Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CHD5	26038	broad.mit.edu	37	1	6202587	6202587	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6202587G>A	uc001amb.1	-	14	2222	c.2122C>T	c.(2122-2124)CTC>TTC	p.L708F	CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	708					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		AGCCAGTTGAGGCCCTCCAGC	0.617													28	69	---	---	---	---	PASS
PRAMEF2	65122	broad.mit.edu	37	1	12919947	12919947	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12919947G>A	uc001aum.1	+	3	774	c.687G>A	c.(685-687)AAG>AAA	p.K229K		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	229											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GTTACCTGAAGGAGATGAAGA	0.403													29	231	---	---	---	---	PASS
PADI2	11240	broad.mit.edu	37	1	17409152	17409152	+	Intron	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17409152A>T	uc001baf.2	-						PADI2_uc010ocm.1_Intron|PADI2_uc001bag.1_Intron	NM_007365	NP_031391	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II						peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(3)|pancreas(1)|central_nervous_system(1)|skin(1)	6		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	TTCATCCTGCAGGGACACCAA	0.512													14	61	---	---	---	---	PASS
PADI1	29943	broad.mit.edu	37	1	17567205	17567205	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17567205C>A	uc001bah.1	+	15	1800	c.1708C>A	c.(1708-1710)CAG>AAG	p.Q570K	PADI1_uc010oco.1_Missense_Mutation_p.Q127K|PADI1_uc010ocp.1_Intron|PADI1_uc010ocq.1_Missense_Mutation_p.Q41K|PADI1_uc009vpb.1_Intron	NM_013358	NP_037490	Q9ULC6	PADI1_HUMAN	peptidylarginine deiminase type I	570					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity				0		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	GGACATTCCCCAGCTCTTCTT	0.587													24	130	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19491395	19491395	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19491395C>T	uc001bbi.2	-	32	4413	c.4409G>A	c.(4408-4410)CGC>CAC	p.R1470H	UBR4_uc001bbm.1_Missense_Mutation_p.R681H	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	1470					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGTAGTCATGCGGGTGAGCCA	0.557													4	128	---	---	---	---	PASS
PINK1	65018	broad.mit.edu	37	1	20976998	20976998	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20976998G>A	uc001bdm.2	+	8	1654	c.1560G>A	c.(1558-1560)AAG>AAA	p.K520K	PINK1_uc001bdn.2_Silent_p.K213K	NM_032409	NP_115785	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1 precursor	520	Cytoplasmic (Potential).				cell death|intracellular protein kinase cascade|mitochondrion degradation|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of release of cytochrome c from mitochondria|regulation of protein complex assembly|regulation of protein ubiquitination|response to stress	cytosol|integral to membrane|mitochondrial outer membrane	ATP binding|C3HC4-type RING finger domain binding|calcium-dependent protein kinase activity|magnesium ion binding|protein serine/threonine kinase activity|ubiquitin protein ligase binding			ovary(2)|central_nervous_system(1)	3		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TAGCCCTGAAGAATCTGAAGT	0.498													27	33	---	---	---	---	PASS
ZNF436	80818	broad.mit.edu	37	1	23693646	23693646	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23693646C>G	uc001bgt.2	-	2	430	c.49G>C	c.(49-51)GAA>CAA	p.E17Q	ZNF436_uc001bgu.2_Missense_Mutation_p.E17Q|C1orf213_uc001bgv.2_5'Flank|C1orf213_uc001bgw.2_5'Flank	NM_030634	NP_085137	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	17	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		GCCATATCTTCAAACGTCACA	0.423													19	117	---	---	---	---	PASS
MDS2	259283	broad.mit.edu	37	1	23953516	23953516	+	RNA	SNP	T	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23953516T>G	uc001bhi.3	+	3		c.806T>G			MDS2_uc001bhj.3_RNA					Homo sapiens MDS2 gene.											ovary(2)	2						TACACACATTTAAACACGCGT	0.209			T	ETV6	MDS								2	2	---	---	---	---	PASS
NIPAL3	57185	broad.mit.edu	37	1	24766703	24766703	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24766703C>T	uc001bjh.2	+	3	542	c.135C>T	c.(133-135)CTC>CTT	p.L45L	NIPAL3_uc010oek.1_Silent_p.L45L|NIPAL3_uc001bjg.2_Silent_p.L45L|NIPAL3_uc009vrc.2_5'UTR	NM_020448	NP_065181	Q6P499	NPAL3_HUMAN	NIPA-like domain containing 3	45	Helical; (Potential).					integral to membrane					0						TCGGGCACCTCGTGGTCAGCA	0.542													22	49	---	---	---	---	PASS
MAN1C1	57134	broad.mit.edu	37	1	26104819	26104819	+	Intron	SNP	A	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26104819A>G	uc001bkm.2	+						MAN1C1_uc009vry.1_Intron|MAN1C1_uc001bkn.2_5'Flank	NM_020379	NP_065112	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(1)	1		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		CGCTCAGGTAACCCTGCAAGG	0.602													5	32	---	---	---	---	PASS
FAM76A	199870	broad.mit.edu	37	1	28081796	28081796	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28081796G>C	uc001boq.2	+	7	792	c.690G>C	c.(688-690)AAG>AAC	p.K230N	FAM76A_uc009vtb.2_Missense_Mutation_p.K230N|FAM76A_uc001bor.2_Missense_Mutation_p.K264N|FAM76A_uc001bos.2_Missense_Mutation_p.K235N|FAM76A_uc001bot.2_Missense_Mutation_p.K201N|FAM76A_uc010ofm.1_Missense_Mutation_p.K150N	NM_152660	NP_689873	Q8TAV0	FA76A_HUMAN	hypothetical protein LOC199870 isoform 3	230	Potential.										0		Colorectal(325;0.000147)|all_lung(284;0.00181)|Lung NSC(340;0.00278)|Renal(390;0.00357)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00253)|KIRC - Kidney renal clear cell carcinoma(1967;0.00292)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)		CCCTGAAGAAGATGTTGCATC	0.438													27	79	---	---	---	---	PASS
COL16A1	1307	broad.mit.edu	37	1	32165448	32165448	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32165448G>A	uc001btk.1	-	4	597	c.232C>T	c.(232-234)CGC>TGC	p.R78C	COL16A1_uc001btj.1_5'Flank|COL16A1_uc001btl.3_Missense_Mutation_p.R78C	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	78	TSP N-terminal.				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GCCCCCAGGCGCAGGATGAGA	0.592													15	89	---	---	---	---	PASS
KIAA0754	643314	broad.mit.edu	37	1	39878590	39878590	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39878590G>A	uc009vvt.1	+	1	3415	c.2653G>A	c.(2653-2655)GTT>ATT	p.V885I	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	NM_015038	NP_055853	O94854	K0754_HUMAN	hypothetical protein LOC643314	749											0	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGACATCCTAGTTGCTTCAAT	0.547													4	9	---	---	---	---	PASS
ZMPSTE24	10269	broad.mit.edu	37	1	40723960	40723960	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40723960C>G	uc001cfg.2	+	1	228	c.17C>G	c.(16-18)TCG>TGG	p.S6W	uc001cff.2_5'Flank	NM_005857	NP_005848	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	6						endoplasmic reticulum membrane|Golgi membrane|integral to membrane	metal ion binding|metalloexopeptidase activity				0	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			ATGTGGGCATCGCTGGACGCT	0.632													28	75	---	---	---	---	PASS
LEPRE1	64175	broad.mit.edu	37	1	43228017	43228017	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43228017C>G	uc001chv.2	-	2	708	c.595G>C	c.(595-597)GAT>CAT	p.D199H	LEPRE1_uc001chw.2_Missense_Mutation_p.D199H|LEPRE1_uc001chx.3_Missense_Mutation_p.D199H|LEPRE1_uc001chy.3_Missense_Mutation_p.D199H	NM_022356	NP_071751	Q32P28	P3H1_HUMAN	leprecan 1 isoform 1	199					negative regulation of cell proliferation	endoplasmic reticulum|proteinaceous extracellular matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			ovary(3)|lung(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GTCTCAAGATCCTTGAAGTCG	0.338													39	213	---	---	---	---	PASS
PTCH2	8643	broad.mit.edu	37	1	45292238	45292238	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45292238C>A	uc010olf.1	-	18	2910	c.2898G>T	c.(2896-2898)CTG>CTT	p.L966L	PTCH2_uc010olg.1_Silent_p.L664L	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2	966	Helical; (Potential).				protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity			lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18	Acute lymphoblastic leukemia(166;0.155)					TGCAGACGGCCAGCAGGAAGC	0.657									Basal_Cell_Nevus_syndrome				5	32	---	---	---	---	PASS
ZCCHC11	23318	broad.mit.edu	37	1	52962837	52962837	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52962837C>T	uc001ctx.2	-	5	1252	c.1018G>A	c.(1018-1020)GAG>AAG	p.E340K	ZCCHC11_uc001cty.2_Missense_Mutation_p.E340K|ZCCHC11_uc001ctz.2_Missense_Mutation_p.E340K|ZCCHC11_uc009vze.1_Missense_Mutation_p.E340K|ZCCHC11_uc009vzf.1_Missense_Mutation_p.E99K|ZCCHC11_uc001cub.2_Missense_Mutation_p.E340K|ZCCHC11_uc001cuc.2_Intron	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform	340					miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						GAACGAAGCTCACTTTCTTCT	0.279													9	23	---	---	---	---	PASS
USP24	23358	broad.mit.edu	37	1	55544314	55544314	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55544314G>C	uc001cyg.3	-	58	6731	c.6731C>G	c.(6730-6732)GCT>GGT	p.A2244G		NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24	2404					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						CTCCCGCAAAGCAAACATTAC	0.438													4	22	---	---	---	---	PASS
CYP2J2	1573	broad.mit.edu	37	1	60373569	60373569	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60373569C>T	uc001czq.2	-	6	897	c.892G>A	c.(892-894)GAA>AAA	p.E298K		NM_000775	NP_000766	P51589	CP2J2_HUMAN	cytochrome P450, family 2, subfamily J,	298					epoxygenase P450 pathway|linoleic acid metabolic process|regulation of heart contraction|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	arachidonic acid 11,12-epoxygenase activity|arachidonic acid 14,15-epoxygenase activity|aromatase activity|electron carrier activity|heme binding|linoleic acid epoxygenase activity			ovary(1)	1	all_cancers(7;0.000396)					AGGTTTTCTTCATGGAAACTT	0.453													28	75	---	---	---	---	PASS
UBE2U	148581	broad.mit.edu	37	1	64680494	64680494	+	Intron	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64680494A>T	uc001dbn.1	+							NM_152489	NP_689702	Q5VVX9	UBE2U_HUMAN	ubiquitin-conjugating enzyme E2U (putative)								ATP binding|protein binding|ubiquitin-protein ligase activity				0						GTGTTTTCCTATAGGTTATGC	0.294													21	61	---	---	---	---	PASS
CACHD1	57685	broad.mit.edu	37	1	65120429	65120429	+	Silent	SNP	A	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65120429A>C	uc001dbo.1	+	12	1677	c.1572A>C	c.(1570-1572)ATA>ATC	p.I524I	CACHD1_uc001dbp.1_Silent_p.I279I|CACHD1_uc001dbq.1_Silent_p.I279I	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN	cache domain containing 1	575	Extracellular (Potential).				calcium ion transport	integral to membrane				ovary(2)	2						CTTGGCACATAAACAAGCTGA	0.458													35	148	---	---	---	---	PASS
RAVER2	55225	broad.mit.edu	37	1	65270690	65270690	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65270690G>C	uc001dbs.1	+	8	1352	c.1274G>C	c.(1273-1275)GGA>GCA	p.G425A	RAVER2_uc001dbt.1_Missense_Mutation_p.G317A|RAVER2_uc010opb.1_Intron	NM_018211	NP_060681	Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	438						cytoplasm|nucleus	nucleotide binding|RNA binding			large_intestine(1)	1						GGCTTACTTGGAGAGCCCCCA	0.418													58	88	---	---	---	---	PASS
IFI44L	10964	broad.mit.edu	37	1	79107177	79107177	+	Missense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79107177A>T	uc010oro.1	+	8	1386	c.1207A>T	c.(1207-1209)AAC>TAC	p.N403Y	IFI44L_uc010orp.1_Missense_Mutation_p.N140Y|IFI44L_uc010orq.1_Missense_Mutation_p.N140Y	NM_006820	NP_006811	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	403						cytoplasm					0						GATGGTTGGAAATTATGCTTC	0.373													29	76	---	---	---	---	PASS
ZNF644	84146	broad.mit.edu	37	1	91405187	91405187	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91405187G>C	uc001dnw.2	-	3	1866	c.1724C>G	c.(1723-1725)TCT>TGT	p.S575C	ZNF644_uc001dnv.2_Intron|ZNF644_uc001dnx.2_Intron|ZNF644_uc001dny.1_Missense_Mutation_p.S575C	NM_201269	NP_958357	Q9H582	ZN644_HUMAN	zinc finger protein 644 isoform 1	575					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TCCTACTACAGAGTCTTTCAT	0.398													33	93	---	---	---	---	PASS
LPPR4	9890	broad.mit.edu	37	1	99771996	99771996	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99771996C>A	uc001dse.2	+	7	1828	c.1722C>A	c.(1720-1722)CCC>CCA	p.P574P	LPPR4_uc010oue.1_Silent_p.P516P	NM_014839	NP_055654	Q7Z2D5	LPPR4_HUMAN	plasticity related gene 1	574							phosphatidate phosphatase activity			ovary(3)	3		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		ACAGCCAGCCCCGAATCATGC	0.547													25	54	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103463882	103463882	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103463882C>G	uc001dul.2	-	25	2498	c.2180G>C	c.(2179-2181)GGT>GCT	p.G727A	COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Missense_Mutation_p.G739A|COL11A1_uc001dun.2_Missense_Mutation_p.G688A|COL11A1_uc009weh.2_Missense_Mutation_p.G611A	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	727	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCCATCAGCACCAGGAAGTCC	0.294													15	24	---	---	---	---	PASS
NTNG1	22854	broad.mit.edu	37	1	107937858	107937858	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107937858C>G	uc001dvh.3	+	4	1688	c.970C>G	c.(970-972)CCA>GCA	p.P324A	NTNG1_uc001dvf.3_Missense_Mutation_p.P324A|NTNG1_uc010out.1_Missense_Mutation_p.P324A|NTNG1_uc001dvc.3_Missense_Mutation_p.P324A|NTNG1_uc001dvi.2_5'UTR|NTNG1_uc001dve.2_RNA|NTNG1_uc009wek.2_RNA|NTNG1_uc001dvg.2_RNA|NTNG1_uc009wem.2_5'UTR|NTNG1_uc001dvd.1_Missense_Mutation_p.P324A	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1	324	Laminin EGF-like 1.				axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		CACTACAGGTCCAGACTGTGG	0.493													65	101	---	---	---	---	PASS
AMPD1	270	broad.mit.edu	37	1	115218197	115218197	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115218197C>G	uc001efe.1	-	12	1717	c.1633G>C	c.(1633-1635)GCC>CCC	p.A545P	AMPD1_uc001eff.1_Missense_Mutation_p.A541P	NM_000036	NP_000027	P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1 (isoform M)	545					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|large_intestine(1)|skin(1)	4	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	ATGTAGTAGGCATAGTAAGTG	0.473													5	175	---	---	---	---	PASS
CD101	9398	broad.mit.edu	37	1	117561160	117561160	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117561160G>A	uc010oxb.1	+	6	2053	c.1995G>A	c.(1993-1995)CTG>CTA	p.L665L	CD101_uc009whd.2_Silent_p.L665L|CD101_uc010oxc.1_Silent_p.L665L|CD101_uc010oxd.1_Silent_p.L603L	NM_004258	NP_004249	Q93033	IGSF2_HUMAN	immunoglobulin superfamily, member 2 precursor	665	Ig-like C2-type 6.|Extracellular (Potential).				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						CTCACCCACTGAGGATAGCCG	0.423													29	57	---	---	---	---	PASS
MAN1A2	10905	broad.mit.edu	37	1	117944986	117944986	+	Missense_Mutation	SNP	A	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117944986A>G	uc001ehd.1	+	2	1202	c.481A>G	c.(481-483)ATT>GTT	p.I161V	MAN1A2_uc009whg.1_Intron	NM_006699	NP_006690	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	161	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity				0	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		ACCAGTCCCTATTCCCAACCT	0.383													21	34	---	---	---	---	PASS
HSD3B1	3283	broad.mit.edu	37	1	120056453	120056453	+	Intron	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120056453A>T	uc001ehv.1	+						HSD3B1_uc001ehw.2_Intron	NM_000862	NP_000853	P14060	3BHS1_HUMAN	3 beta-hydroxysteroid dehydrogenase 1						androgen biosynthetic process|estrogen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	NADH(DB00157)|Trilostane(DB01108)	CTCTTCATGGACAGGTACCCA	0.522													66	267	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144931531	144931531	+	Intron	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144931531G>C	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Missense_Mutation_p.R60G|PDE4DIP_uc001emf.1_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CGATAGATTCGATCAAGCATG	0.512			T	PDGFRB	MPD								15	144	---	---	---	---	PASS
PLEKHO1	51177	broad.mit.edu	37	1	150131509	150131509	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150131509C>T	uc001ett.2	+	6	1299	c.1021C>T	c.(1021-1023)CGG>TGG	p.R341W	PLEKHO1_uc001etr.2_Missense_Mutation_p.R169W|PLEKHO1_uc001ets.2_Missense_Mutation_p.R158W|PLEKHO1_uc001etu.2_Missense_Mutation_p.R169W	NM_016274	NP_057358	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O	341	Negative regulator of AP-1 activity.					cytoplasm|nucleus|plasma membrane				lung(1)	1	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGACCCCCCTCGGTCTCCGCC	0.602													26	62	---	---	---	---	PASS
APH1A	51107	broad.mit.edu	37	1	150239862	150239862	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150239862G>A	uc001ety.1	-	4	697	c.375C>T	c.(373-375)TTC>TTT	p.F125F	APH1A_uc010pbx.1_Silent_p.F55F|APH1A_uc001etz.1_Silent_p.F125F|APH1A_uc001eua.1_Silent_p.F125F|APH1A_uc010pby.1_Silent_p.F68F|APH1A_uc001eub.1_Silent_p.F9F|APH1A_uc010pbz.1_Silent_p.F9F	NM_001077628	NP_001071096	Q96BI3	APH1A_HUMAN	anterior pharynx defective 1 homolog A isoform	125	Helical; Name=4; (Potential).				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to plasma membrane	protein binding			ovary(1)|lung(1)	2	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGATGATACCGAAGGAGAGAC	0.493													19	62	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152081138	152081138	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152081138C>G	uc001ezp.2	-	2	4555	c.4555G>C	c.(4555-4557)GAG>CAG	p.E1519Q	TCHH_uc009wne.1_Missense_Mutation_p.E1519Q	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1519	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTTCCTCCTCGAGGAATTTT	0.587													39	99	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152282605	152282605	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152282605G>T	uc001ezu.1	-	3	4793	c.4757C>A	c.(4756-4758)ACA>AAA	p.T1586K		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1586	Ser-rich.|Filaggrin 9.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCGCCTGCTTGTCTTGGACCC	0.592									Ichthyosis				90	214	---	---	---	---	PASS
IVL	3713	broad.mit.edu	37	1	152882380	152882380	+	Missense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152882380A>T	uc001fau.2	+	2	153	c.107A>T	c.(106-108)CAG>CTG	p.Q36L		NM_005547	NP_005538	P07476	INVO_HUMAN	involucrin	36					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine|keratinization|response to UV-B	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity			ovary(3)	3	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAAATGAAACAGCCAACTCCA	0.557													33	72	---	---	---	---	PASS
S100A7	6278	broad.mit.edu	37	1	153431478	153431478	+	Silent	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153431478A>T	uc001fbv.1	-	2	83	c.12T>A	c.(10-12)ACT>ACA	p.T4T		NM_002963	NP_002954	P31151	S10A7_HUMAN	S100 calcium binding protein A7	4					angiogenesis|defense response to Gram-negative bacterium|innate immune response|keratinocyte differentiation|positive regulation of ERK1 and ERK2 cascade|positive regulation of granulocyte chemotaxis|positive regulation of monocyte chemotaxis|positive regulation of T cell chemotaxis|response to lipopolysaccharide|response to reactive oxygen species|sequestering of metal ion	cytosol|endoplasmic reticulum|extracellular region|focal adhesion|nucleus	calcium ion binding|RAGE receptor binding|zinc ion binding			skin(1)	1	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCTCAGCTTGAGTGTTGCTCA	0.418													46	129	---	---	---	---	PASS
SLC39A1	27173	broad.mit.edu	37	1	153935192	153935192	+	5'UTR	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153935192G>A	uc001fdh.2	-	2					SLC39A1_uc001fdi.2_5'UTR|SLC39A1_uc001fdj.2_5'UTR|SLC39A1_uc001fdk.2_5'UTR|SLC39A1_uc010pee.1_5'UTR|SLC39A1_uc001fdl.2_5'UTR	NM_014437	NP_055252	Q9NY26	S39A1_HUMAN	solute carrier family 39 (zinc transporter),							endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	zinc ion transmembrane transporter activity				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)	Colorectal(1306;0.019)		AGGGCCCCATGATGCTTCTGG	0.602													4	15	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	153994764	153994764	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153994764C>G	uc001fdw.2	-	32	4426	c.4354G>C	c.(4354-4356)GCT>CCT	p.A1452P	NUP210L_uc009woq.2_Missense_Mutation_p.A361P|NUP210L_uc010peh.1_Missense_Mutation_p.A1452P	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	1452						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CTGTTCACAGCCTGGGCCATG	0.453													24	106	---	---	---	---	PASS
DCST2	127579	broad.mit.edu	37	1	155003036	155003036	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155003036G>A	uc001fgm.2	-	6	971	c.891C>T	c.(889-891)GCC>GCT	p.A297A	DCST2_uc009wpb.2_RNA	NM_144622	NP_653223	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	297	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GGCTCCGAGAGGCATTGAGAT	0.602													10	49	---	---	---	---	PASS
DCST2	127579	broad.mit.edu	37	1	155003037	155003037	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155003037G>A	uc001fgm.2	-	6	970	c.890C>T	c.(889-891)GCC>GTC	p.A297V	DCST2_uc009wpb.2_RNA	NM_144622	NP_653223	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	297	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GCTCCGAGAGGCATTGAGATC	0.597													10	49	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155385650	155385650	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155385650C>G	uc009wqq.2	-	6	6373	c.5893G>C	c.(5893-5895)GAA>CAA	p.E1965Q	ASH1L_uc001fkt.2_Missense_Mutation_p.E1965Q	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	1965					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AAGGTACTTTCAGGTTCAGAA	0.433													28	120	---	---	---	---	PASS
YY1AP1	55249	broad.mit.edu	37	1	155657867	155657867	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155657867C>T	uc001fln.2	-	2	197	c.173G>A	c.(172-174)CGA>CAA	p.R58Q	YY1AP1_uc010pgi.1_Missense_Mutation_p.R130Q|YY1AP1_uc001flh.2_Missense_Mutation_p.R130Q|YY1AP1_uc009wqt.2_5'UTR|YY1AP1_uc001flk.2_5'UTR|YY1AP1_uc001fll.2_Intron|YY1AP1_uc009wqv.2_5'UTR|YY1AP1_uc001flm.2_5'UTR|YY1AP1_uc001fli.2_5'UTR|YY1AP1_uc009wqu.2_5'UTR|YY1AP1_uc001flj.2_5'UTR|YY1AP1_uc009wqw.2_5'UTR|YY1AP1_uc001flo.2_Intron|YY1AP1_uc001flp.2_Intron|YY1AP1_uc010pgj.1_Missense_Mutation_p.R58Q|YY1AP1_uc009wqx.2_Missense_Mutation_p.R130Q|YY1AP1_uc010pgk.1_Missense_Mutation_p.R130Q|DAP3_uc001flq.2_5'Flank|DAP3_uc001flr.2_5'Flank|DAP3_uc001fls.2_5'Flank|DAP3_uc010pgl.1_5'Flank|DAP3_uc001flt.2_5'Flank|DAP3_uc001flu.2_5'Flank|DAP3_uc010pgm.1_5'Flank	NM_139118	NP_620829	Q9H869	YYAP1_HUMAN	YY1-associated protein isoform 2	58					regulation of cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					CTCACCGTGTCGGAGGCCGAG	0.627													29	47	---	---	---	---	PASS
RHBG	57127	broad.mit.edu	37	1	156347189	156347189	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156347189C>T	uc010pho.1	+	2	323	c.285C>T	c.(283-285)CTC>CTT	p.L95L	RHBG_uc010phm.1_Intron|RHBG_uc010phn.1_RNA|RHBG_uc001fos.2_Silent_p.L26L|RHBG_uc009wrz.2_Silent_p.L26L|RHBG_uc001for.2_Silent_p.L65L	NM_020407	NP_065140	Q9H310	RHBG_HUMAN	Rhesus blood group, B glycoprotein	95	Helical; (Potential).				transepithelial ammonium transport	anchored to plasma membrane|basolateral plasma membrane|cytoplasmic vesicle membrane|integral to plasma membrane|spectrin-associated cytoskeleton	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			ovary(2)	2	Hepatocellular(266;0.158)					TCACCTTCCTCCTGGCCGCCT	0.622													46	84	---	---	---	---	PASS
TTC24	164118	broad.mit.edu	37	1	156552193	156552193	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156552193C>T	uc009wsc.1	+	1	177	c.37C>T	c.(37-39)CGG>TGG	p.R13W		NM_001105669	NP_001099139	A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	293	TPR 6.						binding			pancreas(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCAGGAAGCTCGGGAGTTTCA	0.622													18	17	---	---	---	---	PASS
FCER1A	2205	broad.mit.edu	37	1	159273818	159273818	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159273818C>T	uc001ftq.2	+	4	276	c.177C>T	c.(175-177)GTC>GTT	p.V59V		NM_002001	NP_001992	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor	59	Extracellular (Potential).|Ig-like 1.					integral to plasma membrane				lung(2)|skin(2)|prostate(1)	5	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	TCTTTGAAGTCAGTTCCACCA	0.378													13	70	---	---	---	---	PASS
ADCY10	55811	broad.mit.edu	37	1	167844384	167844384	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167844384C>T	uc001ger.2	-	13	1745	c.1447G>A	c.(1447-1449)GAT>AAT	p.D483N	ADCY10_uc009wvk.2_Missense_Mutation_p.D391N|ADCY10_uc010plj.1_Missense_Mutation_p.D330N|ADCY10_uc009wvl.2_Missense_Mutation_p.D482N	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10	483					intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3						AAAGGGTAATCCTCCTTTCTG	0.299													14	66	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169505854	169505854	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169505854G>C	uc001ggg.1	-	14	5006	c.4861C>G	c.(4861-4863)CGA>GGA	p.R1621G		NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	1621	F5/8 type A 3.|Plastocyanin-like 5.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	AGGTACTTTCGAAAAACTACT	0.368													12	72	---	---	---	---	PASS
SELE	6401	broad.mit.edu	37	1	169699685	169699685	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169699685G>T	uc001ggm.3	-	5	760	c.603C>A	c.(601-603)AGC>AGA	p.S201R	C1orf112_uc001ggj.2_Intron	NM_000450	NP_000441	P16581	LYAM2_HUMAN	selectin E precursor	201	Sushi 1.|Extracellular (Potential).				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity			ovary(3)|skin(2)	5	all_hematologic(923;0.208)					AAGAATTGTAGCTGAAGTTTC	0.493													31	57	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175293559	175293559	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175293559G>T	uc001gkp.1	-	20	3971	c.3890C>A	c.(3889-3891)GCA>GAA	p.A1297E	TNR_uc009wwu.1_Missense_Mutation_p.A1297E	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	1297	Fibrinogen C-terminal.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					ATACCACCATGCTCCCTTGTA	0.532													26	77	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176983917	176983917	+	Intron	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176983917C>G	uc001glc.2	-						ASTN1_uc001glb.1_Intron|ASTN1_uc001gld.1_Intron|ASTN1_uc009wwx.1_Intron|ASTN1_uc001gle.3_Intron	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1						cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						GTCGTCATGCCCTCACTTACC	0.458													81	337	---	---	---	---	PASS
C1orf125	126859	broad.mit.edu	37	1	179401394	179401394	+	Intron	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179401394C>T	uc001gmo.2	+						C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmn.1_Intron|C1orf125_uc010pnl.1_Intron|C1orf125_uc001gmp.2_Intron	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1												0						TTTTTTTCTTCTTTTCAGTGA	0.284													10	9	---	---	---	---	PASS
LAMC2	3918	broad.mit.edu	37	1	183192282	183192282	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183192282G>T	uc001gqa.2	+	7	1090	c.776G>T	c.(775-777)GGG>GTG	p.G259V	LAMC2_uc001gpz.3_Missense_Mutation_p.G259V|LAMC2_uc010poa.1_Intron	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor	259	Laminin IV type A.				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						AAATTTCTTGGGAATCAACAG	0.463													17	43	---	---	---	---	PASS
FAM129A	116496	broad.mit.edu	37	1	184777204	184777204	+	Intron	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184777204C>A	uc001gra.2	-						FAM129A_uc001grb.1_Intron|FAM129A_uc009wyh.1_Intron|FAM129A_uc009wyi.1_Missense_Mutation_p.G245C	NM_052966	NP_443198	Q9BZQ8	NIBAN_HUMAN	niban protein isoform 2						negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)|skin(1)	4						CCTGCCACACCCACCTCCTGC	0.557													83	132	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198687416	198687416	+	Silent	SNP	A	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198687416A>G	uc001gur.1	+	14	1818	c.1638A>G	c.(1636-1638)ACA>ACG	p.T546T	PTPRC_uc001gus.1_Silent_p.T498T|PTPRC_uc001gut.1_Silent_p.T385T|PTPRC_uc009wzf.1_Silent_p.T434T|PTPRC_uc010ppg.1_Silent_p.T482T	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	546	Extracellular (Potential).|Fibronectin type-III 2.				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						AATATTCAACAGACTACACTT	0.323													10	17	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201027567	201027567	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201027567C>T	uc001gvv.2	-	28	3805	c.3578G>A	c.(3577-3579)AGC>AAC	p.S1193N		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1193	IV.|Helical; Name=S3 of repeat IV; (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	ATCAATGATGCTGCCAATGAC	0.483													21	56	---	---	---	---	PASS
LAX1	54900	broad.mit.edu	37	1	203742998	203742998	+	Intron	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203742998C>T	uc001haa.2	+						LAX1_uc010pql.1_Intron|LAX1_uc001hab.2_Intron	NM_017773	NP_060243	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1 isoform a						B cell activation|immune response|inactivation of MAPK activity|intracellular signal transduction|negative regulation of T cell activation	Golgi apparatus|integral to membrane|plasma membrane	protein kinase binding|SH2 domain binding			central_nervous_system(2)	2	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TTTTCTTCTTCATAGCCCTCC	0.468													8	46	---	---	---	---	PASS
PPP2R5A	5525	broad.mit.edu	37	1	212515550	212515550	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212515550G>C	uc001hjb.2	+	4	1075	c.501G>C	c.(499-501)TTG>TTC	p.L167F	PPP2R5A_uc010ptd.1_Missense_Mutation_p.L108F	NM_006243	NP_006234	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B	167					negative regulation of establishment of protein localization in plasma membrane|negative regulation of lipid kinase activity|positive regulation of protein dephosphorylation|signal transduction	chromosome, centromeric region|cytoplasm|nucleus|protein phosphatase type 2A complex	kinase binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		AATTCTTCTTGAGATTTTTGG	0.343													40	85	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215821941	215821941	+	Silent	SNP	G	A	A	rs139847770	byFrequency	TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215821941G>A	uc001hku.1	-	66	14898	c.14511C>T	c.(14509-14511)ATC>ATT	p.I4837I		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4837	Extracellular (Potential).|Fibronectin type-III 34.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCAGCGTCCCGATTTGTGGAG	0.572										HNSCC(13;0.011)			33	55	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215916599	215916599	+	Missense_Mutation	SNP	A	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215916599A>G	uc001hku.1	-	59	11855	c.11468T>C	c.(11467-11469)GTT>GCT	p.V3823A		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3823	Fibronectin type-III 23.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATGATGACCAACGGAGAAGGC	0.428										HNSCC(13;0.011)			29	107	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216420520	216420520	+	Missense_Mutation	SNP	A	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216420520A>C	uc001hku.1	-	13	2603	c.2216T>G	c.(2215-2217)TTT>TGT	p.F739C	USH2A_uc001hkv.2_Missense_Mutation_p.F739C	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	739	Laminin EGF-like 4.|Extracellular (Potential).		F -> L (in RP39; uncertain pathogenicity).		maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AACATCATTAAAGCTTCGGAG	0.393										HNSCC(13;0.011)			3	158	---	---	---	---	PASS
RRP15	51018	broad.mit.edu	37	1	218480911	218480911	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218480911G>T	uc001hlj.2	+	4	672	c.642G>T	c.(640-642)TTG>TTT	p.L214F		NM_016052	NP_057136	Q9Y3B9	RRP15_HUMAN	ribosomal RNA processing 15 homolog	214						mitochondrion|nucleolus	protein binding				0				all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)		TCAGTGTTTTGAGAGGGATGG	0.368													7	38	---	---	---	---	PASS
SLC30A10	55532	broad.mit.edu	37	1	220091807	220091807	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220091807G>A	uc001hlw.2	-	3	959	c.748C>T	c.(748-750)CTG>TTG	p.L250L	SLC30A10_uc001hlu.1_RNA|SLC30A10_uc001hlv.2_Silent_p.L5L|SLC30A10_uc001hlx.2_Silent_p.L25L	NM_018713	NP_061183	Q6XR72	ZNT10_HUMAN	solute carrier family 30 (zinc transporter),	250	Helical; (Potential).				zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		ACGGACCCCAGGGCATCTCCC	0.527													19	84	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232650395	232650395	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232650395G>T	uc001hvg.2	-	1	849	c.691C>A	c.(691-693)CCT>ACT	p.P231T		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	231					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				AAAAATTCAGGGAACCCAAAA	0.458													48	95	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237516183	237516183	+	Intron	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237516183C>A	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ggtgaggagacaactcttaac	0.000													4	16	---	---	---	---	PASS
CHRM3	1131	broad.mit.edu	37	1	240072470	240072470	+	Nonsense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240072470C>G	uc001hyp.2	+	5	2498	c.1719C>G	c.(1717-1719)TAC>TAG	p.Y573*		NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	573	Cytoplasmic (By similarity).				cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	AGCAGCAGTACCAGCAGAGAC	0.493													17	61	---	---	---	---	PASS
OR2W5	441932	broad.mit.edu	37	1	247655152	247655152	+	Silent	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247655152G>C	uc001icz.1	+	1	723	c.723G>C	c.(721-723)CTG>CTC	p.L241L		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	241					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TTCCACACCTGCTCTTCTCAC	0.562													44	77	---	---	---	---	PASS
OR2G3	81469	broad.mit.edu	37	1	247769620	247769620	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247769620C>A	uc010pyz.1	+	1	733	c.733C>A	c.(733-735)CTT>ATT	p.L245I		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	245	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CTCCTCCCACCTTACAGTGGT	0.478													33	34	---	---	---	---	PASS
OR14A16	284532	broad.mit.edu	37	1	247978591	247978591	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247978591C>A	uc001idm.1	-	1	441	c.441G>T	c.(439-441)TGG>TGT	p.W147C		NM_001001966	NP_001001966	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A,	147	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CCCCATACAGCCAAGACACAG	0.512													39	87	---	---	---	---	PASS
OR2T6	254879	broad.mit.edu	37	1	248551196	248551196	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248551196C>A	uc001iei.1	+	1	287	c.287C>A	c.(286-288)GCC>GAC	p.A96D		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	96	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCTTTCATCGCCTGCACTGCT	0.532													41	82	---	---	---	---	PASS
OR2T6	254879	broad.mit.edu	37	1	248551197	248551197	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248551197C>A	uc001iei.1	+	1	288	c.288C>A	c.(286-288)GCC>GCA	p.A96A		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	96	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTTTCATCGCCTGCACTGCTC	0.532													41	83	---	---	---	---	PASS
RSAD2	91543	broad.mit.edu	37	2	7018277	7018277	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7018277G>A	uc002qyp.1	+	1	482	c.346G>A	c.(346-348)GGT>AGT	p.G116S		NM_080657	NP_542388	Q8WXG1	RSAD2_HUMAN	radical S-adenosyl methionine domain containing	116					defense response to virus	endoplasmic reticulum membrane|Golgi apparatus	catalytic activity|iron-sulfur cluster binding|metal ion binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			OV - Ovarian serous cystadenocarcinoma(76;0.191)		TAAGGAAGCTGGTGAGTACAT	0.512													4	32	---	---	---	---	PASS
NTSR2	23620	broad.mit.edu	37	2	11798693	11798693	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11798693G>T	uc002rbq.3	-	4	1219	c.1145C>A	c.(1144-1146)CCC>CAC	p.P382H		NM_012344	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	382	Cytoplasmic (Potential).				sensory perception	integral to plasma membrane					0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	CCGCTTCATGGGGTGGTGCTC	0.567													11	86	---	---	---	---	PASS
MSGN1	343930	broad.mit.edu	37	2	17998202	17998202	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17998202C>A	uc010yjt.1	+	1	417	c.417C>A	c.(415-417)ACC>ACA	p.T139T		NM_001105569	NP_001099039	A6NI15	MSGN1_HUMAN	mesogenin 1	139	Helix-loop-helix motif.				cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GGATGAGGACCTTGGCAGATG	0.602													10	44	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21250815	21250815	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21250815G>A	uc002red.2	-	14	2080	c.1952C>T	c.(1951-1953)GCC>GTC	p.A651V		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	651	Vitellogenin.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TTTGGCTGAGGCTGGGTCAAG	0.398													24	127	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25463181	25463181	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25463181C>T	uc002rgc.2	-	19	2569	c.2312G>A	c.(2311-2313)CGA>CAA	p.R771Q	DNMT3A_uc002rgd.2_Missense_Mutation_p.R771Q|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Missense_Mutation_p.R582Q	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	771					regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding	p.R771L(1)		haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCGAGAAATCGCGAGATGTC	0.542			Mis|F|N|S		AML								7	133	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25965964	25965964	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25965964G>A	uc002rgs.2	-	12	3463	c.3242C>T	c.(3241-3243)TCA>TTA	p.S1081L	ASXL2_uc002rgt.1_Intron	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	1081					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGGCACAACTGAGAGAAGATT	0.502													24	109	---	---	---	---	PASS
HADHA	3030	broad.mit.edu	37	2	26455021	26455021	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26455021G>A	uc002rgy.2	-						HADHA_uc010yks.1_Intron|HADHA_uc010ykt.1_Intron	NM_000182	NP_000173	P40939	ECHA_HUMAN	mitochondrial trifunctional protein, alpha						fatty acid beta-oxidation	fatty acid beta-oxidation multienzyme complex|mitochondrial nucleoid|nucleolus	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acetyltransferase activity|coenzyme binding|enoyl-CoA hydratase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				NADH(DB00157)	GGGGATGTTAGACTCACCATT	0.398													38	50	---	---	---	---	PASS
GPR113	165082	broad.mit.edu	37	2	26534385	26534385	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26534385C>T	uc002rhe.3	-	11	2211	c.2211G>A	c.(2209-2211)CAG>CAA	p.Q737Q	GPR113_uc010yky.1_Silent_p.Q668Q|GPR113_uc002rhb.1_Silent_p.Q340Q|GPR113_uc010eyk.1_Silent_p.Q538Q|GPR113_uc002rhc.1_Silent_p.Q340Q|GPR113_uc002rhd.1_RNA	NM_001145168	NP_001138640	Q8IZF5	GP113_HUMAN	G-protein coupled receptor 113 isoform 1	737	GPS.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACTGGCCACCTGTGCCTGGC	0.607													20	109	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26706386	26706386	+	Missense_Mutation	SNP	C	T	T	rs146086924		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26706386C>T	uc002rhk.2	-	13	1463	c.1336G>A	c.(1336-1338)GGT>AGT	p.G446S		NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	446	Cytoplasmic (Potential).|C2 2.				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGTTTTCACCGATGAAAGCC	0.552													13	61	---	---	---	---	PASS
