4
AVPR1A	552	broad.mit.edu	36	12	61830058	61830058	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:61830058C>A	uc001sro.1	-	c.826G>T	c.(826-828)GTC>TTC	p.V276F		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	276	Cytoplasmic (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)									0.238095	7.155464	8.481671	5	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61830058	61830058	1252	12	C	A	A	17	17	AVPR1A	A	3	3
CHD4	1108	broad.mit.edu	36	12	6573009	6573009	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:6573009G>C	uc001qpp.1	-	c.2339C>G	c.(2338-2340)CCT>CGT	p.P780R	CHD4_uc001qpn.1_Missense_Mutation_p.P776R|CHD4_uc001qpo.1_Missense_Mutation_p.P783R	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	783	Helicase ATP-binding.				chromatin assembly or disassembly|chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	chromatin|microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|chromatin binding|DNA binding|zinc ion binding			central_nervous_system(2)	2						Colon(32;586 792 4568 16848 45314)								0.148936	11.968027	28.726106	21	120	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6573009	6573009	3461	12	G	C	C	35	35	CHD4	C	3	3
CAND1	55832	broad.mit.edu	36	12	65985992	65985992	+	Silent	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:65985992C>T	uc001stn.2	+	c.2277C>T	c.(2275-2277)TTC>TTT	p.F759F	CAND1_uc001sto.2_Silent_p.F269F	NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein	759	HEAT 17.				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)	1			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)										0.280702	46.881727	49.341988	16	41	CC		KEEP	---	---	---	---	capture			Silent	SNP	65985992	65985992	2732	12	C	T	T	30	30	CAND1	T	2	2
PEX5	5830	broad.mit.edu	36	12	7252910	7252910	+	Silent	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:7252910G>A	uc009zfu.1	+	c.1437G>A	c.(1435-1437)GTG>GTA	p.V479V	PEX5_uc001qsu.1_Silent_p.V442V|PEX5_uc009zfv.1_Silent_p.V479V|PEX5_uc001qsv.1_Silent_p.V471V|PEX5_uc001qsw.1_Silent_p.V479V	NM_000319	NP_000310	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5 isoform b	479	TPR 4.				protein import into peroxisome matrix, translocation|protein targeting to peroxisome|protein tetramerization|protein transport	cytosol|peroxisomal matrix|peroxisomal membrane	peroxisome matrix targeting signal-1 binding|protein C-terminus binding|protein N-terminus binding			ovary(1)	1														0.318182	72.35881	74.950391	28	60	GG		KEEP	---	---	---	---	capture			Silent	SNP	7252910	7252910	12170	12	G	A	A	46	46	PEX5	A	2	2
EFNB2	1948	broad.mit.edu	36	13	105943454	105943454	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:105943454G>A	uc001vqi.1	-	c.937C>T	c.(937-939)CAC>TAC	p.H313Y		NM_004093	NP_004084	P52799	EFNB2_HUMAN	ephrin B2	313	Cytoplasmic (Potential).				cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)													0.588235	111.183796	111.642735	40	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	105943454	105943454	5144	13	G	A	A	46	46	EFNB2	A	2	2
SLC7A1	6541	broad.mit.edu	36	13	28996324	28996324	+	Silent	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:28996324C>A	uc001uso.1	-	c.771G>T	c.(769-771)TCG>TCT	p.S257S		NM_003045	NP_003036	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid	257	Helical; (Potential).				cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	receptor activity				0		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)									0.2	10.101357	14.321739	10	40	CC		KEEP	---	---	---	---	capture			Silent	SNP	28996324	28996324	15189	13	C	A	A	23	23	SLC7A1	A	3	3
CDADC1	81602	broad.mit.edu	36	13	48763860	48763860	+	Missense_Mutation	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr13:48763860A>T	uc001vcu.1	+	c.1511A>T	c.(1510-1512)CAC>CTC	p.H504L	CDADC1_uc001vcv.1_Non-coding_Transcript	NM_030911	NP_112173	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1	504							hydrolase activity|zinc ion binding				0		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)										0.269231	11.2093	12.46435	7	19	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48763860	48763860	3181	13	A	T	T	6	6	CDADC1	T	4	4
PCDH17	27253	broad.mit.edu	36	13	57107097	57107098	+	Missense_Mutation	DNP	CT	AA	AA			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:57107097_57107098CT>AA	uc001vhq.1	+	c.2416_2417CT>AA	c.(2416-2418)CTC>AAC	p.L806N	PCDH17_uc010aec.1_Missense_Mutation_p.L806N	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	806	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(2)|pancreas(2)	4		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		Melanoma(72;952 1291 1619 12849 33676)								1	7.536962	7.418033	3	0	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	57107097	57107098	11932	13	CT	AA	AA	24	24	PCDH17	AA	3	3
DZIP1	22873	broad.mit.edu	36	13	95091963	95091963	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:95091963G>A	uc001vmk.1	-	c.184C>T	c.(184-186)CCG>TCG	p.P62S	DZIP1_uc001vml.1_Missense_Mutation_p.P62S|DZIP1_uc001vmn.1_Missense_Mutation_p.P51S	NM_198968	NP_945319	Q86YF9	DZIP1_HUMAN	DAZ interacting protein 1 isoform 2	62					germ cell development|multicellular organismal development|spermatogenesis	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)											0.4	7.389289	7.478892	4	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	95091963	95091963	5049	13	G	A	A	42	42	DZIP1	A	2	2
PABPN1	8106	broad.mit.edu	36	14	22847025	22847027	+	Missense_Mutation	TNP	TGA	CTC	CTC			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:22847025_22847027TGA>CTC	uc001wjh.2	+	c.209_211TGA>CTC	c.(208-213)GTGACC>GCTCCC	p.70_71VT>AP	BCL2L2_uc001wjg.2_Missense_Mutation_p.70_71VT>AP|BCL2L2_uc001wji.2_Missense_Mutation_p.70_71VT>AP	NM_004643	NP_004634	Q86U42	PABP2_HUMAN	poly(A) binding protein, nuclear 1	149_150	Potential.				modification by virus of host mRNA processing|mRNA 3'-end processing|muscle contraction|nuclear mRNA splicing, via spliceosome|poly(A)+ mRNA export from nucleus|termination of RNA polymerase II transcription|viral infectious cycle	cytoplasm|nucleoplasm|ribonucleoprotein complex	nucleotide binding|protein binding|RNA binding			ovary(2)	2	all_cancers(95;6.69e-06)			GBM - Glioblastoma multiforme(265;0.00643)						17				0.8	8.51249	8.906596	4	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	TNP	22847025	22847027	11784	14	TGA	CTC	CTC	59	59	PABPN1	CTC	4	4
KHNYN	23351	broad.mit.edu	36	14	23970854	23970854	+	Missense_Mutation	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:23970854C>G	uc001wph.2	+	c.547C>G	c.(547-549)CCC>GCC	p.P183A	CBLN3_uc001wpg.2_5'Flank|KHNYN_uc010alw.1_Missense_Mutation_p.P183A	NM_015299	NP_056114	O15037	KHNYN_HUMAN	hypothetical protein LOC23351	183										ovary(2)|liver(1)	3												OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.428571	6.323683	6.354426	3	4	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23970854	23970854	8456	14	C	G	G	26	26	KHNYN	G	3	3
PTGDR	5729	broad.mit.edu	36	14	51805038	51805039	+	Missense_Mutation	DNP	AG	GT	GT			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:51805038_51805039AG>GT	uc001wzq.1	+	c.756_757AG>GT	c.(754-759)GAAGCG>GAGTCG	p.A253S		NM_000953	NP_000944	Q13258	PD2R_HUMAN	prostaglandin D2 receptor	253	Cytoplasmic (Potential).					integral to membrane|plasma membrane	prostaglandin D receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)									0.75	7.176387	7.353035	3	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	51805038	51805039	13195	14	AG	GT	GT	3	3	PTGDR	GT	4	4
FBXO34	55030	broad.mit.edu	36	14	54888968	54888968	+	Nonsense_Mutation	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:54888968A>T	uc001xbu.1	+	c.2107A>T	c.(2107-2109)AAA>TAA	p.K703*	FBXO34_uc001xbv.2_Non-coding_Transcript|FBXO34_uc010aoo.1_Nonsense_Mutation_p.K703*	NM_017943	NP_060413	Q9NWN3	FBX34_HUMAN	F-box only protein 34	703										lung(2)|ovary(1)|skin(1)	4														0.594595	92.999979	93.561701	44	30	AA		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	54888968	54888968	5981	14	A	T	T	1	1	FBXO34	T	5	4
AKAP5	9495	broad.mit.edu	36	14	64005398	64005398	+	Nonsense_Mutation	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:64005398C>G	uc001xhd.2	+	c.533C>G	c.(532-534)TCA>TGA	p.S178*	ZBTB25_uc001xhc.2_Intron|AKAP5_uc001xhe.2_Nonsense_Mutation_p.S178*	NM_004857	NP_004848	P24588	AKAP5_HUMAN	A-kinase anchor protein 5	178					energy reserve metabolic process|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting|regulation of insulin secretion|signal transduction|synaptic transmission	cytosol	adenylate cyclase binding|calmodulin binding				0				all cancers(60;0.00749)|OV - Ovarian serous cystadenocarcinoma(108;0.0095)|BRCA - Breast invasive adenocarcinoma(234;0.0449)										0.333333	8.459675	8.833859	5	10	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	64005398	64005398	457	14	C	G	G	29	29	AKAP5	G	5	3
PCNX	22990	broad.mit.edu	36	14	70563278	70563278	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:70563278G>T	uc001xmo.2	+	c.3392G>T	c.(3391-3393)GGT>GTT	p.G1131V	PCNX_uc010are.1_Missense_Mutation_p.G1020V|PCNX_uc010arf.1_5'UTR	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1131	Helical; (Potential).					integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)										0.15	7.808591	12.540549	6	34	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70563278	70563278	12011	14	G	T	T	44	44	PCNX	T	3	3
BTBD7	55727	broad.mit.edu	36	14	92830450	92830450	+	Silent	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:92830450A>T	uc001ybo.1	-	c.669T>A	c.(667-669)CTT>CTA	p.L223L	BTBD7_uc010aur.1_5'UTR|BTBD7_uc001ybp.1_Intron|BTBD7_uc001ybq.2_Silent_p.L138L|BTBD7_uc001ybr.1_Silent_p.L223L	NM_001002860	NP_001002860	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7 isoform 1	223										pancreas(1)	1		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)										0.215686	14.680769	18.507668	11	40	AA		KEEP	---	---	---	---	capture			Silent	SNP	92830450	92830450	1580	14	A	T	T	13	13	BTBD7	T	4	4
CDAN1	146059	broad.mit.edu	36	15	40814757	40814757	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:40814757C>A	uc001zql.1	-	c.1051G>T	c.(1051-1053)GTC>TTC	p.V351F	CDAN1_uc001zqk.1_5'Flank|CDAN1_uc010bcx.1_Non-coding_Transcript	NM_138477	NP_612486	Q8IWY9	CDAN1_HUMAN	codanin 1	351						integral to membrane	protein binding			ovary(2)	2		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)										0.285714	7.188704	7.769857	4	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40814757	40814757	3182	15	C	A	A	17	17	CDAN1	A	3	3
CD276	80381	broad.mit.edu	36	15	71787786	71787786	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:71787786G>C	uc002avv.1	+	c.1423G>C	c.(1423-1425)GTC>CTC	p.V475L	CD276_uc010bjd.1_Missense_Mutation_p.V329L|CD276_uc002avu.1_Missense_Mutation_p.V475L|CD276_uc002avw.1_Missense_Mutation_p.V257L|CD276_uc002avx.2_Non-coding_Transcript	NM_001024736	NP_001019907	Q5ZPR3	CD276_HUMAN	CD276 antigen isoform a	475	Helical; (Potential).				cell proliferation|immune response|positive regulation of interferon-gamma biosynthetic process|positive regulation of T cell proliferation|regulation of immune response|T cell activation	external side of plasma membrane|integral to membrane	receptor binding				0														0.189189	7.392143	10.755932	7	30	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71787786	71787786	3120	15	G	C	C	48	48	CD276	C	3	3
IL32	9235	broad.mit.edu	36	16	3059295	3059295	+	Missense_Mutation	SNP	C	A	A	rs2741929	unknown	TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:3059295C>A	uc002cto.1	+	c.643C>A	c.(643-645)CCA>ACA	p.P215T	IL32_uc002ctk.1_Missense_Mutation_p.P112T|IL32_uc010btb.1_Missense_Mutation_p.P159T|IL32_uc002ctl.1_Missense_Mutation_p.P169T|IL32_uc002ctm.1_Missense_Mutation_p.P169T|IL32_uc002ctn.1_Missense_Mutation_p.P169T|IL32_uc002cts.2_Missense_Mutation_p.P169T|IL32_uc002ctp.1_Missense_Mutation_p.P149T|IL32_uc002ctq.1_Missense_Mutation_p.P215T|IL32_uc002ctr.1_Missense_Mutation_p.P149T|IL32_uc002ctt.1_Missense_Mutation_p.P169T|IL32_uc002ctu.1_Missense_Mutation_p.P160T	NM_004221	NP_004212	P24001	IL32_HUMAN	interleukin 32 isoform B	215					cell adhesion|defense response|immune response	extracellular space	cytokine activity			pancreas(1)	1														0.272727	16.44392	17.465925	6	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3059295	3059295	7993	16	C	A	A	22	22	IL32	A	3	3
C16orf89	146556	broad.mit.edu	36	16	5050336	5050337	+	Missense_Mutation	DNP	AA	TT	TT			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:5050336_5050337AA>TT	uc010bud.1	-	c.574_575TT>AA	c.(574-576)TTC>AAC	p.F192N	ALG1_uc002cyj.1_Intron|C16orf89_uc002cyk.2_Missense_Mutation_p.F192N	NM_152459	NP_689672	Q6UX73	CP089_HUMAN	hypothetical protein LOC146556 isoform 1	154						extracellular region				ovary(1)	1														1	9.040538	8.978539	4	0	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	5050336	5050337	1895	16	AA	TT	TT	9	9	C16orf89	TT	4	4
ARL2BP	23568	broad.mit.edu	36	16	55841860	55841860	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:55841860C>A	uc002elf.1	+	c.330C>A	c.(328-330)GAC>GAA	p.D110E		NM_012106	NP_036238	Q9Y2Y0	AR2BP_HUMAN	binder of Arl Two	110				D->A: Decreases interaction with ARL2.	maintenance of protein location in nucleus|positive regulation of tyrosine phosphorylation of Stat3 protein|signal transduction	centrosome|midbody|mitochondrial intermembrane space|nucleus|spindle	protein binding|small GTPase regulator activity|transcription coactivator activity				0														0.173529	127.812968	162.038422	59	281	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55841860	55841860	951	16	C	A	A	17	17	ARL2BP	A	3	3
HYDIN	54768	broad.mit.edu	36	16	69401379	69401379	+	Missense_Mutation	SNP	T	A	A			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:69401379T>A	uc002ezr.1	-	c.14688A>T	c.(14686-14688)AAA>AAT	p.K4896N	HYDIN_uc010cfy.1_Non-coding_Transcript	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	4897										ovary(1)	1		Ovarian(137;0.0654)												0.481481	24.133405	24.142895	13	14	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69401379	69401379	7767	16	T	A	A	56	56	HYDIN	A	4	4
JPH3	57338	broad.mit.edu	36	16	86235897	86235897	+	Silent	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:86235897C>G	uc002fkd.1	+	c.915C>G	c.(913-915)CGC>CGG	p.R305R		NM_020655	NP_065706	Q8WXH2	JPH3_HUMAN	junctophilin 3	305	Cytoplasmic (Potential).|MORN 7.				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane	protein binding			ovary(1)|pancreas(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0287)										0.384615	9.892753	10.036202	5	8	CC		KEEP	---	---	---	---	capture			Silent	SNP	86235897	86235897	8266	16	C	G	G	28	28	JPH3	G	3	3
ZNF276	92822	broad.mit.edu	36	16	88331955	88331955	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:88331955G>C	uc002fos.2	+	c.1645G>C	c.(1645-1647)GAG>CAG	p.E549Q	FANCA_uc002fou.1_3'UTR|ZNF276_uc010ciq.1_Missense_Mutation_p.E335Q|ZNF276_uc002fop.2_3'UTR|ZNF276_uc002foq.2_Missense_Mutation_p.E474Q|ZNF276_uc010cir.1_Non-coding_Transcript|ZNF276_uc002for.2_Missense_Mutation_p.E335Q|ZNF276_uc010cis.1_Missense_Mutation_p.E308Q|ZNF276_uc002fot.2_Non-coding_Transcript|ZNF276_uc010cit.1_3'UTR	NM_001113525	NP_001106997	Q8N554	ZN276_HUMAN	zinc finger protein 276 isoform a	549					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)										0.263158	8.158638	9.12965	5	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	88331955	88331955	18403	16	G	C	C	45	45	ZNF276	C	3	3
MYH8	4626	broad.mit.edu	36	17	10244817	10244817	+	Missense_Mutation	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:10244817C>G	uc002gmm.2	-	c.3350G>C	c.(3349-3351)CGC>CCC	p.R1117P		NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1117	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(3)|breast(2)	5														0.4	10.533542	10.667874	6	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10244817	10244817	10436	17	C	G	G	27	27	MYH8	G	3	3
DNAH9	1770	broad.mit.edu	36	17	11749779	11749779	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:11749779T>G	uc002gne.1	+	c.11677T>G	c.(11677-11679)TCG>GCG	p.S3893A	DNAH9_uc010coo.1_Missense_Mutation_p.S3187A|DNAH9_uc002gnf.1_Missense_Mutation_p.S205A	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	3893	AAA 6 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	10		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)										0.177778	8.385599	12.788383	8	37	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	11749779	11749779	4791	17	T	G	G	50	50	DNAH9	G	4	4
FBXW10	10517	broad.mit.edu	36	17	18622891	18622892	+	Missense_Mutation	DNP	AG	CT	CT			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:18622891_18622892AG>CT	uc002gul.1	+	c.2741_2742AG>CT	c.(2740-2742)CAG>CCT	p.Q914P	FBXW10_uc002guk.2_Missense_Mutation_p.Q905P|FBXW10_uc010cqh.1_Missense_Mutation_p.Q852P|FBXW10_uc002guj.1_Missense_Mutation_p.Q904P|FAM18B1_uc002gum.2_5'Flank	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10	905										ovary(1)	1														0.168421	28.944752	48.828913	32	158	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	18622891	18622892	6000	17	AG	CT	CT	7	7	FBXW10	CT	4	4
NF1	4763	broad.mit.edu	36	17	26521129	26521129	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:26521129C>T	uc002hgg.1	+	c.574C>T	c.(574-576)CGA>TGA	p.R192*	NF1_uc002hge.1_Nonsense_Mutation_p.R192*|NF1_uc002hgf.1_Nonsense_Mutation_p.R192*|NF1_uc002hgh.1_Nonsense_Mutation_p.R192*|NF1_uc010csn.1_Intron	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	192					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)|p.R192*(1)		soft_tissue(155)|central_nervous_system(56)|large_intestine(27)|lung(19)|haematopoietic_and_lymphoid_tissue(13)|ovary(12)|autonomic_ganglia(7)|skin(3)|stomach(2)|breast(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	300		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)					p.R192*(JHUEM1-Tumor)|p.R192*(KS1-Tumor)	847	TCGA GBM(6;<1E-8)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.37931	33.420591	33.7901	11	18	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	26521129	26521129	10756	17	C	T	T	19	19	NF1	T	5	1
NF1	4763	broad.mit.edu	36	17	26557504	26557504	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:26557504C>T	uc002hgg.1	+	c.1381C>T	c.(1381-1383)CGA>TGA	p.R461*	NF1_uc002hge.1_Nonsense_Mutation_p.R461*|NF1_uc002hgf.1_Nonsense_Mutation_p.R461*|NF1_uc002hgh.1_Nonsense_Mutation_p.R461*|NF1_uc010csn.1_Nonsense_Mutation_p.R321*	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	461					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(4)|p.R461*(2)		soft_tissue(155)|central_nervous_system(56)|large_intestine(27)|lung(19)|haematopoietic_and_lymphoid_tissue(13)|ovary(12)|autonomic_ganglia(7)|skin(3)|stomach(2)|breast(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	300		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)					p.R461*(SNU1040-Tumor)|p.R461*(KPNYN-Tumor)	847	TCGA GBM(6;<1E-8)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.095541	13.017696	38.778707	15	142	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	26557504	26557504	10756	17	C	T	T	19	19	NF1	T	5	1
