Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
TECTA	7007	broad.mit.edu	36	11	120489056	120489056	+	Silent	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:120489056C>T	uc001pxr.1	+	c.552C>T	c.(550-552)TAC>TAT	p.Y184Y		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	184	NIDO.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)	8	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)										OREG0021430	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.439716	178.752773	179.194187	62	79	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)	Silent	SNP	120489056	120489056	16274	11	C	T	T	19	19	TECTA	T	1	1
OR4D5	219875	broad.mit.edu	36	11	123316320	123316320	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:123316320C>T	uc001pzk.1	+	c.787C>T	c.(787-789)CGG>TGG	p.R263W		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	263	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)												0.382716	354.728431	358.634179	124	200	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)	Missense_Mutation	SNP	123316320	123316320	11464	11	C	T	T	31	31	OR4D5	T	1	1
COPB1	1315	broad.mit.edu	36	11	14447651	14447651	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:14447651G>T	uc001mlg.1	-	c.1772C>A	c.(1771-1773)ACT>AAT	p.T591N	COPB1_uc001mlh.1_Missense_Mutation_p.T591N|COPB1_uc001mli.1_Missense_Mutation_p.T591N	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	591					COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2														0.177419	7.510942	13.779644	11	51	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14447651	14447651	3866	11	G	T	T	36	36	COPB1	T	3	3
ODF3	113746	broad.mit.edu	36	11	187577	187577	+	Silent	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:187577G>A	uc001lob.1	+	c.126G>A	c.(124-126)ACG>ACA	p.T42T	ODF3_uc001loc.2_Silent_p.T42T	NM_053280	NP_444510	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3	42					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm		p.T42T(1)		ovary(1)	1		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)												0.313253	64.676915	67.223306	26	57	GG		KEEP	---	---	---	---	capture		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)	Silent	SNP	187577	187577	11234	11	G	A	A	38	38	ODF3	A	1	1
OR4C12	283093	broad.mit.edu	36	11	49959842	49959842	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:49959842G>A	uc001nhc.1	-	c.772C>T	c.(772-774)CGC>TGC	p.R258C		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	258	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2														0.386555	131.427832	132.767934	46	73	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49959842	49959842	11452	11	G	A	A	38	38	OR4C12	A	1	1
OR5D16	390144	broad.mit.edu	36	11	55363289	55363289	+	Silent	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55363289G>A	uc001nhz.1	+	c.486G>A	c.(484-486)GCG>GCA	p.A162A		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	162	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3		all_epithelial(135;0.208)												0.360406	194.063134	197.445439	71	126	GG		KEEP	---	---	---	---	capture			Silent	SNP	55363289	55363289	11566	11	G	A	A	40	40	OR5D16	A	1	1
OR8H3	390152	broad.mit.edu	36	11	55646787	55646787	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5208-01	TCGA-28-5208-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55646787T>G	uc001nii.1	+	c.363T>G	c.(361-363)GAT>GAG	p.D121E		NM_001005201	NP_001005201	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H,	121	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00693)													0.411658	788.079159	791.814309	226	323	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55646787	55646787	11650	11	T	G	G	50	50	OR8H3	G	4	4
TCN1	6947	broad.mit.edu	36	11	59386709	59386709	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:59386709C>T	uc001noj.2	-	c.322G>A	c.(322-324)GCT>ACT	p.A108T		NM_001062	NP_001053	P20061	TCO1_HUMAN	transcobalamin I precursor	108					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding			ovary(1)	1		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)									0.376471	271.334795	274.750847	96	159	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	59386709	59386709	16232	11	C	T	T	27	27	TCN1	T	1	1
AHNAK	79026	broad.mit.edu	36	11	62040884	62040884	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:62040884G>A	uc001ntl.1	-	c.17581C>T	c.(17581-17583)CGA>TGA	p.R5861*	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	5861					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)	14		Melanoma(852;0.155)												0.39196	471.209993	475.278366	156	242	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	62040884	62040884	417	11	G	A	A	39	39	AHNAK	A	5	1
APBB1	322	broad.mit.edu	36	11	6380399	6380399	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5208-01	TCGA-28-5208-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:6380399A>G	uc001mdb.1	-	c.1237T>C	c.(1237-1239)TCT>CCT	p.S413P	APBB1_uc001mcz.1_Missense_Mutation_p.S34P|APBB1_uc001mda.2_Intron|APBB1_uc001mdc.1_Missense_Mutation_p.S413P|APBB1_uc009yey.1_Missense_Mutation_p.S154P|APBB1_uc009yez.1_Missense_Mutation_p.S193P|APBB1_uc009yfa.1_Missense_Mutation_p.S154P|APBB1_uc001mdd.2_Missense_Mutation_p.S193P|APBB1_uc009yfb.1_Missense_Mutation_p.S154P|APBB1_uc001mde.2_Missense_Mutation_p.S154P	NM_001164	NP_001155	O00213	APBB1_HUMAN	amyloid beta A4 precursor protein-binding,	413	PID 1.				apoptosis|axonogenesis|cell cycle arrest|histone H4 acetylation|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of thymidylate synthase biosynthetic process|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|signal transduction|transcription, DNA-dependent	cytoplasm|growth cone|lamellipodium|nucleus|plasma membrane|synapse	beta-amyloid binding|chromatin binding|histone binding|proline-rich region binding|transcription activator activity|transcription factor binding			breast(2)	2		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)				GBM(147;1810 2556 5672 39622)								0.44878	296.365127	296.845936	92	113	AA		KEEP	---	---	---	---	capture		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)	Missense_Mutation	SNP	6380399	6380399	769	11	A	G	G	10	10	APBB1	G	4	4
