Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
RERE	473	broad.mit.edu	37	1	8418817	8418817	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8418817C>T	uc001ape.2	-	21	4588	c.3778G>A	c.(3778-3780)GCC>ACC	p.A1260T	RERE_uc001apf.2_Missense_Mutation_p.A1260T|RERE_uc001apd.2_Missense_Mutation_p.A706T	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	1260					multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		TGGGGCCGGGCGTACTCGCTC	0.652													10	68	---	---	---	---	PASS
SERINC2	347735	broad.mit.edu	37	1	31898722	31898722	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31898722G>A	uc010ogh.1	+	5	785	c.584G>A	c.(583-585)GGC>GAC	p.G195D	SERINC2_uc010ogg.1_Missense_Mutation_p.G192D|SERINC2_uc009vtw.1_Silent_p.G164G|SERINC2_uc001bst.2_Missense_Mutation_p.G191D|SERINC2_uc001bsu.2_Missense_Mutation_p.G136D|SERINC2_uc001bsv.2_Missense_Mutation_p.G136D	NM_178865	NP_849196	Q96SA4	SERC2_HUMAN	tumor differentially expressed 2-like	191						integral to membrane					0		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		CGGTGGCTGGGCAAGGCCGAG	0.652													4	79	---	---	---	---	PASS
KPNA6	23633	broad.mit.edu	37	1	32628049	32628049	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32628049C>G	uc001bug.2	+	9	923	c.835C>G	c.(835-837)CTG>GTG	p.L279V	KPNA6_uc001buh.2_Missense_Mutation_p.L54V|KPNA6_uc010ogx.1_Missense_Mutation_p.L276V|KPNA6_uc010ogy.1_Missense_Mutation_p.L284V|KPNA6_uc009vtz.2_Missense_Mutation_p.L174V	NM_012316	NP_036448	O60684	IMA7_HUMAN	karyopherin alpha 6	279	ARM 5.				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CCTTTCTTATCTGTCTGATGG	0.542													6	203	---	---	---	---	PASS
LCK	3932	broad.mit.edu	37	1	32742336	32742336	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32742336G>A	uc001bux.2	+	9	1051	c.913G>A	c.(913-915)GCT>ACT	p.A305T	LCK_uc001buy.2_Missense_Mutation_p.A305T|LCK_uc001buz.2_Missense_Mutation_p.A305T|LCK_uc010ohc.1_Missense_Mutation_p.A349T|LCK_uc001bva.2_Missense_Mutation_p.A312T	NM_005356	NP_005347	P06239	LCK_HUMAN	lymphocyte-specific protein tyrosine kinase	305	Protein kinase.				activation of caspase activity|cellular zinc ion homeostasis|induction of apoptosis|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of T cell receptor signaling pathway|regulation of defense response to virus by virus|release of sequestered calcium ion into cytosol|response to drug|T cell costimulation|T cell differentiation|T cell receptor signaling pathway|viral reproduction	cytosol|Golgi apparatus|membrane raft|pericentriolar material|plasma membrane	ATP binding|ATPase binding|CD4 receptor binding|CD8 receptor binding|glycoprotein binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein kinase binding|protein serine/threonine phosphatase activity|SH2 domain binding			lung(3)|central_nervous_system(2)|ovary(1)	6		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)	TCGGCTCTACGCTGTGGTCAC	0.602			T	TRB@	T-ALL								18	13	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34128589	34128589	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34128589C>A	uc001bxn.1	-	26	4065	c.4036G>T	c.(4036-4038)GCC>TCC	p.A1346S	CSMD2_uc001bxm.1_Missense_Mutation_p.A1386S|CSMD2_uc001bxo.1_Missense_Mutation_p.A259S	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1346	CUB 8.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTGGGCAGGGCCGGGCCACTC	0.577													107	209	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34128590	34128590	+	Silent	SNP	C	T	T	rs115110975	byFrequency	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34128590C>T	uc001bxn.1	-	26	4064	c.4035G>A	c.(4033-4035)CCG>CCA	p.P1345P	CSMD2_uc001bxm.1_Silent_p.P1385P|CSMD2_uc001bxo.1_Silent_p.P258P	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1345	CUB 8.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGGGCAGGGCCGGGCCACTCA	0.572													109	205	---	---	---	---	PASS
GRIK3	2899	broad.mit.edu	37	1	37324736	37324736	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37324736G>A	uc001caz.2	-	7	1212	c.1077C>T	c.(1075-1077)GGC>GGT	p.G359G	GRIK3_uc001cba.1_Silent_p.G359G	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	359	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	TGAAGCGGCCGCCAAAGCGCC	0.567													189	107	---	---	---	---	PASS
FHL3	2275	broad.mit.edu	37	1	38463723	38463723	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38463723G>A	uc001ccj.2	-	4	500	c.413C>T	c.(412-414)TCC>TTC	p.S138F	FHL3_uc001cck.2_Missense_Mutation_p.S138F|FHL3_uc001ccl.2_Missense_Mutation_p.S138F|FHL3_uc001ccm.2_Missense_Mutation_p.S30F|FHL3_uc009vvl.1_Missense_Mutation_p.S138F	NM_004468	NP_004459	Q13643	FHL3_HUMAN	four and a half LIM domains 3	138	LIM zinc-binding 2.				muscle organ development		zinc ion binding				0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				AAAAGAACGGGAGCCCAGTGG	0.617													28	209	---	---	---	---	PASS
ZMYND12	84217	broad.mit.edu	37	1	42898856	42898856	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42898856C>G	uc001chj.2	-	7	1203	c.933G>C	c.(931-933)AAG>AAC	p.K311N	ZMYND12_uc010ojt.1_Missense_Mutation_p.K201N	NM_032257	NP_115633	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12 isoform 1	311						intracellular	zinc ion binding			ovary(1)	1	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGACCAGGATCTTCAGAACAA	0.393													11	769	---	---	---	---	PASS
KDM4A	9682	broad.mit.edu	37	1	44126006	44126006	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44126006G>T	uc001cjx.2	+	4	518	c.352G>T	c.(352-354)GAG>TAG	p.E118*	KDM4A_uc010oki.1_Nonsense_Mutation_p.E118*	NM_014663	NP_055478	O75164	KDM4A_HUMAN	jumonji domain containing 2A	118					interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleolus	histone demethylase activity (H3-K36 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1						TGAAGAGCTCGAGCGGAAAta	0.284													79	131	---	---	---	---	PASS
TESK2	10420	broad.mit.edu	37	1	45887417	45887417	+	Silent	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45887417G>C	uc001cns.1	-	3	727	c.324C>G	c.(322-324)CTC>CTG	p.L108L	TESK2_uc009vxr.1_Silent_p.L108L|TESK2_uc010olo.1_Silent_p.L25L|TESK2_uc009vxs.1_5'UTR|TESK2_uc010olp.1_Silent_p.L108L	NM_007170	NP_009101	Q96S53	TESK2_HUMAN	testis-specific protein kinase 2	108	Protein kinase.				actin cytoskeleton organization|focal adhesion assembly|spermatogenesis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(2)|pancreas(1)	5	Acute lymphoblastic leukemia(166;0.155)					TGGGATGGGAGAGTCTATTCA	0.428													20	645	---	---	---	---	PASS
TCTEX1D1	200132	broad.mit.edu	37	1	67243017	67243017	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67243017G>A	uc001dcv.2	+	5	551	c.420G>A	c.(418-420)CAG>CAA	p.Q140Q	TCTEX1D1_uc009wau.2_RNA|TCTEX1D1_uc009wav.2_RNA	NM_152665	NP_689878	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1	140											0						TGAACAGGCAGAGCATACTTA	0.368													148	103	---	---	---	---	PASS
SERBP1	26135	broad.mit.edu	37	1	67895808	67895808	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67895808G>C	uc001ddv.2	-	1	316	c.176C>G	c.(175-177)GCC>GGC	p.A59G	SERBP1_uc001ddx.2_Missense_Mutation_p.A59G|SERBP1_uc001ddy.2_Missense_Mutation_p.A59G|SERBP1_uc001ddw.2_Missense_Mutation_p.A59G	NM_001018067	NP_001018077	Q8NC51	PAIRB_HUMAN	SERPINE1 mRNA binding protein 1 isoform 1	59					regulation of mRNA stability	nucleus|perinuclear region of cytoplasm	mRNA 3'-UTR binding|protein binding			skin(1)	1						GTTGGTCTGGGCCGCGGCCTG	0.647													65	13	---	---	---	---	PASS
DIRAS3	9077	broad.mit.edu	37	1	68512891	68512891	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68512891C>A	uc001ded.2	-	2	385	c.90G>T	c.(88-90)AAG>AAT	p.K30N	uc001deb.1_Intron|uc001dec.1_Intron	NM_004675	NP_004666	O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3	30					regulation of cyclin-dependent protein kinase activity|regulation of gene expression by genetic imprinting|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			skin(1)	1						TCCTGTGGGGCTTGAAGGCGC	0.602													4	49	---	---	---	---	PASS
PTBP2	58155	broad.mit.edu	37	1	97243153	97243153	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97243153G>T	uc001drq.2	+	6	691	c.445G>T	c.(445-447)GTT>TTT	p.V149F	PTBP2_uc001drn.2_Missense_Mutation_p.V149F|PTBP2_uc001dro.2_Missense_Mutation_p.V149F|PTBP2_uc010otz.1_Missense_Mutation_p.V160F|PTBP2_uc001drp.2_RNA|PTBP2_uc009wdw.2_Missense_Mutation_p.V97F|PTBP2_uc001drr.2_Missense_Mutation_p.V149F|PTBP2_uc010oua.1_Missense_Mutation_p.V157F|PTBP2_uc001dru.2_RNA	NM_021190	NP_067013	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	149							nucleotide binding				0		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		TGCTCAGGCAGTTCTTCAAGC	0.443													43	12	---	---	---	---	PASS
SNX7	51375	broad.mit.edu	37	1	99150477	99150477	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99150477A>G	uc010ouc.1	+	2	269	c.217A>G	c.(217-219)ATG>GTG	p.M73V	SNX7_uc001dsa.2_Missense_Mutation_p.M9V|SNX7_uc010oud.1_Missense_Mutation_p.M73V	NM_015976	NP_057060	Q9UNH6	SNX7_HUMAN	sorting nexin 7 isoform a	9					cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		CTTCAGCCCTATGATGCCAAC	0.338													102	17	---	---	---	---	PASS
CHIA	27159	broad.mit.edu	37	1	111855005	111855005	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111855005G>A	uc001eas.2	+	4	352	c.249G>A	c.(247-249)CTG>CTA	p.L83L	CHIA_uc001ear.2_Intron|CHIA_uc001eaq.2_Intron|CHIA_uc009wgc.2_Intron|CHIA_uc001eat.2_Intron|CHIA_uc001eav.2_Intron|CHIA_uc001eau.2_Intron|CHIA_uc009wgd.2_Intron	NM_201653	NP_970615	Q9BZP6	CHIA_HUMAN	acidic chitinase isoform c	83					apoptosis|cell wall chitin metabolic process|chitin catabolic process|digestion|immune response|positive regulation of chemokine secretion|production of molecular mediator involved in inflammatory response|response to acid|response to fungus	cytoplasm|extracellular space	cation binding|chitin binding|chitinase activity|kinase binding|lysozyme activity|sugar binding			ovary(1)	1		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		TCAATGGCCTGAAAAATAAGT	0.368													10	89	---	---	---	---	PASS
GPR89B	51463	broad.mit.edu	37	1	147408773	147408773	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147408773C>T	uc001epv.3	+	2	219	c.75C>T	c.(73-75)TTC>TTT	p.F25F	GPR89B_uc010ozs.1_Silent_p.F25F|GPR89B_uc010ozt.1_5'UTR|GPR89B_uc010ozu.1_5'UTR|GPR89B_uc001epw.3_5'UTR|GPR89B_uc010ozv.1_5'UTR	NM_016334	NP_057418	B7ZAQ6	GPHRA_HUMAN	G protein-coupled receptor 89B	25	Helical; (Potential).				intracellular pH reduction|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein transport	Golgi cisterna membrane|Golgi-associated vesicle membrane|integral to membrane	signal transducer activity|voltage-gated anion channel activity				0	all_hematologic(923;0.0276)					GGCTTTTCTTCATGCGCCAAT	0.299													10	280	---	---	---	---	PASS
CTSK	1513	broad.mit.edu	37	1	150772182	150772182	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150772182C>A	uc001evp.1	-	6	746	c.622G>T	c.(622-624)GAG>TAG	p.E208*	CTSK_uc001evq.1_Nonsense_Mutation_p.E119*	NM_000396	NP_000387	P43235	CATK_HUMAN	cathepsin K preproprotein	208					proteolysis	lysosome	cysteine-type endopeptidase activity|protein binding			skin(1)	1	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			ATACAACTCTCTTCCTGGAAG	0.468													68	184	---	---	---	---	PASS
SETDB1	9869	broad.mit.edu	37	1	150931785	150931785	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150931785A>G	uc001evu.2	+	15	2652	c.2462A>G	c.(2461-2463)GAT>GGT	p.D821G	SETDB1_uc001evv.2_Missense_Mutation_p.D821G|SETDB1_uc009wmg.1_Missense_Mutation_p.D821G	NM_001145415	NP_001138887	Q15047	SETB1_HUMAN	SET domain, bifurcated 1 isoform 1	821	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			CGCTGCTTGGATGACATTGCC	0.458													105	173	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152188316	152188316	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152188316G>C	uc001ezt.1	-	3	5865	c.5789C>G	c.(5788-5790)TCC>TGC	p.S1930C		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	1930	21.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGACTGACGGGAGCCAGACCC	0.577													58	720	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152324336	152324336	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152324336G>C	uc001ezw.3	-	3	5999	c.5926C>G	c.(5926-5928)CAC>GAC	p.H1976D	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1976							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTTGACCGTGAGTGTGTCCT	0.527													201	499	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152326177	152326177	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152326177C>T	uc001ezw.3	-	3	4158	c.4085G>A	c.(4084-4086)AGA>AAA	p.R1362K	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1362							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGTGTGGTCTATGTGAGAC	0.468													166	238	---	---	---	---	PASS
LELP1	149018	broad.mit.edu	37	1	153177281	153177281	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153177281C>A	uc001fbl.2	+	2	208	c.98C>A	c.(97-99)CCC>CAC	p.P33H		NM_001010857	NP_001010857	Q5T871	LELP1_HUMAN	late cornified envelope-like proline-rich 1	33	Cys/Pro-rich.									ovary(1)	1	all_lung(78;3.51e-31)|Lung NSC(65;1.34e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAATGCCAGCCCAGCTGTTTA	0.502													125	129	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155792234	155792234	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155792234C>T	uc001flz.2	-	4	828	c.731G>A	c.(730-732)AGA>AAA	p.R244K	GON4L_uc001fly.1_Missense_Mutation_p.R244K|GON4L_uc009wrh.1_Missense_Mutation_p.R244K|GON4L_uc001fma.1_Missense_Mutation_p.R244K|GON4L_uc001fmc.2_Missense_Mutation_p.R244K|GON4L_uc001fmd.3_Missense_Mutation_p.R244K|GON4L_uc009wri.2_5'UTR|GON4L_uc001fme.2_Missense_Mutation_p.R72K|GON4L_uc001fmf.2_5'Flank	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	244					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TTTCTTTTTTCTCCTTTTCTC	0.428													130	128	---	---	---	---	PASS
LMNA	4000	broad.mit.edu	37	1	156084925	156084925	+	Silent	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156084925C>A	uc001fni.2	+	1	465	c.216C>A	c.(214-216)CGC>CGA	p.R72R	LMNA_uc001fnf.1_Silent_p.R72R|LMNA_uc001fng.2_Silent_p.R72R|LMNA_uc001fnh.2_Silent_p.R72R|LMNA_uc009wro.1_Silent_p.R72R	NM_170707	NP_733821	P02545	LMNA_HUMAN	lamin A/C isoform 1 precursor	72	Interaction with MLIP.|Linker 1.|Rod.				cellular component disassembly involved in apoptosis|cellular response to hypoxia|establishment or maintenance of microtubule cytoskeleton polarity|muscle organ development|positive regulation of cell aging|regulation of apoptosis|regulation of cell migration	cytoplasm|lamin filament|nuclear envelope|nuclear envelope|perinuclear region of cytoplasm	protein binding|structural molecule activity|structural molecule activity			ovary(2)	2	Hepatocellular(266;0.158)					TGGTCAGCCGCGAGGTGTCCG	0.657									Werner_syndrome|Hutchinson-Gilford_Progeria_Syndrome				12	14	---	---	---	---	PASS
FCRL4	83417	broad.mit.edu	37	1	157548273	157548273	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157548273C>T	uc001fqw.2	-	10	1556	c.1420G>A	c.(1420-1422)GAA>AAA	p.E474K	FCRL4_uc010phy.1_RNA	NM_031282	NP_112572	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4 precursor	474	Cytoplasmic (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(2)|kidney(1)|skin(1)	4	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				CCTTCCTCTTCTTCTCCCAGC	0.313													19	179	---	---	---	---	PASS
CD1B	910	broad.mit.edu	37	1	158299295	158299295	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158299295C>A	uc001frx.2	-	4	859	c.751G>T	c.(751-753)GGG>TGG	p.G251W	CD1B_uc001frw.2_Intron	NM_001764	NP_001755	P29016	CD1B_HUMAN	CD1B antigen precursor	251	Extracellular (Potential).|Ig-like.				antigen processing and presentation|immune response	endosome membrane|integral to membrane|lysosomal membrane|plasma membrane	protein binding			ovary(2)	2	all_hematologic(112;0.0378)					AGGATGTCCCCTAGCTGAGTG	0.607													123	154	---	---	---	---	PASS
OR10R2	343406	broad.mit.edu	37	1	158449987	158449987	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158449987C>T	uc010pik.1	+	1	320	c.320C>T	c.(319-321)TCT>TTT	p.S107F	uc001fso.1_RNA	NM_001004472	NP_001004472	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R,	107	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)					AATCTACTTTCTGTGGCCAGG	0.443													32	648	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158621261	158621261	+	Intron	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158621261G>A	uc001fst.1	-							NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1						actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TTCAAATCCTGAATGGGAAAA	0.423													19	318	---	---	---	---	PASS
OR10J1	26476	broad.mit.edu	37	1	159409591	159409591	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159409591G>A	uc010piv.1	+	1	43	c.43G>A	c.(43-45)GAG>AAG	p.E15K	uc001fts.3_Intron	NM_012351	NP_036483	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J,	15	Extracellular (Potential).				sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0429)					CATGAAAAGAGAGAACTTTAC	0.383													15	327	---	---	---	---	PASS
VANGL2	57216	broad.mit.edu	37	1	160394055	160394055	+	Silent	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160394055G>C	uc001fwb.1	+	8	1586	c.1287G>C	c.(1285-1287)ACG>ACC	p.T429T	VANGL2_uc001fwc.1_Silent_p.T429T	NM_020335	NP_065068	Q9ULK5	VANG2_HUMAN	vang-like 2	429	Cytoplasmic (Potential).				apical protein localization|heart looping|nonmotile primary cilium assembly	apical plasma membrane|integral to membrane				ovary(1)	1	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCTGCATCACGCATGACATGA	0.562													37	46	---	---	---	---	PASS
DDR2	4921	broad.mit.edu	37	1	162745571	162745571	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162745571C>T	uc001gcf.2	+	16	2451	c.1986C>T	c.(1984-1986)CTC>CTT	p.L662L	DDR2_uc001gcg.2_Silent_p.L662L	NM_001014796	NP_001014796	Q16832	DDR2_HUMAN	discoidin domain receptor family, member 2	662	Cytoplasmic (Potential).|Protein kinase.				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)			ATGGAGATCTCAATCAGTTTC	0.488													48	253	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169510160	169510160	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169510160C>G	uc001ggg.1	-	13	4313	c.4168G>C	c.(4168-4170)GAG>CAG	p.E1390Q		NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	1390	2-23.|35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	AGGGGCATCTCACTGAGGTCT	0.512													156	182	---	---	---	---	PASS
C1orf125	126859	broad.mit.edu	37	1	179502981	179502981	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179502981G>T	uc001gmo.2	+	24	2894	c.2767G>T	c.(2767-2769)GCT>TCT	p.A923S	C1orf125_uc009wxg.2_RNA|C1orf125_uc001gmp.2_Missense_Mutation_p.A849S|C1orf125_uc009wxh.2_RNA	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	923	Glu-rich.										0						TGAAGCAATGGCTGTAATTGA	0.388													94	108	---	---	---	---	PASS
FAM163A	148753	broad.mit.edu	37	1	179783283	179783283	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179783283G>A	uc009wxj.2	+	6	922	c.463G>A	c.(463-465)GAG>AAG	p.E155K	FAM163A_uc001gnj.2_Missense_Mutation_p.E155K|FAM163A_uc009wxk.2_Missense_Mutation_p.E155K	NM_173509	NP_775780	Q96GL9	F163A_HUMAN	hypothetical protein LOC148753	155						integral to membrane				ovary(1)	1						CTCTGGGCGTGAGGCCTTCAC	0.612													10	234	---	---	---	---	PASS
TOR1AIP2	163590	broad.mit.edu	37	1	179820126	179820126	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179820126G>C	uc001gnk.2	-	4	795	c.407C>G	c.(406-408)TCT>TGT	p.S136C	TOR1AIP2_uc001gnl.2_Missense_Mutation_p.S136C	NM_145034	NP_659471	Q8NFQ8	TOIP2_HUMAN	torsin A interacting protein 2	136						endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1						GAGGGCCACAGAGCTGCTCCC	0.542													6	246	---	---	---	---	PASS
RNASEL	6041	broad.mit.edu	37	1	182544681	182544681	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182544681T>C	uc001gpj.1	-	6	2239	c.2072A>G	c.(2071-2073)TAT>TGT	p.Y691C	RNASEL_uc009wxz.1_Missense_Mutation_p.Y691C	NM_021133	NP_066956	Q05823	RN5A_HUMAN	ribonuclease L	691	KEN.				mRNA processing|response to virus|type I interferon-mediated signaling pathway	mitochondrion	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|metal ion binding|protein kinase activity|RNA binding			ovary(4)|stomach(1)	5						CTTCTGAAAATACAGGGAAGG	0.393									Hereditary_Prostate_Cancer				78	107	---	---	---	---	PASS
CFHR2	3080	broad.mit.edu	37	1	196928158	196928158	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196928158G>A	uc001gtq.1	+	5	838	c.761G>A	c.(760-762)CGA>CAA	p.R254Q	CFHR2_uc001gtr.1_Missense_Mutation_p.R130Q	NM_005666	NP_005657	P36980	FHR2_HUMAN	H factor (complement)-like 3 precursor	254	Sushi 4.					extracellular region				skin(2)|ovary(1)	3						CATTCATTTCGAGCAATGTGT	0.323													69	72	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197072279	197072279	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197072279C>A	uc001gtu.2	-	18	6359	c.6102G>T	c.(6100-6102)ATG>ATT	p.M2034I	ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	2034	IQ 14.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						TTCTCACTTTCATACCACGAT	0.328													55	387	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198717314	198717314	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198717314C>T	uc001gur.1	+	27	3098	c.2918C>T	c.(2917-2919)TCT>TTT	p.S973F	PTPRC_uc001gus.1_Missense_Mutation_p.S925F|PTPRC_uc001gut.1_Missense_Mutation_p.S812F	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	973	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						AACAGGAATTCTAATGTCATC	0.294													13	65	---	---	---	---	PASS
RNPEP	6051	broad.mit.edu	37	1	201958560	201958560	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201958560G>A	uc001gxd.2	+	3	667	c.638G>A	c.(637-639)AGA>AAA	p.R213K	RNPEP_uc001gxe.2_Intron|RNPEP_uc001gxf.2_Missense_Mutation_p.R82K	NM_020216	NP_064601	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase	213					leukotriene biosynthetic process		epoxide hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		TGGGAGAAGAGAGGTCCAAAT	0.498													11	231	---	---	---	---	PASS
PLEKHA6	22874	broad.mit.edu	37	1	204210871	204210871	+	Silent	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204210871G>T	uc001hau.2	-	16	2561	c.2244C>A	c.(2242-2244)ATC>ATA	p.I748I	PLEKHA6_uc009xau.1_RNA	NM_014935	NP_055750	Q9Y2H5	PKHA6_HUMAN	phosphoinositol 3-phosphate-binding protein-3	748										ovary(3)|pancreas(1)	4	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GCACAAGGCTGATGTCTCTGG	0.532													32	206	---	---	---	---	PASS
CNTN2	6900	broad.mit.edu	37	1	205033472	205033472	+	Silent	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205033472G>T	uc001hbr.2	+	11	1532	c.1263G>T	c.(1261-1263)CTG>CTT	p.L421L	CNTN2_uc001hbq.1_Silent_p.L312L|CNTN2_uc001hbs.2_Silent_p.L209L	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	421	Ig-like C2-type 5.				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			ACTTCAGGCTGAATCCCGTGA	0.597													224	267	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215914767	215914767	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215914767C>A	uc001hku.1	-	60	12048	c.11661G>T	c.(11659-11661)TGG>TGT	p.W3887C		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3887	Fibronectin type-III 24.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CAGGTGGCATCCACTTAATCT	0.383										HNSCC(13;0.011)			101	199	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228506760	228506760	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228506760G>T	uc009xez.1	+	54	14351	c.14307G>T	c.(14305-14307)CAG>CAT	p.Q4769H	OBSCN_uc001hsn.2_Missense_Mutation_p.Q4769H	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	4769					apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GCCGCTCGCAGCGCCTGCCAC	0.647													8	8	---	---	---	---	PASS
AGT	183	broad.mit.edu	37	1	230838998	230838998	+	Silent	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230838998A>T	uc001hty.3	-	5	1855	c.1347T>A	c.(1345-1347)CCT>CCA	p.P449P	AGT_uc009xfe.2_3'UTR|AGT_uc009xff.2_Silent_p.P421P	NM_000029	NP_000020	P01019	ANGT_HUMAN	angiotensinogen preproprotein	449					activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding				0	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)	CCAAGACCTCAGGCTTGTTAA	0.547													65	123	---	---	---	---	PASS
TRIM67	440730	broad.mit.edu	37	1	231349681	231349681	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231349681C>T	uc009xfn.1	+	9	2286	c.2244C>T	c.(2242-2244)GAC>GAT	p.D748D		NM_001004342	NP_001004342	Q6ZTA4	TRI67_HUMAN	tripartite motif-containing 67	748	B30.2/SPRY.					cytoplasm|cytoskeleton	zinc ion binding			ovary(2)|breast(1)|kidney(1)	4	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GCCACGTGGACGGGGTCTTCA	0.637													5	84	---	---	---	---	PASS
C1orf131	128061	broad.mit.edu	37	1	231374720	231374720	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231374720G>A	uc001hun.1	-	2	370	c.333C>T	c.(331-333)ATC>ATT	p.I111I	C1orf131_uc001hul.2_Silent_p.I111I|C1orf131_uc001hum.2_Silent_p.I111I|C1orf131_uc010pwd.1_Silent_p.I111I|C1orf131_uc001huo.1_Silent_p.I111I|GNPAT_uc009xfo.1_5'Flank|GNPAT_uc001hup.3_5'Flank|GNPAT_uc009xfp.2_5'Flank	NM_152379	NP_689592	Q8NDD1	CA131_HUMAN	hypothetical protein LOC128061	111										central_nervous_system(1)|skin(1)	2	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				CAGCAGCAAGGATCTCTGGTC	0.478													65	114	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232539917	232539917	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232539917G>T	uc001hvg.2	-	18	4928	c.4770C>A	c.(4768-4770)GAC>GAA	p.D1590E	SIPA1L2_uc001hvf.2_Intron	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1590					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CTTCATCTGAGTCAAGACCTG	0.458													3	77	---	---	---	---	PASS
ARID4B	51742	broad.mit.edu	37	1	235345964	235345964	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235345964G>A	uc001hwq.2	-	20	2768	c.2270C>T	c.(2269-2271)TCA>TTA	p.S757L	ARID4B_uc001hwr.2_Missense_Mutation_p.S671L|ARID4B_uc001hws.3_Missense_Mutation_p.S671L|ARID4B_uc001hwp.2_RNA|ARID4B_uc001hwt.3_Missense_Mutation_p.S438L	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	757					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TAGCAAAGATGAACTGTTCTG	0.343													12	196	---	---	---	---	PASS
AHCTF1	25909	broad.mit.edu	37	1	247076562	247076562	+	Silent	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247076562T>C	uc001ibu.1	-	3	535	c.528A>G	c.(526-528)TCA>TCG	p.S176S	AHCTF1_uc001ibv.1_Silent_p.S185S	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	176	Necessary for cytoplasmic localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TTTGATTGCATGACAAGTCAT	0.398													64	85	---	---	---	---	PASS
OR2T8	343172	broad.mit.edu	37	1	248085040	248085040	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248085040T>A	uc010pzc.1	+	1	721	c.721T>A	c.(721-723)TCA>ACA	p.S241T		NM_001005522	NP_001005522	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T,	241	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CACCTGCTCTTCACATGTGGC	0.527													33	25	---	---	---	---	PASS
OR2M5	127059	broad.mit.edu	37	1	248308530	248308530	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248308530C>T	uc010pze.1	+	1	81	c.81C>T	c.(79-81)CTC>CTT	p.L27L		NM_001004690	NP_001004690	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M,	27	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|kidney(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			ACACCTTCCTCTTCTTTCTGG	0.493													18	647	---	---	---	---	PASS
OR2T33	391195	broad.mit.edu	37	1	248436396	248436396	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248436396A>T	uc010pzi.1	-	1	721	c.721T>A	c.(721-723)TCA>ACA	p.S241T		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	241	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GCCACATGTGAAGAGCAGGTG	0.517													4	66	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685458	248685458	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685458C>A	uc001ien.1	+	1	511	c.511C>A	c.(511-513)CAT>AAT	p.H171N		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	171	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCTCTGTGGTCATCGCACACT	0.562													78	73	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685821	248685821	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685821C>T	uc001ien.1	+	1	874	c.874C>T	c.(874-876)CTG>TTG	p.L292L		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	292	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TATCTACACTCTGAGAAACAA	0.443													17	177	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1843124	1843124	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1843124G>T	uc002qxe.2	-	21	3704	c.2877C>A	c.(2875-2877)TGC>TGA	p.C959*	MYT1L_uc002qxd.2_Nonsense_Mutation_p.C957*|MYT1L_uc010ewk.2_5'UTR	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	959	C2HC-type 5.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CCTGGCCGTCGCACCCGGGGA	0.622													57	51	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1893048	1893048	+	Silent	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1893048G>T	uc002qxe.2	-	16	3312	c.2485C>A	c.(2485-2487)CGG>AGG	p.R829R	MYT1L_uc002qxd.2_Silent_p.R827R|MYT1L_uc010ewl.1_RNA	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	829					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCTATCCTCCGGGGTTTCATT	0.532													86	61	---	---	---	---	PASS
RNF144A	9781	broad.mit.edu	37	2	7154603	7154603	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7154603G>A	uc002qys.2	+	4	596	c.154G>A	c.(154-156)GAG>AAG	p.E52K	RNF144A_uc002qyt.2_Intron	NM_014746	NP_055561	P50876	R144A_HUMAN	ring finger protein 144	52	RING-type 1; atypical.					Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		ACAGTATGTTGAGCTCTTGAT	0.423													15	171	---	---	---	---	PASS
KCNF1	3754	broad.mit.edu	37	2	11053771	11053771	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11053771A>T	uc002rax.2	+	1	1709	c.1219A>T	c.(1219-1221)AAC>TAC	p.N407Y		NM_002236	NP_002227	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F,	407	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		CCCCATCATCAACAACTTTGT	0.612													26	60	---	---	---	---	PASS
PQLC3	130814	broad.mit.edu	37	2	11300791	11300791	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11300791C>A	uc002rbc.2	+	3	400	c.267C>A	c.(265-267)AAC>AAA	p.N89K	PQLC3_uc010yjk.1_Missense_Mutation_p.N89K	NM_152391	NP_689604	Q8N755	PQLC3_HUMAN	PQ loop repeat containing 3 precursor	89						integral to membrane					0	all_hematologic(175;0.0797)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.0978)|OV - Ovarian serous cystadenocarcinoma(76;0.132)		TTAACGGGAACGTGAAGCAGG	0.512													94	84	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21231921	21231921	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21231921G>C	uc002red.2	-	26	7947	c.7819C>G	c.(7819-7821)CTT>GTT	p.L2607V		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2607					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GCTTTCTGAAGAGCCTGAAGA	0.413													63	135	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21239320	21239320	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21239320C>T	uc002red.2	-	21	3451	c.3323G>A	c.(3322-3324)GGC>GAC	p.G1108D		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	1108					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CCTTAGGTGGCCCATGAGGGC	0.478													72	36	---	---	---	---	PASS
SLC4A1AP	22950	broad.mit.edu	37	2	27900642	27900642	+	Silent	SNP	G	A	A	rs116617546	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27900642G>A	uc002rlk.3	+	8	1896	c.1614G>A	c.(1612-1614)GCG>GCA	p.A538A		NM_018158	NP_060628	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger),	538						cytoplasm|nucleus	double-stranded RNA binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)					CTTTAGATGCGTTCATGTCAG	0.373													58	138	---	---	---	---	PASS
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48848036	48848036	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48848036G>A	uc010yol.1	+	3	2227	c.2180G>A	c.(2179-2181)CGG>CAG	p.R727Q	STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.R727Q|GTF2A1L_uc002rws.1_Missense_Mutation_p.R23Q|GTF2A1L_uc010yom.1_Intron|GTF2A1L_uc002rwt.2_Missense_Mutation_p.R23Q	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	727					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GAAGGAGTTCGGAATCTATTT	0.289													59	52	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61622326	61622326	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61622326C>T	uc002sbe.2	-	4	617	c.595G>A	c.(595-597)GAT>AAT	p.D199N		NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	199					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			ACATTCATATCACAGAATGCC	0.229													13	72	---	---	---	---	PASS
FAM161A	84140	broad.mit.edu	37	2	62081029	62081029	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62081029C>G	uc010ypo.1	-	1	250	c.148G>C	c.(148-150)GAG>CAG	p.E50Q	FAM161A_uc002sbm.3_Missense_Mutation_p.E50Q|FAM161A_uc002sbn.3_5'UTR|FAM161A_uc010fcm.1_RNA|FAM161A_uc010fcn.1_5'UTR	NM_032180	NP_115556	Q3B820	F161A_HUMAN	hypothetical protein LOC84140	50	Poly-Glu.				response to stimulus|visual perception	centrosome				large_intestine(2)|ovary(1)	3						TTCTCCTCCTCTTCGTCCTCC	0.657													3	47	---	---	---	---	PASS
EHBP1	23301	broad.mit.edu	37	2	63101542	63101542	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63101542C>T	uc002sby.2	+	11	1647	c.1165C>T	c.(1165-1167)CAA>TAA	p.Q389*	EHBP1_uc010fcp.2_Nonsense_Mutation_p.Q354*|EHBP1_uc002sbz.2_Nonsense_Mutation_p.Q354*|EHBP1_uc002scb.2_Nonsense_Mutation_p.Q354*	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1	389						cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			AAATCCTGTTCAAGAACTAGA	0.378									Hereditary_Prostate_Cancer				21	177	---	---	---	---	PASS
EHBP1	23301	broad.mit.edu	37	2	63101595	63101595	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63101595C>T	uc002sby.2	+	11	1700	c.1218C>T	c.(1216-1218)GTC>GTT	p.V406V	EHBP1_uc010fcp.2_Silent_p.V371V|EHBP1_uc002sbz.2_Silent_p.V371V|EHBP1_uc002scb.2_Silent_p.V371V	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1	406						cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			CTCCACCAGTCCTCTCACCAA	0.388									Hereditary_Prostate_Cancer				25	239	---	---	---	---	PASS
VPS54	51542	broad.mit.edu	37	2	64148355	64148355	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64148355G>A	uc002scq.2	-	13	2017	c.1854C>T	c.(1852-1854)CTC>CTT	p.L618L	VPS54_uc002scp.2_Silent_p.L606L|VPS54_uc002scn.2_5'Flank|VPS54_uc002sco.2_Silent_p.L103L|VPS54_uc010fct.2_Silent_p.L465L	NM_016516	NP_057600	Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 isoform 1	618					protein transport|retrograde transport, endosome to Golgi						0						CTCTTGACATGAGAAATTTGA	0.338													5	148	---	---	---	---	PASS
FBXO41	150726	broad.mit.edu	37	2	73491644	73491644	+	Missense_Mutation	SNP	C	A	A	rs61733550	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73491644C>A	uc002sjb.1	-	6	1751	c.1751G>T	c.(1750-1752)CGC>CTC	p.R584L		NM_001080410	NP_001073879	Q8TF61	FBX41_HUMAN	F-box protein 41	523	F-box.					intracellular	protein binding|zinc ion binding			breast(2)|pancreas(1)	3						TCCCTCGGGGCGGGCTGCAGA	0.637													15	47	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73827841	73827841	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73827841C>T	uc002sje.1	+	20	11819	c.11708C>T	c.(11707-11709)ACT>ATT	p.T3903I	ALMS1_uc002sjf.1_Missense_Mutation_p.T3859I|ALMS1_uc002sjh.1_Missense_Mutation_p.T3289I	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3901					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						AAAAAACACACTCGAGATGTT	0.448													27	81	---	---	---	---	PASS
C2orf78	388960	broad.mit.edu	37	2	74042728	74042728	+	Missense_Mutation	SNP	T	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74042728T>G	uc002sjr.1	+	3	1499	c.1378T>G	c.(1378-1380)TTA>GTA	p.L460V		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	460										ovary(2)	2						CTTCAGTTCCTTACAAGATCT	0.448													62	36	---	---	---	---	PASS
ACTG2	72	broad.mit.edu	37	2	74141894	74141894	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74141894C>A	uc002sjw.2	+	7	823	c.701C>A	c.(700-702)TCT>TAT	p.S234Y	ACTG2_uc010fey.2_Missense_Mutation_p.S234Y|ACTG2_uc010yrn.1_Missense_Mutation_p.S191Y	NM_001615	NP_001606	P63267	ACTH_HUMAN	actin, gamma 2 propeptide	234					muscle contraction	cytoskeleton|cytosol	ATP binding				0						GCAGCTTCCTCTTCCTCCCTG	0.537													29	104	---	---	---	---	PASS
REG1B	5968	broad.mit.edu	37	2	79313940	79313940	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79313940C>G	uc002sny.2	-	3	293	c.181G>C	c.(181-183)GAT>CAT	p.D61H	REG1B_uc010ffv.1_Missense_Mutation_p.D61H|REG1B_uc010ffw.2_Missense_Mutation_p.D61H	NM_006507	NP_006498	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta precursor	61	C-type lectin.				cell proliferation	extracellular region	sugar binding			central_nervous_system(1)|skin(1)	2						TCACTCACATCTGCATCAACC	0.507													8	261	---	---	---	---	PASS
POLR1A	25885	broad.mit.edu	37	2	86267661	86267661	+	Silent	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86267661C>G	uc002sqs.2	-	25	3973	c.3594G>C	c.(3592-3594)CTG>CTC	p.L1198L	POLR1A_uc010ytb.1_Silent_p.L564L|POLR1A_uc002sqt.1_Silent_p.L221L	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A	1198					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						GCTGCCACTTCAGCTGCAGCA	0.647													4	64	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89247051	89247051	+	RNA	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89247051C>G	uc010ytr.1	-	101		c.8008G>C			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GATGGTGACTCTGTCTCCTAC	0.483													70	189	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90060889	90060889	+	Intron	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90060889C>T	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		GGGGTCCCCTCGAGGTTCAGT	0.502													121	75	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90077815	90077815	+	RNA	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90077815C>A	uc010fhm.2	+	13		c.1392C>A								Parts of antibodies, mostly variable regions.																		TCCTGCTACTCTGGCTCCCAG	0.512													58	145	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90229410	90229410	+	Intron	SNP	A	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90229410A>C	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		AAAGATTTGCACCCTGGGGTC	0.483													68	49	---	---	---	---	PASS
ZAP70	7535	broad.mit.edu	37	2	98341707	98341707	+	Silent	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98341707C>A	uc002syd.1	+	4	762	c.555C>A	c.(553-555)GGC>GGA	p.G185G	ZAP70_uc010yvf.1_Silent_p.G185G|ZAP70_uc002sye.1_Silent_p.G75G	NM_001079	NP_001070	P43403	ZAP70_HUMAN	zeta-chain associated protein kinase 70kDa	185	SH2 2.				immune response|intracellular protein kinase cascade|positive thymic T cell selection|T cell receptor signaling pathway	cytosol|T cell receptor complex	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						AGACCGACGGCAAGTTCCTGT	0.642													31	41	---	---	---	---	PASS
ZAP70	7535	broad.mit.edu	37	2	98351769	98351769	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98351769C>A	uc002syd.1	+	10	1346	c.1139C>A	c.(1138-1140)ACG>AAG	p.T380K	ZAP70_uc010yvf.1_3'UTR|ZAP70_uc002sye.1_Missense_Mutation_p.T270K|ZAP70_uc002syf.1_Missense_Mutation_p.T73K	NM_001079	NP_001070	P43403	ZAP70_HUMAN	zeta-chain associated protein kinase 70kDa	380	Protein kinase.				immune response|intracellular protein kinase cascade|positive thymic T cell selection|T cell receptor signaling pathway	cytosol|T cell receptor complex	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						AAGGCAGACACGGAAGAGATG	0.662													63	167	---	---	---	---	PASS
MRPL30	51263	broad.mit.edu	37	2	99811647	99811647	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99811647G>C	uc002szu.2	+	5	510	c.348G>C	c.(346-348)TTG>TTC	p.L116F	MRPL30_uc002szl.1_RNA|MRPL30_uc002szr.2_Missense_Mutation_p.L116F|MRPL30_uc002szt.1_RNA|MRPL30_uc002szv.2_Missense_Mutation_p.L116F	NM_145213	NP_660214	Q8TCC3	RM30_HUMAN	RecName: Full=39S ribosomal protein L30, mitochondrial;          Short=L30mt; AltName: Full=MRP-L30; AltName: Full=MRP-L28; Flags: Precursor;	116					translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1						TTAAGCATTTGATAAGGTTTG	0.318													15	181	---	---	---	---	PASS
LYG2	254773	broad.mit.edu	37	2	99863224	99863224	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99863224G>A	uc002szw.1	-	3	216	c.103C>T	c.(103-105)CTG>TTG	p.L35L	MRPL30_uc002szl.1_Intron|LYG2_uc010fip.1_Silent_p.L35L|LYG2_uc002szx.1_Silent_p.L35L	NM_175735	NP_783862	Q86SG7	LYG2_HUMAN	lysozyme G-like 2 precursor	35					cell wall macromolecule catabolic process|peptidoglycan catabolic process	extracellular region	lysozyme activity			ovary(1)	1						CCGTGGTACAGGCGTGGATGT	0.517													112	86	---	---	---	---	PASS
