Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NBPF1	55672	broad.mit.edu	37	1	16892724	16892724	+	Intron	SNP	A	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16892724A>T	uc009vos.1	-						uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TTAGTAAATGATAAGGGGAGG	0.378													3	46	---	---	---	---	PASS
SH2D5	400745	broad.mit.edu	37	1	21051069	21051069	+	Silent	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21051069G>A	uc001bdt.1	-	5	823	c.198C>T	c.(196-198)CAC>CAT	p.H66H	SH2D5_uc009vpy.1_Silent_p.H150H|SH2D5_uc001bdu.1_RNA	NM_001103160	NP_001096630	Q6ZV89	SH2D5_HUMAN	SH2 domain containing 5 isoform 2	66											0		Colorectal(325;3.46e-05)|all_lung(284;5.32e-05)|Lung NSC(340;5.51e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|GBM - Glioblastoma multiforme(114;0.000465)|Kidney(64;0.000476)|STAD - Stomach adenocarcinoma(196;0.00303)|KIRC - Kidney renal clear cell carcinoma(64;0.00634)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GCTCCTCAGGGTGCTGCAAGA	0.682													8	7	---	---	---	---	PASS
RRAGC	64121	broad.mit.edu	37	1	39317434	39317434	+	Intron	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39317434G>C	uc001ccq.2	-						RRAGC_uc010oim.1_Intron|RRAGC_uc001ccr.2_Intron	NM_022157	NP_071440	Q9HB90	RRAGC_HUMAN	Ras-related GTP binding C						apoptosis|cell growth|cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade|RNA splicing|small GTPase mediated signal transduction|transcription, DNA-dependent	lysosome|nucleus	GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein heterodimerization activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)				TGAATTCTTGGAAAAACAAAT	0.313													7	32	---	---	---	---	PASS
RIMKLA	284716	broad.mit.edu	37	1	42880318	42880318	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42880318T>A	uc001chi.2	+	5	987	c.849T>A	c.(847-849)TTT>TTA	p.F283L		NM_173642	NP_775913	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family	283	ATP-grasp.				protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0						TCCTAGCCTTTGACCAGGCAT	0.498													16	201	---	---	---	---	PASS
EPS15	2060	broad.mit.edu	37	1	51946954	51946954	+	Nonsense_Mutation	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51946954G>C	uc001csq.1	-	2	158	c.66C>G	c.(64-66)TAC>TAG	p.Y22*	EPS15_uc009vyz.1_Nonsense_Mutation_p.Y22*	NM_001981	NP_001972	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway	22	EH 1.				cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2						CCTGTCTATAGTATTTTTCAT	0.264			T	MLL	ALL								11	6	---	---	---	---	PASS
SGIP1	84251	broad.mit.edu	37	1	67145430	67145430	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67145430G>A	uc001dcr.2	+	14	1026	c.809G>A	c.(808-810)GGA>GAA	p.G270E	SGIP1_uc010opd.1_Missense_Mutation_p.G37E|SGIP1_uc001dcs.2_Missense_Mutation_p.G37E|SGIP1_uc001dct.2_Missense_Mutation_p.G37E|uc010ope.1_5'Flank|SGIP1_uc009wat.2_Missense_Mutation_p.G37E	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	270	Pro-rich.				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						TTAACAATTGGACCAGGTACG	0.468													25	24	---	---	---	---	PASS
LRRC8D	55144	broad.mit.edu	37	1	90400336	90400336	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90400336A>G	uc001dnm.2	+	3	2134	c.1709A>G	c.(1708-1710)AAT>AGT	p.N570S	LRRC8D_uc001dnn.2_Missense_Mutation_p.N570S	NM_001134479	NP_001127951	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member	570	LRR 3.					integral to membrane	protein binding			ovary(2)	2		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		TTAATAGGCAATTTGAACTCT	0.428													31	11	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103453203	103453203	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103453203G>A	uc001dul.2	-	30	2806	c.2488C>T	c.(2488-2490)CAA>TAA	p.Q830*	COL11A1_uc001duk.2_Silent_p.V20V|COL11A1_uc001dum.2_Nonsense_Mutation_p.Q842*|COL11A1_uc001dun.2_Nonsense_Mutation_p.Q791*|COL11A1_uc009weh.2_Nonsense_Mutation_p.Q714*	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	830	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TCTCCTGCTTGACCTGAAGGA	0.463													13	34	---	---	---	---	PASS
KCNA2	3737	broad.mit.edu	37	1	111147297	111147297	+	Silent	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111147297C>G	uc001dzu.2	-	2	604	c.108G>C	c.(106-108)GTG>GTC	p.V36V	KCNA2_uc009wfv.1_Silent_p.V36V|KCNA2_uc009wfw.2_Silent_p.V36V	NM_004974	NP_004965	P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related	36						juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(1)	1		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)		AGATGTTGATCACCACCCTCT	0.582													44	197	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120468395	120468395	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120468395T>A	uc001eik.2	-	25	4300	c.4044A>T	c.(4042-4044)CAA>CAT	p.Q1348H		NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	1348	Extracellular (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACATTTCACTTGTCCACAGC	0.547			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				15	13	---	---	---	---	PASS
NES	10763	broad.mit.edu	37	1	156647063	156647063	+	5'UTR	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156647063C>G	uc001fpq.2	-	1						NM_006617	NP_006608	P48681	NEST_HUMAN	nestin						brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCATCCTGCTCGTCTGACCCA	0.637													11	46	---	---	---	---	PASS
CD1B	910	broad.mit.edu	37	1	158298814	158298814	+	Intron	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158298814G>C	uc001frx.2	-						CD1B_uc001frw.2_Intron	NM_001764	NP_001755	P29016	CD1B_HUMAN	CD1B antigen precursor						antigen processing and presentation|immune response	endosome membrane|integral to membrane|lysosomal membrane|plasma membrane	protein binding			ovary(2)	2	all_hematologic(112;0.0378)					CCTGGCAATTGAGAGAGGACA	0.443													4	20	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158623135	158623135	+	Silent	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158623135G>A	uc001fst.1	-	22	3316	c.3117C>T	c.(3115-3117)TTC>TTT	p.F1039F		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1039					actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GGAGCATCGGGAACTCATCGT	0.562													19	64	---	---	---	---	PASS
AIM2	9447	broad.mit.edu	37	1	159035952	159035952	+	Silent	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159035952G>A	uc001ftj.1	-	4	809	c.564C>T	c.(562-564)TTC>TTT	p.F188F		NM_004833	NP_004824	O14862	AIM2_HUMAN	absent in melanoma 2	188	HIN-200.				cellular response to drug|immune response|interleukin-1 beta secretion	mitochondrion|nucleus				ovary(2)|pancreas(1)	3	all_hematologic(112;0.0429)					CTTTTACAAAGAAGAATTCCT	0.363													35	134	---	---	---	---	PASS
IGSF8	93185	broad.mit.edu	37	1	160062180	160062180	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160062180C>T	uc001fva.2	-	5	1663	c.1618G>A	c.(1618-1620)GGC>AGC	p.G540S	IGSF8_uc001fuz.2_Missense_Mutation_p.G540S|IGSF8_uc009wtf.2_Missense_Mutation_p.G540S	NM_052868	NP_443100	Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	540	Ig-like C2-type 4.|Extracellular (Potential).				cell proliferation|cellular component movement|nervous system development|single fertilization|skeletal muscle tissue development	integral to membrane	protein binding				0	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			TGGTACACGCCTTCATCCTCG	0.662													54	126	---	---	---	---	PASS
RABGAP1L	9910	broad.mit.edu	37	1	174190149	174190149	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174190149G>T	uc001gjx.2	+	3	373	c.178G>T	c.(178-180)GAA>TAA	p.E60*	RABGAP1L_uc009wwq.1_Nonsense_Mutation_p.E60*|RABGAP1L_uc001gjw.2_Nonsense_Mutation_p.E23*	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A	60					regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						AAAAGCCATGGAAGAGATTTT	0.373													16	77	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175046710	175046710	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175046710G>T	uc001gkl.1	+	2	269	c.156G>T	c.(154-156)AAG>AAT	p.K52N	TNN_uc010pmx.1_Missense_Mutation_p.K52N	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	52					cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ATGTGCCCAAGTCTGCCTTGG	0.612													16	67	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190067750	190067750	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190067750G>A	uc001gse.1	-	8	1931	c.1699C>T	c.(1699-1701)CCA>TCA	p.P567S	FAM5C_uc010pot.1_Missense_Mutation_p.P465S	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	567						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					GCCAACACTGGCTCCAAGGTG	0.458													67	103	---	---	---	---	PASS
KCNT2	343450	broad.mit.edu	37	1	196311207	196311207	+	Splice_Site	SNP	A	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196311207A>C	uc001gtd.1	-	15	1613	c.1553_splice	c.e15+1	p.K518_splice	KCNT2_uc009wyt.1_Splice_Site|KCNT2_uc001gte.1_Intron|KCNT2_uc001gtf.1_Splice_Site_p.K518_splice|KCNT2_uc001gtg.1_Splice_Site|KCNT2_uc009wyu.2_Splice_Site_p.K518_splice|KCNT2_uc001gth.1_Intron	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2							voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						GCAGAAACATACTTTTTGTGT	0.318													10	30	---	---	---	---	PASS
KCNT2	343450	broad.mit.edu	37	1	196342287	196342287	+	Silent	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196342287A>G	uc001gtd.1	-	14	1446	c.1386T>C	c.(1384-1386)GTT>GTC	p.V462V	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Silent_p.V462V|KCNT2_uc001gtf.1_Silent_p.V462V|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Silent_p.V462V|KCNT2_uc009wyv.1_Silent_p.V437V	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	462	Cytoplasmic (Potential).|RCK N-terminal.					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						TAGAGGTATGAACCAGTAGTG	0.299													4	21	---	---	---	---	PASS
KCNT2	343450	broad.mit.edu	37	1	196458961	196458961	+	Intron	SNP	A	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196458961A>T	uc001gtd.1	-						KCNT2_uc001gte.1_Intron|KCNT2_uc001gtf.1_Intron|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Intron|KCNT2_uc009wyv.1_Intron	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2							voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						AGAAAAAGGTACCTTACCATT	0.303													10	29	---	---	---	---	PASS
CFHR4	10877	broad.mit.edu	37	1	196884133	196884133	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196884133A>G	uc001gto.2	+	5	733	c.664A>G	c.(664-666)ACC>GCC	p.T222A	CFHR4_uc009wyy.2_Missense_Mutation_p.T468A|CFHR4_uc001gtp.2_Missense_Mutation_p.T469A	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	222	Sushi 4.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						CAATGGTGATACCACCTCCTT	0.383													15	52	---	---	---	---	PASS
CR2	1380	broad.mit.edu	37	1	207646438	207646438	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207646438A>T	uc001hfw.2	+	10	1986	c.1892A>T	c.(1891-1893)TAT>TTT	p.Y631F	CR2_uc001hfv.2_Missense_Mutation_p.Y631F|CR2_uc009xch.2_Missense_Mutation_p.Y631F|CR2_uc009xci.1_Missense_Mutation_p.Y116F	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	631	Sushi 10.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						TTCAAGTGTTATAGTGGATTT	0.403													32	38	---	---	---	---	PASS
CR2	1380	broad.mit.edu	37	1	207646439	207646439	+	Nonsense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207646439T>A	uc001hfw.2	+	10	1987	c.1893T>A	c.(1891-1893)TAT>TAA	p.Y631*	CR2_uc001hfv.2_Nonsense_Mutation_p.Y631*|CR2_uc009xch.2_Nonsense_Mutation_p.Y631*|CR2_uc009xci.1_Nonsense_Mutation_p.Y116*	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	631	Sushi 10.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						TCAAGTGTTATAGTGGATTTA	0.398													33	36	---	---	---	---	PASS
RRP15	51018	broad.mit.edu	37	1	218458671	218458671	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218458671G>T	uc001hlj.2	+	1	43	c.13G>T	c.(13-15)GCT>TCT	p.A5S		NM_016052	NP_057136	Q9Y3B9	RRP15_HUMAN	ribosomal RNA processing 15 homolog	5						mitochondrion|nucleolus	protein binding				0				all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)		GGCAGCCGCCGCTCCGGACTC	0.542													8	32	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247607404	247607404	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247607404G>T	uc001icr.2	+	9	2938	c.2800G>T	c.(2800-2802)GAG>TAG	p.E934*	NLRP3_uc001ics.2_Nonsense_Mutation_p.E877*|NLRP3_uc001icu.2_Nonsense_Mutation_p.E934*|NLRP3_uc001icw.2_Nonsense_Mutation_p.E877*|NLRP3_uc001icv.2_Nonsense_Mutation_p.E820*|NLRP3_uc010pyw.1_Nonsense_Mutation_p.E912*	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	934					detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			ACTACTCTGTGAGGGACTCTT	0.507													28	76	---	---	---	---	PASS
OR2T8	343172	broad.mit.edu	37	1	248085113	248085113	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248085113C>A	uc010pzc.1	+	1	794	c.794C>A	c.(793-795)TCC>TAC	p.S265Y		NM_001005522	NP_001005522	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T,	265	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TCCCACAGGTCCACTAACCAC	0.493													35	94	---	---	---	---	PASS
OR2T34	127068	broad.mit.edu	37	1	248737429	248737429	+	Silent	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248737429G>T	uc001iep.1	-	1	630	c.630C>A	c.(628-630)CTC>CTA	p.L210L		NM_001001821	NP_001001821	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T,	210	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGAGAAGCATGAGGATGCAGC	0.542													91	383	---	---	---	---	PASS
CMPK2	129607	broad.mit.edu	37	2	7001388	7001388	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7001388A>G	uc002qyo.2	-	3	1028	c.919T>C	c.(919-921)TAC>CAC	p.Y307H	CMPK2_uc010yis.1_Missense_Mutation_p.Y307H|CMPK2_uc010ewv.2_Missense_Mutation_p.Y307H	NM_207315	NP_997198	Q5EBM0	CMPK2_HUMAN	UMP-CMP kinase 2 precursor	307					dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CCCAAAGAGTAAAAAGCTCTT	0.408													17	46	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21233009	21233009	+	Missense_Mutation	SNP	C	A	A	rs146333152	byFrequency	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21233009C>A	uc002red.2	-	26	6859	c.6731G>T	c.(6730-6732)AGT>ATT	p.S2244I		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2244					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GGATGCAGTACTACTTCCACT	0.323													11	22	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21236165	21236165	+	Silent	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21236165A>G	uc002red.2	-	25	4211	c.4083T>C	c.(4081-4083)AAT>AAC	p.N1361N		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	1361					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TGCTGTAGACATTCGTGGAGA	0.512													3	171	---	---	---	---	PASS
CGREF1	10669	broad.mit.edu	37	2	27327225	27327225	+	Silent	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27327225A>G	uc010eys.1	-	2	152	c.10T>C	c.(10-12)TTG>CTG	p.L4L	CGREF1_uc010ylf.1_Intron|CGREF1_uc002rip.1_5'UTR|CGREF1_uc002riq.2_Silent_p.L4L|CGREF1_uc010eyr.1_Silent_p.L126L|CGREF1_uc002rir.1_Silent_p.L4L|CGREF1_uc002ris.2_Silent_p.L4L	NM_006569	NP_006560	Q99674	CGRE1_HUMAN	cell growth regulator with EF-hand domain 1	4					cell adhesion|cell cycle arrest|negative regulation of cell proliferation|response to stress	extracellular region	calcium ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCATCGTCAAAGGTAACATC	0.562													23	36	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32773076	32773076	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32773076C>T	uc010ezu.2	+	64	13104	c.12970C>T	c.(12970-12972)CTG>TTG	p.L4324L		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	4324					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					TACCTGCCTTCTGCAGGTATA	0.368													9	26	---	---	---	---	PASS
TTC27	55622	broad.mit.edu	37	2	32855589	32855589	+	Splice_Site	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32855589G>T	uc002rom.2	+	2	320	c.89_splice	c.e2-1	p.E30_splice	TTC27_uc010ymx.1_Splice_Site	NM_017735	NP_060205	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27								protein binding			central_nervous_system(1)	1						TTATATTACAGAGAGTGGATC	0.303													10	34	---	---	---	---	PASS
OTX1	5013	broad.mit.edu	37	2	63283220	63283220	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63283220C>T	uc002scd.2	+	5	1082	c.834C>T	c.(832-834)CAC>CAT	p.H278H	OTX1_uc010ypt.1_Silent_p.H212H	NM_014562	NP_055377	P32242	OTX1_HUMAN	orthodenticle homeobox 1	278	His-rich.					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(2)	2	Lung NSC(7;0.121)|all_lung(7;0.211)					ACCATCATCACCACCCACATG	0.537													43	201	---	---	---	---	PASS
PROKR1	10887	broad.mit.edu	37	2	68882195	68882195	+	Silent	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68882195G>T	uc010yqj.1	+	2	669	c.669G>T	c.(667-669)GTG>GTT	p.V223V	PROKR1_uc002ses.2_RNA	NM_138964	NP_620414	Q8TCW9	PKR1_HUMAN	G protein-coupled receptor 73	223	Extracellular (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(1)	1						TCTGGCCTGTGGACCAGCAGC	0.552													38	156	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73635753	73635753	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73635753G>T	uc002sje.1	+	3	442	c.331G>T	c.(331-333)GTT>TTT	p.V111F	ALMS1_uc002sjf.1_Intron	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	110					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						TTTTCAGATTGTTCCATTGAC	0.269													3	23	---	---	---	---	PASS
RETSAT	54884	broad.mit.edu	37	2	85571285	85571285	+	Missense_Mutation	SNP	C	T	T	rs41289947	byFrequency	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85571285C>T	uc002spd.2	-	9	1561	c.1370G>A	c.(1369-1371)CGG>CAG	p.R457Q	RETSAT_uc010fge.2_Intron|RETSAT_uc010ysm.1_Missense_Mutation_p.R396Q|RETSAT_uc010fgf.2_Missense_Mutation_p.R248Q	NM_017750	NP_060220	Q6NUM9	RETST_HUMAN	all-trans-13,14-dihydroretinol saturase	457					retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity			ovary(2)	2					Vitamin A(DB00162)	CATGGTGGACCGGCCTGGGGA	0.612													52	87	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170131760	170131760	+	Intron	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170131760G>C	uc002ues.2	-						LRP2_uc010zdf.1_Intron	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TGTTATAAAAGACACATATAT	0.328													6	27	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179644760	179644760	+	Silent	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179644760A>G	uc010zfg.1	-	22	3920	c.3696T>C	c.(3694-3696)GAT>GAC	p.D1232D	TTN_uc010zfh.1_Silent_p.D1186D|TTN_uc010zfi.1_Silent_p.D1186D|TTN_uc010zfj.1_Silent_p.D1186D|TTN_uc002unb.2_Silent_p.D1232D	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1232							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCACTACAGTATCTTTGGCCA	0.279													25	20	---	---	---	---	PASS
PLCL1	5334	broad.mit.edu	37	2	198948702	198948702	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198948702A>G	uc010fsp.2	+	2	752	c.461A>G	c.(460-462)GAG>GGG	p.E154G	PLCL1_uc002uuv.3_Missense_Mutation_p.E75G	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	154	PH.|Interaction with PPP1C.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	AAAGACCTCGAGAAAGCCAAG	0.443													38	35	---	---	---	---	PASS