NOS1	4842	broad.mit.edu	36	12	116208327	116208327	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:116208327G>A	uc001twm.1	-	c.1255C>T	c.(1255-1257)CGC>TGC	p.R419C		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1 (neuronal)	419					arginine catabolic process|multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|oxidation-reduction process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(2)|pancreas(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)				L-Citrulline(DB00155)	Esophageal Squamous(162;1748 2599 51982 52956)								0.369231	198.284096	201.200227	72	123	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(302;0.0561)	Missense_Mutation	SNP	116208327	116208327	10944	12	G	A	A	38	38	NOS1	A	1	1
KDM2B	84678	broad.mit.edu	36	12	120375343	120375343	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:120375343C>T	uc001uat.1	-	c.1922G>A	c.(1921-1923)CGC>CAC	p.R641H	KDM2B_uc001uas.1_Missense_Mutation_p.R610H|KDM2B_uc009zxe.1_Missense_Mutation_p.R610H|KDM2B_uc001uau.1_Missense_Mutation_p.R524H|KDM2B_uc009zxf.1_Missense_Mutation_p.R641H|KDM2B_uc001uaq.1_Missense_Mutation_p.R81H|KDM2B_uc001uar.1_Missense_Mutation_p.R232H	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform	641	CXXC-type.				oxidation-reduction process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)	1														0.243902	20.736796	23.184809	10	31	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	120375343	120375343	8431	12	C	T	T	27	27	KDM2B	T	1	1
ATN1	1822	broad.mit.edu	36	12	6918020	6918020	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:6918020C>T	uc001qrw.1	+	c.2633C>T	c.(2632-2634)CCT>CTT	p.P878L	ATN1_uc001qrx.1_Missense_Mutation_p.P878L	NM_001007026	NP_001931	P54259	ATN1_HUMAN	atrophin-1	878					cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding			ovary(2)|breast(2)|pancreas(1)	5												OREG0021641	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.441026	262.72187	263.313063	86	109	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6918020	6918020	1130	12	C	T	T	24	24	ATN1	T	2	2
TSHR	7253	broad.mit.edu	36	14	80679778	80679778	+	Silent	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:80679778C>T	uc001xvd.1	+	c.1623C>T	c.(1621-1623)ATC>ATT	p.I541I		NM_000369	NP_000360	P16473	TSHR_HUMAN	thyroid stimulating hormone receptor isoform 1	541	Helical; Name=4; (Potential).				cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)	298					Thyrotropin Alfa(DB00024)					868				0.418269	255.080687	256.29545	87	121	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(234;0.0402)	Silent	SNP	80679778	80679778	17173	14	C	T	T	29	29	TSHR	T	2	2
ASB2	51676	broad.mit.edu	36	14	93473910	93473910	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:93473910G>A	uc001ycd.1	-	c.1562C>T	c.(1561-1563)GCG>GTG	p.A521V	ASB2_uc001ycb.1_Missense_Mutation_p.A199V|ASB2_uc001ycc.1_Missense_Mutation_p.A505V|ASB2_uc001yce.1_Missense_Mutation_p.A451V	NM_016150	NP_057234	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box-containing protein	505					intracellular signal transduction					pancreas(1)	1		all_cancers(154;0.13)												0.425926	60.744031	60.99505	23	31	GG		KEEP	---	---	---	---	capture		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)	Missense_Mutation	SNP	93473910	93473910	1041	14	G	A	A	38	38	ASB2	A	1	1
MGA	23269	broad.mit.edu	36	15	39845576	39845576	+	Silent	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:39845576C>T	uc001zoh.1	+	c.8151C>T	c.(8149-8151)GGC>GGT	p.G2717G		NM_001080541	NP_001074010	Q8IWI9	MGAP_HUMAN	MAX gene associated	2629					regulation of transcription, DNA-dependent	MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|skin(1)	11		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)								606				0.373494	158.982592	161.324242	62	104	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Silent	SNP	39845576	39845576	9930	15	C	T	T	25	25	MGA	T	2	2
EIF3J	8669	broad.mit.edu	36	15	42637132	42637132	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:42637132G>A	uc001ztv.1	+	c.563G>A	c.(562-564)TGT>TAT	p.C188Y	EIF3J_uc001ztw.1_Missense_Mutation_p.C139Y	NM_003758	NP_003749	O75822	EIF3J_HUMAN	eukaryotic translation initiation factor 3,	188						cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity				0		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)												0.405941	229.101377	230.665588	82	120	GG		KEEP	---	---	---	---	capture		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)	Missense_Mutation	SNP	42637132	42637132	5211	15	G	A	A	48	48	EIF3J	A	2	2
GRIN2A	2903	broad.mit.edu	36	16	9851217	9851217	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:9851217C>T	uc002czp.1	-	c.1225G>A	c.(1225-1227)GTC>ATC	p.V409I	GRIN2A_uc002czq.1_Missense_Mutation_p.V409I|GRIN2A_uc002czr.2_Missense_Mutation_p.V409I	NM_000833	NP_000824	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	409	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)					324				0.377682	245.039158	248.099378	88	145	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9851217	9851217	7058	16	C	T	T	19	19	GRIN2A	T	1	1