MED1	5469	broad.mit.edu	36	17	34818848	34818848	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:34818848G>A	uc002hrv.2	-	c.3152C>T	c.(3151-3153)ACT>ATT	p.T1051I	MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	1051	Interaction with ESR1.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription mediator activity|thyroid hormone receptor binding|transcription activator activity|vitamin D receptor binding			ovary(1)|kidney(1)	2		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		Pancreas(21;279 768 2492 4877 24026)								0.15735	128.897505	183.02194	76	407	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	34818848	34818848	9814	17	G	A	A	36	36	MED1	A	2	2
KRT36	8689	broad.mit.edu	36	17	36897253	36897253	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:36897253G>C	uc002hwt.1	-	c.863C>G	c.(862-864)ACT>AGT	p.T288S		NM_003771	NP_003762	O76013	KRT36_HUMAN	keratin 36	288	Rod.|Coil 2.					intermediate filament	protein binding|structural constituent of epidermis				0		Breast(137;0.000286)												0.285714	8.220261	9.101787	6	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36897253	36897253	8788	17	G	C	C	36	36	KRT36	C	3	3
ARHGAP27	201176	broad.mit.edu	36	17	40831124	40831124	+	Missense_Mutation	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:40831124C>G	uc002iix.1	-	c.793G>C	c.(793-795)GCC>CCC	p.A265P	ARHGAP27_uc010dak.1_Missense_Mutation_p.A238P	NM_199282	NP_954976	Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27	606	PH.				positive regulation of Cdc42 GTPase activity|receptor-mediated endocytosis|signal transduction	cytoplasm|membrane	Rac GTPase activator activity|SH3 domain binding				0	Renal(3;0.0405)													0.875	14.624684	15.697542	7	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40831124	40831124	888	17	C	G	G	26	26	ARHGAP27	G	3	3
SP2	6668	broad.mit.edu	36	17	43347754	43347754	+	Splice_Site_SNP	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:43347754G>A	uc002imk.1	+	c.e2_splice_site			SP2_uc002iml.1_Splice_Site_SNP	NM_003110	NP_003101			Sp2 transcription factor						immune response|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|histone deacetylase binding|RNA polymerase II transcription factor activity|zinc ion binding				0														0.35	32.211345	33.016806	14	26	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	43347754	43347754	15464	17	G	A	A	42	42	SP2	A	5	2
C17orf47	284083	broad.mit.edu	36	17	53975728	53975728	+	Silent	SNP	G	T	T			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:53975728G>T	uc002iwq.1	-	c.819C>A	c.(817-819)CTC>CTA	p.L273L		NM_001038704	NP_001033793	Q8NEP4	CQ047_HUMAN	hypothetical protein LOC284083	273										breast(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)													0.127119	47.395775	79.394665	30	206	GG		KEEP	---	---	---	---	capture			Silent	SNP	53975728	53975728	1914	17	G	T	T	45	45	C17orf47	T	3	3
SLC16A5	9121	broad.mit.edu	36	17	70607734	70607734	+	Silent	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:70607734G>A	uc002jmr.1	+	c.381G>A	c.(379-381)ACG>ACA	p.T127T	SLC16A5_uc002jms.1_Silent_p.T127T|SLC16A5_uc002jmt.1_Silent_p.T127T|SLC16A5_uc002jmu.1_Silent_p.T127T	NM_004695	NP_004686	O15375	MOT6_HUMAN	solute carrier family 16, member 5	127	Helical; (Potential).				organic anion transport	integral to plasma membrane|membrane fraction	secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)									0.382353	39.570335	39.981715	13	21	GG		KEEP	---	---	---	---	capture			Silent	SNP	70607734	70607734	14907	17	G	A	A	39	39	SLC16A5	A	1	1
QRICH2	84074	broad.mit.edu	36	17	71799643	71799643	+	Silent	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71799643A>G	uc002jrd.1	-	c.2262T>C	c.(2260-2262)GGT>GGC	p.G754G	QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	754	Gln-rich.						protein binding			ovary(1)|lung(1)|central_nervous_system(1)|pancreas(1)	4														0.202532	21.184205	27.672158	16	63	AA		KEEP	---	---	---	---	capture			Silent	SNP	71799643	71799643	13338	17	A	G	G	14	14	QRICH2	G	4	4
ATP1B2	482	broad.mit.edu	36	17	7498267	7498267	+	Silent	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7498267T>G	uc002gif.1	+	c.519T>G	c.(517-519)ACT>ACG	p.T173T		NM_001678	NP_001669	P14415	AT1B2_HUMAN	Na+/K+ -ATPase beta 2 subunit	173	Extracellular (Potential).				ATP biosynthetic process|blood coagulation|leukocyte migration	integral to membrane|plasma membrane	protein binding|sodium:potassium-exchanging ATPase activity	p.0?(2)		pancreas(1)	1		all_cancers(10;0.000178)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;2.55e-06)|READ - Rectum adenocarcinoma(115;0.168)										0.272727	9.233757	10.26465	6	16	TT		KEEP	---	---	---	---	capture			Silent	SNP	7498267	7498267	1152	17	T	G	G	55	55	ATP1B2	G	4	4
CTDP1	9150	broad.mit.edu	36	18	75576267	75576267	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr18:75576267A>G	uc002lnh.1	+	c.1819A>G	c.(1819-1821)AAG>GAG	p.K607E	CTDP1_uc002lni.1_Missense_Mutation_p.K607E|CTDP1_uc010drd.1_Missense_Mutation_p.K607E	NM_004715	NP_004706	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,	607					positive regulation of viral transcription|protein dephosphorylation|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	CTD phosphatase activity|DNA-directed RNA polymerase activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)										0.357143	18.925408	19.435434	10	18	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75576267	75576267	4161	18	A	G	G	5	5	CTDP1	G	4	4
ICAM5	7087	broad.mit.edu	36	19	10265742	10265742	+	Missense_Mutation	SNP	T	A	A			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:10265742T>A	uc002mnu.2	+	c.1738T>A	c.(1738-1740)TGC>AGC	p.C580S	ICAM5_uc002mnv.2_Missense_Mutation_p.C455S	NM_003259	NP_003250	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5 precursor	580	Extracellular (Potential).|Ig-like C2-type 7.				cell-cell adhesion	integral to plasma membrane				breast(3)	3			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)											0.857143	13.549823	14.39617	6	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10265742	10265742	7783	19	T	A	A	55	55	ICAM5	A	4	4
TYK2	7297	broad.mit.edu	36	19	10328316	10328316	+	Silent	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:10328316G>A	uc002moc.2	-	c.2545C>T	c.(2545-2547)CTG>TTG	p.L849L	TYK2_uc010dxe.1_Silent_p.L664L	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	849	Protein kinase 1.				intracellular protein kinase cascade|protein phosphorylation|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(2)|lung(2)|breast(1)	5			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)							414				0.208333	12.664054	14.552852	5	19	GG		KEEP	---	---	---	---	capture			Silent	SNP	10328316	10328316	17367	19	G	A	A	33	33	TYK2	A	2	2
MAN2B1	4125	broad.mit.edu	36	19	12635521	12635521	+	Silent	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:12635521G>A	uc002mub.2	-	c.759C>T	c.(757-759)TTC>TTT	p.F253F	MAN2B1_uc010dyv.1_Silent_p.F253F	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	253					protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6														0.545455	11.631779	11.64998	6	5	GG		KEEP	---	---	---	---	capture			Silent	SNP	12635521	12635521	9599	19	G	A	A	45	45	MAN2B1	A	2	2
SLC35E1	79939	broad.mit.edu	36	19	16539845	16539845	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:16539845T>G	uc002nel.2	-	c.196A>C	c.(196-198)AAG>CAG	p.K66Q	MED26_uc002nee.2_Intron|SLC35E1_uc002nem.1_Missense_Mutation_p.K210Q	NM_024881	NP_079157	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	210					transport	integral to membrane				ovary(1)	1														0.184211	7.194596	10.767992	7	31	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16539845	16539845	15081	19	T	G	G	64	64	SLC35E1	G	4	4
TLE6	79816	broad.mit.edu	36	19	2938062	2938062	+	Missense_Mutation	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:2938062A>T	uc010dtg.1	+	c.367A>T	c.(367-369)ATC>TTC	p.I123F	TLE6_uc002lwt.1_5'UTR|TLE6_uc002lwu.1_5'UTR|TLE6_uc002lwv.1_5'Flank	NM_024760	NP_079036	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6 isoform 2	Error:Variant_position_missing_in_Q9H808_after_alignment						nucleus				ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.666667	6.351909	6.42427	2	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2938062	2938062	16472	19	A	T	T	8	8	TLE6	T	4	4
SH3GL1	6455	broad.mit.edu	36	19	4315155	4315155	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:4315155T>G	uc002maj.1	-	c.395A>C	c.(394-396)GAC>GCC	p.D132A	SH3GL1_uc002mak.1_Intron	NM_003025	NP_003016	Q99961	SH3G1_HUMAN	SH3-domain GRB2-like 1	132	BAR.				central nervous system development|endocytosis|signal transduction	early endosome membrane	lipid binding|protein binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0152)|STAD - Stomach adenocarcinoma(1328;0.182)		NSCLC(94;1152 2133 30346 33362)				198				0.258065	10.571561	12.231167	8	23	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4315155	4315155	14742	19	T	G	G	58	58	SH3GL1	G	4	4
DPF1	8193	broad.mit.edu	36	19	43404898	43404898	+	Silent	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:43404898C>T	uc002ohp.1	-	c.351G>A	c.(349-351)AGG>AGA	p.R117R	DPF1_uc002ohl.1_Silent_p.R79R|DPF1_uc002ohm.1_Silent_p.R79R|DPF1_uc002ohn.1_Silent_p.R24R|DPF1_uc002oho.1_Silent_p.R117R	NM_004647	NP_004638	Q92782	DPF1_HUMAN	D4, zinc and double PHD fingers family 1 isoform	106					induction of apoptosis|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nBAF complex	zinc ion binding				0	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)											0.384615	28.587934	29.051485	15	24	CC		KEEP	---	---	---	---	capture			Silent	SNP	43404898	43404898	4900	19	C	T	T	30	30	DPF1	T	2	2
RYR1	6261	broad.mit.edu	36	19	43682203	43682204	+	Missense_Mutation	DNP	TG	CC	CC			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:43682203_43682204TG>CC	uc002oit.1	+	c.7116_7117TG>CC	c.(7114-7119)GGTGGC>GGCCGC	p.G2373R	RYR1_uc002oiu.1_Missense_Mutation_p.G2373R|RYR1_uc002oiv.1_Non-coding_Transcript	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2373	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)	10	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)									0.625	9.244511	9.348138	5	3	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	43682203	43682204	14248	19	TG	CC	CC	59	59	RYR1	CC	4	4
ACTN4	81	broad.mit.edu	36	19	43892824	43892824	+	Splice_Site_SNP	SNP	T	A	A			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:43892824T>A	uc002oja.1	+	c.e8_splice_site			ACTN4_uc010egc.1_Splice_Site_SNP	NM_004924	NP_004915			actinin, alpha 4						platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			Colon(168;199 1940 10254 46213 46384)								0.444444	7.691327	7.716419	4	5	TT		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	43892824	43892824	208	19	T	A	A	57	57	ACTN4	A	5	4
PPP1R15A	23645	broad.mit.edu	36	19	54068571	54068571	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:54068571G>A	uc002pky.2	+	c.269G>A	c.(268-270)GGA>GAA	p.G90E		NM_014330	NP_055145	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	90	Required for localization in the endoplasmic reticulum.				apoptosis|cell cycle arrest|regulation of translation|response to DNA damage stimulus	endoplasmic reticulum	protein binding			lung(1)	1		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)										0.26087	7.318423	8.528878	6	17	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54068571	54068571	12798	19	G	A	A	41	41	PPP1R15A	A	2	2
RFX2	5990	broad.mit.edu	36	19	5964107	5964107	+	Silent	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:5964107C>A	uc002meb.1	-	c.789G>T	c.(787-789)TCG>TCT	p.S263S	RFX2_uc002mec.1_Silent_p.S238S	NM_000635	NP_000626	P48378	RFX2_HUMAN	regulatory factor X2 isoform a	263	RFX-type winged-helix.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription regulator activity			breast(4)|ovary(1)	5						Colon(38;171 817 19800 47433 48051)								0.837662	455.364659	472.064216	129	25	CC		KEEP	---	---	---	---	capture			Silent	SNP	5964107	5964107	13735	19	C	A	A	31	31	RFX2	A	3	3
TNNI3	7137	broad.mit.edu	36	19	60359396	60359396	+	Silent	SNP	G	T	T			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:60359396G>T	uc002qjg.2	-	c.267C>A	c.(265-267)GGC>GGA	p.G89G		NM_000363	NP_000354	P19429	TNNI3_HUMAN	troponin I, cardiac	89					cardiac muscle contraction|cellular calcium ion homeostasis|muscle filament sliding|negative regulation of ATPase activity|regulation of systemic arterial blood pressure by ischemic conditions|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|calcium channel inhibitor activity|calcium-dependent protein binding|protein domain specific binding|protein kinase binding|troponin C binding|troponin T binding			lung(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)										0.216216	14.578953	17.331658	8	29	GG		KEEP	---	---	---	---	capture			Silent	SNP	60359396	60359396	16869	19	G	T	T	34	34	TNNI3	T	3	3
GPR108	56927	broad.mit.edu	36	19	6682947	6682947	+	Splice_Site_SNP	SNP	T	A	A			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:6682947T>A	uc002mfp.1	-	c.e14_splice_site			GPR108_uc002mfn.1_Splice_Site_SNP|GPR108_uc002mfo.2_Splice_Site_SNP|GPR108_uc010duw.1_Splice_Site_SNP|GPR108_uc010duv.1_Intron	NM_001080452	NP_064556			G protein-coupled receptor 108 isoform 1							integral to membrane					0														0.428571	6.420238	6.451992	3	4	TT		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	6682947	6682947	6898	19	T	A	A	55	55	GPR108	A	5	4
VAV1	7409	broad.mit.edu	36	19	6803985	6803985	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:6803985G>A	uc002mfu.1	+	c.2227G>A	c.(2227-2229)GAG>AAG	p.E743K	VAV1_uc010dva.1_Missense_Mutation_p.E721K|VAV1_uc002mfv.1_Missense_Mutation_p.E688K	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	743	SH2.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(3)|lung(2)|central_nervous_system(2)|kidney(2)|skin(1)	10										494				0.878238	1095.7483	1149.835865	339	47	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6803985	6803985	17696	19	G	A	A	41	41	VAV1	A	2	2
C1orf59	113802	broad.mit.edu	36	1	108992850	108992850	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:108992850G>A	uc001dvt.2	-	c.1043C>T	c.(1042-1044)GCG>GTG	p.A348V	C1orf59_uc001dvu.2_Missense_Mutation_p.A348V|C1orf59_uc009wer.1_3'UTR	NM_001102592	NP_653185	Q5T8I9	HENMT_HUMAN	hypothetical protein LOC113802	348					gene silencing by RNA|piRNA metabolic process	P granule	metal ion binding|O-methyltransferase activity|RNA binding|RNA methyltransferase activity				0		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0152)|Lung(183;0.0895)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.163)										0.203593	78.156174	91.780987	34	133	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	108992850	108992850	2125	1	G	A	A	38	38	C1orf59	A	1	1
C1orf43	25912	broad.mit.edu	36	1	152451694	152451694	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:152451694G>C	uc001fei.2	-	c.371C>G	c.(370-372)CCC>CGC	p.P124R	C1orf43_uc001fef.1_Missense_Mutation_p.P21R|C1orf43_uc001feg.2_Missense_Mutation_p.P90R|C1orf43_uc001feh.2_Missense_Mutation_p.P72R|C1orf43_uc001fej.2_Missense_Mutation_p.P106R|C1orf43_uc009wos.1_Missense_Mutation_p.P106R|C1orf43_uc001fek.2_Missense_Mutation_p.P124R|C1orf43_uc001fel.2_Missense_Mutation_p.P90R	NM_001098616	NP_001092086	Q9BWL3	CA043_HUMAN	hypothetical protein LOC25912 isoform 3	124						integral to membrane	coenzyme binding|oxidoreductase activity				0	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)													0.2	9.632968	13.427922	9	36	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	152451694	152451694	2114	1	G	C	C	43	43	C1orf43	C	3	3
SCAMP3	10067	broad.mit.edu	36	1	153497069	153497069	+	Silent	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:153497069T>G	uc001fjs.1	-	c.150A>C	c.(148-150)CCA>CCC	p.P50P	SCAMP3_uc001fjr.1_5'Flank|SCAMP3_uc001fjt.1_Silent_p.P24P|SCAMP3_uc001fju.1_Silent_p.P50P|SCAMP3_uc001fjv.1_Silent_p.P50P	NM_005698	NP_005689	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3 isoform 1	50	Cytoplasmic (Potential).				post-Golgi vesicle-mediated transport|protein transport	integral to membrane				ovary(3)	3	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)											0.171717	16.406953	26.528786	17	82	TT		KEEP	---	---	---	---	capture			Silent	SNP	153497069	153497069	14353	1	T	G	G	59	59	SCAMP3	G	4	4
SMG5	23381	broad.mit.edu	36	1	154504078	154504078	+	Silent	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:154504078C>T	uc001foc.2	-	c.924G>A	c.(922-924)GAG>GAA	p.E308E	SMG5_uc009wrv.1_5'Flank	NM_015327	NP_056142	Q9UPR3	SMG5_HUMAN	Est1p-like protein B	308					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding			ovary(2)|skin(2)|pancreas(1)	5	Hepatocellular(266;0.158)													0.205882	10.003693	12.738041	7	27	CC		KEEP	---	---	---	---	capture			Silent	SNP	154504078	154504078	15294	1	C	T	T	28	28	SMG5	T	2	2
IQGAP3	128239	broad.mit.edu	36	1	154777290	154777290	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:154777290G>T	uc001fpf.1	-	c.2573C>A	c.(2572-2574)GCC>GAC	p.A858D		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	858					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)	5	all_hematologic(923;0.088)|Hepatocellular(266;0.158)													0.116279	9.787564	22.264022	10	76	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	154777290	154777290	8119	1	G	T	T	42	42	IQGAP3	T	3	3
PEAR1	375033	broad.mit.edu	36	1	155146459	155146459	+	Missense_Mutation	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:155146459A>T	uc001fqj.1	+	c.1613A>T	c.(1612-1614)GAC>GTC	p.D538V	PEAR1_uc001fqk.1_Missense_Mutation_p.D163V	NM_001080471	NP_001073940	Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	538						integral to membrane				ovary(2)|central_nervous_system(1)	3	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)													0.191176	16.046169	22.115504	13	55	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	155146459	155146459	12133	1	A	T	T	10	10	PEAR1	T	4	4
PPOX	5498	broad.mit.edu	36	1	159405452	159405452	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:159405452C>A	uc001fyj.2	+	c.662C>A	c.(661-663)GCT>GAT	p.A221D	PPOX_uc001fyn.2_Intron|PPOX_uc001fyg.2_Missense_Mutation_p.A221D|PPOX_uc001fyk.2_Missense_Mutation_p.A59D|PPOX_uc001fyl.2_Missense_Mutation_p.A187D|PPOX_uc001fyh.2_Missense_Mutation_p.A59D|PPOX_uc009wuc.1_Missense_Mutation_p.A59D|PPOX_uc001fym.2_De_novo_Start_OutOfFrame|PPOX_uc001fyi.2_Missense_Mutation_p.A59D	NM_001122764	NP_001116236	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	221					heme biosynthetic process|oxidation-reduction process	intrinsic to mitochondrial inner membrane|mitochondrial intermembrane space	flavin adenine dinucleotide binding|oxygen-dependent protoporphyrinogen oxidase activity			ovary(1)	1	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)											0.257143	14.138399	16.029893	9	26	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	159405452	159405452	12783	1	C	A	A	28	28	PPOX	A	3	3