SULT1C3	442038	broad.mit.edu	37	2	108881303	108881303	+	Missense_Mutation	SNP	A	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108881303A>C	uc010ywo.1	+	6	644	c.644A>C	c.(643-645)AAG>ACG	p.K215T		NM_001008743	NP_001008743	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member	215	PAPS.					cytoplasm	alcohol sulfotransferase activity			skin(1)	1						GAAATTGAGAAGATACTGAAG	0.403													64	43	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116594282	116594282	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116594282G>A	uc002tla.1	+	24	2599	c.2142G>A	c.(2140-2142)TTG>TTA	p.L714L	DPP10_uc002tlb.1_Silent_p.L664L|DPP10_uc002tlc.1_Silent_p.L710L|DPP10_uc002tle.2_Silent_p.L718L|DPP10_uc002tlf.1_Silent_p.L707L	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	714	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TTCATGGCTTGAAAGAAGAAA	0.318													25	186	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128394204	128394204	+	Splice_Site	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128394204G>A	uc002top.2	+	45	6182	c.6129_splice	c.e45+1	p.K2043_splice	MYO7B_uc002tos.1_Splice_Site_p.K153_splice|MYO7B_uc002tot.2_Splice_Site_p.K153_splice	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB							apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CAAGACCAAGGTAGCTGCTGG	0.642													7	15	---	---	---	---	PASS
LIMS2	55679	broad.mit.edu	37	2	128398512	128398512	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128398512C>A	uc002tpa.2	-	7	878	c.712G>T	c.(712-714)GAG>TAG	p.E238*	LIMS2_uc002tou.2_Nonsense_Mutation_p.E46*|LIMS2_uc002tov.2_Nonsense_Mutation_p.E86*|LIMS2_uc002tow.2_Nonsense_Mutation_p.E86*|LIMS2_uc002tox.2_Nonsense_Mutation_p.E262*|LIMS2_uc010fmb.2_Nonsense_Mutation_p.E148*|LIMS2_uc002toy.2_Nonsense_Mutation_p.E233*|LIMS2_uc010yzm.1_Nonsense_Mutation_p.E260*|LIMS2_uc002toz.2_Nonsense_Mutation_p.E233*|LIMS2_uc002tpb.2_Nonsense_Mutation_p.E233*	NM_001161403	NP_001154875	Q7Z4I7	LIMS2_HUMAN	LIM and senescent cell antigen-like domains 2	238	LIM zinc-binding 4.				cell junction assembly	cytosol|focal adhesion|nucleus	zinc ion binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0681)		CCCTTCTTCTCATAGTGCCGG	0.622													7	158	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131521044	131521044	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131521044G>C	uc002trw.2	+	2	1589	c.1399G>C	c.(1399-1401)GAG>CAG	p.E467Q	FAM123C_uc010fmv.2_Missense_Mutation_p.E467Q|FAM123C_uc010fms.1_Missense_Mutation_p.E467Q|FAM123C_uc010fmt.1_Missense_Mutation_p.E467Q|FAM123C_uc010fmu.1_Missense_Mutation_p.E467Q	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	467										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		AGTGGGGGCCGAGGAGAACTT	0.637													16	50	---	---	---	---	PASS
ARHGAP15	55843	broad.mit.edu	37	2	144381754	144381754	+	Silent	SNP	C	A	A	rs149563619		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144381754C>A	uc002tvm.3	+	12	1207	c.1056C>A	c.(1054-1056)ACC>ACA	p.T352T	ARHGAP15_uc002tvn.2_Silent_p.T118T	NM_018460	NP_060930	Q53QZ3	RHG15_HUMAN	ARHGAP15	352	Rho-GAP.				regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)		ACGTTGTCACCGGAGCACTGA	0.473													41	37	---	---	---	---	PASS
GTDC1	79712	broad.mit.edu	37	2	144710406	144710406	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144710406C>T	uc002tvp.2	-	10	1414	c.1135G>A	c.(1135-1137)GAA>AAA	p.E379K	GTDC1_uc002tvo.2_Nonsense_Mutation_p.W330*|GTDC1_uc002tvq.2_Missense_Mutation_p.E261K|GTDC1_uc002tvr.2_Missense_Mutation_p.E294K|GTDC1_uc010fnn.2_Missense_Mutation_p.E379K|GTDC1_uc002tvs.2_Missense_Mutation_p.E347K|GTDC1_uc010fno.2_Missense_Mutation_p.E250K	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	379					biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)		TACACAGCTTCCAACCTAGAA	0.353													11	208	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152553725	152553725	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152553725G>A	uc010fnx.2	-	16	1598	c.1407C>T	c.(1405-1407)GGC>GGT	p.G469G	NEB_uc010fny.1_Silent_p.G23G	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	469					muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GAGGGAAGAAGCCTTTGCCTC	0.383													50	117	---	---	---	---	PASS
COBLL1	22837	broad.mit.edu	37	2	165551453	165551453	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165551453C>T	uc010zcw.1	-	15	2888	c.2764G>A	c.(2764-2766)GAT>AAT	p.D922N	COBLL1_uc002ucp.2_Missense_Mutation_p.D855N|COBLL1_uc002ucq.2_Missense_Mutation_p.D817N|COBLL1_uc010zcx.1_Missense_Mutation_p.D863N|COBLL1_uc002ucn.2_Missense_Mutation_p.D283N|COBLL1_uc002uco.2_Missense_Mutation_p.D586N	NM_014900	NP_055715	Q53SF7	COBL1_HUMAN	COBL-like 1	893										ovary(2)|pancreas(1)	3						ACCATGGCATCATCAGGTGAG	0.453													11	186	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166165188	166165188	+	Silent	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166165188A>G	uc002udc.2	+	5	779	c.489A>G	c.(487-489)ACA>ACG	p.T163T	SCN2A_uc002udd.2_Silent_p.T163T|SCN2A_uc002ude.2_Silent_p.T163T	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	163	I.|Helical; Name=S2 of repeat I; (Potential).				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	ATACCTTTACAGGAATTTATA	0.308													54	167	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168106414	168106414	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168106414G>T	uc002udx.2	+	8	8530	c.8512G>T	c.(8512-8514)GAA>TAA	p.E2838*	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Nonsense_Mutation_p.E2663*|XIRP2_uc010fpq.2_Nonsense_Mutation_p.E2616*|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Nonsense_Mutation_p.E184*	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2663					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						ATTAATAACTGAAAGAAAACA	0.383													8	181	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170151127	170151127	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170151127G>A	uc002ues.2	-	5	734	c.521C>T	c.(520-522)TCA>TTA	p.S174L	LRP2_uc010zdf.1_Missense_Mutation_p.S174L	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	174	LDL-receptor class A 4.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	GATTTCATCTGAGGAGTCCCT	0.308													5	83	---	---	---	---	PASS
WIPF1	7456	broad.mit.edu	37	2	175440079	175440079	+	Missense_Mutation	SNP	C	A	A	rs140541247		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175440079C>A	uc002uiy.2	-	5	543	c.211G>T	c.(211-213)GGT>TGT	p.G71C	uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Missense_Mutation_p.G71C|WIPF1_uc010fqt.1_Missense_Mutation_p.G71C|WIPF1_uc002ujc.1_Missense_Mutation_p.G71C|WIPF1_uc002uiz.2_Missense_Mutation_p.G71C|WIPF1_uc002ujb.1_Missense_Mutation_p.G71C|WIPF1_uc010zep.1_Missense_Mutation_p.G71C	NM_003387	NP_003378	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	71	Gly-rich.				actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding			ovary(1)|skin(1)	2						aagccaccaccaccgcctcca	0.274													53	162	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179398902	179398902	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179398902C>A	uc010zfg.1	-	307	94960	c.94736G>T	c.(94735-94737)GGT>GTT	p.G31579V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.G25274V|TTN_uc010zfi.1_Missense_Mutation_p.G25207V|TTN_uc010zfj.1_Missense_Mutation_p.G25082V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	32506							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCTTCTTCACCAACTGCATG	0.438													50	153	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179404670	179404670	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179404670C>T	uc010zfg.1	-	301	90642	c.90418G>A	c.(90418-90420)GAA>AAA	p.E30140K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E23835K|TTN_uc010zfi.1_Missense_Mutation_p.E23768K|TTN_uc010zfj.1_Missense_Mutation_p.E23643K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	31067							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGTATCTTTCATCAAGTTCA	0.383													5	205	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179404840	179404840	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179404840C>A	uc010zfg.1	-	300	90573	c.90349G>T	c.(90349-90351)GAG>TAG	p.E30117*	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.E23812*|TTN_uc010zfi.1_Nonsense_Mutation_p.E23745*|TTN_uc010zfj.1_Nonsense_Mutation_p.E23620*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	31044							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGCAGGCTCACCAGGTCCA	0.458													11	365	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179416881	179416881	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179416881G>A	uc010zfg.1	-	284	83266	c.83042C>T	c.(83041-83043)CCT>CTT	p.P27681L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P21376L|TTN_uc010zfi.1_Missense_Mutation_p.P21309L|TTN_uc010zfj.1_Missense_Mutation_p.P21184L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	28608							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTATCTTCAGGTACATCCCA	0.458													186	149	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179464429	179464429	+	Silent	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179464429G>C	uc010zfg.1	-	238	48719	c.48495C>G	c.(48493-48495)CTC>CTG	p.L16165L	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L9860L|TTN_uc010zfi.1_Silent_p.L9793L|TTN_uc010zfj.1_Silent_p.L9668L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17092							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGTGTCATAGAGAACAGGTT	0.438													29	285	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179514921	179514921	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179514921C>G	uc010zfg.1	-	164	32709	c.32485G>C	c.(32485-32487)GAG>CAG	p.E10829Q	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc010fre.1_Intron|TTN_uc002umw.1_RNA|TTN_uc002umx.1_5'UTR	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11756							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTTCCTCCTCTTCTGCAACA	0.383													3	19	---	---	---	---	PASS
DNAJC10	54431	broad.mit.edu	37	2	183623921	183623921	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183623921C>G	uc002uow.1	+	21	2447	c.2032C>G	c.(2032-2034)CAG>GAG	p.Q678E	DNAJC10_uc002uox.1_RNA|DNAJC10_uc002uoy.1_RNA|DNAJC10_uc002uoz.1_Missense_Mutation_p.Q632E|DNAJC10_uc010fro.1_RNA	NM_018981	NP_061854	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	678	Thioredoxin 4.				apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding			ovary(1)|large_intestine(1)|breast(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TCTAACACCTCAGACTTTCAG	0.343													3	134	---	---	---	---	PASS
COL3A1	1281	broad.mit.edu	37	2	189861890	189861890	+	Splice_Site	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189861890G>T	uc002uqj.1	+	25	1879	c.1762_splice	c.e25-1	p.G588_splice		NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein						axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	TTCTTCTTTAGGGTGCTCCTG	0.363													42	140	---	---	---	---	PASS
PMS1	5378	broad.mit.edu	37	2	190708783	190708783	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190708783C>G	uc002urh.3	+	6	1205	c.676C>G	c.(676-678)CAG>GAG	p.Q226E	PMS1_uc010zga.1_Intron|PMS1_uc010zgb.1_Missense_Mutation_p.Q165E|PMS1_uc002urk.3_Intron|PMS1_uc002uri.3_Missense_Mutation_p.Q226E|PMS1_uc010zgc.1_Missense_Mutation_p.Q50E|PMS1_uc010zgd.1_Missense_Mutation_p.Q50E|PMS1_uc002urj.2_Intron|PMS1_uc010fry.1_Intron|PMS1_uc010frz.2_Intron|PMS1_uc002url.2_Intron|PMS1_uc002urm.2_RNA	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a	226					mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			GGAATCCTTTCAGTACCACTC	0.408			Mis|N			colorectal|endometrial|ovarian		Direct_reversal_of_damage|MMR					4	180	---	---	---	---	PASS
ANKRD44	91526	broad.mit.edu	37	2	198001309	198001309	+	Intron	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198001309C>T	uc002uuc.2	-						ANKRD44_uc002uua.1_Intron|ANKRD44_uc002uub.2_Intron|ANKRD44_uc010zgw.1_Intron|ANKRD44_uc002uud.1_Missense_Mutation_p.D90N	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44								protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)			ATATGGTAATCACTCACTTCA	0.423													16	73	---	---	---	---	PASS
SGOL2	151246	broad.mit.edu	37	2	201399838	201399838	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201399838G>C	uc002uvw.2	+	3	366	c.253G>C	c.(253-255)GAA>CAA	p.E85Q	SGOL2_uc002uvv.3_Missense_Mutation_p.E85Q|SGOL2_uc010zhd.1_Missense_Mutation_p.E85Q|SGOL2_uc010zhe.1_Missense_Mutation_p.E85Q	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	85	Potential.				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						ATTGCAAAAAGAAGTAGAGAA	0.303													13	125	---	---	---	---	PASS
SGOL2	151246	broad.mit.edu	37	2	201438273	201438273	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201438273G>C	uc002uvw.2	+	7	3317	c.3204G>C	c.(3202-3204)CAG>CAC	p.Q1068H	SGOL2_uc010zhd.1_Missense_Mutation_p.Q1068H|SGOL2_uc010zhe.1_Missense_Mutation_p.Q1068H	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	1068					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						GAGAGTGTCAGGTTAAAAAGG	0.363													143	97	---	---	---	---	PASS
NIF3L1	60491	broad.mit.edu	37	2	201756805	201756805	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201756805G>A	uc002uwm.2	+	2	230	c.139G>A	c.(139-141)GAG>AAG	p.E47K	PPIL3_uc002uwh.2_5'Flank|PPIL3_uc002uwi.2_5'Flank|PPIL3_uc002uwj.2_5'Flank|PPIL3_uc002uwk.2_5'Flank|NIF3L1_uc002uwl.2_Missense_Mutation_p.E20K|NIF3L1_uc002uwn.2_Missense_Mutation_p.E20K|NIF3L1_uc002uwo.2_Missense_Mutation_p.E47K|NIF3L1_uc002uwp.2_Missense_Mutation_p.E47K|NIF3L1_uc002uwq.2_Missense_Mutation_p.E47K	NM_001136039	NP_001129511	Q9GZT8	NIF3L_HUMAN	NIF3 NGG1 interacting factor 3-like 1 isoform 1	47					positive regulation of transcription, DNA-dependent		transcription factor binding			skin(1)	1						CTCGTTTGCTGAGAGTTGGGA	0.468													8	203	---	---	---	---	PASS
ALS2CR11	151254	broad.mit.edu	37	2	202483662	202483662	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202483662C>G	uc002uye.2	-	1	240	c.192G>C	c.(190-192)AAG>AAC	p.K64N	ALS2CR11_uc002uyf.2_Missense_Mutation_p.K64N|ALS2CR11_uc010fti.2_Missense_Mutation_p.K64N	NM_152525	NP_689738	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	64										large_intestine(1)|ovary(1)|skin(1)	3						GGTTCTTGTTCTTAGGCAGGG	0.652													22	67	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210559381	210559381	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210559381C>T	uc002vde.1	+	7	2735	c.2487C>T	c.(2485-2487)GCC>GCT	p.A829A	MAP2_uc002vdc.1_Silent_p.A829A|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Silent_p.A825A	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	829					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	CTGAGGTTGCCAGGAGGAAAT	0.488													118	68	---	---	---	---	PASS
TMBIM1	64114	broad.mit.edu	37	2	219143270	219143270	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219143270G>A	uc002vho.1	-	7	1167	c.441C>T	c.(439-441)ACC>ACT	p.T147T	PNKD_uc002vhn.2_Intron|TMBIM1_uc002vhp.1_Silent_p.T147T|TMBIM1_uc010zjz.1_5'UTR|TMBIM1_uc010zka.1_Silent_p.T36T	NM_022152	NP_071435	Q969X1	TMBI1_HUMAN	transmembrane BAX inhibitor motif containing 1	147	Helical; (Potential).					integral to membrane					0		Renal(207;0.0474)		Epithelial(149;8.56e-07)|all cancers(144;0.000154)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGATCAGGTAGGTGACAACGA	0.577													4	142	---	---	---	---	PASS
CTDSP1	58190	broad.mit.edu	37	2	219267953	219267953	+	Splice_Site	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219267953A>T	uc002vhy.2	+	6	808	c.472_splice	c.e6-2	p.Y158_splice	CTDSP1_uc002vhx.2_Splice_Site_p.Y157_splice|CTDSP1_uc002vhz.2_Splice_Site_p.Y17_splice	NM_021198	NP_067021	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,						protein dephosphorylation|regulation of transcription from RNA polymerase II promoter	nucleus	CTD phosphatase activity|metal ion binding|protein binding			ovary(1)	1		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCTGCTCCCAGTACGCAGAC	0.662													38	99	---	---	---	---	PASS
SP110	3431	broad.mit.edu	37	2	231036466	231036466	+	Intron	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231036466G>C	uc002vqh.3	-						SP110_uc002vqg.3_Silent_p.L611L	NM_004509	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein isoform a						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|signal transducer activity|zinc ion binding			ovary(2)|breast(2)	4		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		AGGCCTTCAAGAGGAGGAACT	0.423													4	116	---	---	---	---	PASS
DGKD	8527	broad.mit.edu	37	2	234371381	234371381	+	Silent	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234371381G>C	uc002vui.1	+	26	3198	c.3186G>C	c.(3184-3186)CTG>CTC	p.L1062L	DGKD_uc002vuj.1_Silent_p.L1018L|DGKD_uc010fyi.1_RNA	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	1062					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	AGATGGCCCTGGTAAGCTGGT	0.587													7	179	---	---	---	---	PASS
UGT1A10	54575	broad.mit.edu	37	2	234545802	234545802	+	Missense_Mutation	SNP	G	A	A	rs139087628	byFrequency	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234545802G>A	uc002vur.2	+	1	680	c.634G>A	c.(634-636)GTG>ATG	p.V212M	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Missense_Mutation_p.V212M	NM_019075	NP_061948	Q9HAW8	UD110_HUMAN	UDP glycosyltransferase 1 family, polypeptide	212					flavone metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding			ovary(2)|skin(1)	3		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)		GAACCACATCGTGCACTTGGA	0.453													28	466	---	---	---	---	PASS
FARP2	9855	broad.mit.edu	37	2	242371175	242371175	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242371175C>T	uc002wbi.1	+	9	970	c.853C>T	c.(853-855)CAT>TAT	p.H285Y	FARP2_uc010zoq.1_Missense_Mutation_p.H285Y|FARP2_uc010zor.1_Missense_Mutation_p.H285Y	NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	285	FERM.				axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		TATCAAACTTCATCCAGAGGT	0.254													17	145	---	---	---	---	PASS
SRGAP3	9901	broad.mit.edu	37	3	9057404	9057404	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9057404G>C	uc003brf.1	-	15	2366	c.1690C>G	c.(1690-1692)CTT>GTT	p.L564V	SRGAP3_uc003brg.1_Missense_Mutation_p.L540V|SRGAP3_uc003bri.1_RNA	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	564	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		TCGTCCACAAGGGGGTCTTCA	0.468			T	RAF1	pilocytic astrocytoma								5	113	---	---	---	---	PASS
MTMR14	64419	broad.mit.edu	37	3	9739394	9739394	+	Splice_Site	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9739394G>A	uc003brz.2	+	18	1738	c.1614_splice	c.e18-1	p.R538_splice	MTMR14_uc003bsa.2_Intron|MTMR14_uc003bsb.2_Intron|MTMR14_uc011ath.1_Splice_Site|MTMR14_uc010hcl.2_Intron|MTMR14_uc003bsc.2_Splice_Site	NM_001077525	NP_001070993	Q8NCE2	MTMRE_HUMAN	jumpy isoform 2							perinuclear region of cytoplasm|ruffle	phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(99;0.227)					CTCTGCCCCAGATCAGTGGAC	0.617													17	151	---	---	---	---	PASS
TTLL3	26140	broad.mit.edu	37	3	9877137	9877137	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9877137G>A	uc003btg.2	+	13	2499	c.2283G>A	c.(2281-2283)GCG>GCA	p.A761A	ARPC4_uc003btc.1_Intron	NM_001025930	NP_001021100	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	761					axoneme assembly|cilium assembly|protein polyglycylation	cilium axoneme|cytoplasm|microtubule	protein-glycine ligase activity, initiating|tubulin-tyrosine ligase activity			large_intestine(2)	2	Medulloblastoma(99;0.227)					TGGATGGGGCGAGGCCGTGTA	0.562													5	159	---	---	---	---	PASS
GRIP2	80852	broad.mit.edu	37	3	14547271	14547271	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14547271G>A	uc011avi.1	-	21	2719	c.2719C>T	c.(2719-2721)CGG>TGG	p.R907W	GRIP2_uc010heh.2_RNA|GRIP2_uc011avh.1_Missense_Mutation_p.R438W	NM_001080423	NP_001073892	Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2	809					synaptic transmission	cytosol|plasma membrane	protein binding			pancreas(1)	1						GTCGTGCCCCGGGCTGCTGCC	0.692													3	1	---	---	---	---	PASS
SLC25A38	54977	broad.mit.edu	37	3	39431976	39431976	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39431976G>T	uc003cjo.2	+	3	655	c.254G>T	c.(253-255)GGC>GTC	p.G85V		NM_017875	NP_060345	Q96DW6	S2538_HUMAN	solute carrier family 25, member 38	85	Solcar 1.				erythrocyte differentiation|heme biosynthetic process|transport	integral to membrane|mitochondrial inner membrane					0				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		AGTCTTTTGGGCCTTTGGAAA	0.483													5	80	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47084181	47084181	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47084181C>A	uc003cqs.2	-	17	7161	c.7108G>T	c.(7108-7110)GTT>TTT	p.V2370F	SETD2_uc003cqv.2_Missense_Mutation_p.V2437F|SETD2_uc003cqr.2_5'UTR	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2370					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TTTGTCACAACCATTTCAGAC	0.418			N|F|S|Mis		clear cell renal carcinoma								116	29	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	51246264	51246264	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51246264C>T	uc011bds.1	+	13	1120	c.1097C>T	c.(1096-1098)GCC>GTC	p.A366V		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	366						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		AAGTCCAGTGCCAAGTACTCT	0.458													15	3	---	---	---	---	PASS
ACOX2	8309	broad.mit.edu	37	3	58514545	58514545	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58514545G>A	uc003dkl.2	-	9	1306	c.1131C>T	c.(1129-1131)AAC>AAT	p.N377N		NM_003500	NP_003491	Q99424	ACOX2_HUMAN	acyl-Coenzyme A oxidase 2	377					bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity|acyl-CoA dehydrogenase activity|pristanoyl-CoA oxidase activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		TGAAGTCTTGGTTCAGAATGG	0.567													50	13	---	---	---	---	PASS
FEZF2	55079	broad.mit.edu	37	3	62357936	62357936	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62357936G>A	uc003dlh.2	-	1	815	c.608C>T	c.(607-609)GCC>GTC	p.A203V	FEZF2_uc003dli.2_Missense_Mutation_p.A203V	NM_018008	NP_060478	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	203					transcription, DNA-dependent	nucleus	zinc ion binding			lung(1)	1		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		AGCAGCCAGGGCGGCGGGGGC	0.657													6	2	---	---	---	---	PASS
CNTN3	5067	broad.mit.edu	37	3	74414822	74414822	+	Silent	SNP	A	G	G	rs143146733		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74414822A>G	uc003dpm.1	-	8	1058	c.978T>C	c.(976-978)GAT>GAC	p.D326D		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	326	Ig-like C2-type 4.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CTATTTCCACATCCTTTATGA	0.423													7	315	---	---	---	---	PASS
MINA	84864	broad.mit.edu	37	3	97677949	97677949	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97677949G>C	uc003drz.1	-	4	1133	c.627C>G	c.(625-627)TAC>TAG	p.Y209*	MINA_uc003dsa.1_Nonsense_Mutation_p.Y209*|MINA_uc003dsb.1_Nonsense_Mutation_p.Y209*|MINA_uc003dsc.1_Nonsense_Mutation_p.Y209*|MINA_uc010hpa.1_RNA|MINA_uc010hpb.1_RNA	NM_001042533	NP_001035998	Q8IUF8	MINA_HUMAN	MYC induced nuclear antigen isoform a	209	JmjC.				ribosome biogenesis	cytoplasm|nucleolus				ovary(1)	1						CCTCCACGCTGTACTCTCGTG	0.572													5	131	---	---	---	---	PASS
OR5H1	26341	broad.mit.edu	37	3	97852476	97852476	+	Nonsense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97852476C>G	uc011bgt.1	+	1	935	c.935C>G	c.(934-936)TCA>TGA	p.S312*		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	312	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						GTTAAGGTTTCATACTAATAT	0.299													8	211	---	---	---	---	PASS
SENP7	57337	broad.mit.edu	37	3	101117745	101117745	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101117745G>C	uc003dut.2	-	6	748	c.637C>G	c.(637-639)CAA>GAA	p.Q213E	SENP7_uc003duu.2_Intron|SENP7_uc003duv.2_Missense_Mutation_p.Q180E|SENP7_uc003duw.2_Missense_Mutation_p.Q147E|SENP7_uc003dux.2_Intron	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1	213					proteolysis	nucleus	cysteine-type peptidase activity			ovary(3)|lung(2)	5						TTTAGATTTTGATAAGATTCT	0.353													5	374	---	---	---	---	PASS
ZPLD1	131368	broad.mit.edu	37	3	102187820	102187820	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102187820C>A	uc003dvs.1	+	15	1656	c.774C>A	c.(772-774)GAC>GAA	p.D258E	ZPLD1_uc003dvt.1_Missense_Mutation_p.D274E|ZPLD1_uc011bhg.1_Missense_Mutation_p.D258E	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	258	ZP.|Extracellular (Potential).					integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						GTGACAAGGACCCTCAGACCA	0.438													111	96	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113146061	113146061	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113146061G>A	uc003eae.1	-	3	272	c.226C>T	c.(226-228)CAG>TAG	p.Q76*		NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2	76										central_nervous_system(1)	1						TCACCATACTGAAATGAACTC	0.363													13	333	---	---	---	---	PASS
IGSF11	152404	broad.mit.edu	37	3	118623503	118623503	+	Missense_Mutation	SNP	A	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118623503A>C	uc003ebw.2	-	6	1093	c.846T>G	c.(844-846)AAT>AAG	p.N282K	IGSF11_uc011biv.1_Missense_Mutation_p.N254K|IGSF11_uc003ebx.2_Missense_Mutation_p.N258K|IGSF11_uc003eby.2_Missense_Mutation_p.N281K|IGSF11_uc003ebz.2_Missense_Mutation_p.N257K|IGSF11_uc010hqs.2_Missense_Mutation_p.N281K	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b	282	Cytoplasmic (Potential).				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0						ACCTTATTTCATTAGGAATTT	0.308													116	402	---	---	---	---	PASS
NDUFB4	4710	broad.mit.edu	37	3	120315200	120315200	+	5'UTR	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120315200C>T	uc003edu.2	+	1					NDUFB4_uc003edt.2_5'UTR	NM_004547	NP_004538	O95168	NDUB4_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta						mitochondrial electron transport, NADH to ubiquinone|response to oxidative stress|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0				GBM - Glioblastoma multiforme(114;0.14)	NADH(DB00157)	TGCCCTGGTTCGCCAAGATGT	0.587													9	93	---	---	---	---	PASS
IQCB1	9657	broad.mit.edu	37	3	121508986	121508986	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121508986G>A	uc010hre.1	-	11	1278	c.1063C>T	c.(1063-1065)CAA>TAA	p.Q355*	IQCB1_uc003eek.2_Nonsense_Mutation_p.Q222*|IQCB1_uc010hrf.1_RNA	NM_001023570	NP_001018864	Q15051	IQCB1_HUMAN	IQ motif containing B1 isoform a	355	Potential.				cilium assembly|maintenance of organ identity|photoreceptor cell maintenance	centrosome|photoreceptor connecting cilium	calmodulin binding				0				GBM - Glioblastoma multiforme(114;0.0983)		CTCTGTCTTTGAAGTTGCAAT	0.398													17	900	---	---	---	---	PASS
DIRC2	84925	broad.mit.edu	37	3	122575224	122575224	+	Intron	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122575224G>A	uc003efw.3	+						DIRC2_uc010hrl.2_Intron|DIRC2_uc010hrm.2_Intron	NM_032839	NP_116228	Q96SL1	DIRC2_HUMAN	disrupted in renal carcinoma 2						transport	integral to membrane					0				GBM - Glioblastoma multiforme(114;0.0614)		ATGGCAAGGTGAGAATATTTT	0.388													30	895	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124149620	124149620	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124149620G>A	uc003ehg.2	+	16	2948	c.2821G>A	c.(2821-2823)GAG>AAG	p.E941K	KALRN_uc010hrv.1_Missense_Mutation_p.E941K|KALRN_uc003ehf.1_Missense_Mutation_p.E941K|KALRN_uc011bjy.1_Missense_Mutation_p.E941K|KALRN_uc003ehh.1_Missense_Mutation_p.E287K	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	941	Spectrin 4.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						ACTGGCCATCGAGGTAACACC	0.572													5	116	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124390654	124390654	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124390654A>G	uc003ehg.2	+	48	6975	c.6848A>G	c.(6847-6849)AAC>AGC	p.N2283S	KALRN_uc003ehi.2_Missense_Mutation_p.N624S|KALRN_uc003ehk.2_Missense_Mutation_p.N586S|KALRN_uc011bjz.1_Missense_Mutation_p.N375S	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	2282					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						TCCAGCTATAACCCACCTCTG	0.582													6	521	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126708574	126708574	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126708574G>A	uc003ejg.2	+	1	1073	c.1069G>A	c.(1069-1071)GAG>AAG	p.E357K		NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	380	Sema.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		CTACCGTGGTGAGGGCAAGCT	0.632													19	221	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126724013	126724013	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126724013C>T	uc003ejg.2	+	6	1759	c.1755C>T	c.(1753-1755)AGC>AGT	p.S585S		NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	608	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		AATCTGAGAGCGTCCTGGAGG	0.672													13	78	---	---	---	---	PASS
RAB43	339122	broad.mit.edu	37	3	128853006	128853006	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128853006C>T	uc003elo.1	-	9	785	c.574G>A	c.(574-576)GAG>AAG	p.E192K	ISY1_uc010hsz.1_Intron|ISY1_uc003elp.1_Missense_Mutation_p.E192K|ISY1_uc010hta.1_Missense_Mutation_p.E214K	NM_020701	NP_065752	Q86YS6	RAB43_HUMAN	ISY1 splicing factor homolog	Error:Variant_position_missing_in_Q86YS6_after_alignment					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			lung(1)	1						GCCTCTCTCTCTGCTTTCCAC	0.398													9	348	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130368158	130368158	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130368158G>A	uc010htl.2	+	32	5516	c.5485G>A	c.(5485-5487)GAA>AAA	p.E1829K	COL6A6_uc003eni.3_Intron	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	1829	VWFA 8.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						CAGAGAAATTGAAACTATTCC	0.527													6	35	---	---	---	---	PASS
ATP2C1	27032	broad.mit.edu	37	3	130686258	130686258	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130686258A>G	uc003enl.2	+	16	1525	c.1303A>G	c.(1303-1305)ATG>GTG	p.M435V	ATP2C1_uc011blg.1_Missense_Mutation_p.M469V|ATP2C1_uc011blh.1_Missense_Mutation_p.M430V|ATP2C1_uc011bli.1_Missense_Mutation_p.M469V|ATP2C1_uc003enk.2_Missense_Mutation_p.M419V|ATP2C1_uc003enm.2_Missense_Mutation_p.M435V|ATP2C1_uc003enn.2_Missense_Mutation_p.M419V|ATP2C1_uc003eno.2_Missense_Mutation_p.M435V|ATP2C1_uc003enp.2_Missense_Mutation_p.M435V|ATP2C1_uc003enq.2_Missense_Mutation_p.M435V|ATP2C1_uc003enr.2_Missense_Mutation_p.M435V|ATP2C1_uc003ens.2_Missense_Mutation_p.M435V|ATP2C1_uc003ent.2_Missense_Mutation_p.M435V|ATP2C1_uc003enu.2_Missense_Mutation_p.M113V	NM_014382	NP_055197	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1a	435	Cytoplasmic (By similarity).				actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	TGCTCTTGCAATGAAGGTACG	0.398									Hailey-Hailey_disease				5	284	---	---	---	---	PASS
DNAJC13	23317	broad.mit.edu	37	3	132193846	132193846	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132193846C>G	uc003eor.2	+	22	2427	c.2362C>G	c.(2362-2364)CTT>GTT	p.L788V		NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	788							heat shock protein binding			ovary(1)|breast(1)	2						GAAAGATACTCTTGAATCTGA	0.368													12	574	---	---	---	---	PASS
COPB2	9276	broad.mit.edu	37	3	139102235	139102235	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139102235C>G	uc003etf.3	-	2	176	c.46G>C	c.(46-48)GAT>CAT	p.D16H	COPB2_uc011bmv.1_5'UTR|COPB2_uc010hui.2_5'UTR|COPB2_uc011bmw.1_Missense_Mutation_p.D16H|COPB2_uc003etg.2_Missense_Mutation_p.D16H	NM_004766	NP_004757	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta	16	WD 1.				COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(2)	2						TTAACTCGATCAGATCTAGCA	0.368													8	246	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140122575	140122575	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140122575G>A	uc003etn.2	+	3	527	c.337G>A	c.(337-339)GAC>AAC	p.D113N	CLSTN2_uc003etm.2_Missense_Mutation_p.D113N	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	113	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GAGCCCCATTGACTGTGAGTT	0.557										HNSCC(16;0.037)			13	540	---	---	---	---	PASS
GK5	256356	broad.mit.edu	37	3	141904539	141904539	+	Intron	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141904539G>A	uc003euq.1	-						GK5_uc003eup.1_5'Flank|GK5_uc010hus.1_RNA	NM_001039547	NP_001034636	Q6ZS86	GLPK5_HUMAN	glycerol kinase 5 (putative)						glycerol metabolic process		ATP binding|glycerol kinase activity				0						AAGCAAGTCAGAAAAGGTTAT	0.308													9	68	---	---	---	---	PASS
TRPC1	7220	broad.mit.edu	37	3	142499869	142499869	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142499869G>T	uc003evc.2	+	6	1094	c.958G>T	c.(958-960)GAG>TAG	p.E320*	TRPC1_uc003evb.2_Nonsense_Mutation_p.E286*	NM_003304	NP_003295	P48995	TRPC1_HUMAN	transient receptor potential cation channel,	320	Cytoplasmic (Potential).				axon guidance|cytosolic calcium ion homeostasis|positive regulation of release of sequestered calcium ion into cytosol|response to calcium ion	cytosol|integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2						TAACCAGAAAGAGGTATGAGG	0.229													53	155	---	---	---	---	PASS
AADAC	13	broad.mit.edu	37	3	151545748	151545748	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151545748C>T	uc003eze.2	+	5	1078	c.988C>T	c.(988-990)CGT>TGT	p.R330C		NM_001086	NP_001077	P22760	AAAD_HUMAN	arylacetamide deacetylase	330	Lumenal (Potential).				positive regulation of triglyceride catabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	carboxylesterase activity|deacetylase activity|serine hydrolase activity|triglyceride lipase activity			skin(2)	2		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			CAACAAATTACGTGGCTTACC	0.448													11	375	---	---	---	---	PASS
SGEF	26084	broad.mit.edu	37	3	153905615	153905615	+	Silent	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153905615A>G	uc011bog.1	+	7	1840	c.1629A>G	c.(1627-1629)CTA>CTG	p.L543L	SGEF_uc011boh.1_Silent_p.L543L	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine	543	DH.				regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			AACGAACACTACAAAAATTGT	0.323													48	42	---	---	---	---	PASS
GPR149	344758	broad.mit.edu	37	3	154055876	154055876	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154055876G>C	uc003faa.2	-	4	1908	c.1808C>G	c.(1807-1809)TCA>TGA	p.S603*		NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	603	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			AGAATCTTCTGAGTTTGGTTC	0.413													8	683	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155203419	155203419	+	Silent	SNP	T	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155203419T>G	uc011bok.1	-	22	3001	c.2724A>C	c.(2722-2724)GTA>GTC	p.V908V	PLCH1_uc011boj.1_Silent_p.V908V|PLCH1_uc011bol.1_Silent_p.V870V	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	908					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			ATCGCTTCCGTACATAATGGG	0.463													56	201	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155212304	155212304	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155212304T>A	uc011bok.1	-	15	2138	c.1861A>T	c.(1861-1863)ACC>TCC	p.T621S	PLCH1_uc011boj.1_Missense_Mutation_p.T621S|PLCH1_uc011bol.1_Missense_Mutation_p.T603S	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	621	PI-PLC Y-box.				lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TTTCCTGTGGTTCCTGGCAGT	0.368													8	334	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164712082	164712082	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164712082C>A	uc003fei.2	-	41	4866	c.4804G>T	c.(4804-4806)GCT>TCT	p.A1602S		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1602	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	CCACCATTAGCATGAATTTCA	0.348										HNSCC(35;0.089)			73	277	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164907470	164907470	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164907470G>C	uc003fej.3	-	2	1593	c.1149C>G	c.(1147-1149)ATC>ATG	p.I383M	SLITRK3_uc003fek.2_Missense_Mutation_p.I383M	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	383	LRRNT.|Extracellular (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						CAAGGTCATTGATGTGCAAAT	0.448										HNSCC(40;0.11)			7	620	---	---	---	---	PASS
GOLIM4	27333	broad.mit.edu	37	3	167750308	167750308	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167750308C>T	uc003ffe.2	-	9	1520	c.1176G>A	c.(1174-1176)GAG>GAA	p.E392E	GOLIM4_uc011bpe.1_Silent_p.E392E|GOLIM4_uc011bpf.1_Silent_p.E364E|GOLIM4_uc011bpg.1_Silent_p.E364E	NM_014498	NP_055313	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	392	Glu-rich.|Lumenal (Potential).				transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus				breast(4)|skin(1)	5						GACTTCATACCTCAGCACGCG	0.473													41	823	---	---	---	---	PASS
TERC	7012	broad.mit.edu	37	3	169482713	169482713	+	RNA	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169482713C>A	uc003ffr.1	-	1		c.136G>T				NR_001566				Homo sapiens cDNA clone IMAGE:40002477.												0						AGGCGGCAGGCCGAGGCTTTT	0.612									Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				5	66	---	---	---	---	PASS
TNIK	23043	broad.mit.edu	37	3	170843937	170843937	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170843937G>A	uc003fhh.2	-	17	2122	c.1777C>T	c.(1777-1779)CCA>TCA	p.P593S	TNIK_uc003fhi.2_Missense_Mutation_p.P538S|TNIK_uc003fhj.2_Missense_Mutation_p.P564S|TNIK_uc003fhk.2_Missense_Mutation_p.P593S|TNIK_uc003fhl.2_Missense_Mutation_p.P509S|TNIK_uc003fhm.2_Missense_Mutation_p.P538S|TNIK_uc003fhn.2_Missense_Mutation_p.P564S|TNIK_uc003fho.2_Missense_Mutation_p.P509S	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1	593	Mediates interaction with NEDD4.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			ACCAGATGTGGGATCTAAGCA	0.468													53	200	---	---	---	---	PASS
NAALADL2	254827	broad.mit.edu	37	3	175184923	175184923	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175184923C>T	uc003fit.2	+	8	1571	c.1484C>T	c.(1483-1485)TCT>TTT	p.S495F	NAALADL2_uc003fiu.1_Missense_Mutation_p.S488F|NAALADL2_uc010hwy.1_Missense_Mutation_p.S269F|NAALADL2_uc010hwz.1_Missense_Mutation_p.S89F	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	495	Extracellular (Potential).				proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		GTTTTCTGTTCTTGGGGAGGA	0.403													34	271	---	---	---	---	PASS
PEX5L	51555	broad.mit.edu	37	3	179527318	179527318	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179527318C>T	uc003fki.1	-	12	1423	c.1293G>A	c.(1291-1293)GTG>GTA	p.V431V	PEX5L_uc011bqd.1_Silent_p.V388V|PEX5L_uc011bqe.1_Silent_p.V239V|PEX5L_uc011bqf.1_Silent_p.V323V|PEX5L_uc003fkj.1_Silent_p.V396V|PEX5L_uc010hxd.1_Silent_p.V429V|PEX5L_uc011bqg.1_Silent_p.V407V|PEX5L_uc011bqh.1_Silent_p.V372V	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	431					protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TCTTGCTTTTCACAAGGTATT	0.468													21	530	---	---	---	---	PASS
DNAJC19	131118	broad.mit.edu	37	3	180704813	180704813	+	Intron	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180704813G>A	uc003fkt.2	-						DNAJC19_uc003fku.2_Intron	NM_145261	NP_660304	Q96DA6	TIM14_HUMAN	DnaJ homolog, subfamily C, member 19						genitalia development|protein folding|protein targeting to mitochondrion|transmembrane transport|visual perception	integral to membrane|mitochondrial inner membrane	heat shock protein binding				0	all_cancers(143;3.12e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-36)|OV - Ovarian serous cystadenocarcinoma(80;1.55e-22)			CTGAAGGCCTGAAAGAAGAAA	0.328													37	444	---	---	---	---	PASS
EPHB3	2049	broad.mit.edu	37	3	184294688	184294688	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184294688C>T	uc003foz.2	+	5	1508	c.1071C>T	c.(1069-1071)CTC>CTT	p.L357L		NM_004443	NP_004434	P54753	EPHB3_HUMAN	ephrin receptor EphB3 precursor	357	Fibronectin type-III 1.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(5)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|ovary(1)	11	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			CACTGATCCTCGAGTGGAGTG	0.597													12	504	---	---	---	---	PASS
VPS8	23355	broad.mit.edu	37	3	184603931	184603931	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184603931C>A	uc003fpb.1	+	21	1933	c.1762C>A	c.(1762-1764)CTG>ATG	p.L588M	VPS8_uc010hyd.1_Intron|VPS8_uc010hye.1_Missense_Mutation_p.L17M	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b	590							zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			TTACTGCCTTCTGCTGCAGCG	0.433													9	68	---	---	---	---	PASS
KNG1	3827	broad.mit.edu	37	3	186435504	186435504	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186435504G>T	uc011bsa.1	+	1	385	c.173G>T	c.(172-174)CGC>CTC	p.R58L	KNG1_uc003fqr.2_Missense_Mutation_p.R58L	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1	58	Cystatin 1.				blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	GTATTGTACCGCATAACTGAA	0.403													47	201	---	---	---	---	PASS
FGF12	2257	broad.mit.edu	37	3	192078314	192078314	+	Silent	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192078314T>C	uc003fsx.2	-	2	1039	c.213A>G	c.(211-213)AAA>AAG	p.K71K	FGF12_uc003fsy.2_Silent_p.K9K	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1	71					cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		TCACAATCCCTTTGAGCTGGG	0.393													58	257	---	---	---	---	PASS
GP5	2814	broad.mit.edu	37	3	194118872	194118872	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194118872C>A	uc003ftv.1	-	2	171	c.140G>T	c.(139-141)GGC>GTC	p.G47V		NM_004488	NP_004479	P40197	GPV_HUMAN	glycoprotein V (platelet) precursor	47	LRRNT.|Extracellular (Potential).				blood coagulation, intrinsic pathway|cell adhesion|platelet activation	integral to plasma membrane				skin(2)|breast(1)	3	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		GGTGGGCAGGCCTAGCGCGGA	0.697													155	50	---	---	---	---	PASS