PLCL1	5334	broad.mit.edu	37	2	198948753	198948753	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198948753A>T	uc010fsp.2	+	2	803	c.512A>T	c.(511-513)AAC>ATC	p.N171I	PLCL1_uc002uuv.3_Missense_Mutation_p.N92I	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	171	PH.|Interaction with PPP1C.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	CTGGGGAAAAACACGGAAACA	0.458													24	88	---	---	---	---	PASS
STK11IP	114790	broad.mit.edu	37	2	220462644	220462644	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220462644C>T	uc002vml.2	+	1	49	c.6C>T	c.(4-6)TTC>TTT	p.F2F	STK11IP_uc010zlj.1_5'UTR|STK11IP_uc010zlk.1_5'UTR|STK11IP_uc010zll.1_5'UTR|STK11IP_uc002vmm.1_5'Flank	NM_052902	NP_443134	Q8N1F8	S11IP_HUMAN	LKB1 interacting protein	2					protein localization	cytoplasm	protein kinase binding			ovary(1)	1		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CGGGGAGGTTCGGTATGTCTG	0.572											OREG0003993	type=REGULATORY REGION|Gene=STK11IP|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	5	24	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191556	10191556	+	Silent	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191556G>A	uc003bvc.2	+	3	762	c.549G>A	c.(547-549)TCG>TCA	p.S183S	VHL_uc003bvd.2_Silent_p.S142S	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	183					anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.S183*(6)|p.S183fs*19(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TCGTCAGGTCGCTCTACGAAG	0.512		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				20	12	---	---	---	---	PASS
TRANK1	9881	broad.mit.edu	37	3	36899190	36899190	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36899190G>C	uc003cgj.2	-	3	543	c.241C>G	c.(241-243)CAC>GAC	p.H81D		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	631					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						TGAGATGTGTGACCAGGGGCA	0.582													8	128	---	---	---	---	PASS
CCBP2	1238	broad.mit.edu	37	3	42906283	42906283	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42906283G>T	uc003cme.2	+	3	468	c.289G>T	c.(289-291)GTG>TTG	p.V97L	CCBP2_uc003cmd.1_Missense_Mutation_p.V97L|CCBP2_uc003cmf.2_Missense_Mutation_p.V97L|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Intron	NM_001296	NP_001287	O00590	CCBP2_HUMAN	chemokine binding protein 2	97	Helical; Name=2; (Potential).				chemotaxis|immune response|multicellular organismal development	integral to plasma membrane	C-X-C chemokine receptor activity			lung(4)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.241)		TCTGTTTCTGGTGACACTGCC	0.507													95	57	---	---	---	---	PASS
ZNF662	389114	broad.mit.edu	37	3	42956129	42956129	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42956129G>T	uc003cmi.2	+	5	916	c.564G>T	c.(562-564)GAG>GAT	p.E188D	ZNF662_uc003cmk.2_Missense_Mutation_p.E214D|ZNF662_uc003cmj.2_Missense_Mutation_p.E80D	NM_207404	NP_997287	Q6ZS27	ZN662_HUMAN	zinc finger protein 662 isoform 1	188					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				KIRC - Kidney renal clear cell carcinoma(284;0.217)		TTCTAAATGAGCAAATATTCT	0.363													16	20	---	---	---	---	PASS
FBXW12	285231	broad.mit.edu	37	3	48420927	48420927	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48420927T>C	uc003csr.2	+	7	839	c.653T>C	c.(652-654)CTG>CCG	p.L218P	FBXW12_uc010hjv.2_Missense_Mutation_p.L199P|FBXW12_uc003css.2_Missense_Mutation_p.L148P|FBXW12_uc010hjw.2_Missense_Mutation_p.L117P	NM_207102	NP_996985	Q6X9E4	FBW12_HUMAN	F-box and WD repeat domain containing 12 isoform	218	WD 3.										0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACATTTACACTGCCTGGGTTA	0.418													120	89	---	---	---	---	PASS
USP4	7375	broad.mit.edu	37	3	49318254	49318254	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49318254C>T	uc003cwq.2	-	20	2646	c.2567G>A	c.(2566-2568)TGT>TAT	p.C856Y	USP4_uc003cwo.2_Missense_Mutation_p.C568Y|USP4_uc003cwp.2_Missense_Mutation_p.C586Y|USP4_uc003cwr.2_Missense_Mutation_p.C809Y	NM_003363	NP_003354	Q13107	UBP4_HUMAN	ubiquitin specific protease 4 isoform a	856					negative regulation of protein ubiquitination|protein deubiquitination|protein localization at cell surface|regulation of protein stability|ubiquitin-dependent protein catabolic process	lysosome|nucleus	adenosine receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|urinary_tract(1)|lung(1)	4		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		TGACAGGTTACAGACAAACTC	0.438													17	29	---	---	---	---	PASS
PROS1	5627	broad.mit.edu	37	3	93611872	93611872	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93611872G>C	uc003drb.3	-	10	1401	c.1060C>G	c.(1060-1062)CTT>GTT	p.L354V	PROS1_uc010hoo.2_Missense_Mutation_p.L223V|PROS1_uc003dqz.3_Missense_Mutation_p.L223V	NM_000313	NP_000304	P07225	PROS_HUMAN	protein S, alpha preproprotein	354	Laminin G-like 1.				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity			large_intestine(1)	1					Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)	CCACCACGAAGTGCAATCAGG	0.398													18	35	---	---	---	---	PASS
TBC1D23	55773	broad.mit.edu	37	3	100039691	100039691	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100039691A>T	uc003dtt.2	+	18	2071	c.1894A>T	c.(1894-1896)ATA>TTA	p.I632L	TBC1D23_uc003dts.2_Missense_Mutation_p.I617L|TBC1D23_uc003dtu.2_Missense_Mutation_p.I63L	NM_018309	NP_060779	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	632						intracellular	Rab GTPase activator activity			ovary(1)|liver(1)	2						ATTGGCTTATATACAGTCTCG	0.353													16	23	---	---	---	---	PASS
CCDC80	151887	broad.mit.edu	37	3	112357078	112357078	+	Missense_Mutation	SNP	C	A	A	rs145200206	byFrequency	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112357078C>A	uc003dzf.2	-	2	1893	c.1675G>T	c.(1675-1677)GCA>TCA	p.A559S	CCDC80_uc011bhv.1_Missense_Mutation_p.A559S|CCDC80_uc003dzg.2_Missense_Mutation_p.A559S|CCDC80_uc003dzh.1_Missense_Mutation_p.A559S	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	559	Lys-rich.									ovary(2)	2						aacttgtctgcgttctcattc	0.164													16	59	---	---	---	---	PASS
POPDC2	64091	broad.mit.edu	37	3	119367437	119367437	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119367437G>A	uc003ecx.1	-	3	813	c.679C>T	c.(679-681)CGA>TGA	p.R227*	POPDC2_uc010hqw.1_Nonsense_Mutation_p.R227*|POPDC2_uc003ecy.1_Nonsense_Mutation_p.R45*	NM_022135	NP_071418	Q9HBU9	POPD2_HUMAN	popeye protein 2	227						integral to membrane				central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.242)		GAGATGTATCGCTCTTTGGTC	0.507													14	57	---	---	---	---	PASS
CCDC37	348807	broad.mit.edu	37	3	126152023	126152023	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126152023C>T	uc003eiu.1	+	14	1497	c.1398C>T	c.(1396-1398)TTC>TTT	p.F466F	CCDC37_uc010hsg.1_Silent_p.F467F	NM_182628	NP_872434	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	466										ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.166)		TCTTCCACTTCGGCGAGTACA	0.597													5	216	---	---	---	---	PASS
ECT2	1894	broad.mit.edu	37	3	172500029	172500029	+	Intron	SNP	T	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172500029T>G	uc003fii.2	+						ECT2_uc010hwv.1_Intron|ECT2_uc003fih.2_Intron|ECT2_uc003fij.1_Intron|ECT2_uc003fik.1_Intron|ECT2_uc003fil.1_Intron	NM_018098	NP_060568	Q9H8V3	ECT2_HUMAN	epithelial cell transforming sequence 2 oncogene						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|ovary(1)|skin(1)	4	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			TATGTAAGTATTGTATTTCTT	0.303													26	10	---	---	---	---	PASS
PSMD2	5708	broad.mit.edu	37	3	184020241	184020241	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184020241C>T	uc003fnn.1	+	6	821	c.788C>T	c.(787-789)CCT>CTT	p.P263L	PSMD2_uc011brj.1_Missense_Mutation_p.P104L|PSMD2_uc011brk.1_Missense_Mutation_p.P133L	NM_002808	NP_002799	Q13200	PSMD2_HUMAN	proteasome 26S non-ATPase subunit 2	263					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding				0	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	AGCCGCTTCCCTGAAGCTCTG	0.478													121	74	---	---	---	---	PASS
TBCCD1	55171	broad.mit.edu	37	3	186272063	186272063	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186272063C>T	uc003fqg.2	-	6	1653	c.1524G>A	c.(1522-1524)GTG>GTA	p.V508V	TBCCD1_uc011bry.1_Silent_p.V508V|TBCCD1_uc003fqh.2_Silent_p.V412V	NM_018138	NP_060608	Q9NVR7	TBCC1_HUMAN	TBCC domain containing 1	508					cell morphogenesis|maintenance of centrosome location|maintenance of Golgi location|regulation of cell migration|regulation of cell shape	spindle pole centrosome	binding			large_intestine(1)|ovary(1)	2	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)		GAGCCTCCTTCACAGTTTTCT	0.403													170	125	---	---	---	---	PASS
ACAP2	23527	broad.mit.edu	37	3	195017976	195017976	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195017976C>T	uc003fun.3	-	16	1671	c.1430G>A	c.(1429-1431)CGA>CAA	p.R477Q		NM_012287	NP_036419	Q15057	ACAP2_HUMAN	centaurin, beta 2	477	Arf-GAP.				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2						TTCATAAACTCGATTTATAAC	0.308													6	49	---	---	---	---	PASS
ZNF718	255403	broad.mit.edu	37	4	59997	59997	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59997A>T	uc003fzt.3	+	7	310	c.177A>T	c.(175-177)AGA>AGT	p.R59S	ZNF595_uc003fzu.1_RNA|ZNF595_uc010iay.1_RNA|ZNF595_uc003fzv.1_Silent_p.I59I|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_001039127	NP_001034216	Q3SXZ3	ZN718_HUMAN	zinc finger protein 718	59	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		TGGAGCAAATAAAAGAGCCCT	0.453													4	62	---	---	---	---	PASS
EVC2	132884	broad.mit.edu	37	4	5577977	5577977	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5577977G>T	uc003gij.2	-	18	3316	c.3262C>A	c.(3262-3264)CAT>AAT	p.H1088N	EVC2_uc011bwb.1_Missense_Mutation_p.H528N|EVC2_uc003gik.2_Missense_Mutation_p.H1008N	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin	1088	Potential.					integral to membrane				large_intestine(3)|ovary(2)	5						CACTGCTGATGTTGCTCCAGT	0.562													95	66	---	---	---	---	PASS
CLRN2	645104	broad.mit.edu	37	4	17528554	17528554	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17528554A>G	uc003gpg.1	+	3	650	c.548A>G	c.(547-549)GAA>GGA	p.E183G		NM_001079827	NP_001073296	A0PK11	CLRN2_HUMAN	clarin 2	183						integral to membrane					0						GTGGTGGAAGAACAGTATGAA	0.532													17	35	---	---	---	---	PASS
G3BP2	9908	broad.mit.edu	37	4	76573882	76573882	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76573882C>T	uc003hir.2	-	9	1034	c.869G>A	c.(868-870)CGT>CAT	p.R290H	G3BP2_uc003his.2_Missense_Mutation_p.R290H|G3BP2_uc003hit.2_Missense_Mutation_p.R257H	NM_012297	NP_036429	Q9UN86	G3BP2_HUMAN	Ras-GTPase activating protein SH3 domain-binding	290					cytoplasmic sequestering of NF-kappaB|mRNA transport|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	GTPase activator activity|nucleotide binding|receptor signaling complex scaffold activity|RNA binding			breast(2)|central_nervous_system(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TTCACGCACACGAGGTGGCTG	0.408													12	7	---	---	---	---	PASS
PDHA2	5161	broad.mit.edu	37	4	96761711	96761711	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96761711C>T	uc003htr.3	+	1	473	c.410C>T	c.(409-411)ACG>ATG	p.T137M		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	137					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	GCAGAGCTGACGGGAAGAAGA	0.527													4	105	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113505305	113505305	+	Missense_Mutation	SNP	C	G	G	rs112544380		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113505305C>G	uc003iau.2	-	15	4338	c.4127G>C	c.(4126-4128)GGA>GCA	p.G1376A	C4orf21_uc003iav.2_RNA	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	198						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		AGCTTTGGGTCCATCACATGT	0.368													3	6	---	---	---	---	PASS
PLK4	10733	broad.mit.edu	37	4	128819593	128819593	+	Splice_Site	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128819593G>C	uc003ifo.2	+	16	3056	c.2811_splice	c.e16-1	p.R937_splice	PLK4_uc011cgs.1_Splice_Site_p.R905_splice|PLK4_uc011cgt.1_Splice_Site_p.R896_splice	NM_014264	NP_055079	O00444	PLK4_HUMAN	polo-like kinase 4						G2/M transition of mitotic cell cycle|positive regulation of centriole replication|trophoblast giant cell differentiation	centriole|cleavage furrow|cytosol|nucleolus	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0						GCTTCACTTAGGTATGGAGAA	0.313													6	13	---	---	---	---	PASS
PCDH18	54510	broad.mit.edu	37	4	138453011	138453011	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138453011C>A	uc003ihe.3	-	1	619	c.232G>T	c.(232-234)GTA>TTA	p.V78L	PCDH18_uc003ihf.3_Missense_Mutation_p.V71L|PCDH18_uc011cgz.1_Intron|PCDH18_uc003ihg.3_Intron|PCDH18_uc011cha.1_Intron	NM_019035	NP_061908	Q9HCL0	PCD18_HUMAN	protocadherin 18 precursor	78	Extracellular (Potential).|Cadherin 1.				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			pancreas(3)|skin(2)	5	all_hematologic(180;0.24)					TCGTTTACTACAAGTAGAGGA	0.423													4	91	---	---	---	---	PASS
ASB5	140458	broad.mit.edu	37	4	177142317	177142317	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177142317A>G	uc003iuq.1	-	5	675	c.659T>C	c.(658-660)CTT>CCT	p.L220P	ASB5_uc003iup.1_Missense_Mutation_p.L167P	NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box-containing protein	220	ANK 5.				intracellular signal transduction					skin(2)	2		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		AGCATAAAGAAGCTTCCAGAT	0.368													14	14	---	---	---	---	PASS
SLC6A3	6531	broad.mit.edu	37	5	1443164	1443164	+	Missense_Mutation	SNP	G	A	A	rs146798197		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1443164G>A	uc003jck.2	-	2	270	c.149C>T	c.(148-150)CCG>CTG	p.P50L		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	50	Cytoplasmic (Potential).				cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	GCTCTGCCGCGGGTTGGTGAG	0.632													62	126	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21842269	21842269	+	Splice_Site	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21842269C>T	uc010iuc.2	-	5	1272	c.814_splice	c.e5+1	p.S272_splice	CDH12_uc011cno.1_Splice_Site_p.S232_splice|CDH12_uc003jgk.2_Splice_Site_p.S272_splice	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						AGGTGACATACTTTTGGGGAA	0.408										HNSCC(59;0.17)			11	70	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23509677	23509677	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23509677G>T	uc003jgo.2	+	3	350	c.168G>T	c.(166-168)AGG>AGT	p.R56S		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	56	KRAB-related.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						ATGTGAAAAGGAACTATAATG	0.423										HNSCC(3;0.000094)			40	92	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33643489	33643489	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33643489C>T	uc003jia.1	-	10	1729	c.1566G>A	c.(1564-1566)GAG>GAA	p.E522E	ADAMTS12_uc010iuq.1_Silent_p.E522E	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	522	Disintegrin.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TCACCTTCTTCTCACCACATT	0.547										HNSCC(64;0.19)			31	66	---	---	---	---	PASS
CD180	4064	broad.mit.edu	37	5	66478990	66478990	+	Missense_Mutation	SNP	G	A	A	rs150000308		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66478990G>A	uc003juy.2	-	3	1829	c.1681C>T	c.(1681-1683)CGT>TGT	p.R561C		NM_005582	NP_005573	Q99467	CD180_HUMAN	CD180 molecule precursor	561	LRR 19.|Extracellular (Potential).				inflammatory response|innate immune response	integral to membrane|plasma membrane	receptor activity			ovary(1)	1		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		GGGAGGAGACGGGGTGAGATG	0.453													25	24	---	---	---	---	PASS
XRCC4	7518	broad.mit.edu	37	5	82499434	82499434	+	Silent	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82499434G>C	uc003kib.2	+	5	674	c.546G>C	c.(544-546)CTG>CTC	p.L182L	XRCC4_uc003kia.1_Silent_p.L182L|XRCC4_uc003kid.2_Silent_p.L182L|XRCC4_uc003kic.2_Silent_p.L182L|XRCC4_uc003kie.2_Silent_p.L182L|XRCC4_uc003kif.1_Silent_p.L182L|XRCC4_uc003kig.2_5'Flank	NM_022406	NP_071801	Q13426	XRCC4_HUMAN	X-ray repair cross complementing protein 4	182	Interacts with LIG4.				DNA ligation involved in DNA repair|double-strand break repair via nonhomologous end joining|initiation of viral infection|positive regulation of ligase activity|provirus integration|response to X-ray	cytosol|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|nucleoplasm	DNA binding|protein C-terminus binding			skin(3)	3		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		GGTTTATTCTGGTGTTGAATG	0.313								NHEJ					11	27	---	---	---	---	PASS
POU5F2	134187	broad.mit.edu	37	5	93077080	93077080	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93077080G>T	uc003kkl.1	-	1	230	c.190C>A	c.(190-192)CCC>ACC	p.P64T	FAM172A_uc010jbd.2_Intron|FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron	NM_153216	NP_694948	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	64						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		GGACCCAGGGGAATCCTCCAC	0.677													14	11	---	---	---	---	PASS
PCDHGB5	56101	broad.mit.edu	37	5	140779353	140779353	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140779353C>A	uc003lkf.1	+	1	1659	c.1659C>A	c.(1657-1659)GAC>GAA	p.D553E	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Missense_Mutation_p.D553E	NM_018925	NP_061748	Q9Y5G0	PCDGH_HUMAN	protocadherin gamma subfamily B, 5 isoform 1	553	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCGAAACGACAACGCACCGC	0.682													8	32	---	---	---	---	PASS
WWC1	23286	broad.mit.edu	37	5	167882517	167882517	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167882517G>T	uc003lzu.2	+	19	2908	c.2815G>T	c.(2815-2817)GTG>TTG	p.V939L	WWC1_uc003lzv.2_Missense_Mutation_p.V939L|WWC1_uc011den.1_Missense_Mutation_p.V939L|WWC1_uc003lzw.2_Missense_Mutation_p.V738L|WWC1_uc010jjf.1_Missense_Mutation_p.V211L	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 3	939	Interaction with histone H3.				cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		GAGCCAGTACGTGTGCCGGGT	0.502													63	69	---	---	---	---	PASS
BTNL3	10917	broad.mit.edu	37	5	180424385	180424385	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180424385T>A	uc003mmr.2	+	3	698	c.570T>A	c.(568-570)GAT>GAA	p.D190E		NM_197975	NP_932079	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3 precursor	190	Ig-like V-type.|Extracellular (Potential).				lipid metabolic process	integral to membrane					0	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			GCCTGTATGATGTGGAGATCT	0.498													24	9	---	---	---	---	PASS
GCM2	9247	broad.mit.edu	37	6	10877430	10877430	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10877430C>A	uc003mzn.3	-	2	358	c.286G>T	c.(286-288)GGT>TGT	p.G96C	SYCP2L_uc011dim.1_Intron	NM_004752	NP_004743	O75603	GCM2_HUMAN	glial cells missing homolog 2	96	GCM.				cellular calcium ion homeostasis|cellular phosphate ion homeostasis|parathyroid gland development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				AGGCGGGAACCGTCGGGCAGG	0.627													4	144	---	---	---	---	PASS