NF1	4763	broad.mit.edu	36	17	26557504	26557504	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:26557504C>T	uc002hgg.1	+	c.1381C>T	c.(1381-1383)CGA>TGA	p.R461*	NF1_uc002hge.1_Nonsense_Mutation_p.R461*|NF1_uc002hgf.1_Nonsense_Mutation_p.R461*|NF1_uc002hgh.1_Nonsense_Mutation_p.R461*|NF1_uc010csn.1_Nonsense_Mutation_p.R321*	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	461					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(4)|p.R461*(2)		soft_tissue(155)|central_nervous_system(56)|large_intestine(27)|lung(19)|haematopoietic_and_lymphoid_tissue(13)|ovary(12)|autonomic_ganglia(7)|skin(3)|stomach(2)|breast(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	300		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)							p.R461*(SNU1040-Tumor)|p.R461*(KPNYN-Tumor)	847	TCGA GBM(6;<1E-8)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.392157	290.544489	293.140908	100	155	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	Nonsense_Mutation	SNP	26557504	26557504	10756	17	C	T	T	19	19	NF1	T	5	1
NF1	4763	broad.mit.edu	36	17	26576258	26576258	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:26576258G>T	uc002hgg.1	+	c.1865G>T	c.(1864-1866)TGT>TTT	p.C622F	NF1_uc002hgh.1_Missense_Mutation_p.C622F|NF1_uc002hgi.1_5'UTR|NF1_uc010csn.1_Missense_Mutation_p.C482F	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	622					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(3)		soft_tissue(155)|central_nervous_system(56)|large_intestine(27)|lung(19)|haematopoietic_and_lymphoid_tissue(13)|ovary(12)|autonomic_ganglia(7)|skin(3)|stomach(2)|breast(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	300		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)								847	TCGA GBM(6;<1E-8)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.407303	444.29851	446.974341	145	211	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	Missense_Mutation	SNP	26576258	26576258	10756	17	G	T	T	48	48	NF1	T	3	3
TMEM132E	124842	broad.mit.edu	36	17	29980217	29980217	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:29980217C>T	uc002hif.1	+	c.949C>T	c.(949-951)CGG>TGG	p.R317W		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	317	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1														0.439815	272.292572	272.97412	95	121	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(366;0.231)	Missense_Mutation	SNP	29980217	29980217	16580	17	C	T	T	27	27	TMEM132E	T	1	1
C17orf46	124783	broad.mit.edu	36	17	40689050	40689050	+	Silent	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:40689050G>A	uc002iis.1	-	c.282C>T	c.(280-282)AAC>AAT	p.N94N	LOC100133991_uc010dah.1_Intron	NM_152343	NP_689556	Q96LK8	CQ046_HUMAN	hypothetical protein LOC124783	94										large_intestine(1)|ovary(1)	2														0.415335	373.499445	375.456121	130	183	GG		KEEP	---	---	---	---	capture			Silent	SNP	40689050	40689050	1913	17	G	A	A	40	40	C17orf46	A	1	1
LRRC37A3	374819	broad.mit.edu	36	17	60323745	60323745	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:60323745C>G	uc002jey.1	-	c.93G>C	c.(91-93)TGG>TGC	p.W31C		NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	31						integral to membrane					0														0.181395	81.735955	102.223223	39	176	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60323745	60323745	9368	17	C	G	G	26	26	LRRC37A3	G	3	3
ZNF532	55205	broad.mit.edu	36	18	54738237	54738237	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:54738237G>A	uc002lho.1	+	c.1738G>A	c.(1738-1740)GTG>ATG	p.V580M	ZNF532_uc002lhp.1_Missense_Mutation_p.V578M|ZNF532_uc002lhq.1_Missense_Mutation_p.V580M|ZNF532_uc002lhr.1_Missense_Mutation_p.V578M|ZNF532_uc002lhs.1_Missense_Mutation_p.V578M	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	580					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1														0.426471	80.766369	81.086161	29	39	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54738237	54738237	18566	18	G	A	A	48	48	ZNF532	A	2	2
ZNF236	7776	broad.mit.edu	36	18	72809210	72809210	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:72809210G>T	uc002lmi.1	+	c.5465G>T	c.(5464-5466)AGC>ATC	p.S1822I	ZNF236_uc002lmj.1_Non-coding_Transcript	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1822					cellular response to glucose stimulus|regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)												0.405983	265.755071	267.568218	95	139	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)	Missense_Mutation	SNP	72809210	72809210	18380	18	G	T	T	34	34	ZNF236	T	3	3
DAZAP1	26528	broad.mit.edu	36	19	1385835	1385835	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:1385835G>C	uc002lsn.1	+	c.1148G>C	c.(1147-1149)GGC>GCC	p.G383A	DAZAP1_uc002lsl.1_Missense_Mutation_p.G382A|DAZAP1_uc002lsm.1_3'UTR|DAZAP1_uc002lso.1_Missense_Mutation_p.G382A	NM_018959	NP_061832	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1 isoform b	383	Pro-rich.				cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm|nucleus	nucleotide binding|RNA binding			breast(1)	1		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)												0.307692	9.125488	10.526922	12	27	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Missense_Mutation	SNP	1385835	1385835	4415	19	G	C	C	42	42	DAZAP1	C	3	3
PBX4	80714	broad.mit.edu	36	19	19536769	19536769	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:19536769C>T	uc002nmy.1	-	c.898G>A	c.(898-900)GCC>ACC	p.A300T		NM_025245	NP_079521	Q9BYU1	PBX4_HUMAN	pre-B-cell leukemia homeobox 4	300					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription activator activity			large_intestine(1)|ovary(1)	2														0.267652	343.481534	373.170185	163	446	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19536769	19536769	11915	19	C	T	T	27	27	PBX4	T	1	1
NTF4	4909	broad.mit.edu	36	19	54256451	54256451	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:54256451G>A	uc002pmf.2	-	c.616C>T	c.(616-618)CGG>TGG	p.R206W	NTF4_uc010emr.1_Missense_Mutation_p.R206W	NM_006179	NP_006170	P34130	NTF4_HUMAN	neurotrophin 5 preproprotein	206			R -> Q (in a patient with primary open- angle glaucoma; uncertain pathological significance).|R -> W (in patients with primary open- angle glaucoma and normal pressure glaucoma; uncertain pathological significance; impaired ligand-mediated TRKB signaling and reduced neurite outgrowth).		adult locomotory behavior|epidermis development|ganglion mother cell fate determination|long-term memory|sensory organ boundary specification	endoplasmic reticulum lumen|extracellular region	growth factor activity				0		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)												0.244094	73.169626	80.744267	31	96	GG		KEEP	---	---	---	---	capture		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Missense_Mutation	SNP	54256451	54256451	11102	19	G	A	A	39	39	NTF4	A	1	1