C3orf21	152002	broad.mit.edu	37	3	194877171	194877171	+	Intron	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194877171G>A	uc003fum.3	-						C3orf21_uc003ful.2_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		CTGCAGTCATGACGCACCTGT	0.577													8	206	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195474071	195474071	+	Silent	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195474071C>A	uc011bto.1	-	26	16291	c.15831G>T	c.(15829-15831)CTG>CTT	p.L5277L	MUC4_uc010hzq.2_Silent_p.L262L|MUC4_uc003fuz.2_Silent_p.L1003L|MUC4_uc003fva.2_Silent_p.L885L|MUC4_uc003fvb.2_Silent_p.L921L|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_Silent_p.L921L|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_Silent_p.L885L|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_Silent_p.L969L|MUC4_uc011bti.1_Silent_p.L969L|MUC4_uc011btj.1_Silent_p.L1146L|MUC4_uc011btk.1_Silent_p.L885L|MUC4_uc011btl.1_Silent_p.L914L|MUC4_uc011btm.1_Silent_p.L1094L|MUC4_uc011btn.1_Silent_p.L885L|MUC4_uc003fvo.2_Silent_p.L1169L|MUC4_uc003fvp.2_Silent_p.L1118L	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	2162					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGCTGAGTTCAGGAAATAGG	0.602													26	334	---	---	---	---	PASS
PIGZ	80235	broad.mit.edu	37	3	196674967	196674967	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196674967G>A	uc003fxh.2	-	3	948	c.801C>T	c.(799-801)CTC>CTT	p.L267L		NM_025163	NP_079439	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	267	Helical; (Potential).				GPI anchor biosynthetic process	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			ovary(3)	3	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		CCGCTGCTGTGAGGGCTGCCC	0.607													9	184	---	---	---	---	PASS
ZNF595	152687	broad.mit.edu	37	4	59405	59405	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59405A>G	uc003fzv.1	+	2	242	c.86A>G	c.(85-87)TAT>TGT	p.Y29C	ZNF595_uc003fzu.1_RNA|ZNF718_uc003fzt.3_Missense_Mutation_p.Y29C|ZNF595_uc010iay.1_RNA|ZNF595_uc011bus.1_5'UTR|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595	29					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		CAGAATTTGTATAGAGATGTG	0.413													61	698	---	---	---	---	PASS
FGFR3	2261	broad.mit.edu	37	4	1803568	1803568	+	Missense_Mutation	SNP	C	G	G	rs121913483		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1803568C>G	uc003gdr.3	+	7	1002	c.746C>G	c.(745-747)TCC>TGC	p.S249C	FGFR3_uc003gdu.2_Missense_Mutation_p.S249C|FGFR3_uc003gds.3_Missense_Mutation_p.S249C|FGFR3_uc003gdq.3_Missense_Mutation_p.S249C|FGFR3_uc010icb.1_Missense_Mutation_p.S91C|FGFR3_uc003gdt.1_Missense_Mutation_p.S91C	NM_000142	NP_000133	P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3 isoform 1	249	Extracellular (Potential).		S -> C (in KERSEB, bladder cancer, cervical cancer and TD1).		bone maturation|cell growth|insulin receptor signaling pathway|JAK-STAT cascade|MAPKKK cascade|negative regulation of developmental growth|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|identical protein binding	p.S249C(1368)|p.R248_S249insC(2)|p.S249T(1)|p.R248_S249del(1)		urinary_tract(2177)|skin(314)|upper_aerodigestive_tract(57)|haematopoietic_and_lymphoid_tissue(24)|prostate(9)|cervix(6)|central_nervous_system(4)|large_intestine(3)|lung(3)|testis(2)|pancreas(1)	2600		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)	ACAGAGCGCTCCCCGCACCGG	0.562		1	Mis|T	IGH@|ETV6	bladder|MM|T-cell lymphoma		Hypochondroplasia|Thanatophoric dysplasia		Muenke_syndrome|Saethre-Chotzen_syndrome				3	4	---	---	---	---	PASS
CCDC96	257236	broad.mit.edu	37	4	7043300	7043300	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7043300C>G	uc003gjv.2	-	1	1429	c.1366G>C	c.(1366-1368)GAG>CAG	p.E456Q	TADA2B_uc003gjw.3_5'Flank|TADA2B_uc010idi.2_5'Flank	NM_153376	NP_699207	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	456											0						CACGCGTTCTCCATGTCCATG	0.522													329	75	---	---	---	---	PASS
GPR125	166647	broad.mit.edu	37	4	22390389	22390389	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22390389C>T	uc003gqm.1	-	19	3170	c.2905G>A	c.(2905-2907)GAA>AAA	p.E969K	GPR125_uc010ieo.1_Missense_Mutation_p.E825K|GPR125_uc003gql.1_Missense_Mutation_p.E96K	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor	969	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				TGATTTATTTCGCCATTTTCA	0.438													105	19	---	---	---	---	PASS
GABRA4	2557	broad.mit.edu	37	4	46930618	46930618	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46930618G>T	uc003gxg.2	-	9	1428	c.1289C>A	c.(1288-1290)GCT>GAT	p.A430D		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	430	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TGGACTGGAAGCTAAGTAAGA	0.453													74	34	---	---	---	---	PASS
COMMD8	54951	broad.mit.edu	37	4	47462166	47462166	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47462166C>T	uc003gxi.2	-	2	225	c.217G>A	c.(217-219)GAA>AAA	p.E73K		NM_017845	NP_060315	Q9NX08	COMD8_HUMAN	COMM domain containing 8	73							protein binding				0						GTTACCTCTTCATCAGGTAAG	0.343													39	104	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47538513	47538513	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47538513G>A	uc003gxk.1	+	8	1239	c.1075G>A	c.(1075-1077)GAT>AAT	p.D359N	ATP10D_uc003gxl.1_5'UTR|ATP10D_uc003gxj.3_Missense_Mutation_p.D359N	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	359	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						TCCCGAGCCTGATGGACATAT	0.343													19	337	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	55152092	55152092	+	Missense_Mutation	SNP	G	C	C	rs121913262		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55152092G>C	uc003han.3	+	18	2855	c.2524G>C	c.(2524-2526)GAC>CAC	p.D842H	PDGFRA_uc003haa.2_Missense_Mutation_p.D602H	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	842	Protein kinase.|Cytoplasmic (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity	p.D842V(309)|p.D842_H845del(38)|p.D842Y(6)|p.D842_M844del(5)|p.D842_D846>H(4)|p.D842_D846>E(3)|p.D842_D846del(2)|p.D842I(2)|p.D842del(2)|p.D842_D846>A(2)|p.D842F(1)|p.D842_S847>EA(1)|p.R841_D842>KN(1)|p.D842_S847>RV(1)|p.D842*(1)|p.R841_D842del(1)|p.D842_D846>S(1)|p.D842_H845>A(1)|p.D842_D846>G(1)|p.D842_H845>Y(1)|p.D842_D846>N(1)|p.D842_H845>V(1)		soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	CCTGGCCAGAGACATCATGCA	0.493			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			6	193	---	---	---	---	PASS
POLR2B	5431	broad.mit.edu	37	4	57876647	57876647	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57876647G>T	uc003hcl.1	+	11	1568	c.1525G>T	c.(1525-1527)GTG>TTG	p.V509L	POLR2B_uc011cae.1_Missense_Mutation_p.V502L|POLR2B_uc011caf.1_Missense_Mutation_p.V434L|POLR2B_uc003hcm.1_Missense_Mutation_p.V2L	NM_000938	NP_000929	P30876	RPB2_HUMAN	DNA directed RNA polymerase II polypeptide B	509					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(2)	2	Glioma(25;0.08)|all_neural(26;0.181)					GTGGGGAATGGTGTGTCCTGC	0.413													100	22	---	---	---	---	PASS
TMPRSS11F	389208	broad.mit.edu	37	4	68930597	68930597	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68930597C>T	uc003hdt.1	-	8	870	c.821G>A	c.(820-822)CGA>CAA	p.R274Q	LOC550112_uc003hdl.3_Intron|uc011cak.1_Intron|SYT14L_uc010ihn.2_5'Flank	NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	274	Peptidase S1.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						CCTCACATTTCGTTTCACTGC	0.343													34	45	---	---	---	---	PASS
PPEF2	5470	broad.mit.edu	37	4	76813142	76813142	+	Intron	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76813142G>A	uc003hix.2	-						PPEF2_uc003hiy.2_Intron|PPEF2_uc003hiz.1_Intron	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with						detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CTATGACACCGATGGAGAAGC	0.612													4	68	---	---	---	---	PASS
HNRNPD	3184	broad.mit.edu	37	4	83278594	83278594	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83278594C>A	uc003hmm.1	-	5	943	c.625G>T	c.(625-627)GAA>TAA	p.E209*	HNRNPD_uc003hml.1_RNA|HNRNPD_uc003hmn.1_Nonsense_Mutation_p.E190*|HNRNPD_uc003hmo.1_Nonsense_Mutation_p.E209*|HNRNPD_uc003hmp.1_Nonsense_Mutation_p.E190*|HNRNPD_uc010ijr.1_Nonsense_Mutation_p.E190*|HNRNPD_uc011cci.1_Nonsense_Mutation_p.E55*	NM_031370	NP_112738	Q14103	HNRPD_HUMAN	heterogeneous nuclear ribonucleoprotein D	209	RRM 2.				nuclear mRNA splicing, via spliceosome|positive regulation of transcription, DNA-dependent|RNA catabolic process|transcription, DNA-dependent	cytosol|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|telomeric DNA binding				0						TCTATGGATTCCACCTGGTAT	0.358													43	10	---	---	---	---	PASS
RAP1GDS1	5910	broad.mit.edu	37	4	99341302	99341302	+	Intron	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99341302G>C	uc003htx.3	+						RAP1GDS1_uc003htw.3_Intron|RAP1GDS1_uc003htv.3_Intron|RAP1GDS1_uc003htz.3_Intron|RAP1GDS1_uc003hty.3_Intron|RAP1GDS1_uc003hua.3_Intron	NM_001100427	NP_001093897	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1 isoform								binding|GTPase activator activity			ovary(1)|lung(1)|breast(1)	3				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		CAAGGTAAAAGAAATGTTTTC	0.323			T	NUP98	T-ALL								21	81	---	---	---	---	PASS
CENPE	1062	broad.mit.edu	37	4	104116309	104116309	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104116309G>C	uc003hxb.1	-	5	529	c.439C>G	c.(439-441)CAA>GAA	p.Q147E	CENPE_uc003hxc.1_Missense_Mutation_p.Q147E	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	147	Kinesin-motor.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTCATTTTTTGAGTGCCACAG	0.308													5	94	---	---	---	---	PASS
TBCK	93627	broad.mit.edu	37	4	107173142	107173142	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107173142C>A	uc010ilv.2	-	6	843	c.478G>T	c.(478-480)GAG>TAG	p.E160*	TBCK_uc003hye.2_Nonsense_Mutation_p.E160*|TBCK_uc003hyc.2_Nonsense_Mutation_p.E97*|TBCK_uc003hyd.2_5'UTR|TBCK_uc003hyf.2_Nonsense_Mutation_p.E160*	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN	TBC domain-containing protein kinase-like	160	Protein kinase.					intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						GCAATTACCTCAGGGGCCAAG	0.378													33	67	---	---	---	---	PASS
ENPEP	2028	broad.mit.edu	37	4	111471004	111471004	+	Silent	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111471004T>C	uc003iab.3	+	17	2805	c.2463T>C	c.(2461-2463)TAT>TAC	p.Y821Y		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	821	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	AACTGCTGTATGGATTAGCAT	0.353													80	14	---	---	---	---	PASS
ANXA5	308	broad.mit.edu	37	4	122589678	122589678	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122589678T>A	uc003idu.3	-	12	978	c.908A>T	c.(907-909)GAT>GTT	p.D303V	ANXA5_uc003idv.3_Missense_Mutation_p.D303V|ANXA5_uc003idw.3_RNA|ANXA5_uc010inm.2_Missense_Mutation_p.D259V|ANXA5_uc010inn.2_Missense_Mutation_p.D243V|ANXA5_uc010ino.2_Missense_Mutation_p.D203V	NM_001154	NP_001145	P08758	ANXA5_HUMAN	annexin 5	303	Annexin 4.				anti-apoptosis|blood coagulation|negative regulation of coagulation|signal transduction	cytoplasm	calcium ion binding|calcium-dependent phospholipid binding|phospholipase inhibitor activity			ovary(1)	1						CCCAGATGTATCTCCCTGAAA	0.428													65	16	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177052713	177052713	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177052713C>A	uc003iuj.2	+	8	1150	c.994C>A	c.(994-996)CAA>AAA	p.Q332K	WDR17_uc003iuk.2_Missense_Mutation_p.Q308K|WDR17_uc003ium.3_Missense_Mutation_p.Q308K|WDR17_uc003iul.1_Intron	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	332										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		AGTTTCAGTCCAATCTCCAAC	0.343													5	149	---	---	---	---	PASS
TRIML1	339976	broad.mit.edu	37	4	189067993	189067993	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189067993C>A	uc003izm.1	+	6	989	c.874C>A	c.(874-876)CCA>ACA	p.P292T	TRIML1_uc003izn.1_Missense_Mutation_p.P16T	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	292	B30.2/SPRY.				multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		AACGCTGGACCCAGCCACAGC	0.478													133	46	---	---	---	---	PASS
BRD9	65980	broad.mit.edu	37	5	889243	889243	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:889243C>A	uc003jbq.2	-	5	666	c.499G>T	c.(499-501)GAT>TAT	p.D167Y	BRD9_uc003jbl.2_Missense_Mutation_p.D51Y|BRD9_uc003jbm.2_RNA|BRD9_uc003jbn.2_RNA|BRD9_uc011cmb.1_Missense_Mutation_p.D114Y|BRD9_uc003jbo.2_Missense_Mutation_p.D51Y|BRD9_uc011cmc.1_RNA	NM_023924	NP_076413	Q9H8M2	BRD9_HUMAN	bromodomain containing 9 isoform 1	167	Bromo.						nucleic acid binding				0			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			GCAATTGCATCCGTGACAGGA	0.348													28	58	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5303682	5303682	+	Intron	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5303682C>T	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						CTGTTCTGTGCAGTGCTCACA	0.632													4	113	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13776760	13776760	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13776760G>C	uc003jfd.2	-	55	9203	c.9161C>G	c.(9160-9162)TCA>TGA	p.S3054*		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3054	AAA 4 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TTTCATGACTGATGCCAGGTC	0.428									Kartagener_syndrome				76	178	---	---	---	---	PASS
ZNF622	90441	broad.mit.edu	37	5	16463253	16463253	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16463253T>A	uc003jfq.2	-	3	1133	c.1013A>T	c.(1012-1014)GAT>GTT	p.D338V		NM_033414	NP_219482	Q969S3	ZN622_HUMAN	zinc finger protein 622	338						cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1						CAAAGCAGCATCGCCATCTGT	0.378													104	351	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19612689	19612689	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19612689T>A	uc003jgc.2	-	5	1042	c.665A>T	c.(664-666)CAT>CTT	p.H222L	CDH18_uc003jgd.2_Missense_Mutation_p.H222L|CDH18_uc011cnm.1_Missense_Mutation_p.H222L	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	222	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GTCCATGTTATGTAAGGCCGT	0.363													33	102	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26915914	26915914	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26915914A>T	uc003jgs.1	-	3	516	c.347T>A	c.(346-348)CTA>CAA	p.L116Q	CDH9_uc010iug.2_Missense_Mutation_p.L116Q	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	116	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						TTCTCTGTCTAGTTTCTTTGC	0.383													162	293	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41203217	41203217	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41203217C>T	uc003jmk.2	-	2	326	c.116G>A	c.(115-117)TGC>TAC	p.C39Y	C6_uc003jml.1_Missense_Mutation_p.C39Y	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	39	TSP type-1 1.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TCCAGAATTGCAAGTTTTTGA	0.493													169	296	---	---	---	---	PASS
MRPS30	10884	broad.mit.edu	37	5	44813205	44813205	+	Intron	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44813205C>T	uc003joh.2	+							NM_016640	NP_057724	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30						apoptosis|translation	mitochondrion|ribosome	structural constituent of ribosome				0	Lung NSC(6;8.08e-07)					TTTTGCTCTTCAGGCTCAAAA	0.363													8	185	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45353289	45353289	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45353289C>T	uc003jok.2	-	5	1315	c.1290G>A	c.(1288-1290)AAG>AAA	p.K430K		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	430	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						AATCATGTATCTTCTGACGCA	0.323													39	268	---	---	---	---	PASS
MIER3	166968	broad.mit.edu	37	5	56233465	56233465	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56233465C>T	uc003jrd.1	-	5	401	c.376G>A	c.(376-378)GAT>AAT	p.D126N	MIER3_uc003jqz.1_Missense_Mutation_p.D63N|MIER3_uc003jra.1_Missense_Mutation_p.D126N|MIER3_uc003jrb.1_5'UTR|MIER3_uc003jrc.1_Missense_Mutation_p.D131N	NM_152622	NP_689835	Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family	126					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		GGCGTCAGATCATCCGCAGAA	0.418													81	19	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70837343	70837343	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70837343G>C	uc003kbp.1	+	29	6348	c.6085G>C	c.(6085-6087)GAT>CAT	p.D2029H	BDP1_uc003kbo.2_Missense_Mutation_p.D2029H|BDP1_uc003kbq.1_RNA|BDP1_uc003kbr.1_RNA	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	2029					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TTCTAGCCTAGATAATGTAAA	0.308													4	189	---	---	---	---	PASS
FAM169A	26049	broad.mit.edu	37	5	74077738	74077738	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74077738C>T	uc003kdm.2	-	13	1603	c.1560G>A	c.(1558-1560)AAG>AAA	p.K520K	FAM169A_uc010izm.2_Silent_p.K460K|FAM169A_uc003kdl.2_Silent_p.K338K	NM_015566	NP_056381	Q9Y6X4	F169A_HUMAN	hypothetical protein LOC26049	520											0						GATGTGCTTTCTTTCTTGGAA	0.423													150	31	---	---	---	---	PASS
MCTP1	79772	broad.mit.edu	37	5	94253660	94253660	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94253660G>C	uc003kkx.2	-	8	1291	c.1291C>G	c.(1291-1293)CTT>GTT	p.L431V	MCTP1_uc003kkv.2_Missense_Mutation_p.L210V|MCTP1_uc003kkw.2_Intron|MCTP1_uc003kkz.2_Missense_Mutation_p.L92V|MCTP1_uc003kku.2_Intron	NM_024717	NP_078993	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1 isoform L	431					calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(2)	2		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		AGGACAGGAAGAGCTGGCCTG	0.433													29	65	---	---	---	---	PASS
C5orf30	90355	broad.mit.edu	37	5	102611747	102611747	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102611747C>T	uc003kog.1	+	3	396	c.127C>T	c.(127-129)CCG>TCG	p.P43S	C5orf30_uc003koh.1_Missense_Mutation_p.P43S	NM_033211	NP_149988	Q96GV9	CE030_HUMAN	hypothetical protein LOC90355	43											0		all_cancers(142;2.22e-05)|all_epithelial(76;9.54e-08)|Prostate(80;0.0174)|Colorectal(57;0.0551)|Ovarian(225;0.11)|Lung NSC(167;0.136)|all_lung(232;0.18)		Epithelial(69;2.84e-14)|COAD - Colon adenocarcinoma(37;0.00762)		ACCCTGCTCCCCGATGCGGAG	0.592													69	11	---	---	---	---	PASS
CAMK4	814	broad.mit.edu	37	5	110820052	110820052	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110820052C>G	uc011cvj.1	+	12	1409	c.1310C>G	c.(1309-1311)GCA>GGA	p.A437G	CAMK4_uc003kpf.2_Missense_Mutation_p.A437G|CAMK4_uc010jbv.2_Missense_Mutation_p.A240G|CAMK4_uc003kpg.2_Missense_Mutation_p.A128G	NM_001744	NP_001735	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	437					activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(3)|lung(2)	5		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		GAGGGCCTAGCAGAGGAGAAG	0.537													5	51	---	---	---	---	PASS
STARD4	134429	broad.mit.edu	37	5	110842061	110842061	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110842061C>A	uc003kph.1	-	3	206	c.122G>T	c.(121-123)TGG>TTG	p.W41L	STARD4_uc010jbw.1_5'UTR|STARD4_uc010jbx.1_5'UTR|STARD4_uc003kpi.1_RNA|STARD4_uc003kpj.2_Missense_Mutation_p.W41L	NM_139164	NP_631903	Q96DR4	STAR4_HUMAN	StAR-related lipid transfer (START) domain	41	START.				lipid transport		lipid binding			ovary(1)	1		all_cancers(142;0.00259)|all_epithelial(76;8.32e-05)|Prostate(80;0.0115)|Colorectal(10;0.0959)|Ovarian(225;0.156)|all_lung(232;0.18)|Lung NSC(167;0.248)		OV - Ovarian serous cystadenocarcinoma(64;4.91e-09)|Epithelial(69;1.39e-08)|all cancers(49;2.34e-06)|COAD - Colon adenocarcinoma(37;0.049)|Colorectal(14;0.138)		GGGTTTTCTCCAAACAGTTAC	0.284													27	6	---	---	---	---	PASS
TRIM36	55521	broad.mit.edu	37	5	114506872	114506872	+	Intron	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114506872C>T	uc003kqs.2	-						TRIM36_uc011cwc.1_5'Flank|TRIM36_uc003kqt.2_Intron|TRIM36_uc003kqu.2_Silent_p.K37K	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN	tripartite motif-containing 36 isoform 1							acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding			ovary(4)|lung(2)|breast(2)	8		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		GTTCCGTCGTCTTCCCACAGC	0.458													37	80	---	---	---	---	PASS
HSD17B4	3295	broad.mit.edu	37	5	118862906	118862906	+	Missense_Mutation	SNP	C	G	G	rs138507337		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118862906C>G	uc003ksj.2	+	20	1882	c.1759C>G	c.(1759-1761)CAA>GAA	p.Q587E	HSD17B4_uc011cwg.1_Missense_Mutation_p.Q563E|HSD17B4_uc011cwh.1_Missense_Mutation_p.Q569E|HSD17B4_uc011cwi.1_Missense_Mutation_p.Q612E|HSD17B4_uc003ksk.3_Missense_Mutation_p.Q440E|HSD17B4_uc011cwj.1_Missense_Mutation_p.Q440E|HSD17B4_uc010jcn.1_Missense_Mutation_p.Q325E|HSD17B4_uc010jco.1_Missense_Mutation_p.F55L	NM_000414	NP_000405	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	587	MaoC-like.|Enoyl-CoA hydratase 2.				bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3-hydroxyacyl-CoA dehydrogenase activity|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity|estradiol 17-beta-dehydrogenase activity|isomerase activity|long-chain-enoyl-CoA hydratase activity|protein binding|sterol binding|sterol transporter activity			ovary(1)|pancreas(1)	2		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)	NADH(DB00157)	AATTCATTTTCAAACCAAGGT	0.348													4	67	---	---	---	---	PASS
ACSL6	23305	broad.mit.edu	37	5	131290009	131290009	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131290009G>T	uc010jdo.1	-	21	2095	c.2012C>A	c.(2011-2013)ACA>AAA	p.T671K	ACSL6_uc003kvv.1_Intron|ACSL6_uc003kvx.1_Missense_Mutation_p.T696K|ACSL6_uc003kvy.1_Missense_Mutation_p.T696K|ACSL6_uc003kwb.2_Missense_Mutation_p.T661K|ACSL6_uc003kvz.1_Missense_Mutation_p.T596K|ACSL6_uc003kwa.1_Missense_Mutation_p.T682K|ACSL6_uc003kvw.1_Missense_Mutation_p.T317K|ACSL6_uc010jdn.1_Missense_Mutation_p.T686K	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	671	Cytoplasmic (Potential).				fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TAGTGTTGGTGTCAGCAAGCC	0.368													61	11	---	---	---	---	PASS
SAR1B	51128	broad.mit.edu	37	5	133945269	133945269	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133945269C>T	uc003kzq.2	-	6	587	c.340G>A	c.(340-342)GAA>AAA	p.E114K	SAR1B_uc003kzr.2_Missense_Mutation_p.E114K	NM_001033503	NP_001028675	Q9Y6B6	SAR1B_HUMAN	SAR1a gene homolog 2	114					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol|endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi cisterna membrane	GTP binding|GTPase activity|metal ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACATCAAGTTCTTCTTTTGAC	0.398													31	62	---	---	---	---	PASS
PCDHB4	56131	broad.mit.edu	37	5	140502023	140502023	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140502023G>T	uc003lip.1	+	1	443	c.443G>T	c.(442-444)GGT>GTT	p.G148V		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	148	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCCAGCCGGGTACTCTATTT	0.393													78	23	---	---	---	---	PASS
PCDHB8	56128	broad.mit.edu	37	5	140558009	140558009	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140558009C>G	uc011dai.1	+	1	580	c.394C>G	c.(394-396)CCA>GCA	p.P132A	PCDHB16_uc003liv.2_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	132	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGACCACTCTCCAGTATTTCT	0.453													51	152	---	---	---	---	PASS
PCDHGC5	56097	broad.mit.edu	37	5	140870417	140870417	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140870417G>C	uc003lla.1	+	1	1610	c.1610G>C	c.(1609-1611)CGA>CCA	p.R537P	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc003lky.1_Intron|PCDHGC5_uc011dbc.1_Missense_Mutation_p.R537P	NM_018929	NP_061752	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5 isoform 1	537	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGGGGTTCGAGACTCCGGC	0.537													32	46	---	---	---	---	PASS
PCDHGC5	56097	broad.mit.edu	37	5	140871060	140871060	+	Silent	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140871060G>C	uc003lla.1	+	1	2253	c.2253G>C	c.(2251-2253)GTG>GTC	p.V751V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc003lky.1_Intron|PCDHGC5_uc011dbc.1_Silent_p.V751V	NM_018929	NP_061752	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5 isoform 1	751	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCTGCAGGTGAGCTCGGACG	0.652													4	80	---	---	---	---	PASS
PPARGC1B	133522	broad.mit.edu	37	5	149109981	149109981	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149109981C>G	uc003lrc.2	+	1	118	c.76C>G	c.(76-78)CAG>GAG	p.Q26E	PPARGC1B_uc003lrb.1_Missense_Mutation_p.Q26E|PPARGC1B_uc003lrd.2_Missense_Mutation_p.Q26E|MIR378_hsa-mir-378|MI0000786_5'Flank	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor	26	Abolishes DNA transcriptional activity when missing.				estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CGCTGACACGCAGGTACGGCC	0.731													2	1	---	---	---	---	PASS
IL12B	3593	broad.mit.edu	37	5	158749482	158749482	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158749482C>A	uc003lxr.1	-	4	444	c.402G>T	c.(400-402)AAG>AAT	p.K134N		NM_002187	NP_002178	P29460	IL12B_HUMAN	interleukin 12B precursor	134					cell cycle arrest|cell migration|defense response to Gram-negative bacterium|interferon-gamma biosynthetic process|natural killer cell activation|negative regulation of interleukin-10 production|negative regulation of interleukin-17 production|negative regulation of smooth muscle cell proliferation|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of cell adhesion|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of smooth muscle cell apoptosis|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to UV-B|sexual reproduction|T-helper 1 type immune response|T-helper cell differentiation	interleukin-12 complex|interleukin-23 complex|membrane	cytokine activity|cytokine receptor activity|interleukin-12 receptor binding|protein heterodimerization activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGAATAATTCTTGGCCTCGC	0.393													8	91	---	---	---	---	PASS
GABRA6	2559	broad.mit.edu	37	5	161128738	161128738	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161128738C>G	uc003lyu.2	+	9	1659	c.1321C>G	c.(1321-1323)CTT>GTT	p.L441V	GABRA6_uc003lyv.2_Missense_Mutation_p.L212V	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	441	Helical; (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	GGTAGTTTATCTTTCCAAAGA	0.418										TCGA Ovarian(5;0.080)			10	134	---	---	---	---	PASS
RAB24	53917	broad.mit.edu	37	5	176729500	176729500	+	Intron	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176729500G>A	uc003mfv.2	-						RAB24_uc003mfu.2_Intron|RAB24_uc003mfw.2_Intron|PRELID1_uc003mfx.2_5'Flank|PRELID1_uc003mfy.2_5'Flank	NM_130781	NP_570137	Q969Q5	RAB24_HUMAN	RAB24 gene product						autophagy|protein transport|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|protein binding				0	all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGCAGCCCTGAGGCAGAAGA	0.562													129	26	---	---	---	---	PASS
GFOD1	54438	broad.mit.edu	37	6	13486973	13486973	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13486973G>C	uc003nat.1	-	1	815	c.150C>G	c.(148-150)TTC>TTG	p.F50L	GFOD1_uc003nas.1_5'Flank|C6orf114_uc003nav.2_5'Flank	NM_018988	NP_061861	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain	50						extracellular region	binding|oxidoreductase activity			ovary(2)	2	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)			GGCTAGTGTAGAAGGGGACAC	0.607													13	59	---	---	---	---	PASS
ALDH5A1	7915	broad.mit.edu	37	6	24505163	24505163	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24505163G>T	uc003neg.2	+	4	704	c.676G>T	c.(676-678)GTG>TTG	p.V226L	ALDH5A1_uc003nef.2_Missense_Mutation_p.V226L	NM_001080	NP_001071	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5A1 isoform 2 precursor	226					acetate metabolic process|central nervous system development|galactosylceramide metabolic process|gamma-aminobutyric acid catabolic process|glucose metabolic process|glutamate metabolic process|glutamine metabolic process|glutathione metabolic process|glycerophospholipid metabolic process|neurotransmitter catabolic process|neurotransmitter secretion|protein homotetramerization|respiratory electron transport chain|short-chain fatty acid metabolic process|succinate metabolic process	mitochondrial matrix|soluble fraction	succinate-semialdehyde dehydrogenase activity				0					Chlormerodrin(DB00534)|NADH(DB00157)|Succinic acid(DB00139)	CTGTACTGTCGTGGTGAAGCC	0.582													7	135	---	---	---	---	PASS
HIST1H2BF	8343	broad.mit.edu	37	6	26200015	26200015	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26200015G>A	uc003ngx.2	+	1	229	c.229G>A	c.(229-231)GAG>AAG	p.E77K	HIST1H3D_uc003ngv.2_5'Flank|HIST1H2AD_uc003ngw.2_5'Flank	NM_003522	NP_003513	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	77					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding				0		all_hematologic(11;0.196)				CATCGCTGGCGAGGCTTCCCG	0.612													31	215	---	---	---	---	PASS
ZNF184	7738	broad.mit.edu	37	6	27419815	27419815	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27419815C>A	uc003njj.2	-	5	2334	c.1523G>T	c.(1522-1524)GGA>GTA	p.G508V	ZNF184_uc010jqv.2_Missense_Mutation_p.G508V|ZNF184_uc003nji.2_Missense_Mutation_p.G508V	NM_007149	NP_009080	Q99676	ZN184_HUMAN	zinc finger protein 184	508	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GAAAGCCTTTCCACATTCACT	0.393													111	17	---	---	---	---	PASS
ZNF184	7738	broad.mit.edu	37	6	27419816	27419816	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27419816C>T	uc003njj.2	-	5	2333	c.1522G>A	c.(1522-1524)GGA>AGA	p.G508R	ZNF184_uc010jqv.2_Missense_Mutation_p.G508R|ZNF184_uc003nji.2_Missense_Mutation_p.G508R	NM_007149	NP_009080	Q99676	ZN184_HUMAN	zinc finger protein 184	508	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AAAGCCTTTCCACATTCACTG	0.393													113	16	---	---	---	---	PASS
ZNF192	7745	broad.mit.edu	37	6	28121333	28121333	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28121333G>C	uc003nkn.1	+	6	1459	c.1275G>C	c.(1273-1275)CAG>CAC	p.Q425H	ZNF192_uc010jqx.1_Missense_Mutation_p.Q425H|ZNF192_uc010jqy.1_Missense_Mutation_p.Q238H|ZNF192_uc011dkz.1_Missense_Mutation_p.Q238H	NM_006298	NP_006289	Q15776	ZN192_HUMAN	zinc finger protein 192	425	C2H2-type 4.				viral reproduction	cytoplasm|nucleolus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TTCTGCACCAGAGAATCCACA	0.502													23	126	---	---	---	---	PASS
PGBD1	84547	broad.mit.edu	37	6	28251600	28251600	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28251600G>T	uc003nky.2	+	2	380	c.10G>T	c.(10-12)GCT>TCT	p.A4S	PGBD1_uc003nkz.2_Missense_Mutation_p.A4S	NM_032507	NP_115896	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	4					viral reproduction	membrane|nucleus	scavenger receptor activity|sequence-specific DNA binding transcription factor activity			ovary(4)	4						CATGTATGAAGCTTTGCCAGG	0.468													7	198	---	---	---	---	PASS
MOG	4340	broad.mit.edu	37	6	29627371	29627371	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29627371G>A	uc003nnf.2	+	2	542	c.364G>A	c.(364-366)GAA>AAA	p.E122K	MOG_uc003qzk.1_Missense_Mutation_p.E122K|MOG_uc010kle.1_Intron|MOG_uc010klf.1_Intron|MOG_uc003nmy.1_Missense_Mutation_p.E122K|MOG_uc003nmz.2_Missense_Mutation_p.E122K|MOG_uc011dlt.1_Missense_Mutation_p.E52K|MOG_uc003nna.2_Intron|MOG_uc011dlu.1_Intron|MOG_uc011dlv.1_Intron|MOG_uc003nnd.2_Missense_Mutation_p.E122K|MOG_uc003nne.2_Missense_Mutation_p.E122K|MOG_uc003nng.2_Missense_Mutation_p.E122K|MOG_uc003nnh.2_Missense_Mutation_p.E122K|MOG_uc003nni.2_Missense_Mutation_p.E122K|MOG_uc003nnj.2_Missense_Mutation_p.E122K|MOG_uc003nnk.2_Missense_Mutation_p.E122K	NM_206809	NP_996532	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein isoform	122	Ig-like V-type.|Extracellular (Potential).				cell adhesion|central nervous system development|positive regulation of MyD88-dependent toll-like receptor signaling pathway	integral to membrane|plasma membrane				ovary(1)	1						GTTCTCAGATGAAGGAGGTTT	0.468													13	76	---	---	---	---	PASS
TRIM39	56658	broad.mit.edu	37	6	30297303	30297303	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30297303G>A	uc010jrz.2	+	3	521	c.209G>A	c.(208-210)CGA>CAA	p.R70Q	HCG18_uc003npx.2_5'Flank|HCG18_uc003npy.2_5'Flank|TRIM39_uc003npz.2_Missense_Mutation_p.R70Q|TRIM39_uc003nqb.2_Missense_Mutation_p.R70Q|TRIM39_uc003nqc.2_Missense_Mutation_p.R70Q|TRIM39_uc010jsa.1_Missense_Mutation_p.R70Q	NM_021253	NP_067076	Q9HCM9	TRI39_HUMAN	tripartite motif-containing 39 isoform 1	70	RING-type.				apoptosis	cytosol|mitochondrion	identical protein binding|zinc ion binding			ovary(3)	3						CCTGTCTGTCGAAAGACATCC	0.552													35	126	---	---	---	---	PASS
SLC44A4	80736	broad.mit.edu	37	6	31833700	31833700	+	Silent	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31833700G>C	uc010jti.2	-	14	1503	c.1437C>G	c.(1435-1437)CCC>CCG	p.P479P	NEU1_uc003nxq.3_5'Flank|NEU1_uc010jtg.2_5'Flank|NEU1_uc003nxr.3_5'Flank|NEU1_uc010jth.2_5'Flank|NEU1_uc003nxs.3_5'Flank	NM_025257	NP_079533	Q53GD3	CTL4_HUMAN	choline transporter-like protein 4	479	Cytoplasmic (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4					Choline(DB00122)	GGATGTCCTGGGGCTTGTGGA	0.632													11	70	---	---	---	---	PASS
PBX2	5089	broad.mit.edu	37	6	32155509	32155509	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32155509T>A	uc003oav.1	-	5	1056	c.785A>T	c.(784-786)TAT>TTT	p.Y262F	PBX2_uc003oaw.2_Missense_Mutation_p.Y262F	NM_002586	NP_002577	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	262	Homeobox; TALE-type.						transcription factor binding			ovary(1)	1						GGAGTAGAAATACTCATTTAG	0.517													4	32	---	---	---	---	PASS
BRPF3	27154	broad.mit.edu	37	6	36175169	36175169	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36175169C>T	uc003olv.3	+	4	1909	c.1685C>T	c.(1684-1686)GCG>GTG	p.A562V	BRPF3_uc010jwb.2_Missense_Mutation_p.A562V|BRPF3_uc011dtj.1_RNA|BRPF3_uc010jwc.2_RNA|BRPF3_uc011dtk.1_Missense_Mutation_p.A562V	NM_015695	NP_056510	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	562					histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding			ovary(1)|skin(1)	2						TTGGAGCGGGCGCGGCTGCTG	0.562													4	52	---	---	---	---	PASS
KIF6	221458	broad.mit.edu	37	6	39353422	39353422	+	Missense_Mutation	SNP	G	A	A	rs139112928		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39353422G>A	uc003oot.2	-	16	1932	c.1837C>T	c.(1837-1839)CGG>TGG	p.R613W	KIF6_uc003oos.2_Missense_Mutation_p.R64W|KIF6_uc010jwz.1_5'UTR|KIF6_uc010jxa.1_Missense_Mutation_p.R404W|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Missense_Mutation_p.R557W	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	613	Potential.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						TGTATATGCCGCTGGGTGATT	0.468													4	130	---	---	---	---	PASS
RHAG	6005	broad.mit.edu	37	6	49582568	49582568	+	Splice_Site	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49582568T>C	uc003ozk.3	-	5	703	c.641_splice	c.e5-1	p.G214_splice	RHAG_uc010jzl.2_Splice_Site_p.G214_splice|RHAG_uc010jzm.2_Splice_Site_p.G214_splice	NM_000324	NP_000315	Q02094	RHAG_HUMAN	Rh-associated glycoprotein						carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)|skin(1)	2	Lung NSC(77;0.0255)					AGAGAGTCCCTGTAGTGAACC	0.388													82	8	---	---	---	---	PASS
DEFB110	245913	broad.mit.edu	37	6	49989594	49989594	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49989594C>G	uc003pac.2	-	1	101	c.55G>C	c.(55-57)GCC>CCC	p.A19P	DEFB110_uc011dwr.1_Missense_Mutation_p.A19P	NM_001037497	NP_001032586	Q30KQ9	DB110_HUMAN	beta-defensin 110 isoform a	19					defense response to bacterium	extracellular region				ovary(1)	1	Lung NSC(77;0.042)					TGCATATTACCTGGTAAAATT	0.299													41	16	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51695669	51695669	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51695669G>A	uc003pah.1	-	52	8568	c.8292C>T	c.(8290-8292)CTC>CTT	p.L2764L	PKHD1_uc010jzn.1_Silent_p.L747L|PKHD1_uc003pai.2_Silent_p.L2764L	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2764	G8 2.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TGGGTAAAATGAGAACGTCAT	0.433													42	130	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51771044	51771044	+	Missense_Mutation	SNP	G	C	C	rs140065359	byFrequency	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51771044G>C	uc003pah.1	-	41	7053	c.6777C>G	c.(6775-6777)TTC>TTG	p.F2259L	PKHD1_uc010jzn.1_Intron|PKHD1_uc003pai.2_Missense_Mutation_p.F2259L	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2259	PbH1 2.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					AAATATTGTAGAATACATTAC	0.438													29	116	---	---	---	---	PASS
PAQR8	85315	broad.mit.edu	37	6	52268234	52268234	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52268234G>A	uc003pao.3	+	2	397	c.223G>A	c.(223-225)GAG>AAG	p.E75K		NM_133367	NP_588608	Q8TEZ7	MPRB_HUMAN	progestin and adipoQ receptor family member	75	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|oogenesis	integral to membrane|plasma membrane	receptor activity|steroid binding				0	Lung NSC(77;0.0875)					GAAACACAACGAGGTGGTCAA	0.617													9	123	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	73000470	73000470	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73000470T>C	uc003pga.2	+	25	3720	c.3643T>C	c.(3643-3645)TCA>CCA	p.S1215P	RIMS1_uc011dyb.1_Intron|RIMS1_uc003pgc.2_Intron|RIMS1_uc010kaq.2_Intron|RIMS1_uc011dyc.1_Intron|RIMS1_uc010kar.2_Intron|RIMS1_uc011dyd.1_Intron|RIMS1_uc003pgf.2_Intron|RIMS1_uc003pgg.2_Intron|RIMS1_uc003pgi.2_Intron|RIMS1_uc003pgh.2_Intron|RIMS1_uc003pgd.2_Intron|RIMS1_uc003pge.2_Intron|RIMS1_uc011dye.1_Intron|RIMS1_uc011dyf.1_Intron	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1215					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TCCTGCTCGCTCAAGGTCGAG	0.527													10	68	---	---	---	---	PASS
CD109	135228	broad.mit.edu	37	6	74492445	74492445	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74492445C>T	uc003php.2	+	18	2497	c.2072C>T	c.(2071-2073)CCA>CTA	p.P691L	CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Missense_Mutation_p.P691L|CD109_uc010kba.2_Missense_Mutation_p.P614L	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor	691	Bait region (approximate) (By similarity).					anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						AAGCATTTTCCAGAGACTTGG	0.363													15	213	---	---	---	---	PASS
MYO6	4646	broad.mit.edu	37	6	76576653	76576653	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76576653A>T	uc003pih.1	+	18	2054	c.1775A>T	c.(1774-1776)CAG>CTG	p.Q592L	MYO6_uc003pig.1_Missense_Mutation_p.Q592L|MYO6_uc003pii.1_Missense_Mutation_p.Q592L	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	592	Myosin head-like.				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		TTTCAGACCCAGTTTGTGGAG	0.264													65	6	---	---	---	---	PASS
SNAP91	9892	broad.mit.edu	37	6	84333044	84333044	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84333044T>A	uc011dze.1	-	9	1100	c.783A>T	c.(781-783)AAA>AAT	p.K261N	SNAP91_uc003pkb.2_Missense_Mutation_p.K226N|SNAP91_uc003pkc.2_Missense_Mutation_p.K261N|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Missense_Mutation_p.K261N|SNAP91_uc011dzf.1_Missense_Mutation_p.K142N	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog	261					clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		GAATGTCACCTTTATCAATAC	0.328													8	22	---	---	---	---	PASS
ORC3L	23595	broad.mit.edu	37	6	88317546	88317546	+	Intron	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88317546G>C	uc003pmh.2	+						ORC3L_uc011dzl.1_Intron|ORC3L_uc011dzm.1_Intron|ORC3L_uc011dzn.1_Intron|ORC3L_uc003pmg.2_Intron|ORC3L_uc003pmi.2_Intron|ORC3L_uc011dzo.1_Intron|ORC3L_uc011dzp.1_Intron	NM_012381	NP_036513	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3 isoform 2						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0		all_cancers(76;9.05e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.0469)		CACACAGGTAGATATAAACTG	0.353													4	163	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90368550	90368550	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90368550C>T	uc003pnn.1	-	89	14916	c.14800G>A	c.(14800-14802)GAA>AAA	p.E4934K		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	4934					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CTCTGACTTTCGTTCTGGTCG	0.483													8	403	---	---	---	---	PASS
PRDM13	59336	broad.mit.edu	37	6	100061957	100061957	+	Silent	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100061957C>G	uc003pqg.1	+	4	1707	c.1446C>G	c.(1444-1446)CTC>CTG	p.L482L		NM_021620	NP_067633	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	482					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		ATTACCCGCTCAAATTGCACT	0.652													22	3	---	---	---	---	PASS
AKD1	221264	broad.mit.edu	37	6	109871331	109871331	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109871331G>A	uc003ptn.2	-	25	3003	c.2926C>T	c.(2926-2928)CAT>TAT	p.H976Y	AKD1_uc011eat.1_Missense_Mutation_p.H55Y	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1	976					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						TCCTCAGGATGCTCCAAAAAC	0.403													186	29	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117678018	117678018	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117678018G>A	uc003pxp.1	-	25	4114	c.3915C>T	c.(3913-3915)ATC>ATT	p.I1305I	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1305	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AGGTGTGACTGATAATACTGT	0.383			T	GOPC|ROS1	glioblastoma|NSCLC								5	149	---	---	---	---	PASS