HIST1H2AK	8330	broad.mit.edu	37	6	27806045	27806045	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27806045G>T	uc003njs.2	-	1	73	c.73C>A	c.(73-75)CAG>AAG	p.Q25K	HIST1H2BN_uc003njt.1_5'Flank|HIST1H2BN_uc003nju.1_5'Flank|HIST1H2BN_uc003njv.2_5'Flank	NM_003510	NP_003501	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ak	25					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding			upper_aerodigestive_tract(1)	1						ACTGGGAACTGAAGACCCGCC	0.612													19	76	---	---	---	---	PASS
OR2W1	26692	broad.mit.edu	37	6	29012353	29012353	+	Silent	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29012353G>A	uc003nlw.2	-	1	600	c.600C>T	c.(598-600)TTC>TTT	p.F200F		NM_030903	NP_112165	Q9Y3N9	OR2W1_HUMAN	olfactory receptor, family 2, subfamily W,	200	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						TGCCTAAAGCGAAAACAGACA	0.423													21	83	---	---	---	---	PASS
OR5V1	81696	broad.mit.edu	37	6	29323508	29323508	+	Silent	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29323508G>A	uc011dlo.1	-	1	547	c.465C>T	c.(463-465)AAC>AAT	p.N155N		NM_030876	NP_110503	Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V,	155	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|kidney(1)	4						GCACCACTGAGTTAAGGAAAC	0.433													17	26	---	---	---	---	PASS
ZBTB9	221504	broad.mit.edu	37	6	33423675	33423675	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33423675G>T	uc003oeq.2	+	2	1066	c.798G>T	c.(796-798)GAG>GAT	p.E266D		NM_152735	NP_689948	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	266	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CAGAGGGTGAGAGTGCACCAC	0.567													32	129	---	---	---	---	PASS
SUPT3H	8464	broad.mit.edu	37	6	44971458	44971458	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44971458G>A	uc003oxo.2	-	8	787	c.469C>T	c.(469-471)CAG>TAG	p.Q157*	SUPT3H_uc003oxn.1_Nonsense_Mutation_p.Q146*|SUPT3H_uc011dvv.1_5'UTR|SUPT3H_uc003oxp.2_Nonsense_Mutation_p.Q146*|SUPT3H_uc011dvw.1_Nonsense_Mutation_p.Q60*	NM_181356	NP_852001	O75486	SUPT3_HUMAN	suppressor of Ty 3 homolog isoform 2	228					histone deubiquitination|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	STAGA complex|transcription factor TFTC complex	DNA binding|transcription coactivator activity			ovary(2)|breast(1)	3						TCTCCTGTCTGGTCAATAGAG	0.353													4	29	---	---	---	---	PASS
IL17A	3605	broad.mit.edu	37	6	52053995	52053995	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52053995G>T	uc003pak.1	+	3	418	c.373G>T	c.(373-375)GAG>TAG	p.E125*		NM_002190	NP_002181	Q16552	IL17_HUMAN	interleukin 17A precursor	125					apoptosis|cell-cell signaling|fibroblast activation|immune response|inflammatory response|positive regulation of interleukin-23 production|positive regulation of osteoclast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein glycosylation	extracellular space	cytokine activity				0	Lung NSC(77;0.116)					CCTGCGCAGGGAGCCTCCACA	0.597													17	23	---	---	---	---	PASS
GJA10	84694	broad.mit.edu	37	6	90604623	90604623	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90604623A>G	uc011eaa.1	+	1	436	c.436A>G	c.(436-438)AAA>GAA	p.K146E		NM_032602	NP_115991	Q969M2	CXA10_HUMAN	gap junction protein, alpha 10	146	Cytoplasmic (Potential).				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity				0		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		GAGGATCCATAAAGTCCCTCT	0.448													44	49	---	---	---	---	PASS
HACE1	57531	broad.mit.edu	37	6	105219851	105219851	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105219851T>A	uc003pqu.1	-	18	2240	c.1963A>T	c.(1963-1965)AGG>TGG	p.R655W	HACE1_uc010kcy.1_Missense_Mutation_p.R137W|HACE1_uc010kcz.1_Intron|HACE1_uc010kcx.1_Missense_Mutation_p.R64W|HACE1_uc003pqt.1_Missense_Mutation_p.R308W	NM_020771	NP_065822	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing, E3	655	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity			ovary(5)|lung(2)	7		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		ACCAGCTGCCTGTGGTTCAAC	0.368													14	28	---	---	---	---	PASS
MOXD1	26002	broad.mit.edu	37	6	132618998	132618998	+	Silent	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132618998G>C	uc003qdf.2	-	11	1704	c.1605C>G	c.(1603-1605)CTC>CTG	p.L535L	MOXD1_uc003qde.2_Silent_p.L467L	NM_015529	NP_056344	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1 isoform 2	535	Lumenal (Potential).				catecholamine metabolic process	endoplasmic reticulum membrane|integral to membrane	copper ion binding|dopamine beta-monooxygenase activity			ovary(1)	1	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		TGTTGAAGGAGAGACCTTCCT	0.423													3	37	---	---	---	---	PASS
TAAR1	134864	broad.mit.edu	37	6	132967052	132967052	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132967052C>G	uc003qdm.1	-	1	91	c.91G>C	c.(91-93)GTG>CTG	p.V31L		NM_138327	NP_612200	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	31	Helical; Name=1; (Potential).					plasma membrane					0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)	ATTATGAGCACCATTAAACTG	0.388													31	93	---	---	---	---	PASS
PHACTR2	9749	broad.mit.edu	37	6	144074909	144074909	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144074909A>T	uc003qjq.3	+	4	411	c.281A>T	c.(280-282)AAC>ATC	p.N94I	PHACTR2_uc010khh.2_Missense_Mutation_p.N94I|PHACTR2_uc010khi.2_Missense_Mutation_p.N105I|PHACTR2_uc003qjr.3_Missense_Mutation_p.N105I	NM_014721	NP_055536	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2 isoform 3	94							actin binding|protein phosphatase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		GTAACAGTTAACTTTGAAAAT	0.373													3	18	---	---	---	---	PASS
SLC22A2	6582	broad.mit.edu	37	6	160668227	160668227	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160668227C>A	uc003qtf.2	-	5	1116	c.946G>T	c.(946-948)GCC>TCC	p.A316S	SLC22A2_uc003qte.1_Missense_Mutation_p.A316S	NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2	316	Cytoplasmic (Potential).				body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		TGAAGGGAGGCGGGTAGAGAT	0.483													6	58	---	---	---	---	PASS
PLG	5340	broad.mit.edu	37	6	161139408	161139408	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161139408C>T	uc003qtm.3	+	8	933	c.870C>T	c.(868-870)ACC>ACT	p.T290T		NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen	290	Kringle 3.				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	TGGCTGTTACCGTGTCCGGGC	0.532													6	51	---	---	---	---	PASS
TBP	6908	broad.mit.edu	37	6	170871052	170871052	+	Silent	SNP	G	A	A	rs112083427		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170871052G>A	uc003qxt.2	+	3	460	c.228G>A	c.(226-228)CAG>CAA	p.Q76Q	TBP_uc003qxu.2_Silent_p.Q76Q|TBP_uc011ehf.1_Silent_p.Q56Q|TBP_uc011ehg.1_Silent_p.Q76Q	NM_003194	NP_003185	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription from RNA polymerase III promoter|viral reproduction	transcription factor TFIIA complex|transcription factor TFIID complex	repressing transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.159													3	2	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21584692	21584692	+	Silent	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21584692T>C	uc003svc.2	+	2	451	c.420T>C	c.(418-420)AAT>AAC	p.N140N		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	140	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TTGGAGTAAATGACTTTTCTC	0.338									Kartagener_syndrome				6	4	---	---	---	---	PASS
TXNDC3	51314	broad.mit.edu	37	7	37927962	37927962	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37927962T>A	uc003tfn.2	+	15	1703	c.1331T>A	c.(1330-1332)ATA>AAA	p.I444K		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	444	NDK 2.				cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						GAAAGGGAAATACAGCATTTC	0.373									Kartagener_syndrome				14	29	---	---	---	---	PASS
COBL	23242	broad.mit.edu	37	7	51097005	51097005	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51097005T>A	uc003tpr.3	-	10	1973	c.1788A>T	c.(1786-1788)GAA>GAT	p.E596D	COBL_uc003tps.2_Missense_Mutation_p.E653D|COBL_uc011kcl.1_Missense_Mutation_p.E596D|COBL_uc003tpp.3_Missense_Mutation_p.E382D|COBL_uc003tpq.3_Missense_Mutation_p.E537D|COBL_uc003tpo.3_Missense_Mutation_p.E138D	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	596										skin(3)|ovary(2)	5	Glioma(55;0.08)					GGGCAGGTACTTCCTCCCTTG	0.562													23	86	---	---	---	---	PASS
FKBP6	8468	broad.mit.edu	37	7	72744366	72744366	+	Intron	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72744366G>C	uc003tya.2	+						FKBP6_uc003twz.2_Intron|FKBP6_uc011kew.1_Intron|FKBP6_uc010lbe.1_Intron|TRIM50_uc003txy.1_5'Flank|TRIM50_uc003txz.1_5'Flank	NM_003602	NP_003593	O75344	FKBP6_HUMAN	FK506 binding protein 6 isoform a						protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				GTAAGTTCCAGAGCACAGATG	0.493													7	48	---	---	---	---	PASS
CCDC132	55610	broad.mit.edu	37	7	92940500	92940500	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92940500A>G	uc003umo.2	+	20	1899	c.1771A>G	c.(1771-1773)AGC>GGC	p.S591G	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Missense_Mutation_p.S561G|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Missense_Mutation_p.S311G	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	591											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			AACTCTAAAAAGCAGGAAGAA	0.353													19	36	---	---	---	---	PASS
DYNC1I1	1780	broad.mit.edu	37	7	95665060	95665060	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95665060G>A	uc003uoc.3	+	13	1688	c.1411G>A	c.(1411-1413)GGA>AGA	p.G471R	DYNC1I1_uc003uod.3_Missense_Mutation_p.G454R|DYNC1I1_uc003uob.2_Missense_Mutation_p.G434R|DYNC1I1_uc003uoe.3_Missense_Mutation_p.G451R|DYNC1I1_uc010lfl.2_Missense_Mutation_p.G460R	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	471	WD 4.				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TTGTCGTCATGGAAGGTGATT	0.443													78	136	---	---	---	---	PASS
PSMC2	5701	broad.mit.edu	37	7	103004738	103004738	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103004738A>C	uc003vbs.2	+	8	810	c.740A>C	c.(739-741)CAG>CCG	p.Q247P	SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|PSMC2_uc011klo.1_Missense_Mutation_p.Q110P	NM_002803	NP_002794	P35998	PRS7_HUMAN	proteasome 26S ATPase subunit 2	247					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding				0						GAGCTTGTACAGAAATACGTC	0.413													52	87	---	---	---	---	PASS
CAV1	857	broad.mit.edu	37	7	116166568	116166568	+	Intron	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116166568G>T	uc003vif.1	+						CAV1_uc010lkd.1_Intron|CAV1_uc010lke.1_Intron|CAV1_uc003vig.1_Intron|CAV1_uc003vih.2_5'UTR|CAV1_uc010lkf.1_Intron	NM_001753	NP_001744	Q03135	CAV1_HUMAN	caveolin 1						blood coagulation|calcium ion transport|caveola assembly|cellular response to starvation|cholesterol homeostasis|cytosolic calcium ion homeostasis|inactivation of MAPK activity|interspecies interaction between organisms|leukocyte migration|lipid storage|maintenance of protein location in cell|mammary gland involution|membrane depolarization|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of endothelial cell proliferation|negative regulation of epithelial cell differentiation|negative regulation of nitric oxide biosynthetic process|negative regulation of peptidyl-serine phosphorylation|negative regulation of protein binding|negative regulation of transcription from RNA polymerase II promoter|nitric oxide homeostasis|nitric oxide metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of metalloenzyme activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of vasoconstriction|protein homooligomerization|receptor internalization|regulation of blood coagulation|regulation of fatty acid metabolic process|regulation of nitric-oxide synthase activity|regulation of smooth muscle contraction|response to calcium ion|response to estrogen stimulus|response to hypoxia|response to progesterone stimulus|skeletal muscle tissue development|T cell costimulation|triglyceride metabolic process|vasculogenesis|vesicle organization	apical plasma membrane|basolateral plasma membrane|caveola|caveola|cytosol|endoplasmic reticulum|endosome|Golgi membrane|lipid particle|perinuclear region of cytoplasm	cholesterol binding|nitric-oxide synthase binding|peptidase activator activity|protein binding|protein complex scaffold|receptor binding				0	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)			TCCGCCCTCCGCCCTCTGCAG	0.602											OREG0018273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	46	70	---	---	---	---	PASS
IQUB	154865	broad.mit.edu	37	7	123150084	123150084	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123150084C>A	uc003vkn.2	-	3	980	c.403G>T	c.(403-405)GTT>TTT	p.V135F	IQUB_uc003vko.2_Missense_Mutation_p.V135F|IQUB_uc010lkt.2_RNA|IQUB_uc003vkp.1_Missense_Mutation_p.V135F|IQUB_uc003vkq.2_Missense_Mutation_p.V135F	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	135	Ubiquitin-like.									ovary(3)|large_intestine(1)	4						ATAAGTACAACTTTTACTGTA	0.303													10	45	---	---	---	---	PASS
POT1	25913	broad.mit.edu	37	7	124493159	124493159	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124493159T>A	uc003vlm.2	-	10	1337	c.736A>T	c.(736-738)ACC>TCC	p.T246S	POT1_uc011koe.1_RNA|POT1_uc003vlk.2_RNA|POT1_uc003vll.2_RNA|POT1_uc003vlo.2_Missense_Mutation_p.T115S|POT1_uc003vln.2_RNA	NM_015450	NP_056265	Q9NUX5	POTE1_HUMAN	protection of telomeres 1 isoform 1	246					DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity			central_nervous_system(1)	1						TGAAGTTTGGTATGAAGGCTA	0.328													4	10	---	---	---	---	PASS
FAM115A	9747	broad.mit.edu	37	7	143556250	143556250	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143556250C>T	uc003wdo.1	-	7	2305	c.2172G>A	c.(2170-2172)TGG>TGA	p.W724*	FAM115A_uc011ktu.1_Nonsense_Mutation_p.W300*|FAM115A_uc003wdp.1_Nonsense_Mutation_p.W724*	NM_014719	NP_055534	Q9Y4C2	F115A_HUMAN	hypothetical protein LOC9747	724											0	Melanoma(164;0.0903)					CTGCATGCATCCAGCCTGGAA	0.507													18	118	---	---	---	---	PASS
ARHGEF5	7984	broad.mit.edu	37	7	144060770	144060770	+	Silent	SNP	T	C	C	rs141931104	by1000genomes	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144060770T>C	uc003wel.2	+	2	1126	c.1008T>C	c.(1006-1008)AAT>AAC	p.N336N	ARHGEF5_uc003wek.2_Silent_p.N336N	NM_005435	NP_005426	Q12774	ARHG5_HUMAN	rho guanine nucleotide exchange factor 5	336					intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)					CAGAAGAGAATAGGGCGGACT	0.512													4	337	---	---	---	---	PASS
WDR60	55112	broad.mit.edu	37	7	158723180	158723180	+	Silent	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158723180T>C	uc003woe.3	+	21	2678	c.2520T>C	c.(2518-2520)CAT>CAC	p.H840H	WDR60_uc010lqv.2_RNA|WDR60_uc010lqw.2_Silent_p.H472H	NM_018051	NP_060521	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	840										ovary(2)|breast(1)|central_nervous_system(1)	4	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		AGCTGGTACATAGTGCTCTGA	0.398													9	16	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	2876175	2876175	+	Intron	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2876175A>G	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CGAGATAACTAGAAGGAAAAA	0.338													14	63	---	---	---	---	PASS
SH2D4A	63898	broad.mit.edu	37	8	19192231	19192231	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19192231A>C	uc003wzb.2	+	4	712	c.376A>C	c.(376-378)AAA>CAA	p.K126Q	SH2D4A_uc011kym.1_Missense_Mutation_p.K81Q|SH2D4A_uc003wzc.2_Missense_Mutation_p.K126Q	NM_022071	NP_071354	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	126						cytoplasm|nucleus	protein binding				0				Colorectal(111;0.0732)		CAATAGCTTGAAAACAAAATC	0.413													30	39	---	---	---	---	PASS
EGR3	1960	broad.mit.edu	37	8	22548882	22548882	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22548882C>A	uc003xcm.1	-	2	626	c.268G>T	c.(268-270)GCC>TCC	p.A90S	EGR3_uc011kzn.1_Missense_Mutation_p.A52S|EGR3_uc011kzo.1_Missense_Mutation_p.A36S	NM_004430	NP_004421	Q06889	EGR3_HUMAN	early growth response 3	90					circadian rhythm|muscle organ development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Prostate(55;0.0421)|Breast(100;0.102)		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)		GAGTCGAAGGCGAACTTTCCC	0.617													52	166	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38186925	38186925	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38186925A>G	uc003xli.2	-	6	2070	c.1552T>C	c.(1552-1554)TTT>CTT	p.F518L	WHSC1L1_uc011lbm.1_Missense_Mutation_p.F518L|WHSC1L1_uc010lwe.2_Missense_Mutation_p.F518L|WHSC1L1_uc003xlj.2_Missense_Mutation_p.F518L	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	518					cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			TGATCGATAAATTTCCCATCC	0.388			T	NUP98	AML								15	39	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41574571	41574571	+	Splice_Site	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41574571T>C	uc003xok.2	-	13	1390	c.1306_splice	c.e13-1	p.K436_splice	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Splice_Site_p.K436_splice|ANK1_uc003xoj.2_Splice_Site_p.K436_splice|ANK1_uc003xol.2_Splice_Site_p.K436_splice|ANK1_uc003xom.2_Splice_Site_p.K469_splice	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CTCCACTTTCTATAAAATAAC	0.478													46	144	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61655366	61655366	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61655366C>A	uc003xue.2	+	2	1852	c.1375C>A	c.(1375-1377)CGT>AGT	p.R459S		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	459	Pro-rich.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GCAGCAGTCTCGTCCATTTAT	0.542													3	45	---	---	---	---	PASS
YTHDF3	253943	broad.mit.edu	37	8	64099962	64099962	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64099962T>C	uc003xuy.2	+	5	1709	c.1393T>C	c.(1393-1395)TTC>CTC	p.F465L	YTHDF3_uc010lys.2_Missense_Mutation_p.F409L|YTHDF3_uc003xuz.2_Missense_Mutation_p.F409L|YTHDF3_uc003xva.2_Missense_Mutation_p.F409L|YTHDF3_uc011len.1_Missense_Mutation_p.F409L	NM_152758	NP_689971	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3	465	YTH.										0	Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			CTATTTACTCTTCAGTGTGAA	0.438													11	30	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77690550	77690550	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77690550G>T	uc003yav.2	+	4	3509	c.3122G>T	c.(3121-3123)CGT>CTT	p.R1041L	ZFHX4_uc003yau.1_Missense_Mutation_p.R1067L|ZFHX4_uc003yaw.1_Missense_Mutation_p.R1041L	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1041	C2H2-type 7.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAACATGTCCGTTCGGTGAAG	0.517										HNSCC(33;0.089)			34	82	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77763734	77763734	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77763734G>A	uc003yav.2	+	10	4829	c.4442G>A	c.(4441-4443)GGG>GAG	p.G1481E	ZFHX4_uc003yau.1_Missense_Mutation_p.G1526E|ZFHX4_uc003yaw.1_Missense_Mutation_p.G1481E	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1481						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTTAGAAAAGGGCCCAATTTT	0.433										HNSCC(33;0.089)			7	10	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77763735	77763735	+	Silent	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77763735G>T	uc003yav.2	+	10	4830	c.4443G>T	c.(4441-4443)GGG>GGT	p.G1481G	ZFHX4_uc003yau.1_Silent_p.G1526G|ZFHX4_uc003yaw.1_Silent_p.G1481G	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1481						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTAGAAAAGGGCCCAATTTTA	0.428										HNSCC(33;0.089)			6	10	---	---	---	---	PASS