DUS3L	56931	broad.mit.edu	36	19	5740592	5740592	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5208-01	TCGA-28-5208-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:5740592T>G	uc002mdc.1	-	c.526A>C	c.(526-528)ACC>CCC	p.T176P	DUS3L_uc002mdd.1_Intron|DUS3L_uc010duk.1_5'UTR	NM_020175	NP_064560	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like	176	C3H1-type 2.				oxidation-reduction process|tRNA processing		flavin adenine dinucleotide binding|nucleic acid binding|tRNA dihydrouridine synthase activity|zinc ion binding				0														0.266667	9.396076	10.13229	4	11	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5740592	5740592	4992	19	T	G	G	58	58	DUS3L	G	4	4
ZNF813	126017	broad.mit.edu	36	19	58686083	58686083	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:58686083G>A	uc002qbu.2	+	c.785G>A	c.(784-786)CGT>CAT	p.R262H	ZNF813_uc010eqq.1_Intron	NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	262	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1														0.24	154.808927	171.781424	66	209	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(134;0.00619)	Missense_Mutation	SNP	58686083	58686083	18773	19	G	A	A	40	40	ZNF813	A	1	1
ACTL9	284382	broad.mit.edu	36	19	8669430	8669430	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:8669430C>T	uc002mkl.1	-	c.622G>A	c.(622-624)GTC>ATC	p.V208I		NM_178525	NP_848620	Q8TC94	ACTL9_HUMAN	hypothetical protein LOC284382	208						cytoplasm|cytoskeleton				large_intestine(2)|pancreas(1)	3														0.372671	158.313444	160.621377	60	101	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8669430	8669430	204	19	C	T	T	19	19	ACTL9	T	1	1
FAM132A	388581	broad.mit.edu	36	1	1169279	1169279	+	Missense_Mutation	SNP	A	C	C			TCGA-28-5208-01	TCGA-28-5208-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:1169279A>C	uc001adl.1	-	c.449T>G	c.(448-450)GTG>GGG	p.V150G		NM_001014980	NP_001014980	Q5T7M4	F132A_HUMAN	family with sequence similarity 132, member A	150						extracellular region					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)								448				0.444444	9.587448	9.613048	4	5	AA		KEEP	---	---	---	---	capture		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.22e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	Missense_Mutation	SNP	1169279	1169279	5639	1	A	C	C	6	6	FAM132A	C	4	4
TNFRSF1B	7133	broad.mit.edu	36	1	12184713	12184713	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:12184713G>T	uc001att.1	+	c.1003G>T	c.(1003-1005)GCC>TCC	p.A335S	TNFRSF1B_uc001atu.1_Missense_Mutation_p.A140S|TNFRSF1B_uc009vnk.1_Non-coding_Transcript	NM_001066	NP_001057	P20333	TNR1B_HUMAN	tumor necrosis factor receptor 2 precursor	335	Cytoplasmic (Potential).				apoptosis	extracellular region|integral to membrane|membrane raft|plasma membrane	tumor necrosis factor receptor activity			liver(1)|central_nervous_system(1)	2	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)			Etanercept(DB00005)|Infliximab(DB00065)					222				0.277778	6.569793	7.374471	5	13	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Missense_Mutation	SNP	12184713	12184713	16835	1	G	T	T	42	42	TNFRSF1B	T	3	3
PI4KB	5298	broad.mit.edu	36	1	149537971	149537971	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:149537971C>T	uc001exr.2	-	c.1988G>A	c.(1987-1989)CGC>CAC	p.R663H	PI4KB_uc001exs.2_Missense_Mutation_p.R636H|PI4KB_uc001ext.2_Missense_Mutation_p.R651H|PI4KB_uc001exu.2_Missense_Mutation_p.R636H	NM_002651	NP_002642	Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	651	PI3K/PI4K.				phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|receptor-mediated endocytosis	endosome|Golgi apparatus|mitochondrial outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum membrane	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			ovary(2)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)					Colon(154;765 1838 9854 28443 37492)				342				0.437736	675.518352	677.309495	232	298	CC		KEEP	---	---	---	---	capture	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)		Missense_Mutation	SNP	149537971	149537971	12298	1	C	T	T	27	27	PI4KB	T	1	1
LCE5A	254910	broad.mit.edu	36	1	150750875	150750875	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:150750875C>T	uc001ezy.1	+	c.241C>T	c.(241-243)CGA>TGA	p.R81*	LCE5A_uc009wnf.1_Nonsense_Mutation_p.R81*|CRCT1_uc001ezz.1_5'Flank	NM_178438	NP_848525	Q5TCM9	LCE5A_HUMAN	late cornified envelope 5A	81	Cys-rich.				keratinization					ovary(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)													0.434483	176.505507	177.044115	63	82	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(543;0.206)		Nonsense_Mutation	SNP	150750875	150750875	8998	1	C	T	T	23	23	LCE5A	T	5	1
ITLN1	55600	broad.mit.edu	36	1	159118537	159118537	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:159118537G>T	uc001fxc.1	-	c.239C>A	c.(238-240)ACC>AAC	p.T80N		NM_017625	NP_060095	Q8WWA0	ITLN1_HUMAN	intelectin	80	Fibrinogen C-terminal.				positive regulation of glucose import|positive regulation of protein phosphorylation|response to nematode|signal transduction	anchored to membrane|brush border membrane|extracellular region|membrane raft	receptor binding|sugar binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)													0.386861	152.129559	153.66935	53	84	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(70;0.00737)		Missense_Mutation	SNP	159118537	159118537	8214	1	G	T	T	44	44	ITLN1	T	3	3