MCM9	254394	broad.mit.edu	37	6	119245043	119245043	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119245043C>T	uc003pyh.2	-	3	817	c.554G>A	c.(553-555)TGC>TAC	p.C185Y		NM_153255	NP_694987	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	185					DNA replication		ATP binding|DNA binding|nucleoside-triphosphatase activity			ovary(1)	1		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		GCCTGAGAGGCAAGTGAATTT	0.423													6	118	---	---	---	---	PASS
CLVS2	134829	broad.mit.edu	37	6	123384862	123384862	+	Nonsense_Mutation	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123384862A>T	uc003pzi.1	+	6	1809	c.940A>T	c.(940-942)AAA>TAA	p.K314*		NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN	retinaldehyde binding protein 1-like 2	314					lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						ACGCATGGATAAAAATGAGGA	0.383													105	13	---	---	---	---	PASS
EYA4	2070	broad.mit.edu	37	6	133783758	133783758	+	Splice_Site	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133783758G>C	uc003qec.3	+	9	1039	c.581_splice	c.e9-1	p.D194_splice	EYA4_uc011ecq.1_Splice_Site_p.D140_splice|EYA4_uc011ecr.1_Splice_Site_p.D140_splice|EYA4_uc003qed.3_Splice_Site_p.D194_splice|EYA4_uc003qee.3_Splice_Site_p.D171_splice|EYA4_uc011ecs.1_Splice_Site_p.D194_splice|uc003qef.1_Intron	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a						anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		TTTCTGAACAGATTTGGGTGT	0.423													24	78	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136597180	136597180	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136597180G>C	uc003qgx.1	-	5	1736	c.1483C>G	c.(1483-1485)CAG>GAG	p.Q495E	BCLAF1_uc003qgw.1_Intron|BCLAF1_uc003qgy.1_Missense_Mutation_p.Q493E|BCLAF1_uc011edc.1_Intron|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.Q493E	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	495					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TCAGGTGACTGAGTTTCTTTC	0.393													13	487	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136599579	136599579	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136599579G>A	uc003qgx.1	-	4	693	c.440C>T	c.(439-441)TCA>TTA	p.S147L	BCLAF1_uc003qgw.1_Missense_Mutation_p.S147L|BCLAF1_uc003qgy.1_Missense_Mutation_p.S145L|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.S145L	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	147	Poly-Ser.				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ATATGGGGATGAAGAACGAGA	0.433													15	482	---	---	---	---	PASS
KATNA1	11104	broad.mit.edu	37	6	149919436	149919436	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149919436G>A	uc003qmr.1	-	7	984	c.939C>T	c.(937-939)ATC>ATT	p.I313I	KATNA1_uc003qms.2_Silent_p.I313I|KATNA1_uc003qmt.2_Silent_p.I237I|KATNA1_uc011eed.1_Silent_p.I237I	NM_007044	NP_008975	O75449	KTNA1_HUMAN	katanin p60 subunit A 1	313					cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity			skin(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		GGCGACTACAGATGGAGTCTA	0.413													5	161	---	---	---	---	PASS
NOX3	50508	broad.mit.edu	37	6	155732410	155732410	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155732410C>T	uc003qqm.2	-	11	1496	c.1393G>A	c.(1393-1395)GAG>AAG	p.E465K		NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	465	Cytoplasmic (Potential).						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TTCCCCTGCTCACTCATCCGT	0.403													30	102	---	---	---	---	PASS
LPA	4018	broad.mit.edu	37	6	160969650	160969650	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160969650G>T	uc003qtl.2	-	32	5135	c.5015C>A	c.(5014-5016)ACA>AAA	p.T1672K		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	4180	Kringle 37.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CCAAGGGCCTGTATCGGCATC	0.522													113	15	---	---	---	---	PASS
THBS2	7058	broad.mit.edu	37	6	169632236	169632236	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169632236C>A	uc003qwt.2	-	14	2238	c.1990G>T	c.(1990-1992)GAG>TAG	p.E664*		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	664	EGF-like 3.				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		TAGATGCACTCCGCGTGCTTG	0.622													21	103	---	---	---	---	PASS
MICALL2	79778	broad.mit.edu	37	7	1481960	1481960	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1481960G>C	uc003skj.3	-	7	1726	c.1579C>G	c.(1579-1581)CAG>GAG	p.Q527E	MICALL2_uc003ski.3_Missense_Mutation_p.Q14E	NM_182924	NP_891554	Q8IY33	MILK2_HUMAN	MICAL-like 2 isoform 1	527						cytoplasm|cytoskeleton	zinc ion binding			central_nervous_system(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GCGGATGCCTGAGAGGTACTG	0.667													5	151	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21658823	21658823	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21658823G>C	uc003svc.2	+	24	4406	c.4375G>C	c.(4375-4377)GAG>CAG	p.E1459Q		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1459	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GGCGGTGAAAGAGCTGGGGAC	0.443									Kartagener_syndrome				30	17	---	---	---	---	PASS
NPC1L1	29881	broad.mit.edu	37	7	44561319	44561319	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44561319G>A	uc003tlb.2	-	12	3001	c.2945C>T	c.(2944-2946)TCG>TTG	p.S982L	NPC1L1_uc003tlc.2_Missense_Mutation_p.S982L|NPC1L1_uc011kbw.1_Missense_Mutation_p.S936L|NPC1L1_uc003tla.2_5'Flank	NM_013389	NP_037521	Q9UHC9	NPCL1_HUMAN	Niemann-Pick C1-like protein 1 isoform 1	982	Cytoplasmic (Potential).				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5					Ezetimibe(DB00973)	ACTGACGGTCGAGGGGCAGAA	0.587													53	50	---	---	---	---	PASS
OGDH	4967	broad.mit.edu	37	7	44737357	44737357	+	Silent	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44737357G>T	uc003tln.2	+	17	2443	c.2334G>T	c.(2332-2334)CTG>CTT	p.L778L	OGDH_uc011kbx.1_Silent_p.L774L|OGDH_uc011kby.1_Silent_p.L628L|OGDH_uc003tlp.2_Silent_p.L789L|OGDH_uc011kbz.1_Silent_p.L573L	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	778					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	TCGTGTTGCTGCTGCCCCATG	0.602													74	12	---	---	---	---	PASS
PSPH	5723	broad.mit.edu	37	7	56079530	56079530	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56079530G>A	uc003trg.2	-	7	966	c.603C>T	c.(601-603)ATC>ATT	p.I201I	PSPH_uc003trh.2_Silent_p.I201I|PSPH_uc003tri.2_Silent_p.I201I|PSPH_uc003trj.2_Silent_p.I230I	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase	201					L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTTGTTGCCTGATCACATTTC	0.328													11	149	---	---	---	---	PASS
ASL	435	broad.mit.edu	37	7	65557787	65557787	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65557787G>C	uc003tuo.2	+	17	1394	c.1283G>C	c.(1282-1284)TGG>TCG	p.W428S	ASL_uc003tup.2_Missense_Mutation_p.W428S|ASL_uc003tur.2_Missense_Mutation_p.W402S|ASL_uc003tuq.2_Missense_Mutation_p.W408S	NM_000048	NP_000039	P04424	ARLY_HUMAN	argininosuccinate lyase isoform 1	428					arginine biosynthetic process via ornithine|arginine catabolic process|urea cycle	cytosol	argininosuccinate lyase activity			breast(2)	2					L-Arginine(DB00125)	ATCTGCGTGTGGGACTACGGG	0.692													7	220	---	---	---	---	PASS
RABGEF1	27342	broad.mit.edu	37	7	66240357	66240357	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66240357C>T	uc011kee.1	+	3	529	c.365C>T	c.(364-366)TCT>TTT	p.S122F	RABGEF1_uc003tvf.2_5'UTR|RABGEF1_uc003tvg.2_5'UTR|RABGEF1_uc010lag.2_Missense_Mutation_p.S108F|RABGEF1_uc003tvh.2_Missense_Mutation_p.S108F|RABGEF1_uc003tvi.2_5'UTR	NM_014504	NP_055319	Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	286					endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding			ovary(1)	1						TTCAGTGCATCTTCCAGGGTC	0.458													61	104	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	71135073	71135073	+	Silent	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71135073T>C	uc003tvy.2	+	8	1383	c.1383T>C	c.(1381-1383)AAT>AAC	p.N461N	WBSCR17_uc003tvz.2_Silent_p.N160N	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	461	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GAAGATACAATAATACCGTTG	0.433													133	370	---	---	---	---	PASS
HIP1	3092	broad.mit.edu	37	7	75171274	75171274	+	Silent	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75171274C>A	uc003uds.1	-	29	2957	c.2916G>T	c.(2914-2916)ACG>ACT	p.T972T	HIP1_uc011kfz.1_Silent_p.T798T	NM_005338	NP_005329	O00291	HIP1_HUMAN	huntingtin interacting protein 1	972	I/LWEQ.				activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						TCTGTGTCAGCGTCATGCTTG	0.468			T	PDGFRB	CMML								205	117	---	---	---	---	PASS
CACNA2D1	781	broad.mit.edu	37	7	82072711	82072711	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82072711G>T	uc003uhr.1	-	1	321	c.65C>A	c.(64-66)TCG>TAG	p.S22*		NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	22						voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	CTCCTCCGACGAGGGGCCGAT	0.483													4	15	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82579207	82579207	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82579207C>T	uc003uhx.2	-	6	10986	c.10697G>A	c.(10696-10698)GGA>GAA	p.G3566E	PCLO_uc003uhv.2_Missense_Mutation_p.G3566E|PCLO_uc010lec.2_Missense_Mutation_p.G531E	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	3497					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TGTTTGACATCCTAAACTGCC	0.443													5	172	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88963696	88963696	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88963696C>G	uc011khi.1	+	4	1938	c.1400C>G	c.(1399-1401)ACA>AGA	p.T467R		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	467						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TTTACAAAAACAGAACCCTGT	0.418										HNSCC(36;0.09)			7	133	---	---	---	---	PASS
PEX1	5189	broad.mit.edu	37	7	92146608	92146608	+	Silent	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92146608G>C	uc003uly.2	-	5	1317	c.1221C>G	c.(1219-1221)CTC>CTG	p.L407L	PEX1_uc011khr.1_Silent_p.L199L|PEX1_uc010ley.2_Silent_p.L407L|PEX1_uc011khs.1_Intron|PEX1_uc011kht.1_RNA	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1	407					microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TCCCAAGATGGAGAACTTCTA	0.328													42	288	---	---	---	---	PASS
C7orf64	84060	broad.mit.edu	37	7	92166182	92166182	+	Silent	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92166182A>T	uc003ulz.2	+	5	1076	c.1035A>T	c.(1033-1035)CCA>CCT	p.P345P	C7orf64_uc003uma.2_3'UTR|MGC16142_uc011khv.1_5'Flank	NM_032120	NP_115496	Q5RL73	CG064_HUMAN	hypothetical protein LOC84060	345							nucleotide binding			ovary(2)	2						CATCTGTGCCAAAGCCTCCAG	0.328													15	12	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98562248	98562248	+	Intron	SNP	T	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98562248T>G	uc003upp.2	+						TRRAP_uc011kis.1_Intron|TRRAP_uc003upr.2_Intron	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated						histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TTTCTACATTTTAGGGACCCT	0.428													38	132	---	---	---	---	PASS
PTCD1	26024	broad.mit.edu	37	7	99032607	99032607	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99032607C>T	uc003uqh.2	-	2	390	c.259G>A	c.(259-261)GAG>AAG	p.E87K	PTCD1_uc011kiw.1_Missense_Mutation_p.E136K	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	87										ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CCAAAACTCTCCTCCTCCTCC	0.602													13	233	---	---	---	---	PASS
CNPY4	245812	broad.mit.edu	37	7	99720141	99720141	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99720141G>C	uc003uto.2	+	3	386	c.283G>C	c.(283-285)GAG>CAG	p.E95Q	TAF6_uc011kji.1_5'Flank	NM_152755	NP_689968	Q8N129	CNPY4_HUMAN	canopy 4 homolog precursor	95						extracellular region					0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAATTTATGTGAGCGGATCCT	0.537													5	310	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100684579	100684579	+	Silent	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100684579C>G	uc003uxp.1	+	3	9935	c.9882C>G	c.(9880-9882)GCC>GCG	p.A3294A	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3294	Extracellular (Potential).|Ser-rich.|53.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CAACGGTGGCCAGTTCTGAAA	0.512													243	302	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100686484	100686484	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100686484C>G	uc003uxp.1	+	3	11840	c.11787C>G	c.(11785-11787)ATC>ATG	p.I3929M	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3929	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TATCAGTGATCACAGAAGGAA	0.478													68	187	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101837153	101837153	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101837153G>A	uc003uyx.3	+	13	1146	c.1108G>A	c.(1108-1110)GAG>AAG	p.E370K	CUX1_uc003uys.3_Missense_Mutation_p.E381K|CUX1_uc003uyt.2_Missense_Mutation_p.E381K|CUX1_uc011kkn.1_Missense_Mutation_p.E342K|CUX1_uc003uyw.2_Missense_Mutation_p.E335K|CUX1_uc003uyv.2_Missense_Mutation_p.E365K|CUX1_uc003uyu.2_Missense_Mutation_p.E379K	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	370					negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						TGCACCGTCCGAGGGCGCTGG	0.448													17	53	---	---	---	---	PASS
PMPCB	9512	broad.mit.edu	37	7	102952353	102952353	+	Intron	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102952353C>T	uc003vbl.2	+						PMPCB_uc003vbk.1_Intron|PMPCB_uc003vbm.2_Intron|PMPCB_uc010liv.2_Intron|PMPCB_uc010liw.2_Intron|PMPCB_uc011kll.1_Intron	NM_004279	NP_004270	O75439	MPPB_HUMAN	mitochondrial processing peptidase beta subunit						proteolysis	mitochondrial matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)	4						TGTAAGTAGTCCTGAGTTACT	0.348													42	132	---	---	---	---	PASS
CTTNBP2	83992	broad.mit.edu	37	7	117432529	117432529	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117432529G>C	uc003vjf.2	-	4	813	c.721C>G	c.(721-723)CTT>GTT	p.L241V		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	241	Potential.									ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TTGGCACGAAGCTGTTCCCGC	0.463													29	80	---	---	---	---	PASS
IQUB	154865	broad.mit.edu	37	7	123109393	123109393	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123109393C>G	uc003vkn.2	-	9	2033	c.1456G>C	c.(1456-1458)GAG>CAG	p.E486Q	IQUB_uc003vko.2_Missense_Mutation_p.E486Q|IQUB_uc010lkt.2_RNA|IQUB_uc003vkp.1_Missense_Mutation_p.E486Q	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	486										ovary(3)|large_intestine(1)	4						GTATCCATCTCAATTGTTTTG	0.343													4	242	---	---	---	---	PASS
GPR37	2861	broad.mit.edu	37	7	124386653	124386653	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124386653C>T	uc003vli.2	-	2	2419	c.1768G>A	c.(1768-1770)GAA>AAA	p.E590K		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	590	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3						AGTTCGAGTTCCGTGGTGTAC	0.498													44	201	---	---	---	---	PASS
GPR37	2861	broad.mit.edu	37	7	124404585	124404585	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124404585G>C	uc003vli.2	-	1	1097	c.446C>G	c.(445-447)TCA>TGA	p.S149*		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	149	Extracellular (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3						TTCCTCCTCTGAGATCTGAAG	0.607													11	314	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126173442	126173442	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126173442G>T	uc003vlr.2	-	8	2305	c.1994C>A	c.(1993-1995)GCC>GAC	p.A665D	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.A665D|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	665	Helical; Name=3; (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	GGTCAGAAGGGCTGCATAGCT	0.458										HNSCC(24;0.065)			25	93	---	---	---	---	PASS
GCC1	79571	broad.mit.edu	37	7	127222464	127222464	+	Silent	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127222464T>C	uc003vma.2	-	2	2350	c.1932A>G	c.(1930-1932)CAA>CAG	p.Q644Q		NM_024523	NP_078799	Q96CN9	GCC1_HUMAN	Golgi coiled-coil protein 1	644	Potential.					Golgi membrane|plasma membrane	protein binding			ovary(2)	2						CCGCTGCAAGTTGTAATGCTT	0.587													94	58	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128480731	128480731	+	Intron	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128480731G>C	uc003vnz.3	+						FLNC_uc003voa.3_Intron	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a						cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						CCTCGCAGGTGAGTACCTTGC	0.632													34	183	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131870090	131870090	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131870090G>A	uc003vra.3	-	16	3355	c.3126C>T	c.(3124-3126)ATC>ATT	p.I1042I		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	1042	Extracellular (Potential).|IPT/TIG 3.					integral to membrane|intracellular|plasma membrane				ovary(1)	1						CAATCCGCACGATGGTGGGGT	0.547													15	165	---	---	---	---	PASS
AKR1B10	57016	broad.mit.edu	37	7	134223780	134223780	+	Intron	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134223780T>C	uc003vrr.2	+							NM_020299	NP_064695	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10						cellular aldehyde metabolic process|digestion|steroid metabolic process	cytoplasm	aldo-keto reductase (NADP) activity|protein binding			skin(5)	5						GTAAGTGGCATGGAGTTAACT	0.428													32	73	---	---	---	---	PASS
KIAA1549	57670	broad.mit.edu	37	7	138603329	138603329	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138603329G>A	uc011kql.1	-	2	1092	c.1043C>T	c.(1042-1044)TCG>TTG	p.S348L	KIAA1549_uc003vuk.3_Missense_Mutation_p.S298L|KIAA1549_uc011kqj.1_Missense_Mutation_p.S348L	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	348						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230						GGCTGCGTGCGATGCAGTCAC	0.493			O	BRAF	pilocytic astrocytoma								8	334	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142364684	142364684	+	Intron	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142364684C>G	uc011krp.1	+						uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_RNA|uc011ksg.1_Intron|uc003vzx.3_Missense_Mutation_p.L107V					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		CCAGACAGCTCTTTACTTCTG	0.488													50	123	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142423480	142423480	+	Intron	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142423480A>G	uc011krr.1	+						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_5'Flank|uc011ksg.1_Intron|uc010lol.1_Missense_Mutation_p.M46V|uc011ksj.1_RNA					SubName: Full=V_segment translation product; Flags: Fragment;																		TTCTCAGAATATGAACCATGA	0.473													24	111	---	---	---	---	PASS
EPHB6	2051	broad.mit.edu	37	7	142563239	142563239	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142563239G>A	uc011kst.1	+	8	1743	c.956G>A	c.(955-957)CGG>CAG	p.R319Q	EPHB6_uc011ksu.1_Missense_Mutation_p.R319Q|EPHB6_uc003wbs.2_Missense_Mutation_p.R27Q|EPHB6_uc003wbt.2_5'UTR|EPHB6_uc003wbu.2_Missense_Mutation_p.R27Q|EPHB6_uc003wbv.2_5'Flank	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	319	Extracellular (Potential).|Cys-rich.					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19	Melanoma(164;0.059)					GCCTGCCCACGGGGGCTCTAT	0.657													9	59	---	---	---	---	PASS
OR2F1	26211	broad.mit.edu	37	7	143657394	143657394	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143657394G>C	uc003wds.1	+	1	375	c.331G>C	c.(331-333)GAG>CAG	p.E111Q		NM_012369	NP_036501	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F,	111	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	Melanoma(164;0.0903)					GGGTGGGATTGAGTTTGTTCT	0.537													19	267	---	---	---	---	PASS
GIMAP6	474344	broad.mit.edu	37	7	150325056	150325056	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150325056G>A	uc003whn.2	-	3	1054	c.630C>T	c.(628-630)GCC>GCT	p.A210A	GIMAP6_uc003whm.2_Silent_p.A130A	NM_024711	NP_078987	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	210							GTP binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTCGCAGTTGGGCCTCCTGCT	0.532													216	104	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151879574	151879574	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151879574G>A	uc003wla.2	-	36	5590	c.5371C>T	c.(5371-5373)CAG>TAG	p.Q1791*	MLL3_uc003wkz.2_Nonsense_Mutation_p.Q852*	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	1791	Gln-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		AGAAGATGCTGAGAACCAAAT	0.398			N		medulloblastoma								218	140	---	---	---	---	PASS
PAXIP1	22976	broad.mit.edu	37	7	154754061	154754061	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154754061G>A	uc003wlp.2	-	10	2140	c.2097C>T	c.(2095-2097)TTC>TTT	p.F699F	PAXIP1_uc003wlq.1_Silent_p.F665F|PAXIP1_uc011kvs.1_Silent_p.F663F	NM_007349	NP_031375	Q6ZW49	PAXI1_HUMAN	PAX interacting protein 1	699	Interaction with TP53BP1.				DNA damage response, signal transduction by p53 class mediator|DNA recombination|DNA repair|histone H3-K4 methylation|positive regulation of histone acetylation|positive regulation of histone H3-K36 methylation|positive regulation of histone H3-K4 methylation|positive regulation of isotype switching|positive regulation of protein ubiquitination|positive regulation of transcription initiation from RNA polymerase II promoter|response to ionizing radiation|transcription, DNA-dependent	histone methyltransferase complex|nuclear matrix				lung(2)|ovary(1)|breast(1)|pancreas(1)	5	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		CTCCTGGTGGGAAGGCCACTG	0.468													28	114	---	---	---	---	PASS
NOM1	64434	broad.mit.edu	37	7	156746852	156746852	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156746852G>A	uc003wmy.2	+	3	1183	c.1168G>A	c.(1168-1170)GCC>ACC	p.A390T		NM_138400	NP_612409	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	390	MIF4G.				RNA metabolic process	nucleolus	protein binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		ACTGTACATGGCCCACAGCAG	0.527													67	43	---	---	---	---	PASS
PTPRN2	5799	broad.mit.edu	37	7	157361643	157361643	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157361643C>T	uc003wno.2	-	21	2974	c.2853G>A	c.(2851-2853)CGG>CGA	p.R951R	PTPRN2_uc003wnp.2_Silent_p.R934R|PTPRN2_uc003wnq.2_Silent_p.R922R|PTPRN2_uc003wnr.2_Silent_p.R913R|PTPRN2_uc011kwa.1_Silent_p.R974R|PTPRN2_uc003wnn.2_RNA	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N	951	Substrate binding (By similarity).|Cytoplasmic (Potential).|Tyrosine-protein phosphatase.					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		AGGTGCCGCTCCGGCCTGCAC	0.557													4	138	---	---	---	---	PASS
PTPRN2	5799	broad.mit.edu	37	7	157361644	157361644	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157361644C>T	uc003wno.2	-	21	2973	c.2852G>A	c.(2851-2853)CGG>CAG	p.R951Q	PTPRN2_uc003wnp.2_Missense_Mutation_p.R934Q|PTPRN2_uc003wnq.2_Missense_Mutation_p.R922Q|PTPRN2_uc003wnr.2_Missense_Mutation_p.R913Q|PTPRN2_uc011kwa.1_Missense_Mutation_p.R974Q|PTPRN2_uc003wnn.2_RNA	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N	951	Substrate binding (By similarity).|Cytoplasmic (Potential).|Tyrosine-protein phosphatase.					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GGTGCCGCTCCGGCCTGCACC	0.557													4	135	---	---	---	---	PASS
PIWIL2	55124	broad.mit.edu	37	8	22141783	22141783	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22141783C>T	uc003xbn.2	+	6	889	c.741C>T	c.(739-741)TTC>TTT	p.F247F	PIWIL2_uc011kzf.1_Silent_p.F247F|PIWIL2_uc010ltv.2_Silent_p.F247F	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2	247					DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		ATGTGACTTTCAGGTATTCAC	0.383													11	53	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30704639	30704639	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30704639C>A	uc003xil.2	-	1	1895	c.1895G>T	c.(1894-1896)AGT>ATT	p.S632I		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	632										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		AAAATCTGGACTTTCAGAAGA	0.323													61	75	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35579725	35579725	+	Intron	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35579725C>T	uc003xjr.1	+						UNC5D_uc003xjs.1_Intron|UNC5D_uc003xju.1_5'Flank|UNC5D_uc003xjt.1_Intron	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TTGTGTCTTTCAGGCATTGAG	0.493													16	197	---	---	---	---	PASS
ADAM18	8749	broad.mit.edu	37	8	39537690	39537690	+	Nonsense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39537690C>G	uc003xni.2	+	16	1766	c.1766C>G	c.(1765-1767)TCA>TGA	p.S589*	ADAM18_uc010lww.2_RNA|ADAM18_uc010lwx.2_Nonsense_Mutation_p.S565*	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	a disintegrin and metalloprotease domain 18	589	Cys-rich.|Extracellular (Potential).				cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			TCCATGAGATCAGATGGAACA	0.368													24	46	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41573377	41573377	+	Intron	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41573377G>A	uc003xok.2	-						NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Intron|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Intron	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCTGGACCCCGAAGGGAAAAC	0.318													39	55	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41798403	41798403	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41798403G>C	uc010lxb.2	-	16	3540	c.2996C>G	c.(2995-2997)TCA>TGA	p.S999*	MYST3_uc010lxc.2_Nonsense_Mutation_p.S999*|MYST3_uc003xon.3_Nonsense_Mutation_p.S999*	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	999					histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			TGGCGAGCTTGACCGAGGGCT	0.557													11	269	---	---	---	---	PASS
BHLHE22	27319	broad.mit.edu	37	8	65493498	65493498	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65493498C>T	uc003xvi.2	+	1	685	c.151C>T	c.(151-153)CGG>TGG	p.R51W	LOC401463_uc003xvh.2_Intron	NM_152414	NP_689627	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix domain containing, class	51					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						GCCGCCGCCTCGGGAACGCCC	0.711													10	9	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77768512	77768512	+	Missense_Mutation	SNP	C	T	T	rs61729535	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77768512C>T	uc003yav.2	+	10	9607	c.9220C>T	c.(9220-9222)CCG>TCG	p.P3074S	ZFHX4_uc003yau.1_Missense_Mutation_p.P3119S|ZFHX4_uc003yaw.1_Missense_Mutation_p.P3074S	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	3074	Pro-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATCCTCCTTGCCGGGATTTCC	0.512										HNSCC(33;0.089)			27	59	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77768513	77768513	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77768513C>T	uc003yav.2	+	10	9608	c.9221C>T	c.(9220-9222)CCG>CTG	p.P3074L	ZFHX4_uc003yau.1_Missense_Mutation_p.P3119L|ZFHX4_uc003yaw.1_Missense_Mutation_p.P3074L	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	3074	Pro-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCCTCCTTGCCGGGATTTCCA	0.512										HNSCC(33;0.089)			26	58	---	---	---	---	PASS
CCNE2	9134	broad.mit.edu	37	8	95895093	95895093	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95895093C>T	uc003yhc.2	-	10	968	c.859G>A	c.(859-861)GAT>AAT	p.D287N	CCNE2_uc003yhd.2_Missense_Mutation_p.D287N	NM_057749	NP_477097	O96020	CCNE2_HUMAN	cyclin E2	287					cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	cytosol|nucleoplasm	protein kinase binding				0	Breast(36;8.75e-07)					TCTAATGAATCAATGGCTAGA	0.373													142	123	---	---	---	---	PASS
RGS22	26166	broad.mit.edu	37	8	101052292	101052292	+	Silent	SNP	A	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101052292A>C	uc003yjb.1	-	13	2157	c.1962T>G	c.(1960-1962)GGT>GGG	p.G654G	RGS22_uc003yja.1_Silent_p.G473G|RGS22_uc003yjc.1_Silent_p.G642G|RGS22_uc011lgz.1_RNA|RGS22_uc010mbo.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	654					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			CTCCCAAGGCACCAACATCTG	0.358													65	41	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110451174	110451174	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110451174C>G	uc003yne.2	+	32	3913	c.3809C>G	c.(3808-3810)ACA>AGA	p.T1270R		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1270	Extracellular (Potential).|IPT/TIG 6.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AATGAACTCACACAAAACATG	0.343										HNSCC(38;0.096)			77	37	---	---	---	---	PASS
KLHL38	340359	broad.mit.edu	37	8	124658160	124658160	+	Missense_Mutation	SNP	T	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124658160T>G	uc003yqs.1	-	3	1589	c.1565A>C	c.(1564-1566)AAA>ACA	p.K522T		NM_001081675	NP_001075144	Q2WGJ6	KLH38_HUMAN	kelch-like 38	522											0						CACGTAGAGTTTGTTTCCCAT	0.557													56	76	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131848603	131848603	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131848603C>T	uc003ytd.3	-	12	2851	c.2595G>A	c.(2593-2595)ATG>ATA	p.M865I	ADCY8_uc010mds.2_Missense_Mutation_p.M734I	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	865	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			AGATGGCAATCATGATCAGCA	0.547										HNSCC(32;0.087)			68	64	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139144901	139144901	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139144901C>G	uc003yuy.2	-	20	4327	c.4156G>C	c.(4156-4158)GTG>CTG	p.V1386L	FAM135B_uc003yux.2_Missense_Mutation_p.V1287L|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	1386										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GAATCCAGCACAGCGATGTGA	0.522										HNSCC(54;0.14)			89	170	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139163465	139163465	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139163465C>T	uc003yuy.2	-	13	3424	c.3253G>A	c.(3253-3255)GAT>AAT	p.D1085N	FAM135B_uc003yux.2_Missense_Mutation_p.D986N|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.D647N|FAM135B_uc003yvb.2_Missense_Mutation_p.D647N	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	1085										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			ACTTCCTCATCCAACGTGCTG	0.478										HNSCC(54;0.14)			33	50	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139165256	139165256	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139165256T>A	uc003yuy.2	-	13	1633	c.1462A>T	c.(1462-1464)ACA>TCA	p.T488S	FAM135B_uc003yux.2_Missense_Mutation_p.T389S|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.T50S|FAM135B_uc003yvb.2_Missense_Mutation_p.T50S	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	488										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TGATTTTGTGTGGCCACATTC	0.408										HNSCC(54;0.14)			14	65	---	---	---	---	PASS
PTK2	5747	broad.mit.edu	37	8	141828991	141828991	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141828991C>A	uc003yvu.2	-	9	1007	c.777G>T	c.(775-777)AAG>AAT	p.K259N	PTK2_uc003yvq.2_5'UTR|PTK2_uc003yvr.2_Missense_Mutation_p.K158N|PTK2_uc003yvs.2_Missense_Mutation_p.K259N|PTK2_uc003yvt.2_Missense_Mutation_p.K281N|PTK2_uc003yvv.2_Missense_Mutation_p.K146N|PTK2_uc011ljr.1_Missense_Mutation_p.K259N	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a	259	FERM.				axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CAAGAGCACACTTGAAGCATT	0.333													35	173	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144946539	144946539	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144946539C>T	uc003zaa.1	-	1	896	c.883G>A	c.(883-885)GAA>AAA	p.E295K		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	295	Plectin 6.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TTGTGGCCTTCGGGCAGCAGG	0.692													10	51	---	---	---	---	PASS
OPLAH	26873	broad.mit.edu	37	8	145112502	145112502	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145112502C>T	uc003zar.3	-	10	1353	c.1271G>A	c.(1270-1272)CGC>CAC	p.R424H	OPLAH_uc003zas.1_5'Flank|OPLAH_uc003zat.1_3'UTR	NM_017570	NP_060040	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	424							5-oxoprolinase (ATP-hydrolyzing) activity|ATP binding				0	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		L-Glutamic Acid(DB00142)	CAGGGCTTTGCGGGAGGCCTC	0.652													3	23	---	---	---	---	PASS
GPAA1	8733	broad.mit.edu	37	8	145138688	145138688	+	Silent	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145138688C>G	uc003zax.2	+	4	548	c.438C>G	c.(436-438)CTC>CTG	p.L146L	GPAA1_uc003zav.1_Silent_p.L24L|GPAA1_uc003zaw.1_Silent_p.L86L	NM_003801	NP_003792	O43292	GPAA1_HUMAN	glycosylphosphatidylinositol anchor attachment	146	Lumenal (Potential).				attachment of GPI anchor to protein|C-terminal protein lipidation|protein complex assembly|protein retention in ER lumen	GPI-anchor transamidase complex	tubulin binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.02e-40)|all cancers(56;2.11e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CGCTTGTGCTCACCGTGCCCT	0.672													17	25	---	---	---	---	PASS
NFKBIL2	4796	broad.mit.edu	37	8	145664053	145664053	+	Silent	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145664053G>T	uc011llg.1	-	12	1561	c.1546C>A	c.(1546-1548)CGG>AGG	p.R516R	uc011llh.1_Intron	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	516				R -> P (in Ref. 1; AAA85819).	cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CCCTTCCGCCGGCCCAGGTGG	0.706													18	25	---	---	---	---	PASS
DNAJB5	25822	broad.mit.edu	37	9	34996540	34996540	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34996540C>A	uc003zvt.2	+	3	628	c.490C>A	c.(490-492)CGC>AGC	p.R164S	DNAJB5_uc003zvs.2_Missense_Mutation_p.R198S|DNAJB5_uc011los.1_Missense_Mutation_p.R236S	NM_012266	NP_036398	O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	164					protein folding|response to unfolded protein		heat shock protein binding|unfolded protein binding				0			LUSC - Lung squamous cell carcinoma(32;0.00575)			GTACCCTCGGCGCAAGGTGCA	0.607													85	16	---	---	---	---	PASS
TESK1	7016	broad.mit.edu	37	9	35608409	35608409	+	Silent	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35608409T>A	uc003zxa.2	+	9	1239	c.903T>A	c.(901-903)CGT>CGA	p.R301R	TESK1_uc003zwz.1_RNA|TESK1_uc010mks.2_Silent_p.R141R	NM_006285	NP_006276	Q15569	TESK1_HUMAN	testis-specific protein kinase 1	301	Protein kinase.				cell junction assembly|spermatogenesis	cytosol	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|breast(2)|lung(1)|ovary(1)|skin(1)	7			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CCAGCACCCGTGCCCCCTTCA	0.597													42	69	---	---	---	---	PASS
ALDH1B1	219	broad.mit.edu	37	9	38396569	38396569	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38396569G>A	uc004aay.2	+	2	936	c.824G>A	c.(823-825)GGC>GAC	p.G275D		NM_000692	NP_000683	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1B1 precursor	275					carbohydrate metabolic process	mitochondrial matrix|nucleus	aldehyde dehydrogenase (NAD) activity			skin(1)	1				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)	NADH(DB00157)	AAAGCAGCTGGCGATTCCAAC	0.617													161	57	---	---	---	---	PASS
FXN	2395	broad.mit.edu	37	9	71679843	71679843	+	Intron	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71679843T>C	uc004aha.2	+						FXN_uc011lrr.1_Intron|FXN_uc004agz.2_Intron	NM_000144	NP_000135	Q16595	FRDA_HUMAN	frataxin isoform 1 preproprotein						cellular iron ion homeostasis|cellular response to hydrogen peroxide|heme biosynthetic process|ion transport|iron incorporation into metallo-sulfur cluster|negative regulation of apoptosis|negative regulation of release of cytochrome c from mitochondria|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity|protein autoprocessing|regulation of ferrochelatase activity|response to iron ion	cytosol|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferric iron binding|ferrous iron binding|ferroxidase activity|iron chaperone activity|protein binding				0						TTTTTCCACCTAATCCCCTAG	0.373													3	89	---	---	---	---	PASS
TMEM2	23670	broad.mit.edu	37	9	74340563	74340563	+	Silent	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74340563G>C	uc011lsa.1	-	11	2652	c.2112C>G	c.(2110-2112)CTC>CTG	p.L704L	TMEM2_uc010mos.2_Silent_p.L641L|TMEM2_uc011lsb.1_RNA	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a	704						integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		GTTTTGCCAAGAGCTGCAATC	0.368													60	118	---	---	---	---	PASS
ANXA1	301	broad.mit.edu	37	9	75782448	75782448	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75782448G>T	uc004ajf.1	+	11	912	c.838G>T	c.(838-840)GAG>TAG	p.E280*	ANXA1_uc004aje.1_Nonsense_Mutation_p.E280*|ANXA1_uc004ajg.1_Nonsense_Mutation_p.E280*	NM_000700	NP_000691	P04083	ANXA1_HUMAN	annexin I	280					alpha-beta T cell differentiation|anti-apoptosis|cell surface receptor linked signaling pathway|cellular component movement|inflammatory response|keratinocyte differentiation|lipid metabolic process|peptide cross-linking|positive regulation of vesicle fusion	basolateral plasma membrane|cilium|cornified envelope|cytoplasm|extracellular region|nucleus	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity|protein binding, bridging|receptor binding|structural molecule activity			breast(1)|central_nervous_system(1)	2		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Clobetasol(DB01013)|Clocortolone(DB00838)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Flumethasone Pivalate(DB00663)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol Etabonate(DB00873)|Methylprednisolone(DB00959)|Mometasone(DB00764)|Prednicarbate(DB01130)|Prednisone(DB00635)|Rimexolone(DB00896)|Triamcinolone(DB00620)	TTTCTTTGCAGAGAAGCTTCA	0.338													63	64	---	---	---	---	PASS
PTCH1	5727	broad.mit.edu	37	9	98232122	98232122	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98232122C>G	uc004avk.3	-	13	2008	c.1820G>C	c.(1819-1821)AGA>ACA	p.R607T	PTCH1_uc010mro.2_Missense_Mutation_p.R456T|PTCH1_uc010mrp.2_Missense_Mutation_p.R456T|PTCH1_uc010mrq.2_Missense_Mutation_p.R456T|PTCH1_uc004avl.3_Missense_Mutation_p.R456T|PTCH1_uc010mrr.2_Missense_Mutation_p.R541T|PTCH1_uc004avm.3_Missense_Mutation_p.R606T|PTCH1_uc010mrs.1_Missense_Mutation_p.R275T	NM_000264	NP_000255	Q13635	PTC1_HUMAN	patched isoform L	607	Cytoplasmic (Potential).				embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity			skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				AATATCCAGTCTCCTGTCCTC	0.463									Basal_Cell_Nevus_syndrome				6	182	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101830921	101830921	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101830921G>C	uc004azb.1	+	41	4128	c.3922G>C	c.(3922-3924)GAT>CAT	p.D1308H		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	1308	Nonhelical region 10 (NC10).				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				ATACTCCTTTGATGGTCGAGA	0.393													58	64	---	---	---	---	PASS
OR13C5	138799	broad.mit.edu	37	9	107360818	107360818	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107360818G>T	uc011lvp.1	-	1	877	c.877C>A	c.(877-879)CCT>ACT	p.P293T		NM_001004482	NP_001004482	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C,	293	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4						TAGATTAAAGGATTCATCATG	0.368													9	127	---	---	---	---	PASS
OR13C5	138799	broad.mit.edu	37	9	107361117	107361117	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107361117G>C	uc011lvp.1	-	1	578	c.578C>G	c.(577-579)TCA>TGA	p.S193*		NM_001004482	NP_001004482	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C,	193	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4						CTCATTGCCTGAGATGTCAGC	0.388													12	184	---	---	---	---	PASS
MUSK	4593	broad.mit.edu	37	9	113563031	113563031	+	Silent	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113563031C>A	uc004bey.2	+	14	2471	c.2373C>A	c.(2371-2373)GTC>GTA	p.V791V	MUSK_uc004bez.1_Silent_p.V371V	NM_005592	NP_005583	O15146	MUSK_HUMAN	skeletal muscle receptor tyrosine kinase	791	Protein kinase.|Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6						ATGGCGTGGTCCTCTGGGAGA	0.522													4	67	---	---	---	---	PASS
MUSK	4593	broad.mit.edu	37	9	113563049	113563049	+	Silent	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113563049C>A	uc004bey.2	+	14	2489	c.2391C>A	c.(2389-2391)TCC>TCA	p.S797S	MUSK_uc004bez.1_Silent_p.S377S	NM_005592	NP_005583	O15146	MUSK_HUMAN	skeletal muscle receptor tyrosine kinase	797	Protein kinase.|Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6						AGATCTTCTCCTATGGCCTGC	0.547													4	68	---	---	---	---	PASS
ZNF483	158399	broad.mit.edu	37	9	114305440	114305440	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114305440C>T	uc004bff.2	+	6	2449	c.2225C>T	c.(2224-2226)TCT>TTT	p.S742F	ZNF483_uc004bfg.2_Intron	NM_133464	NP_597721	Q8TF39	ZN483_HUMAN	zinc finger protein 483 isoform a	742					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1						GGATTTCACTCTGCAGAGTAA	0.378													5	105	---	---	---	---	PASS
RGS3	5998	broad.mit.edu	37	9	116346524	116346524	+	Missense_Mutation	SNP	G	T	T	rs149039905		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116346524G>T	uc004bhq.2	+	21	3041	c.2832G>T	c.(2830-2832)GAG>GAT	p.E944D	RGS3_uc004bhs.2_Missense_Mutation_p.E834D|RGS3_uc004bht.2_Missense_Mutation_p.E663D|RGS3_uc010muy.2_Intron|RGS3_uc004bhv.2_Missense_Mutation_p.E265D|RGS3_uc010muz.1_Missense_Mutation_p.E283D|RGS3_uc004bhw.2_Intron|RGS3_uc011lxh.1_Missense_Mutation_p.E254D|RGS3_uc004bhx.2_Missense_Mutation_p.E265D|RGS3_uc004bhy.1_Missense_Mutation_p.E254D|RGS3_uc004bhz.2_Missense_Mutation_p.E286D	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6	944					inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						CGCACAGCGAGGGCAGCCTGC	0.697													15	45	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119249649	119249649	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119249649G>T	uc004bjs.1	-	20	3587	c.3486C>A	c.(3484-3486)GAC>GAA	p.D1162E	ASTN2_uc004bjr.1_Missense_Mutation_p.D1158E|ASTN2_uc004bjt.1_Missense_Mutation_p.D1111E|ASTN2_uc004bjp.1_Missense_Mutation_p.D255E|ASTN2_uc004bjq.1_Missense_Mutation_p.D214E|ASTN2_uc011lxr.1_Missense_Mutation_p.D214E|ASTN2_uc011lxs.1_Missense_Mutation_p.D214E|ASTN2_uc011lxt.1_Missense_Mutation_p.D214E|ASTN2_uc004bjo.1_5'UTR	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	1162	Extracellular (Potential).|Fibronectin type-III.					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						TGTAGAGACCGTCGGGCTCCA	0.507													61	63	---	---	---	---	PASS