PLB1	151056	broad.mit.edu	37	2	28754978	28754978	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28754978C>A	uc002rmb.1	+	9	472	c.472C>A	c.(472-474)CTT>ATT	p.L158I	PLB1_uc010ezj.1_Missense_Mutation_p.L158I	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor	158	4 X 308-326 AA approximate repeats.|Extracellular (Potential).|1.				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					TATTCAGCAACTTGACTTTCA	0.408													31	236	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33623585	33623585	+	Silent	SNP	T	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33623585T>C	uc002ros.2	+	34	5142	c.5142T>C	c.(5140-5142)AAT>AAC	p.N1714N	LTBP1_uc002rot.2_Silent_p.N1388N|LTBP1_uc002rou.2_Silent_p.N1387N|LTBP1_uc002rov.2_Silent_p.N1334N|LTBP1_uc010ymz.1_Silent_p.N1345N|LTBP1_uc010yna.1_Silent_p.N1292N|LTBP1_uc010ynb.1_Silent_p.N611N	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	1713					negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CCGCCTTGAATTTAGAGAAAG	0.433													35	66	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50723113	50723113	+	Silent	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50723113G>T	uc010fbq.2	-	15	4597	c.3120C>A	c.(3118-3120)CTC>CTA	p.L1040L	NRXN1_uc002rxb.3_Silent_p.L672L|NRXN1_uc002rxe.3_Silent_p.L1000L|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TTACAGTGTGGAGGTTGCTGG	0.448													4	45	---	---	---	---	PASS
ERLEC1	27248	broad.mit.edu	37	2	54014354	54014354	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54014354G>A	uc002rxl.2	+	1	287	c.7G>A	c.(7-9)GAA>AAA	p.E3K	ASB3_uc002rxg.1_5'Flank|ASB3_uc002rxh.1_5'Flank|ASB3_uc002rxi.3_Intron|ASB3_uc010yoo.1_5'Flank|ERLEC1_uc002rxm.2_Missense_Mutation_p.E3K|ERLEC1_uc002rxn.2_Missense_Mutation_p.E3K	NM_015701	NP_056516	Q96DZ1	ERLEC_HUMAN	erlectin isoform 1	3					ER-associated protein catabolic process	endoplasmic reticulum lumen	glycoprotein binding|protein binding			ovary(2)	2						GAGGATGGAGGAAGGAGGCGG	0.592													4	26	---	---	---	---	PASS
C2orf86	51057	broad.mit.edu	37	2	63631244	63631244	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63631244G>C	uc002sch.2	-	10	1820	c.1374C>G	c.(1372-1374)ATC>ATG	p.I458M	C2orf86_uc002sce.2_RNA|C2orf86_uc002scf.2_Missense_Mutation_p.I299M|C2orf86_uc010ypu.1_RNA|C2orf86_uc002scg.2_Missense_Mutation_p.I266M|C2orf86_uc002sci.1_Missense_Mutation_p.I434M|C2orf86_uc010fcr.1_Missense_Mutation_p.I348M	NM_015910	NP_056994	O95876	FRITZ_HUMAN	hypothetical protein LOC51057 isoform 2	458					cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0						GGAGATCATAGATATCACTAC	0.393													32	134	---	---	---	---	PASS
UGP2	7360	broad.mit.edu	37	2	64112851	64112851	+	Nonsense_Mutation	SNP	T	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64112851T>A	uc002scm.2	+	6	1010	c.704T>A	c.(703-705)TTG>TAG	p.L235*	UGP2_uc002scl.2_Nonsense_Mutation_p.L224*|UGP2_uc010ypx.1_Nonsense_Mutation_p.L244*	NM_006759	NP_006750	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2 isoform a	235					glycogen biosynthetic process|phosphorylation|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	metal ion binding|protein binding|UTP:glucose-1-phosphate uridylyltransferase activity				0						AACTCTGGATTGCTTGATACC	0.403													49	176	---	---	---	---	PASS
VPS54	51542	broad.mit.edu	37	2	64189585	64189585	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64189585G>A	uc002scq.2	-						VPS54_uc002scp.2_Intron|VPS54_uc010fct.2_Intron	NM_016516	NP_057600	Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 isoform 1						protein transport|retrograde transport, endosome to Golgi						0						CAGCTTAAAAGAGAAGGAAAA	0.328													8	30	---	---	---	---	PASS
PCYOX1	51449	broad.mit.edu	37	2	70486688	70486688	+	Silent	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70486688C>G	uc002sgn.3	+	2	375	c.309C>G	c.(307-309)GTC>GTG	p.V103V	PCYOX1_uc010fdo.2_Silent_p.V26V|PCYOX1_uc010yqu.1_Intron	NM_016297	NP_057381	Q9UHG3	PCYOX_HUMAN	prenylcysteine oxidase 1 precursor	103					prenylated protein catabolic process	lysosome|very-low-density lipoprotein particle	prenylcysteine oxidase activity			central_nervous_system(1)	1						AACGTTTTGTCAAAGACCTGG	0.473													48	177	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71780187	71780187	+	Nonsense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71780187C>G	uc002sie.2	+	20	2175	c.1799C>G	c.(1798-1800)TCA>TGA	p.S600*	DYSF_uc010feg.2_Nonsense_Mutation_p.S631*|DYSF_uc010feh.2_Nonsense_Mutation_p.S586*|DYSF_uc002sig.3_Nonsense_Mutation_p.S586*|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Nonsense_Mutation_p.S600*|DYSF_uc010fef.2_Nonsense_Mutation_p.S617*|DYSF_uc010fei.2_Nonsense_Mutation_p.S617*|DYSF_uc010fek.2_Nonsense_Mutation_p.S618*|DYSF_uc010fej.2_Nonsense_Mutation_p.S587*|DYSF_uc010fel.2_Nonsense_Mutation_p.S587*|DYSF_uc010feo.2_Nonsense_Mutation_p.S632*|DYSF_uc010fem.2_Nonsense_Mutation_p.S601*|DYSF_uc010fen.2_Nonsense_Mutation_p.S618*|DYSF_uc002sif.2_Nonsense_Mutation_p.S601*	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	600	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						GCCTTCTACTCAGCCACCATG	0.567													20	48	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89976327	89976327	+	Intron	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89976327C>G	uc010fhm.2	+						uc010ytu.1_RNA					Parts of antibodies, mostly variable regions.																		AGAGGCCAGGCCAATCTCCAA	0.512													59	114	---	---	---	---	PASS
SULT1C2	6819	broad.mit.edu	37	2	108924925	108924925	+	3'UTR	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108924925G>C	uc002tdy.2	+	8					SULT1C2_uc002tdx.2_3'UTR|SULT1C2_uc010ywq.1_3'UTR	NM_001056	NP_001047	O00338	ST1C2_HUMAN	sulfotransferase family, cytosolic, 1C, member 1						3'-phosphoadenosine 5'-phosphosulfate metabolic process|amine metabolic process|sulfation|xenobiotic metabolic process	cytosol|microtubule cytoskeleton	sulfotransferase activity			ovary(1)	1						CTCTGAGCAAGATGTAAATAA	0.378													9	49	---	---	---	---	PASS
GCC2	9648	broad.mit.edu	37	2	109109244	109109244	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109109244G>T	uc002tec.2	+	19	4599	c.4445G>T	c.(4444-4446)AGA>ATA	p.R1482I	GCC2_uc002ted.2_Missense_Mutation_p.R1381I	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	1482	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						CCGACCACAAGAAGTATGTAT	0.368													16	35	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130872872	130872872	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130872872C>T	uc010fmh.2	-	4	951	c.551G>A	c.(550-552)GGG>GAG	p.G184E		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	184	ANK 1.					cell cortex	ATP binding			skin(3)|ovary(2)	5						TTCTGAATTCCCATTGGCAGA	0.423													23	149	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131520908	131520908	+	Silent	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131520908C>G	uc002trw.2	+	2	1453	c.1263C>G	c.(1261-1263)GCC>GCG	p.A421A	FAM123C_uc010fmv.2_Silent_p.A421A|FAM123C_uc010fms.1_Silent_p.A421A|FAM123C_uc010fmt.1_Silent_p.A421A|FAM123C_uc010fmu.1_Silent_p.A421A	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	421										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		GTGGGGACGCCCTCTACGAGC	0.632													15	62	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136548373	136548373	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136548373C>G	uc002tuu.1	-	15	5201	c.5190G>C	c.(5188-5190)AGG>AGC	p.R1730S		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1730	Extracellular (Potential).|4.|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		TCAGGATCCTCCTGAAGCCAA	0.483													19	83	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141598560	141598560	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141598560C>T	uc002tvj.1	-	30	6013	c.5041G>A	c.(5041-5043)GAT>AAT	p.D1681N		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1681	Extracellular (Potential).|LDL-receptor class B 15.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AAAGAGCCATCTAGCCTTGCC	0.398										TSP Lung(27;0.18)			6	78	---	---	---	---	PASS
PKP4	8502	broad.mit.edu	37	2	159522953	159522953	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159522953G>A	uc002tzv.2	+	16	2866	c.2606G>A	c.(2605-2607)CGA>CAA	p.R869Q	PKP4_uc002tzu.2_Missense_Mutation_p.R869Q|PKP4_uc002tzw.2_Missense_Mutation_p.R869Q|PKP4_uc002tzx.2_Missense_Mutation_p.R526Q|PKP4_uc002uaa.2_Missense_Mutation_p.R721Q|uc002uab.1_Intron|PKP4_uc002uac.2_Missense_Mutation_p.R50Q|PKP4_uc002uad.2_RNA|PKP4_uc002uae.1_5'Flank	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a	869	ARM 8.				cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						GCGGCCGTCCGAAAAGAAAAG	0.443										HNSCC(62;0.18)			26	142	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166908383	166908383	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166908383C>T	uc010zcz.1	-	6	828	c.810G>A	c.(808-810)ATG>ATA	p.M270I	SCN1A_uc002udo.3_Missense_Mutation_p.M139I|SCN1A_uc010fpk.2_Missense_Mutation_p.M139I	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	270	Helical; Name=S5 of repeat I; (By similarity).|I.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	TCAGGTTGCCCATGAACAGCT	0.433													15	89	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168106459	168106459	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168106459G>C	uc002udx.2	+	8	8575	c.8557G>C	c.(8557-8559)GTC>CTC	p.V2853L	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.V2678L|XIRP2_uc010fpq.2_Missense_Mutation_p.V2631L|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Missense_Mutation_p.V199L	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2678					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						ACCAAAGGTCGTCAAGCAAAA	0.353													23	108	---	---	---	---	PASS
DYNC1I2	1781	broad.mit.edu	37	2	172582502	172582502	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172582502C>G	uc002uha.1	+	9	846	c.681C>G	c.(679-681)GAC>GAG	p.D227E	DYNC1I2_uc002uhc.2_Missense_Mutation_p.D201E|DYNC1I2_uc002uhb.1_Missense_Mutation_p.D201E|DYNC1I2_uc010zds.1_Missense_Mutation_p.D219E|DYNC1I2_uc002uhd.1_Missense_Mutation_p.D221E|DYNC1I2_uc002uhe.1_Missense_Mutation_p.D227E|DYNC1I2_uc002uhf.1_Missense_Mutation_p.D201E|DYNC1I2_uc010zdt.1_Missense_Mutation_p.D219E|DYNC1I2_uc002uhg.1_Missense_Mutation_p.D142E|DYNC1I2_uc010zdu.1_5'Flank	NM_001378	NP_001369	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	227					G2/M transition of mitotic cell cycle|interspecies interaction between organisms|microtubule-based movement|transport	centrosome|cytosol|dynein complex|microtubule|vesicle	microtubule motor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.198)			GTTTCTTTGACCATTCTACAA	0.353													9	41	---	---	---	---	PASS
SLC25A12	8604	broad.mit.edu	37	2	172669850	172669850	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172669850C>A	uc002uhh.2	-	11	1259	c.1170G>T	c.(1168-1170)AGG>AGT	p.R390S	SLC25A12_uc010fqh.2_Missense_Mutation_p.R283S	NM_003705	NP_003696	O75746	CMC1_HUMAN	solute carrier family 25, member 12	390	Solcar 1.				gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	CTTACTCACCCCTGTAGAGTC	0.433													17	77	---	---	---	---	PASS
DLX2	1746	broad.mit.edu	37	2	172965551	172965551	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172965551G>T	uc002uhn.2	-	3	919	c.707C>A	c.(706-708)TCA>TAA	p.S236*		NM_004405	NP_004396	Q07687	DLX2_HUMAN	distal-less homeobox 2	236						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.216)			GGCCGGCGCTGAGACTGGCGG	0.701													12	18	---	---	---	---	PASS
ITGA6	3655	broad.mit.edu	37	2	173338886	173338886	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173338886G>C	uc002uhp.1	+	6	1082	c.879G>C	c.(877-879)AAG>AAC	p.K293N	ITGA6_uc010fqk.1_Missense_Mutation_p.K179N|ITGA6_uc010zdy.1_Missense_Mutation_p.K174N|ITGA6_uc002uho.1_Missense_Mutation_p.K293N|ITGA6_uc010fqm.1_5'Flank	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a	332	FG-GAP 4.|Extracellular (Potential).				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			TTTTGCTGAAGAGAGACATGA	0.478													25	57	---	---	---	---	PASS
COL3A1	1281	broad.mit.edu	37	2	189867042	189867042	+	Missense_Mutation	SNP	G	T	T	rs121912920		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189867042G>T	uc002uqj.1	+	35	2527	c.2410G>T	c.(2410-2412)GGC>TGC	p.G804C		NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	804	Triple-helical region.		G -> S (in EDS3).		axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	AGGTGAAACTGGCCCTCCAGG	0.438													24	38	---	---	---	---	PASS
PMS1	5378	broad.mit.edu	37	2	190742031	190742031	+	Missense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190742031A>T	uc002urh.3	+	13	3197	c.2668A>T	c.(2668-2670)ATG>TTG	p.M890L	PMS1_uc002urk.3_Missense_Mutation_p.M851L|PMS1_uc002uri.3_Missense_Mutation_p.M728L|PMS1_uc010zgc.1_Missense_Mutation_p.M714L|PMS1_uc010zgd.1_Missense_Mutation_p.M714L|PMS1_uc002urj.2_RNA|PMS1_uc010frz.2_Missense_Mutation_p.M206L|PMS1_uc002url.2_Missense_Mutation_p.M513L|PMS1_uc002urm.2_RNA	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a	890					mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			ACAATTACCCATGTACTTATC	0.403			Mis|N			colorectal|endometrial|ovarian		Direct_reversal_of_damage|MMR					4	60	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196788444	196788444	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196788444C>A	uc002utj.3	-	23	3801	c.3700G>T	c.(3700-3702)GTA>TTA	p.V1234L		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1234	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						CCCAGAGTTACGCGATTCTGC	0.398													14	63	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215851337	215851337	+	Silent	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215851337G>C	uc002vew.2	-	28	4312	c.4092C>G	c.(4090-4092)CTC>CTG	p.L1364L	ABCA12_uc002vev.2_Silent_p.L1046L|ABCA12_uc010zjn.1_Silent_p.L291L	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	1364	ABC transporter 1.				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGTTCAGATTGAGGTTATCAA	0.428													14	69	---	---	---	---	PASS
RNF25	64320	broad.mit.edu	37	2	219532650	219532650	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219532650C>T	uc002vit.2	-	5	430	c.342G>A	c.(340-342)CTG>CTA	p.L114L	RNF25_uc010fvw.2_Silent_p.L2L	NM_022453	NP_071898	Q96BH1	RNF25_HUMAN	ring finger protein 25	114	RWD.				positive regulation of NF-kappaB transcription factor activity	cytosol|nucleus	NF-kappaB binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGAGTTCATACAGCATGGCAG	0.502													83	102	---	---	---	---	PASS
FAM134A	79137	broad.mit.edu	37	2	220047133	220047133	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220047133C>T	uc002vjw.3	+	9	1550	c.1414C>T	c.(1414-1416)CAG>TAG	p.Q472*	FAM134A_uc010fwc.2_Nonsense_Mutation_p.Q265*|FAM134A_uc002vjx.2_Intron	NM_024293	NP_077269	Q8NC44	F134A_HUMAN	hypothetical protein LOC79137	472						endoplasmic reticulum|integral to membrane				ovary(1)|central_nervous_system(1)	2		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACCTGTTCCCCAGGACTCACC	0.622													45	58	---	---	---	---	PASS
CUL3	8452	broad.mit.edu	37	2	225449700	225449700	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225449700G>A	uc002vny.2	-	1	411	c.27C>T	c.(25-27)GGC>GGT	p.G9G	CUL3_uc010zls.1_Silent_p.G9G	NM_003590	NP_003581	Q13618	CUL3_HUMAN	cullin 3	9					cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CCTTCCGGCTGCCCGTGCCTT	0.602													4	14	---	---	---	---	PASS
SNED1	25992	broad.mit.edu	37	2	241988480	241988480	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241988480G>A	uc002wah.1	+	11	1546	c.1546G>A	c.(1546-1548)GAT>AAT	p.D516N		NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor	516	Follistatin-like 2.				cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		ACAGTGCCCAGATGGGGGCTA	0.587													5	16	---	---	---	---	PASS
PASK	23178	broad.mit.edu	37	2	242075391	242075391	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242075391G>T	uc002wao.1	-	8	1293	c.1201C>A	c.(1201-1203)CAG>AAG	p.Q401K	PASK_uc010zol.1_Missense_Mutation_p.Q215K|PASK_uc010zom.1_Missense_Mutation_p.Q366K|PASK_uc010fzl.1_Missense_Mutation_p.Q401K|PASK_uc010zon.1_Missense_Mutation_p.Q182K|PASK_uc002wap.2_5'Flank|PASK_uc002waq.2_Missense_Mutation_p.Q401K	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	401	PAS 2.				regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		TCTGGGAGCTGTAATGAGCTG	0.557													64	109	---	---	---	---	PASS
ANO7	50636	broad.mit.edu	37	2	242135205	242135205	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242135205C>A	uc002wax.2	+	4	519	c.416C>A	c.(415-417)ACC>AAC	p.T139N	ANO7_uc002waw.2_Missense_Mutation_p.T138N	NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN	transmembrane protein 16G isoform NGEP long	139	Cytoplasmic (Potential).					cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3						ATGCACAGGACCTGGCGGGAG	0.607													10	55	---	---	---	---	PASS
WNT7A	7476	broad.mit.edu	37	3	13896073	13896073	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13896073C>A	uc003bye.1	-	3	831	c.526G>T	c.(526-528)GCC>TCC	p.A176S		NM_004625	NP_004616	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family,	176					activation of JUN kinase activity|anterior/posterior pattern formation|canonical Wnt receptor signaling pathway|cell proliferation in forebrain|cellular response to transforming growth factor beta stimulus|central nervous system vasculogenesis|cerebellar granule cell differentiation|dorsal/ventral pattern formation|embryonic axis specification|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic leg morphogenesis|lens fiber cell development|negative regulation of neurogenesis|palate development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of JNK cascade|positive regulation of synaptogenesis|positive regulation of transcription from RNA polymerase II promoter|regulation of axon diameter|satellite cell activation|satellite cell maintenance involved in skeletal muscle regeneration|sex differentiation|uterus development|Wnt receptor signaling pathway involved in wound healing, spreading of epidermal cells|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled binding|receptor agonist activity|signal transducer activity			ovary(2)|breast(1)	3						AGAGTCCGGGCATTCTGCTTG	0.582													54	232	---	---	---	---	PASS
STT3B	201595	broad.mit.edu	37	3	31677540	31677540	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31677540C>T	uc011axe.1	+	16	2465	c.2465C>T	c.(2464-2466)TCT>TTT	p.S822F		NM_178862	NP_849193	Q8TCJ2	STT3B_HUMAN	source of immunodominant MHC-associated	822				S -> F (in Ref. 3; AAH15880).	protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding				0						AAGAAAATATCTAAGAAGACT	0.368													13	48	---	---	---	---	PASS
PRSS42	339906	broad.mit.edu	37	3	46874683	46874683	+	Missense_Mutation	SNP	T	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46874683T>G	uc011bap.1	-	3	385	c.385A>C	c.(385-387)AGT>CGT	p.S129R	PRSS42_uc003cqj.2_Missense_Mutation_p.S25R	NM_182702	NP_874361	Q7Z5A4	PRS42_HUMAN	testis serine protease 2 precursor	129	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			pancreas(1)	1						ATCTTGACACTGTAATGGAAA	0.448													5	39	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48605026	48605026	+	Missense_Mutation	SNP	T	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48605026T>A	uc003ctz.2	-	108	8028	c.8027A>T	c.(8026-8028)GAG>GTG	p.E2676V		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2676	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GATCAGGCCCTCCTTGCCAGG	0.637													20	58	---	---	---	---	PASS
ACTR8	93973	broad.mit.edu	37	3	53914030	53914030	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53914030C>T	uc003dhd.2	-	2	289	c.230G>A	c.(229-231)CGA>CAA	p.R77Q	ACTR8_uc003dhb.2_5'Flank|ACTR8_uc003dhc.2_5'UTR	NM_022899	NP_075050	Q9H981	ARP8_HUMAN	actin-related protein 8	77					cell division|DNA recombination|DNA repair|mitosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex	protein binding			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		TTTGTGTCTTCGGGCAATGAC	0.478													30	72	---	---	---	---	PASS
CCDC66	285331	broad.mit.edu	37	3	56651142	56651142	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56651142G>A	uc003dhz.2	+	14	1933	c.1846G>A	c.(1846-1848)GAC>AAC	p.D616N	CCDC66_uc003dhy.2_Missense_Mutation_p.D252N|CCDC66_uc003dhu.2_Missense_Mutation_p.D582N|CCDC66_uc003dhx.2_RNA|CCDC66_uc003dia.2_5'UTR	NM_001141947	NP_001135419	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66 isoform 1	616										breast(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		TTTTTTAGATGACTTAAATAT	0.274													7	17	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62388831	62388831	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62388831G>A	uc003dll.2	-	29	4167	c.3807C>T	c.(3805-3807)ATC>ATT	p.I1269I	CADPS_uc003dlj.1_Silent_p.I224I|CADPS_uc003dlk.1_Silent_p.I717I|CADPS_uc003dlm.2_Silent_p.I1230I|CADPS_uc003dln.2_Silent_p.I1190I	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	1269	Mediates targeting and association with DCVs (By similarity).				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		ACCAGGTGCAGATCACGTTCA	0.408													13	42	---	---	---	---	PASS
SYNPR	132204	broad.mit.edu	37	3	63601157	63601157	+	Silent	SNP	A	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63601157A>G	uc003dlq.2	+	5	1167	c.798A>G	c.(796-798)TAA>TAG	p.*266*	SYNPR_uc003dlp.2_Silent_p.*286*|SYNPR_uc011bfk.1_RNA|SYNPR_uc011bfl.1_RNA|SYNPR_uc010hnt.2_Silent_p.*275*|SYNPR_uc011bfm.1_RNA	NM_144642	NP_653243	Q8TBG9	SYNPR_HUMAN	synaptoporin isoform 2	266						cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	transporter activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)		ATCAGATTTAACAGAGTAGCA	0.453													8	43	---	---	---	---	PASS
PRICKLE2	166336	broad.mit.edu	37	3	64184592	64184592	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64184592C>A	uc003dmf.2	-	2	598	c.12G>T	c.(10-12)GTG>GTT	p.V4V		NM_198859	NP_942559	Q7Z3G6	PRIC2_HUMAN	prickle-like 2	4						cytoplasm|nuclear membrane	zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		CCAGCGGCATCACTGTCACCA	0.483													16	75	---	---	---	---	PASS
MITF	4286	broad.mit.edu	37	3	70008416	70008416	+	Intron	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70008416C>T	uc003dnz.2	+						MITF_uc011bgb.1_Intron|MITF_uc003doa.2_Intron|MITF_uc003dob.2_Intron|MITF_uc003dod.2_Intron|MITF_uc003doe.2_Intron|MITF_uc003dof.2_Intron	NM_198159	NP_937802	O75030	MITF_HUMAN	microphthalmia-associated transcription factor						melanocyte differentiation|multicellular organismal development|protein complex assembly	nucleus|protein complex	DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			ovary(2)	2		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		CCTCCATTTTCATCGCAGAGA	0.358			A		melanoma 		Waardenburg syndrome type 2|Tietz syndrome						10	33	---	---	---	---	PASS
OR5K4	403278	broad.mit.edu	37	3	98073316	98073316	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98073316C>G	uc011bgv.1	+	1	619	c.619C>G	c.(619-621)CAA>GAA	p.Q207E		NM_001005517	NP_001005517	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K,	207	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						AATACCAATTCAAATCTTTAC	0.333													7	52	---	---	---	---	PASS
GPR15	2838	broad.mit.edu	37	3	98251486	98251486	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98251486C>A	uc011bgy.1	+	1	609	c.609C>A	c.(607-609)ACC>ACA	p.T203T		NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15	203	Helical; Name=5; (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)		TAATTTTCACCTTTTTTGTCC	0.448													37	78	---	---	---	---	PASS
GPR15	2838	broad.mit.edu	37	3	98251494	98251494	+	Missense_Mutation	SNP	T	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98251494T>G	uc011bgy.1	+	1	617	c.617T>G	c.(616-618)GTC>GGC	p.V206G		NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15	206	Helical; Name=5; (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)		ACCTTTTTTGTCCCTTTGTTG	0.433													35	74	---	---	---	---	PASS
CPOX	1371	broad.mit.edu	37	3	98304461	98304461	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98304461C>A	uc003dsx.2	-	5	1089	c.996G>T	c.(994-996)CGG>CGT	p.R332R		NM_000097	NP_000088	P36551	HEM6_HUMAN	coproporphyrinogen oxidase precursor	332						mitochondrial intermembrane space	coproporphyrinogen oxidase activity|protein homodimerization activity				0						CACCAATGCCCCGCCGTTCTC	0.468													4	132	---	---	---	---	PASS
TBC1D23	55773	broad.mit.edu	37	3	100000667	100000667	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100000667C>T	uc003dtt.2	+	3	424	c.247C>T	c.(247-249)CAC>TAC	p.H83Y	TBC1D23_uc003dts.2_Missense_Mutation_p.H83Y	NM_018309	NP_060779	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	83	Rab-GAP TBC.					intracellular	Rab GTPase activator activity			ovary(1)|liver(1)	2						GAACACTATTCACAAAGATTG	0.353													15	72	---	---	---	---	PASS
NFKBIZ	64332	broad.mit.edu	37	3	101574241	101574241	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101574241G>A	uc003dvp.2	+	8	1708	c.1593G>A	c.(1591-1593)GCG>GCA	p.A531A	NFKBIZ_uc003dvo.2_Silent_p.A431A|NFKBIZ_uc010hpo.2_Silent_p.A431A|NFKBIZ_uc003dvq.2_Silent_p.A409A	NM_031419	NP_113607	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene	531	Interaction with NFKB1/p50 (By similarity).|ANK 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(2)	2						ATCTGCAGGCGATTCAGAAGG	0.373													28	57	---	---	---	---	PASS
DZIP3	9666	broad.mit.edu	37	3	108409675	108409675	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108409675G>A	uc003dxd.2	+	32	3980	c.3558G>A	c.(3556-3558)ACG>ACA	p.T1186T	DZIP3_uc003dxf.1_Silent_p.T1186T|DZIP3_uc011bhm.1_Silent_p.T637T	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	1186	RING-type; atypical.				protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CATGTCCAACGTGCAGACTCC	0.502													30	92	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108723703	108723703	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108723703C>G	uc003dxl.2	-	20	2133	c.2046G>C	c.(2044-2046)TGG>TGC	p.W682C	MORC1_uc011bhn.1_Missense_Mutation_p.W661C	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	682					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						GTTGAGCTCTCCAGACAGTGG	0.368													63	332	---	---	---	---	PASS
C3orf30	152405	broad.mit.edu	37	3	118865623	118865623	+	Missense_Mutation	SNP	G	A	A	rs139845696	byFrequency	TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118865623G>A	uc003ecb.1	+	1	627	c.587G>A	c.(586-588)CGC>CAC	p.R196H	IGSF11_uc003eby.2_5'Flank|IGSF11_uc003ebz.2_5'Flank|IGSF11_uc010hqs.2_5'Flank|C3orf30_uc011biw.1_Missense_Mutation_p.R196H	NM_152539	NP_689752	Q96M34	CC030_HUMAN	hypothetical protein LOC152405	196										ovary(2)	2				GBM - Glioblastoma multiforme(114;0.222)		CAGATGGACCGCAGAATGTCT	0.517													29	113	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121414880	121414880	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121414880C>A	uc003eei.3	-	13	4601	c.4475G>T	c.(4474-4476)CGA>CTA	p.R1492L	GOLGB1_uc010hrc.2_Missense_Mutation_p.R1497L|GOLGB1_uc003eej.3_Missense_Mutation_p.R1458L|GOLGB1_uc011bjm.1_Missense_Mutation_p.R1378L|GOLGB1_uc010hrd.1_Missense_Mutation_p.R1456L	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	1492	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		TGCTTCTTTTCGGGAAATAAG	0.418													56	287	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126747835	126747835	+	Splice_Site	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126747835G>C	uc003ejg.2	+	25	4605	c.4601_splice	c.e25-1	p.E1534_splice	PLXNA1_uc003ejh.2_Splice_Site_p.E202_splice	NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1						axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		TCCTCCCCCAGAGTGGCGCCA	0.642													8	26	---	---	---	---	PASS
RUVBL1	8607	broad.mit.edu	37	3	127806642	127806642	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127806642C>A	uc003ekh.2	-	9	1130	c.1026G>T	c.(1024-1026)GAG>GAT	p.E342D	RUVBL1_uc003eke.2_Intron|RUVBL1_uc003ekf.2_Missense_Mutation_p.E282D|RUVBL1_uc010hss.2_Missense_Mutation_p.E342D	NM_003707	NP_003698	Q9Y265	RUVB1_HUMAN	RuvB-like 1	342					cell division|CenH3-containing nucleosome assembly at centromere|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|mitosis|regulation of growth|regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription, DNA-dependent	Golgi apparatus|Ino80 complex|membrane|microtubule organizing center|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|DNA helicase activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.181)		ATGTGATGTCCTCAGTGCCTC	0.488													4	73	---	---	---	---	PASS
COL29A1	256076	broad.mit.edu	37	3	130159395	130159395	+	Silent	SNP	A	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130159395A>C	uc010htj.1	+	35	6707	c.6213A>C	c.(6211-6213)CCA>CCC	p.P2071P	COL29A1_uc010hti.1_RNA|COL29A1_uc010htk.1_Silent_p.P110P	NM_153264	NP_694996	A8TX70	CO6A5_HUMAN	collagen, type XXIX, alpha 1	2071	VWFA 9.|Nonhelical region.				axon guidance|cell adhesion	collagen					0						ATCTTTTTCCAGAAACACCCT	0.398													16	64	---	---	---	---	PASS
ACPL2	92370	broad.mit.edu	37	3	140998308	140998308	+	Silent	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140998308A>T	uc003etu.2	+	6	626	c.327A>T	c.(325-327)ACA>ACT	p.T109T	ACPL2_uc003etv.2_Silent_p.T109T|ACPL2_uc011bna.1_Silent_p.T71T|ACPL2_uc011bnb.1_Silent_p.T92T	NM_152282	NP_689495	Q8TE99	ACPL2_HUMAN	acid phosphatase-like 2 precursor	109						extracellular region	acid phosphatase activity			skin(1)	1						TTCCCAAAACAAAGCGACCAG	0.448											OREG0015847	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	44	79	---	---	---	---	PASS
TSC22D2	9819	broad.mit.edu	37	3	150176430	150176430	+	3'UTR	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150176430C>G	uc003exv.2	+	4					TSC22D2_uc003exw.2_RNA|TSC22D2_uc003exx.2_3'UTR	NM_014779	NP_055594	O75157	T22D2_HUMAN	TSC22 domain family, member 2								sequence-specific DNA binding transcription factor activity			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ATAAAGCTTTCTTAAGCCTCA	0.463													10	53	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164907140	164907140	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164907140C>T	uc003fej.3	-	2	1923	c.1479G>A	c.(1477-1479)CGG>CGA	p.R493R	SLITRK3_uc003fek.2_Silent_p.R493R	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	493	LRR 10.|Extracellular (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						GCTGGATTTCCCGGATGACAT	0.488										HNSCC(40;0.11)			5	57	---	---	---	---	PASS
ARPM1	84517	broad.mit.edu	37	3	169487114	169487114	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169487114G>T	uc003ffs.1	-	1	570	c.195C>A	c.(193-195)TTC>TTA	p.F65L		NM_032487	NP_115876	Q9BYD9	ARPM1_HUMAN	actin related protein M1	65						cytoplasm|cytoskeleton					0	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;5.01e-59)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			GGTACCTGATGAACAGCGAGC	0.478													8	19	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179448430	179448430	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179448430C>T	uc003fkh.2	+	10	1268	c.1187C>T	c.(1186-1188)TCA>TTA	p.S396L	USP13_uc003fkf.2_Missense_Mutation_p.S396L	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	396					ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			GGCCTTCTCTCAGGCCAGTAT	0.418													23	43	---	---	---	---	PASS
LAMP3	27074	broad.mit.edu	37	3	182871557	182871557	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182871557C>G	uc003flh.3	-	2	896	c.672G>C	c.(670-672)AAG>AAC	p.K224N		NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	224	Lumenal (Potential).				cell proliferation	integral to membrane|lysosomal membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			AAATTCCAGTCTTGACTGACG	0.547													28	107	---	---	---	---	PASS
C3orf43	255798	broad.mit.edu	37	3	196236461	196236461	+	Missense_Mutation	SNP	C	T	T	rs79673145	by1000genomes	TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196236461C>T	uc003fws.2	-	2	287	c.130G>A	c.(130-132)GAA>AAA	p.E44K	C3orf43_uc003fwr.2_Missense_Mutation_p.E36K	NM_001077657	NP_001071125	Q147U7	CC043_HUMAN	hypothetical protein LOC255798	44						integral to membrane				ovary(1)	1	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;2.13e-23)|all cancers(36;2e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00298)		CTATGATGTTCGAATTTCTGC	0.438													28	64	---	---	---	---	PASS
ZNF595	152687	broad.mit.edu	37	4	59383	59383	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59383G>C	uc003fzv.1	+	2	220	c.64G>C	c.(64-66)GAC>CAC	p.D22H	ZNF595_uc003fzu.1_RNA|ZNF718_uc003fzt.3_Missense_Mutation_p.D22H|ZNF595_uc010iay.1_RNA|ZNF595_uc011bus.1_5'UTR|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595	22					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		GAAATGTCTGGACCCTGCCCA	0.413													36	491	---	---	---	---	PASS
TBC1D14	57533	broad.mit.edu	37	4	6995917	6995917	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6995917G>A	uc011bwg.1	+	4	929	c.850G>A	c.(850-852)GAA>AAA	p.E284K	TBC1D14_uc003gjs.3_Missense_Mutation_p.E284K|TBC1D14_uc010idh.2_Missense_Mutation_p.E4K	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a	284						intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						ctaggaatatgaagacaaggc	0.284													17	59	---	---	---	---	PASS
DEFB131	644414	broad.mit.edu	37	4	9452086	9452086	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9452086C>G	uc011bwt.1	+	2	59	c.59C>G	c.(58-60)GCC>GGC	p.A20G		NM_001040448	NP_001035538	P59861	DB131_HUMAN	defensin, beta 131 precursor	20				A -> G (in Ref. 1; AAQ09523).	defense response to bacterium	extracellular region					0						CTTTTTAAAGCCAGAAGCTTC	0.284													5	32	---	---	---	---	PASS
CLRN2	645104	broad.mit.edu	37	4	17517048	17517048	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17517048G>T	uc003gpg.1	+	1	261	c.159G>T	c.(157-159)GAG>GAT	p.E53D		NM_001079827	NP_001073296	A0PK11	CLRN2_HUMAN	clarin 2	53						integral to membrane					0						CAGACAGAGAGCTGGTCAAGT	0.552													11	47	---	---	---	---	PASS
PPARGC1A	10891	broad.mit.edu	37	4	23815388	23815388	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23815388G>A	uc003gqs.2	-	8	1838	c.1718C>T	c.(1717-1719)TCT>TTT	p.S573F	PPARGC1A_uc003gqt.2_RNA|PPARGC1A_uc011bxp.1_RNA|PPARGC1A_uc010ier.1_RNA	NM_013261	NP_037393	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor	573	Arg/Ser-rich.				androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding			ovary(2)|lung(2)|kidney(2)|skin(2)	8		Breast(46;0.0503)				CCTGTGTCGAGAAAAGGACCT	0.448													15	41	---	---	---	---	PASS
KIAA1211	57482	broad.mit.edu	37	4	57182826	57182826	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57182826C>A	uc003hbk.2	+	8	3549	c.3158C>A	c.(3157-3159)CCT>CAT	p.P1053H	KIAA1211_uc010iha.2_Missense_Mutation_p.P1046H|KIAA1211_uc011bzz.1_Missense_Mutation_p.P963H|KIAA1211_uc003hbm.1_Missense_Mutation_p.P939H	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	1053										ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					CAAGAGAAACCTTCTCAAACA	0.468													14	29	---	---	---	---	PASS
TECRL	253017	broad.mit.edu	37	4	65188436	65188436	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65188436C>G	uc003hcv.2	-	4	515	c.406G>C	c.(406-408)GAC>CAC	p.D136H	TECRL_uc003hcw.2_Missense_Mutation_p.D136H	NM_001010874	NP_001010874	Q5HYJ1	TECRL_HUMAN	steroid 5 alpha-reductase 2-like 2	136					lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors				0						TGACCTAGGTCTGTAGCATAC	0.308													16	64	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66213899	66213899	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66213899C>A	uc003hcy.2	-	15	2724	c.2531G>T	c.(2530-2532)TGG>TTG	p.W844L	EPHA5_uc003hcx.2_Missense_Mutation_p.W776L|EPHA5_uc003hcz.2_Missense_Mutation_p.W822L|EPHA5_uc011cah.1_Missense_Mutation_p.W845L|EPHA5_uc011cai.1_Missense_Mutation_p.W823L|EPHA5_uc003hda.2_Missense_Mutation_p.W845L	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	844	Cytoplasmic (Potential).|Protein kinase.				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						TGGGGCAGTCCATCTGATTGG	0.393										TSP Lung(17;0.13)			11	62	---	---	---	---	PASS
YTHDC1	91746	broad.mit.edu	37	4	69199062	69199062	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69199062C>G	uc003hdx.2	-	5	1290	c.937G>C	c.(937-939)GAT>CAT	p.D313H	YTHDC1_uc003hdy.2_Missense_Mutation_p.D313H	NM_001031732	NP_001026902	Q96MU7	YTDC1_HUMAN	splicing factor YT521-B isoform 1	313										upper_aerodigestive_tract(1)|ovary(1)	2						CCACTTCTATCAAAAACAATT	0.343													64	178	---	---	---	---	PASS
CSN1S1	1446	broad.mit.edu	37	4	70808251	70808251	+	Intron	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70808251C>A	uc003hep.1	+						CSN1S1_uc003heq.1_Intron|CSN1S1_uc003her.1_Intron	NM_001890	NP_001881	P47710	CASA1_HUMAN	casein alpha s1 isoform 1							extracellular region	protein binding|transporter activity				0						TCCTTTTATGCAGGAGCAAAT	0.294													3	14	---	---	---	---	PASS
C4orf35	85438	broad.mit.edu	37	4	71201956	71201956	+	3'UTR	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71201956G>T	uc003hff.2	+	1						NM_033122	NP_149113	Q96KC9	CABS1_HUMAN	testis development protein NYD-SP26							flagellum	calcium ion binding				0		all_hematologic(202;0.196)				AGCAACAAAAGGGATACCATG	0.378													3	27	---	---	---	---	PASS
AFF1	4299	broad.mit.edu	37	4	88029336	88029336	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88029336G>C	uc003hqj.3	+	10	1788	c.1381G>C	c.(1381-1383)GTG>CTG	p.V461L	AFF1_uc011ccz.1_Missense_Mutation_p.V468L|AFF1_uc003hqk.3_Missense_Mutation_p.V461L|AFF1_uc011cda.1_Missense_Mutation_p.V99L	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	461						nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		TCCAGAACCAGTGGCATCAGC	0.483													4	88	---	---	---	---	PASS
EGF	1950	broad.mit.edu	37	4	110915914	110915914	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110915914G>A	uc003hzy.3	+	20	3335	c.2883G>A	c.(2881-2883)AGG>AGA	p.R961R	EGF_uc011cfu.1_Silent_p.R919R|EGF_uc011cfv.1_Silent_p.R920R|EGF_uc010imk.2_Silent_p.R109R	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	961	Extracellular (Potential).				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	CTCACCTCAGGGAAGATGACC	0.433													15	64	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123113471	123113471	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123113471G>T	uc003ieh.2	+	9	1034	c.989G>T	c.(988-990)GGA>GTA	p.G330V	KIAA1109_uc003iei.1_Missense_Mutation_p.G84V	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	330					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						CCATGTTGGGGACTGGATATA	0.373													19	61	---	---	---	---	PASS
MMAA	166785	broad.mit.edu	37	4	146567233	146567233	+	Missense_Mutation	SNP	G	C	C	rs150376474		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146567233G>C	uc003ikh.3	+	4	743	c.658G>C	c.(658-660)GTG>CTG	p.V220L	MMAA_uc003ikg.2_Missense_Mutation_p.V220L|MMAA_uc003iki.1_RNA|MMAA_uc010iow.2_RNA	NM_172250	NP_758454	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria type A precursor	220						mitochondrion	GTP binding|nucleoside-triphosphatase activity			ovary(1)	1	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTTAGGAGGCGTGACAAGGAC	0.393													21	81	---	---	---	---	PASS
LRBA	987	broad.mit.edu	37	4	151752973	151752973	+	Silent	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151752973G>C	uc010ipj.2	-	29	5199	c.4725C>G	c.(4723-4725)CTC>CTG	p.L1575L	LRBA_uc003ilt.3_Silent_p.L234L|LRBA_uc003ilu.3_Silent_p.L1575L	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	1575						endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					ACTTACCAGAGAGTGATACAT	0.328													8	30	---	---	---	---	PASS
FHDC1	85462	broad.mit.edu	37	4	153896268	153896268	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153896268G>A	uc003inf.2	+	11	1900	c.1825G>A	c.(1825-1827)GAG>AAG	p.E609K		NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	609					actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					GGGGGGCCAGGAGGAGGCCCC	0.697													34	121	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160235907	160235907	+	Silent	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160235907A>T	uc003iqg.3	+	3	667	c.357A>T	c.(355-357)ACA>ACT	p.T119T		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	119					cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		TTGACCGGACAGATGATGACA	0.423													26	79	---	---	---	---	PASS
FSTL5	56884	broad.mit.edu	37	4	162463830	162463830	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162463830C>A	uc003iqh.2	-	9	1467	c.1031G>T	c.(1030-1032)CGG>CTG	p.R344L	FSTL5_uc003iqi.2_Missense_Mutation_p.R343L|FSTL5_uc010iqv.2_Missense_Mutation_p.R343L	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	344	Ig-like 2.					extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TGGATACACCCGGATGACTGG	0.403													10	61	---	---	---	---	PASS