KCNV1	27012	broad.mit.edu	37	8	110980540	110980540	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110980540A>G	uc003ynr.3	-	3	1622	c.1280T>C	c.(1279-1281)ATT>ACT	p.I427T	KCNV1_uc010mcw.2_Missense_Mutation_p.I427T	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	427	Helical; Name=Segment S6; (Potential).					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			GCGATCGTTAATAATAGCAAT	0.448													3	70	---	---	---	---	PASS
EFR3A	23167	broad.mit.edu	37	8	132996486	132996486	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132996486C>G	uc003yte.2	+	15	1877	c.1676C>G	c.(1675-1677)ACT>AGT	p.T559S		NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A	559						plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			GCTCTTATAACTATTGAACTG	0.363													16	22	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139629158	139629158	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139629158C>T	uc003yvd.2	-	54	4316	c.3869G>A	c.(3868-3870)CGG>CAG	p.R1290Q	COL22A1_uc011ljo.1_Missense_Mutation_p.R570Q	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1290	Pro-rich.|Gly-rich.|Collagen-like 12.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCCACTTACCCGGGGACCGGG	0.572										HNSCC(7;0.00092)			7	56	---	---	---	---	PASS
NAPRT1	93100	broad.mit.edu	37	8	144658690	144658690	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144658690A>T	uc003yym.3	-	7	959	c.934T>A	c.(934-936)TAC>AAC	p.Y312N	NAPRT1_uc003yyn.3_Missense_Mutation_p.Y312N|NAPRT1_uc011lkh.1_Missense_Mutation_p.Y312N|NAPRT1_uc003yyo.3_Missense_Mutation_p.Y312N	NM_145201	NP_660202	Q6XQN6	PNCB_HUMAN	nicotinate phosphoribosyltransferase domain	312					nicotinamide metabolic process|nicotinate nucleotide salvage|response to oxidative stress|water-soluble vitamin metabolic process	cytosol|Golgi apparatus|nucleus	nicotinate phosphoribosyltransferase activity|nicotinate-nucleotide diphosphorylase (carboxylating) activity			ovary(1)	1	all_cancers(97;6.49e-11)|all_epithelial(106;4.73e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.014)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ACTGCCCGGTAGCCCAGCTCT	0.617													12	40	---	---	---	---	PASS
FRMPD1	22844	broad.mit.edu	37	9	37740403	37740403	+	Silent	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37740403C>G	uc004aag.1	+	15	1922	c.1878C>G	c.(1876-1878)ACC>ACG	p.T626T	FRMPD1_uc004aah.1_Silent_p.T626T|FRMPD1_uc011lqm.1_Silent_p.T448T|FRMPD1_uc011lqn.1_Silent_p.T495T	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	626						cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		GCAGGTCCACCTTCTTCCACT	0.587													30	21	---	---	---	---	PASS
WNK2	65268	broad.mit.edu	37	9	96061478	96061478	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96061478G>T	uc004ati.1	+	25	6161	c.6161G>T	c.(6160-6162)CGG>CTG	p.R2054L	WNK2_uc011lud.1_Missense_Mutation_p.R2017L|WNK2_uc004atj.2_Missense_Mutation_p.R2017L|WNK2_uc004atk.2_Intron|WNK2_uc004atl.1_Missense_Mutation_p.R611L	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	2054					intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						TGCTCCGTCCGGGCCTCCCTG	0.657													30	52	---	---	---	---	PASS
C9orf84	158401	broad.mit.edu	37	9	114521017	114521017	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114521017A>G	uc004bfr.2	-	4	497	c.362T>C	c.(361-363)TTA>TCA	p.L121S	C9orf84_uc011lwt.1_RNA|C9orf84_uc004bfs.1_Missense_Mutation_p.L185S|C9orf84_uc004bfq.2_Missense_Mutation_p.L82S|C9orf84_uc010mug.2_Missense_Mutation_p.L67S	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1	121										ovary(2)	2						TTTGAAATCTAAAAGAGGATC	0.318													10	13	---	---	---	---	PASS
C10orf18	54906	broad.mit.edu	37	10	5777516	5777516	+	Intron	SNP	A	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5777516A>C	uc001iij.2	+						C10orf18_uc001iik.2_Intron	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906											ovary(1)|central_nervous_system(1)	2						CCTGGTAAGAAATACTCTTCC	0.363													19	54	---	---	---	---	PASS
ITIH2	3698	broad.mit.edu	37	10	7759670	7759670	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7759670C>T	uc001ijs.2	+	6	711	c.549C>T	c.(547-549)TAC>TAT	p.Y183Y		NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide	183	VIT.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3						AACTTCACTACCAGGAGGTGA	0.517													42	204	---	---	---	---	PASS
ACBD7	414149	broad.mit.edu	37	10	15120603	15120603	+	Intron	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15120603C>T	uc001inv.2	-						ACBD7_uc010qby.1_Intron	NM_001039844	NP_001034933	Q8N6N7	ACBD7_HUMAN	acyl-Coenzyme A binding domain containing 7								fatty-acyl-CoA binding				0						GTCGACAACCCTAGAAAGATA	0.368													32	35	---	---	---	---	PASS
GJD4	219770	broad.mit.edu	37	10	35896661	35896661	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35896661C>T	uc001iyy.1	+	2	378	c.220C>T	c.(220-222)CAC>TAC	p.H74Y		NM_153368	NP_699199	Q96KN9	CXD4_HUMAN	connexin40.1	74	Extracellular (Potential).				cell communication	connexon complex|integral to membrane				large_intestine(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						CCCCGTGTCTCACCTGCGGTT	0.657													60	306	---	---	---	---	PASS
FRMPD2	143162	broad.mit.edu	37	10	49448520	49448520	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49448520C>A	uc001jgi.2	-	6	690	c.583G>T	c.(583-585)GTG>TTG	p.V195L	FRMPD2_uc001jgh.2_Missense_Mutation_p.V164L|FRMPD2_uc001jgj.2_Missense_Mutation_p.V173L	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	195	KIND.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		CTTTCCTCCACAACTCTTTTC	0.557													13	68	---	---	---	---	PASS
SLC18A3	6572	broad.mit.edu	37	10	50820269	50820269	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50820269G>T	uc001jhw.2	+	1	1923	c.1483G>T	c.(1483-1485)GAT>TAT	p.D495Y	CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank|CHAT_uc010qgs.1_5'Flank	NM_003055	NP_003046	Q16572	VACHT_HUMAN	vesicular acetylcholine transporter	495	Cytoplasmic (Potential).				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity			ovary(2)	2						AGGTCTGTACGATGCGGTGCG	0.647													4	149	---	---	---	---	PASS
C10orf53	282966	broad.mit.edu	37	10	50902574	50902574	+	Intron	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50902574G>A	uc001jib.2	+						C10orf53_uc001jic.1_3'UTR|C10orf53_uc001jid.1_Intron	NM_001042427	NP_001035892	Q8N6V4	CJ053_HUMAN	chromosome 10 open reading frame 53 isoform b												0		all_neural(218;0.107)				AATTATATCTGTTTCCCTAGG	0.443													13	17	---	---	---	---	PASS
ZNF365	22891	broad.mit.edu	37	10	64136627	64136627	+	Silent	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64136627C>A	uc001jmc.2	+	2	990	c.675C>A	c.(673-675)GCC>GCA	p.A225A	ZNF365_uc001jly.3_Silent_p.A240A|ZNF365_uc001jmb.3_Silent_p.A225A|ZNF365_uc001jlz.3_Silent_p.A225A|ZNF365_uc001jma.3_Intron	NM_199451	NP_955523	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform C	Error:Variant_position_missing_in_Q70YC4_after_alignment										ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					TGGACGTGGCCGTGGAAATGA	0.522													51	78	---	---	---	---	PASS
LRRTM3	347731	broad.mit.edu	37	10	68687044	68687044	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68687044T>A	uc001jmz.1	+	2	920	c.370T>A	c.(370-372)TTT>ATT	p.F124I	CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Missense_Mutation_p.F124I	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	124	LRR 3.|Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						AATCTCCTATTTTCTTAACAA	0.393													85	103	---	---	---	---	PASS
CYP2C8	1558	broad.mit.edu	37	10	96802818	96802818	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96802818C>A	uc001kkb.2	-	7	1073	c.978G>T	c.(976-978)GAG>GAT	p.E326D	CYP2C8_uc001kkc.2_RNA|CYP2C8_uc010qoa.1_Missense_Mutation_p.E256D|CYP2C8_uc010qob.1_Missense_Mutation_p.E240D|CYP2C8_uc010qoc.1_Missense_Mutation_p.E224D|CYP2C8_uc010qod.1_Missense_Mutation_p.E240D	NM_000770	NP_000761	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C,	326					exogenous drug catabolic process|organic acid metabolic process|oxidative demethylation|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|electron carrier activity|heme binding|oxygen binding				0		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Aminophenazone(DB01424)|Amiodarone(DB01118)|Amodiaquine(DB00613)|Benzphetamine(DB00865)|Carbamazepine(DB00564)|Cerivastatin(DB00439)|Diclofenac(DB00586)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lovastatin(DB00227)|Midazolam(DB00683)|Montelukast(DB00471)|Nicardipine(DB00622)|Paclitaxel(DB01229)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rifampin(DB01045)|Rosiglitazone(DB00412)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Tolbutamide(DB01124)|Torasemide(DB00214)|Tretinoin(DB00755)|Trimethoprim(DB00440)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zopiclone(DB01198)	CATGATCAATCTCTTCCTGGA	0.438													37	19	---	---	---	---	PASS
HSPA12A	259217	broad.mit.edu	37	10	118464801	118464801	+	Intron	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118464801C>A	uc001lct.2	-						HSPA12A_uc001lcu.2_Intron	NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A								ATP binding			ovary(1)	1				all cancers(201;0.0158)		TGCAGATATACAGTGAGGCAT	0.577													85	73	---	---	---	---	PASS
KCNK18	338567	broad.mit.edu	37	10	118969311	118969311	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118969311C>T	uc010qsr.1	+	3	656	c.656C>T	c.(655-657)TCA>TTA	p.S219L		NM_181840	NP_862823	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	219	Cytoplasmic (Potential).					integral to membrane|plasma membrane				upper_aerodigestive_tract(1)	1		Colorectal(252;0.19)		all cancers(201;0.0211)		ACATGTCCTTCACGCCCAAGC	0.532													5	68	---	---	---	---	PASS
SPTY2D1	144108	broad.mit.edu	37	11	18636721	18636721	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18636721C>G	uc001moy.2	-	3	1316	c.1100G>C	c.(1099-1101)GGT>GCT	p.G367A	SPTY2D1_uc010rdi.1_Missense_Mutation_p.G367A	NM_194285	NP_919261	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1	367	Ser-rich.									breast(1)	1						CTGCCTGACACCTGGACTCTT	0.587													5	235	---	---	---	---	PASS
OR4S2	219431	broad.mit.edu	37	11	55419124	55419124	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55419124T>A	uc001nhs.1	+	1	745	c.745T>A	c.(745-747)TTC>ATC	p.F249I		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	249	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				CGTTATCTTTTTCGGCCCCTG	0.483													16	90	---	---	---	---	PASS
OR4S2	219431	broad.mit.edu	37	11	55419125	55419125	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55419125T>A	uc001nhs.1	+	1	746	c.746T>A	c.(745-747)TTC>TAC	p.F249Y		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	249	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				GTTATCTTTTTCGGCCCCTGT	0.478													16	87	---	---	---	---	PASS
OR5M8	219484	broad.mit.edu	37	11	56258190	56258190	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56258190G>T	uc001nix.1	-	1	657	c.657C>A	c.(655-657)TAC>TAA	p.Y219*		NM_001005282	NP_001005282	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M,	219	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	Esophageal squamous(21;0.00352)					CAGGGAAAATGTAAAGGTAGG	0.408													21	50	---	---	---	---	PASS
OR5B2	390190	broad.mit.edu	37	11	58190445	58190445	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58190445A>G	uc010rkg.1	-	1	290	c.290T>C	c.(289-291)GTT>GCT	p.V97A		NM_001005566	NP_001005566	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B,	97	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GAACATCTGAACAGCACATGC	0.502													25	68	---	---	---	---	PASS
OR5A2	219981	broad.mit.edu	37	11	59190177	59190177	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59190177A>G	uc010rkt.1	-	1	250	c.250T>C	c.(250-252)TCT>CCT	p.S84P		NM_001001954	NP_001001954	Q8NGI9	OR5A2_HUMAN	olfactory receptor, family 5, subfamily A,	84	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATGATGTCAGACAGCATCTTA	0.502													28	44	---	---	---	---	PASS
PLCB3	5331	broad.mit.edu	37	11	64032799	64032799	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64032799C>T	uc001nzb.2	+	25	2860	c.2860C>T	c.(2860-2862)CTG>TTG	p.L954L	PLCB3_uc009ypg.1_Silent_p.L954L|PLCB3_uc009yph.1_Silent_p.L887L|PLCB3_uc009ypi.2_Silent_p.L954L	NM_000932	NP_000923	Q01970	PLCB3_HUMAN	phospholipase C beta 3	954					intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2						CCCCACCCCGCTGGATGAGCT	0.692													4	16	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64427952	64427952	+	Silent	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64427952G>A	uc001oar.2	-	12	2680	c.2241C>T	c.(2239-2241)AAC>AAT	p.N747N	NRXN2_uc001oas.2_Silent_p.N716N|NRXN2_uc001oaq.2_Silent_p.N414N	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:Variant_position_missing_in_P58401_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						TGTGCATGGCGTTAGGCAGCA	0.597													22	72	---	---	---	---	PASS
PTPRCAP	5790	broad.mit.edu	37	11	67203563	67203563	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67203563C>T	uc001oli.1	-	2	325	c.262G>A	c.(262-264)GGT>AGT	p.G88S		NM_005608	NP_005599	Q14761	PTCA_HUMAN	protein tyrosine phosphatase, receptor type,	88					defense response	integral to membrane|plasma membrane					0			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			AGCCAGCGACCTGGGGGGCTG	0.701													13	30	---	---	---	---	PASS
C11orf24	53838	broad.mit.edu	37	11	68030121	68030121	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68030121C>T	uc001onr.3	-	4	784	c.342G>A	c.(340-342)ACG>ACA	p.T114T	C11orf24_uc001ons.2_Silent_p.T114T	NM_022338	NP_071733	Q96F05	CK024_HUMAN	hypothetical protein LOC53838 precursor	114	Extracellular (Potential).					integral to membrane					0						AGGCCGCAGTCGTACTGGAGG	0.592													12	49	---	---	---	---	PASS
XRRA1	143570	broad.mit.edu	37	11	74555221	74555221	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74555221C>G	uc009yub.2	-	17	2343	c.2011G>C	c.(2011-2013)GAG>CAG	p.E671Q	XRRA1_uc001ovm.2_RNA|XRRA1_uc001ovn.2_Missense_Mutation_p.E294Q|XRRA1_uc001ovo.2_Missense_Mutation_p.E279Q|XRRA1_uc001ovq.3_Missense_Mutation_p.E584Q|XRRA1_uc001ovp.3_Missense_Mutation_p.E396Q|XRRA1_uc001ovr.2_Missense_Mutation_p.E294Q|XRRA1_uc001ovs.1_Missense_Mutation_p.E273Q	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1	671					response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1						ACCCGTTTCTCTTTGTGAACA	0.522													55	251	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105845102	105845102	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105845102G>T	uc001pix.2	+	16	2921	c.2475G>T	c.(2473-2475)TTG>TTT	p.L825F	GRIA4_uc001piw.2_Missense_Mutation_p.L825F|GRIA4_uc010rvm.1_RNA|GRIA4_uc009yxl.1_RNA	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	825	Helical; (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	TTGGCGGCTTGGGCTTGGCAA	0.498													16	76	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108382901	108382901	+	Silent	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108382901T>C	uc001pkk.2	-	6	3444	c.3333A>G	c.(3331-3333)AGA>AGG	p.R1111R	EXPH5_uc010rvy.1_Silent_p.R923R|EXPH5_uc010rvz.1_Silent_p.R955R|EXPH5_uc010rwa.1_Silent_p.R1035R	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	1111					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		GTGGTCCTTTTCTAACGGAAG	0.468													18	79	---	---	---	---	PASS
NCAM1	4684	broad.mit.edu	37	11	113145981	113145981	+	Intron	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113145981C>T	uc001pns.2	+						uc010rwu.1_5'Flank|NCAM1_uc001pnt.2_Intron			P13591	NCAM1_HUMAN	SubName: Full=cDNA FLJ52974, highly similar to Neural cell adhesion molecule 1, 140 kDa isoform;						axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		TTTCCTGATTCTCTGCAGGAA	0.597													6	28	---	---	---	---	PASS
HTR3A	3359	broad.mit.edu	37	11	113856900	113856900	+	Intron	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113856900G>T	uc010rxb.1	+						HTR3A_uc010rxa.1_Intron|HTR3A_uc009yyx.2_Intron|HTR3A_uc010rxc.1_Intron	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A						digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	AGTTCTATGTGAGTGGGAGTG	0.468													26	132	---	---	---	---	PASS
CRTAM	56253	broad.mit.edu	37	11	122720810	122720810	+	Silent	SNP	C	A	A	rs151156247	byFrequency	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122720810C>A	uc001pyj.2	+	2	81	c.81C>A	c.(79-81)ACC>ACA	p.T27T		NM_019604	NP_062550	O95727	CRTAM_HUMAN	class-I MHC-restricted T cell associated	27	Ig-like V-type.|Extracellular (Potential).				cell recognition|detection of tumor cell|positive regulation of cytokine secretion|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	integral to membrane|plasma membrane	receptor binding			ovary(1)	1		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		AAACCATCACCGTGGAGGAAG	0.532													3	37	---	---	---	---	PASS
OR8D1	283159	broad.mit.edu	37	11	124180028	124180028	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124180028A>G	uc010sag.1	-	1	635	c.635T>C	c.(634-636)CTA>CCA	p.L212P		NM_001002917	NP_001002917	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D,	212	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		AGCAACAGCTAGGGTGGGCAC	0.507													22	14	---	---	---	---	PASS
ESAM	90952	broad.mit.edu	37	11	124626650	124626650	+	Intron	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124626650C>T	uc001qav.3	-						ESAM_uc010sao.1_Intron|ESAM_uc001qau.3_Missense_Mutation_p.A7T|ESAM_uc001qaw.3_Intron|ESAM_uc001qax.3_Intron|ESAM_uc009zbi.2_Intron	NM_138961	NP_620411	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule precursor						blood coagulation|leukocyte migration	adherens junction|integral to membrane|tight junction					0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		TGGTGTGGGGCATAACACATC	0.557													19	20	---	---	---	---	PASS
CDON	50937	broad.mit.edu	37	11	125867207	125867207	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125867207C>T	uc009zbw.2	-	12	2385	c.2257G>A	c.(2257-2259)GCC>ACC	p.A753T	CDON_uc001qdb.3_Missense_Mutation_p.A130T|CDON_uc001qdc.3_Missense_Mutation_p.A753T	NM_016952	NP_058648	Q4KMG0	CDON_HUMAN	surface glycoprotein, Ig superfamily member	753	Fibronectin type-III 2.|Extracellular (Potential).				cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		ACTTTGAAGGCAGTGATTGGA	0.498													11	31	---	---	---	---	PASS