TRIM32	22954	broad.mit.edu	37	9	119460298	119460298	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119460298G>T	uc004bjx.2	+	2	435	c.277G>T	c.(277-279)GAG>TAG	p.E93*	ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjs.1_Intron|ASTN2_uc004bjt.1_Intron|TRIM32_uc004bjw.2_Nonsense_Mutation_p.E93*	NM_001099679	NP_001093149	Q13049	TRI32_HUMAN	tripartite motif-containing 32	93					fat cell differentiation|innate immune response|negative regulation of apoptosis|negative regulation of fibroblast proliferation|positive regulation of cell cycle|positive regulation of cell growth|positive regulation of cell migration|positive regulation of neurogenesis|positive regulation of neuron differentiation|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein catabolic process|positive regulation of proteolysis|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to tumor necrosis factor|response to UV	nucleus	myosin binding|protein self-association|RNA binding|Tat protein binding|transcription coactivator activity|translation initiation factor binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(2)|kidney(1)	3						TGGGCTCAGCGAGGCTGTGGG	0.587									Bardet-Biedl_syndrome				5	107	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7409862	7409862	+	Intron	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7409862C>G	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron|SFMBT2_uc001ijo.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						CTTAAGGAATCAGAAATAGAG	0.403													4	57	---	---	---	---	PASS
ITIH2	3698	broad.mit.edu	37	10	7763616	7763616	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7763616A>T	uc001ijs.2	+	8	905	c.743A>T	c.(742-744)CAC>CTC	p.H248L		NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide	248					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3						TTCTAGGCGCACGTCTCCTTC	0.582													71	70	---	---	---	---	PASS
SVIL	6840	broad.mit.edu	37	10	29811396	29811396	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29811396G>A	uc001iut.1	-	16	4085	c.3332C>T	c.(3331-3333)ACG>ATG	p.T1111M	SVIL_uc010qdw.1_Missense_Mutation_p.T9M|SVIL_uc001iuu.1_Missense_Mutation_p.T685M	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	1111					cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				CCCTGTCGGCGTTTTGATCTC	0.517													11	129	---	---	---	---	PASS
KIAA1462	57608	broad.mit.edu	37	10	30317688	30317688	+	Silent	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30317688C>G	uc001iux.2	-	2	1448	c.1389G>C	c.(1387-1389)CCG>CCC	p.P463P	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Silent_p.P325P|KIAA1462_uc009xle.1_Silent_p.P463P	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	463										ovary(4)	4						CTCCATGAGCCGGCTCTTGAG	0.512													47	159	---	---	---	---	PASS
ZEB1	6935	broad.mit.edu	37	10	31810369	31810369	+	Silent	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31810369A>G	uc001ivs.3	+	7	2169	c.2106A>G	c.(2104-2106)ACA>ACG	p.T702T	ZEB1_uc001ivr.3_Silent_p.T484T|ZEB1_uc010qee.1_Silent_p.T484T|ZEB1_uc010qef.1_Silent_p.T484T|ZEB1_uc009xlj.1_Silent_p.T628T|ZEB1_uc010qeg.1_Silent_p.T561T|ZEB1_uc009xlk.1_Silent_p.T484T|ZEB1_uc001ivt.3_Silent_p.T484T|ZEB1_uc001ivu.3_Silent_p.T703T|ZEB1_uc001ivv.3_Silent_p.T682T|ZEB1_uc010qeh.1_Silent_p.T635T|ZEB1_uc009xlo.1_Silent_p.T685T|ZEB1_uc009xlp.2_Silent_p.T686T	NM_030751	NP_110378	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b	702					cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)				GAAGTAGTACACCATCCCCAT	0.463													98	62	---	---	---	---	PASS
NRP1	8829	broad.mit.edu	37	10	33538423	33538423	+	Intron	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33538423T>C	uc001iwx.3	-						NRP1_uc001iwv.3_Intron|NRP1_uc009xlz.2_Intron|NRP1_uc001iww.3_Intron|NRP1_uc001iwy.3_Intron|NRP1_uc001iwz.2_Intron|NRP1_uc001ixa.2_Intron|NRP1_uc001ixb.1_Intron|NRP1_uc001ixc.1_Intron	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a						axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)	AATGATGTGCTTGAAGAGGAA	0.363													25	16	---	---	---	---	PASS
GJD4	219770	broad.mit.edu	37	10	35897272	35897272	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35897272C>G	uc001iyy.1	+	2	989	c.831C>G	c.(829-831)AGC>AGG	p.S277R		NM_153368	NP_699199	Q96KN9	CXD4_HUMAN	connexin40.1	277	Cytoplasmic (Potential).				cell communication	connexon complex|integral to membrane				large_intestine(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						GGGCTGGCAGCCCCAGGCGTA	0.706													2	1	---	---	---	---	PASS
BMS1	9790	broad.mit.edu	37	10	43317572	43317572	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43317572G>A	uc001jaj.2	+	19	3430	c.3072G>A	c.(3070-3072)GTG>GTA	p.V1024V		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	1024					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						TAAAAATTGTGAAGAAATTAA	0.294													40	124	---	---	---	---	PASS
CCDC6	8030	broad.mit.edu	37	10	61564231	61564231	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61564231G>T	uc001jks.3	-	7	1688	c.1052C>A	c.(1051-1053)TCC>TAC	p.S351Y		NM_005436	NP_005427	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	351						cytoplasm|cytoskeleton	SH3 domain binding|structural constituent of cytoskeleton			ovary(3)|breast(1)	4				Kidney(211;0.0597)		GATCGGGCTGGACACAGTGCG	0.453													60	60	---	---	---	---	PASS
COL13A1	1305	broad.mit.edu	37	10	71658503	71658503	+	Missense_Mutation	SNP	A	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71658503A>C	uc001jpr.1	+	13	1301	c.765A>C	c.(763-765)AAA>AAC	p.K255N	COL13A1_uc001jqj.1_Missense_Mutation_p.K255N|COL13A1_uc001jps.1_Missense_Mutation_p.K226N|COL13A1_uc001jpt.1_Intron|COL13A1_uc001jpu.1_Missense_Mutation_p.K236N|COL13A1_uc001jpv.1_Missense_Mutation_p.K255N|COL13A1_uc001jpx.1_Intron|COL13A1_uc001jpw.1_Intron|COL13A1_uc001jpy.1_Intron|COL13A1_uc001jpz.1_Missense_Mutation_p.K198N|COL13A1_uc001jqa.1_Intron|COL13A1_uc001jqc.1_Missense_Mutation_p.K255N|COL13A1_uc001jqb.1_Intron|COL13A1_uc001jql.2_Missense_Mutation_p.K255N|COL13A1_uc001jqd.1_Missense_Mutation_p.K243N|COL13A1_uc001jqe.1_Missense_Mutation_p.K238N|COL13A1_uc001jqf.1_Missense_Mutation_p.K236N|COL13A1_uc001jqg.1_Intron|COL13A1_uc001jqh.1_Missense_Mutation_p.K255N|COL13A1_uc001jqi.1_Missense_Mutation_p.K255N|COL13A1_uc010qjf.1_Missense_Mutation_p.K45N|COL13A1_uc001jqk.1_Intron	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1	255	Extracellular (Potential).|Nonhelical region 2 (NC2).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)	CGGTCATAAAAAGGCGGACGT	0.587													11	14	---	---	---	---	PASS
CBARA1	10367	broad.mit.edu	37	10	74322751	74322751	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74322751C>G	uc001jtb.1	-	3	365	c.232G>C	c.(232-234)GAT>CAT	p.D78H		NM_006077	NP_006068	Q9BPX6	MICU1_HUMAN	calcium binding atopy-related autoantigen 1	78					calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1						TCCCCTTCATCTTTATTCTTC	0.403													15	47	---	---	---	---	PASS
PLCE1	51196	broad.mit.edu	37	10	96033438	96033438	+	Silent	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96033438A>G	uc001kjk.2	+	19	5260	c.4626A>G	c.(4624-4626)CTA>CTG	p.L1542L	PLCE1_uc010qnx.1_Silent_p.L1526L|PLCE1_uc001kjm.2_Silent_p.L1234L	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	1542					activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				ACAAGAAGCTAAAAGCCCATC	0.383													32	104	---	---	---	---	PASS
ALDH18A1	5832	broad.mit.edu	37	10	97393298	97393298	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97393298C>T	uc001kkz.2	-	6	909	c.667G>A	c.(667-669)GAT>AAT	p.D223N	ALDH18A1_uc001kky.2_Missense_Mutation_p.D223N|ALDH18A1_uc010qog.1_Missense_Mutation_p.D112N|ALDH18A1_uc010qoh.1_Missense_Mutation_p.D11N	NM_002860	NP_002851	P54886	P5CS_HUMAN	pyrroline-5-carboxylate synthetase isoform 1	223	Glutamate 5-kinase.				proline biosynthetic process	mitochondrial inner membrane	ATP binding|glutamate 5-kinase activity|glutamate-5-semialdehyde dehydrogenase activity			pancreas(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)	L-Glutamic Acid(DB00142)	ACAACAGCATCATTTGTGTTG	0.468													4	161	---	---	---	---	PASS
GOT1	2805	broad.mit.edu	37	10	101190260	101190260	+	Silent	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101190260G>T	uc001kpr.2	-	1	271	c.63C>A	c.(61-63)CTC>CTA	p.L21L	GOT1_uc009xwh.2_RNA|GOT1_uc009xwi.2_Silent_p.L21L	NM_002079	NP_002070	P17174	AATC_HUMAN	aspartate aminotransferase 1	21					aspartate catabolic process|cellular response to insulin stimulus|gluconeogenesis|response to glucocorticoid stimulus	cytosol	L-aspartate:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding				0		Ovarian(717;0.028)|Colorectal(252;0.234)		Epithelial(162;4.76e-10)|all cancers(201;3.84e-08)	L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	AGTCGGCAGTGAGCTTGAAGA	0.597													12	141	---	---	---	---	PASS
NOLC1	9221	broad.mit.edu	37	10	103920360	103920360	+	Silent	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103920360G>C	uc001kuo.2	+	10	1486	c.1251G>C	c.(1249-1251)CTG>CTC	p.L417L	NOLC1_uc001kup.2_Silent_p.L427L|NOLC1_uc001kuq.2_Silent_p.L418L|NOLC1_uc009xxb.1_Silent_p.L136L|NOLC1_uc001kur.2_Silent_p.L136L	NM_004741	NP_004732	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	417	Nuclear localization signal (Potential).|11 X 12 AA approximate repeats of an acidic serine cluster.				mitosis|rRNA processing	cytoplasm|nucleolus	ATP binding|GTP binding|protein binding			ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		AGAAGCTTCTGACGAGAAAGG	0.562													21	50	---	---	---	---	PASS
NOLC1	9221	broad.mit.edu	37	10	103921374	103921374	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103921374G>A	uc001kuo.2	+	11	2038	c.1803G>A	c.(1801-1803)AAG>AAA	p.K601K	NOLC1_uc001kup.2_Silent_p.K611K|NOLC1_uc001kuq.2_Silent_p.K602K|NOLC1_uc009xxb.1_Silent_p.K320K|NOLC1_uc001kur.2_Silent_p.K320K	NM_004741	NP_004732	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	601	Nuclear localization signal (Potential).				mitosis|rRNA processing	cytoplasm|nucleolus	ATP binding|GTP binding|protein binding			ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		CTCAGGCCAAGAAGATAAAGC	0.388													20	58	---	---	---	---	PASS
NOLC1	9221	broad.mit.edu	37	10	103921912	103921912	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103921912G>A	uc001kuo.2	+	13	2221	c.1986G>A	c.(1984-1986)TTG>TTA	p.L662L	NOLC1_uc001kup.2_Silent_p.L672L|NOLC1_uc001kuq.2_Silent_p.L663L|NOLC1_uc009xxb.1_Silent_p.L381L|NOLC1_uc001kur.2_Silent_p.L381L	NM_004741	NP_004732	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	662					mitosis|rRNA processing	cytoplasm|nucleolus	ATP binding|GTP binding|protein binding			ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		ATCAGGTTTTGAAGTTCACCA	0.532													104	327	---	---	---	---	PASS
SH3PXD2A	9644	broad.mit.edu	37	10	105363329	105363329	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105363329C>T	uc001kxj.1	-	14	1702	c.1562G>A	c.(1561-1563)CGG>CAG	p.R521Q	SH3PXD2A_uc010qqr.1_Intron|SH3PXD2A_uc010qqs.1_Missense_Mutation_p.R356Q|SH3PXD2A_uc010qqt.1_Missense_Mutation_p.R398Q|SH3PXD2A_uc009xxn.1_Missense_Mutation_p.R356Q|SH3PXD2A_uc010qqu.1_Missense_Mutation_p.R464Q	NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1	549					cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		CTTGAGCTTCCGCGGGGAGTC	0.667													24	125	---	---	---	---	PASS
OBFC1	79991	broad.mit.edu	37	10	105677328	105677328	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105677328C>A	uc001kxl.2	-	1	100	c.25G>T	c.(25-27)GAA>TAA	p.E9*	OBFC1_uc001kxm.2_Nonsense_Mutation_p.E9*|OBFC1_uc001kxn.2_RNA	NM_024928	NP_079204	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold	9					positive regulation of DNA replication|telomere maintenance via telomere lengthening		protein binding|single-stranded telomeric DNA binding			ovary(1)	1		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		GTCTCCTCTTCACACCGGCTG	0.527													86	70	---	---	---	---	PASS
FGFR2	2263	broad.mit.edu	37	10	123278324	123278324	+	Intron	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123278324G>C	uc010qtk.1	-						FGFR2_uc010qtg.1_Intron|FGFR2_uc010qth.1_Intron|FGFR2_uc010qti.1_Intron|FGFR2_uc010qtj.1_Missense_Mutation_p.S320C|FGFR2_uc010qtl.1_Intron|FGFR2_uc010qtm.1_Intron|FGFR2_uc001lfl.3_Missense_Mutation_p.S320C|FGFR2_uc001lfm.2_Missense_Mutation_p.S231C|FGFR2_uc001lfn.3_RNA|FGFR2_uc010qtn.1_Intron|FGFR2_uc010qto.1_Intron|FGFR2_uc001lfo.1_Missense_Mutation_p.S339C|FGFR2_uc001lfg.3_5'Flank	NM_000141	NP_000132	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 1						angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)	TTCTGCATTGGAACTATTTAT	0.493		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				13	111	---	---	---	---	PASS
TCERG1L	256536	broad.mit.edu	37	10	132965127	132965127	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132965127C>T	uc001lkp.2	-	5	964	c.878G>A	c.(877-879)CGA>CAA	p.R293Q	TCERG1L_uc009yax.1_RNA	NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	293										large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		GCGGGCCACTCGGCCCCGCTC	0.512													16	53	---	---	---	---	PASS
TCERG1L	256536	broad.mit.edu	37	10	132965137	132965137	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132965137C>T	uc001lkp.2	-	5	954	c.868G>A	c.(868-870)GAG>AAG	p.E290K	TCERG1L_uc009yax.1_RNA	NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	290										large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		CGGCCCCGCTCTGTCCTTGTA	0.527													16	53	---	---	---	---	PASS
HRAS	3265	broad.mit.edu	37	11	533875	533875	+	Missense_Mutation	SNP	G	T	T	rs28933406		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:533875G>T	uc001lpv.2	-	3	369	c.181C>A	c.(181-183)CAG>AAG	p.Q61K	HRAS_uc010qvw.1_Missense_Mutation_p.Q61K|HRAS_uc010qvx.1_Missense_Mutation_p.Q61K|HRAS_uc010qvy.1_RNA	NM_005343	NP_005334	P01112	RASH_HUMAN	v-Ha-ras Harvey rat sarcoma viral oncogene	61	GTP.		Q -> L (in melanoma; strongly reduced GTP hydrolysis in the presence of RAF1; increases transformation of cultured cell lines).	Q->V: Strongly increased transformation of cultured cell lines.|Q->I: Moderately increased transformation of cultured cell lines.	activation of MAPKK activity|axon guidance|blood coagulation|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|Ras protein signal transduction|synaptic transmission	cytosol|Golgi membrane|plasma membrane	GTP binding|GTPase activity|protein C-terminus binding	p.Q61R(112)|p.Q61L(91)|p.Q61K(39)|p.Q61H(20)|p.Q61P(3)|p.Q61Q(1)|p.Q61E(1)		urinary_tract(174)|thyroid(155)|skin(126)|upper_aerodigestive_tract(112)|soft_tissue(37)|prostate(29)|salivary_gland(24)|cervix(23)|stomach(14)|pituitary(10)|lung(9)|haematopoietic_and_lymphoid_tissue(9)|breast(6)|testis(5)|endometrium(4)|bone(3)|large_intestine(2)|oesophagus(2)|penis(2)|kidney(1)|adrenal_gland(1)|thymus(1)	749		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Sulindac(DB00605)	TACTCCTCCTGGCCGGCGGTA	0.597		6	Mis		infrequent sarcomas|rare other types	rhadomyosarcoma|ganglioneuroblastoma|bladder			Costello_syndrome	HNSCC(11;0.0054)			25	72	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1017189	1017189	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1017189G>C	uc001lsw.2	-	31	5663	c.5612C>G	c.(5611-5613)TCA>TGA	p.S1871*		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1871	Thr-rich.|2.|Approximate repeats.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGTTGGCATTGAGTGGATGGA	0.572													18	438	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1104220	1104220	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1104220C>T	uc001lsx.1	+	52	15524	c.15497C>T	c.(15496-15498)TCC>TTC	p.S5166F		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	5166						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACCGGCACCTCCCGCCGGGCC	0.706													3	13	---	---	---	---	PASS
MRPL23	6150	broad.mit.edu	37	11	1977643	1977643	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1977643G>T	uc001lux.2	+	5	546	c.455G>T	c.(454-456)GGG>GTG	p.G152V		NM_021134	NP_066957	Q16540	RM23_HUMAN	mitochondrial ribosomal protein L23	152					translation	mitochondrial large ribosomal subunit	nucleotide binding|RNA binding|structural constituent of ribosome			large_intestine(2)|ovary(1)	3		all_epithelial(84;6.24e-05)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.0026)|Lung(200;0.0171)|LUSC - Lung squamous cell carcinoma(625;0.0842)		AGCTGGTTCGGGCTGTGACGG	0.736													32	3	---	---	---	---	PASS
OR51I1	390063	broad.mit.edu	37	11	5462615	5462615	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5462615T>A	uc010qze.1	-	1	130	c.130A>T	c.(130-132)AAC>TAC	p.N44Y	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001005288	NP_001005288	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I,	44	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATGCTGAGGTTACCTACAATG	0.512													90	14	---	---	---	---	PASS
OR52N4	390072	broad.mit.edu	37	11	5776473	5776473	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5776473T>A	uc001mbu.2	+	1	551	c.503T>A	c.(502-504)CTG>CAG	p.L168Q	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001005175	NP_001005175	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N,	168	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		ACCAAGCTCCTGCCCTACTGC	0.463													165	23	---	---	---	---	PASS
OR52N5	390075	broad.mit.edu	37	11	5799007	5799007	+	Silent	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5799007C>A	uc010qzn.1	-	1	858	c.858G>T	c.(856-858)GTG>GTT	p.V286V	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001922	NP_001001922	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N,	286	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		AAAGATTAGCCACAATGATGT	0.418													81	14	---	---	---	---	PASS
FAM160A2	84067	broad.mit.edu	37	11	6245602	6245602	+	Intron	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6245602C>A	uc001mcl.3	-						FAM160A2_uc001mck.3_Intron|FAM160A2_uc001mcm.2_Intron	NM_001098794	NP_001092264	Q8N612	F16A2_HUMAN	hypothetical protein LOC84067 isoform 2						early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|protein transport	FHF complex	protein binding			skin(2)	2						GCCATACAGTCTCCTACCTGG	0.498													67	9	---	---	---	---	PASS
C11orf58	10944	broad.mit.edu	37	11	16760341	16760341	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16760341G>C	uc001mmk.2	+	1	194	c.16G>C	c.(16-18)GAG>CAG	p.E6Q	C11orf58_uc010rct.1_5'UTR|SOX6_uc001mmh.1_5'Flank	NM_014267	NP_055082	O00193	SMAP_HUMAN	small acidic protein isoform a	6											0						TGCTGCCAGAGAGTCTCACCC	0.577													9	47	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	20065530	20065530	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20065530G>A	uc010rdm.1	+	14	3341	c.2980G>A	c.(2980-2982)GAT>AAT	p.D994N	NAV2_uc001mpp.2_Missense_Mutation_p.D907N|NAV2_uc001mpr.3_Missense_Mutation_p.D971N|NAV2_uc001mpt.2_Missense_Mutation_p.D57N|NAV2_uc009yhx.2_Missense_Mutation_p.D57N|NAV2_uc009yhy.1_5'UTR	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	994						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						TCCACAGACTGATGCTGAGAA	0.507													89	21	---	---	---	---	PASS
OR4A15	81328	broad.mit.edu	37	11	55136358	55136358	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55136358A>T	uc010rif.1	+	1	999	c.999A>T	c.(997-999)AAA>AAT	p.K333N		NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A,	333	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GGAGTAAAAAAGTAAGCTTAG	0.368													155	29	---	---	---	---	PASS
OR5F1	338674	broad.mit.edu	37	11	55761942	55761942	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55761942G>A	uc010riv.1	-	1	160	c.160C>T	c.(160-162)CAG>TAG	p.Q54*		NM_003697	NP_003688	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F,	54	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)					GTGTGAAGCTGGGAATCGATC	0.418													59	15	---	---	---	---	PASS
MS4A6A	64231	broad.mit.edu	37	11	59939622	59939622	+	3'UTR	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59939622C>A	uc001nor.2	-	7					MS4A6A_uc001noq.2_3'UTR|MS4A6A_uc001nos.3_3'UTR|MS4A6A_uc009ymv.2_3'UTR	NM_152852	NP_690591	Q9H2W1	M4A6A_HUMAN	membrane-spanning 4-domains, subfamily A, member							integral to membrane	receptor activity				0						AATATTTCTCCCTTTTTTCTT	0.313													100	31	---	---	---	---	PASS
BEST1	7439	broad.mit.edu	37	11	61730176	61730176	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61730176C>T	uc001nss.2	+	10	2130	c.1550C>T	c.(1549-1551)TCA>TTA	p.S517L	BEST1_uc010rlq.1_3'UTR|BEST1_uc010rlr.1_3'UTR|BEST1_uc010rls.1_Missense_Mutation_p.S145L|BEST1_uc001nsr.2_Missense_Mutation_p.S457L|BEST1_uc009ynt.2_RNA|BEST1_uc010rlt.1_Missense_Mutation_p.S457L|BEST1_uc001nst.2_Missense_Mutation_p.S430L|BEST1_uc010rlu.1_3'UTR|BEST1_uc010rlv.1_Missense_Mutation_p.S411L	NM_004183	NP_004174	O76090	BEST1_HUMAN	bestrophin 1 isoform 1	517	Cytoplasmic (Potential).				response to stimulus|transepithelial chloride transport|visual perception	basolateral plasma membrane|chloride channel complex|cytosol|membrane fraction	chloride channel activity			central_nervous_system(1)	1						GAATTGCTCTCAGAGAGCGAT	0.478													6	75	---	---	---	---	PASS
GPR137	56834	broad.mit.edu	37	11	64056748	64056748	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64056748C>G	uc001nzg.1	+	8	1473	c.1165C>G	c.(1165-1167)CTT>GTT	p.L389V	GPR137_uc010rni.1_Missense_Mutation_p.L447V|GPR137_uc001nzf.2_3'UTR|GPR137_uc001nzi.2_3'UTR|GPR137_uc010rnj.1_3'UTR|KCNK4_uc009ypl.1_5'Flank|KCNK4_uc001nzj.1_5'Flank|KCNK4_uc001nzk.1_5'Flank|KCNK4_uc010rnk.1_5'Flank|KCNK4_uc001nzl.1_5'Flank|KCNK4_uc001nzm.3_5'Flank|KCNK4_uc001nzn.1_5'Flank	NM_020155	NP_064540	Q96N19	G137A_HUMAN	G protein-coupled receptor 137	389	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(1)	1						TCTGCCGCTTCTTGCCCAGGA	0.652													27	173	---	---	---	---	PASS
CPT1A	1374	broad.mit.edu	37	11	68575083	68575083	+	Missense_Mutation	SNP	T	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68575083T>G	uc001oog.3	-	4	475	c.305A>C	c.(304-306)AAG>ACG	p.K102T	CPT1A_uc001oof.3_Missense_Mutation_p.K102T|CPT1A_uc009ysj.2_Missense_Mutation_p.K102T	NM_001876	NP_001867	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A liver isoform	102	Mitochondrial intermembrane (Potential).				carnitine shuttle|fatty acid beta-oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			skin(2)	2	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		L-Carnitine(DB00583)|Perhexiline(DB01074)	GACCACGTTCTTCGTCTGGCT	0.632													33	9	---	---	---	---	PASS
AQP11	282679	broad.mit.edu	37	11	77314592	77314592	+	Intron	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77314592C>A	uc001oyj.2	+						AQP11_uc009yuu.2_Intron	NM_173039	NP_766627	Q8NBQ7	AQP11_HUMAN	aquaporin 11							cell surface|integral to membrane	transporter activity				0	all_cancers(14;1.75e-17)|all_epithelial(13;4.7e-20)|Ovarian(111;0.249)		Epithelial(5;4.73e-49)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)			TGCTTAAAATCTGTTACAGGA	0.328													21	215	---	---	---	---	PASS
HEPHL1	341208	broad.mit.edu	37	11	93803539	93803539	+	Splice_Site	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93803539G>T	uc001pep.2	+	6	1221	c.1064_splice	c.e6-1	p.A355_splice	uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor						copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CTGTTCTGCAGCTGGTATGCT	0.303													10	1	---	---	---	---	PASS
CADM1	23705	broad.mit.edu	37	11	115102104	115102104	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115102104G>A	uc001ppi.3	-	4	660	c.531C>T	c.(529-531)ATC>ATT	p.I177I	CADM1_uc001ppf.3_Silent_p.I177I|CADM1_uc001ppk.3_Silent_p.I177I|CADM1_uc001ppj.3_Silent_p.I177I|CADM1_uc001ppl.2_Silent_p.I177I	NM_014333	NP_055148	Q9BY67	CADM1_HUMAN	immunoglobulin superfamily, member 4D isoform 1	177	Ig-like C2-type 1.|Extracellular (Potential).				adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		TGAACCACCTGATAGTCGTGG	0.463													35	87	---	---	---	---	PASS
SIDT2	51092	broad.mit.edu	37	11	117062730	117062730	+	Silent	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117062730G>C	uc001pqh.1	+	19	1913	c.1872G>C	c.(1870-1872)GTG>GTC	p.V624V	SIDT2_uc010rxe.1_Silent_p.V624V|SIDT2_uc001pqg.2_Silent_p.V645V|SIDT2_uc001pqi.1_Silent_p.V621V|SIDT2_uc001pqj.1_5'Flank	NM_001040455	NP_001035545	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2 precursor	624	Helical; (Potential).					integral to membrane|lysosomal membrane					0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		TGCTGGGCGTGGTGAGGGCCT	0.592													82	29	---	---	---	---	PASS
OR8B4	283162	broad.mit.edu	37	11	124294657	124294657	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124294657G>A	uc010sak.1	-	1	111	c.111C>T	c.(109-111)TTC>TTT	p.F37F		NM_001005196	NP_001005196	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B,	37	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		CCACCACAGTGAACACATAGA	0.448													9	72	---	---	---	---	PASS
OR8B12	219858	broad.mit.edu	37	11	124413109	124413109	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124413109A>G	uc010sam.1	-	1	442	c.442T>C	c.(442-444)TAT>CAT	p.Y148H		NM_001005195	NP_001005195	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B,	148	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		CCCATCCCATAGGCACCCAAC	0.517													47	15	---	---	---	---	PASS
B4GALNT3	283358	broad.mit.edu	37	12	667770	667770	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:667770G>T	uc001qii.1	+	18	2704	c.2704G>T	c.(2704-2706)GCC>TCC	p.A902S	B4GALNT3_uc001qik.1_Missense_Mutation_p.A451S	NM_173593	NP_775864	Q6L9W6	B4GN3_HUMAN	beta	902	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			ovary(1)|skin(1)	2	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			GGGAAAGATGGCCTTTGCCCC	0.597													4	119	---	---	---	---	PASS
DUSP16	80824	broad.mit.edu	37	12	12653560	12653560	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12653560G>C	uc001rao.1	-	4	1056	c.424C>G	c.(424-426)CTA>GTA	p.L142V	DUSP16_uc001ran.1_Intron	NM_030640	NP_085143	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	142					inactivation of MAPK activity|MAPK export from nucleus|MAPK phosphatase export from nucleus, leptomycin B sensitive	cytoplasmic membrane-bounded vesicle|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		GTAGGGACTAGAGTGGATTTT	0.443													13	62	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	14019133	14019133	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14019133T>C	uc001rbt.2	-	2	189	c.10A>G	c.(10-12)AGA>GGA	p.R4G		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	4					response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	CACTCCGCTCTGGGCTTCATC	0.517													47	20	---	---	---	---	PASS
PTPRO	5800	broad.mit.edu	37	12	15747918	15747918	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15747918G>A	uc001rcv.1	+	26	3768	c.3594G>A	c.(3592-3594)AAG>AAA	p.K1198K	PTPRO_uc001rcw.1_Silent_p.K1170K|PTPRO_uc001rcx.1_Silent_p.K387K|PTPRO_uc001rcy.1_Silent_p.K387K|PTPRO_uc001rcz.1_Silent_p.K359K|PTPRO_uc001rda.1_Silent_p.K359K	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	1198	Cytoplasmic (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				TGTGGATGAAGAAGAAGCAGC	0.423													23	63	---	---	---	---	PASS
PDE3A	5139	broad.mit.edu	37	12	20783030	20783030	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20783030C>G	uc001reh.1	+	6	1751	c.1729C>G	c.(1729-1731)CAA>GAA	p.Q577E		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	577					lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	CCTATCCCCTCAAATCCTGAC	0.423													86	235	---	---	---	---	PASS
LST-3TM12	338821	broad.mit.edu	37	12	21205082	21205082	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21205082G>T	uc010sin.1	+	9	1243	c.1243G>T	c.(1243-1245)GAG>TAG	p.E415*	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Nonsense_Mutation_p.E462*	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	415						membrane	transporter activity				0						TTGCAACTCAGAGTGCAATTG	0.333													41	152	---	---	---	---	PASS
IPO8	10526	broad.mit.edu	37	12	30806004	30806004	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30806004G>A	uc001rjd.2	-	18	2141	c.1971C>T	c.(1969-1971)TCC>TCT	p.S657S	IPO8_uc001rje.1_Silent_p.S146S|IPO8_uc010sjt.1_Silent_p.S452S	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8	657					intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TGTATGCCAGGGAAAGAATTT	0.363													29	73	---	---	---	---	PASS
OR8S1	341568	broad.mit.edu	37	12	48919625	48919625	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48919625C>G	uc010slu.1	+	1	211	c.211C>G	c.(211-213)CTC>GTC	p.L71V		NM_001005203	NP_001005203	Q8NH09	OR8S1_HUMAN	olfactory receptor, family 8, subfamily S,	71	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TTTTGTTGATCTCTGCTTCTC	0.473													19	141	---	---	---	---	PASS
PRPF40B	25766	broad.mit.edu	37	12	50028964	50028964	+	Silent	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50028964C>A	uc001rur.1	+	12	1082	c.1018C>A	c.(1018-1020)CGG>AGG	p.R340R	PRPF40B_uc001rup.1_Silent_p.R362R|PRPF40B_uc001ruq.1_Silent_p.R334R|PRPF40B_uc001rus.1_Silent_p.R283R	NM_001031698	NP_001026868	Q6NWY9	PR40B_HUMAN	Huntingtin interacting protein C isoform 1	340					mRNA processing|RNA splicing	nuclear speck				skin(2)|ovary(1)|pancreas(1)|kidney(1)	5						GGAGGAGGCCCGGCTAAGGGC	0.597													33	79	---	---	---	---	PASS
ACVRL1	94	broad.mit.edu	37	12	52307358	52307358	+	Missense_Mutation	SNP	C	T	T	rs143872998		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52307358C>T	uc001rzj.2	+	4	612	c.329C>T	c.(328-330)TCG>TTG	p.S110L	ACVRL1_uc001rzk.2_Missense_Mutation_p.S110L|ACVRL1_uc010snm.1_Intron	NM_000020	NP_000011	P37023	ACVL1_HUMAN	activin A receptor type II-like 1 precursor	110	Extracellular (Potential).				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	CAACCTCCTTCGGAGCAGCCG	0.672									Hereditary_Hemorrhagic_Telangiectasia				3	35	---	---	---	---	PASS
NCKAP1L	3071	broad.mit.edu	37	12	54894314	54894314	+	Intron	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54894314C>T	uc001sgc.3	+						NCKAP1L_uc010sox.1_Intron|NCKAP1L_uc010soy.1_Intron	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like						actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						GTGTTTCTCTCAGCAACATTT	0.353													8	207	---	---	---	---	PASS
TMEM5	10329	broad.mit.edu	37	12	64202821	64202821	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64202821G>A	uc001srq.1	+	6	1385	c.1281G>A	c.(1279-1281)ATG>ATA	p.M427I	TMEM5_uc001srr.1_Missense_Mutation_p.M324I|TMEM5_uc001srs.1_Missense_Mutation_p.M167I	NM_014254	NP_055069	Q9Y2B1	TMEM5_HUMAN	transmembrane protein 5	427	Extracellular (Potential).					integral to plasma membrane					0		Myeloproliferative disorder(1001;0.0255)	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)		AGCTTAAAATGAAATTTACTA	0.239													4	53	---	---	---	---	PASS
LEMD3	23592	broad.mit.edu	37	12	65633915	65633915	+	Splice_Site	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65633915G>C	uc001ssl.1	+	8	2030	c.2024_splice	c.e8-1	p.D675_splice	LEMD3_uc009zqo.1_Splice_Site_p.D674_splice	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3						negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		TTTATTTTTAGATGTTTTACG	0.313													3	120	---	---	---	---	PASS
HELB	92797	broad.mit.edu	37	12	66698709	66698709	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66698709T>C	uc001sti.2	+	2	414	c.386T>C	c.(385-387)CTC>CCC	p.L129P	HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B	129					DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		ATCTGTGCTCTCTTTCTTAAA	0.353													37	118	---	---	---	---	PASS
HELB	92797	broad.mit.edu	37	12	66703903	66703903	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66703903G>T	uc001sti.2	+	4	1223	c.1195G>T	c.(1195-1197)GAT>TAT	p.D399Y	HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B	399					DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		GAATTCAAGCGATGATGCATT	0.413													173	151	---	---	---	---	PASS
CAND1	55832	broad.mit.edu	37	12	67700370	67700370	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67700370G>C	uc001stn.2	+	10	3359	c.2922G>C	c.(2920-2922)TTG>TTC	p.L974F	CAND1_uc001sto.2_Missense_Mutation_p.L484F	NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein	974	HEAT 23.				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		AGGGGTACTTGATATCAGGTA	0.363													9	155	---	---	---	---	PASS
CAND1	55832	broad.mit.edu	37	12	67703954	67703954	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67703954A>T	uc001stn.2	+	13	3655	c.3218A>T	c.(3217-3219)CAT>CTT	p.H1073L	CAND1_uc001sto.2_Missense_Mutation_p.H583L	NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein	1073	HEAT 25.				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		CCATTTAAACATACGGTTGAT	0.343													157	118	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78401170	78401170	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78401170C>G	uc001syp.2	+	8	2025	c.1852C>G	c.(1852-1854)CAA>GAA	p.Q618E	NAV3_uc001syo.2_Missense_Mutation_p.Q618E	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	618	Poly-Gln.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CCAACTCCCTCAACAGCAGCA	0.502										HNSCC(70;0.22)			37	158	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80704460	80704460	+	IGR	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80704460G>C								PPP1R12A (375225 upstream) : PTPRQ (133666 downstream)																							TGCCAAGAAAGAATGCTCCAT	0.333													25	91	---	---	---	---	PASS
ACSS3	79611	broad.mit.edu	37	12	81545613	81545613	+	Intron	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81545613C>T	uc001szl.1	+						ACSS3_uc001szm.1_Intron|ACSS3_uc001szn.1_5'UTR	NM_024560	NP_078836	Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3							mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						TTCACTTTTTCTCTCCTTAGG	0.388													11	117	---	---	---	---	PASS
PPFIA2	8499	broad.mit.edu	37	12	81839428	81839428	+	Silent	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81839428C>G	uc001szo.1	-	6	638	c.477G>C	c.(475-477)CGG>CGC	p.R159R	PPFIA2_uc010sue.1_Silent_p.R59R|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	85										ovary(3)|lung(2)|pancreas(1)	6						ACTGGGCTTGCCGTTTTACCA	0.428													29	61	---	---	---	---	PASS
SLC25A3	5250	broad.mit.edu	37	12	98992432	98992432	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98992432A>T	uc001tfo.2	+	5	715	c.595A>T	c.(595-597)ACT>TCT	p.T199S	SLC25A3_uc001tfm.2_Missense_Mutation_p.T198S|SLC25A3_uc001tfn.2_Missense_Mutation_p.T198S|SLC25A3_uc001tfp.2_Missense_Mutation_p.T198S|SLC25A3_uc001tfq.2_Missense_Mutation_p.T68S|SLC25A3_uc001tfr.2_Missense_Mutation_p.T199S|SLC25A3_uc001tfs.2_Missense_Mutation_p.T155S|SLC25A3_uc009ztn.2_Missense_Mutation_p.T198S|SLC25A3_uc001tft.2_Missense_Mutation_p.T198S|SNORA53_uc001tfu.1_5'Flank	NM_005888	NP_005879	Q00325	MPCP_HUMAN	solute carrier family 25 member 3 isoform a	199	Solcar 2.|Mitochondrial matrix (Potential).				generation of precursor metabolites and energy	integral to plasma membrane|mitochondrial inner membrane	phosphate carrier activity|symporter activity				0		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		TTATGCCAACACTTTGAGGGA	0.413													28	79	---	---	---	---	PASS
SLC25A3	5250	broad.mit.edu	37	12	98994961	98994961	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98994961G>C	uc001tfo.2	+	7	950	c.830G>C	c.(829-831)TGT>TCT	p.C277S	SLC25A3_uc001tfm.2_Missense_Mutation_p.C276S|SLC25A3_uc001tfn.2_Missense_Mutation_p.C276S|SLC25A3_uc001tfp.2_Missense_Mutation_p.C276S|SLC25A3_uc001tfq.2_Missense_Mutation_p.C146S|SLC25A3_uc001tfr.2_Missense_Mutation_p.C277S|SLC25A3_uc001tfs.2_Missense_Mutation_p.C233S|SLC25A3_uc009ztn.2_Intron|SLC25A3_uc001tft.2_Missense_Mutation_p.C276S	NM_005888	NP_005879	Q00325	MPCP_HUMAN	solute carrier family 25 member 3 isoform a	277	Solcar 3.|Helical; Name=5; (Potential).				generation of precursor metabolites and energy	integral to plasma membrane|mitochondrial inner membrane	phosphate carrier activity|symporter activity				0		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		GGAGTCTTTTGTGCAATTGTT	0.348													4	94	---	---	---	---	PASS
SCYL2	55681	broad.mit.edu	37	12	100732613	100732613	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100732613A>G	uc001thn.2	+	18	2503	c.2453A>G	c.(2452-2454)AAT>AGT	p.N818S		NM_017988	NP_060458	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 protein	818	Necessary for interaction with AP2 complex and clathrin, interaction with clathrin is necessary for its targeting to the TGN and endosomal membranes.				endosome to lysosome transport|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of clathrin-mediated endocytosis|positive regulation of receptor internalization	clathrin-coated vesicle|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|protein kinase activity|receptor binding			lung(3)|ovary(2)|skin(1)	6						CCAAACTTCAATGCTTTGAGT	0.463													210	181	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104100623	104100623	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104100623G>A	uc001tjw.2	+	38	4236	c.4050G>A	c.(4048-4050)GGG>GGA	p.G1350G		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1350	Extracellular (Potential).|Laminin EGF-like 1.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						CCTGCCCAGGGAATGCCCAGA	0.557													45	47	---	---	---	---	PASS
MYO1H	283446	broad.mit.edu	37	12	109853332	109853332	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109853332C>A	uc010sxn.1	+	14	1456	c.1456C>A	c.(1456-1458)CGT>AGT	p.R486S		NM_001101421	NP_001094891	Q8N1T3	MYO1H_HUMAN	myosin 1H	Error:Variant_position_missing_in_B4DNW6_after_alignment						myosin complex	motor activity				0						GTCTCGTAGCCGTAAGCTGGC	0.353													7	11	---	---	---	---	PASS
RASAL1	8437	broad.mit.edu	37	12	113552694	113552694	+	Missense_Mutation	SNP	G	T	T	rs140563833	byFrequency	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113552694G>T	uc001tum.1	-	13	1385	c.1092C>A	c.(1090-1092)CAC>CAA	p.H364Q	RASAL1_uc010syp.1_Missense_Mutation_p.H364Q|RASAL1_uc001tul.2_Missense_Mutation_p.H364Q|RASAL1_uc001tun.1_Missense_Mutation_p.H364Q|RASAL1_uc010syq.1_Missense_Mutation_p.H364Q|RASAL1_uc001tuo.3_Missense_Mutation_p.H364Q|RASAL1_uc010syr.1_Missense_Mutation_p.H364Q	NM_004658	NP_004649	O95294	RASL1_HUMAN	RAS protein activator like 1	364	Ras-GAP.				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity			ovary(2)|skin(2)	4						TCAGGACCTCGTGCAGGTAGG	0.662													106	258	---	---	---	---	PASS
TBX5	6910	broad.mit.edu	37	12	114837386	114837386	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114837386C>T	uc001tvo.2	-	4	789	c.294G>A	c.(292-294)ACG>ACA	p.T98T	TBX5_uc001tvp.2_Silent_p.T98T|TBX5_uc001tvq.2_Silent_p.T48T|TBX5_uc010syv.1_Silent_p.T98T	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	98	T-box.				cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GAATGTACTTCGTTTTGGGAT	0.517													12	263	---	---	---	---	PASS
LRRC43	254050	broad.mit.edu	37	12	122669262	122669262	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122669262C>T	uc009zxm.2	+	2	372	c.347C>T	c.(346-348)CCG>CTG	p.P116L	LRRC43_uc001ubw.3_5'UTR|LRRC43_uc009zxl.1_RNA	NM_001098519	NP_001091989	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43 isoform 1	116											0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		ATCCGGAACCCGCTGACGATC	0.582													4	34	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132502177	132502177	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132502177C>T	uc001ujn.2	+	19	4056	c.4021C>T	c.(4021-4023)CGG>TGG	p.R1341W	EP400_uc001ujl.2_Missense_Mutation_p.R1340W|EP400_uc001ujm.2_Missense_Mutation_p.R1341W	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	1377					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CGTCGAGCCCCGGCACCCAGG	0.607													7	79	---	---	---	---	PASS
DDX51	317781	broad.mit.edu	37	12	132626392	132626392	+	Intron	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132626392T>C	uc001ujy.3	-						NOC4L_uc001ujz.1_5'Flank	NM_175066	NP_778236	Q8N8A6	DDX51_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51						rRNA processing	nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			lung(1)|pancreas(1)	2	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.59e-08)|Epithelial(86;3.62e-07)|all cancers(50;2.13e-05)		TGACACAACCTACGTTTTCTG	0.582													60	47	---	---	---	---	PASS
CENPJ	55835	broad.mit.edu	37	13	25458175	25458175	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25458175C>G	uc001upt.3	-	16	4003	c.3750G>C	c.(3748-3750)CAG>CAC	p.Q1250H	CENPJ_uc010tdf.1_RNA|CENPJ_uc010aae.2_RNA|CENPJ_uc010aaf.2_RNA	NM_018451	NP_060921	Q9HC77	CENPJ_HUMAN	centromere protein J	1250					cell division|centriole replication|G2/M transition of mitotic cell cycle|microtubule nucleation|microtubule polymerization	centriole|cytosol|gamma-tubulin small complex|microtubule	protein domain specific binding|tubulin binding			ovary(2)	2		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TTTTAACAGTCTGGTCAGGAA	0.333													13	181	---	---	---	---	PASS