FSTL5	56884	broad.mit.edu	37	4	162697025	162697025	+	Intron	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162697025C>A	uc003iqh.2	-						FSTL5_uc003iqi.2_Intron|FSTL5_uc010iqv.2_Intron	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a							extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		AGTCACTAATCATACCTGAGT	0.279													16	48	---	---	---	---	PASS
TLL1	7092	broad.mit.edu	37	4	166978409	166978409	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166978409G>T	uc003irh.1	+	14	2441	c.1794G>T	c.(1792-1794)CAG>CAT	p.Q598H	TLL1_uc011cjn.1_Missense_Mutation_p.Q621H|TLL1_uc011cjo.1_Missense_Mutation_p.Q422H	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	598	EGF-like 1; calcium-binding (Potential).				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		GCAGTTACCAGTGTGCCTGTG	0.517													9	46	---	---	---	---	PASS
DDX60	55601	broad.mit.edu	37	4	169190038	169190038	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169190038G>A	uc003irp.2	-	20	3045	c.2753C>T	c.(2752-2754)TCA>TTA	p.S918L		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	918	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TATGGTAGCTGAAAGAGCCAA	0.348													11	74	---	---	---	---	PASS
MORF4	10934	broad.mit.edu	37	4	174537601	174537601	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174537601C>G	uc011cke.1	-	1	194	c.194G>C	c.(193-195)AGA>ACA	p.R65T		NM_006792	NP_006783			mortality factor 4												0		Prostate(90;0.00201)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0765)|all_hematologic(60;0.107)		all cancers(43;1.88e-18)|Epithelial(43;1.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		AACTTCAACTCTGTTCATGAA	0.443													27	109	---	---	---	---	PASS
ASB5	140458	broad.mit.edu	37	4	177190264	177190264	+	5'UTR	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177190264G>C	uc003iuq.1	-	1						NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box-containing protein						intracellular signal transduction					skin(2)	2		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		CGACATTGCTGCAGAAGAATC	0.438													9	43	---	---	---	---	PASS
STOX2	56977	broad.mit.edu	37	4	184931924	184931924	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184931924C>A	uc003ivz.1	+	3	3368	c.1933C>A	c.(1933-1935)CAC>AAC	p.H645N	STOX2_uc003iwa.1_Missense_Mutation_p.H334N	NM_020225	NP_064610	Q9P2F5	STOX2_HUMAN	storkhead box 2	645					embryo development|maternal placenta development						0		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		GCAGGTCCCCCACTCCTCCAG	0.612													3	17	---	---	---	---	PASS
ENPP6	133121	broad.mit.edu	37	4	185045395	185045395	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185045395G>T	uc003iwc.2	-	3	594	c.452C>A	c.(451-453)CCC>CAC	p.P151H		NM_153343	NP_699174	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	151	Extracellular (Potential).				lipid catabolic process	extracellular region|integral to membrane|plasma membrane				central_nervous_system(1)	1		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		GCAGTAGGTGGGTCTGACACC	0.418													33	132	---	---	---	---	PASS
TLR3	7098	broad.mit.edu	37	4	187005962	187005962	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187005962G>C	uc003iyq.2	+	5	2751	c.2650G>C	c.(2650-2652)GAA>CAA	p.E884Q	TLR3_uc011ckz.1_Missense_Mutation_p.E607Q|TLR3_uc003iyr.2_Missense_Mutation_p.E607Q	NM_003265	NP_003256	O15455	TLR3_HUMAN	toll-like receptor 3 precursor	884	Cytoplasmic (Potential).|TIR.				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|defense response to bacterium|defense response to virus|detection of virus|hyperosmotic response|I-kappaB phosphorylation|inflammatory response|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of osteoclast differentiation|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|toll-like receptor 3 signaling pathway	endoplasmic reticulum membrane|endosome membrane|integral to plasma membrane	double-stranded RNA binding|transmembrane receptor activity			ovary(2)|prostate(1)|lung(1)|breast(1)	5		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		AGTTCAGAAAGAACGGATAGG	0.363													19	73	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187629005	187629005	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187629005G>C	uc003izf.2	-	2	2165	c.1977C>G	c.(1975-1977)ATC>ATG	p.I659M	FAT1_uc010iso.1_Missense_Mutation_p.I659M	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	659	Extracellular (Potential).|Cadherin 5.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						CTGTTATGTTGATATATAATG	0.443										HNSCC(5;0.00058)			18	61	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11098820	11098820	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11098820G>T	uc003jfa.1	-	15	2649	c.2504C>A	c.(2503-2505)CCA>CAA	p.P835Q	CTNND2_uc010itt.2_Missense_Mutation_p.P744Q|CTNND2_uc011cmy.1_Missense_Mutation_p.P498Q|CTNND2_uc011cmz.1_Missense_Mutation_p.P402Q|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.P402Q	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	835	ARM 7.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						GATCCCTTTTGGTGGTTCAGC	0.507													23	70	---	---	---	---	PASS
ZNF366	167465	broad.mit.edu	37	5	71739897	71739897	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71739897G>C	uc003kce.1	-	5	2107	c.1921C>G	c.(1921-1923)CAG>GAG	p.Q641E		NM_152625	NP_689838	Q8N895	ZN366_HUMAN	zinc finger protein 366	641					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		GTGCAGAGCTGCTGGCTCTGG	0.652													47	205	---	---	---	---	PASS
UTP15	84135	broad.mit.edu	37	5	72873704	72873704	+	Silent	SNP	A	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72873704A>G	uc003kcw.1	+	9	1141	c.918A>G	c.(916-918)GTA>GTG	p.V306V	UTP15_uc011cso.1_Silent_p.V287V|UTP15_uc011csp.1_Silent_p.V116V|UTP15_uc010ize.1_Silent_p.V306V	NM_032175	NP_115551	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein,	306	WD 7.				rRNA processing	cytoplasm|nucleolus					0		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		CAATAGTTGTAGGAATGACCA	0.323													12	59	---	---	---	---	PASS
PDE8B	8622	broad.mit.edu	37	5	76646981	76646981	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76646981G>A	uc003kfa.2	+						PDE8B_uc003kfb.2_Intron|PDE8B_uc003kfc.2_Intron|PDE8B_uc003kfd.2_Intron|PDE8B_uc003kfe.2_Intron	NM_003719	NP_003710	O95263	PDE8B_HUMAN	phosphodiesterase 8B isoform 1						cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity				0		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)		CAAGGAGGGTGAGAGCAAACT	0.502													21	75	---	---	---	---	PASS
ZCCHC9	84240	broad.mit.edu	37	5	80604814	80604814	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80604814G>A	uc003khj.2	+	4	718	c.585G>A	c.(583-585)CTG>CTA	p.L195L	RNU5E_uc011cto.1_Intron|ZCCHC9_uc003khk.3_Silent_p.L195L|ZCCHC9_uc003khi.2_Silent_p.L195L	NM_001131035	NP_001124507	Q8N567	ZCHC9_HUMAN	zinc finger, CCHC domain containing 9	195	CCHC-type 3.						nucleic acid binding|zinc ion binding			ovary(1)	1		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;8.18e-45)|Epithelial(54;2.72e-39)|all cancers(79;7.33e-34)		TGGGGCACCTGTCTAGATCTT	0.393													20	84	---	---	---	---	PASS
POLR3G	10622	broad.mit.edu	37	5	89781457	89781457	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89781457G>A	uc003kjq.2	+	2	273	c.73G>A	c.(73-75)GAA>AAA	p.E25K	POLR3G_uc011cuc.1_Missense_Mutation_p.E25K	NM_006467	NP_006458	O15318	RPC7_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	25					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus	DNA-directed RNA polymerase III complex	DNA-directed RNA polymerase activity				0		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;2.74e-31)|Epithelial(54;8.2e-26)|all cancers(79;3.86e-22)		TAGCAAAGGTGAAAAGTTACC	0.388													26	77	---	---	---	---	PASS
KCNN2	3781	broad.mit.edu	37	5	113822800	113822800	+	Missense_Mutation	SNP	T	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113822800T>A	uc003kqo.2	+	6	1765	c.1308T>A	c.(1306-1308)AAT>AAA	p.N436K	KCNN2_uc003kqp.2_Missense_Mutation_p.N88K|KCNN2_uc010jcg.2_RNA|uc003kqr.1_Intron	NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	436	Calmodulin-binding (By similarity).					integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		TTTACAAAAATACAAAGCTAG	0.328													14	61	---	---	---	---	PASS
ALDH7A1	501	broad.mit.edu	37	5	125930765	125930765	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125930765C>T	uc003ktx.2	-	1	318	c.126G>A	c.(124-126)CTG>CTA	p.L42L	ALDH7A1_uc003kty.2_RNA|ALDH7A1_uc011cxa.1_Silent_p.L69L|ALDH7A1_uc003ktz.2_Silent_p.L69L	NM_001182	NP_001173	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1	42					cellular aldehyde metabolic process|lysine catabolic process|sensory perception of sound	cytosol|mitochondrial matrix|nucleus	aldehyde dehydrogenase (NAD) activity|betaine-aldehyde dehydrogenase activity|L-aminoadipate-semialdehyde dehydrogenase activity			kidney(2)|ovary(1)	3		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)	NADH(DB00157)|Pyridoxine(DB00165)	CCAGCTCTTTCAGCCACGCAT	0.612													4	9	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127638692	127638692	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127638692C>G	uc003kuu.2	-	46	6329	c.5890G>C	c.(5890-5892)GAA>CAA	p.E1964Q		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1964	EGF-like 32; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TGAGTGAGTTCAAACCCTGGG	0.378													25	110	---	---	---	---	PASS
IRF1	3659	broad.mit.edu	37	5	131822653	131822653	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131822653C>G	uc003kxa.2	-	4	591	c.357G>C	c.(355-357)CAG>CAC	p.Q119H	IRF1_uc003kxd.2_RNA|IRF1_uc003kxb.2_Missense_Mutation_p.Q119H|IRF1_uc010jdt.1_Missense_Mutation_p.Q119H	NM_002198	NP_002189	P10914	IRF1_HUMAN	interferon regulatory factor 1	119					blood coagulation|cellular response to mechanical stimulus|interferon-gamma-mediated signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleoplasm					0		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		TACCTTTTCTCTGGTTCTTGG	0.582													38	120	---	---	---	---	PASS
PPP2CA	5515	broad.mit.edu	37	5	133534875	133534875	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133534875G>A	uc003kze.2	-	6	1157	c.759C>T	c.(757-759)GAC>GAT	p.D253D		NM_002715	NP_002706	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha	253					ceramide metabolic process|inactivation of MAPK activity|induction of apoptosis|meiosis|negative regulation of cell growth|negative regulation of epithelial to mesenchymal transition|negative regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of protein serine/threonine kinase activity|protein dephosphorylation|regulation of cell adhesion|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction|spindle pole	metal ion binding|phosphoprotein phosphatase activity			ovary(2)|lung(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	CTACATTCCGGTCATGGCACC	0.368													20	50	---	---	---	---	PASS
TGFBI	7045	broad.mit.edu	37	5	135388806	135388806	+	Nonsense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135388806C>G	uc003lbf.3	+	8	1285	c.1124C>G	c.(1123-1125)TCA>TGA	p.S375*	TGFBI_uc003lbg.3_Nonsense_Mutation_p.S108*|TGFBI_uc003lbh.3_Nonsense_Mutation_p.S201*|TGFBI_uc011cyb.1_Nonsense_Mutation_p.S201*|TGFBI_uc010jed.2_Nonsense_Mutation_p.S108*	NM_000358	NP_000349	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	375	FAS1 3.				angiogenesis|cell adhesion|cell proliferation|negative regulation of cell adhesion|response to stimulus|visual perception	extracellular space|proteinaceous extracellular matrix	integrin binding			breast(3)|ovary(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ATCCCAGACTCAGGTAGGCCA	0.567													6	29	---	---	---	---	PASS
SPOCK1	6695	broad.mit.edu	37	5	136328224	136328224	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136328224C>T	uc003lbo.2	-	6	846	c.655G>A	c.(655-657)GAG>AAG	p.E219K	SPOCK1_uc003lbp.2_Missense_Mutation_p.E219K	NM_004598	NP_004589	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains	219					cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTCGCATCCTCGTGGAGAGCT	0.478													23	63	---	---	---	---	PASS
UBE2D2	7322	broad.mit.edu	37	5	138994186	138994186	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138994186C>T	uc003ler.2	+	3	730	c.104C>T	c.(103-105)GCT>GTT	p.A35V	UBE2D2_uc003leq.2_Missense_Mutation_p.A6V	NM_003339	NP_003330	P62837	UB2D2_HUMAN	ubiquitin-conjugating enzyme E2D 2 isoform 1	35					protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|protein binding|ubiquitin-protein ligase activity			central_nervous_system(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CATTGGCAAGCTACAATAATG	0.313													18	80	---	---	---	---	PASS
PCDHGB6	56100	broad.mit.edu	37	5	140788511	140788511	+	Nonsense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140788511A>T	uc003lkj.1	+	1	742	c.742A>T	c.(742-744)AGA>TGA	p.R248*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lki.1_Nonsense_Mutation_p.R248*	NM_018926	NP_061749	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6 isoform 1	248	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGACGAATATAGAATTAGTCT	0.493													4	20	---	---	---	---	PASS
DIAPH1	1729	broad.mit.edu	37	5	140958124	140958124	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140958124G>A	uc003llb.3	-	10	1143	c.1002C>T	c.(1000-1002)ATC>ATT	p.I334I	DIAPH1_uc003llc.3_Silent_p.I325I	NM_005219	NP_005210	O60610	DIAP1_HUMAN	diaphanous 1 isoform 1	334	GBD/FH3.				regulation of microtubule-based process|sensory perception of sound	cytoplasm|cytoskeleton|ruffle membrane	actin binding|receptor binding|Rho GTPase binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTCACTTCTGATGTGAACTC	0.448													36	118	---	---	---	---	PASS
JAKMIP2	9832	broad.mit.edu	37	5	147051264	147051264	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147051264C>G	uc003loq.1	-	2	488	c.106G>C	c.(106-108)GAG>CAG	p.E36Q	JAKMIP2_uc011dbx.1_Intron|JAKMIP2_uc003lor.1_Missense_Mutation_p.E36Q|JAKMIP2_uc010jgo.1_Missense_Mutation_p.E36Q	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein	36	Potential.					Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGATGCAGCTCTATCTGAATG	0.547													14	32	---	---	---	---	PASS
SLC36A2	153201	broad.mit.edu	37	5	150726878	150726878	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150726878C>T	uc003lty.2	-	1	274	c.144G>A	c.(142-144)TTG>TTA	p.L48L	GM2A_uc011dcs.1_Intron|SLC36A2_uc003ltz.2_RNA|SLC36A2_uc003lua.2_5'UTR|SLC36A2_uc010jhv.2_Silent_p.L48L|SLC36A2_uc011dct.1_Silent_p.L48L	NM_181776	NP_861441	Q495M3	S36A2_HUMAN	solute carrier family 36, member 2	48	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process	cytoplasm|integral to membrane|plasma membrane	glycine transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGTCTTCTTCAAGCCTGCTG	0.473													42	154	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150907667	150907667	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150907667G>T	uc003lue.3	-	15	10067	c.10054C>A	c.(10054-10056)CTA>ATA	p.L3352I	GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Missense_Mutation_p.L45I	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	3352	Cadherin 30.|Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCACTATTTAGGGGTCCATCT	0.542													17	86	---	---	---	---	PASS
IL12B	3593	broad.mit.edu	37	5	158747368	158747368	+	Missense_Mutation	SNP	C	A	A	rs79446920	by1000genomes	TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158747368C>A	uc003lxr.1	-	5	685	c.643G>T	c.(643-645)GTT>TTT	p.V215F		NM_002187	NP_002178	P29460	IL12B_HUMAN	interleukin 12B precursor	215					cell cycle arrest|cell migration|defense response to Gram-negative bacterium|interferon-gamma biosynthetic process|natural killer cell activation|negative regulation of interleukin-10 production|negative regulation of interleukin-17 production|negative regulation of smooth muscle cell proliferation|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of cell adhesion|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of smooth muscle cell apoptosis|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to UV-B|sexual reproduction|T-helper 1 type immune response|T-helper cell differentiation	interleukin-12 complex|interleukin-23 complex|membrane	cytokine activity|cytokine receptor activity|interleukin-12 receptor binding|protein heterodimerization activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGCTTGTGAACGGCATCCACC	0.473													25	102	---	---	---	---	PASS
C5orf41	153222	broad.mit.edu	37	5	172513617	172513617	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172513617C>T	uc003mch.2	+	3	427	c.123C>T	c.(121-123)TTC>TTT	p.F41F	C5orf41_uc003mcg.2_Silent_p.F41F|C5orf41_uc003mcf.2_Silent_p.F41F|C5orf41_uc011dfd.1_Silent_p.F41F	NM_153607	NP_705835	Q8IUR6	CE041_HUMAN	luman-recruiting factor	41							protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Renal(175;0.000159)|Lung NSC(126;0.00223)|all_lung(126;0.00391)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ATCCAGATTTCATGTATGAAC	0.403													25	96	---	---	---	---	PASS
DDX41	51428	broad.mit.edu	37	5	176943821	176943821	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176943821C>A	uc003mho.2	-	2	64	c.43G>T	c.(43-45)GAG>TAG	p.E15*	DDX41_uc003mhm.2_5'Flank|DDX41_uc003mhn.2_5'UTR|DDX41_uc003mhp.2_5'UTR|DDX41_uc003mhq.1_5'UTR	NM_016222	NP_057306	Q9UJV9	DDX41_HUMAN	DEAD-box protein abstrakt	15					apoptosis|multicellular organismal development	catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|zinc ion binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			GCAGGCACCTCGTCGGTGCGA	0.687													9	25	---	---	---	---	PASS
MGAT1	4245	broad.mit.edu	37	5	180219415	180219415	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180219415G>A	uc003mmg.3	-	2	1052	c.557C>T	c.(556-558)GCG>GTG	p.A186V	MGAT1_uc010jlf.2_Missense_Mutation_p.A186V|MGAT1_uc010jlg.2_Missense_Mutation_p.A186V|MGAT1_uc003mmh.3_Missense_Mutation_p.A186V|MGAT1_uc010jlh.2_Missense_Mutation_p.A186V|MGAT1_uc003mmi.3_Missense_Mutation_p.A186V	NM_002406	NP_002397	P26572	MGAT1_HUMAN	mannosyl (alpha-1,3-)-glycoprotein	186	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(1)	1	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTAGTGGCGCGCGATCTTGTA	0.687													20	46	---	---	---	---	PASS
IRF4	3662	broad.mit.edu	37	6	401436	401436	+	Missense_Mutation	SNP	A	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:401436A>C	uc003msz.3	+	7	871	c.758A>C	c.(757-759)CAC>CCC	p.H253P	IRF4_uc010jne.1_Missense_Mutation_p.H253P|IRF4_uc003mta.3_RNA|IRF4_uc003mtb.3_Missense_Mutation_p.H252P|IRF4_uc003mtc.1_Missense_Mutation_p.H83P	NM_002460	NP_002451	Q15306	IRF4_HUMAN	interferon regulatory factor 4	253					interferon-gamma-mediated signaling pathway|positive regulation of interleukin-10 biosynthetic process|positive regulation of interleukin-13 biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of transcription, DNA-dependent|regulation of T-helper cell differentiation|T cell activation|type I interferon-mediated signaling pathway	cytoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(1)	1		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		TGCCGGCTGCACATCTGCCTG	0.607			T	IGH@	MM 								13	27	---	---	---	---	PASS
ERVFRDE1	405754	broad.mit.edu	37	6	11105243	11105243	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11105243G>T	uc003mzt.2	-	2	671	c.301C>A	c.(301-303)CCT>ACT	p.P101T	LOC221710_uc003mzr.2_Intron|LOC221710_uc011dio.1_Intron	NM_207582	NP_997465	P60508	EFRD1_HUMAN	syncytin 2	101	Extracellular (Potential).					integral to membrane|plasma membrane|virion					0						CGGATATCAGGGAAATCTTGC	0.418													26	135	---	---	---	---	PASS
NEDD9	4739	broad.mit.edu	37	6	11185539	11185539	+	Silent	SNP	G	C	C	rs145403433		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11185539G>C	uc003mzv.2	-	7	2528	c.2361C>G	c.(2359-2361)CTC>CTG	p.L787L	NEDD9_uc010joz.2_Silent_p.L787L|NEDD9_uc003mzw.3_Silent_p.L641L	NM_006403	NP_006394	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally	787					actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			CTATGGTCTTGAGCTGCTCGC	0.542													64	120	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12124483	12124483	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12124483G>A	uc003nac.2	+	4	4634	c.4455G>A	c.(4453-4455)CAG>CAA	p.Q1485Q	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	1485					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TGCACTCTCAGACTCAGGTTA	0.423													12	78	---	---	---	---	PASS
HIST1H2BF	8343	broad.mit.edu	37	6	26199929	26199929	+	Missense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26199929A>T	uc003ngx.2	+	1	143	c.143A>T	c.(142-144)CAG>CTG	p.Q48L	HIST1H3D_uc003ngv.2_5'Flank|HIST1H2AD_uc003ngw.2_5'Flank	NM_003522	NP_003513	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	48					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding				0		all_hematologic(11;0.196)				GTGCTAAAGCAGGTCCACCCC	0.567													46	257	---	---	---	---	PASS
AGPAT1	10554	broad.mit.edu	37	6	32138256	32138256	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32138256C>T	uc003oae.2	-	4	774	c.456G>A	c.(454-456)ACG>ACA	p.T152T	PPT2_uc003nzy.1_RNA|AGPAT1_uc011dpj.1_RNA|AGPAT1_uc011dpk.1_Silent_p.T116T|AGPAT1_uc003oaf.2_Silent_p.T152T|AGPAT1_uc003oag.2_Intron|AGPAT1_uc003oah.2_Silent_p.T152T|AGPAT1_uc003oai.1_Silent_p.T152T|AGPAT1_uc011dpl.1_Silent_p.T40T	NM_006411	NP_006402	Q99943	PLCA_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 1	152					energy reserve metabolic process|phosphatidic acid biosynthetic process|positive regulation of cellular metabolic process|positive regulation of cytokine production|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			central_nervous_system(1)	1						TGGCATCCCCCGTGCGCTTCC	0.627													36	65	---	---	---	---	PASS
UHRF1BP1	54887	broad.mit.edu	37	6	34835144	34835144	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34835144C>T	uc003oju.3	+	16	3789	c.3555C>T	c.(3553-3555)CTC>CTT	p.L1185L	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	1185										ovary(3)	3						GAGAAGACCTCATCTTTCACC	0.493													24	138	---	---	---	---	PASS
PNPLA1	285848	broad.mit.edu	37	6	36260877	36260877	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36260877C>T	uc010jwf.2	+	3	478	c.478C>T	c.(478-480)CTC>TTC	p.L160F	PNPLA1_uc003olw.1_Missense_Mutation_p.L65F|PNPLA1_uc010jwe.1_Missense_Mutation_p.L65F	NM_001145717	NP_001139189	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	160	Patatin.				lipid catabolic process		hydrolase activity			large_intestine(1)|pancreas(1)|breast(1)|skin(1)	4						GTACTGTGGCCTCATCCCCCC	0.652													57	80	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38813505	38813505	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38813505G>C	uc003ooe.1	+	34	4950	c.4350G>C	c.(4348-4350)TTG>TTC	p.L1450F		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TTATCACTTTGATGGAGGATA	0.363													34	62	---	---	---	---	PASS
FOXP4	116113	broad.mit.edu	37	6	41545800	41545800	+	Missense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41545800A>T	uc003oql.2	+	3	739	c.281A>T	c.(280-282)CAG>CTG	p.Q94L	FOXP4_uc003oqm.2_Missense_Mutation_p.Q94L|FOXP4_uc003oqn.2_Missense_Mutation_p.Q94L	NM_001012426	NP_001012426	Q8IVH2	FOXP4_HUMAN	forkhead box P4 isoform 1	94	Gln-rich.				embryonic foregut morphogenesis|heart development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			breast(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)					GACAGCAAACAGTCTGCCTCT	0.642													10	18	---	---	---	---	PASS
PTK7	5754	broad.mit.edu	37	6	43114398	43114398	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43114398G>A	uc003oub.1	+	17	2881	c.2683G>A	c.(2683-2685)GAA>AAA	p.E895K	PTK7_uc003ouc.1_Missense_Mutation_p.E839K|PTK7_uc003oud.1_Missense_Mutation_p.E855K|PTK7_uc003oue.1_Missense_Mutation_p.E765K|PTK7_uc003ouf.1_RNA|PTK7_uc003oug.1_RNA|PTK7_uc011dve.1_Missense_Mutation_p.E903K|PTK7_uc010jyj.1_Missense_Mutation_p.E221K	NM_002821	NP_002812	Q13308	PTK7_HUMAN	PTK7 protein tyrosine kinase 7 isoform a	895	Cytoplasmic (Potential).|Protein kinase; inactive.|Interaction with CTNNB1.				actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(2)|large_intestine(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			GAGCAAGGATGAAAAATTGAA	0.552													16	85	---	---	---	---	PASS
CAPN11	11131	broad.mit.edu	37	6	44150853	44150853	+	Intron	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44150853C>G	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTCCCTCTCTCAGGCATCAAG	0.557													27	55	---	---	---	---	PASS
CYP39A1	51302	broad.mit.edu	37	6	46521598	46521598	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46521598G>A	uc003oyf.1	-						CYP39A1_uc011dwa.1_Intron|CYP39A1_uc010jzd.1_Intron	NM_016593	NP_057677	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A,						bile acid biosynthetic process|bile acid catabolic process|digestion|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	24-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(1)	1						CCACCTGGAAGAAACGAATAA	0.328													14	28	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51889423	51889423	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51889423C>A	uc003pah.1	-	32	5461	c.5185G>T	c.(5185-5187)GCC>TCC	p.A1729S	PKHD1_uc003pai.2_Missense_Mutation_p.A1729S	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1729	IPT/TIG 12; atypical.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					AACACCAGGGCAGATGAGGCC	0.502													54	115	---	---	---	---	PASS
C6orf142	90523	broad.mit.edu	37	6	54025350	54025350	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54025350G>T	uc003pcg.3	+	6	900	c.787G>T	c.(787-789)GAG>TAG	p.E263*	C6orf142_uc003pcf.2_Nonsense_Mutation_p.E787*|C6orf142_uc003pch.3_Intron|C6orf142_uc011dxa.1_Nonsense_Mutation_p.E798*	NM_138569	NP_612636	Q5VWP3	MLIP_HUMAN	hypothetical protein LOC90523	263						nuclear envelope|PML body	protein binding				0	Lung NSC(77;0.0317)					GCAAACTGAAGAGCTCTGTGC	0.408													14	55	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56374593	56374593	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56374593C>A	uc003pdf.2	-	68	12530	c.12502G>T	c.(12502-12504)GCA>TCA	p.A4168S	DST_uc003pcz.3_Missense_Mutation_p.A3990S|DST_uc011dxj.1_Missense_Mutation_p.A4019S|DST_uc011dxk.1_Missense_Mutation_p.A4030S|DST_uc003pcy.3_Missense_Mutation_p.A3664S	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	6076	Spectrin 12.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCAACCTCTGCAGAGATAGAG	0.458													30	46	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56382353	56382353	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56382353C>A	uc003pdf.2	-	64	11866	c.11838G>T	c.(11836-11838)CTG>CTT	p.L3946L	DST_uc003pcz.3_Silent_p.L3768L|DST_uc011dxj.1_Silent_p.L3797L|DST_uc011dxk.1_Silent_p.L3808L|DST_uc003pcy.3_Silent_p.L3442L	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	5854	Spectrin 10.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGATGTCACCCAGAGACATCA	0.383													5	35	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56470023	56470023	+	Intron	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56470023C>G	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Missense_Mutation_p.E2598Q	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCAAGATTCTCAAACTGAACA	0.323													7	31	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79650830	79650830	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79650830G>C	uc003pir.2	-	40	5272	c.5046C>G	c.(5044-5046)ATC>ATG	p.I1682M	PHIP_uc003piq.2_Missense_Mutation_p.I706M|PHIP_uc011dyp.1_Missense_Mutation_p.I1681M|IRAK1BP1_uc010kbg.1_Intron|PHIP_uc003pio.3_Missense_Mutation_p.I568M	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1682					insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CTTCATCTCTGATGGGATGCA	0.363													23	134	---	---	---	---	PASS
UBE2CBP	90025	broad.mit.edu	37	6	83732255	83732255	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83732255C>T	uc003pjp.2	-	7	871	c.763G>A	c.(763-765)GCC>ACC	p.A255T	UBE2CBP_uc011dyx.1_RNA|UBE2CBP_uc003pjq.2_Missense_Mutation_p.A45T	NM_198920	NP_944602	Q7Z6J8	UB2CB_HUMAN	ubiquitin-conjugating enzyme E2C binding	255	Interaction with UBE2C.					cytoplasm	ligase activity			ovary(1)	1		all_cancers(76;0.000374)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0548)		BRCA - Breast invasive adenocarcinoma(397;0.0944)		AGACACTGGGCGATCACGCTC	0.373													6	31	---	---	---	---	PASS
TBX18	9096	broad.mit.edu	37	6	85466591	85466591	+	Intron	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85466591G>C	uc003pkl.1	-						TBX18_uc010kbq.1_Intron	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18						multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		AACATACCTAGAAGGCAATGA	0.458													10	48	---	---	---	---	PASS
REV3L	5980	broad.mit.edu	37	6	111634624	111634624	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111634624C>T	uc003puy.3	-	28	8858	c.8535G>A	c.(8533-8535)CAG>CAA	p.Q2845Q	REV3L_uc003pux.3_Silent_p.Q2767Q|REV3L_uc003puz.3_Silent_p.Q2767Q|REV3L_uc003pva.1_RNA	NM_002912	NP_002903	O60673	DPOLZ_HUMAN	DNA polymerase zeta	2845					DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding			large_intestine(2)|ovary(2)|skin(2)	6		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CTGGGTCCTTCTGATCCAGTG	0.358								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					18	53	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112452258	112452258	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112452258C>A	uc003pvu.2	-	29	4189	c.3880G>T	c.(3880-3882)GAT>TAT	p.D1294Y	LAMA4_uc003pvv.2_Missense_Mutation_p.D1287Y|LAMA4_uc003pvt.2_Missense_Mutation_p.D1287Y	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	1294	Laminin G-like 3.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CCCTTTACATCCATGATGACA	0.458													30	62	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112452259	112452259	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112452259C>A	uc003pvu.2	-	29	4188	c.3879G>T	c.(3877-3879)ATG>ATT	p.M1293I	LAMA4_uc003pvv.2_Missense_Mutation_p.M1286I|LAMA4_uc003pvt.2_Missense_Mutation_p.M1286I	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	1293	Laminin G-like 3.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	p.M1286I(1)		ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CCTTTACATCCATGATGACAG	0.453													30	63	---	---	---	---	PASS
PKIB	5570	broad.mit.edu	37	6	123046281	123046281	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123046281G>C	uc003pyz.2	+	7	639	c.178G>C	c.(178-180)GAG>CAG	p.E60Q	PKIB_uc003pza.2_Missense_Mutation_p.E60Q|PKIB_uc003pzb.2_Missense_Mutation_p.E60Q|PKIB_uc003pzc.2_Missense_Mutation_p.E67Q|PKIB_uc011ebq.1_Missense_Mutation_p.E60Q	NM_181794	NP_861459	Q9C010	IPKB_HUMAN	cAMP-dependent protein kinase inhibitor beta	60							cAMP-dependent protein kinase inhibitor activity				0				GBM - Glioblastoma multiforme(226;0.164)		AGATGCAAAAGAGAAAGATGA	0.299													9	31	---	---	---	---	PASS
TMEM200A	114801	broad.mit.edu	37	6	130762297	130762297	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130762297C>A	uc003qca.2	+	3	1601	c.730C>A	c.(730-732)CCC>ACC	p.P244T	TMEM200A_uc010kfh.2_Missense_Mutation_p.P244T|TMEM200A_uc010kfi.2_Missense_Mutation_p.P244T|TMEM200A_uc003qcb.2_Missense_Mutation_p.P244T	NM_052913	NP_443145	Q86VY9	T200A_HUMAN	transmembrane protein 200A	244	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GCATCTTATGCCCCCTTTGCT	0.483													32	55	---	---	---	---	PASS
PLEKHG1	57480	broad.mit.edu	37	6	151121854	151121854	+	Splice_Site	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151121854G>A	uc003qny.1	+	7	942	c.630_splice	c.e7-1	p.R210_splice	PLEKHG1_uc011eel.1_Splice_Site_p.R250_splice|PLEKHG1_uc011eem.1_Splice_Site_p.R269_splice|PLEKHG1_uc003qnz.2_Splice_Site_p.R210_splice	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		TCTTCCTGCAGGTCCGTGGCT	0.433													22	63	---	---	---	---	PASS
MTRF1L	54516	broad.mit.edu	37	6	153311084	153311084	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153311084C>T	uc003qpi.3	-	7	1194	c.1089G>A	c.(1087-1089)TTG>TTA	p.L363L	MTRF1L_uc003qpl.3_3'UTR|MTRF1L_uc011efa.1_Silent_p.L327L|MTRF1L_uc003qpj.3_Silent_p.L221L|MTRF1L_uc003qpk.3_3'UTR	NM_019041	NP_061914	Q9UGC7	RF1ML_HUMAN	mitochondrial translational release factor	363						mitochondrion	translation release factor activity, codon specific				0		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.24e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0888)		CGTATTCCTTCAATGACTGTA	0.333													33	133	---	---	---	---	PASS
MAS1	4142	broad.mit.edu	37	6	160328255	160328255	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160328255G>T	uc003qsz.2	+	1	282	c.268G>T	c.(268-270)GAC>TAC	p.D90Y		NM_002377	NP_002368	P04201	MAS_HUMAN	MAS1 oncogene	90	Extracellular (Potential).				anatomical structure morphogenesis|cell proliferation|protein kinase C signaling cascade	integral to plasma membrane	angiotensin type II receptor activity			ovary(2)|lung(2)	4		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.6e-06)		CTTGTCTATCGACTATGCTTT	0.433													44	159	---	---	---	---	PASS
QKI	9444	broad.mit.edu	37	6	163899889	163899889	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163899889C>T	uc003qui.2	+	3	914	c.363C>T	c.(361-363)ATC>ATT	p.I121I	QKI_uc003que.2_Silent_p.I121I|QKI_uc003quf.2_Silent_p.I121I|QKI_uc003qug.2_Silent_p.I121I|QKI_uc003quh.2_Silent_p.I121I|QKI_uc003quj.2_Silent_p.I121I	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform	121	KH.				mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		GATGTAAAATCATGGTCCGAG	0.363													24	92	---	---	---	---	PASS
C6orf118	168090	broad.mit.edu	37	6	165715275	165715275	+	Missense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165715275A>T	uc003qum.3	-	2	572	c.536T>A	c.(535-537)CTG>CAG	p.L179Q	C6orf118_uc011egi.1_RNA	NM_144980	NP_659417	Q5T5N4	CF118_HUMAN	hypothetical protein LOC168090	179											0		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		CAAGTCGGGCAGCCGGAGTTC	0.642													6	41	---	---	---	---	PASS
TTLL2	83887	broad.mit.edu	37	6	167753644	167753644	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167753644C>A	uc003qvs.1	+	3	344	c.256C>A	c.(256-258)CCG>ACG	p.P86T	TTLL2_uc011egr.1_RNA	NM_031949	NP_114155	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	86	TTL.				protein modification process		ATP binding|tubulin-tyrosine ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		CCTCTTGAAGCCGCTGGTTTT	0.507													17	53	---	---	---	---	PASS
DLL1	28514	broad.mit.edu	37	6	170594017	170594017	+	Silent	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170594017G>T	uc003qxm.2	-	8	1709	c.1239C>A	c.(1237-1239)CCC>CCA	p.P413P		NM_005618	NP_005609	O00548	DLL1_HUMAN	delta-like 1 precursor	413	Extracellular (Potential).|EGF-like 6.				cell communication|cell fate determination|hemopoiesis|Notch receptor processing|Notch signaling pathway|regulation of cell adhesion	extracellular region|integral to plasma membrane	calcium ion binding|Notch binding			lung(4)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		CATTAGAACAGGGTGAAGAGC	0.547													13	47	---	---	---	---	PASS
CARD11	84433	broad.mit.edu	37	7	2946460	2946460	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2946460G>T	uc003smv.2	-	25	3681	c.3277C>A	c.(3277-3279)CCT>ACT	p.P1093T		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	1093	Guanylate kinase-like.				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TCCGTCTCAGGTCGGGGCAGC	0.682			Mis		DLBCL								7	18	---	---	---	---	PASS
HDAC9	9734	broad.mit.edu	37	7	18869172	18869172	+	Splice_Site	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18869172G>T	uc003suh.2	+	18	2498	c.2457_splice	c.e18+1	p.L819_splice	HDAC9_uc003sue.2_Splice_Site_p.L819_splice|HDAC9_uc011jyd.1_Splice_Site_p.L819_splice|HDAC9_uc003sui.2_Splice_Site_p.L822_splice|HDAC9_uc003suj.2_Splice_Site_p.L778_splice|HDAC9_uc003suk.2_Splice_Site_p.L67_splice	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	TGTAGATCTGGTATGTATTCC	0.388													22	48	---	---	---	---	PASS
ITGB8	3696	broad.mit.edu	37	7	20441706	20441706	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20441706G>T	uc003suu.2	+	10	2349	c.1644G>T	c.(1642-1644)AAG>AAT	p.K548N	ITGB8_uc011jyh.1_Missense_Mutation_p.K413N	NM_002214	NP_002205	P26012	ITB8_HUMAN	integrin, beta 8 precursor	548	Cysteine-rich tandem repeats.|II.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(3)	3						ACTGTGAAAAGGATGACTTTT	0.388													33	70	---	---	---	---	PASS
ITGB8	3696	broad.mit.edu	37	7	20441707	20441707	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20441707G>T	uc003suu.2	+	10	2350	c.1645G>T	c.(1645-1647)GAT>TAT	p.D549Y	ITGB8_uc011jyh.1_Missense_Mutation_p.D414Y	NM_002214	NP_002205	P26012	ITB8_HUMAN	integrin, beta 8 precursor	549	Cysteine-rich tandem repeats.|II.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(3)	3						CTGTGAAAAGGATGACTTTTC	0.388													34	70	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21765525	21765525	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21765525G>A	uc003svc.2	+	46	7415	c.7384G>A	c.(7384-7386)GAC>AAC	p.D2462N		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2462					microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TTATTATGTGGACCACAAAAC	0.423									Kartagener_syndrome				4	14	---	---	---	---	PASS
HOXA2	3199	broad.mit.edu	37	7	27142065	27142065	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27142065C>A	uc003syh.2	-	1	330	c.55G>T	c.(55-57)GCT>TCT	p.A19S		NM_006735	NP_006726	O43364	HXA2_HUMAN	homeobox A2	19						nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						AGGCACTCAGCGAGCGACGGC	0.478													17	152	---	---	---	---	PASS
ADCYAP1R1	117	broad.mit.edu	37	7	31126629	31126629	+	Intron	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31126629C>T	uc003tca.1	+						ADCYAP1R1_uc003tcb.1_Intron|ADCYAP1R1_uc003tcc.1_Intron|ADCYAP1R1_uc003tcd.1_Intron|ADCYAP1R1_uc003tce.1_Intron|ADCYAP1R1_uc003tcf.1_Intron	NM_001118	NP_001109	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1						activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|spermatogenesis	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			ovary(1)	1						TTAGTACATGCGCGAGAGTCA	0.517													24	107	---	---	---	---	PASS
AVL9	23080	broad.mit.edu	37	7	32598723	32598723	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32598723G>C	uc003tcv.1	+	10	1008	c.862G>C	c.(862-864)GAT>CAT	p.D288H	AVL9_uc011kai.1_Missense_Mutation_p.D288H|AVL9_uc010kwj.1_Missense_Mutation_p.D129H	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	288						integral to membrane					0						CCATGGAGAAGATGCTGCCAT	0.453													15	22	---	---	---	---	PASS
KBTBD2	25948	broad.mit.edu	37	7	32909154	32909154	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32909154C>G	uc003tdb.2	-	4	2334	c.1675G>C	c.(1675-1677)GAC>CAC	p.D559H	AVL9_uc011kai.1_Intron	NM_015483	NP_056298	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	559	Kelch 5.										0			GBM - Glioblastoma multiforme(11;0.0499)			GACCACCGGTCAAGTTCCAGG	0.463													48	105	---	---	---	---	PASS
KIAA0895	23366	broad.mit.edu	37	7	36396527	36396527	+	Missense_Mutation	SNP	T	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36396527T>A	uc003tfd.2	-	3	902	c.851A>T	c.(850-852)GAC>GTC	p.D284V	KIAA0895_uc003tfc.2_Missense_Mutation_p.D271V|KIAA0895_uc011kaw.1_Missense_Mutation_p.D133V|KIAA0895_uc003tfb.2_Missense_Mutation_p.D233V|KIAA0895_uc011kax.1_Missense_Mutation_p.D233V|KIAA0895_uc003tfe.2_Missense_Mutation_p.D271V|KIAA0895_uc011kay.1_Missense_Mutation_p.D233V	NM_001100425	NP_001093895	Q8NCT3	K0895_HUMAN	hypothetical protein LOC23366 isoform 1	284											0						AAGAAATCGGTCAGATGCGTG	0.358													12	51	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42005006	42005006	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42005006G>C	uc011kbh.1	-	15	3756	c.3665C>G	c.(3664-3666)CCC>CGC	p.P1222R	GLI3_uc011kbg.1_Missense_Mutation_p.P1163R	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	1222					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						GCCACCGTAGGGGTTGCTGTT	0.637									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				11	79	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48411966	48411966	+	Missense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48411966A>T	uc003toq.2	+	33	11030	c.11005A>T	c.(11005-11007)AGT>TGT	p.S3669C	ABCA13_uc010kys.1_Missense_Mutation_p.S743C|ABCA13_uc003tos.1_Missense_Mutation_p.S495C	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	3669					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CTACCTCTTGAGTGCATTTTT	0.433													53	235	---	---	---	---	PASS