KLRC1	3821	broad.mit.edu	37	12	10601878	10601878	+	Silent	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10601878C>G	uc001qyl.2	-	5	611	c.447G>C	c.(445-447)TCG>TCC	p.S149S	KLRC1_uc009zhm.1_Silent_p.S149S|KLRC1_uc001qym.2_Silent_p.S131S|KLRC1_uc001qyn.2_Silent_p.S149S|KLRC1_uc001qyo.2_Silent_p.S131S	NM_002259	NP_002250	P26715	NKG2A_HUMAN	killer cell lectin-like receptor subfamily C,	149	C-type lectin.|Extracellular (Potential).				cell surface receptor linked signaling pathway|regulation of immune response	integral to plasma membrane	sugar binding|transmembrane receptor activity				0						TGGAGTTCTTCGAAGTACAGG	0.328													20	150	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12311984	12311984	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12311984C>T	uc001rah.3	-	12	2712	c.2570G>A	c.(2569-2571)CGT>CAT	p.R857H	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.R857H	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	857	Extracellular (Potential).|Beta-propeller 3.|LDL-receptor class B 15.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				TTTGTTGGCACGCTCAATGCT	0.488													23	34	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	21960410	21960410	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21960410G>C	uc001rfi.1	-	36	4339	c.4319C>G	c.(4318-4320)GCG>GGG	p.A1440G	ABCC9_uc001rfh.2_Missense_Mutation_p.A1440G|ABCC9_uc001rfj.1_Missense_Mutation_p.A1404G|ABCC9_uc001rfg.2_5'UTR	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1440	Cytoplasmic (Potential).|ABC transporter 2.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AGTGACAACCGCATCTAAATC	0.398													19	49	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43819310	43819310	+	Intron	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43819310A>G	uc010skx.1	-						ADAMTS20_uc001rno.1_Intron	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with							proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CAAGAGTGCTATCATACCGAT	0.353													10	7	---	---	---	---	PASS
NELL2	4753	broad.mit.edu	37	12	45105132	45105132	+	Missense_Mutation	SNP	C	A	A	rs142043324		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45105132C>A	uc001rog.2	-	11	1727	c.1132G>T	c.(1132-1134)GAT>TAT	p.D378Y	NELL2_uc001rof.3_Missense_Mutation_p.D377Y|NELL2_uc001roh.2_Missense_Mutation_p.D378Y|NELL2_uc009zkd.2_Missense_Mutation_p.D377Y|NELL2_uc010skz.1_Missense_Mutation_p.D428Y|NELL2_uc010sla.1_Missense_Mutation_p.D401Y|NELL2_uc001roi.1_Missense_Mutation_p.D378Y|NELL2_uc010slb.1_Missense_Mutation_p.D377Y|NELL2_uc001roj.2_Missense_Mutation_p.D378Y	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	378	VWFC 2.				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		TCTGGACAATCCAAAGCTGGA	0.378													15	30	---	---	---	---	PASS
PLEKHA9	51054	broad.mit.edu	37	12	45567236	45567236	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45567236C>T	uc001rom.1	-	3	1450	c.913G>A	c.(913-915)GAA>AAA	p.E305K	PLEKHA9_uc009zke.2_Missense_Mutation_p.E305K	NM_015899	NP_056983			pleckstrin homology domain containing, family A												0	Lung SC(27;0.192)|Renal(347;0.236)			GBM - Glioblastoma multiforme(48;0.173)		TTTTTCACTTCTGTCAAAAAT	0.483													14	82	---	---	---	---	PASS
VDR	7421	broad.mit.edu	37	12	48249571	48249571	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48249571C>T	uc001rqm.2	-	8	879	c.597G>A	c.(595-597)TCG>TCA	p.S199S	VDR_uc001rql.2_Silent_p.S249S|VDR_uc001rqn.2_Silent_p.S199S|VDR_uc010slq.1_Silent_p.S167S	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor	199	Ligand-binding.				decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	AGAAGCTGGACGAGTCCATCA	0.547													4	97	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49443464	49443464	+	Splice_Site	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49443464C>A	uc001rta.3	-	11	3906	c.3906_splice	c.e11+1	p.Q1302_splice		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2						chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						TAGCCCCTCACCTGTTTGATG	0.567			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			29	48	---	---	---	---	PASS
MAP3K12	7786	broad.mit.edu	37	12	53877794	53877794	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53877794C>T	uc001sdm.1	-	9	1258	c.1160G>A	c.(1159-1161)CGG>CAG	p.R387Q	MAP3K12_uc001sdn.1_Missense_Mutation_p.R420Q	NM_006301	NP_006292	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase	387					histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			lung(2)|ovary(1)|breast(1)|skin(1)	5						TACTTCTTCCCGCCACTCTGC	0.532													16	91	---	---	---	---	PASS
RBMS2	5939	broad.mit.edu	37	12	56975191	56975191	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56975191G>T	uc001sln.2	+	7	830	c.631G>T	c.(631-633)GAT>TAT	p.D211Y	RBMS2_uc010sqp.1_Missense_Mutation_p.D66Y|RBMS2_uc010sqq.1_Missense_Mutation_p.D86Y|RBMS2_uc009zou.2_5'UTR	NM_002898	NP_002889	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting	211	RRM 2.				RNA processing	nucleus	nucleotide binding|RNA binding				0						AGCCCCATCCGATCCCTTGCT	0.532													17	32	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	71029760	71029760	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71029760G>A	uc001swc.3	-	2	186	c.142C>T	c.(142-144)CAG>TAG	p.Q48*	PTPRB_uc001swa.3_Nonsense_Mutation_p.Q48*|PTPRB_uc001swd.3_Nonsense_Mutation_p.Q47*|PTPRB_uc009zrr.1_Nonsense_Mutation_p.Q48*|PTPRB_uc001swe.2_Nonsense_Mutation_p.Q48*	NM_001109754	NP_001103224	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	Error:Variant_position_missing_in_P23467_after_alignment					angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TGCTGGTTCTGGATGGTCCTG	0.493													7	17	---	---	---	---	PASS
ATP2B1	490	broad.mit.edu	37	12	90028892	90028892	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90028892A>T	uc001tbh.2	-	3	724	c.543T>A	c.(541-543)TTT>TTA	p.F181L	ATP2B1_uc001tbg.2_Missense_Mutation_p.F181L	NM_001682	NP_001673	P20020	AT2B1_HUMAN	plasma membrane calcium ATPase 1 isoform 1b	181	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						GCAAACCTCTAAACTGTTTTT	0.433													24	42	---	---	---	---	PASS
VEZT	55591	broad.mit.edu	37	12	95668571	95668571	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95668571C>A	uc001tdz.2	+	7	1007	c.902C>A	c.(901-903)CCT>CAT	p.P301H	VEZT_uc009ztb.1_RNA|VEZT_uc009ztc.1_5'UTR|VEZT_uc001tdy.2_RNA	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane	301						acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						TGTGTGGTGCCTTTTAAAGAG	0.428													6	79	---	---	---	---	PASS
HAL	3034	broad.mit.edu	37	12	96381964	96381964	+	Intron	SNP	T	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96381964T>G	uc001tem.1	-						HAL_uc009zti.1_Intron|HAL_uc010suw.1_Intron|HAL_uc010sux.1_Intron	NM_002108	NP_002099	P42357	HUTH_HUMAN	histidine ammonia-lyase						biosynthetic process|histidine catabolic process	cytosol	histidine ammonia-lyase activity			ovary(2)|skin(1)	3					L-Histidine(DB00117)	TTCTTGAGTTTCCTTACCTCT	0.303													32	51	---	---	---	---	PASS
C12orf63	374467	broad.mit.edu	37	12	97052002	97052002	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97052002G>A	uc001tet.1	+	5	691	c.613G>A	c.(613-615)GAA>AAA	p.E205K		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	205										skin(6)|ovary(1)	7						GAGGTATACAGAACAAGTGAC	0.378													10	79	---	---	---	---	PASS
FOXN4	121643	broad.mit.edu	37	12	109717646	109717646	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109717646C>A	uc001toe.3	-	10	1489	c.1384G>T	c.(1384-1386)GCC>TCC	p.A462S	FOXN4_uc009zvg.2_Missense_Mutation_p.A259S|FOXN4_uc001tof.3_Missense_Mutation_p.A282S	NM_213596	NP_998761	Q96NZ1	FOXN4_HUMAN	forkhead box N4	462					axon extension|embryo development|organ development|pattern specification process|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|lung(1)	2						AGGCCTGAGGCCCCCAGGTCA	0.612													23	19	---	---	---	---	PASS
ACAD10	80724	broad.mit.edu	37	12	112147496	112147496	+	Intron	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112147496T>C	uc001tsq.2	+						ACAD10_uc009zvw.2_Missense_Mutation_p.V233A|ACAD10_uc001tso.3_Intron|ACAD10_uc001tsp.2_Intron|ACAD10_uc009zvx.2_Intron|ACAD10_uc001tsr.2_5'Flank	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10								acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						AAGGTAATAGTCACTAATTTT	0.438													16	29	---	---	---	---	PASS
SDSL	113675	broad.mit.edu	37	12	113866227	113866227	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113866227G>A	uc001tvi.2	+	4	387	c.177G>A	c.(175-177)ATG>ATA	p.M59I	SDSL_uc009zwh.2_Missense_Mutation_p.M59I	NM_138432	NP_612441	Q96GA7	SDSL_HUMAN	serine dehydratase-like	59					cellular amino acid metabolic process		L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)	CTTCCCAGATGGCCAAGAAGG	0.557													12	24	---	---	---	---	PASS
VPS33A	65082	broad.mit.edu	37	12	122724483	122724483	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122724483T>A	uc001ucd.2	-	9	1219	c.1106A>T	c.(1105-1107)GAC>GTC	p.D369V	VPS33A_uc001ucc.2_RNA	NM_022916	NP_075067	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33A	369					lysosome localization|melanosome localization|platelet formation|protein transport|regulation of developmental pigmentation|vesicle docking involved in exocytosis	early endosome|late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			skin(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		ATCAAAAAAGTCTTCAGAAGC	0.318													21	41	---	---	---	---	PASS
CCDC70	83446	broad.mit.edu	37	13	52440012	52440012	+	Silent	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52440012G>A	uc001vfu.3	+	2	794	c.498G>A	c.(496-498)GAG>GAA	p.E166E	uc010tgr.1_RNA	NM_031290	NP_112580	Q6NSX1	CCD70_HUMAN	coiled-coil domain containing 70 precursor	166						extracellular region|plasma membrane					0		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.0107)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;2.4e-08)		TGTGGGTAGAGGAAAGAGCCC	0.557													77	54	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77900796	77900796	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77900796T>A	uc001vkf.2	-	2	92	c.1A>T	c.(1-3)ATG>TTG	p.M1L	MYCBP2_uc010aev.2_5'UTR	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	1					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GGAACCGGCATGAACAGCGCC	0.756													4	0	---	---	---	---	PASS
GPR18	2841	broad.mit.edu	37	13	99908124	99908124	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99908124C>G	uc001voe.3	-	3	504	c.3G>C	c.(1-3)ATG>ATC	p.M1I	UBAC2_uc001voa.3_Intron|UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron|GPR18_uc010afv.2_Missense_Mutation_p.M1I	NM_005292	NP_005283	Q14330	GPR18_HUMAN	G protein-coupled receptor 18	1	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled				0	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Glycine(DB00145)	TCAGGGTGATCATTTTACAGC	0.323													16	63	---	---	---	---	PASS
LIG4	3981	broad.mit.edu	37	13	108862405	108862405	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108862405C>T	uc001vqn.2	-	2	1485	c.1212G>A	c.(1210-1212)CAG>CAA	p.Q404Q	LIG4_uc001vqo.2_Silent_p.Q404Q|LIG4_uc010agg.1_Silent_p.Q337Q|LIG4_uc010agf.2_Silent_p.Q404Q|LIG4_uc001vqp.2_Silent_p.Q404Q	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	404					cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					CTTGTGTTTTCTGCACTATTT	0.333								NHEJ					10	74	---	---	---	---	PASS
COL4A2	1284	broad.mit.edu	37	13	111125434	111125434	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111125434G>T	uc001vqx.2	+	29	2651	c.2362G>T	c.(2362-2364)GGT>TGT	p.G788C		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	788	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GGGAGATGCTGGTGTGCCTGG	0.701													7	6	---	---	---	---	PASS
OR4K15	81127	broad.mit.edu	37	14	20443879	20443879	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20443879C>G	uc010tkx.1	+	1	202	c.202C>G	c.(202-204)CTC>GTC	p.L68V		NM_001005486	NP_001005486	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K,	68	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GGGCAACTTTCTCATCATCCT	0.433													23	61	---	---	---	---	PASS
IRF9	10379	broad.mit.edu	37	14	24633866	24633866	+	Silent	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24633866G>A	uc001wmq.2	+	7	820	c.693G>A	c.(691-693)GTG>GTA	p.V231V	RNF31_uc001wmp.2_RNA|IRF9_uc010alj.2_Intron	NM_006084	NP_006075	Q00978	IRF9_HUMAN	interferon-stimulated transcription factor 3,	231					interferon-gamma-mediated signaling pathway|response to virus|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|nucleoplasm	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00853)		GGCGCGTGGTGGGCGAGGCCC	0.637													47	161	---	---	---	---	PASS
TM9SF1	10548	broad.mit.edu	37	14	24662104	24662104	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24662104G>C	uc001wnb.1	-	3	1065	c.717C>G	c.(715-717)ATC>ATG	p.I239M	IPO4_uc001wmz.1_5'Flank|TM9SF1_uc010toa.1_Missense_Mutation_p.I152M|TM9SF1_uc001wna.1_RNA|TM9SF1_uc010tob.1_Missense_Mutation_p.I474M|TM9SF1_uc001wnc.2_Missense_Mutation_p.I239M|TM9SF1_uc001wnd.2_Missense_Mutation_p.I95M	NM_006405	NP_006396	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1 isoform a	239	Helical; (Potential).				autophagy	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane|lysosomal membrane				ovary(1)	1				GBM - Glioblastoma multiforme(265;0.0183)		TGGAGTTGATGATGGACAACC	0.512													12	33	---	---	---	---	PASS
PLEKHG3	26030	broad.mit.edu	37	14	65203596	65203596	+	Missense_Mutation	SNP	A	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65203596A>T	uc001xho.1	+	13	1640	c.1371A>T	c.(1369-1371)CAA>CAT	p.Q457H	PLEKHG3_uc001xhn.1_Missense_Mutation_p.Q401H|PLEKHG3_uc001xhp.2_Missense_Mutation_p.Q457H|PLEKHG3_uc010aqh.1_5'UTR|PLEKHG3_uc001xhq.1_5'Flank	NM_015549	NP_056364	A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G,	457				QGRRQSEPTKHLLRQLNEKARAAGMK -> KGAGPEPPGSE EEEEEQEESLAVAEQ (in Ref. 2; AAH04298).	regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		TGCTCAGGCAACTCAACGAGA	0.617													9	34	---	---	---	---	PASS
PLEKHH1	57475	broad.mit.edu	37	14	68042598	68042598	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68042598G>T	uc001xjl.1	+	16	2370	c.2228G>T	c.(2227-2229)TGT>TTT	p.C743F	PLEKHH1_uc010tsw.1_Missense_Mutation_p.C311F|PLEKHH1_uc001xjn.1_Missense_Mutation_p.C258F|PLEKHH1_uc010tsx.1_5'Flank	NM_020715	NP_065766	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H	743	PH 2.					cytoskeleton	binding				0				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		GATCGATCCTGTGACTCAGAC	0.607													13	32	---	---	---	---	PASS
PAPLN	89932	broad.mit.edu	37	14	73739301	73739301	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73739301G>A	uc010ttx.1	+	26	3929	c.3766G>A	c.(3766-3768)GAG>AAG	p.E1256K	PAPLN_uc001xnw.3_Missense_Mutation_p.E1229K|PAPLN_uc010arl.2_RNA|PAPLN_uc010ttw.1_RNA|PAPLN_uc010tty.1_Missense_Mutation_p.E1240K|PAPLN_uc010arm.2_Missense_Mutation_p.E455K|PAPLN_uc010arn.2_3'UTR	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	1256	PLAC.					proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		TTGTGGCAATGAGTATTACTC	0.602													97	110	---	---	---	---	PASS
FLRT2	23768	broad.mit.edu	37	14	86088141	86088141	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86088141C>T	uc001xvr.2	+	2	1050	c.283C>T	c.(283-285)CTG>TTG	p.L95L	FLRT2_uc010atd.2_Silent_p.L95L	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	95	Extracellular (Potential).|LRR 2.				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CACGGTCTACCTGTATGGCAA	0.478													28	102	---	---	---	---	PASS
ATG2B	55102	broad.mit.edu	37	14	96772007	96772007	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96772007T>G	uc001yfi.2	-	31	5017	c.4652A>C	c.(4651-4653)AAG>ACG	p.K1551T		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	1551										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AGAGACCTCCTTCACCACATA	0.408													15	47	---	---	---	---	PASS
INF2	64423	broad.mit.edu	37	14	105167956	105167956	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105167956C>T	uc001ypb.2	+	2	397	c.254C>T	c.(253-255)TCG>TTG	p.S85L	INF2_uc010tyi.1_Missense_Mutation_p.S85L|INF2_uc001ypc.2_Missense_Mutation_p.S85L|INF2_uc001yoy.3_Missense_Mutation_p.S85L|INF2_uc001ypa.2_Missense_Mutation_p.S85L	NM_022489	NP_071934	Q27J81	INF2_HUMAN	inverted formin 2 isoform 1	85	GBD/FH3.				actin cytoskeleton organization	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm	actin binding|Rho GTPase binding				0		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		GCGCGGCTGTCGGGCCGCGGC	0.706													11	17	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25959015	25959015	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25959015C>T	uc010ayu.2	-	10	2256	c.2150G>A	c.(2149-2151)CGG>CAG	p.R717Q		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	717	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GTCGTGCAGCCGCTCCACAAG	0.637													45	96	---	---	---	---	PASS
TJP1	7082	broad.mit.edu	37	15	30024643	30024643	+	Missense_Mutation	SNP	T	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30024643T>G	uc001zcr.2	-	15	2486	c.2011A>C	c.(2011-2013)ATT>CTT	p.I671L	TJP1_uc010azl.2_Missense_Mutation_p.I659L|TJP1_uc001zcq.2_Missense_Mutation_p.I675L|TJP1_uc001zcs.2_Missense_Mutation_p.I671L	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	671	Guanylate kinase-like.				cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TTACTTGCAATTTGATAAATA	0.388													8	60	---	---	---	---	PASS
ATPBD4	89978	broad.mit.edu	37	15	35703062	35703062	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35703062C>T	uc001zja.2	-	6	603	c.541G>A	c.(541-543)GAT>AAT	p.D181N	ATPBD4_uc001ziz.2_Missense_Mutation_p.D165N	NM_080650	NP_542381	Q7L8W6	ATBD4_HUMAN	ATP binding domain 4 isoform 1	181											0		all_epithelial(112;2.11e-09)|Lung NSC(122;2.38e-08)|all_lung(180;3.65e-07)		all cancers(64;9.9e-19)|GBM - Glioblastoma multiforme(113;2.01e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)		TCCATTTGATCCAGGGTTTTC	0.343													12	35	---	---	---	---	PASS
ATPBD4	89978	broad.mit.edu	37	15	35703063	35703063	+	Silent	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35703063C>A	uc001zja.2	-	6	602	c.540G>T	c.(538-540)CTG>CTT	p.L180L	ATPBD4_uc001ziz.2_Silent_p.L164L	NM_080650	NP_542381	Q7L8W6	ATBD4_HUMAN	ATP binding domain 4 isoform 1	180											0		all_epithelial(112;2.11e-09)|Lung NSC(122;2.38e-08)|all_lung(180;3.65e-07)		all cancers(64;9.9e-19)|GBM - Glioblastoma multiforme(113;2.01e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)		CCATTTGATCCAGGGTTTTCC	0.343													12	34	---	---	---	---	PASS
FAM82A2	55177	broad.mit.edu	37	15	41029865	41029865	+	Silent	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41029865G>A	uc001zmo.1	-	10	1329	c.1185C>T	c.(1183-1185)CTC>CTT	p.L395L	FAM82A2_uc001zmp.1_Silent_p.L395L|FAM82A2_uc001zmq.1_Silent_p.L395L	NM_018145	NP_060615	Q96TC7	RMD3_HUMAN	family with sequence similarity 82, member A2	395					apoptosis|cell differentiation	integral to membrane|microtubule|mitochondrial membrane|nucleus|spindle pole	protein binding				0						CAGTGGCACTGAGAGGGCTTT	0.468													35	73	---	---	---	---	PASS
CAPN3	825	broad.mit.edu	37	15	42693986	42693986	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42693986C>G	uc001zpn.1	+	11	1808	c.1502C>G	c.(1501-1503)ACC>AGC	p.T501S	CAPN3_uc001zpk.1_Missense_Mutation_p.T274S|CAPN3_uc001zpl.1_Missense_Mutation_p.T414S|CAPN3_uc010udf.1_Missense_Mutation_p.T414S|CAPN3_uc010udg.1_Missense_Mutation_p.T366S|CAPN3_uc001zpo.1_Missense_Mutation_p.T501S|CAPN3_uc001zpp.1_Missense_Mutation_p.T453S|CAPN3_uc001zpq.1_5'Flank|CAPN3_uc010bcv.1_5'Flank|CAPN3_uc001zpr.1_5'Flank|CAPN3_uc001zps.1_5'Flank|CAPN3_uc001zpt.1_5'Flank	NM_000070	NP_000061	P20807	CAN3_HUMAN	calpain 3 isoform a	501	Domain III.				muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity			central_nervous_system(1)	1		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		AGTCTCTTCACCATTGGCTTC	0.592													14	21	---	---	---	---	PASS