FLT3	2322	broad.mit.edu	37	13	28610129	28610129	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28610129G>A	uc001urw.2	-	11	1443	c.1361C>T	c.(1360-1362)TCG>TTG	p.S454L	FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Missense_Mutation_p.S454L	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor	454	Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	GTATCCATCCGAGAAACAGGA	0.398			Mis|O		AML|ALL								91	293	---	---	---	---	PASS
PDS5B	23047	broad.mit.edu	37	13	33327663	33327663	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33327663C>T	uc010abf.2	+	25	3088	c.2930C>T	c.(2929-2931)GCA>GTA	p.A977V	PDS5B_uc010abg.2_RNA	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog	977					cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AAGCAGCATGCAGCTGTTAGT	0.368													4	71	---	---	---	---	PASS
CSNK1A1L	122011	broad.mit.edu	37	13	37678790	37678790	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37678790C>T	uc001uwm.1	-	1	1012	c.604G>A	c.(604-606)GAT>AAT	p.D202N		NM_145203	NP_660204	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	202	Protein kinase.				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)	1		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		TCCATGTCATCTCGGCGGCTC	0.438													29	163	---	---	---	---	PASS
KBTBD7	84078	broad.mit.edu	37	13	41766967	41766967	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41766967G>C	uc001uxw.1	-	1	1736	c.1427C>G	c.(1426-1428)TCC>TGC	p.S476C	uc001uxv.1_Intron	NM_032138	NP_115514	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	476	Kelch 2.						protein binding			ovary(1)	1		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		GAGTTCAAAGGAATAGAAGGA	0.448													6	103	---	---	---	---	PASS
KBTBD7	84078	broad.mit.edu	37	13	41767240	41767240	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41767240G>T	uc001uxw.1	-	1	1463	c.1154C>A	c.(1153-1155)TCA>TAA	p.S385*	uc001uxv.1_Intron	NM_032138	NP_115514	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	385							protein binding			ovary(1)	1		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		ACAGACAGCTGAGGAGGTGAC	0.502													12	180	---	---	---	---	PASS
KIAA0564	23078	broad.mit.edu	37	13	42407528	42407528	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42407528C>A	uc001uyj.2	-	13	1635	c.1565G>T	c.(1564-1566)GGC>GTC	p.G522V	KIAA0564_uc001uyk.2_Missense_Mutation_p.G522V	NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a	522						extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		AGCAAGCGTGCCCGCATTCAC	0.517													43	39	---	---	---	---	PASS
CYSLTR2	57105	broad.mit.edu	37	13	49281675	49281675	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49281675C>G	uc010acx.1	+	6	1405	c.722C>G	c.(721-723)TCT>TGT	p.S241C	CYSLTR2_uc010acy.1_Missense_Mutation_p.S241C|CYSLTR2_uc010acz.1_Missense_Mutation_p.S241C|CYSLTR2_uc010ada.1_Missense_Mutation_p.S241C|CYSLTR2_uc010adb.1_Missense_Mutation_p.S241C|CYSLTR2_uc010adc.1_Missense_Mutation_p.S241C|CYSLTR2_uc010add.1_Missense_Mutation_p.S241C|CYSLTR2_uc010acw.1_Missense_Mutation_p.S241C|CYSLTR2_uc001vck.2_Missense_Mutation_p.S241C	NM_020377	NP_065110	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	241	Cytoplasmic (Potential).				immune response	integral to membrane|plasma membrane				lung(2)	2		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	CTGCGGGTTTCTCACAGGAAG	0.512													5	126	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58299156	58299156	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58299156C>T	uc001vhq.1	+	4	4100	c.3208C>T	c.(3208-3210)CAG>TAG	p.Q1070*	PCDH17_uc010aec.1_Nonsense_Mutation_p.Q1069*|PCDH17_uc001vhr.1_Nonsense_Mutation_p.Q159*	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	1070	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		AGCAAGCAGTCAGTACTTGCC	0.532													47	130	---	---	---	---	PASS
RAB20	55647	broad.mit.edu	37	13	111176244	111176244	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111176244T>A	uc001vqy.2	-	2	678	c.473A>T	c.(472-474)TAT>TTT	p.Y158F		NM_017817	NP_060287	Q9NX57	RAB20_HUMAN	RAB20, member RAS oncogene family	158					protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding				0	all_cancers(4;1.54e-11)|all_epithelial(4;1.22e-06)|all_lung(23;1e-05)|Lung NSC(43;0.000453)|Colorectal(4;0.00323)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.197)			GATCTTTTTATAAAGGGCCAC	0.567													4	73	---	---	---	---	PASS
TTC5	91875	broad.mit.edu	37	14	20763460	20763460	+	Intron	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20763460G>C	uc001vwt.2	-						TTC5_uc001vwu.2_Intron	NM_138376	NP_612385	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5						DNA repair	cytoplasm|nucleus	binding			ovary(1)	1	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		GGAAATCCAAGAGAAACTCAC	0.488													4	50	---	---	---	---	PASS
ARHGAP5	394	broad.mit.edu	37	14	32624153	32624153	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32624153G>A	uc001wrl.2	+	7	4747	c.4508G>A	c.(4507-4509)TGA>TAA	p.*1503*	ARHGAP5_uc001wrm.2_Silent_p.*1502*|ARHGAP5_uc001wrn.2_Silent_p.*1503*|ARHGAP5_uc001wro.2_Silent_p.*242*|ARHGAP5_uc001wrp.2_Silent_p.*238*	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	1503					cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GGTATTATATGAGTAGGAAGT	0.423													27	46	---	---	---	---	PASS
BAZ1A	11177	broad.mit.edu	37	14	35272070	35272070	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35272070T>C	uc001wsk.2	-	7	1419	c.851A>G	c.(850-852)CAT>CGT	p.H284R	BAZ1A_uc001wsl.2_Missense_Mutation_p.H284R|BAZ1A_uc001wsm.1_Missense_Mutation_p.H284R	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	284					chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		TTGACTAATATGTATTCGTTT	0.363													62	15	---	---	---	---	PASS
RALGAPA1	253959	broad.mit.edu	37	14	36140706	36140706	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36140706G>A	uc001wti.2	-	25	3964	c.3573C>T	c.(3571-3573)ATC>ATT	p.I1191I	RALGAPA1_uc010amp.2_RNA|RALGAPA1_uc001wtj.2_Silent_p.I1191I|RALGAPA1_uc010tpv.1_Silent_p.I1204I|RALGAPA1_uc010tpw.1_Silent_p.I1238I	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1	1191					activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						AGTGTTTGATGATTGTATTGA	0.333													16	35	---	---	---	---	PASS
FSCB	84075	broad.mit.edu	37	14	44975031	44975031	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44975031G>A	uc001wvn.2	-	1	1469	c.1160C>T	c.(1159-1161)CCC>CTC	p.P387L		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	387	Pro-rich.					cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		TTGTGCTGAGGGAGACCGAAT	0.527													121	33	---	---	---	---	PASS
KTN1	3895	broad.mit.edu	37	14	56146352	56146352	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56146352C>A	uc001xcb.2	+	44	4320	c.4018C>A	c.(4018-4020)CAG>AAG	p.Q1340K	KTN1_uc001xce.2_Missense_Mutation_p.Q1283K|KTN1_uc001xcc.2_Missense_Mutation_p.Q1340K|KTN1_uc001xcd.2_Missense_Mutation_p.Q1289K|KTN1_uc010trb.1_Missense_Mutation_p.Q1312K|KTN1_uc001xcf.1_Missense_Mutation_p.Q1289K|KTN1_uc010aoq.2_Missense_Mutation_p.Q578K|KTN1_uc010trc.1_Missense_Mutation_p.Q317K|KTN1_uc001xcg.2_Missense_Mutation_p.Q273K	NM_182926	NP_891556	Q86UP2	KTN1_HUMAN	kinectin 1 isoform a	1340	Lumenal (Potential).|Potential.				microtubule-based movement	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction				breast(3)|ovary(2)|lung(1)|central_nervous_system(1)	7						GCAGTTGCTTCAGGCGGTAAA	0.403			T	RET	papillary thryoid								4	116	---	---	---	---	PASS
ADAM21	8747	broad.mit.edu	37	14	70925515	70925515	+	Nonsense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70925515T>A	uc001xmd.2	+	1	1299	c.1299T>A	c.(1297-1299)TGT>TGA	p.C433*		NM_003813	NP_003804	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21 preproprotein	433	Disintegrin.|Extracellular (Potential).				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			pancreas(1)|skin(1)	2				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		AAGACGCCTGTTGTCTGTTGA	0.502													100	13	---	---	---	---	PASS
NEK9	91754	broad.mit.edu	37	14	75570541	75570541	+	Intron	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75570541T>C	uc001xrl.2	-						NEK9_uc001xrk.2_Intron	NM_033116	NP_149107	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9						cell division|mitosis	mitochondrion|nucleus	ATP binding|metal ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(2)|stomach(2)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00718)		ATCAGGACACTCACTTCATGG	0.423													4	137	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20649534	20649534	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20649534G>A	uc001ytg.2	-	18	2684	c.1975C>T	c.(1975-1977)CTG>TTG	p.L659L	uc010tyx.1_RNA|uc001yth.3_Silent_p.L659L|uc010tyy.1_Silent_p.L659L					RecName: Full=Putative HERC2-like protein 3;																		GGGGCTGGCAGCTCTGCCAGC	0.572													8	604	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25322297	25322297	+	Intron	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25322297C>G	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-13_uc001yxw.2_5'Flank|SNORD116-14_uc001yxx.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						TCCCAGCATGCTGCTACATTG	0.448													79	24	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25928476	25928476	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25928476A>T	uc010ayu.2	-	17	3555	c.3449T>A	c.(3448-3450)CTG>CAG	p.L1150Q		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1150	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GTTGGTCAGCAGCACATTGGC	0.562													21	18	---	---	---	---	PASS
SLC12A6	9990	broad.mit.edu	37	15	34528946	34528946	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34528946C>T	uc001zhw.2	-	22	3169	c.3005G>A	c.(3004-3006)CGG>CAG	p.R1002Q	SLC12A6_uc001zhv.2_Missense_Mutation_p.R951Q|SLC12A6_uc001zhx.2_Missense_Mutation_p.R987Q|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_RNA|SLC12A6_uc001zia.2_Missense_Mutation_p.R943Q|SLC12A6_uc001zib.2_Missense_Mutation_p.R993Q|SLC12A6_uc001zic.2_Missense_Mutation_p.R1002Q|SLC12A6_uc010bau.2_Missense_Mutation_p.R1002Q|SLC12A6_uc001zid.2_Missense_Mutation_p.R943Q|SLC12A6_uc001zht.2_RNA|SLC12A6_uc001zhu.2_Missense_Mutation_p.R814Q	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN	solute carrier family 12, member 6 isoform a	1002	Cytoplasmic (Potential).				angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity			central_nervous_system(5)|ovary(1)|skin(1)	7		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	CCGCATGTGCCGGAGCATCTG	0.458													27	116	---	---	---	---	PASS
TMCO5A	145942	broad.mit.edu	37	15	38243444	38243444	+	3'UTR	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38243444G>C	uc001zjw.2	+	11					TMCO5A_uc001zjv.1_Intron	NM_152453	NP_689666	Q8N6Q1	TMC5A_HUMAN	transmembrane and coiled-coil domains 5A							integral to membrane				central_nervous_system(1)	1						GATTCCCTAAGAAATATCCTT	0.478													7	64	---	---	---	---	PASS
CASC5	57082	broad.mit.edu	37	15	40916355	40916355	+	Missense_Mutation	SNP	C	T	T	rs143600140	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40916355C>T	uc010bbs.1	+	11	4132	c.3971C>T	c.(3970-3972)TCC>TTC	p.S1324F	CASC5_uc010ucq.1_Missense_Mutation_p.S1148F|CASC5_uc001zme.2_Missense_Mutation_p.S1298F|CASC5_uc010bbt.1_Missense_Mutation_p.S1298F	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1	1324					acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		GTTTGTGGATCCAGTGATAAT	0.358													10	166	---	---	---	---	PASS
ZFP106	64397	broad.mit.edu	37	15	42742027	42742027	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42742027C>T	uc001zpw.2	-	2	2709	c.2374G>A	c.(2374-2376)GAA>AAA	p.E792K	ZFP106_uc001zpu.2_5'Flank|ZFP106_uc001zpv.2_Intron|ZFP106_uc001zpx.2_Intron|ZFP106_uc010udh.1_Missense_Mutation_p.E575K|ZFP106_uc001zpy.1_Missense_Mutation_p.E815K	NM_022473	NP_071918	Q9H2Y7	ZF106_HUMAN	zinc finger protein 106 homolog	792						nucleolus	zinc ion binding			central_nervous_system(2)|ovary(1)	3		all_cancers(109;1.63e-12)|all_epithelial(112;3.97e-11)|Lung NSC(122;2.04e-07)|all_lung(180;8.31e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.6e-07)		ATGACCTGTTCCCAGTTGACA	0.468													22	273	---	---	---	---	PASS
MFAP1	4236	broad.mit.edu	37	15	44109429	44109429	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44109429C>G	uc001zth.1	-	2	481	c.297G>C	c.(295-297)GAG>GAC	p.E99D		NM_005926	NP_005917	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	99						microfibril				skin(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		GACATTACCTCTCTTCCACAT	0.348													48	37	---	---	---	---	PASS
MFAP1	4236	broad.mit.edu	37	15	44109440	44109440	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44109440C>G	uc001zth.1	-	2	470	c.286G>C	c.(286-288)GAT>CAT	p.D96H		NM_005926	NP_005917	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	96						microfibril				skin(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		TCTTCCACATCTTCACTAATA	0.363													64	44	---	---	---	---	PASS
DUOXA2	405753	broad.mit.edu	37	15	45410045	45410045	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45410045G>A	uc001zuo.2	+	6	1181	c.901G>A	c.(901-903)GGC>AGC	p.G301S	DUOXA2_uc010beb.2_RNA|DUOXA1_uc010uem.1_Intron|DUOXA1_uc001zup.2_Intron|DUOXA1_uc010bec.2_Intron	NM_207581	NP_997464	Q1HG44	DOXA2_HUMAN	dual oxidase activator 2	301	Cytoplasmic (Potential).				protein transport	endoplasmic reticulum membrane|integral to membrane					0		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		TCTTATCCTCGGCGACCCACT	0.597											OREG0023102	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	131	---	---	---	---	PASS
SEMA6D	80031	broad.mit.edu	37	15	48058770	48058770	+	Intron	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48058770G>A	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GTGTTCCTATGAAGGCTGTTA	0.408													3	47	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51839475	51839475	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51839475C>T	uc002abf.2	-	7	923	c.698G>A	c.(697-699)CGA>CAA	p.R233Q	DMXL2_uc010ufy.1_Missense_Mutation_p.R233Q|DMXL2_uc010bfa.2_Missense_Mutation_p.R233Q	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	233	WD 3.					cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		TGTCACAGCTCGGGGATGTGC	0.383													20	89	---	---	---	---	PASS
LEO1	123169	broad.mit.edu	37	15	52244057	52244057	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52244057C>T	uc002abo.2	-	9	1611	c.1595G>A	c.(1594-1596)CGC>CAC	p.R532H	LEO1_uc010bfd.2_Missense_Mutation_p.R472H	NM_138792	NP_620147	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component,	532					histone H2B ubiquitination|histone monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding				0				all cancers(107;0.00264)		CATTTCTGTGCGTTGGCATTC	0.418													97	34	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	62994319	62994319	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62994319G>A	uc002alb.3	+	15	1825	c.1825G>A	c.(1825-1827)GAG>AAG	p.E609K		NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	609					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						GGGCAGCGGGGAGGACTTGCT	0.577													4	97	---	---	---	---	PASS
CA12	771	broad.mit.edu	37	15	63632566	63632566	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63632566C>A	uc002amc.2	-	7	824	c.668G>T	c.(667-669)GGG>GTG	p.G223V	CA12_uc002amd.2_Missense_Mutation_p.G223V|CA12_uc002ame.2_Missense_Mutation_p.G163V	NM_001218	NP_001209	O43570	CAH12_HUMAN	carbonic anhydrase XII isoform 1 precursor	223	Extracellular (Potential).				one-carbon metabolic process	integral to membrane	carbonate dehydratase activity|zinc ion binding			ovary(1)	1					Acetazolamide(DB00819)	GGTCAGGGACCCCCGGTAGCG	0.562													77	72	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	63908646	63908646	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63908646C>T	uc002amp.2	-	75	14072	c.13924G>A	c.(13924-13926)GAG>AAG	p.E4642K		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	4642	HECT.				protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						AAACTCTCCTCGGTAATCCCA	0.463													8	179	---	---	---	---	PASS
PARP16	54956	broad.mit.edu	37	15	65555514	65555514	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65555514C>G	uc002aoo.2	-	4	918	c.664G>C	c.(664-666)GAC>CAC	p.D222H	PARP16_uc002aop.2_Missense_Mutation_p.D107H|PARP16_uc002aoq.2_Missense_Mutation_p.D222H	NM_017851	NP_060321	Q8N5Y8	PAR16_HUMAN	poly (ADP-ribose) polymerase family, member 16	222	PARP catalytic.					integral to membrane	NAD+ ADP-ribosyltransferase activity			lung(2)	2						CACTTGACGTCCGGATGGTCA	0.602													27	37	---	---	---	---	PASS
SMAD3	4088	broad.mit.edu	37	15	67479716	67479716	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67479716G>C	uc002aqj.2	+	8	1321	c.1023G>C	c.(1021-1023)AAG>AAC	p.K341N	SMAD3_uc010ujr.1_Missense_Mutation_p.K236N|SMAD3_uc010ujs.1_Missense_Mutation_p.K297N|SMAD3_uc010ujt.1_Missense_Mutation_p.K146N	NM_005902	NP_005893	P84022	SMAD3_HUMAN	mothers against decapentaplegic homolog 3	341	MH2.			K->R: No effect on acetylation. Completely abolishes acetylation and 97% reduction in transcriptional activity; when associated with R-333; R-378 and R- 409.	activation of caspase activity|cell cycle arrest|cell-cell junction organization|evasion of host defenses by virus|immune response|induction of apoptosis|negative regulation of cell growth|negative regulation of mitotic cell cycle|negative regulation of protein catabolic process|negative regulation of protein phosphorylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|protein stabilization|regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|transport|wound healing	cytosol|nuclear inner membrane|receptor complex	beta-catenin binding|co-SMAD binding|metal ion binding|protein homodimerization activity|protein kinase binding|R-SMAD binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor binding|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding			large_intestine(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		GCAACCTGAAGATCTTCAACA	0.572													8	214	---	---	---	---	PASS
MYO9A	4649	broad.mit.edu	37	15	72286929	72286929	+	Intron	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72286929G>T	uc002atl.3	-						MYO9A_uc010biq.2_Intron|MYO9A_uc002ato.2_Intron|MYO9A_uc002atn.1_Intron	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						GTCACAGCCTGAAAAACAAAA	0.363													9	264	---	---	---	---	PASS
ADAMTS7	11173	broad.mit.edu	37	15	79059849	79059849	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79059849C>T	uc002bej.3	-	18	2942	c.2731G>A	c.(2731-2733)GTG>ATG	p.V911M	ADAMTS7_uc010und.1_Intron	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	911	TSP type-1 3.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						TCCAGCCCCACGCTGCGGATG	0.706													3	25	---	---	---	---	PASS
NTRK3	4916	broad.mit.edu	37	15	88524582	88524582	+	Intron	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88524582G>C	uc002bme.1	-						NTRK3_uc002bmh.2_Intron|NTRK3_uc002bmf.1_Intron|NTRK3_uc010upl.1_Intron|NTRK3_uc010bnh.1_Intron|NTRK3_uc002bmg.2_Nonsense_Mutation_p.S532*|NTRK3_uc010bni.2_Intron	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)			gtctatgtttGAAAAGACCCC	0.209			T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			7	175	---	---	---	---	PASS
NTRK3	4916	broad.mit.edu	37	15	88678596	88678596	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88678596C>G	uc002bme.1	-	9	1102	c.940G>C	c.(940-942)GAG>CAG	p.E314Q	NTRK3_uc002bmh.2_Missense_Mutation_p.E314Q|NTRK3_uc002bmf.1_Missense_Mutation_p.E314Q|NTRK3_uc010upl.1_Missense_Mutation_p.E216Q|NTRK3_uc010bnh.1_Missense_Mutation_p.E314Q|NTRK3_uc002bmg.2_Missense_Mutation_p.E314Q	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	314	Ig-like C2-type 2.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGGCGCAGCTCAGGCTCCTCC	0.612			T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			14	70	---	---	---	---	PASS
PCSK6	5046	broad.mit.edu	37	15	101872072	101872072	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101872072C>T	uc002bwy.2	-	15	2337	c.2023G>A	c.(2023-2025)GAG>AAG	p.E675K	PCSK6_uc010bpd.2_Missense_Mutation_p.E471K|PCSK6_uc010bpe.2_Missense_Mutation_p.E675K|PCSK6_uc002bxa.2_Missense_Mutation_p.E675K|PCSK6_uc002bxb.2_Missense_Mutation_p.E675K	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	675					glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TAATCTTCCTCATCTTCAGGA	0.562													6	86	---	---	---	---	PASS
DECR2	26063	broad.mit.edu	37	16	461361	461361	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:461361G>A	uc002chb.2	+	8	768	c.662G>A	c.(661-663)GGT>GAT	p.G221D	DECR2_uc002chc.2_Missense_Mutation_p.G137D|DECR2_uc010bqv.2_Missense_Mutation_p.G137D|DECR2_uc002chd.2_Missense_Mutation_p.G137D|DECR2_uc002che.1_RNA	NM_020664	NP_065715	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2	221						peroxisome	2,4-dienoyl-CoA reductase (NADPH) activity|binding				0		Hepatocellular(16;0.00015)				TGCCCTCCAGGTGGCCCTCAG	0.667													16	64	---	---	---	---	PASS
SOLH	6650	broad.mit.edu	37	16	601555	601555	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:601555G>A	uc002chi.2	+	9	2599	c.2236G>A	c.(2236-2238)GGC>AGC	p.G746S	SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes	746	Calpain catalytic.				proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				CTCCTGGAACGGCAGCTGGTC	0.667													19	64	---	---	---	---	PASS
IFT140	9742	broad.mit.edu	37	16	1570317	1570317	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1570317C>T	uc002cmb.2	-	28	4050	c.3688G>A	c.(3688-3690)GAC>AAC	p.D1230N	IFT140_uc002clz.2_Missense_Mutation_p.D843N	NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140	1230										ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				TTCTCCGTGTCTCCGGATTTG	0.612													10	158	---	---	---	---	PASS
SPSB3	90864	broad.mit.edu	37	16	1828177	1828177	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1828177G>T	uc002cmr.2	-	3	483	c.450C>A	c.(448-450)TTC>TTA	p.F150L	SPSB3_uc002cms.2_Missense_Mutation_p.F22L|SPSB3_uc002cmt.2_Missense_Mutation_p.F22L|SPSB3_uc002cmu.2_Missense_Mutation_p.F150L|SPSB3_uc002cmv.2_Missense_Mutation_p.F22L|SPSB3_uc010uvm.1_3'UTR	NM_080861	NP_543137	Q6PJ21	SPSB3_HUMAN	splA/ryanodine receptor domain and SOCS box	150	B30.2/SPRY.				intracellular signal transduction						0						TGATCTCCCAGAAGTGCTGGC	0.637													10	36	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3830746	3830746	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3830746G>A	uc002cvv.2	-	8	2014	c.1810C>T	c.(1810-1812)CTA>TTA	p.L604L	CREBBP_uc002cvw.2_Silent_p.L566L	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	604	KIX.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TTATGCACTAGATGGCTCCGC	0.483			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				3	67	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3832751	3832751	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3832751G>A	uc002cvv.2	-	6	1711	c.1507C>T	c.(1507-1509)CAG>TAG	p.Q503*	CREBBP_uc002cvw.2_Nonsense_Mutation_p.Q465*	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	503					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CCAGGAACCTGAGGCTGCAGC	0.557			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				32	68	---	---	---	---	PASS
CORO7	79585	broad.mit.edu	37	16	4414874	4414874	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4414874G>C	uc002cwh.3	-	12	1066	c.946C>G	c.(946-948)CCC>GCC	p.P316A	CORO7_uc002cwe.2_RNA|CORO7_uc002cwf.2_Missense_Mutation_p.P316A|CORO7_uc002cwg.3_Missense_Mutation_p.P96A|CORO7_uc010uxh.1_Missense_Mutation_p.P298A|CORO7_uc010uxi.1_Missense_Mutation_p.P231A|CORO7_uc002cwi.1_Missense_Mutation_p.P96A|CORO7_uc010uxj.1_RNA|CORO7_uc010btp.1_Missense_Mutation_p.P96A	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7	316						cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						GCCTGCCGGGGCACAAGGGCA	0.657													5	11	---	---	---	---	PASS
TMEM186	25880	broad.mit.edu	37	16	8889886	8889886	+	Missense_Mutation	SNP	C	A	A	rs145887653	byFrequency	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8889886C>A	uc002cze.2	-	2	599	c.565G>T	c.(565-567)GTC>TTC	p.V189F	PMM2_uc002czf.3_5'Flank|PMM2_uc010uyf.1_5'Flank|PMM2_uc010uyg.1_5'Flank|PMM2_uc010uyh.1_5'Flank|PMM2_uc010buj.2_5'Flank|PMM2_uc010uyi.1_5'Flank|PMM2_uc010uye.1_5'Flank	NM_015421	NP_056236	Q96B77	TM186_HUMAN	transmembrane protein 186	189						integral to membrane|mitochondrion				ovary(1)	1						CGCAGGGTGACGTAGAAGGTC	0.547													70	140	---	---	---	---	PASS
USP7	7874	broad.mit.edu	37	16	8996252	8996252	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8996252C>T	uc002czl.2	-	17	2126	c.1927G>A	c.(1927-1929)GAC>AAC	p.D643N	USP7_uc010uyk.1_Missense_Mutation_p.D544N|USP7_uc002czj.2_RNA|USP7_uc010uyj.1_Missense_Mutation_p.D544N|USP7_uc002czk.2_Missense_Mutation_p.D627N|USP7_uc010uyl.1_RNA	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7	643	Interaction with ICP0/VMW110.				interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						TTATTGCCGTCGGCTTCATTA	0.413													6	67	---	---	---	---	PASS
PALB2	79728	broad.mit.edu	37	16	23641137	23641137	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23641137C>T	uc002dlx.1	-	5	2538	c.2338G>A	c.(2338-2340)GGC>AGC	p.G780S		NM_024675	NP_078951	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	780					double-strand break repair via homologous recombination	nucleoplasm	DNA binding|protein binding			lung(3)|breast(3)|ovary(2)|skin(1)|kidney(1)|pancreas(1)	11				GBM - Glioblastoma multiforme(48;0.0167)		GCTGGGCTGCCTGAACTGTCG	0.512			F|N|Mis			Wilms tumor|medulloblastoma|AML ,breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia_type_N|Fanconi_Anemia|PALB2-associated_Familial_Breast_and_Pancreatic_Cancer|Pancreatic_Cancer_Familial_Clustering_of				26	59	---	---	---	---	PASS
KIF22	3835	broad.mit.edu	37	16	29810585	29810585	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29810585G>C	uc002dts.3	+	6	784	c.760G>C	c.(760-762)GTG>CTG	p.V254L	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|KIF22_uc010vdv.1_Missense_Mutation_p.V186L|KIF22_uc010vdw.1_Missense_Mutation_p.V186L|KIF22_uc010bzf.2_Missense_Mutation_p.V186L	NM_007317	NP_015556	Q14807	KIF22_HUMAN	kinesin family member 22	254	Kinesin-motor.				blood coagulation|DNA repair|microtubule-based movement|mitosis	cytosol|kinetochore|microtubule|nucleus	ATP binding|DNA binding|microtubule motor activity|protein binding				0						TTACCCCCAGGTGGACCAGCG	0.602													11	28	---	---	---	---	PASS
FAM57B	83723	broad.mit.edu	37	16	30038040	30038040	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30038040C>A	uc002dvt.2	-	3	672	c.334G>T	c.(334-336)GCC>TCC	p.A112S	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|FAM57B_uc002dvu.2_Missense_Mutation_p.A62S	NM_031478	NP_113666	Q71RH2	FA57B_HUMAN	hypothetical protein LOC83723	112	TLC.					endoplasmic reticulum|integral to membrane					0						GGGGCTCTGGCCGCTCCGTCG	0.612													14	25	---	---	---	---	PASS
ZNF764	92595	broad.mit.edu	37	16	30569173	30569173	+	Intron	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30569173G>A	uc002dyq.2	-						ZNF764_uc002dyr.1_Intron	NM_033410	NP_219363	Q96H86	ZN764_HUMAN	zinc finger protein 764						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GATTCCTAGGGAAGAAGAACG	0.687													10	15	---	---	---	---	PASS
ZNF646	9726	broad.mit.edu	37	16	31088519	31088519	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31088519C>T	uc002eap.2	+	2	1163	c.874C>T	c.(874-876)CGG>TGG	p.R292W		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	292					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						TGCCCAGTATCGGCCTTACCA	0.607													4	67	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49670780	49670780	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49670780C>A	uc002efs.2	-	5	2581	c.2283G>T	c.(2281-2283)AAG>AAT	p.K761N	ZNF423_uc010vgn.1_Missense_Mutation_p.K644N	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	761	C2H2-type 18.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				GGTCAGCCTCCTTGCGGAAGT	0.597													41	41	---	---	---	---	PASS
HEATR3	55027	broad.mit.edu	37	16	50112783	50112783	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50112783G>C	uc002efw.2	+	7	1057	c.895G>C	c.(895-897)GAA>CAA	p.E299Q	HEATR3_uc002efx.2_Missense_Mutation_p.E213Q	NM_182922	NP_891552	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	299							binding			ovary(1)|skin(1)	2						GAAAGAGGCTGAAACGCAAAG	0.368													20	72	---	---	---	---	PASS
TOX3	27324	broad.mit.edu	37	16	52473751	52473751	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52473751G>C	uc002egw.2	-	7	1288	c.1117C>G	c.(1117-1119)CAG>GAG	p.Q373E	TOX3_uc010vgt.1_Missense_Mutation_p.Q368E|TOX3_uc010vgu.1_Missense_Mutation_p.Q373E	NM_001080430	NP_001073899	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	373					apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity				0						TGGAGAGTCTGAGGTGATGCT	0.512													101	204	---	---	---	---	PASS
CBFB	865	broad.mit.edu	37	16	67116119	67116119	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67116119G>T	uc002era.2	+	5	664	c.403G>T	c.(403-405)GAG>TAG	p.E135*	CBFB_uc002erb.2_Nonsense_Mutation_p.E135*|CBFB_uc010vja.1_Intron	NM_001755	NP_001746	Q13951	PEBB_HUMAN	core-binding factor, beta subunit isoform 2	135					transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			breast(2)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)		CTGACAGCAGGAGGATGCATT	0.348			T	MYH11	AML								15	31	---	---	---	---	PASS
CBFB	865	broad.mit.edu	37	16	67116183	67116183	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67116183G>C	uc002era.2	+	5	728	c.467G>C	c.(466-468)AGA>ACA	p.R156T	CBFB_uc002erb.2_Missense_Mutation_p.R156T|CBFB_uc010vja.1_Intron	NM_001755	NP_001746	Q13951	PEBB_HUMAN	core-binding factor, beta subunit isoform 2	156					transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			breast(2)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)		TTTGAAGATAGAGACAGGTCT	0.458			T	MYH11	AML								23	73	---	---	---	---	PASS
VAC14	55697	broad.mit.edu	37	16	70820221	70820221	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70820221T>A	uc002ezm.2	-	2	410	c.152A>T	c.(151-153)CAT>CTT	p.H51L	VAC14_uc010cfw.2_Intron|VAC14_uc002ezn.2_5'UTR	NM_018052	NP_060522	Q08AM6	VAC14_HUMAN	Vac14 homolog	51					interspecies interaction between organisms	endoplasmic reticulum|endosome membrane|microsome	protein binding|receptor activity			pancreas(1)|skin(1)	2		Ovarian(137;0.0699)				CTGGATCACATGCTTGATTTG	0.632													39	81	---	---	---	---	PASS
C16orf46	123775	broad.mit.edu	37	16	81094912	81094912	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81094912C>A	uc002fgc.3	-	4	1301	c.1042G>T	c.(1042-1044)GTG>TTG	p.V348L	C16orf46_uc010chf.2_Missense_Mutation_p.V348L|C16orf46_uc010vno.1_Missense_Mutation_p.V75L	NM_152337	NP_689550	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46 isoform 2	348											0						CGGGTGATCACAGGAGATCTT	0.522													80	140	---	---	---	---	PASS
PKD1L2	114780	broad.mit.edu	37	16	81204638	81204638	+	Silent	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81204638G>C	uc002fgh.1	-	17	2820	c.2820C>G	c.(2818-2820)ACC>ACG	p.T940T	PKD1L2_uc002fgg.1_RNA|PKD1L2_uc002fgi.2_Silent_p.T255T|PKD1L2_uc002fgj.2_Silent_p.T940T	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	940	REJ.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CCTCCAAGCCGGTGGTGACTG	0.592													28	28	---	---	---	---	PASS
SLC38A8	146167	broad.mit.edu	37	16	84063148	84063148	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84063148G>C	uc002fhg.1	-	5	641	c.641C>G	c.(640-642)TCC>TGC	p.S214C		NM_001080442	NP_001073911	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	214					amino acid transport|sodium ion transport	integral to membrane					0						AGAGGTCCAGGAGGCAGGGCT	0.502													11	54	---	---	---	---	PASS
ABR	29	broad.mit.edu	37	17	1028614	1028614	+	Silent	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1028614G>T	uc002fsd.2	-	2	260	c.150C>A	c.(148-150)ATC>ATA	p.I50I	ABR_uc002fse.2_Silent_p.I4I|ABR_uc010cjq.1_Silent_p.I62I	NM_021962	NP_068781	Q12979	ABR_HUMAN	active breakpoint cluster region-related	50					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		GCGACTCATCGATGTACGGCA	0.667													3	114	---	---	---	---	PASS
USP6	9098	broad.mit.edu	37	17	5073990	5073990	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5073990G>A	uc002gau.1	+	36	5964	c.3734G>A	c.(3733-3735)CGA>CAA	p.R1245Q	USP6_uc002gav.1_Missense_Mutation_p.R1245Q|USP6_uc010ckz.1_Missense_Mutation_p.R928Q	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	1245					protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						GCCTTGAGCCGAGGGCATATG	0.537			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								22	27	---	---	---	---	PASS
NLGN2	57555	broad.mit.edu	37	17	7319158	7319158	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7319158A>G	uc002ggt.1	+	6	1439	c.1366A>G	c.(1366-1368)ACT>GCT	p.T456A		NM_020795	NP_065846	Q8NFZ4	NLGN2_HUMAN	neuroligin 2 precursor	456	Extracellular (Potential).				cell-cell junction maintenance|neuron cell-cell adhesion|positive regulation of synaptogenesis|regulation of inhibitory postsynaptic membrane potential|synapse assembly	cell surface|integral to plasma membrane|postsynaptic membrane	neurexin binding|receptor activity			central_nervous_system(1)	1		Prostate(122;0.157)				GGCGCTCTTTACTGACCACCA	0.577													58	12	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577141	7577141	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577141C>A	uc002gim.2	-	8	991	c.797G>T	c.(796-798)GGA>GTA	p.G266V	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.G266V|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G134V|TP53_uc010cng.1_Missense_Mutation_p.G134V|TP53_uc002gii.1_Missense_Mutation_p.G134V|TP53_uc010cnh.1_Missense_Mutation_p.G266V|TP53_uc010cni.1_Missense_Mutation_p.G266V|TP53_uc002gij.2_Missense_Mutation_p.G266V	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	266	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> A (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.G266E(45)|p.G266R(42)|p.G266V(32)|p.G266*(12)|p.0?(7)|p.G266fs*79(5)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G266A(2)|p.G266G(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.G266T(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.G266fs*9(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCTGTTCCGTCCCAGTAGATT	0.517		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			18	7	---	---	---	---	PASS
WRAP53	55135	broad.mit.edu	37	17	7592030	7592030	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7592030C>G	uc010vuh.1	+	2	219	c.64C>G	c.(64-66)CCA>GCA	p.P22A	WRAP53_uc010vui.1_Missense_Mutation_p.P22A|WRAP53_uc002gip.2_Missense_Mutation_p.P22A|WRAP53_uc002gir.2_Missense_Mutation_p.P22A|WRAP53_uc002giq.2_RNA|WRAP53_uc010cnl.2_Missense_Mutation_p.P22A|TP53_uc010cnh.1_5'Flank|TP53_uc010cni.1_5'Flank|TP53_uc002gim.2_5'Flank|TP53_uc002gij.2_5'Flank|TP53_uc002gin.2_5'Flank|TP53_uc002gio.2_5'Flank|TP53_uc010vug.1_5'Flank|TP53_uc010cnk.1_5'Flank	NM_001143990	NP_001137462	Q9BUR4	WAP53_HUMAN	WD repeat domain 79 isoform 2	22	Pro-rich.				positive regulation of telomerase activity|telomere formation via telomerase	Cajal body|cytoplasm|telomerase holoenzyme complex	protein binding|RNA binding				0						GGACCCAGCTCCAGCCCATCC	0.587													4	76	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10432298	10432298	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10432298C>A	uc010coi.2	-	27	3581	c.3453G>T	c.(3451-3453)GAG>GAT	p.E1151D	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.E1151D|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1151	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TCTCGCTGATCTCCTCCAGCT	0.622													96	18	---	---	---	---	PASS
C17orf48	56985	broad.mit.edu	37	17	10608831	10608831	+	Silent	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10608831G>C	uc002gmt.2	+	2	663	c.588G>C	c.(586-588)CTG>CTC	p.L196L	C17orf48_uc002gmu.2_RNA|C17orf48_uc002gmv.2_RNA|C17orf48_uc010vvg.1_Silent_p.L196L	NM_020233	NP_064618	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol pyrophosphatase	196							ADP-ribose diphosphatase activity|CDP-glycerol diphosphatase activity|metal ion binding				0						ATACGGAACTGAATAGTCCTC	0.383													5	121	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11550450	11550450	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11550450C>G	uc002gne.2	+	12	2100	c.2032C>G	c.(2032-2034)CTT>GTT	p.L678V		NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	678	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ACAGTACAATCTTTCCCAACC	0.483													10	167	---	---	---	---	PASS
ULK2	9706	broad.mit.edu	37	17	19770651	19770651	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19770651C>A	uc002gwm.3	-	1	589	c.80G>T	c.(79-81)CGG>CTG	p.R27L	ULK2_uc002gwn.2_Missense_Mutation_p.R27L	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2	27	Protein kinase.				signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					CTGGCGGTGCCGCCCCCGGAA	0.577													10	2	---	---	---	---	PASS
SDF2	6388	broad.mit.edu	37	17	26976155	26976155	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26976155C>A	uc002hbw.2	-	3	527	c.488G>T	c.(487-489)GGA>GTA	p.G163V	SDF2_uc002hbx.2_RNA	NM_006923	NP_008854	Q99470	SDF2_HUMAN	stromal cell-derived factor 2 precursor	163	MIR 3.				protein glycosylation	extracellular space|membrane	dolichyl-phosphate-mannose-protein mannosyltransferase activity				0	Lung NSC(42;0.00431)					ATATTGTTCTCCTGTGACAGA	0.512													14	116	---	---	---	---	PASS
RAB34	83871	broad.mit.edu	37	17	27042815	27042815	+	Intron	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27042815C>T	uc002hce.2	-						RAB34_uc002hcg.2_Intron|RAB34_uc002hcf.2_Intron|RAB34_uc010was.1_Intron|RAB34_uc010wat.1_Intron|RAB34_uc002hch.2_Intron|RAB34_uc010wau.1_Intron|RAB34_uc010wav.1_Intron	NM_031934	NP_114140	Q9BZG1	RAB34_HUMAN	Ras-related protein RAB34 isoform 1						protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding				0	Lung NSC(42;0.00431)					TGGAAGCACTCACAGCTGCAA	0.512													8	164	---	---	---	---	PASS
RAB34	83871	broad.mit.edu	37	17	27042849	27042849	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27042849C>G	uc002hce.2	-	4	907	c.283G>C	c.(283-285)GAG>CAG	p.E95Q	RAB34_uc002hcg.2_Missense_Mutation_p.E95Q|RAB34_uc002hcf.2_Missense_Mutation_p.E96Q|RAB34_uc010was.1_Missense_Mutation_p.E152Q|RAB34_uc010wat.1_Missense_Mutation_p.E152Q|RAB34_uc002hch.2_Missense_Mutation_p.E95Q|RAB34_uc010wau.1_Missense_Mutation_p.E73Q|RAB34_uc010wav.1_Missense_Mutation_p.E153Q	NM_031934	NP_114140	Q9BZG1	RAB34_HUMAN	Ras-related protein RAB34 isoform 1	95					protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding				0	Lung NSC(42;0.00431)					CCCAGCACCTCAAATCGTTCC	0.517													7	171	---	---	---	---	PASS
RPL23A	6147	broad.mit.edu	37	17	27047813	27047813	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27047813G>A	uc002hci.2	+	2	138	c.114G>A	c.(112-114)AAG>AAA	p.K38K	RAB34_uc002hce.2_5'Flank|RAB34_uc002hcg.2_5'Flank|RAB34_uc002hcf.2_5'Flank|RAB34_uc010was.1_5'Flank|RAB34_uc010wat.1_5'Flank|RAB34_uc002hch.2_5'Flank|RAB34_uc010wau.1_5'Flank|RAB34_uc010wav.1_5'Flank|RPL23A_uc002hck.1_RNA|SNORD4A_uc002hcl.2_5'Flank|SNORD42A_uc002hcm.1_5'Flank|SNORD4B_uc002hcn.1_5'Flank	NM_000984	NP_000975	P62750	RL23A_HUMAN	ribosomal protein L23a	38					cell proliferation|endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleus	nucleotide binding|protein binding|rRNA binding|structural constituent of ribosome			ovary(1)	1	Lung NSC(42;0.00431)					ACAAAAAGAAGAAGATCCGCA	0.552											OREG0024282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	58	---	---	---	---	PASS
EFCAB5	374786	broad.mit.edu	37	17	28296329	28296329	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28296329G>A	uc002het.2	+	4	903	c.711G>A	c.(709-711)TTG>TTA	p.L237L	EFCAB5_uc010wbi.1_Intron|EFCAB5_uc010wbj.1_Silent_p.L181L|EFCAB5_uc010wbk.1_Intron|EFCAB5_uc010csd.2_RNA|EFCAB5_uc010cse.2_Silent_p.L116L|EFCAB5_uc010csf.2_Silent_p.L116L	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5 isoform a	237							calcium ion binding			ovary(1)|skin(1)	2						ACCAGAGGTTGATGAAAGAAG	0.363													9	23	---	---	---	---	PASS
ERBB2	2064	broad.mit.edu	37	17	37883158	37883158	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37883158G>C	uc002hso.2	+	25	3299	c.3061G>C	c.(3061-3063)GAG>CAG	p.E1021Q	ERBB2_uc002hsm.2_Missense_Mutation_p.E991Q|ERBB2_uc010cwa.2_Missense_Mutation_p.E1006Q|ERBB2_uc002hsp.2_Missense_Mutation_p.E824Q|ERBB2_uc010cwb.2_Missense_Mutation_p.E1021Q|ERBB2_uc010wek.1_Missense_Mutation_p.E745Q	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	1021	Cytoplasmic (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	GGTGGATGCTGAGGAGTATCT	0.627		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			52	148	---	---	---	---	PASS
PSMD3	5709	broad.mit.edu	37	17	38142963	38142963	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38142963G>C	uc002htn.1	+	3	711	c.547G>C	c.(547-549)GAG>CAG	p.E183Q	PSMD3_uc010wen.1_RNA|PSMD3_uc010weo.1_Missense_Mutation_p.E84Q	NM_002809	NP_002800	O43242	PSMD3_HUMAN	proteasome 26S non-ATPase subunit 3	183					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	enzyme regulator activity|protein binding			ovary(1)|pancreas(1)	2	Colorectal(19;0.000442)					GCGCTACAAAGAGGTATCCAG	0.522													124	26	---	---	---	---	PASS