CACNA2D1	781	broad.mit.edu	37	7	81667554	81667554	+	Intron	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81667554G>T	uc003uhr.1	-							NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	CTGTTAAACTGCAAAAGATTA	0.308													14	81	---	---	---	---	PASS
DMTF1	9988	broad.mit.edu	37	7	86823350	86823350	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86823350G>A	uc003uih.2	+	16	2286	c.1960G>A	c.(1960-1962)GAA>AAA	p.E654K	DMTF1_uc003uii.2_Missense_Mutation_p.E388K|DMTF1_uc003uij.2_Missense_Mutation_p.E388K|DMTF1_uc011khb.1_Missense_Mutation_p.E566K|DMTF1_uc003uik.2_RNA|DMTF1_uc003uil.2_Missense_Mutation_p.E654K|DMTF1_uc003uin.2_Missense_Mutation_p.E388K	NM_001142327	NP_001135799	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	654	Interaction with CCND1, CCND2 and CCND3 (By similarity).|Required for transcriptional activation (By similarity).				cell cycle	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(14;0.0058)					AACAGAAGAAGAAATCTCTGA	0.388													19	89	---	---	---	---	PASS
FZD1	8321	broad.mit.edu	37	7	90895882	90895882	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90895882G>T	uc003ula.2	+	1	2100	c.1687G>T	c.(1687-1689)GAC>TAC	p.D563Y		NM_003505	NP_003496	Q9UP38	FZD1_HUMAN	frizzled 1 precursor	563	Extracellular (Potential).				autocrine signaling|axonogenesis|brain development|canonical Wnt receptor signaling pathway involved in mesenchymal stem cell differentiation|canonical Wnt receptor signaling pathway involved in osteoblast differentiation|embryo development|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|lung alveolus development|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|response to drug|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cell surface|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|receptor binding|Wnt receptor activity|Wnt-protein binding				0	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			GGCCTTCCGGGACCAGTGGGA	0.662													15	51	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100680261	100680261	+	Missense_Mutation	SNP	C	A	A	rs141195508	byFrequency	TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100680261C>A	uc003uxp.1	+	3	5617	c.5564C>A	c.(5563-5565)ACC>AAC	p.T1855N	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1855	Extracellular (Potential).|Ser-rich.|29.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GCTGAAGGTACCAGCATAGCA	0.478													55	240	---	---	---	---	PASS
PPP1R3A	5506	broad.mit.edu	37	7	113519333	113519333	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113519333C>A	uc010ljy.1	-	4	1845	c.1814G>T	c.(1813-1815)AGT>ATT	p.S605I		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	605					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						GCTGCCTTCACTAGTCAAATG	0.418													23	141	---	---	---	---	PASS
AASS	10157	broad.mit.edu	37	7	121738539	121738539	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121738539C>A	uc003vka.2	-	14	1716	c.1620G>T	c.(1618-1620)CTG>CTT	p.L540L	AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Silent_p.L540L|AASS_uc011knw.1_Silent_p.L28L	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor	540	Saccharopine dehydrogenase.				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)	CCAAGAAGCCCAGCTTCTCTT	0.338													25	42	---	---	---	---	PASS
LRGUK	136332	broad.mit.edu	37	7	133812110	133812110	+	5'UTR	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133812110C>A	uc003vrm.1	+	1						NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						TAGGCAACCCCGCTAAACAAG	0.637													35	96	---	---	---	---	PASS
KIAA1549	57670	broad.mit.edu	37	7	138579246	138579246	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138579246G>A	uc011kql.1	-	10	3923	c.3874C>T	c.(3874-3876)CCG>TCG	p.P1292S	KIAA1549_uc011kqi.1_Missense_Mutation_p.P76S|KIAA1549_uc003vuk.3_Missense_Mutation_p.P1242S|KIAA1549_uc011kqj.1_Missense_Mutation_p.P1292S|KIAA1549_uc011kqk.1_Missense_Mutation_p.P76S	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	1292						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230						TGGGATTCCGGAGACGGCCTC	0.493			O	BRAF	pilocytic astrocytoma								17	66	---	---	---	---	PASS
TBXAS1	6916	broad.mit.edu	37	7	139529251	139529251	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139529251C>T	uc011kqv.1	+	1	229	c.65C>T	c.(64-66)TCA>TTA	p.S22L	TBXAS1_uc003vvh.2_Missense_Mutation_p.S22L|TBXAS1_uc010lne.2_Intron|TBXAS1_uc011kqu.1_Missense_Mutation_p.S22L|TBXAS1_uc003vvi.2_Missense_Mutation_p.S22L|TBXAS1_uc003vvj.2_Missense_Mutation_p.S22L|TBXAS1_uc011kqw.1_5'UTR|TBXAS1_uc011kqx.1_Missense_Mutation_p.S22L	NM_001130966	NP_001124438	P24557	THAS_HUMAN	thromboxane A synthase 1, platelet isoform	21	Helical; (Potential).				hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)					GTGGCCCTGTCAGTGGCTCTC	0.577													10	36	---	---	---	---	PASS
BRAF	673	broad.mit.edu	37	7	140481411	140481411	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140481411C>A	uc003vwc.3	-	11	1458	c.1397G>T	c.(1396-1398)GGA>GTA	p.G466V		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	466	ATP (By similarity).|Protein kinase.		G -> V (in LNCR).|G -> A (in melanoma).|G -> E (in melanoma).		activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	p.G466V(12)|p.G466E(5)|p.G466A(3)|p.G466R(2)	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	TCCAAATGATCCAGATCCAAT	0.378	G466V(NCIH1666_LUNG)|G466V(CAL12T_LUNG)	61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				31	80	---	---	---	---	PASS
OR9A4	130075	broad.mit.edu	37	7	141618739	141618739	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141618739C>A	uc003vwu.1	+	1	64	c.64C>A	c.(64-66)CTA>ATA	p.L22I		NM_001001656	NP_001001656	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	Melanoma(164;0.0171)					CTCTGAAGAACTACATCATAT	0.378													71	169	---	---	---	---	PASS
CLCN1	1180	broad.mit.edu	37	7	143039210	143039210	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143039210C>G	uc003wcr.1	+	15	1858	c.1771C>G	c.(1771-1773)CCT>GCT	p.P591A	CLCN1_uc011ktc.1_Missense_Mutation_p.P203A	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle	591	Cytoplasmic (By similarity).				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					ACCCTACTTGCCTGACCTTGG	0.552													12	74	---	---	---	---	PASS
ARHGEF5	7984	broad.mit.edu	37	7	144060783	144060783	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144060783C>G	uc003wel.2	+	2	1139	c.1021C>G	c.(1021-1023)CAG>GAG	p.Q341E	ARHGEF5_uc003wek.2_Missense_Mutation_p.Q341E	NM_005435	NP_005426	Q12774	ARHG5_HUMAN	rho guanine nucleotide exchange factor 5	341					intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)					GGCGGACTCTCAGGACGAAAA	0.517													50	71	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146741157	146741157	+	Intron	SNP	T	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146741157T>A	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GTGAGTATCGTATTGTTTAAA	0.343										HNSCC(39;0.1)			22	94	---	---	---	---	PASS
EZH2	2146	broad.mit.edu	37	7	148515176	148515176	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148515176C>T	uc003wfd.1	-	10	1184	c.1018G>A	c.(1018-1020)GCT>ACT	p.A340T	EZH2_uc011kug.1_Missense_Mutation_p.A331T|EZH2_uc003wfb.1_Missense_Mutation_p.A345T|EZH2_uc003wfc.1_Missense_Mutation_p.A301T|EZH2_uc011kuh.1_Missense_Mutation_p.A331T|EZH2_uc011kui.1_Missense_Mutation_p.A340T|EZH2_uc011kuj.1_RNA	NM_004456	NP_004447	Q15910	EZH2_HUMAN	enhancer of zeste 2 isoform a	340	Interaction with DNMT1, DNMT3A and DNMT3B.				negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding	p.A345T(1)		haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			ATCCGCTCAGCGGTGAGAGCA	0.488			Mis		DLBCL								4	161	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149502658	149502658	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149502658C>T	uc010lpk.2	+	58	8471	c.8471C>T	c.(8470-8472)CCC>CTC	p.P2824L		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	2824	TSP type-1 7.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCCTGCAGCCCCCCTGTATGC	0.667													9	44	---	---	---	---	PASS
GIMAP1	170575	broad.mit.edu	37	7	150417443	150417443	+	Silent	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150417443G>T	uc003whq.2	+	3	438	c.351G>T	c.(349-351)CTG>CTT	p.L117L	GIMAP1_uc003whp.2_Silent_p.L125L	NM_130759	NP_570115	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	117	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGCTGCTCCTGGTGACCCAGT	0.617													15	52	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151932935	151932935	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151932935C>T	uc003wla.2	-	16	2955	c.2736G>A	c.(2734-2736)CTG>CTA	p.L912L	MLL3_uc003wkz.2_5'UTR	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	912					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TTCCACTTTTCAGCTTTGACC	0.488			N		medulloblastoma								19	94	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154684591	154684591	+	3'UTR	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154684591G>T	uc003wlk.2	+	26					DPP6_uc003wli.2_3'UTR|DPP6_uc003wlm.2_3'UTR|DPP6_uc011kvq.1_3'UTR	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GTTCCCGTTAGGGACATCACA	0.592													17	84	---	---	---	---	PASS
HTR5A	3361	broad.mit.edu	37	7	154862998	154862998	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154862998G>A	uc003wlu.1	+	1	453	c.389G>A	c.(388-390)TGG>TAG	p.W130*	uc011kvt.1_Nonsense_Mutation_p.Q6*|uc003wlt.2_Nonsense_Mutation_p.Q6*	NM_024012	NP_076917	P47898	5HT5A_HUMAN	5-hydroxytryptamine receptor 5A	130	Helical; Name=3; (By similarity).					integral to plasma membrane	serotonin receptor activity			ovary(2)|large_intestine(1)	3	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		GCCAGCATCTGGAACGTGACG	0.647													11	41	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	2815331	2815331	+	Splice_Site	SNP	T	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2815331T>A	uc011kwk.1	-	63	10096	c.9706_splice	c.e63-1	p.V3236_splice	CSMD1_uc011kwj.1_Splice_Site_p.V2565_splice|CSMD1_uc010lrg.2_Splice_Site_p.V1127_splice	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GCTTCCAACCTAGAGAGGAAA	0.458													5	4	---	---	---	---	PASS
PRSS55	203074	broad.mit.edu	37	8	10383125	10383125	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10383125G>A	uc003wta.2	+	1	45	c.30G>A	c.(28-30)CTG>CTA	p.L10L	uc010lru.2_Intron	NM_198464	NP_940866	Q6UWB4	PRS55_HUMAN	hypothetical protein LOC203074 precursor	10					proteolysis	integral to membrane	serine-type endopeptidase activity			ovary(1)	1						TGCTGCTCCTGTCCCTGGTCA	0.672													15	65	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10468421	10468421	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10468421C>A	uc003wtc.2	-	4	3416	c.3187G>T	c.(3187-3189)GAG>TAG	p.E1063*		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1063					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		GCTGGGGCCTCTCTGTCTGCT	0.677													9	10	---	---	---	---	PASS
MTMR7	9108	broad.mit.edu	37	8	17218615	17218615	+	Intron	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17218615C>T	uc003wxm.2	-							NM_004686	NP_004677	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7								protein tyrosine phosphatase activity			skin(1)	1				Colorectal(111;0.112)		GTTTGGGTTTCACGCACTCAC	0.448													50	52	---	---	---	---	PASS
KIAA1967	57805	broad.mit.edu	37	8	22465539	22465539	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22465539C>A	uc003xch.2	+	7	682	c.545C>A	c.(544-546)CCT>CAT	p.P182H	KIAA1967_uc003xci.2_Missense_Mutation_p.P182H|KIAA1967_uc003xcj.1_Translation_Start_Site	NM_199205	NP_954675	Q8N163	K1967_HUMAN	p30 DBC protein	182					apoptosis|positive regulation of apoptosis	mitochondrial matrix|nucleus	enzyme binding|enzyme inhibitor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00593)|Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		AACAGATTTCCTGCCCGGGGC	0.448													5	242	---	---	---	---	PASS
KCTD9	54793	broad.mit.edu	37	8	25303650	25303650	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25303650C>G	uc003xeo.2	-	2	323	c.165G>C	c.(163-165)TTG>TTC	p.L55F	PPP2R2A_uc003xek.2_Intron	NM_017634	NP_060104	Q7L273	KCTD9_HUMAN	potassium channel tetramerisation domain	55	KHA.					voltage-gated potassium channel complex	voltage-gated potassium channel activity				0		all_cancers(63;0.0164)|Ovarian(32;0.000878)|all_epithelial(46;0.00542)|Breast(100;0.0164)|Hepatocellular(4;0.114)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Epithelial(17;2.39e-12)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0438)		GTTACCTGATCAAAGCAATAT	0.403													12	44	---	---	---	---	PASS
KCTD9	54793	broad.mit.edu	37	8	25303661	25303661	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25303661C>T	uc003xeo.2	-	2	312	c.154G>A	c.(154-156)GAT>AAT	p.D52N	PPP2R2A_uc003xek.2_Intron	NM_017634	NP_060104	Q7L273	KCTD9_HUMAN	potassium channel tetramerisation domain	52	KHA.					voltage-gated potassium channel complex	voltage-gated potassium channel activity				0		all_cancers(63;0.0164)|Ovarian(32;0.000878)|all_epithelial(46;0.00542)|Breast(100;0.0164)|Hepatocellular(4;0.114)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Epithelial(17;2.39e-12)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0438)		AAAGCAATATCATCAATCAGT	0.403													11	53	---	---	---	---	PASS
HMBOX1	79618	broad.mit.edu	37	8	28827693	28827693	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28827693C>G	uc003xhd.3	+	3	499	c.157C>G	c.(157-159)CTT>GTT	p.L53V	HMBOX1_uc010lvd.2_Missense_Mutation_p.L53V|HMBOX1_uc003xhc.3_Missense_Mutation_p.L53V|HMBOX1_uc010lve.2_RNA|HMBOX1_uc003xhe.2_Missense_Mutation_p.L53V|HMBOX1_uc011lay.1_Missense_Mutation_p.L53V|HMBOX1_uc003xhf.2_Missense_Mutation_p.L41V|HMBOX1_uc003xhg.2_Missense_Mutation_p.L41V	NM_001135726	NP_001129198	Q6NT76	HMBX1_HUMAN	homeobox containing 1	53					negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Ovarian(32;0.0192)		KIRC - Kidney renal clear cell carcinoma(542;0.135)|Kidney(114;0.161)		TTTGGACCGTCTTGATCAAGA	0.443													36	103	---	---	---	---	PASS
WRN	7486	broad.mit.edu	37	8	30921849	30921849	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30921849G>T	uc003xio.3	+	4	1042	c.254G>T	c.(253-255)TGG>TTG	p.W85L		NM_000553	NP_000544	Q14191	WRN_HUMAN	Werner syndrome protein	85	Interaction with WRNIP1 (By similarity).|3'-5' exonuclease.				base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		GACATGGAGTGGCCACCATTA	0.328			Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				54	114	---	---	---	---	PASS
IDO2	169355	broad.mit.edu	37	8	39806779	39806779	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39806779C>G	uc010lwy.1	+	2	376	c.134C>G	c.(133-135)TCT>TGT	p.S45C	IDO2_uc003xno.1_RNA	NM_194294	NP_919270	Q6ZQW0	I23O2_HUMAN	indoleamine-pyrrole 2,3 dioxygenase-like 1	32					tryptophan catabolic process to kynurenine	cytosol	heme binding|indoleamine 2,3-dioxygenase activity|tryptophan 2,3-dioxygenase activity			ovary(2)	2						CTTCCAGATTCTCTGGTAAGG	0.383													8	13	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52384806	52384806	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52384806G>A	uc003xqu.3	-	8	854	c.753C>T	c.(751-753)GTC>GTT	p.V251V		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	251	Ig-like C2-type 1.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AGGTGAAGTAGACGGTATTTC	0.438													50	176	---	---	---	---	PASS
CYP7A1	1581	broad.mit.edu	37	8	59410849	59410849	+	Missense_Mutation	SNP	T	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59410849T>A	uc003xtm.3	-	2	323	c.260A>T	c.(259-261)AAG>ATG	p.K87M		NM_000780	NP_000771	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A,	87					bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				GCACAACACCTTATGGTATGA	0.353									Neonatal_Giant_Cell_Hepatitis				82	86	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69021791	69021791	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69021791C>G	uc003xxv.1	+	25	3106	c.3079C>G	c.(3079-3081)CAG>GAG	p.Q1027E	PREX2_uc011lez.1_Missense_Mutation_p.Q962E	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	1027					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						AGACATCTATCAGAAACTGCT	0.453													48	148	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77763549	77763549	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77763549C>T	uc003yav.2	+	10	4644	c.4257C>T	c.(4255-4257)CCC>CCT	p.P1419P	ZFHX4_uc003yau.1_Silent_p.P1464P|ZFHX4_uc003yaw.1_Silent_p.P1419P	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1419						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCTCCTTGCCCGTGAATGGAG	0.507										HNSCC(33;0.089)			12	32	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77765673	77765673	+	Silent	SNP	T	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77765673T>G	uc003yav.2	+	10	6768	c.6381T>G	c.(6379-6381)GTT>GTG	p.V2127V	ZFHX4_uc003yau.1_Silent_p.V2172V|ZFHX4_uc003yaw.1_Silent_p.V2127V	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2127	Homeobox 1.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCCAAAAAGTTATCAAACACT	0.363										HNSCC(33;0.089)			99	122	---	---	---	---	PASS
E2F5	1875	broad.mit.edu	37	8	86121488	86121488	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86121488G>A	uc003ycz.3	+	6	764	c.727G>A	c.(727-729)GTT>ATT	p.V243I	E2F5_uc003yda.3_Missense_Mutation_p.V243I|E2F5_uc010mab.2_Missense_Mutation_p.V82I|E2F5_uc003ydb.3_Missense_Mutation_p.V62I	NM_001951	NP_001942	Q15329	E2F5_HUMAN	E2F transcription factor 5 isoform 1	243					G1 phase of mitotic cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(1)	1						GGTTTTTCCTGTTCCCCCACC	0.458													13	100	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89339329	89339329	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89339329C>T	uc003yeb.3	-	1	389	c.107G>A	c.(106-108)GGA>GAA	p.G36E	MMP16_uc003yec.2_Missense_Mutation_p.G36E	NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1	36					collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						CTGCTCCGTTCCGCAGACTGT	0.502													6	148	---	---	---	---	PASS
RBM12B	389677	broad.mit.edu	37	8	94746677	94746677	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94746677G>A	uc003yfz.2	-	3	2155	c.1962C>T	c.(1960-1962)CCC>CCT	p.P654P		NM_203390	NP_976324	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	654							nucleotide binding|RNA binding				0	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			CCTCCTCAGGGGGTTGCCTGA	0.642													55	221	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100568799	100568799	+	Nonsense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100568799A>T	uc003yiv.2	+	31	5053	c.4942A>T	c.(4942-4944)AAG>TAG	p.K1648*	VPS13B_uc003yiw.2_Nonsense_Mutation_p.K1623*	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	1648					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAAACCAGAGAAGGAAAGTGT	0.438													9	89	---	---	---	---	PASS
LRP12	29967	broad.mit.edu	37	8	105502956	105502956	+	Nonsense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105502956A>T	uc003yma.2	-	7	2620	c.2525T>A	c.(2524-2526)TTA>TAA	p.L842*	LRP12_uc003ymb.2_Nonsense_Mutation_p.L823*|LRP12_uc003ylz.2_Nonsense_Mutation_p.L248*	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	low density lipoprotein-related protein 12	842	Cytoplasmic (Potential).				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TGTTACTTCTAAGCAAGTGTC	0.433													39	134	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110497275	110497275	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110497275G>T	uc003yne.2	+	58	9683	c.9579G>T	c.(9577-9579)GAG>GAT	p.E3193D		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	3193	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTTCTAAGGAGGGAGAAGAGA	0.279										HNSCC(38;0.096)			10	62	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113518987	113518987	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113518987G>A	uc003ynu.2	-	29	4987	c.4828C>T	c.(4828-4830)CAT>TAT	p.H1610Y	CSMD3_uc003yns.2_Missense_Mutation_p.H882Y|CSMD3_uc003ynt.2_Missense_Mutation_p.H1570Y|CSMD3_uc011lhx.1_Missense_Mutation_p.H1506Y	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1610	Extracellular (Potential).|CUB 9.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TCTCTGCTATGCGGATATGGA	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			27	87	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	114448937	114448937	+	Silent	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114448937G>C	uc003ynu.2	-	1	306	c.147C>G	c.(145-147)CTC>CTG	p.L49L	CSMD3_uc011lhx.1_Silent_p.L49L|CSMD3_uc010mcx.1_Silent_p.L49L|CSMD3_uc003ynx.3_Silent_p.L49L	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	49	Helical; (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ATAAAAAGACGAGGTTCCAAA	0.507										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			94	285	---	---	---	---	PASS
ZHX2	22882	broad.mit.edu	37	8	123964740	123964740	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123964740G>A	uc003ypk.1	+	3	1557	c.990G>A	c.(988-990)CGG>CGA	p.R330R		NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	330	Required for interaction with NFYA.|Required for homodimerization.|Required for repressor activity.|Required for nuclear localization.					cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			AGGAGGCCCGGAAGAAGATGT	0.597													42	120	---	---	---	---	PASS
FAM83A	84985	broad.mit.edu	37	8	124219473	124219473	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124219473G>A	uc003ypv.2	+	5	2864	c.850G>A	c.(850-852)GAG>AAG	p.E284K	FAM83A_uc003ypw.2_Missense_Mutation_p.E284K|FAM83A_uc003ypy.2_Missense_Mutation_p.E228K|FAM83A_uc003ypx.2_Missense_Mutation_p.E284K|FAM83A_uc003ypz.2_Missense_Mutation_p.E284K	NM_032899	NP_116288	Q86UY5	FA83A_HUMAN	hypothetical protein LOC84985 isoform a	284										ovary(3)|skin(1)	4	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			GCTGTTTGACGAGGAGTTCCG	0.572													4	53	---	---	---	---	PASS
ATAD2	29028	broad.mit.edu	37	8	124408548	124408548	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124408548G>T	uc003yqh.3	-	1	158	c.50C>A	c.(49-51)TCG>TAG	p.S17*	ATAD2_uc011lii.1_5'UTR|ATAD2_uc003yqi.3_Intron|ATAD2_uc003yqj.2_Nonsense_Mutation_p.S17*	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	17					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GCCCGTGGCCGAGGCCGCGGA	0.682													8	45	---	---	---	---	PASS
ASAP1	50807	broad.mit.edu	37	8	131130450	131130450	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131130450C>A	uc003yta.1	-	19	1865	c.1837G>T	c.(1837-1839)GAT>TAT	p.D613Y	ASAP1_uc003ysz.1_Missense_Mutation_p.D424Y|ASAP1_uc011liw.1_Missense_Mutation_p.D606Y	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	613	ANK 1.				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						GATGTCTGATCTGCAGTTCGG	0.403													31	102	---	---	---	---	PASS
CYP11B2	1585	broad.mit.edu	37	8	143996481	143996481	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143996481G>C	uc003yxk.1	-	3	579	c.576C>G	c.(574-576)ATC>ATG	p.I192M		NM_000498	NP_000489	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B,	192					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity				0	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Candesartan(DB00796)|Metyrapone(DB01011)	TGTAGTGGAAGATGCTGGGCT	0.637									Familial_Hyperaldosteronism_type_I				9	48	---	---	---	---	PASS
TIGD5	84948	broad.mit.edu	37	8	144681126	144681126	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144681126G>T	uc003yyx.1	+	1	906	c.906G>T	c.(904-906)CAG>CAT	p.Q302H	EEF1D_uc011lki.1_5'Flank|EEF1D_uc011lkj.1_5'Flank|EEF1D_uc003yyr.2_5'Flank|EEF1D_uc003yyt.2_5'Flank|EEF1D_uc011lkk.1_5'Flank|EEF1D_uc003yys.2_5'Flank|EEF1D_uc003yyv.2_5'Flank|EEF1D_uc003yyu.2_5'Flank|EEF1D_uc011lkl.1_5'Flank	NM_032862	NP_116251	Q53EQ6	TIGD5_HUMAN	tigger transposable element derived 5	351					regulation of transcription, DNA-dependent	chromosome, centromeric region	DNA binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			GCCTGCAGCAGAAGGCCGTGC	0.706													5	11	---	---	---	---	PASS
TIGD5	84948	broad.mit.edu	37	8	144681439	144681439	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144681439G>C	uc003yyx.1	+	1	1219	c.1219G>C	c.(1219-1221)GAC>CAC	p.D407H	EEF1D_uc011lki.1_5'Flank|EEF1D_uc011lkj.1_5'Flank|EEF1D_uc003yyr.2_5'Flank|EEF1D_uc003yyt.2_5'Flank|EEF1D_uc011lkk.1_5'Flank|EEF1D_uc003yys.2_5'Flank|EEF1D_uc003yyv.2_5'Flank|EEF1D_uc003yyu.2_5'Flank|EEF1D_uc011lkl.1_5'Flank	NM_032862	NP_116251	Q53EQ6	TIGD5_HUMAN	tigger transposable element derived 5	456					regulation of transcription, DNA-dependent	chromosome, centromeric region	DNA binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			CATGCTCAAGGACATGCTCTA	0.677													7	36	---	---	---	---	PASS
TIGD5	84948	broad.mit.edu	37	8	144681815	144681815	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144681815G>T	uc003yyx.1	+	1	1595	c.1595G>T	c.(1594-1596)GGA>GTA	p.G532V	EEF1D_uc011lki.1_5'Flank|EEF1D_uc011lkj.1_5'Flank|EEF1D_uc003yyr.2_5'Flank|EEF1D_uc003yyt.2_5'Flank|EEF1D_uc011lkk.1_5'Flank|EEF1D_uc003yys.2_5'Flank|EEF1D_uc003yyv.2_5'Flank|EEF1D_uc003yyu.2_5'Flank|EEF1D_uc011lkl.1_5'Flank	NM_032862	NP_116251	Q53EQ6	TIGD5_HUMAN	tigger transposable element derived 5	581					regulation of transcription, DNA-dependent	chromosome, centromeric region	DNA binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			ACCGACTATGGAGGGACCTCA	0.716													6	40	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144996741	144996741	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144996741G>A	uc003zaf.1	-	31	7937	c.7767C>T	c.(7765-7767)ATC>ATT	p.I2589I	PLEC_uc003zab.1_Silent_p.I2452I|PLEC_uc003zac.1_Silent_p.I2456I|PLEC_uc003zad.2_Silent_p.I2452I|PLEC_uc003zae.1_Silent_p.I2420I|PLEC_uc003zag.1_Silent_p.I2430I|PLEC_uc003zah.2_Silent_p.I2438I|PLEC_uc003zaj.2_Silent_p.I2479I	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	2589	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CCAGCTCAGCGATGGCCTCCC	0.642													10	57	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	145049349	145049349	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145049349G>A	uc003zaj.2	-	2	238	c.189C>T	c.(187-189)ATC>ATT	p.I63I	PLEC_uc003zah.2_5'Flank	NM_000445	NP_000436	Q15149	PLEC_HUMAN	plectin isoform 1c	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						AGTTACCTGCGATGCGAATGA	0.687											OREG0019050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	35	119	---	---	---	---	PASS
KIFC2	90990	broad.mit.edu	37	8	145693754	145693754	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145693754G>T	uc003zcz.2	+	8	918	c.853G>T	c.(853-855)GAG>TAG	p.E285*	CYHR1_uc003zcw.2_5'Flank|CYHR1_uc003zcx.2_5'Flank|CYHR1_uc003zcy.2_5'Flank	NM_145754	NP_665697	Q96AC6	KIFC2_HUMAN	kinesin family member C2	285	Potential.|Gln-rich.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CCGGCTTCAGGAGGCCCAAGA	0.667													16	88	---	---	---	---	PASS
MFSD3	113655	broad.mit.edu	37	8	145736103	145736103	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145736103G>A	uc003zdi.1	+	3	1118	c.953G>A	c.(952-954)AGA>AAA	p.R318K		NM_138431	NP_612440	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing	318	Leu-rich.				transmembrane transport	integral to membrane				central_nervous_system(2)	2	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			ACAATCTTGAGAGGTGAGGGG	0.652													21	150	---	---	---	---	PASS
ERMP1	79956	broad.mit.edu	37	9	5833008	5833008	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5833008G>A	uc003zjm.1	-	1	74	c.20C>T	c.(19-21)TCG>TTG	p.S7L	ERMP1_uc011lme.1_RNA|ERMP1_uc010mhs.1_5'UTR|ERMP1_uc003zjn.1_Missense_Mutation_p.S7L	NM_024896	NP_079172	Q7Z2K6	ERMP1_HUMAN	aminopeptidase Fxna	7	Cytoplasmic (Potential).				proteolysis	endoplasmic reticulum membrane|integral to membrane	metal ion binding|metallopeptidase activity			ovary(1)	1		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		CACAGCAGCCGACTCAGAACC	0.627													8	6	---	---	---	---	PASS
STOML2	30968	broad.mit.edu	37	9	35102089	35102089	+	Intron	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35102089C>A	uc003zwi.2	-						STOML2_uc003zwh.2_5'UTR|STOML2_uc003zwj.2_Intron|STOML2_uc011lou.1_Intron|STOML2_uc003zwk.2_Intron	NM_013442	NP_038470	Q9UJZ1	STML2_HUMAN	stomatin (EPB72)-like 2							cytoskeleton	receptor binding				0			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CTGAACCCCTCACCGAGAGTC	0.512													14	22	---	---	---	---	PASS
FRMD3	257019	broad.mit.edu	37	9	86004554	86004554	+	Missense_Mutation	SNP	A	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86004554A>G	uc004ams.1	-	2	419	c.217T>C	c.(217-219)TTT>CTT	p.F73L	FRMD3_uc004amr.1_Missense_Mutation_p.F59L	NM_174938	NP_777598	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	73	FERM.					cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2						CGAATGCCAAAGTAGTCCTTC	0.498													19	72	---	---	---	---	PASS
RMI1	80010	broad.mit.edu	37	9	86616459	86616459	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86616459C>T	uc004anq.3	+	3	966	c.558C>T	c.(556-558)AAC>AAT	p.N186N	RMI1_uc004anr.3_Silent_p.N186N|RMI1_uc004anp.3_Silent_p.N186N|RMI1_uc004ans.3_Silent_p.N186N	NM_024945	NP_079221	Q9H9A7	RMI1_HUMAN	RMI1, RecQ mediated genome instability 1,	186					DNA replication	nucleus					0						AACCAGAAAACGTGAAAGTGT	0.353													29	55	---	---	---	---	PASS
PPP3R2	5535	broad.mit.edu	37	9	104357169	104357169	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104357169C>G	uc004bbr.2	-	1	115	c.44G>C	c.(43-45)TGC>TCC	p.C15S	GRIN3A_uc004bbp.1_Intron|GRIN3A_uc004bbq.1_Intron|PPP3R2_uc010mtf.1_RNA	NM_147180	NP_671709	Q96LZ3	CANB2_HUMAN	protein phosphatase 3 regulatory subunit B, beta	12							calcium ion binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)			Cyclosporine(DB00091)	AAAGTGGGAGCACATCTCCGC	0.562													32	46	---	---	---	---	PASS
KIAA1958	158405	broad.mit.edu	37	9	115421863	115421863	+	Silent	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115421863C>G	uc004bgf.1	+	4	1840	c.1665C>G	c.(1663-1665)CTC>CTG	p.L555L	KIAA1958_uc011lwx.1_Silent_p.L583L	NM_133465	NP_597722	Q8N8K9	K1958_HUMAN	hypothetical protein LOC158405	555										skin(1)	1						CTATCACTCTCCTGTCCACTG	0.567													8	16	---	---	---	---	PASS
FKBP15	23307	broad.mit.edu	37	9	115940912	115940912	+	Nonsense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115940912G>C	uc004bgs.2	-	20	2202	c.2084C>G	c.(2083-2085)TCA>TGA	p.S695*	FKBP15_uc010muu.1_Nonsense_Mutation_p.S759*|FKBP15_uc004bgr.2_Nonsense_Mutation_p.S132*|FKBP15_uc011lxc.1_Nonsense_Mutation_p.S276*|FKBP15_uc011lxd.1_Nonsense_Mutation_p.S627*|FKBP15_uc010mut.1_Nonsense_Mutation_p.S563*	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	695	Potential.				endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						GCACATACCTGAGAGCTTTGC	0.463													4	7	---	---	---	---	PASS
QRFP	347148	broad.mit.edu	37	9	133768899	133768899	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133768899G>T	uc011mcb.1	-	1	327	c.327C>A	c.(325-327)AGC>AGA	p.S109R		NM_198180	NP_937823	P83859	OX26_HUMAN	RF(Arg-Phe)amide family 26 amino acid peptide	109					locomotory behavior|neuropeptide signaling pathway|positive regulation of blood pressure|regulation of feeding behavior	extracellular region	neuropeptide hormone activity|orexigenic neuropeptide QRFP receptor binding				0	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.17e-05)|Epithelial(140;0.000267)		CTAACGGGCCGCTGGTCTTCT	0.647													48	58	---	---	---	---	PASS
GFI1B	8328	broad.mit.edu	37	9	135866411	135866411	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135866411C>T	uc004ccg.2	+	7	1118	c.967C>T	c.(967-969)CGC>TGC	p.R323C	GFI1B_uc010mzy.2_Missense_Mutation_p.R277C	NM_004188	NP_004179	Q5VTD9	GFI1B_HUMAN	growth factor independent 1B transcription	323	C2H2-type 6.|Mediates interaction with GATA1.|Interaction with ARIH2.				cell proliferation|chromatin modification|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle|transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)		GCGGCGGCACCGCGAGAGCCA	0.652													17	23	---	---	---	---	PASS
ADAMTS13	11093	broad.mit.edu	37	9	136320403	136320403	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136320403G>A	uc004cdv.3	+						ADAMTS13_uc004cdp.3_Intron|ADAMTS13_uc004cdt.1_Intron|ADAMTS13_uc004cdu.1_Intron|ADAMTS13_uc004cdw.3_Intron|ADAMTS13_uc004cdx.3_Intron|ADAMTS13_uc004cdz.3_Intron|ADAMTS13_uc004cea.1_5'Flank|ADAMTS13_uc004ceb.3_5'Flank	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1						cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CCCTCTCTTGGCAGTGCTCTG	0.458													66	95	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139909531	139909531	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139909531C>A	uc011mem.1	-	24	3861	c.3713G>T	c.(3712-3714)AGC>ATC	p.S1238I	ABCA2_uc011mel.1_Missense_Mutation_p.S1239I|ABCA2_uc004ckl.1_Missense_Mutation_p.S1169I|ABCA2_uc004ckm.1_Missense_Mutation_p.S1269I|ABCA2_uc004ckn.1_RNA	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	1238					cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ACCTGGGGGGCTGGATGCCAG	0.652													17	91	---	---	---	---	PASS
TUBB8	347688	broad.mit.edu	37	10	93743	93743	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93743C>G	uc001ifi.2	-	4	589	c.589G>C	c.(589-591)GAT>CAT	p.D197H	TUBB8_uc009xhe.2_Missense_Mutation_p.D160H|TUBB8_uc010pzs.1_Missense_Mutation_p.D125H	NM_177987	NP_817124	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 isoform 1	197					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		AAGGTCTCATCTGCGTTTTCT	0.522													71	159	---	---	---	---	PASS
ZMYND11	10771	broad.mit.edu	37	10	282786	282786	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:282786G>C	uc010pzt.1	+	5	875	c.447G>C	c.(445-447)AAG>AAC	p.K149N	ZMYND11_uc001ifk.2_Missense_Mutation_p.K149N|ZMYND11_uc010pzu.1_Missense_Mutation_p.K149N|ZMYND11_uc010pzv.1_Missense_Mutation_p.K95N|ZMYND11_uc010pzw.1_Missense_Mutation_p.K95N|ZMYND11_uc001ifm.2_Missense_Mutation_p.K95N|ZMYND11_uc010pzx.1_Missense_Mutation_p.K149N|ZMYND11_uc001ifn.2_Missense_Mutation_p.K95N|ZMYND11_uc009xhg.2_Missense_Mutation_p.K132N|ZMYND11_uc009xhh.2_Missense_Mutation_p.K49N|ZMYND11_uc010pzy.1_Missense_Mutation_p.K49N	NM_006624	NP_006615	Q15326	ZMY11_HUMAN	zinc finger, MYND domain containing 11 isoform	109					cell cycle|cell proliferation|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		AGAGCATTAAGAAGAAGAATA	0.338													8	48	---	---	---	---	PASS
IDI2	91734	broad.mit.edu	37	10	1065705	1065705	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1065705C>G	uc001ifv.1	-	5	501	c.436G>C	c.(436-438)GAG>CAG	p.E146Q	C10orf110_uc010qaf.1_5'Flank|C10orf110_uc001ifx.3_5'Flank|C10orf110_uc001ifw.3_5'Flank|C10orf110_uc001ify.3_5'Flank	NM_033261	NP_150286	Q9BXS1	IDI2_HUMAN	isopentenyl-diphosphate delta isomerase 2	146	Nudix hydrolase.	Magnesium (By similarity).			carotenoid biosynthetic process|cholesterol biosynthetic process	cytosol|peroxisome	hydrolase activity|isopentenyl-diphosphate delta-isomerase activity|metal ion binding				0		Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.143)	Epithelial(11;0.067)|OV - Ovarian serous cystadenocarcinoma(14;0.169)|all cancers(11;0.192)		ATTTCATGCTCTCCCCAAATT	0.438													29	74	---	---	---	---	PASS
FAM171A1	221061	broad.mit.edu	37	10	15255181	15255181	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15255181C>A	uc001iob.2	-	8	2413	c.2406G>T	c.(2404-2406)GGG>GGT	p.G802G		NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061 precursor	802	Cytoplasmic (Potential).					integral to membrane				ovary(2)|breast(1)|skin(1)	4						AGACCGTGGTCCCACATTCGC	0.622													22	37	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17024625	17024625	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17024625C>A	uc001ioo.2	-	31	4605	c.4553G>T	c.(4552-4554)AGT>ATT	p.S1518I		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1518	CUB 10.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AATCTCTCCACTGGGAGCCTG	0.443													19	38	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37508275	37508275	+	Missense_Mutation	SNP	T	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37508275T>A	uc001iza.1	+	34	3566	c.3467T>A	c.(3466-3468)ATT>AAT	p.I1156N		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1212						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						CATGATCAAATTGTGACATCA	0.363													17	64	---	---	---	---	PASS
ZNF37A	7587	broad.mit.edu	37	10	38407496	38407496	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38407496G>T	uc001izk.2	+	8	2236	c.1417G>T	c.(1417-1419)GGG>TGG	p.G473W	ZNF37A_uc001izl.2_Missense_Mutation_p.G473W|ZNF37A_uc001izm.2_Missense_Mutation_p.G473W	NM_001007094	NP_001007095	P17032	ZN37A_HUMAN	zinc finger protein 37a	473	C2H2-type 10.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)	1						TAATGAATGTGGGAAAACCTT	0.398													17	51	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55591249	55591249	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55591249G>T	uc001jju.1	-	30	4423	c.4028C>A	c.(4027-4029)CCG>CAG	p.P1343Q	PCDH15_uc010qhq.1_Missense_Mutation_p.P1348Q|PCDH15_uc010qhr.1_Missense_Mutation_p.P1343Q|PCDH15_uc010qhs.1_Missense_Mutation_p.P1355Q|PCDH15_uc010qht.1_Missense_Mutation_p.P1350Q|PCDH15_uc010qhu.1_Missense_Mutation_p.P1343Q|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.P1343Q|PCDH15_uc010qhw.1_Missense_Mutation_p.P1306Q|PCDH15_uc010qhx.1_Missense_Mutation_p.P1272Q|PCDH15_uc010qhy.1_Missense_Mutation_p.P1348Q|PCDH15_uc010qhz.1_Missense_Mutation_p.P1343Q|PCDH15_uc010qia.1_Missense_Mutation_p.P1321Q|PCDH15_uc010qib.1_Missense_Mutation_p.P1321Q	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1343	Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CCCATAATACGGCTGAAAGTC	0.398										HNSCC(58;0.16)			12	67	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55600180	55600180	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55600180C>A	uc001jju.1	-	29	4278	c.3883G>T	c.(3883-3885)GGA>TGA	p.G1295*	PCDH15_uc010qhq.1_Nonsense_Mutation_p.G1300*|PCDH15_uc010qhr.1_Nonsense_Mutation_p.G1295*|PCDH15_uc010qhs.1_Nonsense_Mutation_p.G1307*|PCDH15_uc010qht.1_Nonsense_Mutation_p.G1302*|PCDH15_uc010qhu.1_Nonsense_Mutation_p.G1295*|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Nonsense_Mutation_p.G1295*|PCDH15_uc010qhw.1_Nonsense_Mutation_p.G1258*|PCDH15_uc010qhx.1_Nonsense_Mutation_p.G1224*|PCDH15_uc010qhy.1_Nonsense_Mutation_p.G1300*|PCDH15_uc010qhz.1_Nonsense_Mutation_p.G1295*|PCDH15_uc010qia.1_Nonsense_Mutation_p.G1273*|PCDH15_uc010qib.1_Nonsense_Mutation_p.G1273*	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1295	Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				AAGGCATCTCCATGCCGGCGA	0.438										HNSCC(58;0.16)			28	74	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	68526066	68526066	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68526066C>G	uc009xpn.1	-	9	1360	c.1237G>C	c.(1237-1239)GAA>CAA	p.E413Q	CTNNA3_uc001jmw.2_Missense_Mutation_p.E413Q|CTNNA3_uc001jmx.3_Missense_Mutation_p.E413Q	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	413					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						GCAGCATATTCTTTTATTTCC	0.433													50	129	---	---	---	---	PASS
COL13A1	1305	broad.mit.edu	37	10	71664711	71664711	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71664711C>A	uc001jpr.1	+	15	1447	c.911C>A	c.(910-912)CCA>CAA	p.P304Q	COL13A1_uc001jqj.1_Missense_Mutation_p.P304Q|COL13A1_uc001jps.1_Missense_Mutation_p.P275Q|COL13A1_uc001jpt.1_Missense_Mutation_p.P263Q|COL13A1_uc001jpu.1_Missense_Mutation_p.P285Q|COL13A1_uc001jpv.1_Missense_Mutation_p.P304Q|COL13A1_uc001jpx.1_Missense_Mutation_p.P282Q|COL13A1_uc001jpw.1_Missense_Mutation_p.P251Q|COL13A1_uc001jpy.1_Missense_Mutation_p.P242Q|COL13A1_uc001jpz.1_Missense_Mutation_p.P247Q|COL13A1_uc001jqa.1_Missense_Mutation_p.P244Q|COL13A1_uc001jqc.1_Missense_Mutation_p.P304Q|COL13A1_uc001jqb.1_Missense_Mutation_p.P253Q|COL13A1_uc001jql.2_Missense_Mutation_p.P304Q|COL13A1_uc001jqd.1_Missense_Mutation_p.P292Q|COL13A1_uc001jqe.1_Missense_Mutation_p.P287Q|COL13A1_uc001jqf.1_Missense_Mutation_p.P285Q|COL13A1_uc001jqg.1_Missense_Mutation_p.P282Q|COL13A1_uc001jqh.1_Missense_Mutation_p.P304Q|COL13A1_uc001jqi.1_Missense_Mutation_p.P304Q|COL13A1_uc010qjf.1_Missense_Mutation_p.P94Q|COL13A1_uc001jqk.1_Missense_Mutation_p.P142Q	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1	304	Extracellular (Potential).|Triple-helical region 2 (COL2).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)	CCTCCTGGACCAAAGGTGAGT	0.493													3	7	---	---	---	---	PASS