CLCNKA	1187	broad.mit.edu	36	1	16230898	16230898	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:16230898A>G	uc001axu.1	+	c.1729A>G	c.(1729-1731)ACC>GCC	p.T577A	CLCNKB_uc001axw.2_Intron|CLCNKA_uc001axt.1_Non-coding_Transcript|CLCNKA_uc001axv.1_Missense_Mutation_p.T577A	NM_004070	NP_004061	P51800	CLCKA_HUMAN	chloride channel Ka isoform 1	577	CBS 1.				excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)									0.2	17.767025	21.136421	8	32	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16230898	16230898	3605	1	A	G	G	10	10	CLCNKA	G	4	4
TMCO4	255104	broad.mit.edu	36	1	19882395	19882396	+	Missense_Mutation	DNP	GA	CT	CT			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:19882395_19882396GA>CT	uc001bcn.1	-	c.1629_1630TC>AG	c.(1627-1632)CCTCGC>CCAGGC	p.R544G	TMCO4_uc001bcm.1_Missense_Mutation_p.R375G|TMCO4_uc001bco.1_Missense_Mutation_p.R544G|TMCO4_uc001bcp.1_Missense_Mutation_p.R504G	NM_181719	NP_859070	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	544						integral to membrane					0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)										1	7.94013	7.821501	3	0	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	19882395	19882396	16528	1	GA	CT	CT	37	37	TMCO4	CT	3	3
GALNT2	2590	broad.mit.edu	36	1	228457677	228457677	+	Missense_Mutation	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:228457677A>T	uc001htt.1	+	c.1100A>T	c.(1099-1101)TAC>TTC	p.Y367F		NM_004481	NP_004472	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	367	Lumenal (Potential).				immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)												0.203704	12.290873	16.710707	11	43	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	228457677	228457677	6477	1	A	T	T	14	14	GALNT2	T	4	4
ARV1	64801	broad.mit.edu	36	1	229181569	229181570	+	Missense_Mutation	DNP	AC	GT	GT			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:229181569_229181570AC>GT	uc009xfl.1	+	c.95_96AC>GT	c.(94-96)TAC>TGT	p.Y32C	TTC13_uc001huf.2_5'Flank|TTC13_uc009xfi.1_5'Flank|TTC13_uc009xfj.1_5'Flank|TTC13_uc001hug.2_5'Flank|TTC13_uc009xfk.1_5'Flank|ARV1_uc001huh.1_Missense_Mutation_p.Y32C	NM_022786	NP_073623	Q9H2C2	ARV1_HUMAN	ARV1 homolog	32					sphingolipid metabolic process	integral to membrane				breast(2)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)		COAD - Colon adenocarcinoma(196;0.211)|Colorectal(1306;0.233)										0.461538	12.138175	12.155676	6	7	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	229181569	229181570	1020	1	AC	GT	GT	14	14	ARV1	GT	4	4
NRD1	4898	broad.mit.edu	36	1	52029234	52029234	+	Missense_Mutation	SNP	T	C	C			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:52029234T>C	uc001ctc.2	-	c.3181A>G	c.(3181-3183)AAG>GAG	p.K1061E	NRD1_uc009vzb.1_Missense_Mutation_p.K756E|NRD1_uc001ctd.2_Missense_Mutation_p.K993E|NRD1_uc001cte.2_Missense_Mutation_p.K929E	NM_002525	NP_002516	O43847	NRDC_HUMAN	nardilysin isoform a	992					cell migration|cell proliferation|neuromuscular junction development|positive regulation of membrane protein ectodomain proteolysis|proteolysis|regulation of endopeptidase activity	cell surface|cytosol	epidermal growth factor binding|metalloendopeptidase activity|zinc ion binding				0														0.181818	6.821909	9.976041	6	27	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52029234	52029234	11050	1	T	C	C	61	61	NRD1	C	4	4
LRRC8B	23507	broad.mit.edu	36	1	89822462	89822462	+	Silent	SNP	T	A	A			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:89822462T>A	uc001dnh.1	+	c.1665T>A	c.(1663-1665)GTT>GTA	p.V555V	LRRC8B_uc001dni.1_Silent_p.V555V|LRRC8B_uc001dnj.1_Silent_p.V555V	NM_015350	NP_056165	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member	555	LRR 4.					integral to membrane				ovary(2)	2		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)										0.205882	8.198066	10.941086	7	27	TT		KEEP	---	---	---	---	capture			Silent	SNP	89822462	89822462	9398	1	T	A	A	63	63	LRRC8B	A	4	4
PCSK2	5126	broad.mit.edu	36	20	17337940	17337940	+	Silent	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:17337940C>T	uc002wpm.1	+	c.576C>T	c.(574-576)AAC>AAT	p.N192N	PCSK2_uc002wpl.1_Silent_p.N173N	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	192	Catalytic.				enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)									0.083102	15.496353	143.02899	60	662	CC		KEEP	---	---	---	---	capture			Silent	SNP	17337940	17337940	12022	20	C	T	T	19	19	PCSK2	T	1	1
ZNF133	7692	broad.mit.edu	36	20	18243906	18243906	+	Missense_Mutation	SNP	A	C	C			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr20:18243906A>C	uc010gcq.1	+	c.411A>C	c.(409-411)AGA>AGC	p.R137S	ZNF133_uc010gcr.1_Missense_Mutation_p.R137S|ZNF133_uc002wql.2_Missense_Mutation_p.R136S|ZNF133_uc010gcs.1_Missense_Mutation_p.R136S|ZNF133_uc002wqm.1_Missense_Mutation_p.R137S	NM_003434	NP_003425	P52736	ZN133_HUMAN	zinc finger protein 133	137					regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)	2														0.444444	6.584702	6.61055	4	5	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18243906	18243906	18314	20	A	C	C	10	10	ZNF133	C	4	4
ENTPD6	955	broad.mit.edu	36	20	25149941	25149941	+	Silent	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:25149941C>G	uc002wuj.2	+	c.1017C>G	c.(1015-1017)GTC>GTG	p.V339V	ENTPD6_uc010gdj.1_Silent_p.V311V|ENTPD6_uc002wum.2_Silent_p.V322V|ENTPD6_uc002wun.2_Intron|ENTPD6_uc002wuk.2_Silent_p.V338V|ENTPD6_uc002wul.2_Silent_p.V338V|ENTPD6_uc002wuo.2_Silent_p.V91V|ENTPD6_uc010gdk.1_5'Flank|ENTPD6_uc010gdl.1_5'Flank	NM_001247	NP_001238	O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6	339	Lumenal (Potential).					Golgi membrane|integral to membrane	nucleoside-diphosphatase activity				0														0.363636	7.890457	8.07288	4	7	CC		KEEP	---	---	---	---	capture			Silent	SNP	25149941	25149941	5336	20	C	G	G	29	29	ENTPD6	G	3	3
SLC4A11	83959	broad.mit.edu	36	20	3158338	3158338	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:3158338C>A	uc002wig.1	-	c.1622G>T	c.(1621-1623)GGC>GTC	p.G541V	SLC4A11_uc002wih.1_Non-coding_Transcript	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	541	Extracellular (Potential).|Membrane (bicarbonate transporter).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1						NSCLC(190;922 2139 10266 10292 38692)								0.333333	7.959312	8.333678	5	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3158338	3158338	15149	20	C	A	A	26	26	SLC4A11	A	3	3
PTGIS	5740	broad.mit.edu	36	20	47594353	47594353	+	Silent	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:47594353G>A	uc002xut.1	-	c.417C>T	c.(415-417)GCC>GCT	p.A139A		NM_000961	NP_000952	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	139					hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|prostaglandin-I synthase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Phenylbutazone(DB00812)									0.283898	184.735876	194.62777	67	169	GG		KEEP	---	---	---	---	capture			Silent	SNP	47594353	47594353	13207	20	G	A	A	47	47	PTGIS	A	2	2
BCAS1	8537	broad.mit.edu	36	20	52108067	52108067	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:52108067C>T	uc002xws.2	-	c.106G>A	c.(106-108)GTG>ATG	p.V36M	BCAS1_uc002xwt.2_Missense_Mutation_p.V36M|BCAS1_uc010gil.1_Missense_Mutation_p.V36M	NM_003657	NP_003648	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	36						cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)											0.12766	32.019086	57.398758	24	164	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52108067	52108067	1371	20	C	T	T	18	18	BCAS1	T	2	2
TCF15	6939	broad.mit.edu	36	20	533269	533269	+	Missense_Mutation	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:533269C>G	uc002wdz.1	-	c.566G>C	c.(565-567)AGG>ACG	p.R189T		NM_004609	NP_004600	Q12870	TCF15_HUMAN	basic helix-loop-helix transcription factor 15	189					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|RNA polymerase II transcription factor activity|sequence-specific DNA binding transcription factor activity				0		Breast(17;0.231)												0.6	6.321297	6.364659	3	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	533269	533269	16214	20	C	G	G	24	24	TCF15	G	3	3
LIPI	149998	broad.mit.edu	36	21	14483542	14483542	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:14483542G>A	uc002yjm.1	-	c.179C>T	c.(178-180)CCG>CTG	p.P60L	LIPI_uc010gkw.1_5'UTR	NM_198996	NP_945347	Q6XZB0	LIPI_HUMAN	lipase, member I	39					lipid catabolic process	extracellular region|extracellular space|plasma membrane	heparin binding|phospholipase activity			ovary(2)	2				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)										0.625	97.155776	97.815059	30	18	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14483542	14483542	9152	21	G	A	A	39	39	LIPI	A	1	1
KCNJ6	3763	broad.mit.edu	36	21	37919415	37919415	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:37919415C>A	uc002ywo.1	-	c.1188G>T	c.(1186-1188)GAG>GAT	p.E396D		NM_002240	NP_002231	P48051	IRK6_HUMAN	potassium inwardly-rectifying channel J6	396	Cytoplasmic (By similarity).				synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding				0					Halothane(DB01159)	Pancreas(48;379 1118 2936 19024 28214)								0.14	32.874411	51.65682	21	129	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37919415	37919415	8360	21	C	A	A	32	32	KCNJ6	A	3	3
BRWD1	54014	broad.mit.edu	36	21	39493112	39493112	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr21:39493112T>G	uc002yxk.1	-	c.5100A>C	c.(5098-5100)TTA>TTC	p.L1700F	BRWD1_uc002yxl.1_Missense_Mutation_p.L1700F|BRWD1_uc010goc.1_Missense_Mutation_p.L343F	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1700					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(1)	1		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				Melanoma(170;988 1986 4794 16843 39731)								0.127119	6.935686	22.986784	15	103	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39493112	39493112	1556	21	T	G	G	57	57	BRWD1	G	4	4
C21orf33	8209	broad.mit.edu	36	21	44387629	44387629	+	Silent	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:44387629C>T	uc002zec.2	+	c.636C>T	c.(634-636)GCC>GCT	p.A212A	C21orf33_uc002zed.2_Silent_p.A181A	NM_004649	NP_004640	P30042	ES1_HUMAN	es1 protein isoform Ia precursor	212						mitochondrion				ovary(1)	1				STAD - Stomach adenocarcinoma(101;0.168)|Colorectal(79;0.191)										0.444444	7.187571	7.213199	4	5	CC		KEEP	---	---	---	---	capture			Silent	SNP	44387629	44387629	2205	21	C	T	T	21	21	C21orf33	T	2	2
PCNT	5116	broad.mit.edu	36	21	46591249	46591249	+	Silent	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr21:46591249A>G	uc002zji.2	+	c.885A>G	c.(883-885)CTA>CTG	p.L295L	PCNT_uc002zjj.1_Silent_p.L177L|PCNT_uc010gqk.1_Non-coding_Transcript	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	295	Glu-rich.|Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)													0.5	6.521939	6.521939	3	3	AA		KEEP	---	---	---	---	capture			Silent	SNP	46591249	46591249	12010	21	A	G	G	14	14	PCNT	G	4	4
SNAP29	9342	broad.mit.edu	36	22	19543608	19543608	+	Silent	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:19543608C>G	uc002zte.1	+	c.210C>G	c.(208-210)TCC>TCG	p.S70S	PI4KA_uc002zsz.2_5'Flank|PI4KA_uc010gsq.1_5'Flank	NM_004782	NP_004773	O95721	SNP29_HUMAN	synaptosomal-associated protein 29	70					cellular membrane fusion|exocytosis|protein transport|vesicle targeting	cell junction|cytoplasm|nucleus|synapse|synaptosome	SNAP receptor activity				0	all_cancers(11;2.77e-25)|all_epithelial(7;8.92e-24)|Lung NSC(8;1.49e-15)|all_lung(8;2.54e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000592)|Lung(15;0.0117)											0.163265	6.572894	11.867378	8	41	CC		KEEP	---	---	---	---	capture			Silent	SNP	19543608	19543608	15331	22	C	G	G	23	23	SNAP29	G	3	3
LZTR1	8216	broad.mit.edu	36	22	19679183	19679183	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:19679183A>G	uc002zto.1	+	c.1810A>G	c.(1810-1812)AAG>GAG	p.K604E	LZTR1_uc002ztn.1_Missense_Mutation_p.K563E|LZTR1_uc002ztp.1_5'Flank	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	604					anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)							1299				0.193548	6.521097	9.255475	6	25	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19679183	19679183	9514	22	A	G	G	1	1	LZTR1	G	4	4
C22orf36	388886	broad.mit.edu	36	22	23311955	23311955	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:23311955C>T	uc003aaq.2	-	c.847G>A	c.(847-849)GAG>AAG	p.E283K	GGT1_uc003aan.1_Intron|C22orf36_uc003aao.2_Non-coding_Transcript|C22orf36_uc003aap.2_Non-coding_Transcript	NM_207644	NP_997527	Q2VPJ9	LRC6X_HUMAN	hypothetical protein LOC388886	283											0														1	9.548107	9.486476	4	0	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23311955	23311955	2227	22	C	T	T	29	29	C22orf36	T	2	2
GGA1	26088	broad.mit.edu	36	22	36349373	36349373	+	Missense_Mutation	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:36349373C>G	uc003atc.1	+	c.703C>G	c.(703-705)CAC>GAC	p.H235D	GGA1_uc003atd.1_Missense_Mutation_p.H235D|GGA1_uc003ate.1_Missense_Mutation_p.H235D|GGA1_uc003atf.1_Missense_Mutation_p.H162D	NM_013365	NP_037497	Q9UJY5	GGA1_HUMAN	golgi associated, gamma adaptin ear containing,	235	Interaction with ARF3.|GAT.				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|Golgi apparatus part	protein binding			breast(2)|ovary(1)	3	Melanoma(58;0.0574)											OREG0026543	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.4	7.08781	7.177792	4	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36349373	36349373	6620	22	C	G	G	21	21	GGA1	G	3	3
TRIOBP	11078	broad.mit.edu	36	22	36441813	36441813	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:36441813A>G	uc003att.1	+	c.554A>G	c.(553-555)GAC>GGC	p.D185G	TRIOBP_uc003atq.1_Missense_Mutation_p.D185G|TRIOBP_uc003atr.1_Missense_Mutation_p.D185G|TRIOBP_uc003ats.1_Missense_Mutation_p.D13G|TRIOBP_uc003atu.1_Missense_Mutation_p.D13G	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	185					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)													0.5	6.923217	6.923217	3	3	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36441813	36441813	17103	22	A	G	G	10	10	TRIOBP	G	4	4
SAP130	79595	broad.mit.edu	36	2	128491819	128491819	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:128491819G>A	uc010fmd.1	-	c.331C>T	c.(331-333)CAT>TAT	p.H111Y	SAP130_uc002tpo.1_5'Flank|SAP130_uc002tpp.1_Missense_Mutation_p.H111Y|SAP130_uc002tpq.1_Missense_Mutation_p.H85Y	NM_024545	NP_078821	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	111					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)										0.508475	96.546157	96.549819	30	29	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	128491819	128491819	14311	2	G	A	A	47	47	SAP130	A	2	2
DHRS9	10170	broad.mit.edu	36	2	169656702	169656702	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:169656702T>G	uc002uep.1	+	c.729T>G	c.(727-729)ATT>ATG	p.I243M	DHRS9_uc002ueq.1_Missense_Mutation_p.I243M	NM_005771	NP_954674	Q9BPW9	DHRS9_HUMAN	NADP-dependent retinol dehydrogenase/reductase	243					9-cis-retinoic acid biosynthetic process|androgen metabolic process|epithelial cell differentiation|oxidation-reduction process|progesterone metabolic process|retinol metabolic process	integral to endoplasmic reticulum membrane|microsome	alcohol dehydrogenase (NAD) activity|binding|racemase and epimerase activity|retinol dehydrogenase activity|testosterone dehydrogenase (NAD+) activity				0														0.382353	23.83897	24.260189	13	21	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	169656702	169656702	4677	2	T	G	G	63	63	DHRS9	G	4	4
CHRNA1	1134	broad.mit.edu	36	2	175327220	175327220	+	Silent	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:175327220G>A	uc002ujd.2	-	c.588C>T	c.(586-588)TAC>TAT	p.Y196Y	CHRNA1_uc002uje.2_Silent_p.Y171Y|CHRNA1_uc002ujf.2_Silent_p.Y171Y	NM_001039523	NP_001034612	P02708	ACHA_HUMAN	nicotinic cholinergic receptor alpha 1 isoform a	196	Extracellular.				muscle cell homeostasis|neuromuscular junction development|neuromuscular process|neuromuscular synaptic transmission|neuron homeostasis|regulation of action potential in neuron|skeletal muscle contraction|skeletal muscle tissue growth	cell junction|cell surface|neuromuscular junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(2)|central_nervous_system(1)	3														0.255319	28.07795	30.632954	12	35	GG		KEEP	---	---	---	---	capture			Silent	SNP	175327220	175327220	3515	2	G	A	A	40	40	CHRNA1	A	1	1
GTF3C3	9330	broad.mit.edu	36	2	197339634	197339634	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:197339634G>A	uc002uts.1	-	c.2438C>T	c.(2437-2439)TCA>TTA	p.S813L		NM_012086	NP_036218	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide	813	TPR 11.				5S class rRNA transcription from RNA polymerase III type 1 promoter|tRNA transcription from RNA polymerase III promoter	transcription factor TFIIIC complex	DNA binding|protein binding			ovary(3)|breast(3)|pancreas(1)	7														0.1875	6.325708	9.265816	6	26	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	197339634	197339634	7154	2	G	A	A	45	45	GTF3C3	A	2	2
MARS2	92935	broad.mit.edu	36	2	198280063	198280063	+	Silent	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:198280063T>G	uc002uuq.1	+	c.1689T>G	c.(1687-1689)CCT>CCG	p.P563P		NM_138395	NP_612404	Q96GW9	SYMM_HUMAN	methionine-tRNA synthetase 2 precursor	563					methionyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|methionine-tRNA ligase activity			ovary(1)|central_nervous_system(1)	2					L-Methionine(DB00134)									0.235294	10.567243	12.764066	8	26	TT		KEEP	---	---	---	---	capture			Silent	SNP	198280063	198280063	9700	2	T	G	G	56	56	MARS2	G	4	4
PLEKHM3	389072	broad.mit.edu	36	2	208504028	208504028	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:208504028G>A	uc002vcl.1	-	c.1753C>T	c.(1753-1755)CAG>TAG	p.Q585*	PLEKHM3_uc002vcm.1_Nonsense_Mutation_p.Q585*	NM_001080475	NP_001073944	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M,	585					intracellular signal transduction		metal ion binding			ovary(1)	1														0.156863	12.670731	18.404617	8	43	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	208504028	208504028	12508	2	G	A	A	47	47	PLEKHM3	A	5	2
PIKFYVE	200576	broad.mit.edu	36	2	208906333	208906333	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:208906333C>A	uc002vcz.1	+	c.4013C>A	c.(4012-4014)GCA>GAA	p.A1338E	PIKFYVE_uc002vcy.1_Missense_Mutation_p.A1282E	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	1338					cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding|zinc ion binding			ovary(5)|kidney(2)|central_nervous_system(1)|pancreas(1)	9										756				0.104265	22.902539	55.770358	22	189	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	208906333	208906333	12348	2	C	A	A	25	25	PIKFYVE	A	3	3