WIPF2	147179	broad.mit.edu	37	17	38421251	38421251	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38421251G>C	uc002hug.1	+	5	1063	c.823G>C	c.(823-825)GAG>CAG	p.E275Q	WIPF2_uc002huh.1_Missense_Mutation_p.E125Q|WIPF2_uc010cww.1_Missense_Mutation_p.E125Q|WIPF2_uc002hui.1_Missense_Mutation_p.E275Q|WIPF2_uc010cwx.1_Intron|WIPF2_uc010cwy.1_Missense_Mutation_p.E275Q	NM_133264	NP_573571	Q8TF74	WIPF2_HUMAN	WIRE protein	275						cytoplasm|cytoskeleton	actin binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						GTCAGCCCCTGAGCTGCCACA	0.607										HNSCC(43;0.11)			11	117	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41243518	41243518	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41243518C>T	uc002icq.2	-	10	4262	c.4030G>A	c.(4030-4032)GAT>AAT	p.D1344N	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.D1273N|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.D1297N|BRCA1_uc002ict.2_Missense_Mutation_p.D1344N|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.D1344N|BRCA1_uc002ide.1_Missense_Mutation_p.D1175N|BRCA1_uc010cyy.1_Missense_Mutation_p.D1344N|BRCA1_uc010whs.1_Missense_Mutation_p.D1344N|BRCA1_uc010cyz.2_Missense_Mutation_p.D1297N|BRCA1_uc010cza.2_Missense_Mutation_p.D1318N|BRCA1_uc010wht.1_Missense_Mutation_p.D1048N	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	1344					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CTTTCTTCATCATCTGAAACC	0.428			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			6	173	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41244205	41244205	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41244205C>G	uc002icq.2	-	10	3575	c.3343G>C	c.(3343-3345)GAA>CAA	p.E1115Q	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.E1044Q|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.E1068Q|BRCA1_uc002ict.2_Missense_Mutation_p.E1115Q|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.E1115Q|BRCA1_uc002ide.1_Missense_Mutation_p.E946Q|BRCA1_uc010cyy.1_Missense_Mutation_p.E1115Q|BRCA1_uc010whs.1_Missense_Mutation_p.E1115Q|BRCA1_uc010cyz.2_Missense_Mutation_p.E1068Q|BRCA1_uc010cza.2_Missense_Mutation_p.E1089Q|BRCA1_uc010wht.1_Missense_Mutation_p.E819Q	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	1115					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TGAACTACTTCTTCATATTCT	0.363			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			9	177	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41244844	41244844	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41244844C>G	uc002icq.2	-	10	2936	c.2704G>C	c.(2704-2706)GAA>CAA	p.E902Q	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.E831Q|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.E855Q|BRCA1_uc002ict.2_Missense_Mutation_p.E902Q|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.E902Q|BRCA1_uc002ide.1_Missense_Mutation_p.E733Q|BRCA1_uc010cyy.1_Missense_Mutation_p.E902Q|BRCA1_uc010whs.1_Missense_Mutation_p.E902Q|BRCA1_uc010cyz.2_Missense_Mutation_p.E855Q|BRCA1_uc010cza.2_Missense_Mutation_p.E876Q|BRCA1_uc010wht.1_Missense_Mutation_p.E606Q	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	902					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TGTTCACATTCAAAAGTGACT	0.398			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			6	150	---	---	---	---	PASS
GJC1	10052	broad.mit.edu	37	17	42882559	42882559	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42882559G>C	uc002ihj.2	-	2	1138	c.627C>G	c.(625-627)TGC>TGG	p.C209W	GJC1_uc002ihk.2_Missense_Mutation_p.C209W|GJC1_uc002ihl.2_Missense_Mutation_p.C209W|GJC1_uc010czx.2_Missense_Mutation_p.C209W|GJC1_uc010czy.1_Missense_Mutation_p.C70W	NM_005497	NP_005488	P36383	CXG1_HUMAN	connexin 45	209	Extracellular (Potential).				cellular membrane organization|gap junction assembly|muscle contraction|synaptic transmission|transport	connexon complex|integral to membrane					0		Prostate(33;0.0959)				GAAGTCTGCTGCACACATAAA	0.453													153	31	---	---	---	---	PASS
GJC1	10052	broad.mit.edu	37	17	42882560	42882560	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42882560C>T	uc002ihj.2	-	2	1137	c.626G>A	c.(625-627)TGC>TAC	p.C209Y	GJC1_uc002ihk.2_Missense_Mutation_p.C209Y|GJC1_uc002ihl.2_Missense_Mutation_p.C209Y|GJC1_uc010czx.2_Missense_Mutation_p.C209Y|GJC1_uc010czy.1_Missense_Mutation_p.C70Y	NM_005497	NP_005488	P36383	CXG1_HUMAN	connexin 45	209	Extracellular (Potential).				cellular membrane organization|gap junction assembly|muscle contraction|synaptic transmission|transport	connexon complex|integral to membrane					0		Prostate(33;0.0959)				AAGTCTGCTGCACACATAAAA	0.448													155	31	---	---	---	---	PASS
PLEKHM1	9842	broad.mit.edu	37	17	43517518	43517518	+	Intron	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43517518G>C	uc002ija.2	-						PLEKHM1_uc010wjm.1_Intron|PLEKHM1_uc002ijb.2_Intron|PLEKHM1_uc010wjn.1_Intron	NM_014798	NP_055613	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M						intracellular signal transduction	cytoplasm	metal ion binding				0	Renal(3;0.0405)					GGGGAAGCATGACACTCTTAC	0.478													15	37	---	---	---	---	PASS
ST6GALNAC1	55808	broad.mit.edu	37	17	74623625	74623625	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74623625A>G	uc002jsh.2	-	3	1046	c.872T>C	c.(871-873)CTG>CCG	p.L291P	ST6GALNAC1_uc002jsi.2_Missense_Mutation_p.L159P|ST6GALNAC1_uc002jsj.2_RNA	NM_018414	NP_060884	Q9NSC7	SIA7A_HUMAN	sialyltransferase 7A	291	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity				0						CTGGAGCCACAGCGACTTGGA	0.557													75	13	---	---	---	---	PASS
SEPT9	10801	broad.mit.edu	37	17	75471954	75471954	+	Intron	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75471954C>G	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron|SEPT9_uc002jtv.2_Intron|SEPT9_uc002jtw.2_Intron|SEPT9_uc002jtx.1_Intron|SEPT9_uc010wtl.1_Intron|SEPT9_uc002jty.3_Intron|SEPT9_uc010wtm.1_Intron|SEPT9_uc010wtn.1_Intron|SEPT9_uc010dhd.2_Missense_Mutation_p.F118L	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)			ACCTTGCATTCTGCTTGGCCA	0.617													26	71	---	---	---	---	PASS
NPTX1	4884	broad.mit.edu	37	17	78449473	78449473	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78449473C>G	uc002jyp.1	-	2	648	c.490G>C	c.(490-492)GAT>CAT	p.D164H		NM_002522	NP_002513	Q15818	NPTX1_HUMAN	neuronal pentraxin I precursor	164					central nervous system development|synaptic transmission|transport	transport vesicle	metal ion binding				0	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			TGCAGCAGATCCTTGAGGCTG	0.652													4	35	---	---	---	---	PASS
C17orf90	339229	broad.mit.edu	37	17	79632239	79632239	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79632239C>T	uc002kba.2	-	2	447	c.436G>A	c.(436-438)GGA>AGA	p.G146R	C17orf90_uc002kbb.2_3'UTR|CCDC137_uc002kbc.3_5'Flank|CCDC137_uc002kbd.2_5'Flank	NM_001039842	NP_001034931	Q5BKU9	CQ090_HUMAN	hypothetical protein LOC339229	146											0	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GCTCAGCCTCCGCACCTGGTG	0.662													42	3	---	---	---	---	PASS
NAPG	8774	broad.mit.edu	37	18	10532793	10532793	+	Splice_Site	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10532793G>A	uc002kon.2	+	3	436	c.209_splice	c.e3+1	p.A70_splice	NAPG_uc010wzr.1_Splice_Site|NAPG_uc002koo.2_Intron	NM_003826	NP_003817	Q99747	SNAG_HUMAN	N-ethylmaleimide-sensitive factor attachment						cellular membrane fusion|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein complex assembly|protein stabilization	membrane|membrane fraction|mitochondrion	protein binding				0						ATAATAGGGCGTATCTTTTTC	0.328													9	11	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21330896	21330896	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21330896G>C	uc002kuq.2	+	5	785	c.699G>C	c.(697-699)TTG>TTC	p.L233F	LAMA3_uc010dlv.1_Missense_Mutation_p.L233F|LAMA3_uc002kur.2_Missense_Mutation_p.L233F	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	233	Laminin N-terminal.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGGTGTCCTTGATAAACGGTC	0.398													5	202	---	---	---	---	PASS
DSC1	1823	broad.mit.edu	37	18	28725645	28725645	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28725645G>A	uc002kwn.2	-	7	1130	c.868C>T	c.(868-870)CAT>TAT	p.H290Y	DSC1_uc002kwm.2_Missense_Mutation_p.H290Y	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein	290	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			TGCTTTGGATGATCTGGGATT	0.408													5	269	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28992992	28992992	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28992992G>T	uc002kwq.2	+	16	2692	c.2557G>T	c.(2557-2559)GAA>TAA	p.E853*	DSG4_uc002kwr.2_Nonsense_Mutation_p.E872*	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	853	Cytoplasmic (Potential).				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CACAGAAATTGAACCATTTCC	0.403													166	116	---	---	---	---	PASS
DSG3	1830	broad.mit.edu	37	18	29049058	29049058	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29049058C>G	uc002kws.2	+	12	1752	c.1643C>G	c.(1642-1644)TCG>TGG	p.S548W		NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	548	Extracellular (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			ACAGCTACCTCGGCCCTCCTC	0.373													4	307	---	---	---	---	PASS
SYT4	6860	broad.mit.edu	37	18	40857251	40857251	+	5'UTR	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40857251T>A	uc002law.2	-	1					SYT4_uc010dng.2_Intron|SYT4_uc010xcm.1_5'UTR|SYT4_uc010dnh.2_Intron	NM_020783	NP_065834	Q9H2B2	SYT4_HUMAN	synaptotagmin IV							cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			skin(5)	5						AGCCATTTTTTACTGCGTGTT	0.507													62	42	---	---	---	---	PASS
PSTPIP2	9050	broad.mit.edu	37	18	43571956	43571956	+	Intron	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43571956G>A	uc002lbp.3	-						PSTPIP2_uc002lbq.3_Intron	NM_024430	NP_077748	Q9H939	PPIP2_HUMAN	proline-serine-threonine phosphatase interacting							membrane				ovary(1)	1						GGTGCTAGGAGAGTCACCAAG	0.458													20	73	---	---	---	---	PASS
MYO5B	4645	broad.mit.edu	37	18	47581668	47581668	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47581668C>A	uc002leb.2	-	2	396	c.108G>T	c.(106-108)AAG>AAT	p.K36N	MYO5B_uc002lec.1_Missense_Mutation_p.K35N	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB	36	Myosin head-like.				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		GCTGTAGGCTCTTGTCTCCTT	0.557													74	50	---	---	---	---	PASS
FECH	2235	broad.mit.edu	37	18	55221509	55221509	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55221509G>C	uc002lgq.3	-	9	1177	c.1060C>G	c.(1060-1062)CAA>GAA	p.Q354E	FECH_uc002lgp.3_Missense_Mutation_p.Q360E|FECH_uc002lgr.3_Missense_Mutation_p.Q212E	NM_000140	NP_000131	P22830	HEMH_HUMAN	ferrochelatase isoform b precursor	354					generation of precursor metabolites and energy|heme biosynthetic process|protoporphyrinogen IX metabolic process|response to light stimulus	mitochondrial inner membrane|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferrochelatase activity|ferrous iron binding|protein binding	p.L354L(1)		central_nervous_system(1)	1		Colorectal(73;0.227)				GCTAAAACTTGAGAGTACTCG	0.413													15	615	---	---	---	---	PASS
CBLN2	147381	broad.mit.edu	37	18	70205928	70205928	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70205928C>G	uc002lku.2	-	3	672	c.437G>C	c.(436-438)AGC>ACC	p.S146T	CBLN2_uc002lkv.2_Missense_Mutation_p.S146T	NM_182511	NP_872317	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	146	C1q.					integral to membrane					0		Esophageal squamous(42;0.131)				CACGTGGAAGCTGAAGCTATA	0.398													145	149	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74622035	74622035	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74622035G>T	uc002lmi.2	+	15	2755	c.2557G>T	c.(2557-2559)GCT>TCT	p.A853S	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	853					cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		TGGGTTTGTGGCTCCACAGGA	0.517													115	125	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76753675	76753675	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76753675G>A	uc002lmt.2	+	2	1684	c.1684G>A	c.(1684-1686)GAG>AAG	p.E562K	SALL3_uc010dra.2_Missense_Mutation_p.E169K	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	562					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGCCTCCAGCGAGTGCGCCTC	0.741													3	10	---	---	---	---	PASS
PARD6G	84552	broad.mit.edu	37	18	77960632	77960632	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77960632T>C	uc002lny.2	-	2	422	c.256A>G	c.(256-258)AGT>GGT	p.S86G	PARD6G_uc010xfp.1_Missense_Mutation_p.S86G	NM_032510	NP_115899	Q9BYG4	PAR6G_HUMAN	PAR-6 gamma protein	86	OPR.				cell cycle|cell division|tight junction assembly	cytosol|tight junction	protein binding				0		all_cancers(4;5.63e-22)|all_epithelial(4;5.86e-15)|all_lung(4;1.32e-05)|Ovarian(4;1.33e-05)|Lung NSC(4;2.77e-05)|Esophageal squamous(42;0.0157)|all_hematologic(56;0.13)|Melanoma(33;0.144)		Epithelial(2;1.48e-13)|all cancers(1;5.77e-13)|OV - Ovarian serous cystadenocarcinoma(15;2.74e-10)|BRCA - Breast invasive adenocarcinoma(31;0.00166)|STAD - Stomach adenocarcinoma(84;0.18)|Lung(128;0.23)		GGATTTGCACTAGAAACCGCC	0.463													72	112	---	---	---	---	PASS
MKNK2	2872	broad.mit.edu	37	19	2041127	2041127	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2041127G>C	uc002lus.2	-	12	1267	c.1022C>G	c.(1021-1023)GCC>GGC	p.A341G	MKNK2_uc002luq.1_Missense_Mutation_p.A85G|MKNK2_uc010xgu.1_Missense_Mutation_p.A180G|MKNK2_uc010xgv.1_Missense_Mutation_p.A210G|MKNK2_uc002lur.2_Missense_Mutation_p.A341G|MKNK2_uc002lut.1_Missense_Mutation_p.A85G	NM_199054	NP_951009	Q9HBH9	MKNK2_HUMAN	MAP kinase-interacting serine/threonine kinase 2	341	Protein kinase.				cell surface receptor linked signaling pathway|intracellular protein kinase cascade|regulation of translation		ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(1)|breast(1)	2		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGTCTTTGGCAGCGCAGGA	0.607													4	170	---	---	---	---	PASS
ZNF554	115196	broad.mit.edu	37	19	2834362	2834362	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2834362G>C	uc002lwm.2	+	5	1327	c.1129G>C	c.(1129-1131)GAG>CAG	p.E377Q	ZNF554_uc002lwl.2_Missense_Mutation_p.E326Q	NM_001102651	NP_001096121	Q86TJ5	ZN554_HUMAN	zinc finger protein 554	377					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCATACTGGAGAGAAGCCCTA	0.552													6	117	---	---	---	---	PASS
TMIGD2	126259	broad.mit.edu	37	19	4298232	4298232	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4298232C>T	uc002lzx.1	-	2	203	c.157G>A	c.(157-159)GAA>AAA	p.E53K	TMIGD2_uc010dtv.1_Missense_Mutation_p.E53K	NM_144615	NP_653216	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain	53	Extracellular (Potential).|Ig-like.					integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGAGCCGTTCCCAGGCTGTG	0.657													4	69	---	---	---	---	PASS
DPP9	91039	broad.mit.edu	37	19	4704166	4704166	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4704166C>A	uc002mba.2	-	6	835	c.577G>T	c.(577-579)GAC>TAC	p.D193Y	DPP9_uc002mbb.2_Missense_Mutation_p.D193Y|DPP9_uc002mbc.2_Missense_Mutation_p.D193Y	NM_139159	NP_631898	Q86TI2	DPP9_HUMAN	dipeptidylpeptidase 9	164					proteolysis	cytosol|membrane	aminopeptidase activity|serine-type peptidase activity			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		TTGCCGCCGTCGCGGCAGTGG	0.672													9	19	---	---	---	---	PASS
C3	718	broad.mit.edu	37	19	6696668	6696668	+	Silent	SNP	C	T	T	rs149209011	byFrequency	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6696668C>T	uc002mfm.2	-	22	2861	c.2799G>A	c.(2797-2799)CCG>CCA	p.P933P		NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	933					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		TGATTCCTTCCGGCTACGCAG	0.577													5	253	---	---	---	---	PASS
XAB2	56949	broad.mit.edu	37	19	7685290	7685290	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7685290G>A	uc002mgx.2	-	16	2163	c.2137C>T	c.(2137-2139)CGG>TGG	p.R713W		NM_020196	NP_064581	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	713	HAT 14.				transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	catalytic step 2 spliceosome|nucleoplasm	protein binding			central_nervous_system(2)|breast(1)|skin(1)	4						TTGCCATGCCGGACCTCAAAG	0.637								Direct_reversal_of_damage|NER					76	45	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9020767	9020767	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9020767G>A	uc002mkp.2	-	20	37539	c.37335C>T	c.(37333-37335)CTC>CTT	p.L12445L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12447	Extracellular (Potential).|SEA 3.				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGTCTCACCTGAGAGAGGTCA	0.547													8	102	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9020769	9020769	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9020769G>A	uc002mkp.2	-	20	37537	c.37333C>T	c.(37333-37335)CTC>TTC	p.L12445F		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12447	Extracellular (Potential).|SEA 3.				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCTCACCTGAGAGAGGTCAGT	0.537													8	104	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9066654	9066654	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9066654G>A	uc002mkp.2	-	3	20996	c.20792C>T	c.(20791-20793)TCA>TTA	p.S6931L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6933	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AACAGACATTGATGTGGAAAC	0.458													128	331	---	---	---	---	PASS
ZNF846	162993	broad.mit.edu	37	19	9868197	9868197	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9868197G>A	uc002mmb.1	-	6	2087	c.1556C>T	c.(1555-1557)TCA>TTA	p.S519L	ZNF846_uc010xky.1_Intron|ZNF846_uc010xkz.1_Intron|ZNF846_uc010dww.2_Intron|ZNF846_uc002mmc.1_Missense_Mutation_p.S390L	NM_001077624	NP_001071092	Q147U1	ZN846_HUMAN	zinc finger protein 846	519	C2H2-type 14; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AGCAAGTGCTGAAGATTGAGT	0.368													18	263	---	---	---	---	PASS
ELOF1	84337	broad.mit.edu	37	19	11664626	11664626	+	Intron	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11664626C>G	uc002mse.1	-						ELOF1_uc002msd.1_Intron	NM_032377	NP_115753	P60002	ELOF1_HUMAN	elongation factor 1 homolog (ELF1, S.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding				0						TCTGACAGATCTGGGCCACTT	0.522													18	61	---	---	---	---	PASS
ZNF823	55552	broad.mit.edu	37	19	11833621	11833621	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11833621G>A	uc002msm.2	-	4	854	c.728C>T	c.(727-729)ACG>ATG	p.T243M	ZNF823_uc010xmd.1_Missense_Mutation_p.T61M|ZNF823_uc010dyi.1_Missense_Mutation_p.T199M	NM_001080493	NP_001073962	P16415	ZN823_HUMAN	ZFP-36 for a zinc finger protein	243					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						TTTCTCTCCCGTGTGGATTCT	0.418										HNSCC(68;0.2)			11	177	---	---	---	---	PASS
ZNF441	126068	broad.mit.edu	37	19	11892259	11892259	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11892259C>T	uc010dyj.2	+	4	1814	c.1620C>T	c.(1618-1620)TTC>TTT	p.F540F	ZNF441_uc002msn.3_Silent_p.F496F	NM_152355	NP_689568	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	540	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GGAAAGGCTTCAGGTCTTCCA	0.423													59	38	---	---	---	---	PASS
ZNF564	163050	broad.mit.edu	37	19	12639413	12639413	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12639413C>G	uc002mty.2	-	2	311	c.101G>C	c.(100-102)CGG>CCG	p.R34P	ZNF709_uc002mtx.3_Intron	NM_144976	NP_659413	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	34	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AAAGGTTTCCCGCATCACATC	0.438													72	106	---	---	---	---	PASS
NOTCH3	4854	broad.mit.edu	37	19	15281270	15281270	+	Silent	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15281270G>C	uc002nan.2	-	27	5062	c.4986C>G	c.(4984-4986)GTC>GTG	p.V1662V		NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor	1662	Helical; (Potential).				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GGGCCACCATGACACCCAGGA	0.662													13	43	---	---	---	---	PASS
FAM125A	93343	broad.mit.edu	37	19	17531169	17531169	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17531169C>T	uc002ngo.1	+	2	171	c.138C>T	c.(136-138)TTC>TTT	p.F46F	FAM125A_uc002ngn.1_Silent_p.F46F|FAM125A_uc002ngp.1_5'UTR|FAM125A_uc002ngq.1_5'Flank	NM_138401	NP_612410	Q96EY5	F125A_HUMAN	family with sequence similarity 125, member A	46	MABP.				protein transport	late endosome membrane|microtubule organizing center|nucleus	SH3 domain binding				0						GCAAGAGCTTCGCGCAGAAAT	0.647													7	73	---	---	---	---	PASS
SF4	57794	broad.mit.edu	37	19	19413070	19413070	+	Intron	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19413070T>C	uc002nmh.2	-						SF4_uc002nmf.2_Intron|SF4_uc002nmg.2_Intron|SF4_uc002nmi.2_Intron|SF4_uc002nmj.2_Intron|SF4_uc010xqr.1_Intron|SF4_uc010xqs.1_Intron	NM_172231	NP_757386	Q8IWZ8	SUGP1_HUMAN	splicing factor 4						nuclear mRNA splicing, via spliceosome	nucleoplasm|spliceosomal complex	RNA binding				0						AGGGCCCCCCTTACCTGAATG	0.617													66	175	---	---	---	---	PASS
SF4	57794	broad.mit.edu	37	19	19413072	19413072	+	Splice_Site	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19413072A>T	uc002nmh.2	-	7	889	c.887_splice	c.e7+1	p.S296_splice	SF4_uc002nmf.2_Intron|SF4_uc002nmg.2_Splice_Site|SF4_uc002nmi.2_Splice_Site_p.S86_splice|SF4_uc002nmj.2_Splice_Site_p.S86_splice|SF4_uc010xqr.1_Splice_Site|SF4_uc010xqs.1_Splice_Site	NM_172231	NP_757386	Q8IWZ8	SUGP1_HUMAN	splicing factor 4						nuclear mRNA splicing, via spliceosome	nucleoplasm|spliceosomal complex	RNA binding				0						GGCCCCCCTTACCTGAATGCC	0.617													66	172	---	---	---	---	PASS
ATP13A1	57130	broad.mit.edu	37	19	19766937	19766937	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19766937C>A	uc002nnh.3	-	8	1167	c.1139G>T	c.(1138-1140)CGG>CTG	p.R380L	ATP13A1_uc002nnf.3_5'Flank|ATP13A1_uc002nng.2_Missense_Mutation_p.R262L	NM_020410	NP_065143	Q9HD20	AT131_HUMAN	ATPase type 13A1	380	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(3)|large_intestine(2)|central_nervous_system(1)	6						GACGTGCAGCCGGGAATCAGC	0.642													36	102	---	---	---	---	PASS
ZNF682	91120	broad.mit.edu	37	19	20133841	20133841	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20133841C>A	uc002noq.2	-	3	321	c.198G>T	c.(196-198)AAG>AAT	p.K66N	ZNF682_uc002noo.2_Missense_Mutation_p.K34N|ZNF682_uc002nop.2_Missense_Mutation_p.K34N|ZNF682_uc010eck.2_Intron	NM_033196	NP_149973	O95780	ZN682_HUMAN	zinc finger protein 682 isoform 1	66	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2						TCTCATGTCTCTTCACATTCC	0.443													8	213	---	---	---	---	PASS
ZNF43	7594	broad.mit.edu	37	19	21990638	21990638	+	Missense_Mutation	SNP	T	G	G	rs145094878		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21990638T>G	uc002nqj.2	-	4	2331	c.2201A>C	c.(2200-2202)TAC>TCC	p.Y734S	ZNF43_uc010ecv.2_Missense_Mutation_p.Y728S|ZNF43_uc002nql.2_Missense_Mutation_p.Y728S|ZNF43_uc002nqm.2_Missense_Mutation_p.Y728S|ZNF43_uc002nqk.2_Missense_Mutation_p.Y664S	NM_003423	NP_003414	P17038	ZNF43_HUMAN	zinc finger protein 43	734	C2H2-type 21.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		TTCACATTTGTAGGGTTGCTC	0.353													69	93	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22363501	22363501	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22363501C>T	uc002nqs.1	-	3	1336	c.1018G>A	c.(1018-1020)GAA>AAA	p.E340K		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	340	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CCGCATTCTTCACATTTGTAG	0.418													6	307	---	---	---	---	PASS
C19orf12	83636	broad.mit.edu	37	19	30199261	30199261	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30199261C>T	uc002nsk.2	-	2	491	c.60G>A	c.(58-60)AAG>AAA	p.K20K	C19orf12_uc002nsj.2_Silent_p.K31K|C19orf12_uc002nsl.2_Intron|C19orf12_uc002nsm.2_RNA	NM_031448	NP_113636	Q9NSK7	CS012_HUMAN	hypothetical protein LOC83636 isoform 2	20						integral to membrane					0	Ovarian(5;0.000567)|Breast(6;0.0203)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0435)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.183)			CCGCCTTCATCTTCCTCTCCC	0.617													12	201	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30936591	30936591	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30936591G>T	uc002nsu.1	+	2	2260	c.2122G>T	c.(2122-2124)GGG>TGG	p.G708W	ZNF536_uc010edd.1_Missense_Mutation_p.G708W	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	708					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					CTCCCAGACCGGGAGTGCCCA	0.677													18	22	---	---	---	---	PASS
ZNF181	339318	broad.mit.edu	37	19	35231986	35231986	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35231986G>C	uc002nvu.3	+	4	1163	c.700G>C	c.(700-702)GAG>CAG	p.E234Q	ZNF181_uc010xsa.1_Missense_Mutation_p.E233Q|ZNF181_uc010xsb.1_Missense_Mutation_p.E233Q|ZNF181_uc010xsc.1_Missense_Mutation_p.E169Q	NM_001029997	NP_001025168	Q2M3W8	ZN181_HUMAN	zinc finger protein 181 isoform 1	234					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTGTAATAGAGAGAAAATCTA	0.428													21	480	---	---	---	---	PASS
ZNF420	147923	broad.mit.edu	37	19	37619207	37619207	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37619207G>C	uc002ofl.2	+	5	1529	c.1314G>C	c.(1312-1314)CAG>CAC	p.Q438H		NM_144689	NP_653290	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	438	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CACGACACCAGAGGATTCATA	0.418													35	133	---	---	---	---	PASS
ZNF420	147923	broad.mit.edu	37	19	37619795	37619795	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37619795G>C	uc002ofl.2	+	5	2117	c.1902G>C	c.(1900-1902)CAG>CAC	p.Q634H		NM_144689	NP_653290	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	634	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTCGGCATCAGAGAATTCATA	0.418													33	144	---	---	---	---	PASS
SIPA1L3	23094	broad.mit.edu	37	19	38652941	38652941	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38652941G>A	uc002ohk.2	+	14	4219	c.3710G>A	c.(3709-3711)GGA>GAA	p.G1237E		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	1237					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			GCCATAGCCGGAAGCAGCGGG	0.612													10	81	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38990398	38990398	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38990398T>A	uc002oit.2	+	44	7281	c.7151T>A	c.(7150-7152)ATC>AAC	p.I2384N	RYR1_uc002oiu.2_Missense_Mutation_p.I2384N|RYR1_uc002oiv.1_5'UTR	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2384	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GAAGAGGCCATCCGCATCTCC	0.692													20	15	---	---	---	---	PASS
GRLF1	2909	broad.mit.edu	37	19	47422551	47422551	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47422551G>T	uc010ekv.2	+	1	619	c.619G>T	c.(619-621)GAG>TAG	p.E207*		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	207					axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		CGAAGGTGTTGAGCGGTACAT	0.443													73	7	---	---	---	---	PASS
GRLF1	2909	broad.mit.edu	37	19	47422564	47422564	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47422564G>C	uc010ekv.2	+	1	632	c.632G>C	c.(631-633)AGA>ACA	p.R211T		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	211					axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		CGGTACATTAGAGATGCACAT	0.448													83	6	---	---	---	---	PASS
CRX	1406	broad.mit.edu	37	19	48339523	48339523	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48339523G>A	uc002phq.3	+	3	328	c.124G>A	c.(124-126)GAG>AAG	p.E42K	CRX_uc010elm.1_RNA	NM_000554	NP_000545	O43186	CRX_HUMAN	cone-rod homeobox protein	42	Homeobox.				organ morphogenesis|response to stimulus|visual perception		leucine zipper domain binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		GCAGCGGCGGGAGCGCACCAC	0.652													22	113	---	---	---	---	PASS
CABP5	56344	broad.mit.edu	37	19	48537475	48537475	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48537475C>G	uc002phu.1	-	5	618	c.493G>C	c.(493-495)GAA>CAA	p.E165Q		NM_019855	NP_062829	Q9NP86	CABP5_HUMAN	calcium binding protein 5	165	EF-hand 4.|3 (Potential).				signal transduction	cytoplasm	calcium ion binding			skin(1)	1		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		ATGTCACCTTCAAAGTCAACT	0.597													5	78	---	---	---	---	PASS
FAM71E1	112703	broad.mit.edu	37	19	50979382	50979382	+	Intron	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50979382C>G	uc002psh.2	-						FAM71E1_uc002psg.2_Intron|FAM71E1_uc002psi.2_Intron|C19orf63_uc002psj.2_5'Flank|C19orf63_uc002psk.2_5'Flank|C19orf63_uc002psl.2_5'Flank	NM_138411	NP_612420	Q6IPT2	F71E1_HUMAN	hypothetical protein LOC112703											breast(1)	1		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.0077)|GBM - Glioblastoma multiforme(134;0.026)		GCTCCCCTCTCTCACCTGCCA	0.672													11	225	---	---	---	---	PASS
KLK3	354	broad.mit.edu	37	19	51361393	51361393	+	Silent	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51361393C>G	uc002pts.1	+	3	356	c.315C>G	c.(313-315)CTC>CTG	p.L105L	KLK3_uc010ycj.1_Silent_p.L105L|KLK3_uc002ptr.1_Intron|KLK3_uc010eof.1_Intron	NM_001030047	NP_001025218	P07288	KLK3_HUMAN	prostate specific antigen isoform 3	105	Peptidase S1.				negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		ATATGAGCCTCCTGAAGAATC	0.572													24	51	---	---	---	---	PASS
SIGLEC14	100049587	broad.mit.edu	37	19	52147258	52147258	+	Silent	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52147258C>A	uc002pxf.3	-	5	906	c.786G>T	c.(784-786)GTG>GTT	p.V262V		NM_001098612	NP_001092082	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14 precursor	262	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding			ovary(1)	1		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		CCTGGATGGGCACCGACATGC	0.607													22	40	---	---	---	---	PASS
ZNF577	84765	broad.mit.edu	37	19	52376027	52376027	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52376027C>G	uc010yde.1	-	7	1607	c.1216G>C	c.(1216-1218)GAG>CAG	p.E406Q	ZNF577_uc010ydd.1_Intron|ZNF577_uc002pxx.3_Missense_Mutation_p.E347Q|ZNF577_uc002pxv.2_Missense_Mutation_p.E399Q|ZNF577_uc002pxw.2_Missense_Mutation_p.E340Q	NM_032679	NP_116068	Q9BSK1	ZN577_HUMAN	zinc finger protein 577 isoform a	406					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		GTCTTTTGCTCTTGTATGAGT	0.443													9	350	---	---	---	---	PASS
ZNF614	80110	broad.mit.edu	37	19	52519616	52519616	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52519616C>T	uc002pyj.2	-	5	1637	c.1235G>A	c.(1234-1236)CGC>CAC	p.R412H	ZNF614_uc002pyi.3_Intron|ZNF614_uc010epj.2_Missense_Mutation_p.R115H	NM_025040	NP_079316	Q8N883	ZN614_HUMAN	zinc finger protein 614	412	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	5		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		AACGAGAGTGCGTTTGACAGT	0.423													82	549	---	---	---	---	PASS
ZNF836	162962	broad.mit.edu	37	19	52659761	52659761	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52659761C>T	uc010ydi.1	-	5	1549	c.1175G>A	c.(1174-1176)GGA>GAA	p.G392E	ZNF836_uc010ydj.1_Missense_Mutation_p.G392E	NM_001102657	NP_001096127	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	392	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAAGGACTTTCCACATATGTT	0.398													5	147	---	---	---	---	PASS
ZNF28	7576	broad.mit.edu	37	19	53303166	53303166	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53303166G>A	uc002qad.2	-	4	2052	c.1932C>T	c.(1930-1932)TTC>TTT	p.F644F	ZNF28_uc002qac.2_Silent_p.F591F|ZNF28_uc010eqe.2_Silent_p.F590F	NM_006969	NP_008900	P17035	ZNF28_HUMAN	zinc finger protein 28	644	C2H2-type 16.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		ACATCTGACTGAAGGTCTTGC	0.433													19	600	---	---	---	---	PASS
ZNF816A	125893	broad.mit.edu	37	19	53454623	53454623	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53454623C>T	uc002qal.1	-	5	706	c.405G>A	c.(403-405)TTG>TTA	p.L135L	ZNF321_uc010eqj.2_Intron|ZNF321_uc002qak.1_Intron|ZNF816A_uc002qam.1_Silent_p.L119L	NM_001031665	NP_001026835	Q0VGE8	ZN816_HUMAN	zinc finger protein 816A	135					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0313)		TACTACCAGTCAACTTTTTGA	0.413													29	682	---	---	---	---	PASS
ZNF415	55786	broad.mit.edu	37	19	53612472	53612472	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53612472C>T	uc002qax.2	-	7	1319	c.970G>A	c.(970-972)GAA>AAA	p.E324K	ZNF415_uc002qat.2_Missense_Mutation_p.E288K|ZNF415_uc002qaw.2_Missense_Mutation_p.E276K|ZNF415_uc010yds.1_Missense_Mutation_p.E276K|ZNF415_uc010ydt.1_Missense_Mutation_p.E276K|ZNF415_uc002qau.2_Missense_Mutation_p.E263K|ZNF415_uc002qav.2_Missense_Mutation_p.E288K|ZNF415_uc002qba.2_Missense_Mutation_p.E46K|ZNF415_uc002qay.2_Missense_Mutation_p.E263K|ZNF415_uc002qaz.2_Missense_Mutation_p.E324K	NR_028343		Q09FC8	ZN415_HUMAN	RecName: Full=Zinc finger protein 415;	324	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.0191)		CTGTCACATTCATTACATTTG	0.408													6	200	---	---	---	---	PASS
ZNF765	91661	broad.mit.edu	37	19	53911332	53911332	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53911332C>T	uc010ydx.1	+	6	851	c.524C>T	c.(523-525)TCA>TTA	p.S175L	ZNF765_uc002qbm.2_Missense_Mutation_p.S175L|ZNF765_uc002qbn.2_Intron	NM_001040185	NP_001035275	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	175					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)		TCCTTGGTTTCAACAGCCCAA	0.368													10	236	---	---	---	---	PASS
TMC4	147798	broad.mit.edu	37	19	54664048	54664048	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54664048G>C	uc010erf.2	-	15	2266	c.2134C>G	c.(2134-2136)CTT>GTT	p.L712V	LENG1_uc002qdm.2_5'Flank|TMC4_uc002qdn.2_Missense_Mutation_p.L426V|TMC4_uc002qdo.2_Missense_Mutation_p.L706V	NM_001145303	NP_001138775	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4 isoform 1	712	Cytoplasmic (Potential).					integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GGGGGTCAAAGAGCCGGTTTG	0.458													38	304	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55143120	55143120	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55143120G>A	uc002qgj.2	+	5	580	c.240G>A	c.(238-240)AAG>AAA	p.K80K	LILRB1_uc010erp.1_Intron|LILRB1_uc002qgl.2_Silent_p.K80K|LILRB1_uc002qgk.2_Silent_p.K80K|LILRB1_uc002qgm.2_Silent_p.K80K|LILRB1_uc010erq.2_Silent_p.K80K|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	80	Ig-like C2-type 1.|Extracellular (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		TTGTGAAGAAGGGCCAGTTCC	0.562										HNSCC(37;0.09)			143	139	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57326411	57326411	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57326411G>T	uc002qnu.2	-	7	3750	c.3399C>A	c.(3397-3399)TGC>TGA	p.C1133*	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Nonsense_Mutation_p.C1104*|PEG3_uc002qnv.2_Nonsense_Mutation_p.C1133*|PEG3_uc002qnw.2_Nonsense_Mutation_p.C1009*|PEG3_uc002qnx.2_Nonsense_Mutation_p.C1007*|PEG3_uc010etr.2_Nonsense_Mutation_p.C1133*	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	1133					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TGTCAACCAGGCACTTCCTGC	0.478													202	206	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57640100	57640100	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57640100G>C	uc002qny.2	+	4	413	c.57G>C	c.(55-57)ATG>ATC	p.M19I		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	19					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AGACTGGGATGACTAAGCTGA	0.348													64	83	---	---	---	---	PASS
ZNF547	284306	broad.mit.edu	37	19	57883207	57883207	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57883207C>G	uc002qol.2	+	3	275	c.82C>G	c.(82-84)CTC>GTC	p.L28V	ZNF547_uc010ygx.1_Missense_Mutation_p.L28V	NM_173631	NP_775902	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	28	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GTGGGGGCATCTCGATGAGGC	0.498													31	729	---	---	---	---	PASS
TMC2	117532	broad.mit.edu	37	20	2618178	2618178	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2618178C>T	uc002wgf.1	+	19	2459	c.2444C>T	c.(2443-2445)TCA>TTA	p.S815L	TMC2_uc002wgg.1_Missense_Mutation_p.S799L	NM_080751	NP_542789	Q8TDI7	TMC2_HUMAN	transmembrane cochlear-expressed protein 2	815	Cytoplasmic (Potential).					integral to membrane				ovary(3)	3						GCCAGAGATTCAGAGGACACA	0.433													9	136	---	---	---	---	PASS
SLC4A11	83959	broad.mit.edu	37	20	3211589	3211589	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3211589G>A	uc002wig.2	-	9	1254	c.1206C>T	c.(1204-1206)GAC>GAT	p.D402D	SLC4A11_uc010zqe.1_Silent_p.D429D|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Silent_p.D386D	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	402	Membrane (bicarbonate transporter).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1						CGATGGCCCCGTCTGTGTTCT	0.662													74	74	---	---	---	---	PASS
MCM8	84515	broad.mit.edu	37	20	5966673	5966673	+	Nonsense_Mutation	SNP	C	T	T	rs140773345	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5966673C>T	uc002wmi.2	+	16	2436	c.2059C>T	c.(2059-2061)CGA>TGA	p.R687*	MCM8_uc002wmj.2_Nonsense_Mutation_p.R671*|MCM8_uc002wmk.2_Nonsense_Mutation_p.R727*|MCM8_uc002wml.2_Nonsense_Mutation_p.R687*|MCM8_uc010gbp.2_Nonsense_Mutation_p.R640*|MCM8_uc002wmm.2_Nonsense_Mutation_p.R225*	NM_032485	NP_115874	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8	687					cell cycle checkpoint|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|nucleoside-triphosphatase activity			skin(1)	1						AGAAGCTGCTCGAGTTCTTCA	0.468													9	263	---	---	---	---	PASS
PLCB4	5332	broad.mit.edu	37	20	9318721	9318721	+	Intron	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9318721G>T	uc002wnf.2	+						PLCB4_uc010gbw.1_Intron|PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						AAAGGTACCTGTGATTGGTAT	0.413													59	17	---	---	---	---	PASS
PAK7	57144	broad.mit.edu	37	20	9520232	9520232	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9520232C>T	uc002wnl.2	-	11	2582	c.2037G>A	c.(2035-2037)TTG>TTA	p.L679L	PAK7_uc002wnk.2_Silent_p.L679L|PAK7_uc002wnj.2_Silent_p.L679L|PAK7_uc010gby.1_Silent_p.L592L	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	p21-activated kinase 7	679	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)			TCACCAACATCAAGTCTAGGA	0.502													71	443	---	---	---	---	PASS
PAK7	57144	broad.mit.edu	37	20	9546564	9546564	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9546564C>T	uc002wnl.2	-	6	2003	c.1458G>A	c.(1456-1458)CAG>CAA	p.Q486Q	PAK7_uc002wnk.2_Silent_p.Q486Q|PAK7_uc002wnj.2_Silent_p.Q486Q|PAK7_uc010gby.1_Silent_p.Q486Q	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	p21-activated kinase 7	486	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)			GTTCTCGTCTCTGTTGCTTCC	0.438													11	641	---	---	---	---	PASS
SPTLC3	55304	broad.mit.edu	37	20	13107262	13107262	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13107262C>T	uc002wod.1	+	9	1466	c.1177C>T	c.(1177-1179)CAC>TAC	p.H393Y		NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base	393					sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)	TTTACGGGTTCACTCGCATAG	0.438													12	707	---	---	---	---	PASS
MACROD2	140733	broad.mit.edu	37	20	16025218	16025218	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16025218G>A	uc002wou.2	+	17	1498	c.1234G>A	c.(1234-1236)GAA>AAA	p.E412K	MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Missense_Mutation_p.E177K|MACROD2_uc002wpb.2_Intron|MACROD2_uc002wpd.2_Missense_Mutation_p.E63K	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1	412											0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				GGTGACAGTTGAAATGAATAG	0.333													6	127	---	---	---	---	PASS
ASXL1	171023	broad.mit.edu	37	20	31019263	31019263	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31019263C>T	uc002wxs.2	+	8	1284	c.858C>T	c.(856-858)TTC>TTT	p.F286F	ASXL1_uc010geb.2_Silent_p.F177F	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	286	LXXLL motif.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						AGCTCCTCTTCCTCCTGCCTG	0.512			F|N|Mis		MDS|CMML								96	311	---	---	---	---	PASS
ASXL1	171023	broad.mit.edu	37	20	31022586	31022586	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31022586C>T	uc002wxs.2	+	12	2497	c.2071C>T	c.(2071-2073)CTA>TTA	p.L691L	ASXL1_uc010geb.2_Silent_p.L582L	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	691					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						TACGTCAGATCTACAGCGAAC	0.607			F|N|Mis		MDS|CMML								9	73	---	---	---	---	PASS
ASXL1	171023	broad.mit.edu	37	20	31023203	31023203	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31023203G>A	uc002wxs.2	+	12	3114	c.2688G>A	c.(2686-2688)TTG>TTA	p.L896L	ASXL1_uc010geb.2_Silent_p.L787L	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	896					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						ACAGTTCTTTGCATTGGATAC	0.463			F|N|Mis		MDS|CMML								8	397	---	---	---	---	PASS
PXMP4	11264	broad.mit.edu	37	20	32298406	32298406	+	Silent	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32298406G>A	uc002wzv.2	-	3	453	c.330C>T	c.(328-330)CTC>CTT	p.L110L	PXMP4_uc002wzw.2_Intron|PXMP4_uc010zuh.1_Missense_Mutation_p.S117L	NM_007238	NP_009169	Q9Y6I8	PXMP4_HUMAN	peroxisomal membrane protein 4 isoform a	110	Helical; (Potential).					integral to membrane|membrane fraction|mitochondrial inner membrane|peroxisomal membrane	protein transporter activity				0						GGATACCCCCGAGGAAGGCCG	0.557													37	241	---	---	---	---	PASS
NFS1	9054	broad.mit.edu	37	20	34260741	34260741	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34260741C>G	uc002xdw.1	-	12	1310	c.1246G>C	c.(1246-1248)GAG>CAG	p.E416Q	CPNE1_uc002xdn.1_RNA|CPNE1_uc002xdo.1_RNA|CPNE1_uc002xdp.1_RNA|NFS1_uc002xdt.1_Missense_Mutation_p.E356Q|NFS1_uc002xdu.1_Missense_Mutation_p.E356Q|NFS1_uc002xdv.1_RNA|NFS1_uc010zvk.1_Missense_Mutation_p.E214Q|NFS1_uc010zvl.1_Missense_Mutation_p.E365Q	NM_021100	NP_066923	Q9Y697	NFS1_HUMAN	NFS1 nitrogen fixation 1 precursor	416					cysteine metabolic process|iron incorporation into metallo-sulfur cluster|Mo-molybdopterin cofactor biosynthetic process|protein complex assembly|water-soluble vitamin metabolic process	cytosol|mitochondrial matrix|nucleus	cysteine desulfurase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	ACTTCCTCCTCTGTAGTGAAG	0.458													9	219	---	---	---	---	PASS