COL13A1	1305	broad.mit.edu	37	10	71682537	71682537	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71682537C>A	uc001jpr.1	+	21	1720	c.1184C>A	c.(1183-1185)CCC>CAC	p.P395H	COL13A1_uc001jqj.1_Missense_Mutation_p.P395H|COL13A1_uc001jps.1_Missense_Mutation_p.P366H|COL13A1_uc001jpt.1_Missense_Mutation_p.P354H|COL13A1_uc001jpu.1_Missense_Mutation_p.P376H|COL13A1_uc001jpv.1_Missense_Mutation_p.P395H|COL13A1_uc001jpx.1_Missense_Mutation_p.P373H|COL13A1_uc001jpw.1_Missense_Mutation_p.P342H|COL13A1_uc001jpy.1_Missense_Mutation_p.P333H|COL13A1_uc001jpz.1_Missense_Mutation_p.P338H|COL13A1_uc001jqa.1_Missense_Mutation_p.P335H|COL13A1_uc001jqc.1_Missense_Mutation_p.P395H|COL13A1_uc001jqb.1_Missense_Mutation_p.P344H|COL13A1_uc001jql.2_Missense_Mutation_p.P395H|COL13A1_uc001jqd.1_Missense_Mutation_p.P383H|COL13A1_uc001jqe.1_Missense_Mutation_p.P378H|COL13A1_uc001jqf.1_Missense_Mutation_p.P376H|COL13A1_uc001jqg.1_Missense_Mutation_p.P373H|COL13A1_uc001jqh.1_Missense_Mutation_p.P395H|COL13A1_uc001jqi.1_Missense_Mutation_p.P395H|COL13A1_uc010qjf.1_Missense_Mutation_p.P185H|COL13A1_uc001jqk.1_Missense_Mutation_p.P233H	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1	395	Extracellular (Potential).|Triple-helical region 2 (COL2).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)	CTCCCTGGGCCCCCAGGGCCA	0.617													6	14	---	---	---	---	PASS
COL13A1	1305	broad.mit.edu	37	10	71703943	71703943	+	Intron	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71703943C>T	uc001jpr.1	+						COL13A1_uc001jqj.1_Intron|COL13A1_uc001jps.1_Intron|COL13A1_uc001jpt.1_Intron|COL13A1_uc001jpu.1_Intron|COL13A1_uc001jpv.1_Intron|COL13A1_uc001jpx.1_Intron|COL13A1_uc001jpw.1_Intron|COL13A1_uc001jpy.1_Intron|COL13A1_uc001jpz.1_Intron|COL13A1_uc001jqa.1_Intron|COL13A1_uc001jqc.1_Intron|COL13A1_uc001jqb.1_Intron|COL13A1_uc001jql.2_Intron|COL13A1_uc001jqd.1_Intron|COL13A1_uc001jqe.1_Intron|COL13A1_uc001jqf.1_Intron|COL13A1_uc001jqg.1_Intron|COL13A1_uc001jqh.1_Intron|COL13A1_uc001jqi.1_Intron|COL13A1_uc010qjf.1_Intron	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1						cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)	GGGTGAGTGTCACTGAGCCAG	0.627													18	49	---	---	---	---	PASS
USP54	159195	broad.mit.edu	37	10	75276616	75276616	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75276616G>A	uc001juo.2	-	18	3585	c.3568C>T	c.(3568-3570)CTG>TTG	p.L1190L	USP54_uc010qkk.1_Silent_p.L372L|USP54_uc001juk.2_Silent_p.L278L|USP54_uc001jul.2_Silent_p.L278L|USP54_uc001jum.2_RNA|USP54_uc001jun.2_RNA	NM_152586	NP_689799	Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1190					ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity			breast(3)|lung(2)|kidney(1)	6	Prostate(51;0.0112)					CCACCCTCCAGAGAGGATTGT	0.502													113	251	---	---	---	---	PASS
GLUD1	2746	broad.mit.edu	37	10	88817471	88817471	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88817471C>T	uc001keh.2	-	11	1568	c.1471G>A	c.(1471-1473)GCA>ACA	p.A491T	GLUD1_uc001keg.2_Missense_Mutation_p.A324T|GLUD1_uc010qmp.1_Missense_Mutation_p.A358T	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor	491					glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	TGGAACTCTGCCGTGGGTACA	0.428													4	132	---	---	---	---	PASS
KIF20B	9585	broad.mit.edu	37	10	91497625	91497625	+	Silent	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91497625C>G	uc001kgs.1	+	20	3099	c.3027C>G	c.(3025-3027)CTC>CTG	p.L1009L	KIF20B_uc001kgr.1_Silent_p.L969L|KIF20B_uc001kgt.1_Silent_p.L220L|KIF20B_uc009xtw.1_RNA	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	1009					cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						TGCTCAATCTCAGGGATCTGT	0.323													15	88	---	---	---	---	PASS
TNKS2	80351	broad.mit.edu	37	10	93608302	93608302	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93608302C>G	uc001khp.2	+	19	2818	c.2521C>G	c.(2521-2523)CTT>GTT	p.L841V		NM_025235	NP_079511	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related	841					positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding			kidney(3)|skin(3)|ovary(1)|lung(1)	8		Colorectal(252;0.162)				AGCCAGCAGTCTTGACAACTT	0.493													19	86	---	---	---	---	PASS
PKD2L1	9033	broad.mit.edu	37	10	102054753	102054753	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102054753C>A	uc001kqx.1	-	8	1867	c.1484G>T	c.(1483-1485)GGC>GTC	p.G495V	PKD2L1_uc009xwm.1_Missense_Mutation_p.G448V	NM_016112	NP_057196	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	495	Helical; (Potential).				signal transduction	integral to membrane	calcium activated cation channel activity|calcium ion binding|cytoskeletal protein binding			ovary(4)	4		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		AAGCAGGTAGCCGAGTTGGGC	0.562													14	58	---	---	---	---	PASS
PSD	5662	broad.mit.edu	37	10	104172152	104172152	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104172152C>T	uc001kvg.1	-	6	2261	c.1734G>A	c.(1732-1734)CGG>CGA	p.R578R	PSD_uc001kvh.1_Silent_p.R199R|PSD_uc009xxd.1_Silent_p.R578R	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	578	SEC7.				regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		TGCCCAGGTGCCGGGCCACAT	0.597													11	28	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108923810	108923810	+	Nonsense_Mutation	SNP	T	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108923810T>A	uc001kym.2	-	1	483	c.475A>T	c.(475-477)AGA>TGA	p.R159*	SORCS1_uc001kyl.2_Nonsense_Mutation_p.R159*|SORCS1_uc009xxs.2_Nonsense_Mutation_p.R159*|SORCS1_uc001kyn.1_Nonsense_Mutation_p.R159*|SORCS1_uc001kyo.2_Nonsense_Mutation_p.R159*	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	159	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CTGGTCAGTCTCAGCTCCTCC	0.632													12	63	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108923811	108923811	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108923811C>A	uc001kym.2	-	1	482	c.474G>T	c.(472-474)CTG>CTT	p.L158L	SORCS1_uc001kyl.2_Silent_p.L158L|SORCS1_uc009xxs.2_Silent_p.L158L|SORCS1_uc001kyn.1_Silent_p.L158L|SORCS1_uc001kyo.2_Silent_p.L158L	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	158	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TGGTCAGTCTCAGCTCCTCCA	0.637													12	64	---	---	---	---	PASS
SMC3	9126	broad.mit.edu	37	10	112361435	112361435	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112361435G>A	uc001kze.2	+	24	2811	c.2685G>A	c.(2683-2685)AAG>AAA	p.K895K		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	895	Potential.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		CTGGAATTAAGGAGCTTCAGA	0.353													20	147	---	---	---	---	PASS
SMC3	9126	broad.mit.edu	37	10	112361436	112361436	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112361436G>A	uc001kze.2	+	24	2812	c.2686G>A	c.(2686-2688)GAG>AAG	p.E896K		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	896	Potential.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TGGAATTAAGGAGCTTCAGAA	0.353													20	146	---	---	---	---	PASS
HABP2	3026	broad.mit.edu	37	10	115341888	115341888	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115341888C>A	uc001lai.3	+	9	1195	c.1092C>A	c.(1090-1092)ACC>ACA	p.T364T	HABP2_uc010qrz.1_Intron	NM_004132	NP_004123	Q14520	HABP2_HUMAN	hyaluronan binding protein 2 preproprotein	364	Peptidase S1.				cell adhesion|proteolysis	extracellular space	glycosaminoglycan binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)		CCCACTGCACCGAGTAGGTGC	0.637													3	19	---	---	---	---	PASS
ATRNL1	26033	broad.mit.edu	37	10	117093882	117093882	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117093882G>T	uc001lcg.2	+	19	3514	c.3128G>T	c.(3127-3129)TGT>TTT	p.C1043F	ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	1043	Laminin EGF-like 1.|Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TGTCAAGATTGTATGCCAGGT	0.368													10	51	---	---	---	---	PASS
PNLIPRP3	119548	broad.mit.edu	37	10	118231286	118231286	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118231286G>A	uc001lcl.3	+	10	1168	c.1067G>A	c.(1066-1068)AGG>AAG	p.R356K		NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3 precursor	356	PLAT.				lipid catabolic process	extracellular region	triglyceride lipase activity			ovary(1)	1				all cancers(201;0.0131)		CTAGGTTGGAGGCACAAATTG	0.413													31	166	---	---	---	---	PASS
SLC18A2	6571	broad.mit.edu	37	10	119012937	119012937	+	Silent	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119012937G>C	uc001ldd.1	+	4	523	c.492G>C	c.(490-492)GCG>GCC	p.A164A	SLC18A2_uc009xyy.1_5'UTR	NM_003054	NP_003045	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine),	164	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity				0		Colorectal(252;0.19)		all cancers(201;0.029)	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)	CCATATTTGCGGGATTCTGCA	0.433													19	136	---	---	---	---	PASS
SYCE1	93426	broad.mit.edu	37	10	135367790	135367790	+	3'UTR	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135367790C>G	uc009ybn.2	-	13					CYP2E1_uc001lnl.1_Intron|SYCE1_uc001lnm.2_3'UTR|SYCE1_uc001lnn.2_3'UTR	NM_001143763	NP_001137235	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1						cell division	central element				ovary(1)	1		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		GTGAGCCTCTCTCTTCAACTC	0.473													56	69	---	---	---	---	PASS
LRDD	55367	broad.mit.edu	37	11	803520	803520	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:803520C>T	uc001lro.1	-	3	505	c.363G>A	c.(361-363)CTG>CTA	p.L121L	LRDD_uc009yck.1_5'Flank|LRDD_uc001lrk.1_Silent_p.L121L|LRDD_uc001lrl.1_5'UTR|LRDD_uc001lrm.1_5'UTR|LRDD_uc001lrn.1_5'UTR|LRDD_uc001lrp.1_5'UTR	NM_145886	NP_665893	Q9HB75	PIDD_HUMAN	leucine rich repeat and death domain containing	121					apoptosis|signal transduction	cytoplasm|nucleus	death receptor binding				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCAGGCCACTCAGACCAGCGG	0.677													8	27	---	---	---	---	PASS
CHID1	66005	broad.mit.edu	37	11	884148	884148	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:884148G>A	uc001lsl.2	-	9	884	c.723C>T	c.(721-723)TTC>TTT	p.F241F	CHID1_uc010qwu.1_Silent_p.F271F|CHID1_uc010qwv.1_Silent_p.F302F|CHID1_uc001lsn.2_Silent_p.F266F|CHID1_uc001lsm.2_Silent_p.F241F|CHID1_uc001lso.2_Silent_p.F241F|CHID1_uc001lsp.2_Silent_p.F210F|CHID1_uc010qww.1_Silent_p.F241F|uc001lsq.1_5'Flank|uc001lsr.1_5'Flank	NM_023947	NP_076436	Q9BWS9	CHID1_HUMAN	chitinase domain containing 1 isoform a	241					chitin catabolic process|innate immune response	extracellular region|lysosome	cation binding|chitinase activity				0		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.48e-25)|Epithelial(43;3.75e-24)|BRCA - Breast invasive adenocarcinoma(625;4.65e-05)|Lung(200;0.0624)|LUSC - Lung squamous cell carcinoma(625;0.0735)		CCTTGTGCGTGAACATGCCCA	0.612													9	30	---	---	---	---	PASS
AP2A2	161	broad.mit.edu	37	11	981303	981303	+	Intron	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:981303A>T	uc001lss.2	+						AP2A2_uc001lst.1_Intron|AP2A2_uc009yco.1_Intron|AP2A2_uc001lsu.1_Missense_Mutation_p.S110C	NM_012305	NP_036437	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|cytosol	lipid binding|protein transporter activity				0		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		AAGCAGAGTAAGTCTGTTCGT	0.413													3	17	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1087495	1087495	+	Nonsense_Mutation	SNP	T	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1087495T>A	uc001lsx.1	+	24	3273	c.3246T>A	c.(3244-3246)TGT>TGA	p.C1082*		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	1082						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CGTGCTCCTGTGACACGGGTG	0.657													6	37	---	---	---	---	PASS
OR52B4	143496	broad.mit.edu	37	11	4389100	4389100	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4389100C>A	uc010qye.1	-	1	426	c.426G>T	c.(424-426)CTG>CTT	p.L142L		NM_001005161	NP_001005161	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B,	142	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTTTCTTGATCAGAGCATTTG	0.383													20	63	---	---	---	---	PASS
TPP1	1200	broad.mit.edu	37	11	6635806	6635806	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6635806C>A	uc001mel.1	-	13	1724	c.1663G>T	c.(1663-1665)GCT>TCT	p.A555S	TAF10_uc001mej.1_5'Flank|TPP1_uc001mek.1_Missense_Mutation_p.A312S	NM_000391	NP_000382	O14773	TPP1_HUMAN	tripeptidyl-peptidase I preproprotein	555					bone resorption|cell death|lipid metabolic process|lysosome organization|nervous system development|neuromuscular process controlling balance|peptide catabolic process|protein catabolic process|proteolysis	lysosome|melanosome|soluble fraction	metal ion binding|peptide binding|protein binding|serine-type endopeptidase activity|tripeptidyl-peptidase activity				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)		TTCAGCAAAGCTGGGAAGTTG	0.562													18	77	---	---	---	---	PASS
SERGEF	26297	broad.mit.edu	37	11	18029510	18029510	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18029510C>T	uc001mnm.2	-	2	254	c.174G>A	c.(172-174)GGG>GGA	p.G58G	SERGEF_uc009yhd.2_RNA|SERGEF_uc001mnn.2_Silent_p.G58G|SERGEF_uc010rcz.1_5'UTR|SERGEF_uc001mno.1_5'UTR	NM_012139	NP_036271	Q9UGK8	SRGEF_HUMAN	deafness locus associated putative guanine	58	RCC1 1.				negative regulation of protein secretion|signal transduction	cytoplasm|nucleus	protein binding|Ran guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1						CAGAGTGGCCCCCTCCTCCTG	0.468													23	62	---	---	---	---	PASS
SAAL1	113174	broad.mit.edu	37	11	18111804	18111804	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18111804C>A	uc001mnq.2	-	6	557	c.507G>T	c.(505-507)GTG>GTT	p.V169V	SAAL1_uc001mnr.2_Silent_p.V169V|SAAL1_uc001mns.2_RNA|SAAL1_uc009yhf.2_Silent_p.V169V	NM_138421	NP_612430	Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	169					acute-phase response	extracellular region	binding				0						AAACACTGGCCACTTCTGCCT	0.373													7	44	---	---	---	---	PASS
MRGPRX2	117194	broad.mit.edu	37	11	19077955	19077955	+	Translation_Start_Site	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19077955G>T	uc001mph.2	-	2	83	c.-5C>A	c.(-7--3)TTCTG>TTATG			NM_054030	NP_473371	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2						sensory perception of pain|sleep	plasma membrane	G-protein coupled receptor activity|neuropeptide binding			ovary(1)	1						TCCATGCTCAGAAAACCTCCA	0.413													37	188	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	20124928	20124928	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20124928G>T	uc001mpr.3	+	33	6915	c.6554G>T	c.(6553-6555)GGG>GTG	p.G2185V	NAV2_uc001mpp.2_Missense_Mutation_p.G2118V|NAV2_uc009yhx.2_Missense_Mutation_p.G1246V|NAV2_uc009yhz.2_Missense_Mutation_p.G827V|NAV2_uc001mpu.2_Missense_Mutation_p.G620V|NAV2_uc001mpv.2_5'Flank	NM_182964	NP_892009	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 1	2241						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						ATCTTCAATGGGCTGCTCAAC	0.557													18	94	---	---	---	---	PASS
ANO5	203859	broad.mit.edu	37	11	22294421	22294421	+	Silent	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22294421G>T	uc001mqi.2	+	19	2438	c.2121G>T	c.(2119-2121)GTG>GTT	p.V707V	ANO5_uc001mqj.2_Silent_p.V706V	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	707	Cytoplasmic (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						AGATTCGAGTGGATGCCTGGA	0.393													14	58	---	---	---	---	PASS
LUZP2	338645	broad.mit.edu	37	11	24759756	24759756	+	Intron	SNP	T	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24759756T>C	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN	leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2						CTCTGTTTTCTACTAAAATAG	0.353													15	48	---	---	---	---	PASS
CCDC73	493860	broad.mit.edu	37	11	32635290	32635290	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32635290G>A	uc001mtv.2	-	16	2618	c.2574C>T	c.(2572-2574)TTC>TTT	p.F858F		NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79	858										ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)					GTCCTTCACTGAACATTTTTC	0.358													29	132	---	---	---	---	PASS
CD44	960	broad.mit.edu	37	11	35226076	35226076	+	Missense_Mutation	SNP	A	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35226076A>G	uc001mvu.2	+	10	1605	c.1171A>G	c.(1171-1173)AGT>GGT	p.S391G	CD44_uc001mvv.2_Missense_Mutation_p.S348G|CD44_uc001mvw.2_Intron|CD44_uc001mvx.2_Intron|CD44_uc001mvy.2_Intron|CD44_uc001mwc.3_Intron|CD44_uc010rer.1_Intron|CD44_uc009ykh.2_Intron|CD44_uc010res.1_Intron|CD44_uc010ret.1_Intron|CD44_uc010reu.1_Intron	NM_000610	NP_000601	P16070	CD44_HUMAN	CD44 antigen isoform 1 precursor	391	Extracellular (Potential).|Stem.				cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)	AACTCCTAGTAGTACAACGGA	0.443													35	56	---	---	---	---	PASS
RAG1	5896	broad.mit.edu	37	11	36595984	36595984	+	Nonsense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36595984C>G	uc001mwu.3	+	2	1254	c.1130C>G	c.(1129-1131)TCA>TGA	p.S377*	RAG1_uc001mwt.2_RNA	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	377	RAG1-type.				histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5	all_lung(20;0.226)	all_hematologic(20;0.107)				CACCACATCTCAAGTCACAAG	0.468									Familial_Hemophagocytic_Lymphohistiocytosis				16	60	---	---	---	---	PASS
API5	8539	broad.mit.edu	37	11	43357478	43357478	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43357478G>C	uc010rfh.1	+	13	1599	c.1426G>C	c.(1426-1428)GAT>CAT	p.D476H	API5_uc010rfg.1_Missense_Mutation_p.D465H|API5_uc001mxf.2_Missense_Mutation_p.D476H|API5_uc010rfi.1_Missense_Mutation_p.D422H|API5_uc001mxg.2_Missense_Mutation_p.D350H	NM_001142930	NP_001136402	Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5 isoform a	476					anti-apoptosis|apoptosis	cytoplasm|spliceosomal complex	fibroblast growth factor binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						ACCAAAAAGAGATGCCAGGCA	0.423													14	52	---	---	---	---	PASS
SYT13	57586	broad.mit.edu	37	11	45265766	45265766	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45265766C>G	uc001myq.2	-	6	1244	c.1118G>C	c.(1117-1119)AGT>ACT	p.S373T	SYT13_uc009yku.1_Missense_Mutation_p.S229T	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	373	C2 2.|Cytoplasmic (Potential).					transport vesicle				ovary(1)	1						CAGCTCCACACTGGAGGCCTG	0.597													18	30	---	---	---	---	PASS
CKAP5	9793	broad.mit.edu	37	11	46772716	46772716	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46772716C>G	uc001ndi.1	-	40	5522	c.5412G>C	c.(5410-5412)CAG>CAC	p.Q1804H	CKAP5_uc009ylg.1_Missense_Mutation_p.Q1697H|CKAP5_uc001ndj.1_Missense_Mutation_p.Q1744H|CKAP5_uc001ndh.1_Missense_Mutation_p.Q733H	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein	1804					cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2						TGCTCCCAGTCTGGTCCATAC	0.507													22	79	---	---	---	---	PASS
LRP4	4038	broad.mit.edu	37	11	46898789	46898789	+	Missense_Mutation	SNP	T	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46898789T>C	uc001ndn.3	-	23	3384	c.3238A>G	c.(3238-3240)ATG>GTG	p.M1080V		NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	1080	Extracellular (Potential).				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		GTGTTCTTCATGGTAATGTTG	0.498													20	115	---	---	---	---	PASS
NUP160	23279	broad.mit.edu	37	11	47809787	47809787	+	Silent	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47809787G>C	uc001ngm.2	-	31	3778	c.3693C>G	c.(3691-3693)CTC>CTG	p.L1231L	NUP160_uc009ylw.2_RNA	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa	1231					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						AAGTCTGACAGAGTGATATGG	0.378													8	32	---	---	---	---	PASS
OR4A16	81327	broad.mit.edu	37	11	55110996	55110996	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55110996G>T	uc010rie.1	+	1	320	c.320G>T	c.(319-321)GGT>GTT	p.G107V		NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A,	107	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(2)|pancreas(1)	3						TTACTTGGTGGTGCAGAGGTC	0.448													18	283	---	---	---	---	PASS
OR5L1	219437	broad.mit.edu	37	11	55579266	55579266	+	Silent	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55579266G>T	uc001nhw.1	+	1	324	c.324G>T	c.(322-324)GTG>GTT	p.V108V		NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L,	108	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(2)	5		all_epithelial(135;0.208)				GCACTTGTGTGGTCACTGAGG	0.468													30	156	---	---	---	---	PASS
OR5F1	338674	broad.mit.edu	37	11	55761313	55761313	+	Missense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55761313A>T	uc010riv.1	-	1	789	c.789T>A	c.(787-789)AGT>AGA	p.S263R		NM_003697	NP_003688	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F,	263	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)					AGTAGCTGGAACTAGGTCTCA	0.507													23	112	---	---	---	---	PASS
OR9G9	504191	broad.mit.edu	37	11	56468503	56468503	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468503C>A	uc010rjn.1	+	1	640	c.640C>A	c.(640-642)CTG>ATG	p.L214M		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	214	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AGTGCTCATCCTGGCCTCCTA	0.552													13	235	---	---	---	---	PASS
YPEL4	219539	broad.mit.edu	37	11	57413795	57413795	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57413795C>T	uc001nkv.3	-	4	713	c.269G>A	c.(268-270)TGC>TAC	p.C90Y	uc001nkt.1_Intron|YPEL4_uc009ymk.2_RNA	NM_145008	NP_659445	Q96NS1	YPEL4_HUMAN	yippee-like 4	90						nucleolus					0						TGTGGTTTTGCAGCTCTCACA	0.557													4	96	---	---	---	---	PASS
MEN1	4221	broad.mit.edu	37	11	64577259	64577259	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64577259C>A	uc001obj.2	-	2	396	c.323G>T	c.(322-324)CGA>CTA	p.R108L	MEN1_uc001obk.2_Missense_Mutation_p.R108L|MEN1_uc001obl.2_Missense_Mutation_p.R108L|MEN1_uc001obm.2_Missense_Mutation_p.R108L|MEN1_uc001obn.2_Missense_Mutation_p.R108L|MEN1_uc001obo.2_Missense_Mutation_p.R108L|MEN1_uc001obp.2_Missense_Mutation_p.R108L|MEN1_uc001obq.2_Missense_Mutation_p.R108L|MEN1_uc001obr.2_Missense_Mutation_p.R108L	NM_130800	NP_570712	O00255	MEN1_HUMAN	menin isoform 1	108					DNA repair|histone lysine methylation|MAPKKK cascade|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of JNK cascade|negative regulation of osteoblast differentiation|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of telomerase activity|negative regulation of transcription from RNA polymerase II promoter|osteoblast development|positive regulation of protein binding|positive regulation of transforming growth factor beta receptor signaling pathway|response to gamma radiation|response to UV|transcription, DNA-dependent	chromatin|cleavage furrow|cytosol|histone methyltransferase complex|nuclear matrix|soluble fraction	double-stranded DNA binding|four-way junction DNA binding|protein binding, bridging|protein N-terminus binding|R-SMAD binding|transcription regulatory region DNA binding|Y-form DNA binding	p.R108*(2)		parathyroid(105)|pancreas(64)|gastrointestinal_tract_(site_indeterminate)(15)|small_intestine(13)|lung(9)|pituitary(7)|NS(7)|adrenal_gland(5)|soft_tissue(4)|central_nervous_system(4)|thymus(2)|stomach(1)|retroperitoneum(1)|skin(1)	238						ACCCCCTTCTCGAGGATAGAG	0.612			D|Mis|N|F|S		parathyroid tumors|Pancreatic neuroendocrine tumors	parathyroid adenoma|pituitary adenoma|pancreatic islet cell|carcinoid			Hyperparathyroidism_Familial_Isolated|Multiple_Endocrine_Neoplasia_type_1				51	28	---	---	---	---	PASS
C11orf24	53838	broad.mit.edu	37	11	68029630	68029630	+	Nonsense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68029630G>C	uc001onr.3	-	4	1275	c.833C>G	c.(832-834)TCA>TGA	p.S278*	C11orf24_uc001ons.2_Nonsense_Mutation_p.S278*	NM_022338	NP_071733	Q96F05	CK024_HUMAN	hypothetical protein LOC53838 precursor	278	Extracellular (Potential).|Pro-rich.					integral to membrane					0						GGTTGTGTTTGAGGGCATGGG	0.597													61	55	---	---	---	---	PASS
TPCN2	219931	broad.mit.edu	37	11	68851475	68851475	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68851475G>A	uc001oos.2	+	19	1868	c.1752G>A	c.(1750-1752)GGG>GGA	p.G584G	TPCN2_uc010rqg.1_Intron|TPCN2_uc001oot.2_RNA	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	584	Helical; Name=S5 of repeat II; (Potential).				cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CGTTTGGCGGGATCCTGGTGG	0.657													28	48	---	---	---	---	PASS
AQP11	282679	broad.mit.edu	37	11	77320423	77320423	+	3'UTR	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77320423C>G	uc001oyj.2	+	3					AQP11_uc009yuu.2_RNA	NM_173039	NP_766627	Q8NBQ7	AQP11_HUMAN	aquaporin 11							cell surface|integral to membrane	transporter activity				0	all_cancers(14;1.75e-17)|all_epithelial(13;4.7e-20)|Ovarian(111;0.249)		Epithelial(5;4.73e-49)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)			AAAGGAATAACTGTTCCAAAG	0.368													47	43	---	---	---	---	PASS
NOX4	50507	broad.mit.edu	37	11	89165992	89165992	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89165992C>A	uc001pct.2	-	7	747	c.508G>T	c.(508-510)GTG>TTG	p.V170L	NOX4_uc009yvr.2_Missense_Mutation_p.V145L|NOX4_uc001pcu.2_Missense_Mutation_p.V96L|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Missense_Mutation_p.V170L|NOX4_uc009yvo.2_RNA|NOX4_uc010rtu.1_Missense_Mutation_p.V4L|NOX4_uc009yvp.2_Missense_Mutation_p.V170L|NOX4_uc010rtv.1_Missense_Mutation_p.V146L|NOX4_uc009yvq.2_Missense_Mutation_p.V146L|NOX4_uc009yvs.1_RNA	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	170	Ferric oxidoreductase.|Helical; (Potential).				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AGGAATAGCACCACCACCATG	0.338													13	10	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	89486726	89486726	+	IGR	SNP	T	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89486726T>C								TRIM77 (35688 upstream) : TRIM49 (44098 downstream)																							TCCCTGTATTTCTTTGACAGG	0.433													12	28	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92533301	92533301	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92533301G>A	uc001pdj.3	+	9	7139	c.7122G>A	c.(7120-7122)CTG>CTA	p.L2374L		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2374	Cadherin 21.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCCCATCACTGAGCAGTGAGG	0.423										TCGA Ovarian(4;0.039)			23	192	---	---	---	---	PASS
CNTN5	53942	broad.mit.edu	37	11	99690344	99690344	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99690344C>G	uc001pga.2	+	4	464	c.125C>G	c.(124-126)TCT>TGT	p.S42C	CNTN5_uc009ywv.1_Missense_Mutation_p.S42C|CNTN5_uc001pfz.2_Missense_Mutation_p.S42C|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	42					cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AAGAGTTCATCTTCATCTCTC	0.403													11	178	---	---	---	---	PASS
CNTN5	53942	broad.mit.edu	37	11	99944898	99944898	+	Silent	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99944898G>T	uc001pga.2	+	13	1791	c.1452G>T	c.(1450-1452)CTG>CTT	p.L484L	CNTN5_uc009ywv.1_Silent_p.L484L|CNTN5_uc001pfz.2_Silent_p.L484L|CNTN5_uc001pgb.2_Silent_p.L410L	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	484	Ig-like C2-type 5.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		CTTTTGCACTGAATCAACTGA	0.373													31	23	---	---	---	---	PASS
MMP13	4322	broad.mit.edu	37	11	102825188	102825188	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102825188C>A	uc001phl.2	-	3	538	c.510G>T	c.(508-510)AAG>AAT	p.K170N		NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein	170					collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)		CATCATTACCCTTAATTCCAA	0.294													18	17	---	---	---	---	PASS
CUL5	8065	broad.mit.edu	37	11	107965533	107965533	+	Intron	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107965533C>T	uc001pjv.2	+						CUL5_uc001pju.2_Intron	NM_003478	NP_003469	Q93034	CUL5_HUMAN	Vasopressin-activated calcium-mobilizing						cell cycle arrest|cell proliferation|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process|viral reproduction	cullin-RING ubiquitin ligase complex|cytosol	calcium channel activity|receptor activity|ubiquitin protein ligase binding			ovary(1)	1		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		ATATTCTTCTCTATAGCTGAT	0.318													8	58	---	---	---	---	PASS
NPAT	4863	broad.mit.edu	37	11	108043625	108043625	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108043625C>T	uc001pjz.3	-	13	2188	c.2086G>A	c.(2086-2088)GAA>AAA	p.E696K	NPAT_uc010rvv.1_5'Flank|NPAT_uc001pka.2_Missense_Mutation_p.E491K	NM_002519	NP_002510	Q14207	NPAT_HUMAN	nuclear protein,  ataxia-telangiectasia locus	696					positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			ovary(2)	2		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		TGACTGTTTTCTACAGGAGTG	0.418													38	32	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108381581	108381581	+	Missense_Mutation	SNP	C	G	G	rs146274272		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108381581C>G	uc001pkk.2	-	6	4764	c.4653G>C	c.(4651-4653)GAG>GAC	p.E1551D	EXPH5_uc010rvy.1_Missense_Mutation_p.E1363D|EXPH5_uc010rvz.1_Missense_Mutation_p.E1395D|EXPH5_uc010rwa.1_Missense_Mutation_p.E1475D	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	1551					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CCTTCCTGCTCTCTGTCATAT	0.433													21	82	---	---	---	---	PASS
SIK3	23387	broad.mit.edu	37	11	116719898	116719898	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116719898C>A	uc001ppy.2	-	21	3475	c.3439G>T	c.(3439-3441)GAG>TAG	p.E1147*	SIK3_uc001ppz.2_Nonsense_Mutation_p.E986*|SIK3_uc001pqa.2_Nonsense_Mutation_p.E1087*|SIK3_uc001ppw.2_Nonsense_Mutation_p.E504*|SIK3_uc001ppx.2_Nonsense_Mutation_p.E525*	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK	1147						cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						CTGTGGTGCTCATGGACGGAG	0.597													20	54	---	---	---	---	PASS
OR10G4	390264	broad.mit.edu	37	11	123886831	123886831	+	Missense_Mutation	SNP	C	G	G	rs149568158		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123886831C>G	uc010sac.1	+	1	550	c.550C>G	c.(550-552)CTG>GTG	p.L184V		NM_001004462	NP_001004462	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.L184L(1)		skin(2)|ovary(1)|central_nervous_system(1)	4		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		ACCGCCCATCCTGAAACTGGC	0.532													167	100	---	---	---	---	PASS
OR10G7	390265	broad.mit.edu	37	11	123909463	123909463	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123909463G>A	uc001pzq.1	-	1	246	c.246C>T	c.(244-246)ACC>ACT	p.T82T		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	82	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GGGACACCAAGGTCATCAGCA	0.532													136	106	---	---	---	---	PASS
FEZ1	9638	broad.mit.edu	37	11	125330565	125330565	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125330565G>A	uc001qbx.2	-						FEZ1_uc010sbc.1_Intron	NM_005103	NP_005094	Q99689	FEZ1_HUMAN	zygin 1 isoform 1						axon guidance|cell adhesion|transport	microtubule|plasma membrane				central_nervous_system(3)|ovary(1)	4	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		TCAATTACCTGAAGAAGGTAC	0.453													82	84	---	---	---	---	PASS
FOXM1	2305	broad.mit.edu	37	12	2970476	2970476	+	Intron	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2970476G>C	uc001qlf.2	-						FOXM1_uc001qle.2_Missense_Mutation_p.L457V|FOXM1_uc001qlg.2_Intron|FOXM1_uc009zea.2_Intron|FOXM1_uc009zeb.2_Intron	NM_021953	NP_068772	Q08050	FOXM1_HUMAN	forkhead box M1 isoform 2						cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			gataaacaaagaaagataaaa	0.000													17	36	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6103190	6103190	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6103190G>C	uc001qnn.1	-	37	6686	c.6436C>G	c.(6436-6438)CTG>GTG	p.L2146V	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	2146	VWFD 4.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	TCAGCAAACAGTGGTAAGAGG	0.602													10	62	---	---	---	---	PASS
USP5	8078	broad.mit.edu	37	12	6965209	6965209	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6965209G>A	uc001qri.3	+	4	392	c.333G>A	c.(331-333)GAG>GAA	p.E111E	USP5_uc001qrh.3_Silent_p.E111E	NM_001098536	NP_001092006	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 isoform 1	111					positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			lung(2)|breast(1)|skin(1)	4						ACCTTAGCGAGGAGAAGTTTG	0.512													67	174	---	---	---	---	PASS
SLC2A14	144195	broad.mit.edu	37	12	7982360	7982360	+	Splice_Site	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7982360A>T	uc001qtk.2	-	10	1375	c.582_splice	c.e10+1	p.Q194_splice	SLC2A14_uc001qtl.2_Splice_Site_p.Q171_splice|SLC2A14_uc001qtm.2_Splice_Site_p.Q171_splice|SLC2A14_uc010sgg.1_Splice_Site_p.Q85_splice|SLC2A14_uc001qtn.2_Splice_Site_p.Q194_splice|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Splice_Site_p.Q209_splice	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)		GTTCTAGAGTACCTGGGCCAC	0.368													21	56	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9242563	9242563	+	Missense_Mutation	SNP	T	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9242563T>C	uc001qvk.1	-	21	2766	c.2653A>G	c.(2653-2655)ACT>GCT	p.T885A	A2M_uc009zgk.1_Missense_Mutation_p.T735A	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	885					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	GGCACCTCAGTCCCACACAGC	0.428													28	192	---	---	---	---	PASS
STYK1	55359	broad.mit.edu	37	12	10786662	10786662	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10786662G>A	uc001qys.2	-	4	635	c.114C>T	c.(112-114)CTC>CTT	p.L38L		NM_018423	NP_060893	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	38	Helical; (Potential).					integral to membrane|plasma membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8						CAAGAAGGATGAGGAAGATAG	0.463										HNSCC(73;0.22)			106	235	---	---	---	---	PASS
KCNJ8	3764	broad.mit.edu	37	12	21919488	21919488	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21919488C>T	uc001rff.2	-	3	782	c.444G>A	c.(442-444)ATG>ATA	p.M148I		NM_004982	NP_004973	Q15842	IRK8_HUMAN	potassium inwardly-rectifying channel J8	148	Extracellular (By similarity).					voltage-gated potassium channel complex					0					Levosimendan(DB00922)	ATTCCTCTGTCATCATCCTCC	0.418													26	47	---	---	---	---	PASS
ST8SIA1	6489	broad.mit.edu	37	12	22354968	22354968	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22354968G>C	uc001rfo.3	-	5	1071	c.589C>G	c.(589-591)CAG>GAG	p.Q197E	ST8SIA1_uc009zix.2_Missense_Mutation_p.Q54E	NM_003034	NP_003025	Q92185	SIA8A_HUMAN	alpha-2,8-sialyltransferase 1	197	Lumenal (Potential).				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(3)	3						AGAAGGTTCTGAAACCTATTG	0.378													9	56	---	---	---	---	PASS
LRMP	4033	broad.mit.edu	37	12	25259900	25259900	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25259900C>T	uc001rgh.2	+	20	2206	c.1172C>T	c.(1171-1173)TCT>TTT	p.S391F	LRMP_uc010sja.1_Missense_Mutation_p.S391F|LRMP_uc010sjb.1_Missense_Mutation_p.S338F|LRMP_uc001rgi.2_RNA|LRMP_uc010sjc.1_Missense_Mutation_p.S391F|LRMP_uc010sjd.1_Missense_Mutation_p.S338F	NM_006152	NP_006143	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein	447	Cytoplasmic (Potential).				vesicle fusion|vesicle targeting	endoplasmic reticulum membrane|integral to plasma membrane				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					TCAGAGCCATCTGGAGAAGAA	0.308													9	21	---	---	---	---	PASS
TMTC1	83857	broad.mit.edu	37	12	29670466	29670466	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29670466G>T	uc001rjb.2	-	14	2213	c.1739C>A	c.(1738-1740)CCT>CAT	p.P580H	TMTC1_uc001riz.2_Missense_Mutation_p.P337H|TMTC1_uc001rja.2_Missense_Mutation_p.P424H|TMTC1_uc001riy.2_Missense_Mutation_p.P33H	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	688	TPR 7.					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					TGCTCCCAAAGGTGACAATAT	0.468													38	150	---	---	---	---	PASS
TMTC1	83857	broad.mit.edu	37	12	29904607	29904607	+	Silent	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29904607G>T	uc001rjb.2	-	5	1080	c.606C>A	c.(604-606)TCC>TCA	p.S202S	TMTC1_uc001rjc.1_Silent_p.S202S	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	310						integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					acctcatcatggaccacacag	0.368													28	81	---	---	---	---	PASS
TMTC1	83857	broad.mit.edu	37	12	29904660	29904660	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29904660G>T	uc001rjb.2	-	5	1027	c.553C>A	c.(553-555)CCA>ACA	p.P185T	TMTC1_uc001rjc.1_Missense_Mutation_p.P185T	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	293						integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GGTTCTGGTGGCAGTGGAGAG	0.418													29	67	---	---	---	---	PASS
DENND5B	160518	broad.mit.edu	37	12	31604942	31604942	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31604942C>A	uc001rki.1	-	5	1747	c.1561G>T	c.(1561-1563)GTC>TTC	p.V521F	DENND5B_uc001rkh.1_Missense_Mutation_p.V556F|DENND5B_uc009zjq.1_Intron|DENND5B_uc001rkj.2_Missense_Mutation_p.V543F|DENND5B_uc001rkk.1_Missense_Mutation_p.V443F	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	521	dDENN.					integral to membrane				ovary(1)|central_nervous_system(1)	2						GTCTGAATGACAAATGCTTCG	0.443													43	73	---	---	---	---	PASS
KIF21A	55605	broad.mit.edu	37	12	39752079	39752079	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39752079C>G	uc001rly.2	-	8	1262	c.1116G>C	c.(1114-1116)AAG>AAC	p.K372N	KIF21A_uc001rlx.2_Missense_Mutation_p.K372N|KIF21A_uc001rlz.2_Missense_Mutation_p.K372N|KIF21A_uc010skl.1_Missense_Mutation_p.K372N|KIF21A_uc001rma.1_Missense_Mutation_p.K380N	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	372	Potential.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				TCACCTTATTCTTGATATTTC	0.423													89	226	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40618961	40618961	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40618961G>A	uc001rmg.3	+	1	149	c.28G>A	c.(28-30)GAA>AAA	p.E10K		NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	10					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TCAGGGGTGCGAAGAGGACGA	0.582													13	45	---	---	---	---	PASS
CCNT1	904	broad.mit.edu	37	12	49087619	49087619	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49087619G>C	uc001rse.1	-	9	1701	c.1378C>G	c.(1378-1380)CTC>GTC	p.L460V	LOC144438_uc001rsd.3_5'Flank|CCNT1_uc009zkz.1_Missense_Mutation_p.L175V	NM_001240	NP_001231	O60563	CCNT1_HUMAN	cyclin T1	460					cell cycle|cell division|interspecies interaction between organisms|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	DNA binding|protein kinase binding			ovary(3)|lung(1)|breast(1)|skin(1)	6						CTCATTTTGAGAGCTGTTTTG	0.443													36	92	---	---	---	---	PASS
WNT10B	7480	broad.mit.edu	37	12	49360170	49360170	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49360170C>A	uc001rss.2	-	5	1224	c.878G>T	c.(877-879)GGA>GTA	p.G293V	WNT10B_uc001rst.2_3'UTR	NM_003394	NP_003385	O00744	WN10B_HUMAN	wingless-type MMTV integration site family,	293					axis specification|bone trabecula formation|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|chondrocyte differentiation|female gonad development|hemopoietic stem cell proliferation|midbrain-hindbrain boundary development|myoblast cell differentiation involved in skeletal muscle regeneration|negative regulation of epithelial cell proliferation|negative regulation of fat cell differentiation|neuron differentiation|positive regulation of anagen|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cell proliferation|positive regulation of epithelial cell differentiation|positive regulation of osteoblast differentiation|protein stabilization|regulation of skeletal muscle tissue development|skeletal muscle fiber development|smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			skin(4)|lung(3)	7						CTGGAAGGCTCCAGAATTGCG	0.637													43	108	---	---	---	---	PASS
KRT6C	286887	broad.mit.edu	37	12	52863615	52863615	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52863615C>A	uc001sal.3	-	7	1311	c.1263G>T	c.(1261-1263)AAG>AAT	p.K421N		NM_173086	NP_775109	P48668	K2C6C_HUMAN	keratin 6C	421	Rod.|Coil 2.				cytoskeleton organization	keratin filament	structural molecule activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0828)		TCTTAGCATCCTTGAGTGCCA	0.577													18	68	---	---	---	---	PASS
KRT76	51350	broad.mit.edu	37	12	53170983	53170983	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53170983G>T	uc001sax.2	-	1	147	c.93C>A	c.(91-93)AGC>AGA	p.S31R		NM_015848	NP_056932	Q01546	K22O_HUMAN	keratin 76	31	Head.				cytoskeleton organization	keratin filament	structural molecule activity			breast(1)|skin(1)	2						GGGCCACACAGCTCATCCTGC	0.607													44	75	---	---	---	---	PASS