COL6A3	1293	broad.mit.edu	36	2	237930747	237930747	+	Silent	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:237930747A>T	uc002vwl.2	-	c.6564T>A	c.(6562-6564)CCT>CCA	p.P2188P	COL6A3_uc002vwk.2_Silent_p.P2021P|COL6A3_uc002vwm.2_Silent_p.P1987P|COL6A3_uc002vwn.2_Silent_p.P1988P|COL6A3_uc002vwo.2_Silent_p.P1982P|COL6A3_uc002vwp.1_5'Flank	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2188	Triple-helical region.|Collagen-like 3.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|pancreas(1)	15		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)										0.173913	8.986065	11.294041	4	19	AA		KEEP	---	---	---	---	capture			Silent	SNP	237930747	237930747	3839	2	A	T	T	7	7	COL6A3	T	4	4
COL6A3	1293	broad.mit.edu	36	2	237954854	237954854	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:237954854A>G	uc002vwl.2	-	c.1340T>C	c.(1339-1341)GTC>GCC	p.V447A	COL6A3_uc002vwk.2_Missense_Mutation_p.V447A|COL6A3_uc002vwm.2_Missense_Mutation_p.V246A|COL6A3_uc002vwn.2_Missense_Mutation_p.V447A|COL6A3_uc002vwo.2_Missense_Mutation_p.V241A|COL6A3_uc002vwq.2_Missense_Mutation_p.V241A|COL6A3_uc002vwr.2_Missense_Mutation_p.V40A	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	447	VWFA 3.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|pancreas(1)	15		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)										0.375	10.733595	10.957077	6	10	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	237954854	237954854	3839	2	A	G	G	10	10	COL6A3	G	4	4
RAB17	64284	broad.mit.edu	36	2	238148782	238148782	+	Silent	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:238148782C>G	uc002vwz.1	-	c.516G>C	c.(514-516)GTG>GTC	p.V172V	RAB17_uc002vxa.1_Non-coding_Transcript|RAB17_uc002vxb.1_Non-coding_Transcript	NM_022449	NP_071894	Q9H0T7	RAB17_HUMAN	RAB17, member RAS oncogene family	172					protein transport|small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|protein binding				0		Renal(207;0.00272)|Breast(86;0.00297)|all_hematologic(139;0.182)|Ovarian(221;0.221)		Epithelial(121;9.36e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.26e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000354)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.026)		Colon(56;987 1029 6466 13943 27336)								0.25	6.8888	7.801693	4	12	CC		KEEP	---	---	---	---	capture			Silent	SNP	238148782	238148782	13361	2	C	G	G	17	17	RAB17	G	3	3
CAD	790	broad.mit.edu	36	2	27315601	27315601	+	Silent	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:27315601G>C	uc002rji.1	+	c.5250G>C	c.(5248-5250)GTG>GTC	p.V1750V	CAD_uc010eyw.1_Silent_p.V1687V	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	1750	DHOase (dihydroorotase).				'de novo' pyrimidine base biosynthetic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|nuclear matrix	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)					653				0.363636	7.088194	7.271482	4	7	GG		KEEP	---	---	---	---	capture			Silent	SNP	27315601	27315601	2681	2	G	C	C	47	47	CAD	C	3	3
PLEKHH2	130271	broad.mit.edu	36	2	43788166	43788166	+	Silent	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:43788166C>T	uc010fau.1	+	c.1944C>T	c.(1942-1944)GGC>GGT	p.G648G	PLEKHH2_uc002rte.2_Silent_p.G648G|PLEKHH2_uc002rtf.2_Silent_p.G647G	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	648	Ser-rich.					cytoplasm|cytoskeleton|integral to membrane	binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)												0.65625	311.01397	314.442243	105	55	CC		KEEP	---	---	---	---	capture			Silent	SNP	43788166	43788166	12503	2	C	T	T	25	25	PLEKHH2	T	2	2
SPTBN1	6711	broad.mit.edu	36	2	54711914	54711914	+	Missense_Mutation	SNP	T	C	C			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:54711914T>C	uc002rxu.1	+	c.3226T>C	c.(3226-3228)TCC>CCC	p.S1076P	SPTBN1_uc002rxx.1_Missense_Mutation_p.S1063P	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	1076	Spectrin 8.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(2)|breast(2)|central_nervous_system(2)	6			Lung(47;0.24)											0.5	7.021237	7.021237	3	3	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54711914	54711914	15633	2	T	C	C	58	58	SPTBN1	C	4	4
DUSP2	1844	broad.mit.edu	36	2	96173372	96173372	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:96173372T>G	uc002svk.2	-	c.862A>C	c.(862-864)AAG>CAG	p.K288Q		NM_004418	NP_004409	Q05923	DUS2_HUMAN	dual specificity phosphatase 2	288	Tyrosine-protein phosphatase.				endoderm formation|inactivation of MAPK activity|regulation of apoptosis	nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/threonine phosphatase activity				0		Ovarian(717;0.0228)												0.666667	9.194722	9.340476	4	2	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	96173372	96173372	5004	2	T	G	G	61	61	DUSP2	G	4	4
CNGA3	1261	broad.mit.edu	36	2	98366283	98366283	+	Silent	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:98366283C>T	uc002syt.1	+	c.396C>T	c.(394-396)AGC>AGT	p.S132S	CNGA3_uc002syu.1_Intron|CNGA3_uc010fij.1_Silent_p.S136S	NM_001298	NP_001289	Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3 isoform	132					signal transduction|visual perception	integral to membrane	cGMP binding			ovary(5)	5														0.253731	43.542059	47.231819	17	50	CC		KEEP	---	---	---	---	capture			Silent	SNP	98366283	98366283	3736	2	C	T	T	27	27	CNGA3	T	1	1
MCM2	4171	broad.mit.edu	36	3	128800922	128800922	+	Silent	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:128800922C>G	uc003ejp.1	+	c.78C>G	c.(76-78)TCC>TCG	p.S26S	MCM2_uc010hsl.1_Non-coding_Transcript	NM_004526	NP_004517	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	26	Interaction with MYST2 (By similarity).				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding			ovary(3)|skin(1)	4														0.363636	7.489986	7.672551	4	7	CC		KEEP	---	---	---	---	capture			Silent	SNP	128800922	128800922	9775	3	C	G	G	21	21	MCM2	G	3	3
IQSEC1	9922	broad.mit.edu	36	3	12952717	12952717	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:12952717G>C	uc003bxt.1	-	c.841C>G	c.(841-843)CCC>GCC	p.P281A	IQSEC1_uc003bxu.2_Missense_Mutation_p.P159A	NM_014869	NP_055684	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1 isoform b	281					regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1														1	7.94013	7.821501	3	0	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12952717	12952717	8120	3	G	C	C	44	44	IQSEC1	C	3	3
TMEM108	66000	broad.mit.edu	36	3	134597406	134597406	+	Silent	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:134597406C>T	uc003eph.1	+	c.1614C>T	c.(1612-1614)CTC>CTT	p.L538L	TMEM108_uc003epi.1_Silent_p.L538L|TMEM108_uc003epk.1_Silent_p.L68L|TMEM108_uc003epm.1_Silent_p.L489L	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108	538	Cytoplasmic (Potential).					integral to membrane				ovary(2)	2														0.204778	128.443251	152.079322	60	233	CC		KEEP	---	---	---	---	capture			Silent	SNP	134597406	134597406	16554	3	C	T	T	32	32	TMEM108	T	2	2
PLCH1	23007	broad.mit.edu	36	3	156750268	156750268	+	Splice_Site_SNP	SNP	A	C	C			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:156750268A>C	uc010hvs.1	-	c.e8_splice_site			PLCH1_uc003fai.2_Splice_Site_SNP|PLCH1_uc003faj.2_Splice_Site_SNP	NM_014996	NP_055811			phospholipase C-like 3 isoform b						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)	1			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)											0.233333	9.801047	11.764976	7	23	AA		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	156750268	156750268	12463	3	A	C	C	14	14	PLCH1	C	5	4
BCHE	590	broad.mit.edu	36	3	167031308	167031308	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:167031308G>A	uc003fem.2	-	c.208C>T	c.(208-210)CGA>TGA	p.R70*	BCHE_uc003fen.2_Intron	NM_000055	NP_000046	P06276	CHLE_HUMAN	butyrylcholinesterase precursor	70					acetylcholine catabolic process|choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|cholinesterase activity|enzyme binding			ovary(3)|pancreas(1)	4					Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)									0.188559	186.309329	229.170818	89	383	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	167031308	167031308	1379	3	G	A	A	37	37	BCHE	A	5	1
OR5K3	403277	broad.mit.edu	36	3	99593094	99593094	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:99593094A>G	uc003dsl.1	+	c.895A>G	c.(895-897)ATG>GTG	p.M299V		NM_001005516	NP_001005516	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K,	299	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.5	7.122802	7.122802	3	3	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99593094	99593094	11578	3	A	G	G	16	16	OR5K3	G	4	4
ALPK1	80216	broad.mit.edu	36	4	113571268	113571268	+	Silent	SNP	A	C	C			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:113571268A>C	uc003ian.2	+	c.1116A>C	c.(1114-1116)ACA>ACC	p.T372T	ALPK1_uc003iap.2_Silent_p.T372T|ALPK1_uc003iao.2_Intron|ALPK1_uc010imo.1_Silent_p.T200T	NM_001102406	NP_079420	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	372					protein phosphorylation		ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)						252				0.147541	7.425864	14.728558	9	52	AA		KEEP	---	---	---	---	capture			Silent	SNP	113571268	113571268	547	4	A	C	C	7	7	ALPK1	C	4	4
SYNPO2	171024	broad.mit.edu	36	4	120171278	120171278	+	Nonsense_Mutation	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:120171278A>T	uc010inb.1	+	c.1900A>T	c.(1900-1902)AGA>TGA	p.R634*	SYNPO2_uc010ina.1_Nonsense_Mutation_p.R634*|SYNPO2_uc003icm.2_Nonsense_Mutation_p.R634*|SYNPO2_uc010inc.1_Nonsense_Mutation_p.R562*	NM_133477	NP_597734	Q9UMS6	SYNP2_HUMAN	synaptopodin 2 isoform a	634	Pro-rich.					nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2														0.154762	7.201878	16.832701	13	71	AA		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	120171278	120171278	15978	4	A	T	T	7	7	SYNPO2	T	5	4
KIAA1530	57654	broad.mit.edu	36	4	1350178	1350178	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:1350178G>A	uc003gde.2	+	c.1247G>A	c.(1246-1248)GGG>GAG	p.G416E	KIAA1530_uc010ibv.1_5'UTR	NM_020894	NP_065945	Q2YD98	K1530_HUMAN	hypothetical protein LOC57654	416											0			OV - Ovarian serous cystadenocarcinoma(23;0.0138)											0.884615	79.958356	83.741286	23	3	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1350178	1350178	8550	4	G	A	A	43	43	KIAA1530	A	2	2
C4orf19	55286	broad.mit.edu	36	4	37268922	37268922	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:37268922G>A	uc003gsw.2	+	c.850G>A	c.(850-852)GAT>AAT	p.D284N	RELL1_uc003gsz.2_3'UTR|C4orf19_uc003gsy.2_Missense_Mutation_p.D284N	NM_001104629	NP_060772	Q8IY42	CD019_HUMAN	hypothetical protein LOC55286	284											0														0.548387	109.452297	109.578723	34	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37268922	37268922	2348	4	G	A	A	41	41	C4orf19	A	2	2
ATP8A1	10396	broad.mit.edu	36	4	42278506	42278506	+	Silent	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:42278506G>C	uc003gwr.2	-	c.723C>G	c.(721-723)GGC>GGG	p.G241G	ATP8A1_uc003gws.2_Silent_p.G241G	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),	241	Cytoplasmic (Potential).				ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			central_nervous_system(1)	1					Phosphatidylserine(DB00144)									0.277778	14.71015	16.329734	10	26	GG		KEEP	---	---	---	---	capture			Silent	SNP	42278506	42278506	1211	4	G	C	C	46	46	ATP8A1	C	3	3
COMMD10	51397	broad.mit.edu	36	5	115451146	115451146	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:115451146G>T	uc003krt.1	+	c.95G>T	c.(94-96)CGG>CTG	p.R32L		NM_016144	NP_057228	Q9Y6G5	COMDA_HUMAN	COMM domain containing 10	32							protein binding			ovary(1)	1		all_cancers(142;0.0834)|all_epithelial(76;0.00314)|Prostate(80;0.0102)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;4.3e-07)|Epithelial(69;8.06e-07)|all cancers(49;4.06e-05)										0.122807	10.291658	18.226617	7	50	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	115451146	115451146	3853	5	G	T	T	39	39	COMMD10	T	3	3
KIF20A	10112	broad.mit.edu	36	5	137543429	137543429	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:137543429A>G	uc003lcj.1	+	c.161A>G	c.(160-162)CAG>CGG	p.Q54R	BRD8_uc003lcc.1_5'Flank|BRD8_uc003lcf.1_5'Flank|BRD8_uc003lcg.1_5'Flank|BRD8_uc003lch.1_5'Flank|BRD8_uc010jer.1_5'Flank|BRD8_uc003lci.1_5'Flank|BRD8_uc010jes.1_5'Flank|KIF20A_uc003lck.1_Missense_Mutation_p.Q54R	NM_005733	NP_005724	O95235	KI20A_HUMAN	kinesin family member 20A	54					cytokinesis|M phase of mitotic cell cycle|microtubule-based movement|protein transport|vesicle-mediated transport	Golgi apparatus|microtubule|nucleoplasm	ATP binding|microtubule motor activity|protein binding|transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)											0.5	10.56704	10.56704	5	5	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	137543429	137543429	8597	5	A	G	G	7	7	KIF20A	G	4	4
PCDHGC5	56097	broad.mit.edu	36	5	140850348	140850348	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140850348C>A	uc003lla.1	+	c.1357C>A	c.(1357-1359)CGC>AGC	p.R453S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc003lky.1_Intron|PCDHGC5_uc003lkz.1_Missense_Mutation_p.R453S	NM_018929	NP_061752	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5 isoform 1	453	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.272727	9.934268	10.964257	6	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140850348	140850348	11991	5	C	A	A	23	23	PCDHGC5	A	3	3
TIGD6	81789	broad.mit.edu	36	5	149355838	149355839	+	Missense_Mutation	DNP	GA	TT	TT			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:149355838_149355839GA>TT	uc003lri.1	-	c.266_267TC>AA	c.(265-267)ATC>AAA	p.I89K	TIGD6_uc003lrj.1_Missense_Mutation_p.I89K|TIGD6_uc010jhb.1_Missense_Mutation_p.I89K	NM_030953	NP_112215	Q17RP2	TIGD6_HUMAN	hypothetical protein LOC81789	89	HTH CENPB-type.					chromosome, centromeric region|nucleus	DNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)											0.214286	7.224866	9.350327	6	22	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	149355838	149355839	16429	5	GA	TT	TT	41	41	TIGD6	TT	3	3
TCOF1	6949	broad.mit.edu	36	5	149735549	149735550	+	Missense_Mutation	DNP	GG	TT	TT			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:149735549_149735550GG>TT	uc003lry.1	+	c.1777_1778GG>TT	c.(1777-1779)GGG>TTG	p.G593L	TCOF1_uc003lrw.1_Missense_Mutation_p.G593L|TCOF1_uc003lrx.1_Missense_Mutation_p.G516L|TCOF1_uc003lrz.1_Missense_Mutation_p.G593L|TCOF1_uc003lsa.1_Missense_Mutation_p.G516L	NM_001008657	NP_001008657	Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	593					skeletal system development	nucleolus	protein binding|transporter activity			ovary(2)|large_intestine(1)	3		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)											0.444444	7.691487	7.716547	4	5	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	149735549	149735550	16234	5	GG	TT	TT	35	35	TCOF1	TT	3	3
ITK	3702	broad.mit.edu	36	5	156603897	156603897	+	Missense_Mutation	SNP	A	C	C			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:156603897A>C	uc003lwo.1	+	c.1280A>C	c.(1279-1281)GAG>GCG	p.E427A		NM_005546	NP_005537	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	427	Protein kinase.				cellular defense response|intracellular signal transduction|protein phosphorylation|T cell receptor signaling pathway	cytosol|plasma membrane	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(8)|lung(4)|skin(3)|stomach(1)|central_nervous_system(1)	17	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			Esophageal Squamous(70;1378 1469 8785 19883)				330				0.195122	7.359001	10.94469	8	33	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	156603897	156603897	8213	5	A	C	C	11	11	ITK	C	4	4
HRH2	3274	broad.mit.edu	36	5	175043732	175043732	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:175043732C>A	uc003mdc.2	+	c.890C>A	c.(889-891)ACC>AAC	p.T297N	HRH2_uc003mdd.1_Missense_Mutation_p.T297N|HRH2_uc010jjx.1_Missense_Mutation_p.T297N	NM_022304	NP_071640	P25021	HRH2_HUMAN	histamine receptor H2 isoform 2	297	Cytoplasmic (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|immune response	integral to plasma membrane	histamine receptor activity			ovary(1)	1	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Nizatidine(DB00585)|Ranitidine(DB00863)									0.275862	12.479073	13.798974	8	21	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	175043732	175043732	7648	5	C	A	A	18	18	HRH2	A	3	3
TSPAN17	26262	broad.mit.edu	36	5	176012473	176012473	+	Silent	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:176012473C>A	uc003met.1	+	c.409C>A	c.(409-411)CGG>AGG	p.R137R	TSPAN17_uc003mes.2_Silent_p.R71R|TSPAN17_uc003meu.1_Silent_p.R137R|TSPAN17_uc003mev.1_Silent_p.R137R|TSPAN17_uc003mew.1_Silent_p.R137R	NM_012171	NP_036303	Q96FV3	TSN17_HUMAN	transmembrane 4 superfamily member 17 isoform a	137	Extracellular (Potential).					integral to membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)											0.090909	16.875761	59.520158	23	230	CC		KEEP	---	---	---	---	capture			Silent	SNP	176012473	176012473	17192	5	C	A	A	23	23	TSPAN17	A	3	3
B4GALT7	11285	broad.mit.edu	36	5	176963950	176963950	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:176963950C>T	uc003mhy.1	+	c.215C>T	c.(214-216)CCC>CTC	p.P72L	B4GALT7_uc003mhz.1_5'UTR	NM_007255	NP_009186	Q9UBV7	B4GT7_HUMAN	xylosylprotein beta 1,4-galactosyltransferase 7	72	Lumenal (Potential).				fibril organization|glycosaminoglycan biosynthetic process|negative regulation of fibroblast proliferation|protein modification process|proteoglycan metabolic process	Golgi cisterna membrane|integral to membrane	metal ion binding|xylosylprotein 4-beta-galactosyltransferase activity			pancreas(1)	1	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)											0.444444	9.095106	9.119742	4	5	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	176963950	176963950	1297	5	C	T	T	22	22	B4GALT7	T	2	2
PDZD2	23037	broad.mit.edu	36	5	32128823	32128823	+	Nonsense_Mutation	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:32128823T>G	uc003jhl.1	+	c.7781T>G	c.(7780-7782)TTA>TGA	p.L2594*	PDZD2_uc003jhm.1_Nonsense_Mutation_p.L2594*	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	2594					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|large_intestine(1)	7														0.222222	8.828444	10.754763	6	21	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	32128823	32128823	12122	5	T	G	G	61	61	PDZD2	G	5	4
OXCT1	5019	broad.mit.edu	36	5	41843203	41843203	+	Missense_Mutation	SNP	T	A	A			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:41843203T>A	uc003jmn.1	-	c.827A>T	c.(826-828)GAG>GTG	p.E276V		NM_000436	NP_000427	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1 precursor	276					cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity			large_intestine(1)|ovary(1)	2					Succinic acid(DB00139)									0.25	9.294633	10.902556	7	21	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41843203	41843203	11742	5	T	A	A	54	54	OXCT1	A	4	4
HMGCS1	3157	broad.mit.edu	36	5	43334641	43334641	+	Silent	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:43334641T>G	uc003jnr.2	-	c.184A>C	c.(184-186)AGA>CGA	p.R62R	HMGCS1_uc003jnq.2_Silent_p.R62R	NM_001098272	NP_002121	Q01581	HMCS1_HUMAN	hydroxymethylglutaryl-CoA synthase 1	62					cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	hydroxymethylglutaryl-CoA synthase activity				0														0.169492	8.192781	14.333778	10	49	TT		KEEP	---	---	---	---	capture			Silent	SNP	43334641	43334641	7523	5	T	G	G	53	53	HMGCS1	G	4	4