C1orf125	126859	broad.mit.edu	36	1	177621066	177621066	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:177621066G>A	uc001gmo.1	+	c.812G>A	c.(811-813)CGA>CAA	p.R271Q	C1orf125_uc009wxg.1_Non-coding_Transcript|C1orf125_uc001gmn.1_Missense_Mutation_p.R59Q|C1orf125_uc001gmp.1_Missense_Mutation_p.R271Q	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	271											0														0.325123	181.886161	187.391707	66	137	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	177621066	177621066	2060	1	G	A	A	37	37	C1orf125	A	1	1
WNT9A	7483	broad.mit.edu	36	1	226178688	226178688	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:226178688G>A	uc001hri.1	-	c.389C>T	c.(388-390)TCG>TTG	p.S130L		NM_003395	NP_003386	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family,	130					anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|cornea development in camera-type eye|embryonic arm morphogenesis|embryonic skeletal joint morphogenesis|endoderm development|iris morphogenesis|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of gene-specific transcription from RNA polymerase II promoter|neuron differentiation|positive regulation of smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|G-protein-coupled receptor binding|signal transducer activity			central_nervous_system(1)|pancreas(1)	2		Prostate(94;0.0405)												0.452555	180.828389	181.097583	62	75	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	226178688	226178688	17972	1	G	A	A	37	37	WNT9A	A	1	1
NLRP3	114548	broad.mit.edu	36	1	245653778	245653778	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:245653778G>A	uc001icr.1	+	c.410G>A	c.(409-411)CGT>CAT	p.R137H	NLRP3_uc001ics.1_Missense_Mutation_p.R137H|NLRP3_uc001ict.1_Missense_Mutation_p.R135H|NLRP3_uc001icu.1_Missense_Mutation_p.R137H|NLRP3_uc001icw.1_Missense_Mutation_p.R137H|NLRP3_uc001icv.1_Missense_Mutation_p.R137H	NM_001079821	NP_004886	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	137					detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			ovary(5)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	11	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)								412				0.458333	66.446762	66.519034	22	26	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		Missense_Mutation	SNP	245653778	245653778	10881	1	G	A	A	40	40	NLRP3	A	1	1
TMEM61	199964	broad.mit.edu	36	1	55230242	55230242	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:55230242G>A	uc001cyd.1	+	c.511G>A	c.(511-513)GCC>ACC	p.A171T		NM_182532	NP_872338	Q8N0U2	TMM61_HUMAN	transmembrane protein 61	171						integral to membrane					0														0.431818	319.253958	320.310876	114	150	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55230242	55230242	16727	1	G	A	A	38	38	TMEM61	A	1	1
ZNF335	63925	broad.mit.edu	36	20	44021345	44021345	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:44021345G>A	uc002xqw.1	-	c.2155C>T	c.(2155-2157)CGC>TGC	p.R719C		NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	719					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)												0.375	157.202173	159.298908	57	95	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44021345	44021345	18444	20	G	A	A	39	39	ZNF335	A	1	1
UCKL1	54963	broad.mit.edu	36	20	62042202	62042202	+	Silent	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:62042202C>T	uc010gkn.1	-	c.1383G>A	c.(1381-1383)GCG>GCA	p.A461A	UCKL1_uc002yhj.1_Silent_p.A104A|UCKL1_uc010gkm.1_Silent_p.A70A	NM_017859	NP_060329	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	461					interspecies interaction between organisms	endoplasmic reticulum|nucleus	ATP binding|phosphotransferase activity, alcohol group as acceptor|protein binding|uridine kinase activity				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)													0.270833	31.252855	33.527507	13	35	CC		KEEP	---	---	---	---	capture			Silent	SNP	62042202	62042202	17483	20	C	T	T	23	23	UCKL1	T	1	1
TPTE	7179	broad.mit.edu	36	21	9964866	9964866	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:9964866G>A	uc002yip.1	-	c.592C>T	c.(592-594)CGA>TGA	p.R198*	TPTE_uc002yiq.1_Nonsense_Mutation_p.R180*|TPTE_uc002yir.1_Nonsense_Mutation_p.R160*|TPTE_uc010gkv.1_Nonsense_Mutation_p.R60*|TPTE_uc002yis.1_Non-coding_Transcript	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	198					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5														0.246032	74.058412	81.46183	31	95	GG		KEEP	---	---	---	---	capture	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	Nonsense_Mutation	SNP	9964866	9964866	16974	21	G	A	A	40	40	TPTE	A	5	1
KCNF1	3754	broad.mit.edu	36	2	10970107	10970107	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5208-01	TCGA-28-5208-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:10970107T>G	uc002rax.1	+	c.104T>G	c.(103-105)GTG>GGG	p.V35G		NM_002236	NP_002227	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F,	35	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)													0.310345	6.908592	8.062272	9	20	TT		KEEP	---	---	---	---	capture		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)	Missense_Mutation	SNP	10970107	10970107	8331	2	T	G	G	59	59	KCNF1	G	4	4
SNTG2	54221	broad.mit.edu	36	2	1158837	1158837	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:1158837G>A	uc002qwq.1	+	c.559G>A	c.(559-561)GGT>AGT	p.G187S	SNTG2_uc010ewi.1_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	187					central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)												0.396907	483.486599	487.089199	154	234	GG		KEEP	---	---	---	---	capture		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)	Missense_Mutation	SNP	1158837	1158837	15375	2	G	A	A	39	39	SNTG2	A	1	1