CEP152	22995	broad.mit.edu	37	15	49081179	49081179	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49081179G>C	uc001zwy.2	-	9	1026	c.992C>G	c.(991-993)ACA>AGA	p.T331R	CEP152_uc001zwz.2_Missense_Mutation_p.T331R|CEP152_uc001zxa.1_Missense_Mutation_p.T238R	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa	331	Potential.				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CATTTCAGTTGTTCTGGACTT	0.383													33	80	---	---	---	---	PASS
DPP8	54878	broad.mit.edu	37	15	65790284	65790284	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65790284C>A	uc002aov.2	-	5	2259	c.681G>T	c.(679-681)TGG>TGT	p.W227C	DPP8_uc002aow.2_Missense_Mutation_p.W227C|DPP8_uc010uiv.1_RNA|DPP8_uc002aox.2_Missense_Mutation_p.W211C|DPP8_uc002aoy.2_Missense_Mutation_p.W227C|DPP8_uc002aoz.2_Missense_Mutation_p.W211C|DPP8_uc010bhj.2_Missense_Mutation_p.W227C|DPP8_uc002apa.2_Missense_Mutation_p.W124C	NM_130434	NP_569118	Q6V1X1	DPP8_HUMAN	dipeptidyl peptidase 8 isoform 1	227					immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1						TAAAAGCAATCCAGTCTGGAT	0.403													35	41	---	---	---	---	PASS
DIS3L	115752	broad.mit.edu	37	15	66621404	66621404	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66621404G>T	uc010ujm.1	+	13	2313	c.2298G>T	c.(2296-2298)ATG>ATT	p.M766I	DIS3L_uc002app.2_Missense_Mutation_p.M683I|DIS3L_uc010bho.2_Missense_Mutation_p.M632I	NM_001143688	NP_001137160	Q8TF46	DI3L1_HUMAN	DIS3 mitotic control homolog (S.	766					rRNA catabolic process	cytoplasm|exosome (RNase complex)	exonuclease activity|protein binding|ribonuclease activity|RNA binding			ovary(2)	2						CGCAGGCCATGTCGAATGCTC	0.517													39	75	---	---	---	---	PASS
MPI	4351	broad.mit.edu	37	15	75188595	75188595	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75188595A>G	uc002azc.1	+	6	778	c.773A>G	c.(772-774)AAC>AGC	p.N258S	MPI_uc010ulv.1_Missense_Mutation_p.N258S|MPI_uc010ulw.1_Missense_Mutation_p.N147S|MPI_uc002azd.1_Missense_Mutation_p.N258S|MPI_uc010ulx.1_Missense_Mutation_p.N208S|MPI_uc002aze.1_Missense_Mutation_p.N197S	NM_002435	NP_002426	P34949	MPI_HUMAN	mannose-6- phosphate isomerase	258					dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	mannose-6-phosphate isomerase activity|zinc ion binding			ovary(2)	2						TACTTCCTGAACCTGCTTACC	0.547													46	117	---	---	---	---	PASS
CHRNA3	1136	broad.mit.edu	37	15	78894275	78894275	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78894275T>C	uc002bec.2	-	5	895	c.709A>G	c.(709-711)ATC>GTC	p.I237V	CHRNA3_uc002bea.2_RNA|CHRNA3_uc002beb.2_Missense_Mutation_p.I237V	NM_000743	NP_000734	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3	237	Extracellular (Potential).			I -> S (in Ref. 1; AAC84176).	activation of transmembrane receptor protein tyrosine kinase activity|behavioral response to nicotine|locomotory behavior|regulation of acetylcholine secretion|regulation of dendrite morphogenesis|regulation of excitatory postsynaptic membrane potential|regulation of smooth muscle contraction|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|dendrite|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic density|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(3)|ovary(1)	4						AGGCGCCGGATGTACAGCGAG	0.572													23	56	---	---	---	---	PASS
CHSY1	22856	broad.mit.edu	37	15	101717972	101717972	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101717972T>C	uc002bwt.1	-	4	2513	c.2030A>G	c.(2029-2031)AAC>AGC	p.N677S	CHSY1_uc010usd.1_Missense_Mutation_p.N405S	NM_014918	NP_055733	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	677	Lumenal (Potential).				chondroitin sulfate biosynthetic process	Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity				0	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGCAAAATGGTTGTCACTGGG	0.418													56	117	---	---	---	---	PASS
IL4R	3566	broad.mit.edu	37	16	27374479	27374479	+	Silent	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27374479T>A	uc002don.2	+	11	2048	c.1806T>A	c.(1804-1806)GGT>GGA	p.G602G	IL4R_uc002dop.3_Silent_p.G587G|IL4R_uc010bxy.2_Silent_p.G602G|IL4R_uc002doo.2_Silent_p.G442G	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	602	Required for IL4-induced gene expression.|Cytoplasmic (Potential).				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						GAGAGGCTGGTTACAAGGCCT	0.612													20	70	---	---	---	---	PASS
LPCAT2	54947	broad.mit.edu	37	16	55608595	55608595	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55608595T>C	uc002eie.3	+	12	1449	c.1268T>C	c.(1267-1269)TTG>TCG	p.L423S	LPCAT2_uc002eic.2_Missense_Mutation_p.L153S	NM_017839	NP_060309	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	423	Lumenal (Potential).|EF-hand 1.				cellular membrane organization|platelet activating factor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|Golgi stack|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding				0						CTGGCTGTCTTGTGCAACCCT	0.468													11	34	---	---	---	---	PASS
CCDC135	84229	broad.mit.edu	37	16	57760055	57760055	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57760055G>A	uc002emi.2	+	13	1923	c.1834G>A	c.(1834-1836)GCG>ACG	p.A612T	CCDC135_uc002emj.2_Missense_Mutation_p.A612T|CCDC135_uc002emk.2_Missense_Mutation_p.A547T	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135	612						cytoplasm				central_nervous_system(1)	1						GTTTCTGGTCGCGGAGGAGCG	0.632													22	77	---	---	---	---	PASS
AARS	16	broad.mit.edu	37	16	70302213	70302213	+	Silent	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70302213G>C	uc002eyn.1	-	8	1142	c.1032C>G	c.(1030-1032)GGC>GGG	p.G344G	AARS_uc010vlu.1_Silent_p.G174G	NM_001605	NP_001596	P49588	SYAC_HUMAN	alanyl-tRNA synthetase	344					alanyl-tRNA aminoacylation|tRNA processing	cytosol|soluble fraction	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			pancreas(1)	1		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)	L-Alanine(DB00160)	TAGCAAAGAAGCCCCTGCTGG	0.498													25	76	---	---	---	---	PASS
CHST6	4166	broad.mit.edu	37	16	75512961	75512961	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75512961C>T	uc002fef.2	-	3	946	c.766G>A	c.(766-768)GCC>ACC	p.A256T	CHST6_uc002feg.1_RNA|CHST6_uc002feh.1_Missense_Mutation_p.A256T	NM_021615	NP_067628	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	256	Lumenal (Potential).				keratan sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						TTGAGTGTGGCGGCCTCGGCG	0.721													43	44	---	---	---	---	PASS
C17orf97	400566	broad.mit.edu	37	17	263657	263657	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:263657C>T	uc002frh.2	+	3	1069	c.1053C>T	c.(1051-1053)GCC>GCT	p.A351A	C17orf97_uc010vpz.1_RNA	NM_001013672	NP_001013694	Q6ZQX7	CQ097_HUMAN	hypothetical protein LOC400566	371	18.|20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									ovary(1)	1						ACCCCGAGGCCCTCAAGGGCT	0.697													5	55	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578208	7578208	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578208T>C	uc002gim.2	-	6	835	c.641A>G	c.(640-642)CAT>CGT	p.H214R	TP53_uc002gig.1_Missense_Mutation_p.H214R|TP53_uc002gih.2_Missense_Mutation_p.H214R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H82R|TP53_uc010cng.1_Missense_Mutation_p.H82R|TP53_uc002gii.1_Missense_Mutation_p.H82R|TP53_uc010cnh.1_Missense_Mutation_p.H214R|TP53_uc010cni.1_Missense_Mutation_p.H214R|TP53_uc002gij.2_Missense_Mutation_p.H214R|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.H121R|TP53_uc002gio.2_Missense_Mutation_p.H82R|TP53_uc010vug.1_Missense_Mutation_p.H175R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	214	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		H -> Y (in sporadic cancers; somatic mutation).|H -> D (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> P (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H214R(45)|p.0?(7)|p.H214Y(4)|p.H214Q(4)|p.H214D(3)|p.H214fs*5(2)|p.H214fs*33(2)|p.D208fs*1(1)|p.K164_P219del(1)|p.H214H(1)|p.H214fs*7(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213fs*32(1)|p.T211_S215delTFRHS(1)|p.H214_S215insX(1)|p.R209fs*6(1)|p.D208_V216delDRNTFRHSV(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CACCACACTATGTCGAAAAGT	0.542		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			57	20	---	---	---	---	PASS
KDM6B	23135	broad.mit.edu	37	17	7751014	7751014	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7751014C>G	uc002giw.1	+	11	1784	c.1408C>G	c.(1408-1410)CCA>GCA	p.P470A	KDM6B_uc002gix.2_5'UTR	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	470	Pro-rich.				inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2						ctcaccccctccacccccctg	0.333													4	7	---	---	---	---	PASS
SREBF1	6720	broad.mit.edu	37	17	17722421	17722421	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17722421C>A	uc002gru.1	-	5	1168	c.974G>T	c.(973-975)CGC>CTC	p.R325L	SREBF1_uc002grp.1_5'Flank|SREBF1_uc002grq.1_5'UTR|SREBF1_uc002grr.1_Missense_Mutation_p.R71L|SREBF1_uc002grs.1_Missense_Mutation_p.R301L|SREBF1_uc002grt.1_Missense_Mutation_p.R355L|SREBF1_uc010cpp.1_Missense_Mutation_p.R301L|SREBF1_uc010cpq.1_Missense_Mutation_p.R325L	NM_004176	NP_004167	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription	325	Cytoplasmic (Potential).|Basic motif.|Interaction with LMNA (By similarity).				cellular response to starvation|cholesterol metabolic process|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter	endoplasmic reticulum|endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleus	protein binding|protein binding|sequence-specific DNA binding transcription factor activity|sterol response element binding			skin(1)	1						GTGGGCTGTGCGCTTCTCTCC	0.597													29	166	---	---	---	---	PASS
RAB34	83871	broad.mit.edu	37	17	27043983	27043983	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27043983C>T	uc002hce.2	-	2	708	c.84G>A	c.(82-84)GGG>GGA	p.G28G	RAB34_uc002hcg.2_Silent_p.G28G|RAB34_uc002hcf.2_Silent_p.G28G|RAB34_uc010was.1_Silent_p.G85G|RAB34_uc010wat.1_Silent_p.G85G|RAB34_uc002hch.2_Silent_p.G28G|RAB34_uc010wau.1_Silent_p.G28G|RAB34_uc010wav.1_Silent_p.G85G	NM_031934	NP_114140	Q9BZG1	RAB34_HUMAN	Ras-related protein RAB34 isoform 1	28					protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding				0	Lung NSC(42;0.00431)					AGTCTTTGTGCCCGTGCAAAG	0.637													5	230	---	---	---	---	PASS
MED1	5469	broad.mit.edu	37	17	37565861	37565861	+	Silent	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37565861G>A	uc002hrv.3	-	17	2825	c.2613C>T	c.(2611-2613)AAC>AAT	p.N871N	MED1_uc010wee.1_Silent_p.N699N|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	871	Interaction with ESR1.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GGCTCTGGCTGTTCAATAAAT	0.398										HNSCC(31;0.082)			26	89	---	---	---	---	PASS
MPP3	4356	broad.mit.edu	37	17	41907163	41907163	+	Intron	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41907163C>T	uc002iei.3	-						MPP3_uc002ieh.2_Intron|MPP3_uc002iej.2_Intron|MPP3_uc010czi.1_Intron|MPP3_uc010wik.1_Intron|MPP3_uc010czj.1_3'UTR	NM_001932	NP_001923	Q13368	MPP3_HUMAN	palmitoylated membrane protein 3						signal transduction	cell surface|integral to plasma membrane	guanylate kinase activity			large_intestine(1)|skin(1)	2		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		GCACAGCCTGCCGGGAAAGCC	0.587													25	51	---	---	---	---	PASS
CCDC43	124808	broad.mit.edu	37	17	42761315	42761315	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42761315G>A	uc002ihc.2	-	2	261	c.217C>T	c.(217-219)CTC>TTC	p.L73F	CCDC43_uc010czw.1_Missense_Mutation_p.L73F	NM_144609	NP_653210	Q96MW1	CCD43_HUMAN	coiled-coil domain containing 43 isoform 1	73											0		Prostate(33;0.0322)				ATATTAAGGAGGGAATCTTCT	0.393													11	23	---	---	---	---	PASS
KIAA1267	284058	broad.mit.edu	37	17	44249081	44249081	+	Silent	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44249081C>A	uc002ikb.2	-	1	514	c.429G>T	c.(427-429)ACG>ACT	p.T143T	KIAA1267_uc002ikc.2_Silent_p.T143T|KIAA1267_uc002ikd.2_Silent_p.T143T|KIAA1267_uc010dav.2_Silent_p.T143T	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058	143						MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				TCTGACCACTCGTATTCATGG	0.438													5	439	---	---	---	---	PASS
SPAG9	9043	broad.mit.edu	37	17	49197943	49197943	+	Silent	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49197943G>A	uc002itc.2	-	1	284	c.75C>T	c.(73-75)TCC>TCT	p.S25S	SPAG9_uc002itb.2_Silent_p.S25S|SPAG9_uc002itd.2_Silent_p.S25S	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1	25					positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CGGCCAGGCCGGACACCCGCT	0.627													9	17	---	---	---	---	PASS
KCNH6	81033	broad.mit.edu	37	17	61619602	61619602	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61619602G>A	uc002jay.2	+	9	2035	c.1955G>A	c.(1954-1956)GGA>GAA	p.G652E	KCNH6_uc010wpl.1_Missense_Mutation_p.G529E|KCNH6_uc010wpm.1_Missense_Mutation_p.G652E|KCNH6_uc002jaz.1_Missense_Mutation_p.G599E	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	652	cNMP.|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	TGGCTGGCAGGAAAGAATGAC	0.587													16	40	---	---	---	---	PASS
ABCA8	10351	broad.mit.edu	37	17	66914254	66914254	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66914254C>A	uc002jhp.2	-	14	2040	c.1861G>T	c.(1861-1863)GAA>TAA	p.E621*	ABCA8_uc002jhq.2_Nonsense_Mutation_p.E661*|ABCA8_uc010wqq.1_Nonsense_Mutation_p.E661*|ABCA8_uc010wqr.1_Nonsense_Mutation_p.E600*|ABCA8_uc002jhr.2_Nonsense_Mutation_p.E661*	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8	621	ABC transporter 1.					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)					GTTTTGCGTTCTTTCAGAAGG	0.463													11	43	---	---	---	---	PASS
P4HB	5034	broad.mit.edu	37	17	79801949	79801949	+	Missense_Mutation	SNP	T	G	G	rs148124283		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79801949T>G	uc002kbn.1	-	11	1663	c.1466A>C	c.(1465-1467)GAA>GCA	p.E489A	P4HB_uc002kbl.1_Missense_Mutation_p.E166A|P4HB_uc002kbm.1_Missense_Mutation_p.E166A	NM_000918	NP_000909	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta subunit precursor	489					cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			CTCCTCTGCTTCTTCCAGGTC	0.612													79	279	---	---	---	---	PASS
P4HB	5034	broad.mit.edu	37	17	79801950	79801950	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79801950C>A	uc002kbn.1	-	11	1662	c.1465G>T	c.(1465-1467)GAA>TAA	p.E489*	P4HB_uc002kbl.1_Nonsense_Mutation_p.E166*|P4HB_uc002kbm.1_Nonsense_Mutation_p.E166*	NM_000918	NP_000909	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta subunit precursor	489					cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			TCCTCTGCTTCTTCCAGGTCC	0.607													80	278	---	---	---	---	PASS
P4HB	5034	broad.mit.edu	37	17	79803533	79803533	+	Silent	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79803533G>C	uc002kbn.1	-	9	1460	c.1263C>G	c.(1261-1263)GTC>GTG	p.V421V	P4HB_uc002kbl.1_Silent_p.V98V|P4HB_uc002kbm.1_Silent_p.V98V	NM_000918	NP_000909	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta subunit precursor	421	Thioredoxin 2.				cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			TCTTGGCGATGACGATGTTCT	0.542													9	30	---	---	---	---	PASS
APCDD1	147495	broad.mit.edu	37	18	10487807	10487807	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10487807C>T	uc002kom.3	+	5	1671	c.1317C>T	c.(1315-1317)AAC>AAT	p.N439N		NM_153000	NP_694545	Q8J025	APCD1_HUMAN	adenomatosis polyposis coli down-regulated 1	439	Extracellular (Potential).				hair follicle development|negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to plasma membrane	Wnt-protein binding				0				READ - Rectum adenocarcinoma(15;0.08)		TGCTGTTCAACGGTCAGAGGC	0.607													14	127	---	---	---	---	PASS
CHST9	83539	broad.mit.edu	37	18	24496806	24496806	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24496806T>A	uc002kwd.2	-	5	947	c.749A>T	c.(748-750)CAC>CTC	p.H250L	C18orf16_uc002kwb.2_Intron|C18orf16_uc010xbm.1_Intron|CHST9_uc002kwc.2_Missense_Mutation_p.H165L|CHST9_uc002kwe.2_Missense_Mutation_p.H250L	NM_031422	NP_113610	Q7L1S5	CHST9_HUMAN	GalNAc-4-sulfotransferase 2	250	Lumenal (Potential).				carbohydrate biosynthetic process|glycosaminoglycan metabolic process|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	extracellular region|Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			ovary(2)|skin(1)	3	all_lung(6;0.0145)|Ovarian(20;0.124)					CTTCCCGTAGTGGACAGCATT	0.428													26	28	---	---	---	---	PASS
ARID3A	1820	broad.mit.edu	37	19	960131	960131	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:960131C>G	uc002lql.2	+	4	1023	c.733C>G	c.(733-735)CTG>GTG	p.L245V		NM_005224	NP_005215	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT- like)	245	ARID.					cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAAGGAATTCCTGGATGACTT	0.597													39	68	---	---	---	---	PASS
ANKRD24	170961	broad.mit.edu	37	19	4219654	4219654	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4219654G>A	uc010dtt.1	+	19	3346	c.3070G>A	c.(3070-3072)GAG>AAG	p.E1024K		NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	1024	Potential.										0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GGCCACAGCAGAGCAGCAGCT	0.652													70	138	---	---	---	---	PASS
INSR	3643	broad.mit.edu	37	19	7163054	7163054	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7163054T>C	uc002mgd.1	-	9	2127	c.2018A>G	c.(2017-2019)TAT>TGT	p.Y673C	INSR_uc002mge.1_Missense_Mutation_p.Y673C|INSR_uc002mgf.2_Missense_Mutation_p.Y673C	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor	673	Fibronectin type-III 1.				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTTGAGGCAATAATCCAGCTC	0.547													27	145	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10602649	10602649	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10602649A>G	uc002moq.1	-	3	1085	c.929T>C	c.(928-930)CTG>CCG	p.L310P	KEAP1_uc002mop.1_Missense_Mutation_p.L28P|KEAP1_uc002mor.1_Missense_Mutation_p.L310P	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	310	Nuclear export signal.			L->A: Loss of export from nucleus; when associated with A-308.	regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			GGGCTTGTGCAGGGTGAGCTC	0.637													47	79	---	---	---	---	PASS
DNAJB1	3337	broad.mit.edu	37	19	14627679	14627679	+	Missense_Mutation	SNP	A	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14627679A>C	uc002myz.1	-	2	431	c.391T>G	c.(391-393)TTC>GTC	p.F131V	DNAJB1_uc010xnr.1_Missense_Mutation_p.F31V	NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	131					chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)		AAGCCAGAGAATGGGTCATCA	0.567													94	128	---	---	---	---	PASS