ITGB7	3695	broad.mit.edu	37	12	53589169	53589169	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53589169C>T	uc009zmv.2	-	8	1221	c.1150G>A	c.(1150-1152)GAT>AAT	p.D384N	ITGB7_uc001scc.2_Missense_Mutation_p.D384N|ITGB7_uc010snz.1_RNA	NM_000889	NP_000880	P26010	ITB7_HUMAN	integrin, beta 7 precursor	384	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|regulation of immune response	integrin complex	identical protein binding|metal ion binding|receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|breast(1)	8						TTATAAGCATCCATGATGAGC	0.552													21	86	---	---	---	---	PASS
AMHR2	269	broad.mit.edu	37	12	53818661	53818661	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53818661C>G	uc001scx.1	+	3	479	c.401C>G	c.(400-402)TCC>TGC	p.S134C	AMHR2_uc009zmy.1_Missense_Mutation_p.S134C	NM_020547	NP_065434	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II isoform	134	Extracellular (Potential).				Mullerian duct regression		ATP binding|hormone binding|metal ion binding			ovary(1)|skin(1)	2					Adenosine triphosphate(DB00171)	ACTCCTGGCTCCCAGGGTCCC	0.632									Persistant_Mullerian_Duct_Syndrome_(type_I_and_II)				45	136	---	---	---	---	PASS
HNRNPA1	3178	broad.mit.edu	37	12	54676268	54676268	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54676268G>C	uc001sfl.2	+	5	685	c.581G>C	c.(580-582)AGA>ACA	p.R194T	CBX5_uc001sfk.3_5'Flank|CBX5_uc001sfi.3_5'Flank|HNRNPA1_uc001sfm.2_Missense_Mutation_p.R194T|HNRNPA1_uc009zng.2_Missense_Mutation_p.R194T|HNRNPA1_uc009znh.2_Missense_Mutation_p.R194T|HNRNPA1_uc009zni.2_Missense_Mutation_p.R194T|HNRNPA1_uc001sfn.2_Missense_Mutation_p.R194T|HNRNPA1_uc001sfo.3_RNA|HNRNPA1_uc001sfp.1_Missense_Mutation_p.R149T|HNRNPA1_uc009znj.1_Missense_Mutation_p.R149T	NM_031157	NP_112420	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	194					interspecies interaction between organisms|mRNA transport|nuclear import	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|protein binding|single-stranded DNA binding			skin(2)|ovary(1)	3						TCCAGCCAAAGAGGTATGCTT	0.368													8	42	---	---	---	---	PASS
OR6C65	403282	broad.mit.edu	37	12	55794865	55794865	+	Missense_Mutation	SNP	A	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55794865A>G	uc010spl.1	+	1	553	c.553A>G	c.(553-555)ATT>GTT	p.I185V		NM_001005518	NP_001005518	A6NJZ3	O6C65_HUMAN	olfactory receptor, family 6, subfamily C,	185	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TATGCTGCTGATTGCTTGCAC	0.443													121	292	---	---	---	---	PASS
GLI1	2735	broad.mit.edu	37	12	57857555	57857555	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57857555C>A	uc001snx.2	+	2	159	c.81C>A	c.(79-81)GCC>GCA	p.A27A	GLI1_uc009zpp.2_Intron|GLI1_uc009zpq.2_Intron|GLI1_uc009zpr.1_Intron	NM_005269	NP_005260	P08151	GLI1_HUMAN	GLI family zinc finger 1 isoform 1	27					epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding			skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15			GBM - Glioblastoma multiforme(3;3.99e-32)			GTCAGGGGGCCCCCAGTGTGG	0.607													21	39	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70981033	70981033	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70981033G>T	uc001swb.3	-	7	1441	c.1411C>A	c.(1411-1413)CTC>ATC	p.L471I	PTPRB_uc010sto.1_Missense_Mutation_p.L471I|PTPRB_uc010stp.1_Missense_Mutation_p.L381I|PTPRB_uc001swc.3_Missense_Mutation_p.L689I|PTPRB_uc001swa.3_Missense_Mutation_p.L689I|PTPRB_uc001swd.3_Missense_Mutation_p.L688I|PTPRB_uc009zrr.1_Missense_Mutation_p.L568I	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	471	Fibronectin type-III 6.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CGAAGCTGGAGGACAGCCAGG	0.468													12	58	---	---	---	---	PASS
TPH2	121278	broad.mit.edu	37	12	72425478	72425478	+	3'UTR	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72425478C>A	uc009zrw.1	+	11					TPH2_uc001swy.2_3'UTR	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2						aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity			ovary(2)|central_nervous_system(1)|skin(1)	4					L-Tryptophan(DB00150)	GGATTTGATGCCTGGAACTAT	0.423													43	83	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78362332	78362332	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78362332G>A	uc001syp.2	+	5	694	c.521G>A	c.(520-522)GGG>GAG	p.G174E	NAV3_uc001syo.2_Missense_Mutation_p.G174E	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	174	CH.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						GCCATTCTAGGGCTGTTTTTC	0.348										HNSCC(70;0.22)			24	73	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80658975	80658975	+	IGR	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80658975C>G								PPP1R12A (329740 upstream) : PTPRQ (179151 downstream)																							TTTCAGAACTCAGATTTCTTT	0.438													3	35	---	---	---	---	PASS
MYF6	4618	broad.mit.edu	37	12	81101810	81101810	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81101810G>A	uc001szf.1	+	1	365	c.312G>A	c.(310-312)AGG>AGA	p.R104R		NM_002469	NP_002460	P23409	MYF6_HUMAN	myogenic factor 6	104	Basic motif.				muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						GCGAAAGGAGGAGGCTAAAGA	0.607													30	67	---	---	---	---	PASS
RASSF9	9182	broad.mit.edu	37	12	86199572	86199572	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86199572C>T	uc001taf.1	-	2	555	c.216G>A	c.(214-216)GGG>GGA	p.G72G		NM_005447	NP_005438	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family	72	Ras-associating.				endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity			ovary(1)	1						CACTGGGCTTCCCCAGAAGAA	0.498													32	199	---	---	---	---	PASS
TMCC3	57458	broad.mit.edu	37	12	94965215	94965215	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94965215C>G	uc001tdj.2	-	4	1548	c.1430G>C	c.(1429-1431)AGA>ACA	p.R477T	TMCC3_uc001tdi.2_Missense_Mutation_p.R446T	NM_020698	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	477						integral to membrane				ovary(1)|skin(1)	2						GTGGCTTCATCTTGGTATTAT	0.388													20	63	---	---	---	---	PASS
VEZT	55591	broad.mit.edu	37	12	95611648	95611648	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95611648G>C	uc001tdz.2	+	1	127	c.22G>C	c.(22-24)GAG>CAG	p.E8Q	FGD6_uc001tdp.3_5'Flank|FGD6_uc009zsx.2_5'Flank|VEZT_uc009zsy.1_5'UTR|VEZT_uc001tdr.2_5'UTR|VEZT_uc001tds.2_5'UTR|VEZT_uc001tdt.2_5'UTR|VEZT_uc009zsz.1_Missense_Mutation_p.E8Q|VEZT_uc001tdv.2_5'UTR|VEZT_uc001tdw.1_5'Flank	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane	8						acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						GTTTGACGAAGAGGTGGTTTT	0.582													33	79	---	---	---	---	PASS
SNRPF	6636	broad.mit.edu	37	12	96259141	96259141	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96259141G>A	uc001tej.2	+	3	312	c.169G>A	c.(169-171)GGA>AGA	p.G57R		NM_003095	NP_003086	P62306	RUXF_HUMAN	small nuclear ribonucleoprotein polypeptide F	57					histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	protein binding|RNA binding				0						AGCTTTGTCTGGACATCTGGG	0.328													41	115	---	---	---	---	PASS
NR1H4	9971	broad.mit.edu	37	12	100934608	100934608	+	Intron	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100934608G>T	uc001tht.1	+						NR1H4_uc001thp.1_Intron|NR1H4_uc001thq.1_Intron|NR1H4_uc010svj.1_Intron|NR1H4_uc001thr.1_Intron|NR1H4_uc010svk.1_Intron|NR1H4_uc001ths.1_Intron	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4						bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						TAAGTGATTTGGCTAATGGTA	0.249													19	54	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101436227	101436227	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101436227C>G	uc010svm.1	+	12	1707	c.1135C>G	c.(1135-1137)CTG>GTG	p.L379V	ANO4_uc001thw.2_Missense_Mutation_p.L344V|ANO4_uc001thx.2_Missense_Mutation_p.L379V	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	379	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						CGTCACCACTCTGGATCACAG	0.483										HNSCC(74;0.22)			28	98	---	---	---	---	PASS
KIAA1033	23325	broad.mit.edu	37	12	105543464	105543464	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105543464C>G	uc001tld.2	+	25	2673	c.2586C>G	c.(2584-2586)ATC>ATG	p.I862M	KIAA1033_uc010swr.1_Missense_Mutation_p.I863M|KIAA1033_uc010sws.1_Missense_Mutation_p.I674M	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	862					endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						ATGAACACATCAAATCCAGAT	0.254													60	156	---	---	---	---	PASS
RIC8B	55188	broad.mit.edu	37	12	107279770	107279770	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107279770G>C	uc001tlx.2	+	9	1665	c.1540G>C	c.(1540-1542)GAG>CAG	p.E514Q	RIC8B_uc001tly.2_3'UTR|RIC8B_uc001tlz.2_RNA|RIC8B_uc009zur.2_RNA	NM_018157	NP_060627	Q9NVN3	RIC8B_HUMAN	resistance to inhibitors of cholinesterase 8	514					regulation of G-protein coupled receptor protein signaling pathway	cell cortex|cytosol|plasma membrane	G-protein alpha-subunit binding|guanyl-nucleotide exchange factor activity			ovary(1)	1						TGTCATCGAAGAGACCAGCTC	0.433													31	142	---	---	---	---	PASS
FOXN4	121643	broad.mit.edu	37	12	109724503	109724503	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109724503G>A	uc001toe.3	-	7	748	c.643C>T	c.(643-645)CCT>TCT	p.P215S	FOXN4_uc009zvg.2_Missense_Mutation_p.P12S|FOXN4_uc001tof.3_Missense_Mutation_p.P35S	NM_213596	NP_998761	Q96NZ1	FOXN4_HUMAN	forkhead box N4	215	Fork-head.				axon extension|embryo development|organ development|pattern specification process|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|lung(1)	2						TCGCTCACAGGCAGGCTGCCT	0.483													7	22	---	---	---	---	PASS
TCTN1	79600	broad.mit.edu	37	12	111066671	111066671	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111066671C>T	uc009zvs.2	+	4	680	c.572C>T	c.(571-573)TCA>TTA	p.S191L	TCTN1_uc010syb.1_Missense_Mutation_p.S191L|TCTN1_uc009zvr.1_RNA|TCTN1_uc001trl.2_RNA|TCTN1_uc001trm.2_Missense_Mutation_p.S131L|TCTN1_uc010syc.1_RNA|TCTN1_uc001tro.2_RNA|TCTN1_uc001trp.3_Missense_Mutation_p.S191L|TCTN1_uc001trn.3_Missense_Mutation_p.S191L|TCTN1_uc001tri.2_Missense_Mutation_p.S135L|TCTN1_uc001trj.1_Missense_Mutation_p.S135L|TCTN1_uc001trk.3_RNA|HVCN1_uc001trq.1_Intron	NM_001082537	NP_001076006	Q2MV58	TECT1_HUMAN	tectonic family member 1 isoform 2	191					multicellular organismal development	extracellular region					0						AATGCTGAATCATATGTTTCC	0.333													28	52	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112617177	112617177	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112617177C>G	uc009zwc.2	-	56	9764	c.9746G>C	c.(9745-9747)AGA>ACA	p.R3249T		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						CAGAACCTCTCTGGCTCCGGG	0.537													7	19	---	---	---	---	PASS
RPH3A	22895	broad.mit.edu	37	12	113325651	113325651	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113325651G>A	uc010syl.1	+	17	1848	c.1486G>A	c.(1486-1488)GAG>AAG	p.E496K	RPH3A_uc001ttz.2_Missense_Mutation_p.E496K|RPH3A_uc001tty.2_Missense_Mutation_p.E492K|RPH3A_uc009zwe.1_Missense_Mutation_p.E492K|RPH3A_uc010sym.1_Missense_Mutation_p.E447K|RPH3A_uc001tua.2_Missense_Mutation_p.E256K	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 1	496	C2 1.				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)		ATTTATTGGTGAGACCAGATT	0.458													31	223	---	---	---	---	PASS
DDX54	79039	broad.mit.edu	37	12	113617062	113617062	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113617062G>T	uc001tup.2	-	4	478	c.450C>A	c.(448-450)TTC>TTA	p.F150L	DDX54_uc001tuq.3_Missense_Mutation_p.F150L	NM_024072	NP_076977	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	150	Helicase ATP-binding.				estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	nucleolus	ATP binding|ATP-dependent RNA helicase activity|estrogen receptor binding|RNA binding|transcription corepressor activity			skin(2)|central_nervous_system(1)	3						TTGGGAGGAGGAAGCAGGCTG	0.657													12	32	---	---	---	---	PASS
SLC24A6	80024	broad.mit.edu	37	12	113770684	113770684	+	5'UTR	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113770684C>G	uc001tvc.2	-	2					SLC24A6_uc001tvd.1_5'UTR	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN	solute carrier family 24 member 6 precursor						response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1						TGCCGGCCATCTGCCCCCACG	0.612													25	67	---	---	---	---	PASS
TBX3	6926	broad.mit.edu	37	12	115110029	115110029	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115110029C>T	uc001tvt.1	-	8	2813	c.1849G>A	c.(1849-1851)GCG>ACG	p.A617T	TBX3_uc001tvu.1_Missense_Mutation_p.A597T	NM_016569	NP_057653	O15119	TBX3_HUMAN	T-box 3 protein isoform 2	617	Transcription repression.			SAAASSSVHRHPF -> LRQPQLRCTAPL (in Ref. 1).	anterior/posterior axis specification, embryo|anti-apoptosis|cell aging|embryonic arm morphogenesis|embryonic digit morphogenesis|female genitalia development|follicle-stimulating hormone secretion|luteinizing hormone secretion|male genitalia development|mesoderm morphogenesis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter|skeletal system development	nucleus	sequence-specific DNA binding			ovary(2)|skin(1)	3	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		GAGGCTGCCGCAGAGGAGGCG	0.667													5	7	---	---	---	---	PASS
PXN	5829	broad.mit.edu	37	12	120660757	120660757	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120660757C>T	uc001txt.2	-	4	533	c.402G>A	c.(400-402)ATG>ATA	p.M134I	PXN_uc001txv.2_Missense_Mutation_p.M1I|PXN_uc001txx.2_Missense_Mutation_p.M1I|PXN_uc001txy.2_Missense_Mutation_p.M134I|PXN_uc001txz.2_RNA|uc001tya.2_5'Flank	NM_001080855	NP_001074324	P49023	PAXI_HUMAN	paxillin isoform 1	134					cell junction assembly|cell-matrix adhesion|cellular response to reactive oxygen species|epidermal growth factor receptor signaling pathway|growth hormone receptor signaling pathway|muscle contraction|signal complex assembly	cytoplasm|focal adhesion|lamellipodium|microtubule associated complex	beta-catenin binding|vinculin binding|zinc ion binding			ovary(1)|breast(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGGACGTGCTCATTACGGTGG	0.547													21	70	---	---	---	---	PASS
ZCCHC8	55596	broad.mit.edu	37	12	122958049	122958049	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122958049C>G	uc001ucn.2	-	14	2250	c.2119G>C	c.(2119-2121)GAA>CAA	p.E707Q	ZCCHC8_uc001ucl.2_Missense_Mutation_p.E318Q|ZCCHC8_uc001ucm.2_Missense_Mutation_p.E469Q|ZCCHC8_uc009zxp.2_Missense_Mutation_p.E469Q|ZCCHC8_uc009zxq.2_Missense_Mutation_p.E469Q	NM_017612	NP_060082	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	707						catalytic step 2 spliceosome	nucleic acid binding|protein binding|zinc ion binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		AGCCATTATTCAGAGGCCTTT	0.368													13	54	---	---	---	---	PASS
MPHOSPH9	10198	broad.mit.edu	37	12	123687559	123687559	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123687559G>A	uc001uel.2	-	6	1044	c.937C>T	c.(937-939)CCG>TCG	p.P313S	MPHOSPH9_uc010tal.1_Intron|MPHOSPH9_uc010tam.1_RNA|MPHOSPH9_uc001uem.2_Intron	NM_022782	NP_073619	Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	313					M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		AGGGCATTCGGAAGGCCGTGA	0.458													75	169	---	---	---	---	PASS
N4BP2L1	90634	broad.mit.edu	37	13	33002142	33002142	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33002142G>A	uc001uuc.2	-	1	174	c.78C>T	c.(76-78)CCC>CCT	p.P26P	N4BP2L1_uc001uud.2_Silent_p.P26P|N4BP2L1_uc010tdy.1_Silent_p.P26P|N4BP2L1_uc001uuf.2_Silent_p.P26P	NM_052818	NP_438169	Q5TBK1	N42L1_HUMAN	NEDD4 binding protein 2-like 1 isoform 1	26					cell killing		ATP binding			ovary(1)	1		Lung SC(185;0.0262)		all cancers(112;6.3e-06)|Epithelial(112;3.51e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00607)|BRCA - Breast invasive adenocarcinoma(63;0.0171)		ggggcggccggggcggccgct	0.468													5	6	---	---	---	---	PASS
MAB21L1	4081	broad.mit.edu	37	13	36049686	36049686	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36049686G>T	uc001uvc.2	-	1	1147	c.590C>A	c.(589-591)CCC>CAC	p.P197H	NBEA_uc001uvb.2_Intron|NBEA_uc010abi.2_Intron|NBEA_uc010tee.1_Intron|NBEA_uc010tef.1_5'Flank|NBEA_uc010teg.1_5'Flank	NM_005584	NP_005575	Q13394	MB211_HUMAN	mab-21-like protein 1	197					anatomical structure morphogenesis	nucleus				ovary(2)	2		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		CACCCGGTTGGGTCCCGGCCA	0.642													28	47	---	---	---	---	PASS
DCLK1	9201	broad.mit.edu	37	13	36443235	36443235	+	Intron	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36443235C>A	uc001uvf.2	-						uc001uvi.1_Intron	NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		gGCCTATAGCCCAGATTTAAT	0.219													7	12	---	---	---	---	PASS
LRCH1	23143	broad.mit.edu	37	13	47127780	47127780	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47127780G>C	uc001vbj.2	+	1	485	c.249G>C	c.(247-249)TTG>TTC	p.L83F	LRCH1_uc010acp.2_Missense_Mutation_p.L83F|LRCH1_uc001vbk.2_Missense_Mutation_p.L83F|LRCH1_uc001vbl.3_Missense_Mutation_p.L83F	NM_015116	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH)	83										ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		CCAGGAAATTGAAGGAATTTC	0.692													5	8	---	---	---	---	PASS
TDRD3	81550	broad.mit.edu	37	13	61068714	61068714	+	Intron	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61068714G>T	uc001via.2	+						TDRD3_uc010aef.2_Intron|TDRD3_uc001vhz.3_Intron|TDRD3_uc010aeg.2_Intron|TDRD3_uc001vib.3_Intron	NM_030794	NP_110421	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3 isoform 2						chromatin modification	cytoplasm|nucleus	chromatin binding|methylated histone residue binding|nucleic acid binding|transcription coactivator activity			upper_aerodigestive_tract(1)|skin(1)	2		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		GAACTGGTAAGGCTAAAGAAC	0.343													29	22	---	---	---	---	PASS
OR4K14	122740	broad.mit.edu	37	14	20482684	20482684	+	Silent	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20482684G>T	uc010tky.1	-	1	669	c.669C>A	c.(667-669)CTC>CTA	p.L223L		NM_001004712	NP_001004712	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K,	223	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		TGATAGCGAGGAGGATCACGG	0.498													11	39	---	---	---	---	PASS
JPH4	84502	broad.mit.edu	37	14	24040504	24040504	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24040504G>A	uc001wkq.2	-	6	2354	c.1436C>T	c.(1435-1437)CCA>CTA	p.P479L	JPH4_uc010tnr.1_Missense_Mutation_p.P144L|JPH4_uc001wkr.2_Missense_Mutation_p.P479L	NM_032452	NP_115828	Q96JJ6	JPH4_HUMAN	junctophilin 4	479	Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane				ovary(1)|pancreas(1)	2	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		AGGAGGCAGTGGGCTCCGGCA	0.667													28	73	---	---	---	---	PASS
MDP1	145553	broad.mit.edu	37	14	24683361	24683361	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24683361G>A	uc001wnl.1	-						TM9SF1_uc010tob.1_5'Flank|CHMP4A_uc001wni.2_5'Flank|CHMP4A_uc010toc.1_5'Flank|CHMP4A_uc001wnj.2_Intron|MDP1_uc001wnk.1_3'UTR|CHMP4A_uc001wnm.1_Intron	NM_138476	NP_612485	Q86V88	MGDP1_HUMAN	magnesium-dependent phosphatase 1								metal ion binding|protein tyrosine phosphatase activity				0						GTAACACCTAGAAAGATAAGA	0.423													42	96	---	---	---	---	PASS
TGM1	7051	broad.mit.edu	37	14	24724586	24724586	+	Silent	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24724586G>C	uc001wod.2	-	11	1753	c.1629C>G	c.(1627-1629)CTC>CTG	p.L543L	TGM1_uc010tog.1_Silent_p.L101L	NM_000359	NP_000350	P22735	TGM1_HUMAN	transglutaminase 1	543					cell envelope organization|keratinization|peptide cross-linking	cornified envelope|intrinsic to membrane	acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GGTGCTTATAGAGGTAGGTGA	0.542													16	31	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	33293734	33293734	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33293734G>T	uc001wrq.2	+	13	6885	c.6715G>T	c.(6715-6717)GCA>TCA	p.A2239S		NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	2239					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CAGTGGCTGTGCAGAAAACTT	0.448													13	53	---	---	---	---	PASS
PAX9	5083	broad.mit.edu	37	14	37132112	37132112	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37132112C>T	uc001wty.3	+	3	732	c.15C>T	c.(13-15)TTC>TTT	p.F5F		NM_006194	NP_006185	P55771	PAX9_HUMAN	paired box 9	5	Paired.				multicellular organismal development|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.218)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.00998)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0181)		AGCCAGCCTTCGGGGAGGTGA	0.662													32	76	---	---	---	---	PASS
MIPOL1	145282	broad.mit.edu	37	14	37717107	37717107	+	Nonsense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37717107C>G	uc001wuc.2	+	4	517	c.14C>G	c.(13-15)TCA>TGA	p.S5*	MIPOL1_uc010amr.2_RNA|MIPOL1_uc001wub.3_5'UTR|MIPOL1_uc001wud.2_Nonsense_Mutation_p.S5*|MIPOL1_uc010ams.2_Nonsense_Mutation_p.S5*|MIPOL1_uc001wue.2_5'UTR|MIPOL1_uc010amt.2_Intron	NM_138731	NP_620059	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1	5										ovary(1)|central_nervous_system(1)	2	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		GAGAACTGGTCAAAAGGTAAG	0.373													14	37	---	---	---	---	PASS
KLHL28	54813	broad.mit.edu	37	14	45414864	45414864	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45414864C>A	uc001wvq.2	-	2	514	c.268G>T	c.(268-270)GTG>TTG	p.V90L	KLHL28_uc001wvr.2_Missense_Mutation_p.V90L|KLHL28_uc001wvt.3_Missense_Mutation_p.V90L	NM_017658	NP_060128	Q9NXS3	KLH28_HUMAN	BTB (POZ) domain containing 5	90	BTB.									ovary(1)	1						GCATACTCCACAATGGCCTGG	0.428													25	56	---	---	---	---	PASS
KTN1	3895	broad.mit.edu	37	14	56138564	56138564	+	Missense_Mutation	SNP	A	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56138564A>C	uc001xcb.2	+	38	3802	c.3500A>C	c.(3499-3501)AAG>ACG	p.K1167T	KTN1_uc001xce.2_Missense_Mutation_p.K1138T|KTN1_uc001xcc.2_Missense_Mutation_p.K1167T|KTN1_uc001xcd.2_Missense_Mutation_p.K1144T|KTN1_uc010trb.1_Missense_Mutation_p.K1167T|KTN1_uc001xcf.1_Missense_Mutation_p.K1144T|KTN1_uc010aoq.2_Missense_Mutation_p.K433T|KTN1_uc010trc.1_Missense_Mutation_p.K172T|KTN1_uc001xcg.2_Missense_Mutation_p.K128T	NM_182926	NP_891556	Q86UP2	KTN1_HUMAN	kinectin 1 isoform a	1167	Lumenal (Potential).|Potential.				microtubule-based movement	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction				breast(3)|ovary(2)|lung(1)|central_nervous_system(1)	7						TGGAAAGTTAAGGTCGATGAA	0.249			T	RET	papillary thryoid								24	69	---	---	---	---	PASS
KIAA0586	9786	broad.mit.edu	37	14	58915116	58915116	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58915116C>T	uc001xdv.3	+	7	1139	c.866C>T	c.(865-867)TCC>TTC	p.S289F	KIAA0586_uc010trr.1_Missense_Mutation_p.S330F|KIAA0586_uc001xdt.3_Missense_Mutation_p.S245F|KIAA0586_uc001xdu.3_Missense_Mutation_p.S274F|KIAA0586_uc010trs.1_Missense_Mutation_p.S204F|KIAA0586_uc010trt.1_Missense_Mutation_p.S149F|KIAA0586_uc010tru.1_Missense_Mutation_p.S149F	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN	talpid3 protein	289										ovary(1)	1						AGTATGCCCTCCTCCAGAGCA	0.338													43	101	---	---	---	---	PASS
PPM1A	5494	broad.mit.edu	37	14	60749451	60749451	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60749451G>A	uc010apn.2	+	3	432	c.30G>A	c.(28-30)ATG>ATA	p.M10I	PPM1A_uc001xew.3_Missense_Mutation_p.M83I|PPM1A_uc001xex.3_Missense_Mutation_p.M10I|PPM1A_uc001xey.3_Missense_Mutation_p.M10I	NM_021003	NP_066283	P35813	PPM1A_HUMAN	protein phosphatase 1A isoform 1	10					cell cycle arrest|insulin receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway|protein dephosphorylation|Wnt receptor signaling pathway	cytosol|nucleus|protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein serine/threonine phosphatase activity|signal transducer activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.046)		AGCCAAAGATGGAAAAGCATA	0.443													76	171	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64444689	64444689	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64444689C>T	uc001xgm.2	+	13	1590	c.1360C>T	c.(1360-1362)CAC>TAC	p.H454Y	SYNE2_uc001xgl.2_Missense_Mutation_p.H454Y	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	454	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GGATGAAAATCACTTGCCATT	0.378													18	46	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64676674	64676674	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64676674G>C	uc001xgm.2	+	103	18785	c.18555G>C	c.(18553-18555)CAG>CAC	p.Q6185H	SYNE2_uc001xgl.2_Missense_Mutation_p.Q6185H|SYNE2_uc010apy.2_Missense_Mutation_p.Q2570H|SYNE2_uc001xgn.2_Missense_Mutation_p.Q1147H|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_Missense_Mutation_p.Q155H|SYNE2_uc001xgq.2_Missense_Mutation_p.Q550H|SYNE2_uc001xgr.2_5'UTR	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6185	Spectrin 7.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTCAGCGGCAGATTCATGAGC	0.617													29	60	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71413810	71413810	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71413810C>A	uc001xmo.2	+	2	778	c.332C>A	c.(331-333)TCA>TAA	p.S111*	PCNX_uc001xmn.3_Nonsense_Mutation_p.S111*|PCNX_uc010are.1_Nonsense_Mutation_p.S111*	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	111						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GGCAACTGTTCAACCAGGAGA	0.403													12	22	---	---	---	---	PASS
JDP2	122953	broad.mit.edu	37	14	75936092	75936092	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75936092C>T	uc010asj.2	+	4	473	c.406C>T	c.(406-408)CGC>TGC	p.R136C	JDP2_uc010tvb.1_Missense_Mutation_p.R136C|JDP2_uc010tvc.1_Missense_Mutation_p.R136C|JDP2_uc001xrq.2_Missense_Mutation_p.R147C	NM_001135047	NP_001128519	Q8WYK2	JDP2_HUMAN	Jun dimerization protein 2 isoform a	136						nucleus	sequence-specific DNA binding				0				BRCA - Breast invasive adenocarcinoma(234;0.0296)		GAACCGACACCGCCCCACCTG	0.592													15	52	---	---	---	---	PASS
SNORD114-2	767578	broad.mit.edu	37	14	101416223	101416223	+	5'Flank	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101416223C>G	uc001yis.2	+						SNORD114-1_uc001yir.2_RNA	NR_003194				Homo sapiens small nucleolar RNA, C/D box 114-2 (SNORD114-2), non-coding RNA.												0						GAATACAGGTCTGGAAGTCTG	0.383													9	49	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102478379	102478379	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102478379C>T	uc001yks.2	+	33	6950	c.6786C>T	c.(6784-6786)GAC>GAT	p.D2262D		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	2262	AAA 2 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						TCAGCAAAGACCACCTCTACG	0.547													14	61	---	---	---	---	PASS
EIF5	1983	broad.mit.edu	37	14	103804282	103804282	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103804282G>A	uc001ymq.2	+						EIF5_uc001ymr.2_Intron|EIF5_uc001yms.2_Intron|EIF5_uc001ymt.2_Intron|EIF5_uc001ymu.2_Intron|SNORA28_uc001ymv.1_RNA	NM_001969	NP_001960	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5						regulation of translational initiation|RNA metabolic process	cytosol	GTP binding|GTPase activity|translation initiation factor activity			pancreas(1)|breast(1)|skin(1)	3		Melanoma(154;0.155)	Epithelial(46;0.182)			TCTCTCCCATGAGACAAGCCG	0.438													13	56	---	---	---	---	PASS
PPP1R13B	23368	broad.mit.edu	37	14	104208264	104208264	+	Nonsense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104208264G>C	uc001yof.1	-	11	1968	c.1685C>G	c.(1684-1686)TCA>TGA	p.S562*	PPP1R13B_uc010awv.1_RNA|PPP1R13B_uc001yog.1_Nonsense_Mutation_p.S429*	NM_015316	NP_056131	Q96KQ4	ASPP1_HUMAN	apoptosis-stimulating protein of p53, 1	562	Pro-rich.				apoptosis|induction of apoptosis|negative regulation of cell cycle	cytoplasm|nucleus|plasma membrane	protein binding			ovary(1)	1		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				CTGTGGCCTTGACCCTTTATC	0.552													54	97	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107035121	107035121	+	RNA	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107035121G>C	uc010tyt.1	-	153		c.7193C>G			uc001ysz.2_Silent_p.L14L					Parts of antibodies, mostly variable regions.												0						ACTGACCTTGGAGAACAGCCA	0.582													4	31	---	---	---	---	PASS
MKRN3	7681	broad.mit.edu	37	15	23811409	23811409	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23811409C>A	uc001ywh.3	+	1	956	c.480C>A	c.(478-480)CCC>CCA	p.P160P	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Silent_p.P160P	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	160						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		CGGAAGCCCCCCCGGCTGCAT	0.647													16	32	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	26825604	26825604	+	Splice_Site	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26825604C>T	uc001zaz.2	-	6	687	c.545_splice	c.e6-1	p.Y182_splice	GABRB3_uc010uae.1_Splice_Site_p.Y97_splice|GABRB3_uc001zba.2_Splice_Site_p.Y182_splice|GABRB3_uc001zbb.2_Splice_Site_p.Y238_splice	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	GTGTAGCCATCTGCCAAGAGA	0.493													32	44	---	---	---	---	PASS
GABRG3	2567	broad.mit.edu	37	15	27772743	27772743	+	Nonsense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27772743A>T	uc001zbg.1	+	8	1196	c.1030A>T	c.(1030-1032)AGA>TGA	p.R344*		NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma	344	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		TTCCAGCTGTAGAAAACCAAC	0.517													9	15	---	---	---	---	PASS
CAPN3	825	broad.mit.edu	37	15	42681211	42681211	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42681211G>A	uc001zpn.1	+	5	1024	c.718G>A	c.(718-720)GAG>AAG	p.E240K	CAPN3_uc001zpk.1_Missense_Mutation_p.E13K|CAPN3_uc001zpl.1_Missense_Mutation_p.E153K|CAPN3_uc010udf.1_Missense_Mutation_p.E153K|CAPN3_uc010udg.1_Missense_Mutation_p.E153K|CAPN3_uc001zpo.1_Missense_Mutation_p.E240K|CAPN3_uc001zpp.1_Missense_Mutation_p.E240K	NM_000070	NP_000061	P20807	CAN3_HUMAN	calpain 3 isoform a	240	Calpain catalytic.				muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity			central_nervous_system(1)	1		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		AGAGTTTTTTGAGATCAGGGA	0.522													61	69	---	---	---	---	PASS
UBR1	197131	broad.mit.edu	37	15	43258489	43258489	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43258489G>A	uc001zqq.2	-							NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		ATGGAGCTAGGAGACAATAAT	0.388													8	34	---	---	---	---	PASS
UBR1	197131	broad.mit.edu	37	15	43262764	43262764	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43262764G>A	uc001zqq.2	-	40	4477	c.4411C>T	c.(4411-4413)CAT>TAT	p.H1471Y		NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	1471					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		GATGCGGAATGAGCCTCTTCA	0.358													33	123	---	---	---	---	PASS
UBR1	197131	broad.mit.edu	37	15	43262791	43262791	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43262791G>C	uc001zqq.2	-	40	4450	c.4384C>G	c.(4384-4386)CAG>GAG	p.Q1462E		NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	1462					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		TCTTGAACCTGAGCAAGGGGT	0.353													28	101	---	---	---	---	PASS
UBR1	197131	broad.mit.edu	37	15	43313514	43313514	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43313514G>A	uc001zqq.2	-	27	2965	c.2899C>T	c.(2899-2901)CAG>TAG	p.Q967*	UBR1_uc010udk.1_Nonsense_Mutation_p.Q967*	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	967					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		CCTTCTAACTGGGGAATTCCT	0.313													70	70	---	---	---	---	PASS
KIAA1370	56204	broad.mit.edu	37	15	52901085	52901085	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52901085C>G	uc002acg.3	-	6	2179	c.2026G>C	c.(2026-2028)GAT>CAT	p.D676H	KIAA1370_uc002ach.3_RNA|KIAA1370_uc010bfg.1_Missense_Mutation_p.D588H|KIAA1370_uc010ugf.1_Missense_Mutation_p.D683H	NM_019600	NP_062546	Q32MH5	K1370_HUMAN	hypothetical protein LOC56204	676											0				all cancers(107;0.0803)		TTGGAATCATCAGACTGAAGA	0.274													10	50	---	---	---	---	PASS
MNS1	55329	broad.mit.edu	37	15	56748594	56748594	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56748594G>T	uc002adr.2	-	3	516	c.351C>A	c.(349-351)AAC>AAA	p.N117K	MNS1_uc010bfo.2_Intron	NM_018365	NP_060835	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1	117	Potential.|Glu-rich.				meiosis					ovary(1)	1				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)		CAAGATACCTGTTTTCTCTTA	0.323													11	44	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	64010802	64010802	+	Nonsense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64010802G>A	uc002amp.2	-	21	4097	c.3949C>T	c.(3949-3951)CAA>TAA	p.Q1317*	HERC1_uc010uil.1_Intron	NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	1317					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						GACCTTGTTTGAATAAGTTCA	0.358													5	12	---	---	---	---	PASS
RBPMS2	348093	broad.mit.edu	37	15	65042584	65042584	+	Intron	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65042584C>A	uc002anq.2	-							NM_194272	NP_919248	Q6ZRY4	RBPS2_HUMAN	RNA binding protein with multiple splicing 2								nucleic acid binding|nucleotide binding				0						CATACCCCTGCGGAGAGAGGT	0.567													36	145	---	---	---	---	PASS
SPG21	51324	broad.mit.edu	37	15	65273231	65273231	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65273231G>C	uc002aod.2	-	3	289	c.196C>G	c.(196-198)CTG>GTG	p.L66V	SPG21_uc002aoe.2_Missense_Mutation_p.L66V|SPG21_uc010bhb.2_Missense_Mutation_p.L66V|SPG21_uc010bhc.2_5'UTR	NM_001127889	NP_001121361	Q9NZD8	SPG21_HUMAN	spastic paraplegia 21 isoform a	66					cell death	cytosol|endosome membrane|trans-Golgi network transport vesicle	CD4 receptor binding				0						CATCCAGTCAGAGCCAAAATC	0.463													15	49	---	---	---	---	PASS
ISL2	64843	broad.mit.edu	37	15	76633489	76633489	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76633489G>A	uc002bbw.1	+	5	888	c.810G>A	c.(808-810)CTG>CTA	p.L270L		NM_145805	NP_665804	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2	270						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TTCAGGGACTGACTGGGACGC	0.647													21	19	---	---	---	---	PASS
IL16	3603	broad.mit.edu	37	15	81585375	81585375	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81585375C>T	uc002bgh.3	+	12	2275	c.1899C>T	c.(1897-1899)GGC>GGT	p.G633G	IL16_uc002bgc.2_RNA|IL16_uc010blq.1_Intron|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Silent_p.G675G|IL16_uc002bgg.2_Silent_p.G633G|IL16_uc002bgi.1_5'UTR|IL16_uc002bgj.2_Silent_p.G127G|IL16_uc002bgk.2_5'Flank	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2	633					immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						CCACCTGTGGCCAGGTAAGAG	0.498													7	46	---	---	---	---	PASS
C15orf40	123207	broad.mit.edu	37	15	83679055	83679055	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83679055C>T	uc010uoo.1	-	2	206	c.172G>A	c.(172-174)GAT>AAT	p.D58N	C15orf40_uc010uon.1_Missense_Mutation_p.D58N|C15orf40_uc002bjm.2_Missense_Mutation_p.D58N|C15orf40_uc010uop.1_Missense_Mutation_p.D58N|C15orf40_uc010uoq.1_RNA|C15orf40_uc010uor.1_Missense_Mutation_p.D58N	NM_001160115	NP_001153587	Q8WUR7	CO040_HUMAN	hypothetical protein LOC123207 isoform d	31										skin(1)	1						CCTTTAGGATCAACTGCCACA	0.463													25	148	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84558983	84558983	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84558983G>C	uc002bjz.3	+	11	1419	c.1195G>C	c.(1195-1197)GAT>CAT	p.D399H	ADAMTSL3_uc010bmt.1_Missense_Mutation_p.D399H|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.D399H	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	399						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			ATGCAGCATGGATCCCTGCCC	0.413													15	56	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84611357	84611357	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84611357G>A	uc002bjz.3	+	18	2351	c.2127G>A	c.(2125-2127)GTG>GTA	p.V709V	ADAMTSL3_uc010bmt.1_Silent_p.V709V|ADAMTSL3_uc010bmu.1_Silent_p.V709V	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	709	TSP type-1 5.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGTGGCATGTGGGCTCTTGGG	0.547													11	87	---	---	---	---	PASS
ANPEP	290	broad.mit.edu	37	15	90334279	90334279	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90334279G>T	uc002bop.3	-	19	2866	c.2574C>A	c.(2572-2574)GAC>GAA	p.D858E		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	858	Extracellular.|Metalloprotease.				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	TAGAGGTGGCGTCCTGCTTCC	0.512													22	96	---	---	---	---	PASS
CASKIN1	57524	broad.mit.edu	37	16	2233646	2233646	+	Splice_Site	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2233646C>A	uc010bsg.1	-	16	1661	c.1629_splice	c.e16+1	p.P543_splice		NM_020764	NP_065815	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1						signal transduction	cytoplasm				skin(2)	2						GGTGGCCTTACGGGTTTGTGC	0.577													18	22	---	---	---	---	PASS
VWA3A	146177	broad.mit.edu	37	16	22143039	22143039	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22143039G>T	uc010vbq.1	+	19	1957	c.1861G>T	c.(1861-1863)GAC>TAC	p.D621Y	VWA3A_uc010bxd.2_RNA|VWA3A_uc010bxc.2_Missense_Mutation_p.D629Y	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	621	VWFA 1.					extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		GGGCATCCCCGACCAGGACAT	0.562													16	16	---	---	---	---	PASS
VWA3A	146177	broad.mit.edu	37	16	22143053	22143053	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22143053G>A	uc010vbq.1	+						VWA3A_uc010bxd.2_Intron|VWA3A_uc010bxc.2_Intron	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A							extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		AGGACATGGTGGGTAGGCCAC	0.537													14	19	---	---	---	---	PASS
ATXN2L	11273	broad.mit.edu	37	16	28844802	28844802	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28844802C>G	uc002drc.2	+	15	2166	c.1998C>G	c.(1996-1998)TTC>TTG	p.F666L	uc010vct.1_Intron|ATXN2L_uc002drb.2_Missense_Mutation_p.F666L|ATXN2L_uc002dqy.2_Missense_Mutation_p.F666L|ATXN2L_uc002dra.2_Missense_Mutation_p.F666L|ATXN2L_uc002dqz.2_Missense_Mutation_p.F666L|ATXN2L_uc010vdb.1_Missense_Mutation_p.F672L|ATXN2L_uc002dre.2_Missense_Mutation_p.F666L|ATXN2L_uc002drf.2_Missense_Mutation_p.F75L|ATXN2L_uc002drg.2_5'Flank	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	666						membrane				upper_aerodigestive_tract(1)|ovary(1)	2						CTAAGGAGTTCAATCCTACAA	0.473													21	20	---	---	---	---	PASS
HSD3B7	80270	broad.mit.edu	37	16	30997528	30997528	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30997528G>A	uc002eaf.2	+						HSD3B7_uc010cac.2_Intron|HSD3B7_uc002eag.2_Intron|HSD3B7_uc002eah.2_Intron	NM_025193	NP_079469	Q9H2F3	3BHS7_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta-						bile acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity				0						CGTGCAGGGTGAGGAGCTCTG	0.592													7	10	---	---	---	---	PASS
ADCY7	113	broad.mit.edu	37	16	50326585	50326585	+	Splice_Site	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50326585A>T	uc002egd.1	+	4	806	c.538_splice	c.e4-2	p.L180_splice	ADCY7_uc002egb.1_Splice_Site_p.L180_splice|ADCY7_uc002egc.1_Splice_Site_p.L180_splice	NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			skin(1)	1		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)	GTCTACCCGCAGCTGCTGGCC	0.602													37	48	---	---	---	---	PASS
COG4	25839	broad.mit.edu	37	16	70524228	70524228	+	Intron	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70524228C>T	uc002ezc.2	-						COG4_uc002eza.2_Intron|COG4_uc002ezb.2_Intron|COG4_uc010cfu.2_Intron|COG4_uc002ezd.2_Intron|COG4_uc002eze.2_Intron	NM_015386	NP_056201	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4						Golgi organization|Golgi vesicle prefusion complex stabilization|protein transport|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0		Ovarian(137;0.0694)				CAATTTCCCTCGTACCTCCAG	0.463													28	47	---	---	---	---	PASS
COG4	25839	broad.mit.edu	37	16	70524265	70524265	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70524265C>T	uc002ezc.2	-	13	1689	c.1678G>A	c.(1678-1680)GAA>AAA	p.E560K	COG4_uc002eza.2_5'UTR|COG4_uc002ezb.2_Intron|COG4_uc010cfu.2_RNA|COG4_uc002ezd.2_Intron|COG4_uc002eze.2_Missense_Mutation_p.E254K	NM_015386	NP_056201	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	556					Golgi organization|Golgi vesicle prefusion complex stabilization|protein transport|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0		Ovarian(137;0.0694)				GAGATGTTTTCACTGCAGACT	0.507													30	46	---	---	---	---	PASS