ALPPL2	251	broad.mit.edu	36	2	232982637	232982637	+	Silent	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:232982637C>T	uc002vss.2	+	c.1410C>T	c.(1408-1410)GGC>GGT	p.G470G		NM_031313	NP_112603	P10696	PPBN_HUMAN	placental-like alkaline phosphatase	470					phosphorylation	anchored to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)			Amifostine(DB01143)|Levamisole(DB00848)									0.477273	58.169643	58.189368	21	23	CC		KEEP	---	---	---	---	capture		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Silent	SNP	232982637	232982637	552	2	C	T	T	27	27	ALPPL2	T	1	1
ABCG5	64240	broad.mit.edu	36	2	43904756	43904756	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5208-01	TCGA-28-5208-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:43904756A>G	uc002rtn.1	-	c.1124T>C	c.(1123-1125)GTG>GCG	p.V375A	ABCG5_uc002rto.1_Missense_Mutation_p.V204A|ABCG5_uc002rtp.1_5'UTR|ABCG5_uc002rtm.1_5'UTR	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5	375	Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|intestinal cholesterol absorption|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)												0.473282	204.647802	204.728568	62	69	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43904756	43904756	72	2	A	G	G	6	6	ABCG5	G	4	4
APLF	200558	broad.mit.edu	36	2	68583374	68583374	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:68583374C>G	uc002sep.1	+	c.176C>G	c.(175-177)ACA>AGA	p.T59R	APLF_uc010fdf.1_Missense_Mutation_p.T35R	NM_173545	NP_775816	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	59	FHA-like.				double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2														0.459184	328.358955	328.639606	90	106	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	68583374	68583374	786	2	C	G	G	17	17	APLF	G	3	3
SENP7	57337	broad.mit.edu	36	3	102619277	102619277	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:102619277C>T	uc003dut.1	-	c.332G>A	c.(331-333)CGA>CAA	p.R111Q	SENP7_uc003duu.1_Missense_Mutation_p.R111Q|SENP7_uc003duv.1_Missense_Mutation_p.R78Q|SENP7_uc003duw.1_Intron|SENP7_uc003dux.1_Intron	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1	111					proteolysis	nucleus	cysteine-type peptidase activity			ovary(2)|lung(1)	3														0.453039	248.266955	248.608221	82	99	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	102619277	102619277	14537	3	C	T	T	31	31	SENP7	T	1	1
SETD2	29072	broad.mit.edu	36	3	47073913	47073913	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:47073913C>T	uc003cqs.1	-	c.4856G>A	c.(4855-4857)CGG>CAG	p.R1619Q	SETD2_uc003cqt.1_Non-coding_Transcript	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2122	Potential.				oxidation-reduction process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)												0.401015	234.697048	236.381085	79	118	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	Missense_Mutation	SNP	47073913	47073913	14620	3	C	T	T	23	23	SETD2	T	1	1
CACNA2D3	55799	broad.mit.edu	36	3	55082894	55082894	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:55082894C>T	uc003dhf.1	+	c.3151C>T	c.(3151-3153)CGC>TGC	p.R1051C		NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha	1051	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7														0.367647	66.753243	67.801818	25	43	CC		KEEP	---	---	---	---	capture		KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Missense_Mutation	SNP	55082894	55082894	2666	3	C	T	T	27	27	CACNA2D3	T	1	1
ANKRD56	345079	broad.mit.edu	36	4	78036841	78036841	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:78036841C>T	uc003hki.1	-	c.1186G>A	c.(1186-1188)GAC>AAC	p.D396N		NM_001029870	NP_001025041	A6NEL2	ANR56_HUMAN	ankyrin repeat domain 56	396											0														0.412121	385.019802	387.250313	136	194	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	78036841	78036841	690	4	C	T	T	29	29	ANKRD56	T	2	2
MMRN1	22915	broad.mit.edu	36	4	91076256	91076256	+	Missense_Mutation	SNP	A	C	C			TCGA-28-5208-01	TCGA-28-5208-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:91076256A>C	uc003hst.1	+	c.2402A>C	c.(2401-2403)CAA>CCA	p.Q801P	MMRN1_uc010iku.1_Intron	NM_007351	NP_031377	Q13201	MMRN1_HUMAN	multimerin 1	801					cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen				ovary(4)	4		Hepatocellular(203;0.114)												0.403509	243.547594	244.937902	69	102	AA		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)	Missense_Mutation	SNP	91076256	91076256	10061	4	A	C	C	5	5	MMRN1	C	4	4
PCDHA1	56147	broad.mit.edu	36	5	140147913	140147913	+	Silent	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140147913G>A	uc003lhb.1	+	c.1854G>A	c.(1852-1854)GCG>GCA	p.A618A	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lgz.1_Silent_p.A618A	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	618	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding				0														0.526012	250.702445	250.806273	91	82	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Silent	SNP	140147913	140147913	11939	5	G	A	A	38	38	PCDHA1	A	1	1
PCDHGA4	56111	broad.mit.edu	36	5	140716619	140716619	+	Silent	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140716619C>T	uc003ljq.1	+	c.1668C>T	c.(1666-1668)AAC>AAT	p.N556N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Silent_p.N556N	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	556	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0														0.438114	647.041513	648.739272	223	286	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Silent	SNP	140716619	140716619	11976	5	C	T	T	19	19	PCDHGA4	T	1	1
NOTCH4	4855	broad.mit.edu	36	6	32279985	32279985	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:32279985C>T	uc003obb.1	-	c.3025G>A	c.(3025-3027)GAG>AAG	p.E1009K	NOTCH4_uc003oba.1_5'Flank	NM_004557	NP_004548	Q99466	NOTC4_HUMAN	notch4 preproprotein	1009	Extracellular (Potential).|EGF-like 26.				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity			ovary(5)|lung(5)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	14										693				0.405797	79.497057	80.028607	28	41	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32279985	32279985	10954	6	C	T	T	31	31	NOTCH4	T	1	1