ARRDC2	27106	broad.mit.edu	37	19	18119344	18119344	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18119344C>T	uc002nhv.2	+	1	368	c.225C>T	c.(223-225)TAC>TAT	p.Y75Y	ARRDC2_uc002nhu.2_Intron	NM_015683	NP_056498	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2 isoform 1	75										pancreas(1)	1						CGCAGAGCTACAGTGAACGCG	0.711													9	19	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23556594	23556594	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23556594C>T	uc002nre.2	-	3	316	c.203G>A	c.(202-204)GGA>GAA	p.G68E	ZNF91_uc010xrj.1_Intron	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	68	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				GGGCTCTTTTCCTTGCTCCAG	0.433													19	74	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41040049	41040049	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41040049C>T	uc002ony.2	+	20	4244	c.4158C>T	c.(4156-4158)GGC>GGT	p.G1386G	SPTBN4_uc002onx.2_Silent_p.G1386G|SPTBN4_uc002onz.2_Silent_p.G1386G|SPTBN4_uc010egx.2_Silent_p.G129G|SPTBN4_uc010egy.1_Silent_p.G62G|SPTBN4_uc002ooa.2_Silent_p.G62G|SPTBN4_uc010egz.1_Silent_p.G62G	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	1386	Spectrin 11.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGAAGCTGGGCGAGATCCGCC	0.637													8	12	---	---	---	---	PASS
CYP2B6	1555	broad.mit.edu	37	19	41512931	41512931	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41512931C>G	uc002opr.1	+	4	613	c.606C>G	c.(604-606)TTC>TTG	p.F202L	CYP2A7_uc002opo.2_Intron|CYP2B6_uc010xvu.1_Intron	NM_000767	NP_000758	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B,	202					cellular ketone metabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(20;0.00322)		Bupropion(DB01156)|Butalbital(DB00241)|Carbamazepine(DB00564)|Clopidogrel(DB00758)|Cyclophosphamide(DB00531)|Efavirenz(DB00625)|Ifosfamide(DB01181)|Memantine(DB01043)|Meperidine(DB00454)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicotine(DB00184)|Orphenadrine(DB01173)|Phenytoin(DB00252)|Propofol(DB00818)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Ticlopidine(DB00208)|Troleandomycin(DB01361)	TGAACTTGTTCTACCAGACTT	0.512													38	86	---	---	---	---	PASS
PRKD2	25865	broad.mit.edu	37	19	47207510	47207510	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47207510T>C	uc002pfh.2	-	6	1147	c.805A>G	c.(805-807)ATC>GTC	p.I269V	PRKD2_uc002pfg.2_Missense_Mutation_p.I112V|PRKD2_uc002pfi.2_Missense_Mutation_p.I269V|PRKD2_uc002pfj.2_Missense_Mutation_p.I269V|PRKD2_uc010xye.1_Missense_Mutation_p.I269V|PRKD2_uc002pfk.2_Missense_Mutation_p.I112V	NM_001079881	NP_001073350	Q9BZL6	KPCD2_HUMAN	protein kinase D2 isoform A	269	Phorbol-ester/DAG-type 2.				cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity			ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		TAGCTGTGGATGAGGAAGGTG	0.582											OREG0025578	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	37	86	---	---	---	---	PASS
PPP1R15A	23645	broad.mit.edu	37	19	49378889	49378889	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49378889G>A	uc002pky.3	+	3	1953	c.1684G>A	c.(1684-1686)GTC>ATC	p.V562I		NM_014330	NP_055145	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	562	Interaction with SMARCB1.				apoptosis|cell cycle arrest|regulation of translation|response to DNA damage stimulus	endoplasmic reticulum	protein binding			lung(1)	1		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		CTCCGAGAAGGTCACTGTCCA	0.687													62	59	---	---	---	---	PASS
SHANK1	50944	broad.mit.edu	37	19	51165736	51165736	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51165736C>T	uc002psx.1	-	23	5991	c.5972G>A	c.(5971-5973)CGG>CAG	p.R1991Q	SHANK1_uc002psw.1_Missense_Mutation_p.R1375Q	NM_016148	NP_057232	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1991					cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CAGAGGGGGCCGCATCTCGAA	0.741													5	3	---	---	---	---	PASS
ZNF616	90317	broad.mit.edu	37	19	52633754	52633754	+	Silent	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52633754C>T	uc002pym.2	-	2	295	c.12G>A	c.(10-12)CAG>CAA	p.Q4Q	ZNF616_uc002pyn.2_RNA	NM_178523	NP_848618	Q08AN1	ZN616_HUMAN	zinc finger protein 616	4					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		ATCACTCTACCTGAGTAGCCA	0.413													47	30	---	---	---	---	PASS
C20orf96	140680	broad.mit.edu	37	20	259859	259859	+	Missense_Mutation	SNP	G	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:259859G>A	uc002wde.1	-	5	558	c.419C>T	c.(418-420)ACG>ATG	p.T140M	C20orf96_uc002wdc.2_Missense_Mutation_p.T87M|C20orf96_uc002wdd.2_Missense_Mutation_p.T105M|C20orf96_uc010zpi.1_Missense_Mutation_p.T87M|C20orf96_uc010zpj.1_Missense_Mutation_p.T105M|C20orf96_uc010zpk.1_Missense_Mutation_p.T78M	NM_153269	NP_695001	Q9NUD7	CT096_HUMAN	hypothetical protein LOC140680	140	Potential.										0		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			GTGCAGGGTCGTGCTGTTCTC	0.567													31	55	---	---	---	---	PASS
CDS2	8760	broad.mit.edu	37	20	5157335	5157335	+	Silent	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5157335T>A	uc002wls.2	+	4	590	c.333T>A	c.(331-333)ACT>ACA	p.T111T	CDS2_uc002wlr.1_Silent_p.T33T|CDS2_uc010zqt.1_RNA|CDS2_uc002wlu.2_Silent_p.T56T|CDS2_uc010zqu.1_Intron|CDS2_uc002wlv.2_Silent_p.T13T|CDS2_uc010zqv.1_5'Flank	NM_003818	NP_003809	O95674	CDS2_HUMAN	phosphatidate cytidylyltransferase 2	111					phospholipid biosynthetic process	integral to membrane|mitochondrial inner membrane	phosphatidate cytidylyltransferase activity				0						AGATAATCACTATTGGCTACA	0.453													8	131	---	---	---	---	PASS
EMILIN3	90187	broad.mit.edu	37	20	39990911	39990911	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39990911T>C	uc002xjy.1	-	4	1522	c.1298A>G	c.(1297-1299)GAC>GGC	p.D433G		NM_052846	NP_443078	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	433						proteinaceous extracellular matrix				ovary(1)	1		Myeloproliferative disorder(115;0.00425)				AAGCAGCCCGTCCACACCTCC	0.667													85	184	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57428683	57428683	+	Silent	SNP	T	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57428683T>G	uc002xzw.2	+	1	648	c.363T>G	c.(361-363)CCT>CCG	p.P121P	GNASAS_uc002xzs.1_5'Flank|GNAS_uc002xzt.2_Intron|GNAS_uc002xzu.3_Intron|GNAS_uc010gjq.2_Intron|GNAS_uc002xzv.2_RNA	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas	Error:Variant_position_missing_in_P63092_after_alignment					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			TGGAGCAGCCTGGATTCCCCA	0.632			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			33	56	---	---	---	---	PASS
POTED	317754	broad.mit.edu	37	21	14982968	14982968	+	Missense_Mutation	SNP	T	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14982968T>A	uc002yjb.1	+	1	471	c.419T>A	c.(418-420)CTG>CAG	p.L140Q		NM_174981	NP_778146	Q86YR6	POTED_HUMAN	pote protein	140						plasma membrane				ovary(3)|skin(3)	6						CGAGAAGATCTGGACAAGCTC	0.582													72	30	---	---	---	---	PASS
KRTAP19-3	337970	broad.mit.edu	37	21	31864238	31864238	+	Missense_Mutation	SNP	T	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31864238T>C	uc002yog.1	-	1	38	c.38A>G	c.(37-39)TAT>TGT	p.Y13C		NM_181609	NP_853640	Q7Z4W3	KR193_HUMAN	keratin associated protein 19-3	13						intermediate filament					0						TCCACAGCCATAGCCCAGGCC	0.557													55	36	---	---	---	---	PASS
COL6A2	1292	broad.mit.edu	37	21	47541030	47541030	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47541030G>C	uc002zia.1	+	17	1533	c.1451G>C	c.(1450-1452)GGA>GCA	p.G484A	COL6A2_uc002zhy.1_Missense_Mutation_p.G484A|COL6A2_uc002zhz.1_Missense_Mutation_p.G484A|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	484	Triple-helical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GGGGAGCCCGGAAAGCAGGTC	0.642													20	49	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23165714	23165714	+	RNA	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23165714C>A	uc011aim.1	+	287		c.13276C>A								Parts of antibodies, mostly variable regions.												0						CCTCCCTGACCGTCTCTGGGC	0.522													76	269	---	---	---	---	PASS
SLC5A1	6523	broad.mit.edu	37	22	32506172	32506172	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32506172C>A	uc003amc.2	+	15	2199	c.1967C>A	c.(1966-1968)GCT>GAT	p.A656D	SLC5A1_uc011alz.1_Missense_Mutation_p.A529D	NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	656	Helical; (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						GTGACCGTGGCTGTCTTTTGC	0.483													13	79	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38119859	38119859	+	Silent	SNP	C	T	T	rs66505048		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38119859C>T	uc003atr.2	+	7	1567	c.1296C>T	c.(1294-1296)TGC>TGT	p.C432C	TRIOBP_uc003atu.2_Silent_p.C260C|TRIOBP_uc003atq.1_Silent_p.C432C|TRIOBP_uc003ats.1_Silent_p.C260C	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	432					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GAACATCCTGCGCCCAGCGGG	0.582													5	239	---	---	---	---	PASS
MOV10L1	54456	broad.mit.edu	37	22	50555692	50555692	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50555692G>T	uc003bjj.2	+	9	1449	c.1366G>T	c.(1366-1368)GCG>TCG	p.A456S	MOV10L1_uc003bjk.3_Missense_Mutation_p.A456S|MOV10L1_uc011arp.1_Missense_Mutation_p.A436S|MOV10L1_uc011arq.1_Missense_Mutation_p.A217S|MOV10L1_uc010hao.1_RNA	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	456					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		ACTAATTGCTGCGCGCGAACC	0.443													38	51	---	---	---	---	PASS
MAGEB18	286514	broad.mit.edu	37	X	26157221	26157221	+	Missense_Mutation	SNP	C	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26157221C>T	uc004dbq.1	+	2	306	c.119C>T	c.(118-120)TCT>TTT	p.S40F		NM_173699	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	40							protein binding			central_nervous_system(1)	1						TCACCCTCCCCTGCCTATCTT	0.577													8	15	---	---	---	---	PASS
MAGEB2	4113	broad.mit.edu	37	X	30237487	30237487	+	Missense_Mutation	SNP	C	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30237487C>G	uc004dbz.2	+	2	893	c.790C>G	c.(790-792)CCC>GCC	p.P264A		NM_002364	NP_002355	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	264	MAGE.						protein binding			ovary(1)	1						CAAGCAGGTGCCCAGCAGTGA	0.512													19	5	---	---	---	---	PASS
DDX3X	1654	broad.mit.edu	37	X	41203390	41203390	+	Intron	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41203390G>C	uc004dfe.2	+						DDX3X_uc010nhf.1_Intron|DDX3X_uc004dff.2_Intron|DDX3X_uc011mkq.1_Intron|DDX3X_uc011mkr.1_Intron|DDX3X_uc011mks.1_Intron|DDX3X_uc004dfg.2_Intron|DDX3X_uc011mkt.1_Intron	NM_001356	NP_001347	O00571	DDX3X_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3						interspecies interaction between organisms	cytoplasm|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding|RNA binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						AAGTAAGTATGAGTTCCAGTG	0.353										HNSCC(61;0.18)			5	13	---	---	---	---	PASS
KDM6A	7403	broad.mit.edu	37	X	44896929	44896929	+	Missense_Mutation	SNP	A	G	G			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44896929A>G	uc004dge.3	+	8	1024	c.649A>G	c.(649-651)ACC>GCC	p.T217A	KDM6A_uc010nhk.2_Missense_Mutation_p.T217A|KDM6A_uc011mkz.1_Missense_Mutation_p.T217A|KDM6A_uc011mla.1_Missense_Mutation_p.T217A|KDM6A_uc011mlb.1_Missense_Mutation_p.T217A|KDM6A_uc011mlc.1_5'UTR	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	217	TPR 4.				histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	p.0(2)|p.?(1)		kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						CTTATATGAAACCCAGGTAAG	0.299			D|N|F|S		renal|oesophageal SCC|MM								9	10	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50052359	50052359	+	Missense_Mutation	SNP	G	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50052359G>C	uc004dox.3	+	6	1488	c.1190G>C	c.(1189-1191)CGT>CCT	p.R397P	CCNB3_uc004doy.2_Missense_Mutation_p.R397P|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	397					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					AAGAGGTCCCGTCTGAAGCCA	0.468													5	22	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107408095	107408095	+	Intron	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107408095G>T	uc004enw.3	-						COL4A6_uc004env.3_Intron|COL4A6_uc011msn.1_Intron|COL4A6_uc010npk.2_Intron|COL4A6_uc010npj.2_5'Flank	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor						cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						GCAGCCAGCCGAGCAGCCGTA	0.597									Alport_syndrome_with_Diffuse_Leiomyomatosis				3	29	---	---	---	---	PASS
NKRF	55922	broad.mit.edu	37	X	118723942	118723942	+	Silent	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118723942C>A	uc004erq.2	-	2	2099	c.1446G>T	c.(1444-1446)GTG>GTT	p.V482V	NKRF_uc004err.2_Silent_p.V482V	NM_017544	NP_060014	O15226	NKRF_HUMAN	transcription factor NRF	482					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|double-stranded RNA binding			ovary(1)|central_nervous_system(1)	2						TCTCTAGAATCACTTTGCATT	0.463													5	87	---	---	---	---	PASS
ARHGEF6	9459	broad.mit.edu	37	X	135795454	135795454	+	Missense_Mutation	SNP	G	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135795454G>T	uc004fab.2	-	7	1270	c.808C>A	c.(808-810)CCC>ACC	p.P270T	ARHGEF6_uc011mwd.1_Missense_Mutation_p.P143T|ARHGEF6_uc011mwe.1_Missense_Mutation_p.P116T	NM_004840	NP_004831	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor 6	270	DH.				apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)					GACTGCAGGGGTCTTAAGTAA	0.323													25	8	---	---	---	---	PASS
SOX3	6658	broad.mit.edu	37	X	139586835	139586835	+	Missense_Mutation	SNP	C	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139586835C>A	uc004fbd.1	-	1	391	c.391G>T	c.(391-393)GGC>TGC	p.G131C		NM_005634	NP_005625	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	131	Poly-Gly.				face development|hypothalamus development|negative regulation of neuron differentiation|pituitary gland development|regulation of transcription, DNA-dependent|sensory organ development|sex determination|transcription, DNA-dependent	nucleus	DNA binding			pancreas(1)	1	Acute lymphoblastic leukemia(192;7.65e-05)					GTACCCCCGCCACCTCCGCTC	0.706													26	12	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	122067667	122067668	+	IGR	INS	-	TGTT	TGTT	rs141956564	by1000genomes	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122067667_122067668insTGTT								TFCP2L1 (24889 upstream) : CLASP1 (27686 downstream)																							ACATGAACgtgtgtgtgtgtgt	0.401													4	2	---	---	---	---	
CHPF	79586	broad.mit.edu	37	2	220406348	220406362	+	In_Frame_Del	DEL	CCAGTGCAGCCCACC	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220406348_220406362delCCAGTGCAGCCCACC	uc002vmc.3	-	2	1091_1105	c.864_878delGGTGGGCTGCACTGG	c.(862-879)GGGGTGGGCTGCACTGGT>GGT	p.288_293GVGCTG>G	CHPF_uc010zlh.1_In_Frame_Del_p.126_131GVGCTG>G|CHPF_uc002vmd.3_In_Frame_Del_p.288_293GVGCTG>G|TMEM198_uc002vme.2_5'Flank|TMEM198_uc002vmf.2_5'Flank	NM_024536	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	288_293	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity|protein binding				0		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CTCGTGGTCACCAGTGCAGCCCACCCCGGTGGCAT	0.526											OREG0015229	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	8	---	---	---	---	
KLHL30	377007	broad.mit.edu	37	2	239053011	239053012	+	Intron	INS	-	GAAGGAAA	GAAGGAAA	rs72336409		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239053011_239053012insGAAGGAAA	uc002vxr.1	+							NM_198582	NP_940984	Q0D2K2	KLH30_HUMAN	kelch-like 30												0		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		GAGGGTGCTCggaaggaaggaa	0.069													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	40418595	40418595	+	IGR	DEL	G	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40418595delG								EIF1B (64682 upstream) : ENTPD3 (10078 downstream)																							agggaggggaggggagggagg	0.000													2	5	---	---	---	---	
MAGI1	9223	broad.mit.edu	37	3	65415667	65415667	+	Frame_Shift_Del	DEL	G	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65415667delG	uc003dmn.2	-	12	2221	c.1695delC	c.(1693-1695)CCCfs	p.P565fs	MAGI1_uc003dmm.2_Frame_Shift_Del_p.P565fs|MAGI1_uc003dmo.2_Frame_Shift_Del_p.P565fs|MAGI1_uc003dmp.2_Frame_Shift_Del_p.P565fs|MAGI1_uc010hny.2_Frame_Shift_Del_p.P450fs	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ	565					cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		AACTTGTATTGGGGTCATCTG	0.453													28	22	---	---	---	---	
PDIA5	10954	broad.mit.edu	37	3	122821475	122821475	+	Intron	DEL	T	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122821475delT	uc003egc.1	+						PDIA5_uc003egd.1_Intron	NM_006810	NP_006801	Q14554	PDIA5_HUMAN	protein disulfide isomerase A5 precursor						cell redox homeostasis|glycerol ether metabolic process|protein folding|response to stress	endoplasmic reticulum lumen	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0427)		CAATTATTTCTTTTAAAAAAA	0.303													6	5	---	---	---	---	
SDHAP2	727956	broad.mit.edu	37	3	195412514	195412515	+	Intron	INS	-	C	C	rs140203535		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195412514_195412515insC	uc003fuw.2	+						SDHAP2_uc003fuv.2_Intron					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						tcatttacagtcccctgttgcg	0.050													4	2	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195490839	195490845	+	Intron	DEL	TCCAGAT	-	-	rs63306962		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195490839_195490845delTCCAGAT	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTACTCCTTATCCAGATGCCACCTCCC	0.628													10	5	---	---	---	---	
ABLIM2	84448	broad.mit.edu	37	4	8021782	8021782	+	Intron	DEL	A	-	-	rs35828218		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8021782delA	uc003gko.2	-						ABLIM2_uc003gkk.2_Intron|ABLIM2_uc003gkl.2_Intron|ABLIM2_uc003gkj.3_Intron|ABLIM2_uc003gkm.3_Intron|ABLIM2_uc003gkp.2_Intron|ABLIM2_uc003gkq.2_Intron|ABLIM2_uc003gkr.2_Intron|ABLIM2_uc003gks.3_Intron	NM_001130084	NP_001123556	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2						axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding			pancreas(3)	3						GGTTTTAAAGAAATCTCAGTG	0.532													3	3	---	---	---	---	
SLC6A18	348932	broad.mit.edu	37	5	1246258	1246259	+	3'UTR	INS	-	CCCCGC	CCCCGC	rs140436341	by1000genomes	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1246258_1246259insCCCCGC	uc003jby.1	+	12						NM_182632	NP_872438	Q96N87	S6A18_HUMAN	solute carrier family 6, member 18						cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GGTGGGCGGGGCCCCGCCCACA	0.693													5	6	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5234982	5234983	+	Intron	INS	-	AGA	AGA	rs5865597		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5234982_5234983insAGA	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron|ADAMTS16_uc010itk.1_5'Flank	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						gactccatctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