MRPS30	10884	broad.mit.edu	36	5	44845057	44845057	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:44845057A>G	uc003joh.1	+	c.236A>G	c.(235-237)AAG>AGG	p.K79R	MRPS30_uc003joi.1_5'Flank	NM_016640	NP_057724	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	79					apoptosis|translation	mitochondrion|ribosome	structural constituent of ribosome				0	Lung NSC(6;8.08e-07)													0.2	7.122414	9.650368	6	24	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44845057	44845057	10233	5	A	G	G	3	3	MRPS30	G	4	4
MBLAC2	153364	broad.mit.edu	36	5	89805799	89805799	+	Missense_Mutation	SNP	A	C	C			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:89805799A>C	uc003kjp.1	-	c.67T>G	c.(67-69)TTC>GTC	p.F23V	POLR3G_uc003kjq.1_5'Flank	NM_203406	NP_981951	Q68D91	MBLC2_HUMAN	beta-lactamase-like	23							hydrolase activity|metal ion binding				0														0.191489	10.836762	15.039037	9	38	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	89805799	89805799	9740	5	A	C	C	1	1	MBLAC2	C	4	4
LAMA2	3908	broad.mit.edu	36	6	129677552	129677552	+	Silent	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:129677552C>T	uc003qbn.1	+	c.3471C>T	c.(3469-3471)GCC>GCT	p.A1157A	LAMA2_uc003qbo.1_Silent_p.A1157A|LAMA2_uc010kfe.1_Silent_p.A1157A	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	1157	Laminin EGF-like 13.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)										0.1875	6.42884	9.368013	6	26	CC		KEEP	---	---	---	---	capture			Silent	SNP	129677552	129677552	8929	6	C	T	T	21	21	LAMA2	T	2	2
REPS1	85021	broad.mit.edu	36	6	139308411	139308411	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:139308411G>A	uc003qii.1	-	c.394C>T	c.(394-396)CCA>TCA	p.P132S	REPS1_uc003qih.1_Missense_Mutation_p.P80S|REPS1_uc003qig.2_Missense_Mutation_p.P132S|REPS1_uc003qij.1_Missense_Mutation_p.P132S|REPS1_uc003qik.1_5'UTR	NM_031922	NP_114128	Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	132						coated pit|plasma membrane	calcium ion binding|SH3 domain binding				0				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)										0.275	27.107435	28.931944	11	29	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	139308411	139308411	13697	6	G	A	A	43	43	REPS1	A	2	2
RBM16	22828	broad.mit.edu	36	6	155195145	155195145	+	Missense_Mutation	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:155195145C>G	uc003qqa.1	+	c.2740C>G	c.(2740-2742)CCT>GCT	p.P914A	RBM16_uc003qpz.1_Missense_Mutation_p.P914A|RBM16_uc010kji.1_Intron|TIAM2_uc003qqb.1_5'Flank	NM_014892	NP_055707	Q9UPN6	SCAF8_HUMAN	RNA-binding motif protein 16	914	Pro-rich.				mRNA processing|RNA splicing	nuclear matrix|spliceosomal complex	nucleotide binding|RNA binding|RNA polymerase core enzyme binding				0		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;2.33e-15)|BRCA - Breast invasive adenocarcinoma(81;0.00524)										0.181818	6.421076	9.575805	6	27	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	155195145	155195145	13579	6	C	G	G	22	22	RBM16	G	3	3
HIST1H2AG	8969	broad.mit.edu	36	6	27209035	27209035	+	Missense_Mutation	SNP	A	C	C			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:27209035A>C	uc003niw.1	+	c.206A>C	c.(205-207)AAC>ACC	p.N69T	HIST1H2BJ_uc003niu.1_5'Flank|HIST1H2BJ_uc003niv.1_5'Flank	NM_021064	NP_066408	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	69					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding				0														0.307692	6.588769	7.021421	4	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	27209035	27209035	7418	6	A	C	C	2	2	HIST1H2AG	C	4	4
VARS	7407	broad.mit.edu	36	6	31858529	31858529	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:31858529A>G	uc003nxe.1	-	c.1835T>C	c.(1834-1836)ATC>ACC	p.I612T	VARS_uc003nxf.1_5'Flank	NM_006295	NP_006286	P26640	SYVC_HUMAN	valyl-tRNA synthetase	612					translational elongation|valyl-tRNA aminoacylation	cytosol	ATP binding|protein binding|valine-tRNA ligase activity			ovary(1)	1					L-Valine(DB00161)									0.5	6.622579	6.622579	3	3	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31858529	31858529	17688	6	A	G	G	12	12	VARS	G	4	4
PNPLA1	285848	broad.mit.edu	36	6	36367252	36367252	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:36367252C>T	uc010jwe.1	+	c.98C>T	c.(97-99)ACG>ATG	p.T33M	PNPLA1_uc003olw.1_Missense_Mutation_p.T33M|PNPLA1_uc010jwf.1_Missense_Mutation_p.T128M	NM_173676	NP_775947	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	128	Patatin.				lipid catabolic process		hydrolase activity			large_intestine(1)|breast(1)|pancreas(1)	3														0.15	14.052406	21.089008	9	51	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36367252	36367252	12591	6	C	T	T	19	19	PNPLA1	T	1	1
GFRAL	389400	broad.mit.edu	36	6	55322885	55322885	+	Missense_Mutation	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:55322885C>G	uc003pcm.1	+	c.353C>G	c.(352-354)ACT>AGT	p.T118S		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	118	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)											0.123288	14.522969	24.657445	9	64	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55322885	55322885	6619	6	C	G	G	20	20	GFRAL	G	3	3
HMGCLL1	54511	broad.mit.edu	36	6	55408506	55408506	+	Nonsense_Mutation	SNP	G	T	T			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:55408506G>T	uc003pcn.1	-	c.1026C>A	c.(1024-1026)TAC>TAA	p.Y342*	HMGCLL1_uc003pco.1_Nonsense_Mutation_p.Y312*|HMGCLL1_uc010jzx.1_Nonsense_Mutation_p.Y213*	NM_019036	NP_061909	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-Coenzyme A	342							hydroxymethylglutaryl-CoA lyase activity|metal ion binding			ovary(1)|pancreas(1)	2	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			Ovarian(35;840 893 7837 15538 42887)								0.3125	12.66718	13.169155	5	11	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	55408506	55408506	7521	6	G	T	T	48	48	HMGCLL1	T	5	3
MDN1	23195	broad.mit.edu	36	6	90524768	90524768	+	Missense_Mutation	SNP	A	C	C			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:90524768A>C	uc003pnn.1	-	c.2629T>G	c.(2629-2631)TTC>GTC	p.F877V	MDN1_uc003pno.1_Missense_Mutation_p.F296V	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	877					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)	8		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)										0.333333	10.231271	10.680459	6	12	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	90524768	90524768	9804	6	A	C	C	3	3	MDN1	C	4	4
RELN	5649	broad.mit.edu	36	7	102930773	102930773	+	Silent	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:102930773A>T	uc003vca.1	-	c.8415T>A	c.(8413-8415)TCT>TCA	p.S2805S	RELN_uc010liz.1_Silent_p.S2805S	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2805					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|large_intestine(2)|central_nervous_system(2)|pancreas(1)|skin(1)	14				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		NSCLC(146;835 1944 15585 22231 52158)								0.291667	10.400567	11.344522	7	17	AA		KEEP	---	---	---	---	capture			Silent	SNP	102930773	102930773	13689	7	A	T	T	11	11	RELN	T	4	4
CAV1	857	broad.mit.edu	36	7	115986314	115986314	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:115986314T>G	uc003vif.1	+	c.274T>G	c.(274-276)TTC>GTC	p.F92V	CAV1_uc010lkd.1_Missense_Mutation_p.F61V|CAV1_uc010lke.1_Missense_Mutation_p.F61V|CAV1_uc003vig.1_Non-coding_Transcript|CAV1_uc003vih.2_Missense_Mutation_p.F61V|CAV1_uc010lkf.1_Missense_Mutation_p.F61V	NM_001753	NP_001744	Q03135	CAV1_HUMAN	caveolin 1	92	Cytoplasmic (Potential).				blood coagulation|calcium ion transport|caveola assembly|cellular response to starvation|cholesterol homeostasis|cytosolic calcium ion homeostasis|inactivation of MAPK activity|interspecies interaction between organisms|leukocyte migration|lipid storage|maintenance of protein location in cell|mammary gland involution|membrane depolarization|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of endothelial cell proliferation|negative regulation of epithelial cell differentiation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of MAPKKK cascade|negative regulation of nitric oxide biosynthetic process|negative regulation of peptidyl-serine phosphorylation|negative regulation of protein binding|nitric oxide homeostasis|nitric oxide metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of metalloenzyme activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of vasoconstriction|protein homooligomerization|receptor internalization|regulation of blood coagulation|regulation of fatty acid metabolic process|regulation of nitric-oxide synthase activity|regulation of smooth muscle contraction|response to calcium ion|response to estrogen stimulus|response to hypoxia|response to progesterone stimulus|skeletal muscle tissue development|T cell costimulation|triglyceride metabolic process|vasculogenesis|vesicle organization	apical plasma membrane|basolateral plasma membrane|caveola|caveola|endoplasmic reticulum|Golgi membrane|lipid particle|perinuclear region of cytoplasm	cholesterol binding|nitric-oxide synthase binding|peptidase activator activity|protein binding|protein complex scaffold|receptor binding				0	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)											0.238095	15.320192	17.963818	10	32	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	115986314	115986314	2812	7	T	G	G	56	56	CAV1	G	4	4
UNCX	340260	broad.mit.edu	36	7	1239734	1239734	+	Silent	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:1239734C>A	uc003skg.1	+	c.327C>A	c.(325-327)CGC>CGA	p.R109R		NM_001080461	NP_001073930	A6NJT0	UNC4_HUMAN	UNC homeobox	109	Homeobox.				cell differentiation|regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity				0		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)										0.461538	9.81912	9.838341	6	7	CC		KEEP	---	---	---	---	capture			Silent	SNP	1239734	1239734	17557	7	C	A	A	25	25	UNCX	A	3	3
FAM40B	57464	broad.mit.edu	36	7	128885434	128885434	+	Missense_Mutation	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:128885434A>T	uc003vox.1	+	c.1181A>T	c.(1180-1182)CAG>CTG	p.Q394L	FAM40B_uc003vow.1_Missense_Mutation_p.Q394L	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN	hypothetical protein LOC57464 isoform a	394											0														0.333333	9.323344	9.776537	6	12	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	128885434	128885434	5782	7	A	T	T	7	7	FAM40B	T	4	4
PKD1L1	168507	broad.mit.edu	36	7	47843090	47843090	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:47843090A>G	uc003tny.1	-	c.5897T>C	c.(5896-5898)GTC>GCC	p.V1966A		NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	1966	Helical; (Potential).				cell-cell adhesion	integral to membrane				ovary(7)|breast(1)	8														0.173077	10.346149	15.603845	9	43	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47843090	47843090	12388	7	A	G	G	10	10	PKD1L1	G	4	4
AUTS2	26053	broad.mit.edu	36	7	69893769	69893769	+	Missense_Mutation	SNP	A	T	T			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:69893769A>T	uc003tvw.2	+	c.3631A>T	c.(3631-3633)ACC>TCC	p.T1211S	AUTS2_uc003tvx.2_Missense_Mutation_p.T1187S	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1	1211										ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)										0.4	6.889047	6.978568	4	6	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69893769	69893769	1246	7	A	T	T	10	10	AUTS2	T	4	4
POM121C	100101267	broad.mit.edu	36	7	74904763	74904763	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:74904763G>T	uc003udk.2	-	c.446C>A	c.(445-447)ACC>AAC	p.T149N	POM121C_uc010lde.1_Missense_Mutation_p.T391N	NM_001099415	NP_001092885	A8CG34	P121C_HUMAN	POM121 membrane glycoprotein (rat)-like	391	Required for targeting to the nucleus and nuclear pore complex.|Pore side (Potential).|Ser-rich.				mRNA transport|protein transport|transmembrane transport	endoplasmic reticulum membrane|nuclear membrane|nuclear pore	protein binding				0														0.24	8.02836	9.583484	6	19	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74904763	74904763	12668	7	G	T	T	44	44	POM121C	T	3	3
MAGI2	9863	broad.mit.edu	36	7	78920432	78920432	+	Silent	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:78920432C>T	uc003ugx.1	-	c.141G>A	c.(139-141)GTG>GTA	p.V47V	MAGI2_uc003ugy.1_Silent_p.V47V	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	47	PDZ 1.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)	5		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)												0.108844	13.494188	35.789099	16	131	CC		KEEP	---	---	---	---	capture			Silent	SNP	78920432	78920432	9574	7	C	T	T	29	29	MAGI2	T	2	2
FZD1	8321	broad.mit.edu	36	7	90733127	90733127	+	Silent	SNP	C	A	A			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:90733127C>A	uc003ula.1	+	c.996C>A	c.(994-996)GCC>GCA	p.A332A		NM_003505	NP_003496	Q9UP38	FZD1_HUMAN	frizzled 1	332	Helical; Name=1; (Potential).				autocrine signaling|axonogenesis|brain development|canonical Wnt receptor signaling pathway involved in mesenchymal stem cell differentiation|canonical Wnt receptor signaling pathway involved in osteoblast differentiation|embryo development|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|lung alveolus development|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|regulation of gene-specific transcription from RNA polymerase II promoter|response to drug|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cell surface|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|receptor binding|Wnt receptor activity|Wnt-protein binding				0	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)							79				0.272727	9.433689	10.464312	6	16	CC		KEEP	---	---	---	---	capture			Silent	SNP	90733127	90733127	6379	7	C	A	A	24	24	FZD1	A	3	3
UBR5	51366	broad.mit.edu	36	8	103426804	103426804	+	Silent	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr8:103426804A>G	uc003ykr.1	-	c.882T>C	c.(880-882)TCT>TCC	p.S294S	UBR5_uc003yks.1_Silent_p.S294S	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	294					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(5)|ovary(3)|large_intestine(3)|kidney(1)|central_nervous_system(1)	13	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			Ovarian(131;96 1741 5634 7352 27489)				1024				0.333333	10.16793	10.537981	5	10	AA		KEEP	---	---	---	---	capture			Silent	SNP	103426804	103426804	17463	8	A	G	G	11	11	UBR5	G	4	4
TMEM71	137835	broad.mit.edu	36	8	133803526	133803526	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:133803526C>T	uc003ytp.1	-	c.691G>A	c.(691-693)GAG>AAG	p.E231K	TMEM71_uc003ytm.1_Missense_Mutation_p.E53K|TMEM71_uc003ytn.1_Missense_Mutation_p.E213K|TMEM71_uc003yto.1_Missense_Mutation_p.E169K	NM_144649	NP_653250	Q6P5X7	TMM71_HUMAN	transmembrane protein 71 isoform 1	232	Helical; (Potential).					integral to membrane				ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)											0.173611	55.392737	69.87006	25	119	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	133803526	133803526	16739	8	C	T	T	32	32	TMEM71	T	2	2
MTMR7	9108	broad.mit.edu	36	8	17243318	17243318	+	Silent	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:17243318G>A	uc003wxm.1	-	c.657C>T	c.(655-657)GAC>GAT	p.D219D	MTMR7_uc003wxn.2_De_novo_Start_OutOfFrame	NM_004686	NP_004677	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	219	Myotubularin phosphatase.						protein tyrosine phosphatase activity				0				Colorectal(111;0.112)										0.52	37.871898	37.880617	13	12	GG		KEEP	---	---	---	---	capture			Silent	SNP	17243318	17243318	10341	8	G	A	A	40	40	MTMR7	A	1	1
DPYSL2	1808	broad.mit.edu	36	8	26566742	26566742	+	Silent	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:26566742C>T	uc003xfa.2	+	c.1854C>T	c.(1852-1854)GTC>GTT	p.V618V	DPYSL2_uc010luk.1_Non-coding_Transcript|DPYSL2_uc003xfb.1_Silent_p.V513V	NM_001386	NP_001377	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	513					axon guidance|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding			large_intestine(1)	1		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)										0.307692	6.487546	6.920987	4	9	CC		KEEP	---	---	---	---	capture			Silent	SNP	26566742	26566742	4931	8	C	T	T	29	29	DPYSL2	T	2	2
VCPIP1	80124	broad.mit.edu	36	8	67739901	67739901	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:67739901G>A	uc003xwn.1	-	c.1847C>T	c.(1846-1848)TCA>TTA	p.S616L	SGK3_uc003xwp.1_5'Flank|C8orf44_uc003xwo.1_5'Flank	NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	616					protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			NSCLC(179;265 2915 6144 43644)				91				0.183333	24.391325	30.039184	11	49	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	67739901	67739901	17706	8	G	A	A	45	45	VCPIP1	A	2	2
TTC16	158248	broad.mit.edu	36	9	129529370	129529370	+	Silent	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:129529370G>C	uc004brq.1	+	c.1569G>C	c.(1567-1569)GGG>GGC	p.G523G	PTRH1_uc004brp.1_5'Flank|TTC16_uc004brr.1_Missense_Mutation_p.R373S|TTC16_uc010mxn.1_Silent_p.G119G	NM_144965	NP_659402	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	523							binding				0														0.529412	17.051241	17.062768	9	8	GG		KEEP	---	---	---	---	capture			Silent	SNP	129529370	129529370	17237	9	G	C	C	41	41	TTC16	C	3	3
SH3GLB2	56904	broad.mit.edu	36	9	130816957	130816957	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:130816957C>T	uc004bww.1	-	c.382G>A	c.(382-384)GCG>ACG	p.A128T	SH3GLB2_uc004bwv.1_Missense_Mutation_p.A128T|SH3GLB2_uc004bwx.1_Missense_Mutation_p.A128T	NM_020145	NP_064530	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	128	BAR.|Potential.				filopodium assembly|signal transduction	cytoplasm|nucleus	cytoskeletal adaptor activity|SH3 domain binding				0														0.272727	14.539076	15.564621	6	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	130816957	130816957	14746	9	C	T	T	27	27	SH3GLB2	T	1	1
C9orf106	414318	broad.mit.edu	36	9	131124529	131124529	+	Missense_Mutation	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:131124529C>G	uc004bxs.2	+	c.616C>G	c.(616-618)CTC>GTC	p.L206V	C9orf106_uc010myv.1_Missense_Mutation_p.L206V	NM_001012715	NP_001012733	Q8NAJ2	CI106_HUMAN	hypothetical protein LOC414318	206											0		Ovarian(14;0.00556)|Medulloblastoma(224;0.235)												0.4	13.875068	14.055102	8	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	131124529	131124529	2560	9	C	G	G	24	24	C9orf106	G	3	3
PMPCA	23203	broad.mit.edu	36	9	138431440	138431440	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:138431440G>A	uc004chl.1	+	c.850G>A	c.(850-852)GTG>ATG	p.V284M	PMPCA_uc010nbl.1_Missense_Mutation_p.V184M|PMPCA_uc004chm.1_Missense_Mutation_p.V34M|PMPCA_uc004chn.1_5'Flank	NM_015160	NP_055975	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	284					proteolysis	mitochondrial inner membrane|mitochondrial matrix	metalloendopeptidase activity|zinc ion binding				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)										0.905405	211.255116	223.470228	67	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	138431440	138431440	12566	9	G	A	A	40	40	PMPCA	A	1	1