C7orf52	375607	broad.mit.edu	36	7	100604567	100604567	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100604567G>A	uc003uxy.1	-	c.242C>T	c.(241-243)CCT>CTT	p.P81L	C7orf52_uc003uxz.1_Missense_Mutation_p.P81L|C7orf52_uc003uya.1_Missense_Mutation_p.P81L|C7orf52_uc003uyb.1_Missense_Mutation_p.P81L	NM_198571	NP_940973	Q8N8M0	CG052_HUMAN	hypothetical protein LOC375607	81	N-acetyltransferase.						N-acetyltransferase activity			ovary(1)	1	Lung NSC(181;0.168)|all_lung(186;0.215)													0.261905	9.742399	12.05633	11	31	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100604567	100604567	2508	7	G	A	A	35	35	C7orf52	A	2	2
ANLN	54443	broad.mit.edu	36	7	36426381	36426381	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5208-01	TCGA-28-5208-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:36426381A>G	uc003tff.1	+	c.1948A>G	c.(1948-1950)AGA>GGA	p.R650G	ANLN_uc003tfg.1_Missense_Mutation_p.R613G|ANLN_uc010kxe.1_Missense_Mutation_p.R612G	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	650	Interaction with F-actin.				cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3														0.513333	854.902913	854.975528	231	219	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36426381	36426381	702	7	A	G	G	3	3	ANLN	G	4	4
CACNA2D1	781	broad.mit.edu	36	7	81637860	81637860	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:81637860C>T	uc003uhr.1	-	c.296G>A	c.(295-297)CGC>CAC	p.R99H		NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	99	Extracellular (Potential).			R -> S (in Ref. 1; AAA51903).		voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)									0.095465	21.190445	89.994229	40	379	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	81637860	81637860	2664	7	C	T	T	27	27	CACNA2D1	T	1	1
PCLO	27445	broad.mit.edu	36	7	82622277	82622277	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:82622277G>T	uc003uhx.2	-	c.1616C>A	c.(1615-1617)CCC>CAC	p.P539H	PCLO_uc003uhv.2_Missense_Mutation_p.P539H	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	485	Gln-rich.|Pro-rich.|10 X 10 AA tandem approximate repeats of P-A-K-P-Q-P-Q-Q-P-X.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity|zinc ion binding			ovary(7)	7														0.413738	701.776194	705.847215	259	367	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	82622277	82622277	12003	7	G	T	T	43	43	PCLO	T	3	3
SAMD9L	219285	broad.mit.edu	36	7	92601694	92601694	+	Nonsense_Mutation	SNP	A	C	C			TCGA-28-5208-01	TCGA-28-5208-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:92601694A>C	uc003umh.1	-	c.1527T>G	c.(1525-1527)TAT>TAG	p.Y509*	SAMD9L_uc003umj.1_Nonsense_Mutation_p.Y509*|SAMD9L_uc003umi.1_Nonsense_Mutation_p.Y509*|SAMD9L_uc010lfb.1_Nonsense_Mutation_p.Y509*|SAMD9L_uc003umk.1_Nonsense_Mutation_p.Y509*|SAMD9L_uc010lfc.1_Nonsense_Mutation_p.Y509*|SAMD9L_uc010lfd.1_Nonsense_Mutation_p.Y509*|SAMD9L_uc010lfe.1_Nonsense_Mutation_p.Y509*	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	509										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)													0.396226	428.408865	431.3976	126	192	AA		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(171;0.000302)		Nonsense_Mutation	SNP	92601694	92601694	14307	7	A	C	C	16	16	SAMD9L	C	5	4
ST18	9705	broad.mit.edu	36	8	53234169	53234169	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:53234169C>T	uc003xqz.1	-	c.1648G>A	c.(1648-1650)GCC>ACC	p.A550T	ST18_uc003xra.1_Missense_Mutation_p.A550T|ST18_uc003xrb.1_Missense_Mutation_p.A550T	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	550						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)												0.4	261.809047	263.860588	94	141	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53234169	53234169	15730	8	C	T	T	27	27	ST18	T	1	1
FKBP15	23307	broad.mit.edu	36	9	114986887	114986887	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:114986887G>A	uc004bgs.2	-	c.1517C>T	c.(1516-1518)TCA>TTA	p.S506L	FKBP15_uc004bgr.2_5'Flank|FKBP15_uc010mut.1_Missense_Mutation_p.S374L|FKBP15_uc010muu.1_Missense_Mutation_p.S570L	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	506					endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3														0.210526	6.708837	8.169258	4	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	114986887	114986887	6143	9	G	A	A	45	45	FKBP15	A	2	2
TMEM215	401498	broad.mit.edu	36	9	32774670	32774670	+	Silent	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:32774670C>T	uc003zri.2	+	c.489C>T	c.(487-489)GAC>GAT	p.D163D	TMEM215_uc010mjl.1_Silent_p.D163D	NM_212558	NP_997723	Q68D42	TM215_HUMAN	transmembrane protein 215	163						integral to membrane					0														0.792453	130.571836	134.773151	42	11	CC		KEEP	---	---	---	---	capture			Silent	SNP	32774670	32774670	16674	9	C	T	T	19	19	TMEM215	T	1	1
TPD52L3	89882	broad.mit.edu	36	9	6318761	6318761	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:6318761C>T	uc003zjw.1	+	c.166C>T	c.(166-168)CGC>TGC	p.R56C	TPD52L3_uc003zjv.1_Missense_Mutation_p.R56C|TPD52L3_uc003zjx.1_Missense_Mutation_p.R56C	NM_033516	NP_277051	Q96J77	TPD55_HUMAN	protein kinase NYD-SP25 isoform 1	56	Potential.						protein binding				0		Acute lymphoblastic leukemia(23;0.158)												0.662791	172.065621	174.076014	57	29	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(50;0.0198)|Lung(218;0.1)	Missense_Mutation	SNP	6318761	6318761	16944	9	C	T	T	19	19	TPD52L3	T	1	1
TRPM6	140803	broad.mit.edu	36	9	76612831	76612831	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:76612831C>T	uc004ajl.1	-	c.1577G>A	c.(1576-1578)CGC>CAC	p.R526H	TRPM6_uc004ajk.1_Missense_Mutation_p.R521H|TRPM6_uc010mpb.1_Non-coding_Transcript|TRPM6_uc010mpc.1_Missense_Mutation_p.R526H|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	526	Cytoplasmic (Potential).				protein phosphorylation|response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4										879				0.352542	286.249938	291.889112	104	191	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	76612831	76612831	17141	9	C	T	T	27	27	TRPM6	T	1	1