MAF	4094	broad.mit.edu	37	16	79633671	79633671	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79633671G>A	uc002ffn.2	-	1	952	c.129C>T	c.(127-129)ATC>ATT	p.I43I	MAF_uc002ffm.2_Silent_p.I43I	NM_001031804	NP_001026974	O75444	MAF_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene	43					transcription from RNA polymerase II promoter	chromatin|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)	1		all_epithelial(2;0.139)|Lung NSC(2;0.186)|Melanoma(2;0.211)		UCEC - Uterine corpus endometrioid carcinoma (2;0.0178)		CGCACTGGCTGATGATGCGGT	0.622			T	IGH@	MM								23	29	---	---	---	---	PASS
RNMTL1	55178	broad.mit.edu	37	17	685696	685696	+	Silent	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:685696G>T	uc002frw.2	+	1	184	c.78G>T	c.(76-78)GCG>GCT	p.A26A	GLOD4_uc002fru.2_5'Flank|GLOD4_uc010vqc.1_5'Flank|GLOD4_uc002frv.2_5'Flank	NM_018146	NP_060616	Q9HC36	RMTL1_HUMAN	RNA methyltransferase like 1	26					RNA processing		protein binding|RNA binding|RNA methyltransferase activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0219)		ACCTTGACGCGAGGCGCTGGG	0.677													23	34	---	---	---	---	PASS
OR3A1	4994	broad.mit.edu	37	17	3195848	3195848	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3195848G>T	uc002fvh.1	-	1	29	c.29C>A	c.(28-30)ACA>AAA	p.T10K		NM_002550	NP_002541	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A,	10	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(2)|central_nervous_system(1)	3						AGCAATGACTGTTCCATTGGC	0.502													23	55	---	---	---	---	PASS
NLRP1	22861	broad.mit.edu	37	17	5421084	5421084	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5421084C>T	uc002gci.2	-	15	4594	c.4039G>A	c.(4039-4041)GAG>AAG	p.E1347K	NLRP1_uc002gcg.1_Missense_Mutation_p.E1351K|NLRP1_uc002gck.2_Missense_Mutation_p.E1303K|NLRP1_uc002gcj.2_Missense_Mutation_p.E1317K|NLRP1_uc002gcl.2_Missense_Mutation_p.E1273K|NLRP1_uc002gch.3_Missense_Mutation_p.E1303K	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1	1347					defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)				ACCAAGGCCTCCCACACCAGA	0.448													17	136	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577088	7577088	+	Missense_Mutation	SNP	T	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577088T>G	uc002gim.2	-	8	1044	c.850A>C	c.(850-852)ACA>CCA	p.T284P	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.T284P|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.T152P|TP53_uc010cng.1_Missense_Mutation_p.T152P|TP53_uc002gii.1_Missense_Mutation_p.T152P|TP53_uc010cnh.1_Missense_Mutation_p.T284P|TP53_uc010cni.1_Missense_Mutation_p.T284P|TP53_uc002gij.2_Missense_Mutation_p.T284P	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	284	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		T -> A (in sporadic cancers; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> P (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.T284P(7)|p.T284fs*61(3)|p.T284T(3)|p.T284A(3)|p.?(2)|p.T284fs*21(2)|p.T284fs*62(2)|p.R283fs*16(2)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.T284I(1)|p.G279fs*59(1)|p.R283fs*56(1)|p.R283_T284>T(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.R283fs*59(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCTTCCTCTGTGCGCCGGTCT	0.562		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			9	44	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7579355	7579355	+	Missense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7579355A>T	uc002gim.2	-	4	526	c.332T>A	c.(331-333)CTG>CAG	p.L111Q	TP53_uc002gig.1_Missense_Mutation_p.L111Q|TP53_uc002gih.2_Missense_Mutation_p.L111Q|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Missense_Mutation_p.L111Q|TP53_uc010cni.1_Missense_Mutation_p.L111Q|TP53_uc002gij.2_Missense_Mutation_p.L111Q|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Missense_Mutation_p.L72Q|TP53_uc010cnk.1_Missense_Mutation_p.L126Q	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	111	|Interaction with HIPK1 (By similarity).		L -> Q (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> M (in a sporadic cancer; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.L111P(6)|p.L111Q(4)|p.L111R(4)|p.G59fs*23(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.Y107fs*44(1)|p.L111L(1)|p.L111M(1)|p.L111fs*10(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y103_L111>L(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAAGAAGCCCAGACGGAAACC	0.617		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			23	48	---	---	---	---	PASS
EFNB3	1949	broad.mit.edu	37	17	7612580	7612580	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7612580C>T	uc002gis.2	+	5	1106	c.709C>T	c.(709-711)CTG>TTG	p.L237L		NM_001406	NP_001397	Q15768	EFNB3_HUMAN	ephrin-B3 precursor	237	Helical; (Potential).				cell-cell signaling|interspecies interaction between organisms	integral to plasma membrane	ephrin receptor binding|transmembrane-ephrin receptor activity			ovary(1)	1		all_cancers(10;1.14e-06)|Prostate(122;0.081)				GGGGCTGGCGCTGCTCTTGCT	0.716													9	22	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7643162	7643162	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7643162G>T	uc002giu.1	+	8	1296	c.1282G>T	c.(1282-1284)GAG>TAG	p.E428*	DNAH2_uc002git.2_Nonsense_Mutation_p.E510*|DNAH2_uc010vuk.1_Nonsense_Mutation_p.E428*	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	428	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCTGGAGATTGAGGACATCTT	0.527													7	45	---	---	---	---	PASS
NTN1	9423	broad.mit.edu	37	17	9066153	9066153	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9066153C>T	uc002glw.3	+	3	1149	c.1042C>T	c.(1042-1044)CGG>TGG	p.R348W		NM_004822	NP_004813	O95631	NET1_HUMAN	netrin 1 precursor	348	Laminin EGF-like 2.				apoptosis|axon guidance		protein binding				0						CCTGCATGCCCGGCGCTGCCG	0.642													51	82	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10356989	10356989	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10356989C>G	uc002gmn.2	-	23	3016	c.2905G>C	c.(2905-2907)GAG>CAG	p.E969Q	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	969	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						TTCTCCTTCTCAACCTTGGCC	0.378													44	224	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10399469	10399469	+	Missense_Mutation	SNP	T	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10399469T>A	uc002gmo.2	-	35	5061	c.4967A>T	c.(4966-4968)GAT>GTT	p.D1656V	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1656	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	p.D1656Y(1)		ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						GAGCTGGGTATCCTGTGGAAC	0.547													38	52	---	---	---	---	PASS
MYOCD	93649	broad.mit.edu	37	17	12656532	12656532	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12656532G>A	uc002gnn.2	+	10	2226	c.1927G>A	c.(1927-1929)GTG>ATG	p.V643M	MYOCD_uc002gno.2_Missense_Mutation_p.V643M|MYOCD_uc002gnp.1_Missense_Mutation_p.V547M|MYOCD_uc002gnq.2_Missense_Mutation_p.V362M	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	643					cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		GCTGGGGGCTGTGAAAAGCCC	0.557													31	122	---	---	---	---	PASS
FLII	2314	broad.mit.edu	37	17	18148479	18148479	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18148479C>G	uc002gsr.1	-	30	3834	c.3783G>C	c.(3781-3783)TGG>TGC	p.W1261C	FLII_uc002gsq.1_Missense_Mutation_p.W1132C|FLII_uc010cpy.1_Missense_Mutation_p.W1250C|FLII_uc010vxn.1_Missense_Mutation_p.W1230C|FLII_uc010vxo.1_Missense_Mutation_p.W1206C	NM_002018	NP_002009	Q13045	FLII_HUMAN	flightless I homolog	1261					multicellular organismal development|muscle contraction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	actin binding			central_nervous_system(1)|skin(1)	2	all_neural(463;0.228)					AGAAGGCGCTCCAGGCGTGGA	0.637													40	163	---	---	---	---	PASS
FLII	2314	broad.mit.edu	37	17	18148904	18148904	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18148904C>T	uc002gsr.1	-	28	3625	c.3574G>A	c.(3574-3576)GAT>AAT	p.D1192N	FLII_uc002gsq.1_Missense_Mutation_p.D1063N|FLII_uc010cpy.1_Missense_Mutation_p.D1181N|FLII_uc010vxn.1_Missense_Mutation_p.D1161N|FLII_uc010vxo.1_Missense_Mutation_p.D1137N	NM_002018	NP_002009	Q13045	FLII_HUMAN	flightless I homolog	1192	Gelsolin-like 5.				multicellular organismal development|muscle contraction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	actin binding			central_nervous_system(1)|skin(1)	2	all_neural(463;0.228)					ATGTCATCATCTGCCAGGTCA	0.512													31	136	---	---	---	---	PASS
MFAP4	4239	broad.mit.edu	37	17	19288704	19288704	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19288704C>A	uc002gvt.2	-	4	329	c.304G>T	c.(304-306)GGC>TGC	p.G102C	MFAP4_uc002gvr.2_Intron|MFAP4_uc002gvs.2_Missense_Mutation_p.G126C	NM_002404	NP_002395	P55083	MFAP4_HUMAN	microfibrillar-associated protein 4 precursor	102	Fibrinogen C-terminal.				cell adhesion|signal transduction	microfibril	receptor binding				0	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					CGGCCGAAGCCCAGCTTGTAG	0.577													31	59	---	---	---	---	PASS
MFAP4	4239	broad.mit.edu	37	17	19288705	19288705	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19288705C>A	uc002gvt.2	-	4	328	c.303G>T	c.(301-303)CTG>CTT	p.L101L	MFAP4_uc002gvr.2_Intron|MFAP4_uc002gvs.2_Silent_p.L125L	NM_002404	NP_002395	P55083	MFAP4_HUMAN	microfibrillar-associated protein 4 precursor	101	Fibrinogen C-terminal.				cell adhesion|signal transduction	microfibril	receptor binding				0	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					GGCCGAAGCCCAGCTTGTAGT	0.582													31	58	---	---	---	---	PASS
SUPT6H	6830	broad.mit.edu	37	17	27002030	27002030	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27002030G>T	uc002hby.2	+	5	478	c.388G>T	c.(388-390)GAT>TAT	p.D130Y	SUPT6H_uc010crt.2_Missense_Mutation_p.D130Y	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog	130	Asp/Glu-rich.				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)					TGACGAGGACGATGACGAGGA	0.498													3	63	---	---	---	---	PASS
C17orf66	256957	broad.mit.edu	37	17	34195652	34195652	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34195652G>A	uc002hke.1	-						C17orf66_uc010wck.1_RNA|C17orf66_uc010wcl.1_Intron|C17orf66_uc010wcm.1_5'UTR	NM_152781	NP_689994	A2RTY3	CQ066_HUMAN	hypothetical protein LOC256957								binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		GTCCATCCCAGCCTCACCTTT	0.483													11	69	---	---	---	---	PASS
IKZF3	22806	broad.mit.edu	37	17	37922313	37922313	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37922313C>A	uc002hsu.2	-	8	1322	c.1260G>T	c.(1258-1260)GAG>GAT	p.E420D	IKZF3_uc002htd.2_Missense_Mutation_p.E386D|IKZF3_uc010cwd.2_Missense_Mutation_p.E277D|IKZF3_uc002hsv.2_Missense_Mutation_p.E347D|IKZF3_uc010cwe.2_Missense_Mutation_p.E286D|IKZF3_uc010cwf.2_Missense_Mutation_p.E238D|IKZF3_uc010cwg.2_Missense_Mutation_p.E199D|IKZF3_uc002hsw.2_Missense_Mutation_p.E381D|IKZF3_uc002hsx.2_Missense_Mutation_p.E364D|IKZF3_uc002hsy.2_Missense_Mutation_p.E381D|IKZF3_uc002hsz.2_Missense_Mutation_p.E325D|IKZF3_uc002hta.2_Missense_Mutation_p.E342D|IKZF3_uc002htb.2_RNA|IKZF3_uc010cwh.2_Missense_Mutation_p.E333D|IKZF3_uc002htc.2_Missense_Mutation_p.E173D|IKZF3_uc010wel.1_Missense_Mutation_p.E173D	NM_012481	NP_036613	Q9UKT9	IKZF3_HUMAN	aiolos isoform 1	420					B cell activation|mesoderm development|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)|kidney(2)|skin(2)	6	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			AGCGGGGAACCTCCTTCAGAA	0.542													53	114	---	---	---	---	PASS
CDC6	990	broad.mit.edu	37	17	38449707	38449707	+	Splice_Site	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38449707G>A	uc002huj.1	+	5	871	c.661_splice	c.e5-1	p.K221_splice		NM_001254	NP_001245	Q99741	CDC6_HUMAN	cell division cycle 6 protein						cell division|DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|mitosis|negative regulation of cell proliferation|negative regulation of DNA replication|positive regulation of cell cycle cytokinesis|positive regulation of chromosome segregation|regulation of cyclin-dependent protein kinase activity|regulation of mitotic anaphase|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm|spindle midzone|spindle pole	ATP binding|kinase binding|nucleoside-triphosphatase activity			ovary(2)|breast(1)	3						TTTTTTTCCAGAAGGAACTGA	0.403													17	45	---	---	---	---	PASS
CDC6	990	broad.mit.edu	37	17	38449807	38449807	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38449807G>A	uc002huj.1	+	5	970	c.760G>A	c.(760-762)GAG>AAG	p.E254K		NM_001254	NP_001245	Q99741	CDC6_HUMAN	cell division cycle 6 protein	254					cell division|DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|mitosis|negative regulation of cell proliferation|negative regulation of DNA replication|positive regulation of cell cycle cytokinesis|positive regulation of chromosome segregation|regulation of cyclin-dependent protein kinase activity|regulation of mitotic anaphase|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm|spindle midzone|spindle pole	ATP binding|kinase binding|nucleoside-triphosphatase activity			ovary(2)|breast(1)	3						TTGTCAGGAAGAGGTATCCAG	0.453													36	67	---	---	---	---	PASS
CDC6	990	broad.mit.edu	37	17	38453016	38453016	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38453016G>A	uc002huj.1	+	9	1456	c.1246G>A	c.(1246-1248)GAA>AAA	p.E416K		NM_001254	NP_001245	Q99741	CDC6_HUMAN	cell division cycle 6 protein	416					cell division|DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|mitosis|negative regulation of cell proliferation|negative regulation of DNA replication|positive regulation of cell cycle cytokinesis|positive regulation of chromosome segregation|regulation of cyclin-dependent protein kinase activity|regulation of mitotic anaphase|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm|spindle midzone|spindle pole	ATP binding|kinase binding|nucleoside-triphosphatase activity			ovary(2)|breast(1)	3						ACCACTGTCTGAATGTAAGTA	0.328													29	43	---	---	---	---	PASS
KLHL11	55175	broad.mit.edu	37	17	40021343	40021343	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40021343C>T	uc002hyf.1	-	1	287	c.281G>A	c.(280-282)TGC>TAC	p.C94Y		NM_018143	NP_060613	Q9NVR0	KLH11_HUMAN	kelch-like 11 precursor	94	BTB.					extracellular region					0		Breast(137;0.00156)				GGTAATGTCGCAGAAGAGGCC	0.687													10	20	---	---	---	---	PASS
RUNDC1	146923	broad.mit.edu	37	17	41143266	41143266	+	Missense_Mutation	SNP	T	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41143266T>G	uc002ici.1	+	5	1387	c.1375T>G	c.(1375-1377)TTG>GTG	p.L459V	RUNDC1_uc010whi.1_Missense_Mutation_p.L229V	NM_173079	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	459	RUN.										0		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		TATTGCTTGTTTGCTGCCAGC	0.577													8	45	---	---	---	---	PASS
COL1A1	1277	broad.mit.edu	37	17	48266583	48266583	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48266583G>A	uc002iqm.2	-	40	3009	c.2883C>T	c.(2881-2883)GTC>GTT	p.V961V		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	961	Triple-helical region.				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	CAGGCAGGCCGACCACACCAC	0.622			T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						9	27	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51901867	51901867	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51901867C>T	uc002iua.2	+	1	1629	c.1473C>T	c.(1471-1473)CAC>CAT	p.H491H	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	491					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						ACAAGCCTCACACCCCATTCA	0.527													28	40	---	---	---	---	PASS
GDPD1	284161	broad.mit.edu	37	17	57350206	57350206	+	Intron	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57350206C>T	uc002ixk.1	+						GDPD1_uc002ixj.2_Silent_p.F277F	NM_182569	NP_872375	Q8N9F7	GDPD1_HUMAN	glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process	cytoplasm|integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding				0	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					AAGTAAGTTTCTGGAATGATG	0.383													18	90	---	---	---	---	PASS
TANC2	26115	broad.mit.edu	37	17	61432487	61432487	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61432487C>T	uc002jal.3	+	12	2119	c.2096C>T	c.(2095-2097)TCT>TTT	p.S699F	TANC2_uc010wpe.1_Missense_Mutation_p.S609F|TANC2_uc002jam.1_Missense_Mutation_p.S66F	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and	699							binding			ovary(2)	2						CCAACCCAGTCTTCCTTTGAC	0.478													15	96	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62022729	62022729	+	Silent	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62022729G>C	uc002jds.1	-	19	3788	c.3711C>G	c.(3709-3711)CTC>CTG	p.L1237L		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	1237	III.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	CCACCTGCAGGAGGGAGAGGT	0.617													13	47	---	---	---	---	PASS
SDK2	54549	broad.mit.edu	37	17	71394258	71394258	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71394258C>A	uc010dfm.2	-	24	3270	c.3270G>T	c.(3268-3270)CAG>CAT	p.Q1090H	SDK2_uc002jjt.3_Missense_Mutation_p.Q249H|SDK2_uc010dfn.2_Missense_Mutation_p.Q769H	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2	1090	Extracellular (Potential).				cell adhesion	integral to membrane				ovary(2)	2						CCTGCAGGGTCTGGATCTTTC	0.622													13	52	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	72945521	72945521	+	IGR	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72945521C>A								OTOP3 (11 upstream) : C17orf28 (1319 downstream)																							AGGCTGCCCACCCCCGGCAGA	0.632													15	42	---	---	---	---	PASS
RECQL5	9400	broad.mit.edu	37	17	73658595	73658595	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73658595G>T	uc010dgl.2	-	4	891	c.735C>A	c.(733-735)TTC>TTA	p.F245L	RECQL5_uc010dgk.2_Missense_Mutation_p.F218L|RECQL5_uc002jpb.1_Missense_Mutation_p.F245L|RECQL5_uc002joz.3_Missense_Mutation_p.F245L|RECQL5_uc002jpa.3_Missense_Mutation_p.F245L	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1	245	Helicase C-terminal.				DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CCTTAAGGCAGAAGTCCTTCA	0.522								Other_identified_genes_with_known_or_suspected_DNA_repair_function					65	349	---	---	---	---	PASS
LGALS3BP	3959	broad.mit.edu	37	17	76967757	76967757	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76967757C>A	uc002jwh.2	-	6	1838	c.1659G>T	c.(1657-1659)TCG>TCT	p.S553S	LGALS3BP_uc002jwi.2_Silent_p.S359S|LGALS3BP_uc010dhr.2_Silent_p.S359S	NM_005567	NP_005558	Q08380	LG3BP_HUMAN	galectin 3 binding protein	553					cell adhesion|cellular defense response	extracellular space|membrane|proteinaceous extracellular matrix	protein binding|scavenger receptor activity			central_nervous_system(3)|ovary(1)	4			BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			AGGTGCTCTTCGAGCTGTTGG	0.612											OREG0024787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	47	---	---	---	---	PASS
ZNF519	162655	broad.mit.edu	37	18	14105322	14105322	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14105322C>A	uc002kst.1	-	3	1370	c.1217G>T	c.(1216-1218)TGT>TTT	p.C406F	ZNF519_uc002ksq.1_Intron|ZNF519_uc002ksr.1_Intron|ZNF519_uc010dlm.1_Intron	NM_145287	NP_660330	Q8TB69	ZN519_HUMAN	zinc finger protein 519	406	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACATTCCTTACACTTGAAAGG	0.393													43	117	---	---	---	---	PASS
KIAA1012	22878	broad.mit.edu	37	18	29432550	29432550	+	Intron	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29432550G>T	uc002kxc.3	-						KIAA1012_uc002kxb.3_Intron|KIAA1012_uc002kxd.3_Intron	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878						ER to Golgi vesicle-mediated transport	cis-Golgi network					0						AAAGTAAAGTGAATTTACCTT	0.348													80	120	---	---	---	---	PASS
ELP2	55250	broad.mit.edu	37	18	33750170	33750170	+	Intron	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33750170G>T	uc002kzk.1	+						ELP2_uc010xcg.1_Intron|ELP2_uc002kzl.1_Intron|ELP2_uc002kzm.1_Intron|ELP2_uc010xch.1_Intron|ELP2_uc002kzn.1_Intron|ELP2_uc002kzo.1_Intron	NM_018255	NP_060725	Q6IA86	ELP2_HUMAN	elongator protein 2						regulation of transcription from RNA polymerase II promoter	Golgi apparatus|transcription elongation factor complex				breast(2)|ovary(1)|skin(1)	4						GTCAGTCTCTGTGTGGGGCTT	0.507													33	39	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42643668	42643668	+	3'UTR	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42643668G>T	uc010dni.2	+	6						NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CCCTAGGGCGGGTCTGGGCGT	0.687									Schinzel-Giedion_syndrome				6	10	---	---	---	---	PASS
SMAD4	4089	broad.mit.edu	37	18	48584787	48584787	+	Nonsense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48584787C>T	uc010xdp.1	+	7	1403	c.865C>T	c.(865-867)CAG>TAG	p.Q289*	SMAD4_uc002lfb.3_Nonsense_Mutation_p.Q134*	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	289	SAD.				BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.?(2)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CGGCCATCTTCAGCACCACCC	0.463									Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				28	43	---	---	---	---	PASS
WDR7	23335	broad.mit.edu	37	18	54423878	54423878	+	Missense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54423878A>T	uc002lgk.1	+	15	2265	c.2054A>T	c.(2053-2055)GAC>GTC	p.D685V	WDR7_uc010dpk.1_RNA|WDR7_uc002lgl.1_Missense_Mutation_p.D685V	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1	685										ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		AACCTAACAGACCCGGACATA	0.348													41	43	---	---	---	---	PASS
KIAA1468	57614	broad.mit.edu	37	18	59925844	59925844	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59925844G>C	uc002lil.2	+	15	2352	c.2137G>C	c.(2137-2139)GAA>CAA	p.E713Q	KIAA1468_uc002lik.1_Missense_Mutation_p.E713Q|KIAA1468_uc010xel.1_Missense_Mutation_p.E713Q|KIAA1468_uc002lim.2_Missense_Mutation_p.E357Q	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614	713							binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				GTGGACTACAGAACTTGGAAA	0.373													34	37	---	---	---	---	PASS
TMPRSS9	360200	broad.mit.edu	37	19	2413846	2413846	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2413846C>T	uc010xgx.1	+	9	1301	c.1301C>T	c.(1300-1302)GCC>GTC	p.A434V	TMPRSS9_uc002lvv.1_Missense_Mutation_p.A468V	NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	434	Extracellular (Potential).|Peptidase S1 1.				proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCCTGGAGGCCACCACCAAA	0.672													11	12	---	---	---	---	PASS
PNPLA6	10908	broad.mit.edu	37	19	7620514	7620514	+	Silent	SNP	A	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7620514A>G	uc010xjq.1	+	26	3183	c.2988A>G	c.(2986-2988)GTA>GTG	p.V996V	PNPLA6_uc002mgq.1_Silent_p.V948V|PNPLA6_uc010xjp.1_Silent_p.V921V|PNPLA6_uc002mgr.1_Silent_p.V948V|PNPLA6_uc002mgs.2_Silent_p.V986V|PNPLA6_uc002mgt.1_RNA	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b	987	Patatin.|Cytoplasmic (Potential).				cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3						ACATCGGAGTACTAAAGGCAT	0.667													11	26	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8186173	8186173	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8186173C>G	uc002mjf.2	-	24	3201	c.3180G>C	c.(3178-3180)GAG>GAC	p.E1060D		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1060	EGF-like 13; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						TGAAGCCACTCTCGTAGCCGG	0.627													21	32	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	8976368	8976368	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8976368C>A	uc002mkp.2	-	75	42664	c.42460G>T	c.(42460-42462)GGC>TGC	p.G14154C	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.G954C|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGCCCGGGGCCCACAGGGTCA	0.597													10	17	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	8976594	8976594	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8976594G>A	uc002mkp.2	-	74	42586	c.42382C>T	c.(42382-42384)CTG>TTG	p.L14128L	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.L928L|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	14159	SEA 14.|Extracellular (Potential).			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGGGAGATCAGTTGGCAACCC	0.567													8	14	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9067184	9067184	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9067184G>T	uc002mkp.2	-	3	20466	c.20262C>A	c.(20260-20262)GAC>GAA	p.D6754E		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6756	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TAGTTGGTGTGTCCAAGGTAA	0.483													102	119	---	---	---	---	PASS
OR1M1	125963	broad.mit.edu	37	19	9203994	9203994	+	Missense_Mutation	SNP	C	A	A	rs61738474	byFrequency	TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9203994C>A	uc010xkj.1	+	1	74	c.74C>A	c.(73-75)ACG>AAG	p.T25K		NM_001004456	NP_001004456	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M,	25	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3						GAGCAGGAGACGCTTCTCTTT	0.522													33	28	---	---	---	---	PASS
SMARCA4	6597	broad.mit.edu	37	19	11130342	11130342	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11130342G>A	uc002mqf.3	+	18	2865	c.2581G>A	c.(2581-2583)GAG>AAG	p.E861K	SMARCA4_uc010dxp.2_Missense_Mutation_p.E861K|SMARCA4_uc010dxo.2_Missense_Mutation_p.E861K|SMARCA4_uc002mqg.1_Missense_Mutation_p.E861K|SMARCA4_uc010dxq.2_Missense_Mutation_p.E861K|SMARCA4_uc010dxr.2_Missense_Mutation_p.E861K|SMARCA4_uc002mqj.3_Missense_Mutation_p.E861K|SMARCA4_uc010dxs.2_Missense_Mutation_p.E861K|SMARCA4_uc010dxt.1_Missense_Mutation_p.E81K|SMARCA4_uc002mqh.3_5'UTR|SMARCA4_uc002mqi.1_5'Flank	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated	861	Helicase ATP-binding.				chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GACGACGTACGAGTACATCAT	0.597			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				5	23	---	---	---	---	PASS
CD97	976	broad.mit.edu	37	19	14518791	14518791	+	Silent	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14518791C>A	uc002myl.2	+	19	2571	c.2448C>A	c.(2446-2448)ACC>ACA	p.T816T	CD97_uc002mym.2_Silent_p.T767T|CD97_uc002myn.2_Silent_p.T723T	NM_078481	NP_510966	P48960	CD97_HUMAN	CD97 antigen isoform 1 precursor	816	Cytoplasmic (Potential).				cell adhesion|cell-cell signaling|cellular component movement|immune response|inflammatory response|neuropeptide signaling pathway	extracellular space|integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(3)|breast(1)	4						TCACCTCCACCACGTCTGGCA	0.657													7	21	---	---	---	---	PASS
PIK3R2	5296	broad.mit.edu	37	19	18271322	18271322	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18271322G>T	uc002nia.1	+	3	876	c.364G>T	c.(364-366)GAT>TAT	p.D122Y	PIK3R2_uc002nib.1_RNA|PIK3R2_uc010ebi.1_RNA	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	122	Rho-GAP.				fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)	6						CTCCCCACCTGATGTGGCTCC	0.567													4	26	---	---	---	---	PASS
GRAMD1A	57655	broad.mit.edu	37	19	35504605	35504605	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35504605G>A	uc010xse.1	+						GRAMD1A_uc002nxi.1_Intron|GRAMD1A_uc002nxk.2_Intron|GRAMD1A_uc002nxl.2_Intron|GRAMD1A_uc010xsf.1_Intron|GRAMD1A_uc002nxm.1_Intron|GRAMD1A_uc002nxn.1_5'Flank	NM_020895	NP_065946	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A isoform 1							integral to membrane					0	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			GGTGAGCGGTGGGTTGGAAGA	0.572													7	57	---	---	---	---	PASS
DPF1	8193	broad.mit.edu	37	19	38713015	38713015	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38713015G>T	uc002ohl.2	-	3	388	c.361C>A	c.(361-363)CCC>ACC	p.P121T	DPF1_uc002ohm.2_Missense_Mutation_p.P121T|DPF1_uc002ohn.2_Missense_Mutation_p.P39T|DPF1_uc010xtu.1_Missense_Mutation_p.P95T|DPF1_uc010xtv.1_Missense_Mutation_p.P95T|DPF1_uc010xtw.1_Missense_Mutation_p.P95T	NM_004647	NP_004638	Q92782	DPF1_HUMAN	D4, zinc and double PHD fingers family 1 isoform	121					induction of apoptosis|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nBAF complex	zinc ion binding				0	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TACTCGCAGGGCCTGAGTCTG	0.612													113	86	---	---	---	---	PASS
LGALS4	3960	broad.mit.edu	37	19	39299479	39299479	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39299479C>T	uc002ojg.2	-	3	458	c.244G>A	c.(244-246)GGG>AGG	p.G82R	LGALS4_uc010xuj.1_Missense_Mutation_p.G82R	NM_006149	NP_006140	P56470	LEG4_HUMAN	galectin-4	82	Galectin 1.				cell adhesion	cytosol|plasma membrane	sugar binding			ovary(1)|skin(1)	2	all_cancers(60;1.02e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			CCCCACTTCCCGCCCTGCAAC	0.582													17	100	---	---	---	---	PASS
CNTD2	79935	broad.mit.edu	37	19	40730462	40730462	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40730462C>A	uc010xvi.1	-	3	495	c.446G>T	c.(445-447)CGC>CTC	p.R149L	CNTD2_uc002ond.2_RNA	NM_024877	NP_079153	Q9H8S5	CNTD2_HUMAN	cyclin N-terminal domain containing 2 isoform 2	149					regulation of cyclin-dependent protein kinase activity		protein kinase binding				0						CAGCTGCAGGCGATGTAGACG	0.612													141	72	---	---	---	---	PASS
AXL	558	broad.mit.edu	37	19	41749512	41749512	+	Intron	SNP	C	A	A	rs139678321	by1000genomes	TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41749512C>A	uc010ehj.2	+						CYP2F1_uc010xvw.1_Intron|AXL_uc010ehi.1_Intron|AXL_uc010ehk.2_Intron	NM_021913	NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase isoform 1							integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|stomach(3)|ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	13						TACTCCCCCTCCCCCCCAGAG	0.572													110	71	---	---	---	---	PASS
PSG7	5676	broad.mit.edu	37	19	43430769	43430769	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43430769G>T	uc002ovl.3	-	5	911	c.809C>A	c.(808-810)ACC>AAC	p.T270N	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_RNA|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_Missense_Mutation_p.T148N	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7	270	Ig-like C2-type 2.				female pregnancy	extracellular region					0		Prostate(69;0.00682)				CCAAATGTAGGTGTAGTTCTC	0.488													342	201	---	---	---	---	PASS
CD177	57126	broad.mit.edu	37	19	43859925	43859925	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43859925G>T	uc002owi.2	+	4	534	c.492G>T	c.(490-492)AGG>AGT	p.R164S	CD177_uc010eis.2_RNA|CD177_uc002owj.2_RNA	NM_020406	NP_065139	Q8N6Q3	CD177_HUMAN	CD177 molecule precursor	164	UPAR/Ly6 1.				blood coagulation|leukocyte migration	anchored to membrane|plasma membrane				central_nervous_system(1)	1		Prostate(69;0.00682)				GCCTCCTCAGGCTCAGGGGAG	0.582													30	119	---	---	---	---	PASS
TEX101	83639	broad.mit.edu	37	19	43910675	43910675	+	Intron	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43910675C>G	uc002owk.2	+							NM_031451	NP_113639	Q9BY14	TX101_HUMAN	testis expressed 101 isoform 1							anchored to membrane|plasma membrane				ovary(1)	1		Prostate(69;0.0199)				gaggcaggtacatgggccttg	0.000													21	9	---	---	---	---	PASS
TEX101	83639	broad.mit.edu	37	19	43922079	43922079	+	Silent	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43922079G>T	uc010xwo.1	+	5	636	c.441G>T	c.(439-441)GGG>GGT	p.G147G	TEX101_uc002owk.2_Silent_p.G165G	NM_001130011	NP_001123483	Q9BY14	TX101_HUMAN	testis expressed 101 isoform 2	147						anchored to membrane|plasma membrane				ovary(1)	1		Prostate(69;0.0199)				TGGCTTTGGGGACCTGTTTCA	0.493													11	278	---	---	---	---	PASS
PLAUR	5329	broad.mit.edu	37	19	44169569	44169569	+	Nonsense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44169569G>C	uc002oxf.1	-	3	439	c.209C>G	c.(208-210)TCA>TGA	p.S70*	PLAUR_uc002oxd.1_Nonsense_Mutation_p.S70*|PLAUR_uc002oxe.1_Nonsense_Mutation_p.S65*|PLAUR_uc002oxg.1_Nonsense_Mutation_p.S70*	NM_002659	NP_002650	Q03405	UPAR_HUMAN	plasminogen activator, urokinase receptor	70	UPAR/Ly6 1.				attachment of GPI anchor to protein|blood coagulation|C-terminal protein lipidation|cellular component movement|chemotaxis|fibrinolysis|regulation of proteolysis	anchored to membrane|cell surface|endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region|extrinsic to membrane|integral to membrane|plasma membrane	enzyme binding|U-plasminogen activator receptor activity			ovary(1)	1		Prostate(69;0.0153)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Urokinase(DB00013)	GGTCTTCTCTGAGTGGGTACA	0.542													75	43	---	---	---	---	PASS
SULT2A1	6822	broad.mit.edu	37	19	48386955	48386955	+	Nonsense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48386955G>T	uc002phr.2	-	2	364	c.224C>A	c.(223-225)TCA>TAA	p.S75*		NM_003167	NP_003158	Q06520	ST2A1_HUMAN	bile-salt sulfotransferase 2A1	75					3'-phosphoadenosine 5'-phosphosulfate metabolic process|bile acid catabolic process|cellular lipid metabolic process|digestion|sulfation|xenobiotic metabolic process	cytosol	bile-salt sulfotransferase activity			ovary(1)|pancreas(1)	2		all_cancers(25;3.02e-09)|all_lung(116;6.48e-07)|all_epithelial(76;7.35e-07)|Lung NSC(112;1.56e-06)|all_neural(266;0.0146)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000254)|all cancers(93;0.000545)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.0552)		TACCCAGGGTGATCGCTCCCA	0.517													56	26	---	---	---	---	PASS
LIG1	3978	broad.mit.edu	37	19	48654549	48654549	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48654549C>G	uc002pia.1	-	7	634	c.514G>C	c.(514-516)GAG>CAG	p.E172Q	LIG1_uc010xze.1_5'UTR|LIG1_uc002phz.1_RNA|LIG1_uc002pib.1_RNA|LIG1_uc010xzf.1_Intron|LIG1_uc010xzg.1_Missense_Mutation_p.E141Q|LIG1_uc010xzh.1_RNA	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I	172					anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	CCTTCCTTCTCTGTGGCCACT	0.562								NER					30	171	---	---	---	---	PASS
TULP2	7288	broad.mit.edu	37	19	49392767	49392767	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49392767C>G	uc002pkz.2	-	7	787	c.636G>C	c.(634-636)AAG>AAC	p.K212N		NM_003323	NP_003314	O00295	TULP2_HUMAN	tubby like protein 2	212					visual perception	cytoplasm|extracellular region				ovary(1)|kidney(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		ATTTTCCTACCTTTTGGAAGG	0.493													103	67	---	---	---	---	PASS
SLC6A16	28968	broad.mit.edu	37	19	49814440	49814440	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49814440C>T	uc002pmz.2	-	2	399	c.165G>A	c.(163-165)CGG>CGA	p.R55R	SLC6A16_uc002pna.2_Silent_p.R55R|hsa-mir-4324|MI0015854_5'Flank	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	55	Cytoplasmic (Potential).					integral to membrane|intracellular	neurotransmitter:sodium symporter activity			skin(2)|ovary(1)|kidney(1)	4		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		CCTCTGCAACCCGGGCTGCTG	0.547													36	23	---	---	---	---	PASS
POLD1	5424	broad.mit.edu	37	19	50905612	50905612	+	Missense_Mutation	SNP	A	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50905612A>T	uc002psb.3	+	6	796	c.740A>T	c.(739-741)AAC>ATC	p.N247I	POLD1_uc002psc.3_Missense_Mutation_p.N247I|POLD1_uc010enx.2_RNA|POLD1_uc010eny.2_Missense_Mutation_p.N247I	NM_002691	NP_002682	P28340	DPOD1_HUMAN	DNA-directed DNA polymerase delta 1	247					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		TACGAGGCCAACGTCGACTTT	0.711								DNA_polymerases_(catalytic_subunits)					40	29	---	---	---	---	PASS
KLK6	5653	broad.mit.edu	37	19	51471362	51471362	+	5'UTR	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51471362G>T	uc002pui.2	-	3					KLK6_uc010eoj.2_5'UTR|KLK6_uc002puh.2_Missense_Mutation_p.A9D|KLK6_uc002puj.2_Intron|KLK6_uc010ycn.1_5'UTR|KLK6_uc002pul.2_5'UTR|KLK6_uc002pum.2_5'UTR	NM_001012964	NP_001012982	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6 isoform A						amyloid precursor protein metabolic process|central nervous system development|collagen catabolic process|hormone metabolic process|myelination|positive regulation of G-protein coupled receptor protein signaling pathway|protein autoprocessing|proteolysis|regulation of cell differentiation|tissue regeneration	endoplasmic reticulum|extracellular region|microsome|mitochondrion|nucleolus	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		CTTCTTCATGGCCGCTCCTGA	0.547													39	35	---	---	---	---	PASS
ZNF665	79788	broad.mit.edu	37	19	53678738	53678738	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53678738C>A	uc010eqm.1	-	3	202	c.102G>T	c.(100-102)AGG>AGT	p.R34S		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	Error:Variant_position_missing_in_Q9H7R5_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)		ACATGACGTCCCTGTACAAAG	0.453													129	61	---	---	---	---	PASS
CACNG7	59284	broad.mit.edu	37	19	54418653	54418653	+	Silent	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54418653C>G	uc002qcr.1	+	3	333	c.318C>G	c.(316-318)GTC>GTG	p.V106V	CACNG7_uc010era.1_Silent_p.V106V	NM_031896	NP_114102	P62955	CCG7_HUMAN	voltage-dependent calcium channel gamma-7	106	Helical; (Potential).				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(1)	1	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)		TCCCCATGGTCAGCCTCTTCC	0.602													47	30	---	---	---	---	PASS
TSEN34	79042	broad.mit.edu	37	19	54695960	54695960	+	Intron	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54695960C>T	uc002qdu.2	+						MBOAT7_uc002qdq.2_5'Flank|MBOAT7_uc002qdr.2_5'Flank|MBOAT7_uc002qds.2_5'Flank|MBOAT7_uc010yen.1_5'Flank|MBOAT7_uc002qdt.3_5'Flank|TSEN34_uc010yeo.1_Intron|TSEN34_uc002qdv.2_Intron|TSEN34_uc002qdw.2_Intron	NM_024075	NP_076980	Q9BSV6	SEN34_HUMAN	tRNA-intron endonuclease 34						mRNA processing|tRNA-type intron splice site recognition and cleavage	nucleolus|tRNA-intron endonuclease complex	nucleic acid binding|tRNA-intron endonuclease activity				0	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TCTGTACTCCCCACCAGGCCC	0.557													76	39	---	---	---	---	PASS
ZNF579	163033	broad.mit.edu	37	19	56089972	56089972	+	Nonsense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56089972G>C	uc002qlh.2	-	2	1087	c.1034C>G	c.(1033-1035)TCA>TGA	p.S345*		NM_152600	NP_689813	Q8NAF0	ZN579_HUMAN	zinc finger protein 579	345	Gly-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.106)		CCCCTTGGCTGAGTTCCGTGC	0.667													19	7	---	---	---	---	PASS
ZNF579	163033	broad.mit.edu	37	19	56090271	56090271	+	Silent	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56090271G>C	uc002qlh.2	-	2	788	c.735C>G	c.(733-735)CTC>CTG	p.L245L		NM_152600	NP_689813	Q8NAF0	ZN579_HUMAN	zinc finger protein 579	245					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.106)		GGTGCGCCTTGAGCTCGCCCT	0.701													9	4	---	---	---	---	PASS
ZSCAN4	201516	broad.mit.edu	37	19	58190226	58190226	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58190226G>A	uc002qpu.2	+	5	1952	c.1255G>A	c.(1255-1257)GAG>AAG	p.E419K		NM_152677	NP_689890	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	419					telomere maintenance via telomere lengthening|viral reproduction	nuclear chromosome, telomeric region	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GAGGACTCATGAGAAAATTAC	0.418													98	57	---	---	---	---	PASS
ZSCAN1	284312	broad.mit.edu	37	19	58565154	58565154	+	Missense_Mutation	SNP	C	A	A	rs143175520		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58565154C>A	uc002qrc.1	+	6	1209	c.962C>A	c.(961-963)CCG>CAG	p.P321Q		NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	321	C2H2-type 2.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GGGCCCTTTCCGTGCCCCGAG	0.632													53	31	---	---	---	---	PASS
ZNF324B	388569	broad.mit.edu	37	19	58967450	58967450	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58967450G>A	uc002qsv.1	+	4	1246	c.1139G>A	c.(1138-1140)CGC>CAC	p.R380H	ZNF324B_uc002qsu.1_Missense_Mutation_p.R370H|ZNF324B_uc010euq.1_Missense_Mutation_p.R380H	NM_207395	NP_997278	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	380	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CGCTTCTGCCGCAACTCGCAC	0.652													3	51	---	---	---	---	PASS
MZF1	7593	broad.mit.edu	37	19	59073609	59073609	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59073609G>A	uc002qto.2	-	6	2596	c.2035C>T	c.(2035-2037)CGG>TGG	p.R679W	LOC100131691_uc002qtm.2_Intron|MZF1_uc002qtn.2_Missense_Mutation_p.R679W	NM_198055	NP_932172	P28698	MZF1_HUMAN	zinc finger protein 42 isoform 2	679					viral reproduction	nucleus	protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		GCGTAGGGCCGTTCACCCGTG	0.692													3	29	---	---	---	---	PASS
SIRPG	55423	broad.mit.edu	37	20	1617104	1617104	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1617104G>T	uc002wfm.1	-	3	543	c.478C>A	c.(478-480)CCT>ACT	p.P160T	SIRPG_uc002wfn.1_Missense_Mutation_p.P160T|SIRPG_uc002wfo.1_Intron|uc002wfp.1_Intron	NM_018556	NP_061026	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma isoform 1	160	Extracellular (Potential).|Ig-like C1-type 1.				blood coagulation|cell adhesion|cell junction assembly|cell-cell signaling|intracellular signal transduction|leukocyte migration|negative regulation of cell proliferation|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to membrane|intracellular|plasma membrane	protein binding			ovary(1)	1						GTATGCTCAGGTGTGGTCCTC	0.512													31	69	---	---	---	---	PASS