FLT4	2324	broad.mit.edu	37	5	180058912	180058926	+	Intron	DEL	CGCGTGGCCTGGCCT	-	-	rs140253537	by1000genomes	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180058912_180058926delCGCGTGGCCTGGCCT	uc003mma.3	-						FLT4_uc003mlz.3_Intron|FLT4_uc003mmb.1_5'Flank|FLT4_uc011dgy.1_Intron|FLT4_uc011dgz.1_Intron|FLT4_uc011dha.1_Intron	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	CAGCCAGCACCGCGTGGCCTGGCCTCACCATGTGC	0.670									Congenital_Hereditary_Lymphedema				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	1515541	1515607	+	Intron	DEL	GAGCTGCTGCTTCACACTGACTTACACGGTGAGCAGCGGCGGCAGGGGAGGAGGTGGAACCCGCGGC	-	-	rs66528622	by1000genomes	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1515541_1515607delGAGCTGCTGCTTCACACTGACTTACACGGTGAGCAGCGGCGGCAGGGGAGGAGGTGGAACCCGCGGC	uc003mto.2	+											Homo sapiens cDNA clone IMAGE:30390216.																		CCCGGGGCTGGAGCTGCTGCTTCACACTGACTTACACGGTGAGCAGCGGCGGCAGGGGAGGAGGTGGAACCCGCGGCGAGCTGCTGC	0.637													37	43	---	---	---	---	
BAI3	577	broad.mit.edu	37	6	70049069	70049069	+	Intron	DEL	A	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70049069delA	uc003pev.3	+						BAI3_uc010kak.2_Intron|BAI3_uc011dxx.1_Intron|BAI3_uc003pex.1_Intron	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				GATAGTATATAAAAAAAAAAA	0.303													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55002530	55002531	+	IGR	INS	-	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55002530_55002531insA								SEC61G (175591 upstream) : EGFR (84194 downstream)																							TGTGGTGCTAGAAAAAACACCT	0.371													64	38	---	---	---	---	
ZNF107	51427	broad.mit.edu	37	7	64169016	64169017	+	In_Frame_Ins	INS	-	GAA	GAA			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64169016_64169017insGAA	uc003ttd.2	+	7	3120_3121	c.2334_2335insGAA	c.(2332-2337)insGAA	p.779_780insE	ZNF107_uc003tte.2_In_Frame_Ins_p.779_780insE	NM_016220	NP_057304	Q9UII5	ZN107_HUMAN	zinc finger protein 107	779_780					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.00948)|all_lung(88;0.0249)				CCTACAAATGTGAGTATGGCAA	0.351													4	2	---	---	---	---	
SLC26A4	5172	broad.mit.edu	37	7	107315731	107315731	+	Intron	DEL	A	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107315731delA	uc003vep.2	+							NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin						regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7						ctcatctcttaaaaaaaaaaa	0.000									Pendred_syndrome				6	5	---	---	---	---	
FOXP2	93986	broad.mit.edu	37	7	114271579	114271580	+	Intron	INS	-	CAG	CAG	rs111544687		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114271579_114271580insCAG	uc003vhb.2	+						FOXP2_uc003vgu.2_Intron|FOXP2_uc003vgz.2_Intron|FOXP2_uc003vha.2_Intron|FOXP2_uc011kmu.1_Intron|FOXP2_uc011kmv.1_Intron|FOXP2_uc010ljz.1_Intron|FOXP2_uc003vgt.1_Intron|FOXP2_uc003vgv.1_Intron|FOXP2_uc003vgx.2_Intron|FOXP2_uc003vhd.2_Intron|FOXP2_uc003vhc.2_Intron	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						TTTTCTGATACcagcagcagca	0.411													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	33143590	33143591	+	IGR	INS	-	GAAG	GAAG			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33143590_33143591insGAAG								NRG1 (521032 upstream) : FUT10 (84755 downstream)																							gagggaggaaagaaggaaggaa	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	96977957	96977964	+	IGR	DEL	AGGGAAGG	-	-	rs67336860		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96977957_96977964delAGGGAAGG								C8orf37 (696520 upstream) : GDF6 (176596 downstream)																							gaaggaaggaagggaaggaaggaaggaa	0.125													4	2	---	---	---	---	
VPS13B	157680	broad.mit.edu	37	8	100245228	100245228	+	Intron	DEL	T	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100245228delT	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron|VPS13B_uc003yiu.1_Intron|VPS13B_uc003yix.1_Intron	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TTGTCAGGTGTTGGAAGGGCT	0.547													12	17	---	---	---	---	
RIMS2	9699	broad.mit.edu	37	8	104781292	104781292	+	Intron	DEL	A	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104781292delA	uc003ylp.2	+							NM_001100117	NP_001093587	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGATCAGACTAAAAAAAAAAG	0.264										HNSCC(12;0.0054)			4	2	---	---	---	---	
CYC1	1537	broad.mit.edu	37	8	145151666	145151692	+	Intron	DEL	GGCAGTGGGCATGTGGAATACTTCTCC	-	-	rs75325545		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145151666_145151692delGGCAGTGGGCATGTGGAATACTTCTCC	uc003zaz.3	+						CYC1_uc003zay.2_Intron	NM_001916	NP_001907	P08574	CY1_HUMAN	cytochrome c-1						respiratory electron transport chain|transport	cell junction|integral to membrane|mitochondrial inner membrane|respiratory chain	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity|heme binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTCCAGTCTGGCAGTGGGCATGTGGAATACTTCTCCACTACCCCCA	0.559													0	16	---	---	---	---	
CDKN2A	1029	broad.mit.edu	37	9	21971114	21971114	+	Frame_Shift_Del	DEL	C	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971114delC	uc003zpk.2	-	2	456	c.244delG	c.(244-246)GTGfs	p.V82fs	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Frame_Shift_Del_p.R137fs	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	82	ANK 3.				cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.?(13)|p.V82M(2)|p.V82V(1)|p.T79fs*37(1)|p.V82fs*62(1)|p.V82_E88del(1)|p.V82_G89>G(1)|p.E61_L94del(1)|p.R137fs*48(1)|p.A68fs*3(1)|p.P81_A85del(1)|p.R80fs*34(1)|p.V82L(1)|p.P81fs*38(1)|p.V82fs*44(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GCGTCGTGCACGGGTCGGGTG	0.741		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			28	21	---	---	---	---	
EGFL7	51162	broad.mit.edu	37	9	139565480	139565480	+	Intron	DEL	G	-	-	rs71988346		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139565480delG	uc004cid.2	+						EGFL7_uc004cif.2_Intron|EGFL7_uc004cig.2_Intron|EGFL7_uc010nbp.2_Intron|EGFL7_uc004cie.2_Intron|EGFL7_uc004cih.2_Intron	NM_201446	NP_958854	Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7						angiogenesis|vasculogenesis		calcium ion binding			ovary(1)	1	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		AGGCATTGGTGGGGGGGGGGG	0.667													5	3	---	---	---	---	
GTPBP4	23560	broad.mit.edu	37	10	1061538	1061570	+	Intron	DEL	CTGGGGTCCTGAGCGCTGAGCCTGGGAGTGGAC	-	-	rs71731536	by1000genomes	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1061538_1061570delCTGGGGTCCTGAGCGCTGAGCCTGGGAGTGGAC	uc001ift.2	+						GTPBP4_uc001ifu.2_Intron|GTPBP4_uc010qad.1_Intron|GTPBP4_uc010qae.1_Intron	NM_012341	NP_036473	Q9BZE4	NOG1_HUMAN	G protein-binding protein CRFG						negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of DNA replication|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		gggagcggggctggggtcctgagcgctgagcctgggagtggacctggggtcct	0.039													4	2	---	---	---	---	
CKAP5	9793	broad.mit.edu	37	11	46837632	46837633	+	Intron	DEL	CA	-	-	rs59649961		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46837632_46837633delCA	uc001ndi.1	-						CKAP5_uc009ylg.1_Intron|CKAP5_uc001ndj.1_Intron	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein						cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2						acgacccccccattccccccaa	0.030													7	12	---	---	---	---	
OR5W2	390148	broad.mit.edu	37	11	55681566	55681566	+	Frame_Shift_Del	DEL	G	-	-	rs61749302	byFrequency	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55681566delG	uc010rir.1	-	1	493	c.493delC	c.(493-495)CGCfs	p.R165fs		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						AAGCATAGGCGGAAGGCCAGT	0.428													50	33	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	80744228	80744229	+	IGR	DEL	CG	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80744228_80744229delCG								None (None upstream) : None (None downstream)																							gtgaagagaccgcgcagtcagt	0.015													3	3	---	---	---	---	
SYTL2	54843	broad.mit.edu	37	11	85524759	85524760	+	5'Flank	INS	-	TTCC	TTCC			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85524759_85524760insTTCC	uc010rti.1	-						SYTL2_uc010rtj.1_5'Flank	NM_032943	NP_116561	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform a						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		ccctccctcctttccttccttc	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80714025	80714026	+	IGR	INS	-	T	T			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80714025_80714026insT								PPP1R12A (384790 upstream) : PTPRQ (124100 downstream)																							TAAAGTACTACTTTTTTTTTTC	0.267													2	4	---	---	---	---	
KIAA0125	9834	broad.mit.edu	37	14	106385208	106385217	+	Intron	DEL	TTCAGTGGGG	-	-	rs71406526		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106385208_106385217delTTCAGTGGGG	uc001ysq.2	+						ADAM6_uc010tyt.1_Intron|KIAA0125_uc001ysr.2_Intron|KIAA0125_uc001yss.2_Intron|KIAA0125_uc001yst.2_Intron					SubName: Full=HCG2029388, isoform CRA_d; SubName: Full=FAM30A protein;												0						GTCCTCACCATTCAGTGGGGTTCAGTGGGG	0.657													11	5	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106790941	106790942	+	RNA	DEL	TC	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106790941_106790942delTC	uc010tyt.1	-	387		c.14676_14677delGA								Parts of antibodies, mostly variable regions.												0						GCCGCTGATTTCCCGCCAGCGT	0.584													0	8	---	---	---	---	
HERC2	8924	broad.mit.edu	37	15	28517891	28517892	+	Intron	DEL	TA	-	-	rs75694916		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28517891_28517892delTA	uc001zbj.2	-						HERC2_uc001zbl.1_Intron	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GAAGAAAAGGTAAAGAGAGAGA	0.396													6	3	---	---	---	---	
LPCAT4	254531	broad.mit.edu	37	15	34656625	34656627	+	Intron	DEL	TTC	-	-	rs60508631	by1000genomes	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34656625_34656627delTTC	uc001zig.2	-						LPCAT4_uc010bav.1_Intron	NM_153613	NP_705841	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|calcium ion binding				0						ttttttttttttctgttgttgtt	0.202													9	6	---	---	---	---	
LPCAT4	254531	broad.mit.edu	37	15	34656626	34656627	+	Intron	DEL	TC	-	-	rs60508631	by1000genomes	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34656626_34656627delTC	uc001zig.2	-						LPCAT4_uc010bav.1_Intron	NM_153613	NP_705841	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|calcium ion binding				0						tttttttttttctgttgttgtt	0.203													8	5	---	---	---	---	
DUOX1	53905	broad.mit.edu	37	15	45447768	45447768	+	Intron	DEL	A	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45447768delA	uc001zus.1	+						DUOX1_uc001zut.1_Intron|DUOX1_uc010bee.1_Intron	NM_017434	NP_059130	Q9NRD9	DUOX1_HUMAN	dual oxidase 1 precursor						cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		actccatctcaaaaaaaaaaa	0.000													5	3	---	---	---	---	
TMOD3	29766	broad.mit.edu	37	15	52218858	52218859	+	Intron	INS	-	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52218858_52218859insA	uc010bfc.1	+							NM_014547		Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)							cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(1)	1				all cancers(107;0.00194)		gagtctgtctcaaaaaaaaaaa	0.163													5	3	---	---	---	---	
PTPLAD1	51495	broad.mit.edu	37	15	65856306	65856307	+	Intron	INS	-	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65856306_65856307insA	uc002apc.2	+						PTPLAD1_uc002apb.1_Intron|PTPLAD1_uc010uiw.1_Intron	NM_016395	NP_057479	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain						activation of JUN kinase activity|fatty acid biosynthetic process|I-kappaB kinase/NF-kappaB cascade|Rac protein signal transduction	endoplasmic reticulum membrane|integral to membrane	GTPase activator activity|lyase activity|protein binding				0						gactccatctcaaaaaaaaaaa	0.193													4	2	---	---	---	---	
C15orf27	123591	broad.mit.edu	37	15	76461849	76461850	+	Intron	INS	-	G	G	rs150798816	by1000genomes	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76461849_76461850insG	uc002bbq.2	+						C15orf27_uc010bkp.2_Intron|C15orf27_uc002bbr.2_Intron	NM_152335	NP_689548	Q2M3C6	CO027_HUMAN	hypothetical protein LOC123591							integral to membrane					0						CCAAGGGATTTGAGTGTATTCT	0.500													2	7	---	---	---	---	
WDR61	80349	broad.mit.edu	37	15	78587083	78587083	+	Intron	DEL	T	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78587083delT	uc002bdn.2	-						WDR61_uc002bdo.2_Intron|WDR61_uc010umz.1_Intron|WDR61_uc010una.1_Intron|WDR61_uc010blc.1_3'UTR	NM_025234	NP_079510	Q9GZS3	WDR61_HUMAN	WD repeat domain 61								protein binding			ovary(1)|skin(1)	2						TGATGACTGCTTTTTTTTTTT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92293055	92293060	+	IGR	DEL	GGTGGA	-	-	rs142559582	by1000genomes	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92293055_92293060delGGTGGA								SV2B (454407 upstream) : SLCO3A1 (103878 downstream)																							aggtggaggtggtggaggtggaggtg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	11609702	11609736	+	IGR	DEL	GCCCGGCCCAGCCCAGCCCAGCCCAGCCCAGCCCA	-	-	rs75270661	by1000genomes	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11609702_11609736delGCCCGGCCCAGCCCAGCCCAGCCCAGCCCAGCCCA								C16orf75 (164085 upstream) : LITAF (31846 downstream)																							GCAGTCAGGGgcccggcccagcccagcccagcccagcccagcccagcccagccca	0.217													4	2	---	---	---	---	
VAT1L	57687	broad.mit.edu	37	16	77850683	77850683	+	Intron	DEL	A	-	-	rs71884745		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77850683delA	uc002ffg.1	+							NM_020927	NP_065978	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport protein 1 homolog (T.								oxidoreductase activity|zinc ion binding			central_nervous_system(1)	1						TGCCAAaaagaaaaaaaaaag	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	16569371	16569372	+	IGR	INS	-	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16569371_16569372insC								ZNF624 (12213 upstream) : CCDC144A (24267 downstream)																							cgcgctcttgtgcccaggctgg	0.208													4	2	---	---	---	---	
NUFIP2	57532	broad.mit.edu	37	17	27620689	27620690	+	Intron	DEL	AC	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27620689_27620690delAC	uc002hdy.3	-						NUFIP2_uc002hdx.3_Intron	NM_020772	NP_065823	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein							nucleus|polysomal ribosome	protein binding|RNA binding			skin(2)|ovary(1)|breast(1)	4			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			GCCGGAGGGGACACACACACAC	0.450													4	2	---	---	---	---	
TBX4	9496	broad.mit.edu	37	17	59557756	59557756	+	Intron	DEL	C	-	-	rs112008276		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59557756delC	uc002izi.2	+						TBX4_uc010ddo.2_Intron|TBX4_uc010woy.1_Intron	NM_018488	NP_060958	P57082	TBX4_HUMAN	T-box 4						leg morphogenesis|skeletal system morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						CTCTGCAGCGCCCCCCCCCCC	0.592													5	3	---	---	---	---	
C17orf99	100141515	broad.mit.edu	37	17	76154382	76154382	+	Intron	DEL	T	-	-	rs6501181	by1000genomes	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76154382delT	uc002jus.3	+						C17orf99_uc010wts.1_5'Flank	NM_001163075	NP_001156547	Q6UX52	CQ099_HUMAN	hypothetical protein LOC100141515 precursor							extracellular region					0						CTCCTACACAttttttttttt	0.333													4	2	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3741135	3741136	+	Intron	INS	-	C	C			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3741135_3741136insC	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron|DLGAP1_uc002kmk.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				caccaccaccacatcaccatca	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3131446	3131446	+	IGR	DEL	C	-	-	rs66993077		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3131446delC								GNA11 (9994 upstream) : GNA15 (4745 downstream)																							aaaaaaaaaacaaaaaaaaaa	0.348													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	6288371	6288374	+	IGR	DEL	CGCA	-	-	rs57273457		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6288371_6288374delCGCA								MLLT1 (8412 upstream) : ACER1 (18136 downstream)																							aatttctgtgcgcacgcgtgtgtg	0.000													4	2	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153065	7153066	+	Intron	DEL	CA	-	-	rs113402674		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153065_7153066delCA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	cacacccccccacacacacaca	0.054													4	2	---	---	---	---	
LIME1	54923	broad.mit.edu	37	20	62369426	62369427	+	Intron	INS	-	GGGGCG	GGGGCG	rs150938918	by1000genomes	TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62369426_62369427insGGGGCG	uc002ygp.3	+						ZGPAT_uc002ygn.3_Intron|LIME1_uc011abi.1_Intron|SLC2A4RG_uc002ygq.2_5'Flank|SLC2A4RG_uc002ygr.2_5'Flank	NM_017806	NP_060276	Q9H400	LIME1_HUMAN	Lck interacting transmembrane adaptor 1							integral to membrane|plasma membrane					0	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GAGCAGAgggcggggcgggggc	0.594													4	3	---	---	---	---	
ETS2	2114	broad.mit.edu	37	21	40187100	40187113	+	Intron	DEL	GTGTGTGTGTGTGT	-	-	rs5843932		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40187100_40187113delGTGTGTGTGTGTGT	uc002yxg.2	+						ETS2_uc002yxf.2_Intron	NM_005239	NP_005230	P15036	ETS2_HUMAN	v-ets erythroblastosis virus E26 oncogene						positive regulation of transcription, DNA-dependent|skeletal system development	nucleus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|breast(1)|pancreas(1)	4		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				CTTTAtgtgagtgtgtgtgtgtgtgtgtgtgtgt	0.336													6	4	---	---	---	---	
COL6A2	1292	broad.mit.edu	37	21	47541703	47541703	+	Intron	DEL	C	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47541703delC	uc002zia.1	+						COL6A2_uc002zhy.1_Intron|COL6A2_uc002zhz.1_Intron|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GTCCAGGAAGCCCCCCTGGCT	0.667													0	6	---	---	---	---	
FBXO7	25793	broad.mit.edu	37	22	32875388	32875388	+	Intron	DEL	C	-	-			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32875388delC	uc003amq.2	+						FBXO7_uc003amp.1_Intron|FBXO7_uc003amr.2_Intron|FBXO7_uc003ams.2_Intron|FBXO7_uc003amt.2_Intron|FBXO7_uc003amu.2_Intron	NM_012179	NP_036311	Q9Y3I1	FBX7_HUMAN	F-box only protein 7 isoform 1						cell death|regulation of protein stability|ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(1)	1						ATAtttttttctttttttttt	0.144													4	2	---	---	---	---	
TAB1	10454	broad.mit.edu	37	22	39772469	39772470	+	Intron	DEL	CC	-	-	rs72559287		TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39772469_39772470delCC	uc003axr.2	+						SYNGR1_uc003axo.3_Intron|SYNGR1_uc003axp.3_Intron|SYNGR1_uc003axq.3_Intron|SYNGR1_uc003axs.3_Intron	NM_006116	NP_006107	Q15750	TAB1_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|activation of MAPKKK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane	catalytic activity|protein binding			breast(1)	1						TCACGGACCACCCCCCccccaa	0.347													3	7	---	---	---	---	
POLDIP3	84271	broad.mit.edu	37	22	42995618	42995619	+	Intron	INS	-	A	A			TCGA-33-4538-01	TCGA-33-4538-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42995618_42995619insA	uc003bcu.2	-						POLDIP3_uc011app.1_Intron|POLDIP3_uc003bcv.2_Intron|POLDIP3_uc011apq.1_Intron|POLDIP3_uc010gza.2_Intron|POLDIP3_uc011apr.1_Intron|POLDIP3_uc010gzb.1_Intron	NM_032311	NP_115687	Q9BY77	PDIP3_HUMAN	DNA polymerase delta interacting protein 3						positive regulation of translation	cytoplasm|nuclear speck	nucleotide binding|protein binding|RNA binding				0						cgtctcaaaacaaaaaaaacaa	0.213													29	14	---	---	---	---	