BNC2	54796	broad.mit.edu	36	9	16426410	16426410	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:16426410G>C	uc003zml.1	-	c.1782C>G	c.(1780-1782)ATC>ATG	p.I594M	BNC2_uc003zmm.2_Missense_Mutation_p.I552M|BNC2_uc003zmp.1_Missense_Mutation_p.I622M|BNC2_uc003zmq.1_Missense_Mutation_p.I608M|BNC2_uc003zmr.1_Missense_Mutation_p.I631M|BNC2_uc010mij.1_Missense_Mutation_p.I516M|BNC2_uc003zmo.1_Missense_Mutation_p.I516M|BNC2_uc010mii.1_Missense_Mutation_p.I359M|BNC2_uc003zmi.1_Missense_Mutation_p.I359M|BNC2_uc003zmj.1_Missense_Mutation_p.I359M|BNC2_uc003zmk.1_Non-coding_Transcript|BNC2_uc003zmn.1_Missense_Mutation_p.I359M	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	594	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)										0.5	13.506292	13.506292	7	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16426410	16426410	1500	9	G	C	C	45	45	BNC2	C	3	3
FAM154A	158297	broad.mit.edu	36	9	18918864	18918864	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr9:18918864A>G	uc003zni.1	-	c.611T>C	c.(610-612)GTG>GCG	p.V204A	FAM154A_uc010mip.1_Missense_Mutation_p.V12A	NM_153707	NP_714918	Q8IYX7	F154A_HUMAN	hypothetical protein LOC158297	204										pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.53e-16)										0.173913	7.969239	12.602686	8	38	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18918864	18918864	5661	9	A	G	G	6	6	FAM154A	G	4	4
PLAA	9373	broad.mit.edu	36	9	26913265	26913265	+	Missense_Mutation	SNP	A	C	C			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr9:26913265A>C	uc003zqd.1	-	c.950T>G	c.(949-951)CTG>CGG	p.L317R	PLAA_uc003zqe.1_Missense_Mutation_p.L317R	NM_001031689	NP_001026859	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein	317					phospholipid metabolic process|signal transduction		phospholipase A2 activator activity				0		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		Melanoma(175;2670 2735 14091 35526)								0.206897	7.123524	9.449596	6	23	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26913265	26913265	12437	9	A	C	C	7	7	PLAA	C	4	4
HINT2	84681	broad.mit.edu	36	9	35803729	35803729	+	Missense_Mutation	SNP	T	C	C			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:35803729T>C	uc003zyh.1	-	c.134A>G	c.(133-135)CAG>CGG	p.Q45R	SPAG8_uc003zye.1_5'Flank|SPAG8_uc003zyf.1_5'Flank|SPAG8_uc003zyg.1_5'Flank|HINT2_uc003zyi.1_Missense_Mutation_p.R10G	NM_032593	NP_115982	Q9BX68	HINT2_HUMAN	PKCI-1-related HIT protein	45					apoptosis|steroid biosynthetic process	mitochondrion	hydrolase activity				0	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			GBM(185;1694 2122 5473 25431 37228)						OREG0019179	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.384615	9.764529	9.918448	5	8	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35803729	35803729	7397	9	T	C	C	55	55	HINT2	C	4	4
TJP2	9414	broad.mit.edu	36	9	71030868	71030868	+	Silent	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:71030868C>G	uc004ahe.1	+	c.1167C>G	c.(1165-1167)CTC>CTG	p.L389L	TJP2_uc004ahd.2_Silent_p.L389L|TJP2_uc004ahf.1_Silent_p.L389L	NM_004817	NP_004808	Q9UDY2	ZO2_HUMAN	tight junction protein 2 (zona occludens 2)	389					cellular component disassembly involved in apoptosis	adherens junction|cytoplasm|nucleus|tight junction	guanylate kinase activity|protein binding				0														0.277778	6.752785	7.564321	5	13	CC		KEEP	---	---	---	---	capture			Silent	SNP	71030868	71030868	16459	9	C	G	G	29	29	TJP2	G	3	3
TRPM6	140803	broad.mit.edu	36	9	76544705	76544705	+	Silent	SNP	G	C	C			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:76544705G>C	uc004ajl.1	-	c.5241C>G	c.(5239-5241)TCC>TCG	p.S1747S	TRPM6_uc004ajj.1_Silent_p.S703S|TRPM6_uc004ajk.1_Silent_p.S1742S|TRPM6_uc010mpb.1_Non-coding_Transcript|TRPM6_uc010mpc.1_Silent_p.S698S|TRPM6_uc010mpd.1_Silent_p.S580S|TRPM6_uc010mpe.1_Silent_p.S294S	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	1747	Cytoplasmic (Potential).				protein phosphorylation|response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4										879				0.25	22.827651	25.104632	10	30	GG		KEEP	---	---	---	---	capture			Silent	SNP	76544705	76544705	17141	9	G	C	C	43	43	TRPM6	C	3	3
WWC3	55841	broad.mit.edu	36	X	10037950	10037951	+	Missense_Mutation	DNP	TG	CC	CC			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:10037950_10037951TG>CC	uc004csx.2	+	c.864_865TG>CC	c.(862-867)ATTGCA>ATCCCA	p.A289P	WWC3_uc010nds.1_5'UTR|WWC3_uc010ndt.1_Non-coding_Transcript	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3	289	Potential.									ovary(4)	4														1	10.455845	10.394588	4	0	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	10037950	10037951	17987	23	TG	CC	CC	63	63	WWC3	CC	4	4
NXF5	55998	broad.mit.edu	36	X	100979244	100979244	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:100979244G>A	uc004eih.1	-	c.958C>T	c.(958-960)CGA>TGA	p.R320*	NXF5_uc004eii.1_Non-coding_Transcript|NXF5_uc004eij.1_Non-coding_Transcript|NXF5_uc004eik.1_Non-coding_Transcript|NXF5_uc004eil.1_Non-coding_Transcript	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	320	NTF2; truncated.				mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1														0.745763	142.255105	145.467189	44	15	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	100979244	100979244	11191	23	G	A	A	40	40	NXF5	A	5	1
COL4A5	1287	broad.mit.edu	36	X	107756217	107756217	+	Silent	SNP	A	C	C			TCGA-28-1760-01	TCGA-28-1760-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:107756217A>C	uc004enz.1	+	c.3228A>C	c.(3226-3228)CCA>CCC	p.P1076P	COL4A5_uc010npl.1_Silent_p.P1076P|COL4A5_uc010npm.1_Silent_p.P1076P|COL4A5_uc010npn.1_Silent_p.P1076P|COL4A5_uc004eob.1_Silent_p.P684P	NM_033380	NP_000486	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	1076	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4														0.6	64.555908	64.818308	18	12	AA		KEEP	---	---	---	---	capture			Silent	SNP	107756217	107756217	3832	23	A	C	C	7	7	COL4A5	C	4	4
TMEM164	84187	broad.mit.edu	36	X	109301347	109301347	+	Silent	SNP	T	A	A			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:109301347T>A	uc004eom.1	+	c.630T>A	c.(628-630)CTT>CTA	p.L210L	TMEM164_uc004eol.1_Silent_p.L61L|TMEM164_uc010npq.1_Silent_p.L171L	NM_032227	NP_115603	Q5U3C3	TM164_HUMAN	transmembrane protein 164	210	Helical; (Potential).					integral to membrane				large_intestine(1)|lung(1)|skin(1)	3														0.206897	7.626961	9.947366	6	23	TT		KEEP	---	---	---	---	capture			Silent	SNP	109301347	109301347	16613	23	T	A	A	62	62	TMEM164	A	4	4
MPP1	4354	broad.mit.edu	36	X	153663174	153663175	+	Nonsense_Mutation	DNP	GA	CT	CT			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:153663174_153663175GA>CT	uc004fmp.1	-	c.1043_1044TC>AG	c.(1042-1044)TTC>TAG	p.F348*	MPP1_uc004fmq.1_Nonsense_Mutation_p.F302*|MPP1_uc010nvg.1_Nonsense_Mutation_p.F328*	NM_002436	NP_002427	Q00013	EM55_HUMAN	palmitoylated membrane protein 1	348	Guanylate kinase-like.|Interaction with MPP5.				regulation of neutrophil chemotaxis|signal transduction	integral to plasma membrane|membrane fraction|stereocilium	guanylate kinase activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)													0.169811	8.532203	14.026074	9	44	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	DNP	153663174	153663175	10125	23	GA	CT	CT	33	33	MPP1	CT	5	3
F8	2157	broad.mit.edu	36	X	153719086	153719086	+	Missense_Mutation	SNP	C	G	G			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:153719086C>G	uc004fmt.1	-	c.7036G>C	c.(7036-7038)GAG>CAG	p.E2346Q	F8_uc004fms.1_Missense_Mutation_p.E211Q	NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	2346					acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|oxidation-reduction process|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)					359				0.294118	7.659025	8.310736	5	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	153719086	153719086	5544	23	C	G	G	31	31	F8	G	3	3
MAP7D2	256714	broad.mit.edu	36	X	19991524	19991525	+	Missense_Mutation	DNP	GC	CT	CT			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:19991524_19991525GC>CT	uc010nfo.1	-	c.300_301GC>AG	c.(298-303)GAGCAG>GAAGAG	p.Q101E	MAP7D2_uc004czr.1_Missense_Mutation_p.Q101E|MAP7D2_uc004czs.1_Missense_Mutation_p.Q57E	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	101	Potential.									ovary(2)|breast(1)	3														0.307692	7.996261	8.424517	4	9	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	19991524	19991525	9651	23	GC	CT	CT	46	46	MAP7D2	CT	3	3
ARSF	416	broad.mit.edu	36	X	3008960	3008960	+	Silent	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:3008960C>T	uc004cre.1	+	c.312C>T	c.(310-312)GTC>GTT	p.V104V	ARSF_uc004crf.1_Silent_p.V104V	NM_004042	NP_004033	P54793	ARSF_HUMAN	arylsulfatase F precursor	104						extracellular region	arylsulfatase activity|metal ion binding			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)												0.230769	14.336143	16.063785	6	20	CC		KEEP	---	---	---	---	capture			Silent	SNP	3008960	3008960	1009	23	C	T	T	29	29	ARSF	T	2	2
MAGEB3	4114	broad.mit.edu	36	X	30164542	30164542	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:30164542C>T	uc004dca.1	+	c.580C>T	c.(580-582)CGT>TGT	p.R194C	MAGEB3_uc010ngg.1_Missense_Mutation_p.R194C	NM_002365	NP_002356	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	194	MAGE.										0														0.461538	16.747809	16.764407	6	7	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30164542	30164542	9558	23	C	T	T	31	31	MAGEB3	T	1	1
TAB3	257397	broad.mit.edu	36	X	30782775	30782775	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1760-01	TCGA-28-1760-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:30782775G>T	uc004dcj.1	-	c.928C>A	c.(928-930)CAA>AAA	p.Q310K	TAB3_uc004dck.1_Missense_Mutation_p.Q310K|TAB3_uc010ngl.1_Missense_Mutation_p.Q310K	NM_152787	NP_690000	Q8N5C8	TAB3_HUMAN	mitogen-activated protein kinase kinase kinase 7	310	Pro-rich.				activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein binding|zinc ion binding			ovary(1)	1						Pancreas(164;1598 1985 29022 43301 49529)								0.285714	9.330596	10.204315	6	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30782775	30782775	16018	23	G	T	T	45	45	TAB3	T	3	3
MXRA5	25878	broad.mit.edu	36	X	3248486	3248486	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1760-01	TCGA-28-1760-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:3248486C>T	uc004crg.2	-	c.5240G>A	c.(5239-5241)CGG>CAG	p.R1747Q		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican	1747						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(23;0.00031)|Lung NSC(23;0.000946)												0.827586	87.121803	90.07792	24	5	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3248486	3248486	10397	23	C	T	T	23	23	MXRA5	T	1	1
FAM47A	158724	broad.mit.edu	36	X	34057979	34057979	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:34057979T>G	uc004ddg.1	-	c.2338A>C	c.(2338-2340)AAG>CAG	p.K780Q		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	780										ovary(4)|central_nervous_system(1)	5														0.195652	9.426525	13.432379	9	37	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	34057979	34057979	5790	23	T	G	G	63	63	FAM47A	G	4	4
XK	7504	broad.mit.edu	36	X	37472482	37472482	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:37472482T>G	uc004ddq.1	+	c.1163T>G	c.(1162-1164)TTT>TGT	p.F388C		NM_021083	NP_066569	P51811	XK_HUMAN	membrane transport protein XK	388	Cytoplasmic (Potential).				amino acid transport	integral to membrane	protein binding|transporter activity				0		all_lung(315;0.175)												0.276596	21.138907	23.264406	13	34	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37472482	37472482	18012	23	T	G	G	64	64	XK	G	4	4
AWAT2	158835	broad.mit.edu	36	X	69178511	69178511	+	Missense_Mutation	SNP	T	A	A			TCGA-28-1760-01	TCGA-28-1760-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:69178511T>A	uc004dxt.1	-	c.874A>T	c.(874-876)ATT>TTT	p.I292F		NM_001002254	NP_001002254	Q6E213	AWAT2_HUMAN	diacylglycerol O-acyltransferase 2-like 4	292						endoplasmic reticulum membrane|integral to membrane	long-chain-alcohol O-fatty-acyltransferase activity				0						NSCLC(80;1334 1436 9350 24214 26427)								0.733333	36.730979	37.468682	11	4	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69178511	69178511	1256	23	T	A	A	50	50	AWAT2	A	4	4
SH3PXD2A	9644	broad.mit.edu	36	10	105516902	105516910	+	In_Frame_Del	DEL	TATCCAAAA	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:105516902_105516910delTATCCAAAA	uc001kxj.1	-	c.161_169delTTTTGGATA	c.(160-171)CTTTTGGATAAG>CAG	p.54_57LLDK>Q		NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1	54_57	PX.				cell communication	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)										0.48			29	31				---	---	---	---	capture_indel			In_Frame_Del	DEL	105516902	105516910	14748	10	TATCCAAAA	-	-	61	61	SH3PXD2A	-	5	5
VWA2	340706	broad.mit.edu	36	10	116036182	116036183	+	Frame_Shift_Ins	INS	-	T	T			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:116036182_116036183insT	uc001lbl.1	+	c.1492_1493insT	c.(1492-1494)ATGfs	p.M498fs	VWA2_uc001lbk.1_Frame_Shift_Ins_p.M498fs|VWA2_uc009xyf.1_Frame_Shift_Ins_p.M194fs	NM_198496	NP_940898	Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	498	VWFA 2.					extracellular region				ovary(2)|large_intestine(1)|central_nervous_system(1)	4				Epithelial(162;0.036)|all cancers(201;0.0793)										0.77			44	13				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	116036182	116036183	17808	10	-	T	T	12	12	VWA2	T	5	5
RRP12	23223	broad.mit.edu	36	10	99106843	99106846	+	Frame_Shift_Del	DEL	AGGG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:99106843_99106846delAGGG	uc001knf.1	-	c.3889_3892delCCCT	c.(3889-3894)CCCTGAfs	p.P1297fs	RRP12_uc001kne.1_Frame_Shift_Del_p.P312fs|RRP12_uc009xvl.1_Frame_Shift_Del_p.P414fs|RRP12_uc009xvm.1_Frame_Shift_Del_p.P1015fs|RRP12_uc009xvn.1_Frame_Shift_Del_p.P1197fs	NM_015179	NP_055994	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog	1297_1298						integral to membrane|nuclear membrane|nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)										0.35			18	33				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	99106843	99106846	14166	10	AGGG	-	-	7	7	RRP12	-	5	5
NAA40	79829	broad.mit.edu	36	11	63476520	63476521	+	Frame_Shift_Ins	INS	-	T	T			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:63476520_63476521insT	uc009yoz.1	+	c.317_318insT	c.(316-318)GCCfs	p.A106fs		NM_024771	NP_079047	Q86UY6	NAA40_HUMAN	N-acetyltransferase 11	106	N-acetyltransferase.						N-acetyltransferase activity				0														0.39			51	79				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	63476520	63476521	10520	11	-	T	T	26	26	NAA40	T	5	5
SDS	10993	broad.mit.edu	36	12	112320764	112320766	+	In_Frame_Del	DEL	CCT	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:112320764_112320766delCCT	uc001tvg.1	-	c.362_364delAGG	c.(361-366)AAGGCC>ACC	p.121_122KA>T	SDS_uc001tvh.1_In_Frame_Del_p.121_122KA>T	NM_006843	NP_006834	P20132	SDHL_HUMAN	serine dehydratase	121_122					gluconeogenesis|L-serine catabolic process|pyruvate biosynthetic process	cytoplasm	L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|protein homodimerization activity|pyridoxal phosphate binding			pancreas(1)	1					L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)									0.53			50	45				---	---	---	---	capture_indel			In_Frame_Del	DEL	112320764	112320766	14461	12	CCT	-	-	26	26	SDS	-	5	5
GCN1L1	10985	broad.mit.edu	36	12	119084185	119084186	+	Frame_Shift_Ins	INS	-	A	A			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:119084185_119084186insA	uc001txo.1	-	c.2223_2224insT	c.(2221-2226)CAGCTCfs	p.Q741fs		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	741_742					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(3)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)													0.50			5	5				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	119084185	119084186	6565	12	-	A	A	34	34	GCN1L1	A	5	5
DAZAP2	9802	broad.mit.edu	36	12	49922381	49922388	+	Frame_Shift_Del	DEL	CCTCCACC	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:49922381_49922388delCCTCCACC	uc001ryb.1	+	c.379_386delCCTCCACC	c.(379-387)CCTCCACCTfs	p.P127fs		NM_014764	NP_055579	Q15038	DAZP2_HUMAN	DAZ associated protein 2 isoform a	127_129	Pro-rich.						WW domain binding				0														0.88			290	38				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	49922381	49922388	4416	12	CCTCCACC	-	-	26	26	DAZAP2	-	5	5
NTF3	4908	broad.mit.edu	36	12	5474169	5474173	+	Frame_Shift_Del	DEL	GGGGG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:5474169_5474173delGGGGG	uc001qnk.2	+	c.567_571delGGGGG	c.(565-573)CTGGGGGAGfs	p.L189fs	NTF3_uc001qnl.2_Frame_Shift_Del_p.L176fs	NM_001102654	NP_001096124	P20783	NTF3_HUMAN	neurotrophin 3 isoform 1 preproprotein	176_178					signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding			pancreas(1)	1						GBM(194;1104 2182 8339 9578 18493)								0.46			21	25				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	5474169	5474173	11101	12	GGGGG	-	-	47	47	NTF3	-	5	5
C12orf50	160419	broad.mit.edu	36	12	86914486	86914487	+	Frame_Shift_Ins	INS	-	T	T			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:86914486_86914487insT	uc001tam.1	-	c.357_358insA	c.(355-360)TGTTATfs	p.C119fs	C12orf50_uc001tan.2_Frame_Shift_Ins_p.C173fs	NM_152589	NP_689802	Q8NA57	CL050_HUMAN	hypothetical protein LOC160419	119_120										ovary(1)	1														0.35			8	15				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	86914486	86914487	1739	12	-	T	T	13	13	C12orf50	T	5	5
MCF2L	23263	broad.mit.edu	36	13	112790097	112790098	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:112790097_112790098delGA	uc001vsu.2	+	c.2842_2843delGA	c.(2842-2844)GAGfs	p.E948fs	MCF2L_uc001vsq.2_Frame_Shift_Del_p.E948fs|MCF2L_uc001vsr.2_Frame_Shift_Del_p.E895fs|MCF2L_uc001vss.2_Frame_Shift_Del_p.E889fs	NM_001112732	NP_001106203	O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming	921	PH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(1)|kidney(1)	2	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)												0.78			97	27				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	112790097	112790098	9768	13	GA	-	-	41	41	MCF2L	-	5	5
HS6ST3	266722	broad.mit.edu	36	13	96282746	96282754	+	In_Frame_Del	DEL	AATTTCTAT	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:96282746_96282754delAATTTCTAT	uc001vmw.1	+	c.709_717delAATTTCTAT	c.(709-717)AATTTCTATdel	p.NFY237del		NM_153456	NP_703157	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	237_239	Lumenal (Potential).				carbohydrate biosynthetic process	integral to membrane	sulfotransferase activity			ovary(1)	1	all_neural(89;0.0878)|Medulloblastoma(90;0.163)													0.60			84	55				---	---	---	---	capture_indel			In_Frame_Del	DEL	96282746	96282754	7666	13	AATTTCTAT	-	-	9	9	HS6ST3	-	5	5