FGD3	89846	broad.mit.edu	36	9	94832010	94832010	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:94832010C>T	uc004asw.2	+	c.1591C>T	c.(1591-1593)CGT>TGT	p.R531C	FGD3_uc004asx.2_Missense_Mutation_p.R531C|FGD3_uc004asz.2_Missense_Mutation_p.R531C	NM_001083536	NP_149077	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	531					actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|ruffle	Rho guanyl-nucleotide exchange factor activity|small GTPase binding|zinc ion binding			ovary(1)|breast(1)	2														0.459016	163.890302	164.067989	56	66	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	94832010	94832010	6071	9	C	T	T	19	19	FGD3	T	1	1
CHRDL1	91851	broad.mit.edu	36	X	109809302	109809302	+	Silent	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:109809302G>A	uc004eow.1	-	c.1158C>T	c.(1156-1158)CTC>CTT	p.L386L	CHRDL1_uc004eov.1_Silent_p.L377L|CHRDL1_uc010nps.1_Silent_p.L381L|CHRDL1_uc004eou.2_Silent_p.L382L	NM_145234	NP_660277	Q9BU40	CRDL1_HUMAN	chordin-like 1 isoform 3 precursor	380					BMP signaling pathway|cell differentiation|nervous system development|ossification	extracellular region					0														0.813187	246.098337	254.455783	74	17	GG		KEEP	---	---	---	---	capture			Silent	SNP	109809302	109809302	3507	23	G	A	A	41	41	CHRDL1	A	2	2
TLR7	51284	broad.mit.edu	36	X	12816408	12816408	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:12816408G>A	uc004cvc.1	+	c.2860G>A	c.(2860-2862)GTG>ATG	p.V954M		NM_016562	NP_057646	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	954	TIR.|Cytoplasmic (Potential).				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of inflammatory response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity			ovary(1)	1					Imiquimod(DB00724)					69				0.860902	798.350231	831.827648	229	37	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12816408	12816408	16486	23	G	A	A	36	36	TLR7	A	2	2
GPC4	2239	broad.mit.edu	36	X	132376642	132376642	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:132376642C>A	uc004exc.1	-	c.18G>T	c.(16-18)TTG>TTT	p.L6F		NM_001448	NP_001439	O75487	GPC4_HUMAN	glypican 4	6					anatomical structure morphogenesis|cell proliferation	anchored to membrane|external side of plasma membrane|extracellular space|insoluble fraction|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	Acute lymphoblastic leukemia(192;0.000127)													0.238095	7.641642	8.983999	5	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	132376642	132376642	6874	23	C	A	A	25	25	GPC4	A	3	3
AFF2	2334	broad.mit.edu	36	X	147847607	147847607	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:147847607G>A	uc004fcp.1	+	c.2609G>A	c.(2608-2610)CGC>CAC	p.R870H	AFF2_uc004fcq.1_Missense_Mutation_p.R860H|AFF2_uc004fcr.1_Missense_Mutation_p.R831H|AFF2_uc004fcs.1_Missense_Mutation_p.R837H	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	870					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)													0.858407	934.10609	976.095646	291	48	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	147847607	147847607	358	23	G	A	A	38	38	AFF2	A	1	1
L1CAM	3897	broad.mit.edu	36	X	152783770	152783770	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:152783770C>T	uc004fjb.1	-	c.2839G>A	c.(2839-2841)GTG>ATG	p.V947M	L1CAM_uc004fjc.1_Missense_Mutation_p.V947M	NM_000425	NP_000416	P32004	L1CAM_HUMAN	L1 cell adhesion molecule isoform 1 precursor	947	Extracellular (Potential).|Fibronectin type-III 4.		Missing (in HSAS).		axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane		p.V947M(1)		ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)													0.863636	116.456572	122.086089	38	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	152783770	152783770	8911	23	C	T	T	19	19	L1CAM	T	1	1
KRTAP5-5	439915	broad.mit.edu	36	11	1607775	1607804	+	In_Frame_Del	DEL	AGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	-	-			TCGA-28-5208-01	TCGA-28-5208-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:1607775_1607804delAGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	uc001lty.1	+	c.129_158delAGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	c.(127-159)GGAGGCTGTGGGGGCTGTGGCTCCGGCTGTGCG>GGG	p.GCGGCGSGCA44del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	44_53				A -> G (in Ref. 1; BAD20201 and 2; CAF31639).		keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)										0.72			152	58				---	---	---	---	capture_indel			In_Frame_Del	DEL	1607775	1607804	8886	11	AGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	-	-	11	11	KRTAP5-5	-	5	5
ZCCHC3	85364	broad.mit.edu	36	20	226688	226690	+	In_Frame_Del	DEL	CGG	-	-			TCGA-28-5208-01	TCGA-28-5208-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:226688_226690delCGG	uc002wdf.1	+	c.461_463delCGG	c.(460-465)CCGGCG>CCG	p.A158del	ZCCHC3_uc002wdg.2_Intron	NM_033089	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	158	Poly-Ala.						nucleic acid binding|zinc ion binding				0		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)											0.50			6	6				---	---	---	---	capture_indel			In_Frame_Del	DEL	226688	226690	18177	20	CGG	-	-	23	23	ZCCHC3	-	5	5
QKI	9444	broad.mit.edu	36	6	163819811	163819811	+	Frame_Shift_Del	DEL	G	-	-			TCGA-28-5208-01	TCGA-28-5208-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:163819811_163819811delG	uc003qui.1	+	c.295_295delG	c.(295-297)GTTfs	p.V99fs	QKI_uc003que.1_Frame_Shift_Del_p.V99fs|QKI_uc003quf.1_Frame_Shift_Del_p.V99fs|QKI_uc003qug.1_Frame_Shift_Del_p.V99fs|QKI_uc003quh.1_Frame_Shift_Del_p.V99fs|QKI_uc003quj.1_Frame_Shift_Del_p.V99fs	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform	99	KH.				mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)										0.33			68	136				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	163819811	163819811	13331	6	G	-	-	48	48	QKI	-	5	5