HSPA12B	116835	broad.mit.edu	37	20	3732708	3732708	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3732708G>C	uc002wjd.2	+	13	2059	c.1956G>C	c.(1954-1956)GAG>GAC	p.E652D	HSPA12B_uc010zqi.1_Missense_Mutation_p.E651D|HSPA12B_uc002wje.2_Missense_Mutation_p.E565D|HSPA12B_uc010zqj.1_Missense_Mutation_p.E486D	NM_052970	NP_443202	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B	652							ATP binding				0						GCCGCCGCGAGATCCGCGCCG	0.692													3	14	---	---	---	---	PASS
RIN2	54453	broad.mit.edu	37	20	19956105	19956105	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19956105C>T	uc002wro.1	+	7	1472	c.1436C>T	c.(1435-1437)TCC>TTC	p.S479F	RIN2_uc010gcu.1_Intron|RIN2_uc010gcv.1_Missense_Mutation_p.S273F	NM_018993	NP_061866	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	479					endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity			lung(4)|ovary(1)	5						CCCATCAAGTCCAAAAAGAAA	0.592													9	60	---	---	---	---	PASS
NKX2-2	4821	broad.mit.edu	37	20	21493106	21493106	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21493106C>A	uc002wsi.2	-	2	634	c.277G>T	c.(277-279)GGG>TGG	p.G93W		NM_002509	NP_002500	O95096	NKX22_HUMAN	NK2 transcription factor related, locus 2	93					brain development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	chromatin binding|core promoter proximal region DNA binding|transcription coactivator activity			pancreas(1)|skin(1)	2						GGGGGCGCCCCGGCAGCCAGA	0.726													5	19	---	---	---	---	PASS
ACSS2	55902	broad.mit.edu	37	20	33501891	33501891	+	Intron	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33501891C>T	uc002xbd.2	+						ACSS2_uc002xbc.2_Intron|ACSS2_uc010zum.1_Intron|ACSS2_uc010gey.2_Intron|ACSS2_uc002xbe.2_Intron|ACSS2_uc002xbf.2_Intron	NM_018677	NP_061147	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2						ethanol oxidation|lipid biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	acetate-CoA ligase activity|ATP binding|protein binding				0					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GTCTGTTGCTCCCCAAAGATG	0.537													11	31	---	---	---	---	PASS
TRPC4AP	26133	broad.mit.edu	37	20	33593507	33593507	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33593507C>G	uc002xbk.2	-	16	1961	c.1927G>C	c.(1927-1929)GAT>CAT	p.D643H	TRPC4AP_uc002xbj.2_RNA|TRPC4AP_uc010zuq.1_Missense_Mutation_p.D234H|TRPC4AP_uc002xbl.2_Missense_Mutation_p.D635H|TRPC4AP_uc010zur.1_Missense_Mutation_p.D604H	NM_015638	NP_056453	Q8TEL6	TP4AP_HUMAN	TRPC4-associated protein isoform a	643					protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)			CCTTTCATATCCACCTGGTTT	0.517													33	60	---	---	---	---	PASS
UQCC	55245	broad.mit.edu	37	20	33969754	33969754	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33969754C>A	uc002xcd.2	-	4	367	c.300G>T	c.(298-300)ATG>ATT	p.M100I	UQCC_uc010zuy.1_Missense_Mutation_p.M1I|UQCC_uc010zuz.1_Intron|UQCC_uc010zva.1_Intron|UQCC_uc002xce.2_Missense_Mutation_p.M100I|UQCC_uc002xcg.2_5'UTR|UQCC_uc010gfb.2_Missense_Mutation_p.M100I|UQCC_uc010zvb.1_Intron|UQCC_uc002xcf.2_Intron|GDF5_uc010gfc.1_Intron|UQCC_uc002xci.1_Missense_Mutation_p.M54I|UQCC_uc010gfd.1_Missense_Mutation_p.M86I	NM_018244	NP_060714	Q9NVA1	UQCC_HUMAN	basic FGF-repressed Zic binding protein isoform	100						cytoplasmic membrane-bounded vesicle				breast(1)	1			BRCA - Breast invasive adenocarcinoma(18;0.00252)			CCGTGAATCCCATGGCTTCTA	0.378													74	178	---	---	---	---	PASS
TGM2	7052	broad.mit.edu	37	20	36766704	36766704	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36766704G>A	uc002xhr.2	-	10	1526	c.1426C>T	c.(1426-1428)CGG>TGG	p.R476W	TGM2_uc010zvx.1_Missense_Mutation_p.R395W|TGM2_uc010zvy.1_Missense_Mutation_p.R416W|TGM2_uc002xhs.1_Missense_Mutation_p.R452W|TGM2_uc002xht.2_Missense_Mutation_p.R476W	NM_004613	NP_004604	P21980	TGM2_HUMAN	transglutaminase 2 isoform a	476					apoptotic cell clearance|peptide cross-linking|positive regulation of cell adhesion		acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(1)|lung(1)|ovary(1)	3		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	ACACGGATCCGCATGGCCATC	0.587													15	73	---	---	---	---	PASS
RALGAPB	57148	broad.mit.edu	37	20	37126041	37126041	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37126041G>A	uc002xiw.2	+	4	692	c.435G>A	c.(433-435)CTG>CTA	p.L145L	RALGAPB_uc010zvz.1_Silent_p.L145L|RALGAPB_uc002xix.2_Silent_p.L145L|RALGAPB_uc002xiy.1_Silent_p.L145L|RALGAPB_uc002xiz.2_Intron	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit	145					activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						TACAGGTCCTGAGAGCCATTC	0.483													16	85	---	---	---	---	PASS
PLCG1	5335	broad.mit.edu	37	20	39802170	39802170	+	Silent	SNP	T	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39802170T>C	uc002xjp.1	+	28	3511	c.3390T>C	c.(3388-3390)TTT>TTC	p.F1130F	PLCG1_uc002xjo.1_Silent_p.F1130F|PLCG1_uc010zwe.1_Silent_p.F756F	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b	1130	C2.				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				AGACAGAGTTTGTGGGTCAGT	0.562											OREG0025953	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	52	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40713430	40713430	+	Missense_Mutation	SNP	T	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40713430T>C	uc002xkg.2	-	29	4212	c.4028A>G	c.(4027-4029)TAC>TGC	p.Y1343C	PTPRT_uc010ggj.2_Missense_Mutation_p.Y1362C|PTPRT_uc010ggi.2_Missense_Mutation_p.Y546C	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1343	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CGTGTCCCGGTAGGCAGGCCA	0.592													9	34	---	---	---	---	PASS
SULF2	55959	broad.mit.edu	37	20	46295089	46295089	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46295089G>T	uc002xto.2	-	12	2050	c.1720C>A	c.(1720-1722)CAA>AAA	p.Q574K	SULF2_uc002xtr.2_Missense_Mutation_p.Q574K|SULF2_uc002xtq.2_Missense_Mutation_p.Q574K|SULF2_uc010zyd.1_5'Flank	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	574					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						TTGTCATCTTGGTCCTCAGGG	0.632													37	79	---	---	---	---	PASS
B4GALT5	9334	broad.mit.edu	37	20	48259098	48259098	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48259098C>T	uc002xuu.3	-	5	707	c.513G>A	c.(511-513)CGG>CGA	p.R171R		NM_004776	NP_004767	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-	171	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	galactosyltransferase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			CGTGGCGGTTCCGGAAGGGGA	0.522													25	66	---	---	---	---	PASS
DPM1	8813	broad.mit.edu	37	20	49552786	49552786	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49552786C>G	uc002xvw.1	-	8	577	c.577G>C	c.(577-579)GAA>CAA	p.E193Q	DPM1_uc002xvv.1_Missense_Mutation_p.E123Q|DPM1_uc002xvx.1_RNA	NM_003859	NP_003850	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase 1	193					C-terminal protein lipidation|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|protein N-linked glycosylation via asparagine|protein O-linked mannosylation	dolichol-phosphate-mannose synthase complex|endoplasmic reticulum membrane|membrane fraction	dolichyl-phosphate beta-D-mannosyltransferase activity|dolichyl-phosphate-mannose-protein mannosyltransferase activity|protein binding			ovary(1)	1						TCTAGAACTTCTTTTCGGTAT	0.333													22	32	---	---	---	---	PASS
BCAS1	8537	broad.mit.edu	37	20	52570115	52570115	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52570115C>T	uc002xws.2	-	11	1874	c.1536G>A	c.(1534-1536)CAG>CAA	p.Q512Q	BCAS1_uc010zza.1_Silent_p.Q178Q|BCAS1_uc010zzb.1_Silent_p.Q438Q|BCAS1_uc010gim.2_Silent_p.Q368Q|BCAS1_uc002xwt.2_Silent_p.Q498Q|BCAS1_uc010gil.1_Silent_p.Q434Q	NM_003657	NP_003648	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	512						cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			TGTTGCTCTTCTGCTTGTTCA	0.547													20	97	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57768531	57768531	+	Silent	SNP	C	G	G	rs57571629	by1000genomes	TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57768531C>G	uc002yan.2	+	1	2457	c.2457C>G	c.(2455-2457)CCC>CCG	p.P819P		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	819						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					ACAAGCTCCCCTCAGAGAGGA	0.637													14	44	---	---	---	---	PASS
PHACTR3	116154	broad.mit.edu	37	20	58318184	58318184	+	Silent	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58318184G>T	uc002yau.2	+	2	608	c.141G>T	c.(139-141)CCG>CCT	p.P47P	PHACTR3_uc002yat.2_Silent_p.P44P|PHACTR3_uc010zzw.1_Silent_p.P6P|PHACTR3_uc002yav.2_Silent_p.P6P|PHACTR3_uc002yaw.2_Silent_p.P6P|PHACTR3_uc002yax.2_Silent_p.P6P	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1	47						nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			AAACGCCCCCGGCGCGTCCTG	0.572													23	118	---	---	---	---	PASS
ARFGAP1	55738	broad.mit.edu	37	20	61916280	61916280	+	Intron	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61916280G>T	uc002yem.2	+						ARFGAP1_uc011aas.1_Intron|ARFGAP1_uc011aat.1_Intron|ARFGAP1_uc002yel.2_Intron|ARFGAP1_uc002yen.2_Intron|ARFGAP1_uc002yeo.1_Intron|hsa-mir-4326|MI0015866_5'Flank	NM_018209	NP_060679	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating						COPI coating of Golgi vesicle|protein transport|regulation of ARF GTPase activity|retrograde vesicle-mediated transport, Golgi to ER	cytosol|Golgi-associated vesicle membrane	ARF GTPase activator activity|zinc ion binding			pancreas(1)	1	all_cancers(38;1.59e-09)					AGAAGGTAACGGGCAGCTCCG	0.632													12	15	---	---	---	---	PASS
COL20A1	57642	broad.mit.edu	37	20	61939981	61939981	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61939981C>T	uc011aau.1	+	8	963	c.863C>T	c.(862-864)ACG>ATG	p.T288M	COL20A1_uc011aav.1_Missense_Mutation_p.T109M	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	288	VWFA.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					ATTCTGGTGACGGACGGCAAG	0.667													6	18	---	---	---	---	PASS
BTG3	10950	broad.mit.edu	37	21	18977217	18977217	+	Missense_Mutation	SNP	T	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18977217T>A	uc002ykk.2	-	3	532	c.272A>T	c.(271-273)GAG>GTG	p.E91V	BTG3_uc002ykl.2_Missense_Mutation_p.E91V	NM_006806	NP_006797	Q14201	BTG3_HUMAN	B-cell translocation gene 3 isoform b	91					negative regulation of cell proliferation|negative regulation of mitotic cell cycle	cytoplasm					0				Epithelial(23;0.000283)|all cancers(11;0.0012)|Lung(58;0.0191)|OV - Ovarian serous cystadenocarcinoma(11;0.0206)|COAD - Colon adenocarcinoma(22;0.0315)|LUSC - Lung squamous cell carcinoma(23;0.0703)|Colorectal(24;0.0971)		GAGAGTGAGCTCCTTTGGCAA	0.453													27	30	---	---	---	---	PASS
BTG3	10950	broad.mit.edu	37	21	18977219	18977219	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18977219C>A	uc002ykk.2	-	3	530	c.270G>T	c.(268-270)AAG>AAT	p.K90N	BTG3_uc002ykl.2_Missense_Mutation_p.K90N	NM_006806	NP_006797	Q14201	BTG3_HUMAN	B-cell translocation gene 3 isoform b	90					negative regulation of cell proliferation|negative regulation of mitotic cell cycle	cytoplasm					0				Epithelial(23;0.000283)|all cancers(11;0.0012)|Lung(58;0.0191)|OV - Ovarian serous cystadenocarcinoma(11;0.0206)|COAD - Colon adenocarcinoma(22;0.0315)|LUSC - Lung squamous cell carcinoma(23;0.0703)|Colorectal(24;0.0971)		GAGTGAGCTCCTTTGGCAAGC	0.453													28	28	---	---	---	---	PASS
GRIK1	2897	broad.mit.edu	37	21	31015280	31015280	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31015280C>G	uc002yno.1	-	7	1428	c.964G>C	c.(964-966)GCT>CCT	p.A322P	GRIK1_uc002ynn.2_Missense_Mutation_p.A322P|GRIK1_uc011acs.1_Missense_Mutation_p.A322P|GRIK1_uc011act.1_Missense_Mutation_p.A266P|GRIK1_uc010glq.1_Missense_Mutation_p.A180P|GRIK1_uc002ynr.2_Missense_Mutation_p.A322P	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	322	Extracellular (Potential).				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	TACATCAGAGCCGCTTCAGTC	0.517													54	55	---	---	---	---	PASS
MRPS6	64968	broad.mit.edu	37	21	35514721	35514721	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35514721G>T	uc002ytp.2	+	3	377	c.199G>T	c.(199-201)GAT>TAT	p.D67Y		NM_032476	NP_115865	P82932	RT06_HUMAN	mitochondrial ribosomal protein S6	67					translation	mitochondrion|small ribosomal subunit	rRNA binding|structural constituent of ribosome			skin(1)	1						TTTCTTGGTGGATTTTTATGC	0.383													40	38	---	---	---	---	PASS
ETS2	2114	broad.mit.edu	37	21	40181949	40181949	+	Intron	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40181949C>G	uc002yxg.2	+						ETS2_uc002yxf.2_Intron	NM_005239	NP_005230	P15036	ETS2_HUMAN	v-ets erythroblastosis virus E26 oncogene						positive regulation of transcription, DNA-dependent|skeletal system development	nucleus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|breast(1)|pancreas(1)	4		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				TTTTTTTTTTCTTTTTTAAGA	0.398													10	20	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	41414427	41414427	+	Nonsense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41414427C>A	uc002yyq.1	-	32	6009	c.5557G>T	c.(5557-5559)GAG>TAG	p.E1853*	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1853	Cytoplasmic (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TCCGTGTACTCATTTGTCCCT	0.537													82	73	---	---	---	---	PASS
PRDM15	63977	broad.mit.edu	37	21	43256623	43256623	+	Missense_Mutation	SNP	C	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43256623C>A	uc002yzq.1	-	16	2346	c.2235G>T	c.(2233-2235)AAG>AAT	p.K745N	PRDM15_uc002yzo.2_Missense_Mutation_p.K416N|PRDM15_uc002yzp.2_Missense_Mutation_p.K416N|PRDM15_uc002yzr.1_Missense_Mutation_p.K416N	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	745	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCTGGAAGATCTTGCTGCAGA	0.468													69	66	---	---	---	---	PASS
PWP2	5822	broad.mit.edu	37	21	45547881	45547881	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45547881G>A	uc002zeb.2	+	18	2299	c.2209G>A	c.(2209-2211)GAC>AAC	p.D737N		NM_005049	NP_005040	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog	737	WD 14.					cytoplasm|nucleolus	signal transducer activity			pancreas(1)	1				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		CGTGCTCTTTGACCCGTTTGA	0.627													30	37	---	---	---	---	PASS
KRTAP12-4	386684	broad.mit.edu	37	21	46074512	46074512	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46074512G>C	uc002zfs.1	-	1	65	c.20C>G	c.(19-21)TCT>TGT	p.S7C	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198698	NP_941971	P60329	KR124_HUMAN	keratin associated protein 12-4	7						keratin filament				ovary(1)	1						GCAGCCCGAAGAGTGGCTGGT	0.662													11	7	---	---	---	---	PASS
ADARB1	104	broad.mit.edu	37	21	46605012	46605012	+	Intron	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46605012G>T	uc002zgy.2	+						ADARB1_uc002zgr.2_Intron|ADARB1_uc002zgs.2_Intron|ADARB1_uc002zgw.2_Intron|ADARB1_uc002zgv.2_Intron|ADARB1_uc002zgt.2_Intron|ADARB1_uc010gpx.2_Intron|ADARB1_uc002zgq.2_Intron|ADARB1_uc002zgu.2_Intron	NM_015833	NP_056648	P78563	RED1_HUMAN	RNA-specific adenosine deaminase B1 isoform 2						adenosine to inosine editing|mRNA modification|mRNA processing|RNA processing	nucleoplasm|nucleus	double-stranded RNA adenosine deaminase activity|double-stranded RNA adenosine deaminase activity|double-stranded RNA binding|double-stranded RNA binding|metal ion binding|mRNA binding|RNA binding			skin(1)	1				Colorectal(79;0.115)		GCACGGTAAGGGGCGGGGGCT	0.572													63	58	---	---	---	---	PASS
DIP2A	23181	broad.mit.edu	37	21	47952109	47952109	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47952109G>C	uc002zjo.2	+	10	1447	c.1264G>C	c.(1264-1266)GAG>CAG	p.E422Q	DIP2A_uc011afy.1_Missense_Mutation_p.E358Q|DIP2A_uc011afz.1_Missense_Mutation_p.E418Q|DIP2A_uc002zjl.2_Missense_Mutation_p.E422Q|DIP2A_uc002zjm.2_Missense_Mutation_p.E422Q|DIP2A_uc010gql.2_Missense_Mutation_p.E379Q|DIP2A_uc002zjn.2_Missense_Mutation_p.E422Q|DIP2A_uc002zjp.1_Missense_Mutation_p.E167Q	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a	422					multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		TCTCCTGGCAGAGCTGGTTCC	0.478													23	29	---	---	---	---	PASS
DGCR8	54487	broad.mit.edu	37	22	20079140	20079140	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20079140G>A	uc002zri.2	+	6	1839	c.1489G>A	c.(1489-1491)GCA>ACA	p.A497T	DGCR8_uc010grz.2_Missense_Mutation_p.A497T|DGCR8_uc002zrj.2_Missense_Mutation_p.A140T	NM_022720	NP_073557	Q8WYQ5	DGCR8_HUMAN	DiGeorge syndrome critical region gene 8	497	Necessary for heme-binding and pri-miRNA processing.|Necessary for interaction with DROSHA.				primary miRNA processing	cytoplasm|cytoplasm|microtubule cytoskeleton|nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding				0	Colorectal(54;0.0993)					AGTGCAAGATGCACCCACAAA	0.463													100	91	---	---	---	---	PASS
TRMT2A	27037	broad.mit.edu	37	22	20100675	20100675	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20100675G>A	uc002zrk.1	-	11	1730	c.1515C>T	c.(1513-1515)CTC>CTT	p.L505L	TRMT2A_uc002zrl.1_Silent_p.L505L|TRMT2A_uc002zrm.1_Silent_p.L327L|TRMT2A_uc002zrn.1_Silent_p.L523L	NM_182984	NP_892029	Q8IZ69	TRM2A_HUMAN	HpaII tiny fragments locus 9C	505					RNA processing		nucleotide binding|RNA binding|RNA methyltransferase activity			breast(1)	1						GGATGGCCACGAGGTGCTGGG	0.612													36	49	---	---	---	---	PASS
PRAME	23532	broad.mit.edu	37	22	22890745	22890745	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22890745C>G	uc002zwf.2	-	5	1430	c.1274G>C	c.(1273-1275)AGT>ACT	p.S425T	LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Missense_Mutation_p.S409T|PRAME_uc010gtr.2_Missense_Mutation_p.S425T|PRAME_uc002zwg.2_Missense_Mutation_p.S425T|PRAME_uc002zwh.2_Missense_Mutation_p.S425T|PRAME_uc002zwi.2_Missense_Mutation_p.S425T|PRAME_uc002zwj.2_Missense_Mutation_p.S425T|PRAME_uc002zwk.2_Missense_Mutation_p.S425T	NM_206956	NP_996839	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	425	LRR 4.|Mediates interaction with RARA.				apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|regulation of growth|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding			central_nervous_system(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		CTGCAGGAGACTCTGCAAGGC	0.557													9	53	---	---	---	---	PASS
SEZ6L	23544	broad.mit.edu	37	22	26769434	26769434	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26769434G>A	uc003acb.2	+	14	2968	c.2812G>A	c.(2812-2814)GAA>AAA	p.E938K	SEZ6L_uc003acc.2_Missense_Mutation_p.E938K|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Missense_Mutation_p.E711K|SEZ6L_uc010gvc.1_Intron|SEZ6L_uc011ake.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	938	Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						AGACAGTTTTGAACATGCTTT	0.323													33	48	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	32435600	32435600	+	IGR	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32435600C>T								YWHAH (82011 upstream) : SLC5A1 (3437 downstream)																							GCCATTATCCCCAGCAAGAAG	0.527													107	157	---	---	---	---	PASS
RFPL3	10738	broad.mit.edu	37	22	32756478	32756478	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32756478G>T	uc003amj.2	+	2	818	c.613G>T	c.(613-615)GGG>TGG	p.G205W	RFPL3_uc010gwn.2_Missense_Mutation_p.G176W|RFPL3S_uc003amk.2_RNA|RFPL3S_uc003aml.2_RNA	NM_001098535	NP_001092005	O75679	RFPL3_HUMAN	ret finger protein-like 3 isoform 1	205	B30.2/SPRY.						zinc ion binding			ovary(1)	1						TCACTGCAAAGGGAAGATCCA	0.567													41	60	---	---	---	---	PASS
SYN3	8224	broad.mit.edu	37	22	33327469	33327469	+	Intron	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33327469G>A	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						AATTCAGCCTGAAGAATAAAG	0.438													31	36	---	---	---	---	PASS
CELSR1	9620	broad.mit.edu	37	22	46932349	46932349	+	Missense_Mutation	SNP	C	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46932349C>G	uc003bhw.1	-	1	719	c.719G>C	c.(718-720)AGA>ACA	p.R240T		NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	240	Extracellular (Potential).				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CAGGCTCCCTCTGCCGCTCGT	0.537													9	14	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3235316	3235316	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3235316G>T	uc004crg.3	-	6	6563	c.6406C>A	c.(6406-6408)CAG>AAG	p.Q2136K		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2136	Ig-like C2-type 5.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				ACGTTCAGCTGCACCGTCCTG	0.687													9	3	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32591903	32591903	+	Missense_Mutation	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32591903G>T	uc004dda.1	-	14	1907	c.1663C>A	c.(1663-1665)CAA>AAA	p.Q555K	DMD_uc004dcz.2_Missense_Mutation_p.Q432K|DMD_uc004dcy.1_Missense_Mutation_p.Q551K|DMD_uc004ddb.1_Missense_Mutation_p.Q547K|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Missense_Mutation_p.Q547K|DMD_uc010ngp.1_Nonsense_Mutation_p.Y74*|DMD_uc010ngq.1_RNA	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	555	Spectrin 2.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AGGATGTCTTGTAAAAGAACC	0.433													17	25	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34149269	34149269	+	Missense_Mutation	SNP	T	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34149269T>C	uc004ddg.2	-	1	1160	c.1127A>G	c.(1126-1128)CAC>CGC	p.H376R		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	376										ovary(4)|central_nervous_system(1)	5						AGGCTCCGCGTGGAGACTGGA	0.637													11	25	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34149330	34149330	+	Missense_Mutation	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34149330C>T	uc004ddg.2	-	1	1099	c.1066G>A	c.(1066-1068)GAG>AAG	p.E356K		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	356										ovary(4)|central_nervous_system(1)	5						ACTCCAGTCTCGGAAGGCTCC	0.657													9	21	---	---	---	---	PASS
XK	7504	broad.mit.edu	37	X	37587032	37587032	+	Missense_Mutation	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37587032G>A	uc004ddq.2	+	3	734	c.652G>A	c.(652-654)GAG>AAG	p.E218K		NM_021083	NP_066569	P51811	XK_HUMAN	membrane transport protein XK	218	Helical; (Potential).				amino acid transport	integral to membrane	protein binding|transporter activity				0		all_lung(315;0.175)				GAGGAGCTTTGAGATTGCCAC	0.458													27	17	---	---	---	---	PASS
GPRASP2	114928	broad.mit.edu	37	X	101970929	101970929	+	Missense_Mutation	SNP	G	C	C			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101970929G>C	uc004ejk.2	+	4	2466	c.1132G>C	c.(1132-1134)GAA>CAA	p.E378Q	GPRASP2_uc004ejl.2_Missense_Mutation_p.E378Q|GPRASP2_uc004ejm.2_Missense_Mutation_p.E378Q|GPRASP2_uc011mrp.1_5'Flank	NM_138437	NP_612446	Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting	378						cytoplasm	protein binding			ovary(1)	1						GGTCAAACAAGAACCCAGGTT	0.478													43	25	---	---	---	---	PASS
TEX13B	56156	broad.mit.edu	37	X	107225187	107225187	+	Silent	SNP	G	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107225187G>A	uc004enn.1	-	2	264	c.171C>T	c.(169-171)AGC>AGT	p.S57S		NM_031273	NP_112563	Q9BXU2	TX13B_HUMAN	testis expressed 13B	57										ovary(1)	1						TGGGCACCTCGCTGTCCTCCA	0.602													63	43	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123870953	123870953	+	Silent	SNP	G	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123870953G>T	uc004euj.2	-	4	694	c.630C>A	c.(628-630)CCC>CCA	p.P210P	ODZ1_uc011muj.1_Silent_p.P210P|ODZ1_uc010nqy.2_Silent_p.P210P	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	210	Teneurin N-terminal.|Cytoplasmic (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						CCGCTGCAGGGGGTGGCTTCC	0.622													45	41	---	---	---	---	PASS
BCORL1	63035	broad.mit.edu	37	X	129147552	129147552	+	Silent	SNP	C	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129147552C>T	uc004evb.1	+	4	918	c.804C>T	c.(802-804)CTC>CTT	p.L268L	BCORL1_uc010nrd.1_Silent_p.L170L	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	268	Pro-rich.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						TGCCCACGCTCATCTCTGACT	0.592													67	49	---	---	---	---	PASS
MAMLD1	10046	broad.mit.edu	37	X	149639719	149639719	+	Missense_Mutation	SNP	A	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149639719A>G	uc004fee.1	+	3	1950	c.1874A>G	c.(1873-1875)CAG>CGG	p.Q625R	MAMLD1_uc011mxt.1_Missense_Mutation_p.Q587R|MAMLD1_uc011mxu.1_Missense_Mutation_p.Q600R|MAMLD1_uc011mxv.1_Missense_Mutation_p.Q600R|MAMLD1_uc011mxw.1_Missense_Mutation_p.Q552R	NM_005491	NP_005482	Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	625					male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(192;6.56e-05)					CAGCGTTTTCAGCGATCAGTG	0.388													4	100	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157774037	157774037	+	Intron	DEL	C	-	-	rs71658497		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157774037delC	uc001frg.2	-						FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CATGTCTCCACCCCCCCCCCA	0.527													6	3	---	---	---	---	
FAM5B	57795	broad.mit.edu	37	1	177250856	177250857	+	3'UTR	DEL	AC	-	-			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177250856_177250857delAC	uc001glf.2	+	8					FAM5B_uc001glg.2_3'UTR	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B							extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						GCGcacgcatacacacacacac	0.441													4	2	---	---	---	---	
LYST	1130	broad.mit.edu	37	1	235945481	235945481	+	Intron	DEL	T	-	-	rs11300413		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235945481delT	uc001hxj.2	-						LYST_uc009xgb.1_Intron|LYST_uc010pxs.1_Intron	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TGGGGAAttcttttttttttt	0.134									Chediak-Higashi_syndrome				4	2	---	---	---	---	
CMPK2	129607	broad.mit.edu	37	2	7001225	7001236	+	Intron	DEL	ACACACACACGC	-	-	rs149134084		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7001225_7001236delACACACACACGC	uc002qyo.2	-						CMPK2_uc010yis.1_Intron|CMPK2_uc010ewv.2_Intron	NM_207315	NP_997198	Q5EBM0	CMPK2_HUMAN	UMP-CMP kinase 2 precursor						dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATGTACGTATacacacacacgcacacacacac	0.189													6	6	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	79423063	79423066	+	Intron	DEL	TTTG	-	-	rs3979543		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79423063_79423066delTTTG	uc010yse.1	+							NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						AACTCAGttttttgtttgtttgtt	0.201													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91902877	91902878	+	IGR	DEL	AT	-	-			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91902877_91902878delAT								LOC654342 (54902 upstream) : GGT8P (60490 downstream)																							AAATGCAAACATATGGAAATTT	0.317													4	3	---	---	---	---	
OLA1	29789	broad.mit.edu	37	2	175006417	175006418	+	Intron	INS	-	T	T	rs148877495	by1000genomes	TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175006417_175006418insT	uc002uih.2	-						OLA1_uc002uii.2_Intron|OLA1_uc010fqq.2_Intron|OLA1_uc002uij.2_Intron|OLA1_uc002uik.2_Intron|OLA1_uc010fqr.2_Intron	NM_013341	NP_037473	Q9NTK5	OLA1_HUMAN	Obg-like ATPase 1 isoform 1						ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding			ovary(1)|breast(1)	2						TTCCTTAACAATTTTTTTTAAC	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	208896715	208896716	+	IGR	INS	-	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208896715_208896716insT								PLEKHM3 (6431 upstream) : CRYGD (89616 downstream)																							AAGAAAGCCTGTTTTTTTTTTT	0.322													4	2	---	---	---	---	
TBL1XR1	79718	broad.mit.edu	37	3	176767668	176767671	+	Intron	DEL	TTAC	-	-	rs35503291		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176767668_176767671delTTAC	uc003fiw.3	-						TBL1XR1_uc003fix.3_Intron|TBL1XR1_uc011bpz.1_Intron	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			CGGTTTGTTGTTACTAGTTAATAA	0.333													4	5	---	---	---	---	
FBXW7	55294	broad.mit.edu	37	4	153247487	153247488	+	Intron	DEL	TT	-	-			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153247487_153247488delTT	uc003ims.2	-						FBXW7_uc011cii.1_Intron|FBXW7_uc003imt.2_Intron|FBXW7_uc011cih.1_Intron|FBXW7_uc003imq.2_Intron|FBXW7_uc003imr.2_Intron	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform						interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding			haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				GTTTTTTAGCTTTTTTTTTTTT	0.292			Mis|N|D|F		colorectal|endometrial|T-ALL								5	3	---	---	---	---	
ADAMTS2	9509	broad.mit.edu	37	5	178770715	178770715	+	Intron	DEL	A	-	-			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178770715delA	uc003mjw.2	-						ADAMTS2_uc011dgm.1_Intron	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		ACCCTTTTCCAAAACCCAGGC	0.607													4	2	---	---	---	---	
NUDT1	4521	broad.mit.edu	37	7	2290259	2290260	+	Intron	INS	-	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2290259_2290260insT	uc003slp.1	+						NUDT1_uc003slq.1_Intron|NUDT1_uc003slr.1_Intron|NUDT1_uc003sls.1_Intron|NUDT1_uc003slt.1_Intron|NUDT1_uc003slu.1_Intron|NUDT1_uc003slv.1_Intron	NM_198949	NP_945187	P36639	8ODP_HUMAN	nudix-type motif 1 isoform p22						DNA protection|DNA repair|response to oxidative stress	cytoplasm	8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity|8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity|GTPase activity|metal ion binding|protein binding				0		Ovarian(82;0.0253)|Melanoma(862;0.155)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.8e-14)|BRCA - Breast invasive adenocarcinoma(126;0.15)		cgcccggctaatttttttgtat	0.000								Direct_reversal_of_damage|Modulation_of_nucleotide_pools					6	4	---	---	---	---	
NUP205	23165	broad.mit.edu	37	7	135287859	135287860	+	Intron	DEL	AC	-	-			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135287859_135287860delAC	uc003vsw.2	+							NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						GCCTCAttttactttttttttt	0.153													4	4	---	---	---	---	
TRY6	154754	broad.mit.edu	37	7	142481471	142481472	+	Intron	INS	-	GCTTAA	GCTTAA			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142481471_142481472insGCTTAA	uc011ksq.1	+						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc003wan.1_Intron	NR_001296				SubName: Full=Protease, serine, 3; Flags: Fragment;												0						CTCACCTCCAGGACACATTTCT	0.480													4	2	---	---	---	---	
ZFAT	57623	broad.mit.edu	37	8	135602974	135602976	+	Intron	DEL	CAA	-	-	rs146800539		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135602974_135602976delCAA	uc003yup.2	-						ZFAT_uc003yun.2_Intron|ZFAT_uc003yuo.2_Intron|ZFAT_uc010meh.2_Intron|ZFAT_uc010mei.2_Intron|ZFAT_uc003yuq.2_Intron|ZFAT_uc010mej.2_Intron	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			ccaccaccaccaacaccaccacc	0.000													6	3	---	---	---	---	
TOP1MT	116447	broad.mit.edu	37	8	144403663	144403666	+	Intron	DEL	CACG	-	-	rs72210604		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144403663_144403666delCACG	uc003yxz.2	-						TOP1MT_uc011lkd.1_Intron|TOP1MT_uc011lke.1_Intron|TOP1MT_uc010mfb.2_Intron|TOP1MT_uc011lkf.1_Intron|TOP1MT_uc010mfd.1_Intron	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor						DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	gcacgccacacacgcacgccacac	0.137													5	6	---	---	---	---	
AKR1C4	1109	broad.mit.edu	37	10	5246177	5246178	+	Intron	INS	-	GTA	GTA	rs140536638	by1000genomes	TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5246177_5246178insGTA	uc001ihw.2	+							NM_001818	NP_001809	P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4						androgen metabolic process|bile acid biosynthetic process	cytosol	aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid transmembrane transporter activity|chlordecone reductase activity|electron carrier activity			ovary(1)	1					NADH(DB00157)	ATATGCAATATGTAGCTTTCAT	0.307													6	4	---	---	---	---	
LOC731789	731789	broad.mit.edu	37	10	26939628	26939628	+	RNA	DEL	C	-	-			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26939628delC	uc001isu.3	+	4		c.5622delC				NR_026794				Homo sapiens mRNA; cDNA DKFZp686G1626 (from clone DKFZp686G1626).												0						ACCCAGCCGTCCCCcaggaga	0.284													18	8	---	---	---	---	
VWA2	340706	broad.mit.edu	37	10	116006264	116006265	+	Intron	INS	-	A	A			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116006264_116006265insA	uc001lbl.1	+						VWA2_uc001lbk.1_Intron|VWA2_uc009xyf.1_Intron	NM_198496	NP_940898	Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2							extracellular region				ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5				Epithelial(162;0.036)|all cancers(201;0.0793)		aactccatctcaaaaaaaaaaa	0.173													6	3	---	---	---	---	
DDB2	1643	broad.mit.edu	37	11	47251369	47251370	+	Intron	INS	-	T	T	rs11445579		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47251369_47251370insT	uc001neb.2	+						DDB2_uc001nec.2_Intron|DDB2_uc009yli.1_Intron|DDB2_uc001ned.2_Intron|DDB2_uc001nee.2_Intron|DDB2_uc001nef.2_Intron|DDB2_uc001neg.2_Intron|DDB2_uc001neh.2_Intron	NM_000107	NP_000098	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2						nucleotide-excision repair, DNA damage removal|protein autoubiquitination|protein polyubiquitination|response to UV	nucleoplasm|protein complex	damaged DNA binding|protein binding			kidney(2)|ovary(1)	3						gatggctcttcttttttttttt	0.000			Mis|N			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				7	4	---	---	---	---	
FADS2	9415	broad.mit.edu	37	11	61602459	61602461	+	Intron	DEL	CCA	-	-	rs149597144	by1000genomes	TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61602459_61602461delCCA	uc001nsl.1	+						FADS2_uc001nsj.2_Intron|FADS2_uc010rlo.1_Intron|FADS2_uc001nsk.2_Intron	NM_004265	NP_004256	O95864	FADS2_HUMAN	fatty acid desaturase 2						electron transport chain|transport|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	heme binding			ovary(1)|pancreas(1)	2					Alpha-Linolenic Acid(DB00132)	gcctgcccccccaccccagccct	0.379													4	3	---	---	---	---	
SNAPC1	6617	broad.mit.edu	37	14	62234188	62234188	+	Intron	DEL	T	-	-			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62234188delT	uc001xft.2	+							NM_003082	NP_003073	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex,						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		GACTTTTAGCttttttttttt	0.144													6	3	---	---	---	---	
MIR544	664613	broad.mit.edu	37	14	101514904	101514905	+	5'Flank	DEL	GT	-	-	rs112536165		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101514904_101514905delGT	hsa-mir-544|MI0003515	+						MIR655_hsa-mir-655|MI0003677_5'Flank																	0						CACCTCTGGGgtgtgtgtgtgt	0.312													4	2	---	---	---	---	
TYRO3	7301	broad.mit.edu	37	15	41865130	41865130	+	Intron	DEL	G	-	-			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41865130delG	uc001zof.1	+							NM_006293	NP_006284	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase precursor							integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			ovary(3)|lung(2)|central_nervous_system(1)	6		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TTTCTGGCCAGGGACCCCCAT	0.602													11	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102299886	102299887	+	5'Flank	INS	-	G	G			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102299886_102299887insG	uc002bzh.1	-						uc002bzk.2_5'Flank|uc002bzn.2_5'Flank|uc010uso.1_5'Flank|uc002bzs.2_5'Flank|uc010usv.1_5'Flank|uc002cal.2_5'Flank|uc002cam.2_5'Flank|uc010usx.1_5'Flank|uc002cao.2_5'Flank|uc002cap.2_5'Flank|uc002caq.2_5'Flank|uc010usz.1_5'Flank|uc010uta.1_5'Flank|uc002cas.2_5'Flank|uc002cat.1_5'Flank|uc002cau.2_5'Flank|uc010utb.1_5'Flank|uc002cav.2_5'Flank|uc002caw.2_5'Flank|uc002cax.2_5'Flank|uc010utc.1_5'Flank|uc002cay.2_5'Flank|uc002cbb.2_5'Flank|uc002cbc.1_5'Flank|uc002cbd.2_5'Flank|uc002cbe.2_5'Flank|uc002cbg.2_5'Flank|uc002cbh.2_5'Flank|uc002cbi.2_5'Flank|uc002cbk.2_5'Flank|uc002cbl.2_5'Flank|uc010utd.1_5'Flank					DQ575740																		AACCTGTACTCGCGTCGGAACC	0.589													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32471773	32471774	+	IGR	INS	-	A	A	rs149995933	by1000genomes	TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32471773_32471774insA								HERC2P4 (307899 upstream) : TP53TG3B (213067 downstream)																							TATCACTTGCTAAAAAAAAATC	0.252													4	2	---	---	---	---	
HYDIN	54768	broad.mit.edu	37	16	71218891	71218891	+	Frame_Shift_Del	DEL	A	-	-			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71218891delA	uc002ezr.2	-	3	266	c.138delT	c.(136-138)CTTfs	p.L46fs	HYDIN_uc010cfz.1_5'UTR|HYDIN_uc002ezv.2_Frame_Shift_Del_p.L46fs|HYDIN_uc010vmc.1_Frame_Shift_Del_p.L63fs|HYDIN_uc010vmd.1_Frame_Shift_Del_p.L73fs|HYDIN_uc002ezw.3_Frame_Shift_Del_p.L63fs	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	46										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				CTGAGGGTGTAAGCTAGAATG	0.393													29	18	---	---	---	---	
HOXB3	3213	broad.mit.edu	37	17	46629934	46629934	+	5'UTR	DEL	C	-	-			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46629934delC	uc002inn.2	-	1					HOXB3_uc010wlm.1_Intron|HOXB3_uc010dbf.2_5'UTR|HOXB3_uc010dbg.2_Intron|HOXB3_uc002ino.2_5'UTR|HOXB3_uc010wlk.1_Intron|HOXB3_uc010wll.1_Intron	NM_002146	NP_002137	P14651	HXB3_HUMAN	homeobox B3						angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						ACACGCCGGAccccccccccc	0.512													6	4	---	---	---	---	
ADNP2	22850	broad.mit.edu	37	18	77896699	77896700	+	3'UTR	INS	-	A	A	rs149305900		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77896699_77896700insA	uc002lnw.2	+	4						NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2						cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		ATAAAACTTGCAAAAAAAAAAA	0.307													6	4	---	---	---	---	
EMR3	84658	broad.mit.edu	37	19	14761747	14761748	+	Intron	INS	-	T	T			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14761747_14761748insT	uc002mzi.3	-						EMR3_uc010dzp.2_Intron|EMR3_uc010xnv.1_Intron	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						GGGAAAATGTCTTTTTTTTTTT	0.411													4	2	---	---	---	---	
CEACAM21	90273	broad.mit.edu	37	19	42083433	42083434	+	Intron	DEL	AC	-	-			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42083433_42083434delAC	uc002ore.3	+						CEACAM21_uc002orc.1_Intron|CEACAM21_uc002ord.1_Intron|CEACAM21_uc002orf.2_Intron|CEACAM21_uc002org.3_Intron	NM_001098506	NP_001091976	Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion							integral to membrane				ovary(1)	1						ACCCAGTAGGacacacacacac	0.302													6	3	---	---	---	---	
UBE2M	9040	broad.mit.edu	37	19	59068153	59068153	+	Frame_Shift_Del	DEL	C	-	-			TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59068153delC	uc002qtl.3	-	4	843	c.248delG	c.(247-249)GGCfs	p.G83fs	CHMP2A_uc002qti.2_5'Flank|CHMP2A_uc002qtj.2_5'Flank|CHMP2A_uc002qtk.2_5'Flank|LOC100131691_uc002qtm.2_5'Flank	NM_003969	NP_003960	P61081	UBC12_HUMAN	ubiquitin-conjugating enzyme E2M	83					protein neddylation		ATP binding|NEDD8 ligase activity|protein binding|ribosomal S6-glutamic acid ligase activity|ubiquitin-protein ligase activity			ovary(1)|pancreas(1)	2		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GTAACCCTGGCCCACCTGGCT	0.597													66	60	---	---	---	---	
STAU1	6780	broad.mit.edu	37	20	47782357	47782358	+	Intron	DEL	CT	-	-	rs72593076		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47782357_47782358delCT	uc002xud.2	-						STAU1_uc002xua.2_Intron|STAU1_uc002xub.2_Intron|STAU1_uc002xuc.2_Intron|STAU1_uc002xue.2_Intron|STAU1_uc002xuf.2_Intron|STAU1_uc002xug.2_Intron	NM_017453	NP_059347	O95793	STAU1_HUMAN	staufen isoform b							microtubule associated complex|rough endoplasmic reticulum|stress granule	double-stranded RNA binding			ovary(4)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			ACTGAGGCCCCTGTCAACCCCT	0.431													5	3	---	---	---	---	
AGPAT3	56894	broad.mit.edu	37	21	45390750	45390750	+	Intron	DEL	A	-	-	rs72381560		TCGA-33-6737-01	TCGA-33-6737-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45390750delA	uc002zdv.2	+						AGPAT3_uc002zdw.2_Intron|AGPAT3_uc002zdx.2_Intron|AGPAT3_uc002zdy.2_Intron	NM_020132	NP_064517	Q9NRZ7	PLCC_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 3						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0				STAD - Stomach adenocarcinoma(101;0.18)|Colorectal(79;0.24)		TGATTTCTTTAAAAAAAAAAA	0.542													3	3	---	---	---	---	