GOLGA5	9950	broad.mit.edu	36	14	92369284	92369284	+	Frame_Shift_Del	DEL	C	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:92369284_92369284delC	uc001yaz.1	+	c.1784_1784delC	c.(1783-1785)ACAfs	p.T595fs	GOLGA5_uc001yba.1_5'UTR	NM_005113	NP_005104	Q8TBA6	GOGA5_HUMAN	Golgi autoantigen, golgin subfamily a, 5	595	Cytoplasmic (Potential).|Potential.				Golgi organization|protein phosphorylation	cis-Golgi network|integral to membrane	ATP binding|protein homodimerization activity|protein tyrosine kinase activity|Rab GTPase binding			ovary(2)|lung(1)	3		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)						351				0.33			6	12				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	92369284	92369284	6825	14	C	-	-	17	17	GOLGA5	-	5	5
DDX24	57062	broad.mit.edu	36	14	93615625	93615639	+	In_Frame_Del	DEL	CTTCCTTTGAGAAGA	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:93615625_93615639delCTTCCTTTGAGAAGA	uc001ycj.1	-	c.203_217delTCTTCTCAAAGGAAG	c.(202-219)CTCTTCTCAAAGGAAGCA>CCA	p.68_73LFSKEA>P	IFI27L1_uc001ycl.1_5'Flank|IFI27L1_uc001yck.1_5'Flank	NM_020414	NP_065147	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 24	68_73					RNA metabolic process	cytoplasm|nucleolus|nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|skin(1)	4		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)										0.53			178	156				---	---	---	---	capture_indel			In_Frame_Del	DEL	93615625	93615639	4522	14	CTTCCTTTGAGAAGA	-	-	28	28	DDX24	-	5	5
EIF2AK4	440275	broad.mit.edu	36	15	38111723	38111731	+	Splice_Site_Del	DEL	TTCTGGCTG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:38111723_38111731delTTCTGGCTG	uc001zkm.1	+	c.e36_splice_site			EIF2AK4_uc010bbj.1_Splice_Site_Del|EIF2AK4_uc001zkn.1_Splice_Site_Del|EIF2AK4_uc001zko.1_Splice_Site_Del|EIF2AK4_uc010bbk.1_Intron	NM_001013703	NP_001013725			eukaryotic translation initiation factor 2 alpha						protein phosphorylation|translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)					(HEC151-Tumor)	876				0.57			30	23				---	---	---	---	capture_indel			Splice_Site_Del	DEL	38111723	38111731	5188	15	TTCTGGCTG	-	-	52	52	EIF2AK4	-	5	5
BAHD1	22893	broad.mit.edu	36	15	38541443	38541459	+	Frame_Shift_Del	DEL	GGAAGCTGGCCACCCAG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:38541443_38541459delGGAAGCTGGCCACCCAG	uc001zlu.2	+	c.1473_1489delGGAAGCTGGCCACCCAG	c.(1471-1491)CCGGAAGCTGGCCACCCAGCCfs	p.P491fs	BAHD1_uc001zlt.2_Frame_Shift_Del_p.P490fs|BAHD1_uc010bbp.1_Frame_Shift_Del_p.P490fs|BAHD1_uc001zlv.2_Frame_Shift_Del_p.P491fs	NM_014952	NP_055767	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	491_497					heterochromatin formation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin silencing complex|chromosome	chromatin binding|DNA binding|protein binding				0		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)										0.77			75	22				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	38541443	38541459	1318	15	GGAAGCTGGCCACCCAG	-	-	39	39	BAHD1	-	5	5
LTK	4058	broad.mit.edu	36	15	39583916	39583916	+	Frame_Shift_Del	DEL	G	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:39583916_39583916delG	uc001zoa.2	-	c.2262_2262delC	c.(2260-2262)CGCfs	p.R754fs	LTK_uc010bcg.1_Frame_Shift_Del_p.R365fs|LTK_uc001zob.2_Frame_Shift_Del_p.R693fs	NM_002344	NP_002335	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase isoform 1	754	Protein kinase.|Cytoplasmic (Potential).				protein phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|central_nervous_system(1)	7		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)						314	TSP Lung(18;0.14)			0.64			14	8				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	39583916	39583916	9456	15	G	-	-	46	46	LTK	-	5	5
SPATA5L1	79029	broad.mit.edu	36	15	43495232	43495232	+	Frame_Shift_Del	DEL	G	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:43495232_43495232delG	uc001zve.1	+	c.1800_1800delG	c.(1798-1800)AAGfs	p.K600fs	SPATA5L1_uc001zvf.1_Non-coding_Transcript	NM_024063	NP_076968	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	600						cytoplasm	ATP binding|nucleoside-triphosphatase activity			ovary(2)	2		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)										0.62			53	33				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	43495232	43495232	15522	15	G	-	-	33	33	SPATA5L1	-	5	5
SEPT12	124404	broad.mit.edu	36	16	4773541	4773549	+	In_Frame_Del	DEL	TCCTCAGGT	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:4773541_4773549delTCCTCAGGT	uc002cxq.1	-	c.641_649delACCTGAGGA	c.(640-651)AACCTGAGGACC>ACC	p.NLR214del	SEPT12_uc010bty.1_Non-coding_Transcript|SEPT12_uc002cxr.1_In_Frame_Del_p.NLR168del	NM_144605	NP_653206	Q8IYM1	SEP12_HUMAN	septin 12	214_216					cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity				0														0.41			61	86				---	---	---	---	capture_indel			In_Frame_Del	DEL	4773541	4773549	14548	16	TCCTCAGGT	-	-	58	58	SEPT12	-	5	5
BZRAP1	9256	broad.mit.edu	36	17	53740262	53740263	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:53740262_53740263delCA	uc002ivx.2	-	c.4770_4771delTG	c.(4768-4773)TCTGGGfs	p.S1590fs	BZRAP1_uc010dcs.1_Frame_Shift_Del_p.S1530fs	NM_004758	NP_004749	O95153	RIMB1_HUMAN	peripheral benzodiazepine receptor-associated	1590_1591						mitochondrion	benzodiazepine receptor binding				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)													0.71			10	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	53740262	53740263	1611	17	CA	-	-	21	21	BZRAP1	-	5	5
CCDC137	339230	broad.mit.edu	36	17	77245248	77245258	+	Frame_Shift_Del	DEL	CCGCCAAGAGA	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:77245248_77245258delCCGCCAAGAGA	uc002kbc.2	+	c.219_229delCCGCCAAGAGA	c.(217-231)AGCCGCCAAGAGATGfs	p.S73fs	C17orf90_uc002kba.1_5'Flank|C17orf90_uc002kbb.2_5'Flank|CCDC137_uc002kbd.2_Non-coding_Transcript	NM_199287	NP_954981	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137	73_77										central_nervous_system(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)											0.42			11	15				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	77245248	77245258	2891	17	CCGCCAAGAGA	-	-	26	26	CCDC137	-	5	5
REXO1	57455	broad.mit.edu	36	19	1767557	1767558	+	Frame_Shift_Ins	INS	-	C	C			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:1767557_1767558insC	uc002lua.2	-	c.3328_3329insG	c.(3328-3330)GTGfs	p.V1110fs		NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3	1110	Exonuclease.					nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	1767557	1767558	13711	19	-	C	C	6	6	REXO1	C	5	5
TMIGD2	126259	broad.mit.edu	36	19	4249177	4249178	+	Frame_Shift_Ins	INS	-	C	C			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:4249177_4249178insC	uc002lzx.1	-	c.211_212insG	c.(211-213)ATCfs	p.I71fs	TMIGD2_uc010dtv.1_Frame_Shift_Ins_p.I71fs	NM_144615	NP_653216	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain	71	Extracellular (Potential).|Ig-like.					integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)										0.56			43	34				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	4249177	4249178	16771	19	-	C	C	12	12	TMIGD2	C	5	5
ZNF793	390927	broad.mit.edu	36	19	42715098	42715111	+	Frame_Shift_Del	DEL	ATACCTGTGTCATT	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:42715098_42715111delATACCTGTGTCATT	uc010efm.1	+	c.16_29delATACCTGTGTCATT	c.(16-30)ATACCTGTGTCATTCfs	p.I6fs	ZNF793_uc010efn.1_Frame_Shift_Del_p.I6fs|ZNF793_uc010efo.1_Frame_Shift_Del_p.I6fs	NM_001013659	NP_001013681	Q6ZN11	ZN793_HUMAN	zinc finger protein 793	6_10	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			Melanoma(44;400 1431 1499 19093)								0.60			139	93				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	42715098	42715111	18763	19	ATACCTGTGTCATT	-	-	12	12	ZNF793	-	5	5
CYP2A13	1553	broad.mit.edu	36	19	46293590	46293601	+	In_Frame_Del	DEL	GTCCCCTCAGTC	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:46293590_46293601delGTCCCCTCAGTC	uc002opt.1	+	c.1389_1400delGTCCCCTCAGTC	c.(1387-1401)AAGTCCCCTCAGTCG>AAG	p.SPQS464del		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	464_467					oxidation-reduction process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)									0.35			219	411				---	---	---	---	capture_indel			In_Frame_Del	DEL	46293590	46293601	4326	19	GTCCCCTCAGTC	-	-	36	36	CYP2A13	-	5	5
ZNF71	58491	broad.mit.edu	36	19	61825039	61825042	+	Frame_Shift_Del	DEL	GCGG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:61825039_61825042delGCGG	uc002qnm.2	+	c.572_575delGCGG	c.(571-576)TGCGGCfs	p.C191fs	ZNF71_uc010eto.1_Frame_Shift_Del_p.C191fs	NM_021216	NP_067039	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	191_192	C2H2-type 3.				regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)										0.44			19	24				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	61825039	61825042	18710	19	GCGG	-	-	46	46	ZNF71	-	5	5
PINK1	65018	broad.mit.edu	36	1	20849568	20849580	+	Frame_Shift_Del	DEL	CATATTCTAGCCC	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:20849568_20849580delCATATTCTAGCCC	uc001bdm.1	+	c.1543_1555delCATATTCTAGCCC	c.(1543-1557)CATATTCTAGCCCTGfs	p.H515fs	PINK1_uc001bdn.1_Frame_Shift_Del_p.H208fs	NM_032409	NP_115785	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1 precursor	515_519	Cytoplasmic (Potential).				cell death|intracellular protein kinase cascade|mitochondrion degradation|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of release of cytochrome c from mitochondria|regulation of protein complex assembly|regulation of protein ubiquitination|response to stress	cytosol|integral to membrane|mitochondrial outer membrane	ATP binding|C3HC4-type RING finger domain binding|calcium-dependent protein kinase activity|magnesium ion binding|protein serine/threonine kinase activity|ubiquitin protein ligase binding			ovary(2)|central_nervous_system(1)	3		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		Esophageal Squamous(145;853 1803 8146 34412 35011)			p.A518A(EN-Tumor)	367				0.57			39	30				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	20849568	20849580	12356	1	CATATTCTAGCCC	-	-	17	17	PINK1	-	5	5
PDIK1L	149420	broad.mit.edu	36	1	26313577	26313587	+	Frame_Shift_Del	DEL	ATCCAAATGTG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:26313577_26313587delATCCAAATGTG	uc001blj.2	+	c.191_201delATCCAAATGTG	c.(190-201)CATCCAAATGTGfs	p.H64fs	PDIK1L_uc009vsb.1_Frame_Shift_Del_p.H64fs	NM_152835	NP_690048	Q8N165	PDK1L_HUMAN	PDLIM1 interacting kinase 1 like	64_67	Protein kinase.				protein phosphorylation	nucleus	ATP binding|protein serine/threonine kinase activity				0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00239)|all_lung(284;0.00366)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000735)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)						46				0.32			38	80				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	26313577	26313587	12094	1	ATCCAAATGTG	-	-	8	8	PDIK1L	-	5	5
PUM1	9698	broad.mit.edu	36	1	31238092	31238093	+	Frame_Shift_Ins	INS	-	G	G			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:31238092_31238093insG	uc001bsk.1	-	c.997_998insC	c.(997-999)CGTfs	p.R333fs	PUM1_uc001bsf.1_5'UTR|PUM1_uc001bsg.1_Frame_Shift_Ins_p.R109fs|PUM1_uc001bsh.1_Frame_Shift_Ins_p.R297fs|PUM1_uc001bsi.1_Frame_Shift_Ins_p.R297fs|PUM1_uc001bsj.1_Frame_Shift_Ins_p.R297fs	NM_001020658	NP_001018494	Q14671	PUM1_HUMAN	pumilio 1 isoform 1	297					cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)										0.50			123	125				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	31238092	31238093	13283	1	-	G	G	19	19	PUM1	G	5	5
C1orf210	149466	broad.mit.edu	36	1	43521208	43521213	+	In_Frame_Del	DEL	TCGGCG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:43521208_43521213delTCGGCG	uc001cit.2	-	c.172_177delCGCCGA	c.(172-177)CGCCGAdel	p.RR58del		NM_182517	NP_872323	Q8IVY1	CA210_HUMAN	hypothetical protein LOC149466	58_59	Cytoplasmic (Potential).					integral to membrane					0	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)												0.38			33	54				---	---	---	---	capture_indel			In_Frame_Del	DEL	43521208	43521213	2098	1	TCGGCG	-	-	50	50	C1orf210	-	5	5
C20orf3	57136	broad.mit.edu	36	20	24897680	24897681	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:24897680_24897681delAC	uc002wtz.1	-	c.888_889delGT	c.(886-891)CTGTTTfs	p.L296fs	C20orf3_uc002wty.1_Frame_Shift_Del_p.L296fs	NM_020531	NP_065392	Q9HDC9	APMAP_HUMAN	chromosome 20 open reading frame 3	296_297	Extracellular (Potential).				biosynthetic process	cell surface|integral to membrane	arylesterase activity|strictosidine synthase activity			ovary(1)	1														0.39			61	96				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	24897680	24897681	2189	20	AC	-	-	2	2	C20orf3	-	5	5
DNMT3B	1789	broad.mit.edu	36	20	30838083	30838096	+	Splice_Site_Del	DEL	CCGGCTACCAGGGT	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:30838083_30838096delCCGGCTACCAGGGT	uc002wyc.1	+	c.e5_splice_site			DNMT3B_uc002wyd.1_Splice_Site_Del|DNMT3B_uc002wye.1_Splice_Site_Del|DNMT3B_uc010gee.1_Splice_Site_Del|DNMT3B_uc010gef.1_Splice_Site_Del|DNMT3B_uc002wyf.1_Splice_Site_Del	NM_006892	NP_008823			DNA cytosine-5 methyltransferase 3 beta isoform						negative regulation of histone H3-K9 methylation|positive regulation of gene expression|positive regulation of histone H3-K4 methylation		protein binding|transcription corepressor activity|zinc ion binding			ovary(2)|lung(1)	3										1211				0.50			65	65				---	---	---	---	capture_indel			Splice_Site_Del	DEL	30838083	30838096	4860	20	CCGGCTACCAGGGT	-	-	22	22	DNMT3B	-	5	5
SREBF2	6721	broad.mit.edu	36	22	40620867	40620871	+	Frame_Shift_Del	DEL	AGACC	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:40620867_40620871delAGACC	uc003bbi.1	+	c.2475_2479delAGACC	c.(2473-2481)GGAGACCAGfs	p.G825fs	LOC339674_uc003bba.1_Intron|SREBF2_uc003bbj.1_Non-coding_Transcript	NM_004599	NP_004590	Q12772	SRBP2_HUMAN	sterol regulatory element-binding transcription	825_827	Cytoplasmic (Potential).				cholesterol metabolic process	ER to Golgi transport vesicle membrane|Golgi membrane|nucleus|SREBP-SCAP-Insig complex	protein C-terminus binding			breast(2)|ovary(1)|central_nervous_system(1)	4														0.40			56	84				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	40620867	40620871	15656	22	AGACC	-	-	11	11	SREBF2	-	5	5
CELSR1	9620	broad.mit.edu	36	22	45238805	45238820	+	Frame_Shift_Del	DEL	GGGACATGTTCTCCAG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:45238805_45238820delGGGACATGTTCTCCAG	uc003bhw.1	-	c.3631_3646delCTGGAGAACATGTCCC	c.(3631-3648)CTGGAGAACATGTCCCAGfs	p.L1211fs		NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	1211_1216	Extracellular (Potential).|Cadherin 9.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			pancreas(2)|skin(1)	3		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)										0.66			19	10				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	45238805	45238820	3354	22	GGGACATGTTCTCCAG	-	-	47	47	CELSR1	-	5	5
BRD1	23774	broad.mit.edu	36	22	48603126	48603131	+	In_Frame_Del	DEL	TGAAGG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:48603126_48603131delTGAAGG	uc003biu.2	-	c.839_844delCCTTCA	c.(838-846)GCCTTCAAA>GAA	p.280_282AFK>E	BRD1_uc010hah.1_Non-coding_Transcript|BRD1_uc003biv.1_In_Frame_Del_p.280_282AFK>E	NM_014577	NP_055392	O95696	BRD1_HUMAN	bromodomain containing protein 1	280_282					histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)										0.56			32	25				---	---	---	---	capture_indel			In_Frame_Del	DEL	48603126	48603131	1532	22	TGAAGG	-	-	63	63	BRD1	-	5	5
TGFBRAP1	9392	broad.mit.edu	36	2	105252350	105252364	+	In_Frame_Del	DEL	GTCCACGGCAGCCAC	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:105252350_105252364delGTCCACGGCAGCCAC	uc002tcq.1	-	c.2203_2217delGTGGCTGCCGTGGAC	c.(2203-2217)GTGGCTGCCGTGGACdel	p.VAAVD735del	TGFBRAP1_uc010fjc.1_In_Frame_Del_p.VAAVD504del|TGFBRAP1_uc002tcr.2_In_Frame_Del_p.VAAVD735del	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor	735_739					regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2						Esophageal Squamous(183;794 2019 9730 21801 48859)								0.33			31	63				---	---	---	---	capture_indel			In_Frame_Del	DEL	105252350	105252364	16352	2	GTCCACGGCAGCCAC	-	-	44	44	TGFBRAP1	-	5	5
RAB3GAP1	22930	broad.mit.edu	36	2	135642639	135642645	+	Frame_Shift_Del	DEL	GAAAGAA	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:135642639_135642645delGAAAGAA	uc010fnf.1	+	c.2785_2791delGAAAGAA	c.(2785-2793)GAAAGAAGGfs	p.E929fs	RAB3GAP1_uc002tuj.1_Frame_Shift_Del_p.E922fs|RAB3GAP1_uc010fng.1_Frame_Shift_Del_p.E747fs|RAB3GAP1_uc010fnh.1_Non-coding_Transcript	NM_012233	NP_036365	Q15042	RB3GP_HUMAN	RAB3 GTPase-activating protein	922_924						centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)										0.75			76	25				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	135642639	135642645	13394	2	GAAAGAA	-	-	41	41	RAB3GAP1	-	5	5
GPR155	151556	broad.mit.edu	36	2	175009347	175009356	+	Frame_Shift_Del	DEL	GGTCACAGCC	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:175009347_175009356delGGTCACAGCC	uc002uit.1	-	c.2347_2356delGGCTGTGACC	c.(2347-2358)GGCTGTGACCTGfs	p.G783fs	GPR155_uc002uiu.1_Frame_Shift_Del_p.G783fs|GPR155_uc002uiv.1_Frame_Shift_Del_p.G783fs|GPR155_uc010fqs.1_Frame_Shift_Del_p.G755fs	NM_001033045	NP_689742	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155 isoform 9	783_786	DEP.				intracellular signal transduction|transmembrane transport	integral to membrane				ovary(1)	1														0.48			179	194				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	175009347	175009356	6935	2	GGTCACAGCC	-	-	35	35	GPR155	-	5	5
SMEK2	57223	broad.mit.edu	36	2	55697836	55697837	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:55697836_55697837delAG	uc002rzc.1	-	c.89_90delCT	c.(88-90)ACTfs	p.T30fs	SMEK2_uc002rzb.1_Frame_Shift_Del_p.T30fs|SMEK2_uc002rzd.1_Frame_Shift_Del_p.T30fs|SMEK2_uc002rze.2_Non-coding_Transcript	NM_001122964	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 isoform 1	30	WH1.					microtubule organizing center|nucleus	protein binding				0			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)											0.60			74	49				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	55697836	55697837	15292	2	AG	-	-	3	3	SMEK2	-	5	5
NEK11	79858	broad.mit.edu	36	3	132231289	132231290	+	Frame_Shift_Ins	INS	-	T	T			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:132231289_132231290insT	uc003eny.1	+	c.47_48insT	c.(46-48)GCCfs	p.A16fs	NEK11_uc003enw.1_Frame_Shift_Ins_p.A16fs|NEK11_uc003enx.1_Frame_Shift_Ins_p.A16fs|NEK11_uc003enz.1_5'UTR|NEK11_uc010htn.1_Non-coding_Transcript|NEK11_uc003eoa.1_Frame_Shift_Ins_p.A16fs|ASTE1_uc010htm.1_5'Flank|ASTE1_uc003env.1_5'Flank	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1	16					cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade|protein phosphorylation	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|central_nervous_system(1)	5										271				0.38			99	164				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	132231289	132231290	10722	3	-	T	T	26	26	NEK11	T	5	5
EXOG	9941	broad.mit.edu	36	3	38520109	38520109	+	Splice_Site_Del	DEL	G	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:38520109_38520109delG	uc003cih.1	+	c.e4_splice_site			EXOG_uc010hhd.1_Splice_Site_Del|EXOG_uc003cij.1_Splice_Site_Del|EXOG_uc003cik.1_Splice_Site_Del|EXOG_uc003cii.1_Splice_Site_Del|EXOG_uc010hhe.1_Splice_Site_Del|EXOG_uc010hhf.1_Splice_Site_Del|EXOG_uc010hhg.1_Splice_Site_Del	NM_005107	NP_005098			endo/exonuclease (5'-3'), endonuclease G-like							mitochondrial inner membrane	endonuclease activity|metal ion binding|nucleic acid binding				0														0.30			7	16				---	---	---	---	capture_indel			Splice_Site_Del	DEL	38520109	38520109	5505	3	G	-	-	33	33	EXOG	-	5	5
ZNF35	7584	broad.mit.edu	36	3	44667684	44667691	+	Frame_Shift_Del	DEL	GAGAACAT	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:44667684_44667691delGAGAACAT	uc003cnq.1	+	c.121_128delGAGAACAT	c.(121-129)GAGAACATCfs	p.E41fs	ZNF35_uc003cnr.1_5'UTR	NM_003420	NP_003411	P13682	ZNF35_HUMAN	zinc finger protein 35	41_43	Globular domain.				cellular response to retinoic acid|regulation of transcription, DNA-dependent|spermatogenesis	nucleus|perinuclear region of cytoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(412;0.0228)		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)										0.48			118	126				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	44667684	44667691	18454	3	GAGAACAT	-	-	37	37	ZNF35	-	5	5
SFMBT1	51460	broad.mit.edu	36	3	52937392	52937394	+	In_Frame_Del	DEL	AAA	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:52937392_52937394delAAA	uc003dgf.1	-	c.901_903delTTT	c.(901-903)TTTdel	p.F301del	SFMBT1_uc003dgg.1_In_Frame_Del_p.F301del|SFMBT1_uc003dgh.1_In_Frame_Del_p.F301del|SFMBT1_uc010hmr.1_In_Frame_Del_p.F248del	NM_001005159	NP_057413	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	301	MBT 3.					nucleus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)										0.30			28	64				---	---	---	---	capture_indel			In_Frame_Del	DEL	52937392	52937394	14646	3	AAA	-	-	5	5	SFMBT1	-	5	5
ACTR8	93973	broad.mit.edu	36	3	53879188	53879188	+	Frame_Shift_Del	DEL	A	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:53879188_53879188delA	uc003dhd.1	-	c.1592_1592delT	c.(1591-1593)ATGfs	p.M531fs	ACTR8_uc003dhb.1_Frame_Shift_Del_p.M236fs|ACTR8_uc003dhc.1_Frame_Shift_Del_p.M420fs	NM_022899	NP_075050	Q9H981	ARP8_HUMAN	actin-related protein 8	531					cell division|mitosis	chromosome|nucleus				ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)										0.37			109	187				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	53879188	53879188	218	3	A	-	-	8	8	ACTR8	-	5	5
LEF1	51176	broad.mit.edu	36	4	109222272	109222274	+	In_Frame_Del	DEL	TGC	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:109222272_109222274delTGC	uc003hyt.1	-	c.639_641delGCA	c.(637-642)TGGCAA>TGA	p.213_214WQ>*	LEF1_uc003hyu.1_Intron|LEF1_uc003hyv.1_Intron|LEF1_uc010imb.1_Non-coding_Transcript|LEF1_uc003hyw.1_5'Flank	NM_016269	NP_057353	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1 isoform 1	213_214	Pro-rich.				canonical Wnt receptor signaling pathway|cell chemotaxis|cellular response to interleukin-4|epithelial to mesenchymal transition|histone H3 acetylation|histone H4 acetylation|negative regulation of apoptosis in bone marrow|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of caspase activity|negative regulation of cell-cell adhesion|negative regulation of DNA binding|negative regulation of estrogen receptor binding|negative regulation of gene-specific transcription|negative regulation of interleukin-13 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of transcription, DNA-dependent|neutrophil differentiation|osteoblast differentiation|palate development|positive regulation by host of viral transcription|positive regulation of cell cycle process|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cell proliferation in bone marrow|positive regulation of cell-cell adhesion|positive regulation of epithelial to mesenchymal transition|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|T-helper 1 cell differentiation	cytoplasm|protein-DNA complex|transcription factor complex	armadillo repeat domain binding|beta-catenin binding|C2H2 zinc finger domain binding|caspase inhibitor activity|DNA bending activity|enhancer binding|estrogen receptor activity|estrogen receptor binding|gamma-catenin binding|histone binding|promoter binding|transcription activator activity|transcription repressor activity			large_intestine(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000224)										0.83			506	100				---	---	---	---	capture_indel			In_Frame_Del	DEL	109222272	109222274	9038	4	TGC	-	-	63	63	LEF1	-	5	5
PIGG	54872	broad.mit.edu	36	4	504949	504952	+	Frame_Shift_Del	DEL	AAGG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:504949_504952delAAGG	uc003gak.2	+	c.1219_1222delAAGG	c.(1219-1224)AAGGTTfs	p.K407fs	PIGG_uc003gai.2_Non-coding_Transcript|PIGG_uc003gaj.2_Frame_Shift_Del_p.K407fs|PIGG_uc010ibf.1_Frame_Shift_Del_p.K274fs|PIGG_uc003gal.2_Frame_Shift_Del_p.K318fs|PIGG_uc003gam.2_Intron|PIGG_uc003gan.2_Frame_Shift_Del_p.K318fs	NM_001127178	NP_001120650	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	407_408	Lumenal (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity			ovary(1)|central_nervous_system(1)	2														0.44			79	102				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	504949	504952	12312	4	AAGG	-	-	5	5	PIGG	-	5	5
CDHR2	54825	broad.mit.edu	36	5	175949181	175949188	+	Frame_Shift_Del	DEL	CACCGAAG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:175949181_175949188delCACCGAAG	uc003mem.1	+	c.3164_3171delCACCGAAG	c.(3163-3171)ACACCGAAGfs	p.T1055fs	CDHR2_uc003men.1_Frame_Shift_Del_p.T1055fs	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor	1055_1057	Extracellular (Potential).|Cadherin 9.				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2														0.72			89	34				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	175949181	175949188	3248	5	CACCGAAG	-	-	17	17	CDHR2	-	5	5
GRM6	2916	broad.mit.edu	36	5	178351684	178351701	+	Splice_Site_Del	DEL	GGGGTATCTGTGGGGCAG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:178351684_178351701delGGGGTATCTGTGGGGCAG	uc003mjr.1	-	c.e2_splice_site			GRM6_uc010jla.1_5'Flank|GRM6_uc003mjs.1_5'Flank	NM_000843	NP_000834			glutamate receptor, metabotropic 6 precursor						detection of visible light|visual perception	integral to plasma membrane				ovary(2)|breast(1)|pancreas(1)	4	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)										0.62			10	6				---	---	---	---	capture_indel			Splice_Site_Del	DEL	178351684	178351701	7080	5	GGGGTATCTGTGGGGCAG	-	-	47	47	GRM6	-	5	5
OCLN	4950	broad.mit.edu	36	5	68841143	68841148	+	In_Frame_Del	DEL	TTACCA	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:68841143_68841148delTTACCA	uc003jwu.1	+	c.470_475delTTACCA	c.(469-477)GTTACCAGT>GGT	p.157_159VTS>G	OCLN_uc003jwv.2_In_Frame_Del_p.157_159VTS>G	NM_002538	NP_002529			occludin												0		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)										0.62			111	68				---	---	---	---	capture_indel			In_Frame_Del	DEL	68841143	68841148	11225	5	TTACCA	-	-	60	60	OCLN	-	5	5
ENC1	8507	broad.mit.edu	36	5	73967657	73967658	+	Frame_Shift_Ins	INS	-	GC	GC			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:73967657_73967658insGC	uc003kdc.2	-	c.409_410insGC	c.(409-411)GCAfs	p.A137fs	ENC1_uc010izg.1_Frame_Shift_Ins_p.A137fs	NM_003633	NP_003624	O14682	ENC1_HUMAN	ectodermal-neural cortex (with BTB-like domain)	137					nervous system development	cytoplasm|cytoskeleton|nuclear matrix	actin binding			ovary(1)|pancreas(1)|skin(1)	3		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.45e-59)										0.77			223	68				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	73967657	73967658	5306	5	-	GC	GC	46	46	ENC1	GC	5	5
GCNT4	51301	broad.mit.edu	36	5	74360666	74360667	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:74360666_74360667delTT	uc003kdn.1	-	c.952_953delAA	c.(952-954)AACfs	p.N318fs		NM_016591	NP_057675	Q9P109	GCNT4_HUMAN	core 2 beta-1,6-N-acetylglucosaminyltransferase	318	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)										0.33			25	51				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	74360666	74360667	6569	5	TT	-	-	60	60	GCNT4	-	5	5
KDM1B	221656	broad.mit.edu	36	6	18279677	18279680	+	Frame_Shift_Del	DEL	TACT	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:18279677_18279680delTACT	uc003ncn.1	+	c.522_525delTACT	c.(520-525)AATACTfs	p.N174fs		NM_153042	NP_694587	Q8NB78	KDM1B_HUMAN	amine oxidase (flavin containing) domain 1	174_175	CW-type.				multicellular organismal development|oxidation-reduction process|regulation of DNA methylation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-monomethyl-K4 specific)|oxidoreductase activity|zinc ion binding				0														0.45			27	33				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	18279677	18279680	8429	6	TACT	-	-	49	49	KDM1B	-	5	5
KCNK5	8645	broad.mit.edu	36	6	39269947	39269948	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:39269947_39269948delTG	uc003oon.1	-	c.609_610delCA	c.(607-612)ACCATCfs	p.T203fs		NM_003740	NP_003731	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	203_204					excretion	integral to plasma membrane	potassium channel activity|voltage-gated ion channel activity			central_nervous_system(1)	1														0.57			34	26				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	39269947	39269948	8374	6	TG	-	-	51	51	KCNK5	-	5	5
ICK	22858	broad.mit.edu	36	6	52986627	52986635	+	In_Frame_Del	DEL	GGAGGTGGG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:52986627_52986635delGGAGGTGGG	uc003pbh.2	-	c.936_944delCCCACCTCC	c.(934-945)GGCCCACCTCCT>GGT	p.PPP313del	ICK_uc003pbi.2_In_Frame_Del_p.PPP313del	NM_016513	NP_057597	Q9UPZ9	ICK_HUMAN	intestinal cell kinase	313_315					intracellular protein kinase cascade|multicellular organismal development|protein phosphorylation	cytosol|nucleus	ATP binding|cyclin-dependent protein kinase activity|magnesium ion binding			ovary(1)|large_intestine(1)|lung(1)|kidney(1)|central_nervous_system(1)	5	Lung NSC(77;0.103)								p.G312G(SNU1079-Tumor)	283				0.35			13	24				---	---	---	---	capture_indel			In_Frame_Del	DEL	52986627	52986635	7784	6	GGAGGTGGG	-	-	35	35	ICK	-	5	5
C6orf168	84553	broad.mit.edu	36	6	99835831	99835852	+	Frame_Shift_Del	DEL	AAATCTGTGTCTGGGGTTCTGG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:99835831_99835852delAAATCTGTGTCTGGGGTTCTGG	uc003ppj.2	-	c.1139_1160delCCAGAACCCCAGACACAGATTT	c.(1138-1161)TCCAGAACCCCAGACACAGATTTTfs	p.S380fs	C6orf168_uc003ppi.2_Frame_Shift_Del_p.S100fs	NM_032511	NP_115900	Q5TGI0	CF168_HUMAN	hypothetical protein LOC84553	380_387										ovary(2)|central_nervous_system(1)	3		all_cancers(76;1.63e-06)|Acute lymphoblastic leukemia(125;5.12e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00898)|Colorectal(196;0.0699)|Lung NSC(302;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.073)										0.40			39	58				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	99835831	99835852	2448	6	AAATCTGTGTCTGGGGTTCTGG	-	-	1	1	C6orf168	-	5	5
CUX1	1523	broad.mit.edu	36	7	101627164	101627172	+	In_Frame_Del	DEL	TCCGTGAGC	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:101627164_101627172delTCCGTGAGC	uc003uys.2	+	c.1786_1794delTCCGTGAGC	c.(1786-1794)TCCGTGAGCdel	p.SVS596del	CUX1_uc003uyt.1_Intron|CUX1_uc003uyv.1_Intron|CUX1_uc003uyw.1_Intron|CUX1_uc003uyu.1_Intron|CUX1_uc003uyx.2_In_Frame_Del_p.SVS585del	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	585_587	CUT 1.				negative regulation of transcription from RNA polymerase II promoter	nucleus	RNA polymerase II transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|central_nervous_system(1)|pancreas(1)	7														0.64			62	35				---	---	---	---	capture_indel			In_Frame_Del	DEL	101627164	101627172	4224	7	TCCGTGAGC	-	-	58	58	CUX1	-	5	5
LAMB1	3912	broad.mit.edu	36	7	107429469	107429470	+	Frame_Shift_Ins	INS	-	A	A			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:107429469_107429470insA	uc003vev.2	-	c.54_55insT	c.(52-57)TTTCGGfs	p.F18fs	LAMB1_uc003vew.2_Intron|LAMB1_uc003vex.2_Intron|LAMB1_uc010ljn.1_Intron	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	Error:Variant_position_missing_in_P07942_after_alignment					axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)	4					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)									0.43			3	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	107429469	107429470	8933	7	-	A	A	37	37	LAMB1	A	5	5
MLL3	58508	broad.mit.edu	36	7	151504305	151504316	+	In_Frame_Del	DEL	GTAGAAGTAGAG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:151504305_151504316delGTAGAAGTAGAG	uc003wla.1	-	c.9155_9166delCTCTACTTCTAC	c.(9154-9168)CCTCTACTTCTACAG>CAG	p.PLLL3052del	MLL3_uc003wkz.1_In_Frame_Del_p.PLLL2113del|MLL3_uc003wky.2_In_Frame_Del_p.PLLL561del	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	3052_3055	Potential.|Gln-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			pancreas(12)|ovary(7)|large_intestine(6)|central_nervous_system(4)|urinary_tract(1)|skin(1)	31	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		Colon(68;14 1149 1884 27689 34759)			p.Q2117E(HCC56-Tumor)|p.P2113H(HEC1A-Tumor)	1780				0.57			102	78				---	---	---	---	capture_indel			In_Frame_Del	DEL	151504305	151504316	10012	7	GTAGAAGTAGAG	-	-	48	48	MLL3	-	5	5
NOM1	64434	broad.mit.edu	36	7	156455016	156455024	+	In_Frame_Del	DEL	GTGAGGGTT	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:156455016_156455024delGTGAGGGTT	uc003wmy.1	+	c.2441_2449delGTGAGGGTT	c.(2440-2451)CGTGAGGGTTTG>CTG	p.REG814del		NM_138400	NP_612409	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	814_816					RNA metabolic process	nucleolus	protein binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)										0.87			775	112				---	---	---	---	capture_indel			In_Frame_Del	DEL	156455016	156455024	10933	7	GTGAGGGTT	-	-	40	40	NOM1	-	5	5
ITGB8	3696	broad.mit.edu	36	7	20386901	20386907	+	Frame_Shift_Del	DEL	TCATAGA	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:20386901_20386907delTCATAGA	uc003suu.1	+	c.723_729delTCATAGA	c.(721-729)GTTCATAGAfs	p.V241fs	ITGB8_uc003sut.2_Frame_Shift_Del_p.V241fs	NM_002214	NP_002205	P26012	ITB8_HUMAN	integrin, beta 8 precursor	241_243	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(2)	2										842				0.56			119	92				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	20386901	20386907	8205	7	TCATAGA	-	-	62	62	ITGB8	-	5	5
OR2AE1	81392	broad.mit.edu	36	7	99312268	99312292	+	Frame_Shift_Del	DEL	CACCTAGACACAAATAGAGGAAGTG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:99312268_99312292delCACCTAGACACAAATAGAGGAAGTG	uc003usc.1	-	c.301_325delCACTTCCTCTATTTGTGTCTAGGTG	c.(301-327)CACTTCCTCTATTTGTGTCTAGGTGGTfs	p.H101fs		NM_001005276	NP_001005276	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE,	101_109	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)													0.78			658	186				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	99312268	99312292	11389	7	CACCTAGACACAAATAGAGGAAGTG	-	-	21	21	OR2AE1	-	5	5
HSPA5	3309	broad.mit.edu	36	9	127038919	127038919	+	Frame_Shift_Del	DEL	C	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:127038919_127038919delC	uc004bpn.1	-	c.1738_1738delG	c.(1738-1740)GAAfs	p.E580fs		NM_005347	NP_005338	P11021	GRP78_HUMAN	heat shock 70kDa protein 5	580					anti-apoptosis|cellular response to glucose starvation|ER-associated protein catabolic process|negative regulation of caspase activity|platelet activation|platelet degranulation|regulation of protein folding in endoplasmic reticulum	cell surface|endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|integral to endoplasmic reticulum membrane|melanosome|midbody|nucleus|perinuclear region of cytoplasm	ATP binding|ATPase activity|calcium ion binding|caspase inhibitor activity|chaperone binding|misfolded protein binding|protein binding, bridging|protein domain specific binding|ubiquitin protein ligase binding|unfolded protein binding			ovary(3)	3					Antihemophilic Factor(DB00025)						Prostate(1;0.17)			0.54			13	11				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	127038919	127038919	7713	9	C	-	-	32	32	HSPA5	-	5	5
SLC27A4	10999	broad.mit.edu	36	9	130147623	130147628	+	In_Frame_Del	DEL	TTGTCT	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:130147623_130147628delTTGTCT	uc004but.1	+	c.530_535delTTGTCT	c.(529-537)CTTGTCTTT>CTT	p.VF178del	SLC27A4_uc004buu.1_Intron	NM_005094	NP_005085	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid	178_179					long-chain fatty acid transport|transmembrane transport	integral to membrane	fatty acid transporter activity|nucleotide binding|protein binding				0						Pancreas(107;1554 2241 10946 12953)								0.46			6	7				---	---	---	---	capture_indel			In_Frame_Del	DEL	130147623	130147628	15025	9	TTGTCT	-	-	56	56	SLC27A4	-	5	5
NUP214	8021	broad.mit.edu	36	9	133088119	133088127	+	In_Frame_Del	DEL	TTCCTCTCC	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:133088119_133088127delTTCCTCTCC	uc004cag.1	+	c.5883_5891delTTCCTCTCC	c.(5881-5892)TTTTCCTCTCCA>TTA	p.1961_1964FSSP>L	NUP214_uc004cah.1_In_Frame_Del_p.1951_1954FSSP>L|NUP214_uc004cai.1_In_Frame_Del_p.1391_1394FSSP>L|NUP214_uc010mzg.1_Non-coding_Transcript	NM_005085	NP_005076	P35658	NU214_HUMAN	nucleoporin 214kDa	1961_1964	Pro/Ser/Thr-rich.|11 X 3 AA approximate repeats.|11 X 5 AA approximate repeats.|18 X 4 AA approximate repeats.				carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding			breast(3)|ovary(2)|lung(1)|central_nervous_system(1)	7	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		Pancreas(4;24 48 25510 30394 32571)				1058				0.39			46	71				---	---	---	---	capture_indel			In_Frame_Del	DEL	133088119	133088127	11167	9	TTCCTCTCC	-	-	64	64	NUP214	-	5	5
UNC13B	10497	broad.mit.edu	36	9	35368342	35368348	+	Frame_Shift_Del	DEL	CCTTACG	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:35368342_35368348delCCTTACG	uc003zwr.1	+	c.1867_1873delCCTTACG	c.(1867-1875)CCTTACGTGfs	p.P623fs	UNC13B_uc003zwq.1_Frame_Shift_Del_p.P623fs	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	623_625	C2 2.				excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)	4	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)											0.32			31	67				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	35368342	35368348	17543	9	CCTTACG	-	-	22	22	UNC13B	-	5	5
UNC13B	10497	broad.mit.edu	36	9	35393533	35393533	+	Frame_Shift_Del	DEL	G	-	-			TCGA-28-1760-01	TCGA-28-1760-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:35393533_35393533delG	uc003zwr.1	+	c.4484_4484delG	c.(4483-4485)AGGfs	p.R1495fs	UNC13B_uc003zwq.1_Frame_Shift_Del_p.R1476fs	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	1476	C2 3.				excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)	4	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)											0.73			480	179				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	35393533	35393533	17543	9	G	-	-	35	35	UNC13B	-	5	5