PPP1R16B	26051	broad.mit.edu	37	20	37546855	37546855	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37546855G>A	uc002xje.2	+	11	1439	c.1250G>A	c.(1249-1251)CGA>CAA	p.R417Q	PPP1R16B_uc010ggc.2_Missense_Mutation_p.R375Q	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor	417					regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				AAGATCCCACGAGGTGAACTG	0.572													11	261	---	---	---	---	PASS
L3MBTL	26013	broad.mit.edu	37	20	42169587	42169587	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42169587G>C	uc010zwh.1	+	22	2388	c.2342G>C	c.(2341-2343)AGA>ACA	p.R781T	L3MBTL_uc002xkl.2_Missense_Mutation_p.R713T|L3MBTL_uc002xkm.2_3'UTR|L3MBTL_uc010ggl.2_3'UTR|L3MBTL_uc002xkn.1_Intron|L3MBTL_uc002xko.2_3'UTR|L3MBTL_uc002xkp.2_Missense_Mutation_p.R101T|SGK2_uc002xkq.1_Intron	NM_015478	NP_056293	Q9Y468	LMBL1_HUMAN	l(3)mbt-like isoform I	Error:Variant_position_missing_in_Q9Y468_after_alignment					chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AGAATAGTCAGAGTGACCCAT	0.572													4	37	---	---	---	---	PASS
YWHAB	7529	broad.mit.edu	37	20	43533775	43533775	+	Intron	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43533775G>A	uc002xmt.2	+						YWHAB_uc002xmu.2_Intron	NM_003404	NP_003395	P31946	1433B_HUMAN	tyrosine 3-monooxygenase/tryptophan						activation of MAPKK activity|activation of pro-apoptotic gene products|axon guidance|cytoplasmic sequestering of protein|epidermal growth factor receptor signaling pathway|induction of apoptosis by intracellular signals|insulin receptor signaling pathway|mRNA metabolic process|negative regulation of protein dephosphorylation|nerve growth factor receptor signaling pathway|Ras protein signal transduction	centrosome|cytosol|melanosome|perinuclear region of cytoplasm	histone deacetylase binding|phosphoserine binding|protein domain specific binding			kidney(2)|ovary(1)|breast(1)	4		Myeloproliferative disorder(115;0.0122)				CAAAAACGGTGAGAAAGACCC	0.378													4	62	---	---	---	---	PASS
MATN4	8785	broad.mit.edu	37	20	43927019	43927019	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43927019G>T	uc002xnn.2	-	7	1404	c.1217C>A	c.(1216-1218)GCC>GAC	p.A406D	MATN4_uc002xno.2_Missense_Mutation_p.A365D|MATN4_uc002xnp.2_Missense_Mutation_p.A324D|MATN4_uc010zwr.1_Missense_Mutation_p.A354D|MATN4_uc002xnr.1_Missense_Mutation_p.A406D	NM_003833	NP_003824	O95460	MATN4_HUMAN	matrilin 4 isoform 1 precursor	447	VWFA 2.					extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)				CTTCACCTCGGCTGCGGTGCC	0.677													12	27	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57769516	57769516	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57769516C>G	uc002yan.2	+	1	3442	c.3442C>G	c.(3442-3444)CCA>GCA	p.P1148A		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1148						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					CCCAGGCTGGCCAGAGCTGGC	0.677													65	21	---	---	---	---	PASS
NPBWR2	2832	broad.mit.edu	37	20	62737588	62737588	+	Silent	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62737588C>G	uc011abt.1	-	1	597	c.597G>C	c.(595-597)CTG>CTC	p.L199L		NM_005286	NP_005277	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	199	Extracellular (Potential).					plasma membrane	opioid receptor activity|protein binding			large_intestine(1)	1	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					ACGGGAAGCTCAGCCCACAGC	0.622													10	34	---	---	---	---	PASS
MIRLET7C	406885	broad.mit.edu	37	21	17912228	17912228	+	RNA	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17912228G>C	hsa-let-7c|MI0000064	+			c.81G>C			C21orf34_uc002ykb.2_Intron|C21orf34_uc010glc.2_Intron|C21orf34_uc002ykc.2_Intron|uc002yke.2_RNA																	0						GCTTTCCTTGGAGCACACTTG	0.438													31	99	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19653497	19653497	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19653497A>T	uc002ykw.2	-	22	2559	c.2528T>A	c.(2527-2529)CTG>CAG	p.L843Q		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	843	Extracellular (Potential).|Peptidase S1.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						TTTCATATGCAGGCCTAGGAT	0.403													116	216	---	---	---	---	PASS
HLCS	3141	broad.mit.edu	37	21	38309032	38309032	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38309032G>A	uc010gnb.2	-	4	1914	c.713C>T	c.(712-714)TCT>TTT	p.S238F	HLCS_uc002yvs.2_Missense_Mutation_p.S238F|HLCS_uc010gnc.1_Missense_Mutation_p.S385F	NM_000411	NP_000402	P50747	BPL1_HUMAN	holocarboxylase synthetase	238					cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	CCCTCCCTGAGAAAGATAGGC	0.532													5	70	---	---	---	---	PASS
PEX26	55670	broad.mit.edu	37	22	18562701	18562701	+	Missense_Mutation	SNP	C	T	T	rs62641228		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18562701C>T	uc002znp.3	+	3	501	c.292C>T	c.(292-294)CGG>TGG	p.R98W	TUBA8_uc002znr.2_5'UTR|PEX26_uc002znq.3_Missense_Mutation_p.R98W|uc002zns.2_5'Flank|PEX26_uc002znt.2_Missense_Mutation_p.R98W	NM_017929	NP_060399	Q7Z412	PEX26_HUMAN	peroxisome biogenesis factor 26	98	Cytoplasmic (Potential).		R -> W (in NALD; affects the interaction with PEX6).		protein import into peroxisome matrix|protein import into peroxisome membrane	integral to peroxisomal membrane	protein C-terminus binding|protein complex binding			skin(1)	1						AGAAATGGATCGGTGGCAAGA	0.517													9	164	---	---	---	---	PASS
CYTSA	23384	broad.mit.edu	37	22	24765209	24765209	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24765209C>T	uc002zzw.2	+	14	3315	c.3008C>T	c.(3007-3009)TCA>TTA	p.S1003L	CYTSA_uc002zzv.3_Missense_Mutation_p.S1003L|CYTSA_uc011ajq.1_Missense_Mutation_p.S1003L	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A	1003					cell cycle|cell division						0						GACCCTCTCTCAGCATTGGCC	0.378													20	92	---	---	---	---	PASS
SF3A1	10291	broad.mit.edu	37	22	30730595	30730595	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30730595C>T	uc003ahl.2	-	16	2502	c.2370G>A	c.(2368-2370)GGG>GGA	p.G790G		NM_005877	NP_005868	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa isoform 1	790	Ubiquitin-like.				nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding			ovary(3)|large_intestine(1)|pancreas(1)	5						ACTTCTTCCTCCCGCCTCTCT	0.562													5	193	---	---	---	---	PASS
MAFF	23764	broad.mit.edu	37	22	38609893	38609893	+	Silent	SNP	A	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38609893A>G	uc011anp.1	+	2	371	c.33A>G	c.(31-33)CTA>CTG	p.L11L	MAFF_uc003avc.2_Silent_p.L11L|MAFF_uc011anq.1_Intron|MAFF_uc011anr.1_Silent_p.L11L|MAFF_uc003avd.2_Missense_Mutation_p.K61E	NM_001161572	NP_001155044	Q9ULX9	MAFF_HUMAN	transcription factor MAFF isoform a	11					blood coagulation|parturition|transcription from RNA polymerase II promoter	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Melanoma(58;0.045)					GCAAAGCTCTAAAGGTGAGGA	0.547													44	65	---	---	---	---	PASS
TOMM22	56993	broad.mit.edu	37	22	39078929	39078929	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39078929C>G	uc003awe.2	+	3	312	c.282C>G	c.(280-282)ATC>ATG	p.I94M	uc003awd.2_5'Flank	NM_020243	NP_064628	Q9NS69	TOM22_HUMAN	mitochondrial import receptor Tom22	94	TMD; necessary for mitochondrion outer membrane localization and integration in the TOM complex (By similarity).|Helical; (Potential).				protein import into mitochondrial outer membrane	integral to membrane|integral to membrane of membrane fraction|mitochondrial outer membrane translocase complex	protein binding|protein transmembrane transporter activity|receptor activity				0	Melanoma(58;0.04)					CCTTTATGATCCTGGTTCTTC	0.522													55	327	---	---	---	---	PASS
XRCC6	2547	broad.mit.edu	37	22	42042981	42042981	+	Silent	SNP	A	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42042981A>C	uc003bao.1	+	7	925	c.855A>C	c.(853-855)CCA>CCC	p.P285P	XRCC6_uc003bap.1_Silent_p.P244P|XRCC6_uc011apc.1_Silent_p.P235P|XRCC6_uc003baq.1_Silent_p.P285P|XRCC6_uc003bar.1_Silent_p.P285P|XRCC6_uc003bas.1_Silent_p.P235P	NM_001469	NP_001460	P12956	XRCC6_HUMAN	ATP-dependent DNA helicase II, 70 kDa subunit	285	Ku.				DNA ligation|double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|provirus integration|telomere maintenance|transcription, DNA-dependent	DNA-dependent protein kinase-DNA ligase 4 complex|Ku70:Ku80 complex|membrane fraction|nuclear telomere cap complex|transcription factor complex	5'-deoxyribose-5-phosphate lyase activity|ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|transcription regulatory region DNA binding			skin(2)|ovary(1)|lung(1)|kidney(1)	5						AGCCTCCTCCAATAAAGCTCT	0.438								Direct_reversal_of_damage|NHEJ					142	237	---	---	---	---	PASS
EFCAB6	64800	broad.mit.edu	37	22	43933266	43933266	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43933266C>A	uc003bdy.1	-	29	4254	c.4039G>T	c.(4039-4041)GAT>TAT	p.D1347Y	EFCAB6_uc003bdz.1_Missense_Mutation_p.D1195Y|EFCAB6_uc010gzi.1_Missense_Mutation_p.D1195Y	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	1347	Interaction with PARK7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				CCCAGGAAATCGGAGGCGTTG	0.577													110	120	---	---	---	---	PASS
GRAMD4	23151	broad.mit.edu	37	22	47059980	47059980	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47059980G>A	uc003bhx.2	+	7	722	c.683G>A	c.(682-684)TGG>TAG	p.W228*	GRAMD4_uc010had.2_Nonsense_Mutation_p.W167*	NM_015124	NP_055939	Q6IC98	GRAM4_HUMAN	death-inducing-protein	228					apoptosis	integral to membrane|mitochondrial membrane				ovary(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		TTATCCGACTGGTACTCCGTC	0.592													7	164	---	---	---	---	PASS
KLHDC7B	113730	broad.mit.edu	37	22	50987715	50987715	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50987715G>A	uc003bmi.2	+	1	1254	c.1120G>A	c.(1120-1122)GAG>AAG	p.E374K		NM_138433	NP_612442	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	374	Kelch 2.									central_nervous_system(1)	1		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CTGCTCCAACGAGGTCTTCTG	0.662													7	119	---	---	---	---	PASS
SH3KBP1	30011	broad.mit.edu	37	X	19713856	19713856	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19713856C>T	uc004czm.2	-	5	710	c.394G>A	c.(394-396)GAG>AAG	p.E132K	SH3KBP1_uc004czl.2_Missense_Mutation_p.E95K	NM_031892	NP_114098	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1 isoform a	132	SH3 2.				apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding				0						CATCCTTCCTCTACCTGCAGA	0.473													10	350	---	---	---	---	PASS
SH3KBP1	30011	broad.mit.edu	37	X	19764486	19764486	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19764486C>A	uc004czm.2	-	3	552	c.236G>T	c.(235-237)AGT>ATT	p.S79I	SH3KBP1_uc004czl.2_Missense_Mutation_p.S42I	NM_031892	NP_114098	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1 isoform a	79					apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding				0						AGAGTTTCCACTGGGCACTTC	0.428													439	172	---	---	---	---	PASS
CNKSR2	22866	broad.mit.edu	37	X	21608737	21608737	+	Missense_Mutation	SNP	A	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21608737A>C	uc004czx.1	+	14	1692	c.1656A>C	c.(1654-1656)AAA>AAC	p.K552N	CNKSR2_uc004czw.2_Missense_Mutation_p.K552N|CNKSR2_uc011mjn.1_Missense_Mutation_p.K503N|CNKSR2_uc011mjo.1_Missense_Mutation_p.K522N|CNKSR2_uc004czy.2_Missense_Mutation_p.K144N	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	552					regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2						AGAAAAACAAAGGTAAGAAAA	0.403													67	26	---	---	---	---	PASS
MBTPS2	51360	broad.mit.edu	37	X	21896174	21896174	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21896174G>C	uc004dae.2	+	8	1182	c.985G>C	c.(985-987)GAT>CAT	p.D329H	MBTPS2_uc010nfr.2_Intron	NM_015884	NP_056968	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase,	329	Cys-rich.|Lumenal (Probable).				cholesterol metabolic process|proteolysis	Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity			ovary(1)	1						CAAACGACTAGATGGTTCAAC	0.323													10	299	---	---	---	---	PASS
MBTPS2	51360	broad.mit.edu	37	X	21896718	21896718	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21896718C>T	uc004dae.2	+	9	1366	c.1169C>T	c.(1168-1170)TCT>TTT	p.S390F	MBTPS2_uc010nfr.2_5'UTR	NM_015884	NP_056968	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase,	390	Lumenal (Probable).				cholesterol metabolic process|proteolysis	Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity			ovary(1)	1						ATAATACCTTCTTTGGAAACT	0.388													177	355	---	---	---	---	PASS
SMS	6611	broad.mit.edu	37	X	21995302	21995302	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21995302A>T	uc004dag.2	+	5	554	c.453A>T	c.(451-453)AAA>AAT	p.K151N	SMS_uc011mjq.1_Missense_Mutation_p.K55N|SMS_uc004daf.1_Missense_Mutation_p.K98N|SMS_uc010nfs.2_5'Flank|SMS_uc010nft.2_5'Flank	NM_004595	NP_004586	P52788	SPSY_HUMAN	spermine synthase	151					methionine metabolic process|spermine biosynthetic process	cytosol	spermidine synthase activity|spermine synthase activity			ovary(1)	1					Spermine(DB00127)	AAAATATAAAAATTCTACACT	0.443													15	349	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	29972810	29972810	+	Splice_Site	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29972810G>T	uc004dby.2	+	10	1880	c.1372_splice	c.e10+1	p.T458_splice		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1						innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						CCAACTGGAAGTAAGTTAATG	0.328													68	170	---	---	---	---	PASS
NR0B1	190	broad.mit.edu	37	X	30326750	30326750	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30326750C>A	uc004dcf.3	-	1	746	c.731G>T	c.(730-732)CGG>CTG	p.R244L		NM_000475	NP_000466	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	244	4; truncated.|4 X 67 AA tandem repeats.				adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding			ovary(1)|lung(1)	2					Dexamethasone(DB01234)|Tretinoin(DB00755)	CGCCACCGGCCGCAGCGCACC	0.672											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	28	12	---	---	---	---	PASS
DGKK	139189	broad.mit.edu	37	X	50130570	50130570	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50130570T>C	uc010njr.1	-	14	2160	c.2100A>G	c.(2098-2100)ATA>ATG	p.I700M		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	700					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					TCACAGACACTATTGCAGTGT	0.388													13	43	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53587154	53587154	+	Silent	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53587154C>A	uc004dsp.2	-	56	8133	c.7731G>T	c.(7729-7731)CTG>CTT	p.L2577L	HUWE1_uc004dsn.2_Silent_p.L1401L|uc004dss.2_5'Flank|MIRLET7F2_hsa-let-7f-2|MI0000068_5'Flank	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	2577					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						CTCACCTCTGCAGTATAAGAG	0.498													6	13	---	---	---	---	PASS
FGD1	2245	broad.mit.edu	37	X	54482795	54482795	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54482795C>T	uc004dtg.2	-	10	2434	c.1700G>A	c.(1699-1701)CGA>CAA	p.R567Q	FGD1_uc011moi.1_Missense_Mutation_p.R325Q	NM_004463	NP_004454	P98174	FGD1_HUMAN	faciogenital dysplasia protein	567					actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|skin(2)|central_nervous_system(1)	6						CTTATGCATTCGCTCCTGGCA	0.547													31	64	---	---	---	---	PASS
ARHGEF9	23229	broad.mit.edu	37	X	62944454	62944454	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62944454C>A	uc004dvl.2	-	2	986	c.147G>T	c.(145-147)CAG>CAT	p.Q49H	ARHGEF9_uc004dvj.1_Intron|ARHGEF9_uc004dvk.1_5'UTR|ARHGEF9_uc011mos.1_Missense_Mutation_p.Q28H|ARHGEF9_uc004dvm.1_Missense_Mutation_p.Q28H|ARHGEF9_uc011mot.1_Intron|ARHGEF9_uc004dvn.2_Missense_Mutation_p.Q56H	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9	49	SH3.				apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						CATCGTCGATCTGGCCCCACC	0.537													54	36	---	---	---	---	PASS
MSN	4478	broad.mit.edu	37	X	64949369	64949369	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64949369G>C	uc004dwf.2	+	4	460	c.262G>C	c.(262-264)GAT>CAT	p.D88H		NM_002444	NP_002435	P26038	MOES_HUMAN	moesin	88	FERM.				leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking	apical plasma membrane|cytoskeleton|extrinsic to membrane|microvillus membrane|nucleolus	cell adhesion molecule binding|receptor binding|structural constituent of cytoskeleton	p.D88A(1)	MSN/ALK(6)	haematopoietic_and_lymphoid_tissue(6)|ovary(3)|lung(1)	10						CTACCCTGAGGATGTGTCCGA	0.502			T	ALK	ALCL								132	109	---	---	---	---	PASS
VSIG4	11326	broad.mit.edu	37	X	65252493	65252493	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65252493G>A	uc004dwh.2	-	3	638	c.511C>T	c.(511-513)CCT>TCT	p.P171S	VSIG4_uc004dwi.2_Intron|VSIG4_uc010nkq.1_Missense_Mutation_p.P171S|VSIG4_uc004dwj.2_Missense_Mutation_p.P171S|VSIG4_uc011moy.1_Intron|VSIG4_uc004dwk.2_Missense_Mutation_p.P171S|VSIG4_uc004dwl.2_Missense_Mutation_p.P67S	NM_007268	NP_009199	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	171	Ig-like 2.|Extracellular (Potential).				complement activation, alternative pathway	integral to membrane	protein binding				0						CTGATGGGAGGAGAACCCCGA	0.502													4	99	---	---	---	---	PASS
FAM155B	27112	broad.mit.edu	37	X	68725502	68725502	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68725502C>A	uc004dxk.2	+	1	425	c.377C>A	c.(376-378)CCC>CAC	p.P126H		NM_015686	NP_056501	O75949	F155B_HUMAN	transmembrane protein 28	126						integral to membrane				ovary(1)|breast(1)	2						AAAGCCGCCCCCGCCGCCGGC	0.557													3	14	---	---	---	---	PASS
IGBP1	3476	broad.mit.edu	37	X	69353813	69353813	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69353813G>A	uc004dxv.2	+	1	515	c.16G>A	c.(16-18)GAG>AAG	p.E6K	IGBP1_uc004dxw.2_Missense_Mutation_p.E6K	NM_001551	NP_001542	P78318	IGBP1_HUMAN	immunoglobulin binding protein 1	6					B cell activation|negative regulation of caspase activity|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|regulation of microtubule-based movement|response to interleukin-1|response to tumor necrosis factor|signal transduction	cytoplasm	protein phosphatase type 2A regulator activity	p.E6V(1)		kidney(1)|pancreas(1)	2						TGCTGAGGACGAGTTACAGCT	0.552											OREG0019849	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	39	---	---	---	---	PASS
TEX11	56159	broad.mit.edu	37	X	69871348	69871348	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69871348G>A	uc004dyl.2	-	18	1642	c.1480C>T	c.(1480-1482)CAA>TAA	p.Q494*	TEX11_uc004dyk.2_Nonsense_Mutation_p.Q169*|TEX11_uc004dym.2_Nonsense_Mutation_p.Q479*	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN	testis expressed sequence 11 isoform 1	494							protein binding			ovary(3)|breast(1)|skin(1)	5	Renal(35;0.156)					ATATAAAATTGAGTGAAAACG	0.343													6	107	---	---	---	---	PASS
ARMCX5	64860	broad.mit.edu	37	X	101857187	101857187	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101857187G>A	uc004ejg.2	+	6	999	c.118G>A	c.(118-120)GCT>ACT	p.A40T	ARMCX5_uc004ejh.2_Missense_Mutation_p.A40T	NM_022838	NP_073749	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	40							binding			ovary(1)	1						CGAGGCAGTGGCTGAGGCAGA	0.542													47	19	---	---	---	---	PASS
GPRASP1	9737	broad.mit.edu	37	X	101912007	101912007	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101912007C>T	uc004ejj.3	+	5	3967	c.3166C>T	c.(3166-3168)CCA>TCA	p.P1056S	GPRASP1_uc004eji.3_Missense_Mutation_p.P1056S|GPRASP1_uc010nod.2_Missense_Mutation_p.P1056S	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting	1056	OPRD1-binding.					cytoplasm	protein binding			ovary(1)|lung(1)	2						CAAGCCTGGTCCATGGGGTAG	0.522													79	336	---	---	---	---	PASS
IL1RAPL2	26280	broad.mit.edu	37	X	104984616	104984616	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104984616C>A	uc004elz.1	+	8	1736	c.980C>A	c.(979-981)GCG>GAG	p.A327E		NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	327	Ig-like C2-type 3.|Extracellular (Potential).				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3						GCTGACCTGGCGAATTATACC	0.388													60	52	---	---	---	---	PASS
MUM1L1	139221	broad.mit.edu	37	X	105450780	105450780	+	Missense_Mutation	SNP	A	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105450780A>C	uc004emf.1	+	4	2004	c.1355A>C	c.(1354-1356)CAA>CCA	p.Q452P	MUM1L1_uc004emg.1_Missense_Mutation_p.Q452P	NM_152423	NP_689636	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	452	PWWP.									ovary(2)|pancreas(1)|skin(1)	4						AAAGAGAAACAAATGCTAGTG	0.353													33	108	---	---	---	---	PASS
LONRF3	79836	broad.mit.edu	37	X	118109537	118109537	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118109537A>T	uc004eqw.2	+	1	825	c.794A>T	c.(793-795)AAG>ATG	p.K265M	LONRF3_uc004eqx.2_Missense_Mutation_p.K265M|LONRF3_uc004eqy.2_RNA|LONRF3_uc004eqz.2_5'Flank	NM_001031855	NP_001027026	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger	265	TPR 2.				proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)	2						GCACTGCTCAAGTACAACGAG	0.667													7	4	---	---	---	---	PASS
KIAA1210	57481	broad.mit.edu	37	X	118243104	118243104	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118243104C>T	uc004era.3	-	5	712	c.712G>A	c.(712-714)GAG>AAG	p.E238K		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	238										ovary(4)|skin(1)	5						CTTTCAGGCTCAGGACCCAAC	0.488													5	45	---	---	---	---	PASS
SLC25A5	292	broad.mit.edu	37	X	118604025	118604025	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118604025G>C	uc004erh.3	+	2	629	c.513G>C	c.(511-513)AAG>AAC	p.K171N	LOC100303728_uc004ere.1_5'Flank|LOC100303728_uc004erg.1_5'Flank	NM_001152	NP_001143	P05141	ADT2_HUMAN	adenine nucleotide translocator 2	171	Solcar 2.				chromosome segregation|energy reserve metabolic process|interspecies interaction between organisms|regulation of insulin secretion|viral reproduction	integral to plasma membrane|mitochondrial inner membrane|mitochondrial nucleoid|MMXD complex	adenine transmembrane transporter activity|protein binding			ovary(1)	1					Clodronate(DB00720)	ATGGGATTAAGGGCCTGTACC	0.502													276	222	---	---	---	---	PASS
UPF3B	65109	broad.mit.edu	37	X	118985785	118985785	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118985785G>A	uc004erz.1	-	2	285	c.208C>T	c.(208-210)CAT>TAT	p.H70Y	UPF3B_uc004esa.1_Missense_Mutation_p.H70Y	NM_080632	NP_542199	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B	70	Necessary for interaction with UPF2.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(2)|kidney(1)	3						GGTTGAAGATGTTCCTGAAGC	0.328													14	49	---	---	---	---	PASS
RNF113A	7737	broad.mit.edu	37	X	119004853	119004853	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119004853C>T	uc004esb.2	-	1	939	c.724G>A	c.(724-726)GGT>AGT	p.G242S	NDUFA1_uc004esc.3_5'Flank	NM_006978	NP_008909	O15541	R113A_HUMAN	ring finger protein 113A	242							nucleic acid binding|zinc ion binding			breast(2)	2						TCATAGACACCATAGCGACCC	0.488													13	258	---	---	---	---	PASS
ATP1B4	23439	broad.mit.edu	37	X	119509334	119509334	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119509334C>A	uc004esr.2	+	5	754	c.670C>A	c.(670-672)CGC>AGC	p.R224S	ATP1B4_uc004esq.2_Missense_Mutation_p.R220S|ATP1B4_uc011mtx.1_Missense_Mutation_p.R189S|ATP1B4_uc011mty.1_Missense_Mutation_p.R181S	NM_001142447	NP_001135919	Q9UN42	AT1B4_HUMAN	ATPase, (Na+)/K+ transporting, beta 4	224	Perinuclear space (Potential).				ATP biosynthetic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to plasma membrane|nuclear inner membrane	sodium:potassium-exchanging ATPase activity			ovary(1)|skin(1)	2						CCAATTTAAGCGCTCCTTCCT	0.483													174	107	---	---	---	---	PASS
GLUD2	2747	broad.mit.edu	37	X	120183012	120183012	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:120183012G>A	uc004eto.2	+	1	1551	c.1474G>A	c.(1474-1476)GAG>AAG	p.E492K		NM_012084	NP_036216	P49448	DHE4_HUMAN	glutamate dehydrogenase 2 precursor	492					glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding			pancreas(1)	1					L-Glutamic Acid(DB00142)|NADH(DB00157)	ACCCACGGCAGAGTTCCAAGA	0.453													11	215	---	---	---	---	PASS
THOC2	57187	broad.mit.edu	37	X	122840735	122840735	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122840735C>T	uc004etu.2	-	3	227	c.195G>A	c.(193-195)CAG>CAA	p.Q65Q	THOC2_uc011muh.1_5'UTR|THOC2_uc011mui.1_5'UTR	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	65					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						CATTAGATGCCTGTTCATGCT	0.299													24	31	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123224561	123224561	+	Silent	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123224561C>T	uc004etz.3	+	30	3753	c.3414C>T	c.(3412-3414)TTC>TTT	p.F1138F	STAG2_uc004eua.2_Silent_p.F1138F|STAG2_uc004eub.2_Silent_p.F1138F|STAG2_uc004euc.2_Silent_p.F1138F|STAG2_uc004eud.2_Silent_p.F1138F|STAG2_uc004eue.2_Silent_p.F1138F	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	1138					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						AGGATAGCTTCATGAGTGTTT	0.383													7	201	---	---	---	---	PASS
IGSF1	3547	broad.mit.edu	37	X	130416701	130416701	+	Silent	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130416701G>T	uc004ewd.2	-	7	1201	c.963C>A	c.(961-963)CCC>CCA	p.P321P	IGSF1_uc004ewe.3_Silent_p.P310P|IGSF1_uc004ewf.2_Silent_p.P301P	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	321	Ig-like C2-type 4.|Extracellular (Potential).				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						GCCAGGTCTTGGGGAAAGTGT	0.507													67	75	---	---	---	---	PASS
GPC3	2719	broad.mit.edu	37	X	132834024	132834024	+	Silent	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132834024G>T	uc004exe.1	-	4	1255	c.1065C>A	c.(1063-1065)CGC>CGA	p.R355R	GPC3_uc004exd.1_Silent_p.R227R|GPC3_uc010nrn.1_Silent_p.R378R|GPC3_uc011mvh.1_Silent_p.R339R|GPC3_uc010nro.1_Silent_p.R301R|GPC3_uc010nrp.1_Silent_p.R227R	NM_004484	NP_004475	P51654	GPC3_HUMAN	glypican 3 isoform 2 precursor	355						extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity			lung(2)|prostate(1)|breast(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)					ATCTATATTGGCGTTGTTGAG	0.323			T|D|Mis|N|F|S			Wilms tumour			Simpson-Golabi-Behmel_syndrome				132	216	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135428578	135428578	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135428578G>C	uc004ezu.1	+	6	3004	c.2713G>C	c.(2713-2715)GAG>CAG	p.E905Q	GPR112_uc010nsb.1_Missense_Mutation_p.E700Q|GPR112_uc010nsc.1_Missense_Mutation_p.E672Q	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	905	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					TGCAACAACTGAGGTGAGAGA	0.378													22	467	---	---	---	---	PASS
RBMX	27316	broad.mit.edu	37	X	135956578	135956578	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135956578G>T	uc004fae.1	-	9	1109	c.899C>A	c.(898-900)CCC>CAC	p.P300H	RBMX_uc004fac.1_5'Flank|RBMX_uc011mwf.1_Intron|RBMX_uc004fad.1_3'UTR|RBMX_uc011mwg.1_Missense_Mutation_p.P261H|RBMX_uc004faf.1_Missense_Mutation_p.P161H|RBMX_uc010nsf.1_Missense_Mutation_p.P261H|RBMX_uc004fag.1_Missense_Mutation_p.P172H	NM_002139	NP_002130	P38159	HNRPG_HUMAN	RNA binding motif protein, X-linked isoform 1	300						catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					AGATGGCGGGGGCCCTCGTGT	0.463													96	187	---	---	---	---	PASS
RBMX	27316	broad.mit.edu	37	X	135961272	135961272	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135961272C>T	uc004fae.1	-	3	330	c.120G>A	c.(118-120)ATG>ATA	p.M40I	RBMX_uc011mwf.1_Missense_Mutation_p.M40I|RBMX_uc004fad.1_Missense_Mutation_p.M40I|RBMX_uc011mwg.1_Missense_Mutation_p.M1I|RBMX_uc004faf.1_5'UTR|RBMX_uc010nsf.1_Missense_Mutation_p.M1I|RBMX_uc004fag.1_Intron	NM_002139	NP_002130	P38159	HNRPG_HUMAN	RNA binding motif protein, X-linked isoform 1	40	RRM.					catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					CACGGTCTTTCATCAAGAGTA	0.378													71	354	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138670585	138670585	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138670585C>G	uc004fau.2	-	21	2677	c.2383G>C	c.(2383-2385)GAT>CAT	p.D795H	MCF2_uc004fav.2_Missense_Mutation_p.D811H|MCF2_uc011mwl.1_Missense_Mutation_p.D772H|MCF2_uc010nsh.1_Missense_Mutation_p.D795H|MCF2_uc011mwm.1_Missense_Mutation_p.D756H|MCF2_uc011mwn.1_Missense_Mutation_p.D940H|MCF2_uc004faw.2_Missense_Mutation_p.D855H|MCF2_uc011mwo.1_Missense_Mutation_p.D871H	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	795	PH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					ATCTTCACATCTACATTAGAA	0.338													19	87	---	---	---	---	PASS
ATP11C	286410	broad.mit.edu	37	X	138869371	138869371	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138869371C>A	uc004faz.2	-	15	1661	c.1562G>T	c.(1561-1563)GGA>GTA	p.G521V	ATP11C_uc004fay.2_RNA|ATP11C_uc004fba.2_Missense_Mutation_p.G521V	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	521	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					TCTCATATATCCATTTCGATT	0.284													4	115	---	---	---	---	PASS
CDR1	1038	broad.mit.edu	37	X	139866206	139866206	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139866206G>A	uc004fbg.1	-	1	518	c.326C>T	c.(325-327)CCG>CTG	p.P109L	uc004fbf.1_RNA	NM_004065	NP_004056	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1,	109	18.|23 X 6 AA approximate repeats.										0	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				CAAAAAATCCGGGTCTTCCAG	0.448													108	236	---	---	---	---	PASS
FMR1NB	158521	broad.mit.edu	37	X	147106426	147106426	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147106426T>C	uc004fcm.2	+	5	748	c.674T>C	c.(673-675)GTA>GCA	p.V225A		NM_152578	NP_689791	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	225	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					AACAGAGTTGTAACGGGTTTG	0.413													131	102	---	---	---	---	PASS
MAGEA11	4110	broad.mit.edu	37	X	148796226	148796226	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148796226C>G	uc004fdq.2	+	3	284	c.182C>G	c.(181-183)CCA>CGA	p.P61R	HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|MAGEA11_uc004fdr.2_Missense_Mutation_p.P32R	NM_005366	NP_005357	P43364	MAGAB_HUMAN	melanoma antigen family A, 11 isoform a	61						cytoplasm|nucleus	protein binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CAGGATCTGCCAAGAGTCCAG	0.547													14	53	---	---	---	---	PASS
CD99L2	83692	broad.mit.edu	37	X	149999760	149999760	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149999760C>T	uc004fel.2	-	2	192	c.74G>A	c.(73-75)GGG>GAG	p.G25E	CD99L2_uc004fem.2_Missense_Mutation_p.G25E|CD99L2_uc004fen.2_Missense_Mutation_p.G25E|CD99L2_uc004feo.2_RNA|CD99L2_uc011myb.1_Missense_Mutation_p.G25E	NM_031462	NP_113650	Q8TCZ2	C99L2_HUMAN	CD99 antigen-like 2 isoform E3'-E4'-E3-E4	25					cell adhesion	cell junction|integral to membrane				large_intestine(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ATCAAAGTCCCCAGATCCtaa	0.279													50	161	---	---	---	---	PASS
GABRA3	2556	broad.mit.edu	37	X	151533043	151533043	+	5'UTR	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151533043C>T	uc010ntk.1	-	2						NM_000808	NP_000799	P34903	GBRA3_HUMAN	gamma-aminobutyric acid A receptor, alpha 3						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)				Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TGATTATCATCTTCTTAGGCA	0.323													12	241	---	---	---	---	PASS
PNMA5	114824	broad.mit.edu	37	X	152158903	152158903	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152158903C>T	uc010ntw.2	-	3	1579	c.1240G>A	c.(1240-1242)GCT>ACT	p.A414T	PNMA5_uc004fha.3_Missense_Mutation_p.A414T|PNMA5_uc010ntx.2_Missense_Mutation_p.A414T|PNMA5_uc004fgy.3_Missense_Mutation_p.A414T	NM_001103151	NP_001096621	Q96PV4	PNMA5_HUMAN	paraneoplastic antigen like 5	414					apoptosis					ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TGGTTTTCAGCCTTGGGATAC	0.612													7	257	---	---	---	---	PASS
ZNF275	10838	broad.mit.edu	37	X	152613051	152613051	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152613051G>A	uc004fhg.1	+	4	1085	c.908G>A	c.(907-909)CGA>CAA	p.R303Q	ZNF275_uc011mym.1_Missense_Mutation_p.R303Q|ZNF275_uc011myn.1_Missense_Mutation_p.R240Q			A6NFS0	A6NFS0_HUMAN	SubName: Full=cDNA FLJ16723 fis, clone UTERU3004418, highly similar to Zinc finger protein 275; SubName: Full=Putative uncharacterized protein ZNF275;	303						intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AAGCTCTTCCGAAGGAGCTCG	0.682													6	15	---	---	---	---	PASS
PLXNB3	5365	broad.mit.edu	37	X	153043732	153043732	+	Missense_Mutation	SNP	A	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153043732A>C	uc004fii.2	+	33	5600	c.5426A>C	c.(5425-5427)AAA>ACA	p.K1809T	PLXNB3_uc010nuk.2_Missense_Mutation_p.K1832T|PLXNB3_uc011mzd.1_Missense_Mutation_p.K1448T|SRPK3_uc004fik.2_5'UTR|SRPK3_uc010nul.2_5'Flank|SRPK3_uc004fin.2_5'Flank|SRPK3_uc004fil.2_5'Flank|SRPK3_uc004fim.2_5'Flank	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1	1809	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CCAGTGAACAAACTGCTCTAC	0.652													27	74	---	---	---	---	PASS
IDH3G	3421	broad.mit.edu	37	X	153053286	153053286	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153053286C>G	uc004fip.2	-	7	718	c.532G>C	c.(532-534)GAG>CAG	p.E178Q	IDH3G_uc004fio.2_Missense_Mutation_p.E120Q|IDH3G_uc004fiq.2_Missense_Mutation_p.E178Q|IDH3G_uc010num.2_Missense_Mutation_p.E120Q|IDH3G_uc004fir.2_Missense_Mutation_p.E120Q|IDH3G_uc004fit.1_Missense_Mutation_p.E178Q|IDH3G_uc004fis.2_Missense_Mutation_p.E120Q|IDH3G_uc004fiu.2_5'Flank	NM_004135	NP_004126	P51553	IDH3G_HUMAN	isocitrate dehydrogenase 3 (NAD+) gamma isoform	178					carbohydrate metabolic process|isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleolus	ATP binding|isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)				NADH(DB00157)	ACCTCATGCTCCAGGCTGCTG	0.592													8	287	---	---	---	---	PASS
PLXNA3	55558	broad.mit.edu	37	X	153695501	153695501	+	Intron	SNP	C	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153695501C>T	uc004flm.2	+							NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor						axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AATGTGAGTACCAGCTGCCCC	0.637													44	104	---	---	---	---	PASS
FUNDC2	65991	broad.mit.edu	37	X	154280053	154280053	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154280053G>C	uc004fmw.2	+	4	619	c.469G>C	c.(469-471)GAG>CAG	p.E157Q		NM_023934	NP_076423	Q9BWH2	FUND2_HUMAN	FUN14 domain containing 2	157						mitochondrion					0	all_cancers(53;3.51e-17)|all_epithelial(53;5.13e-11)|all_lung(58;3.84e-07)|Lung NSC(58;1.2e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GATACCTACTGAGGTCAGGAG	0.463													3	126	---	---	---	---	PASS
RAB39B	116442	broad.mit.edu	37	X	154493444	154493444	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154493444C>A	uc004fne.2	-	1	409	c.130G>T	c.(130-132)GAT>TAT	p.D44Y		NM_171998	NP_741995	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	44	Effector region (By similarity).				protein transport|small GTPase mediated signal transduction|synapse organization|vesicle-mediated transport	Golgi apparatus|plasma membrane	GTP binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GAGAAAAAATCCACCCCCACG	0.597													69	144	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1600092	1600093	+	Intron	DEL	TG	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1600092_1600093delTG	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc009vkl.1_Intron|SLC35E2B_uc001ahe.3_Intron|SLC35E2B_uc001ahf.3_Intron|SLC35E2B_uc001ahg.3_Intron|SLC35E2B_uc001ahh.3_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						CTGTTTTTTTTGTTTGTTTGTT	0.317													4	5	---	---	---	---	
YTHDF2	51441	broad.mit.edu	37	1	29070609	29070610	+	Intron	INS	-	G	G	rs72508792	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29070609_29070610insG	uc001brc.2	+						YTHDF2_uc001brd.2_Intron|YTHDF2_uc010ofx.1_Intron|YTHDF2_uc001bre.2_Intron	NM_016258	NP_057342	Q9Y5A9	YTHD2_HUMAN	high glucose-regulated protein 8						humoral immune response					ovary(1)|skin(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		ATACAGTATCACCTAACAGTTC	0.332													0	8	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39545374	39545377	+	5'Flank	DEL	TTCC	-	-	rs112113087		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39545374_39545377delTTCC	uc010ois.1	+						MACF1_uc010oir.1_5'Flank	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAAATTTCTTttccttccttcctt	0.186													4	4	---	---	---	---	
PPT1	5538	broad.mit.edu	37	1	40557538	40557538	+	Intron	DEL	A	-	-	rs11308805		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40557538delA	uc001cfb.2	-						PPT1_uc010ojf.1_Intron|PPT1_uc010ojg.1_Intron|PPT1_uc009vwa.2_Intron	NM_000310	NP_000301	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1 isoform 1						brain development|cofactor metabolic process|cofactor transport|DNA fragmentation involved in apoptotic nuclear change|lysosomal lumen acidification|membrane raft organization|negative regulation of cell growth|negative regulation of neuron apoptosis|neuron development|pinocytosis|positive regulation of pinocytosis|positive regulation of receptor-mediated endocytosis|protein depalmitoylation|protein transport|receptor-mediated endocytosis|regulation of synapse structure and activity|sphingolipid catabolic process|visual perception	axon|cytosol|Golgi apparatus|lysosome|membrane fraction|membrane raft|nucleus|synaptic vesicle	palmitoyl-(protein) hydrolase activity|palmitoyl-CoA hydrolase activity			ovary(1)	1	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			attctgtctcaaaaaaaaaaa	0.129													7	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	199130136	199130137	+	IGR	INS	-	G	G	rs142603788	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199130136_199130137insG								MIR181A1 (301854 upstream) : NR5A2 (866633 downstream)																							gaaggaaggaagaaggaaggaa	0.149													4	3	---	---	---	---	
RAB3GAP2	25782	broad.mit.edu	37	1	220363995	220363995	+	Intron	DEL	A	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220363995delA	uc010puk.1	-						RAB3GAP2_uc001hmf.2_Intron|RAB3GAP2_uc001hmg.2_Intron	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic						intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		AAATACTGATAGCAAGTACAT	0.358													10	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	222986696	222986703	+	IGR	DEL	CACACACA	-	-	rs72212579		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222986696_222986703delCACACACA								FAM177B (62695 upstream) : DISP1 (115080 downstream)																							CCAGCGTGGGcacacacacacacacaca	0.288													4	2	---	---	---	---	
ASAP2	8853	broad.mit.edu	37	2	9411230	9411231	+	Intron	INS	-	T	T	rs149039710	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9411230_9411231insT	uc002qzh.2	+						ASAP2_uc002qzi.2_Intron	NM_003887	NP_003878	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0						ccCTGTTTTCATTTTTTTTTAT	0.188													3	3	---	---	---	---	
ASXL2	55252	broad.mit.edu	37	2	26079232	26079233	+	Intron	INS	-	TTT	TTT	rs143352675		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26079232_26079233insTTT	uc002rgs.2	-							NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ctggccTATACttttttttttt	0.218													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	38456195	38456196	+	IGR	INS	-	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38456195_38456196insA								C2orf58 (47204 upstream) : ATL2 (65835 downstream)																							atacccaacttaaaaaaaaaaa	0.010													4	2	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	79423063	79423066	+	Intron	DEL	TTTG	-	-	rs3979543		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79423063_79423066delTTTG	uc010yse.1	+							NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						AACTCAGttttttgtttgtttgtt	0.201													6	6	---	---	---	---	
PLGLB2	5342	broad.mit.edu	37	2	87238032	87238032	+	3'UTR	DEL	A	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87238032delA	uc002ssd.2	-	4					RMND5A_uc002srs.3_Intron|RGPD1_uc010fgv.2_Intron|RGPD1_uc002ssb.2_Intron|RGPD1_uc002ssc.2_Intron	NM_002665	NP_002656	Q02325	PLGB_HUMAN	plasminogen-like B2 precursor							extracellular region					0						tctgtctcagaaaaaaaaaaa	0.179													4	2	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179477935	179477935	+	Frame_Shift_Del	DEL	C	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179477935delC	uc010zfg.1	-	213	42121	c.41897delG	c.(41896-41898)GGAfs	p.G13966fs	uc002ump.1_Intron|TTN_uc010zfh.1_Frame_Shift_Del_p.G7661fs|TTN_uc010zfi.1_Frame_Shift_Del_p.G7594fs|TTN_uc010zfj.1_Frame_Shift_Del_p.G7469fs	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14893							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTTGGTTTTCCAGGTCCAGC	0.338													45	53	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179565944	179565945	+	Intron	INS	-	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179565944_179565945insT	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAGAAAATAAATGCCGTTAGTA	0.361													143	71	---	---	---	---	
COL5A2	1290	broad.mit.edu	37	2	189931414	189931414	+	Intron	DEL	A	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189931414delA	uc002uqk.2	-						COL5A2_uc010frx.2_Intron	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein						axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			ACTTCCAGACAATACTATGTT	0.348													88	116	---	---	---	---	
TTLL4	9654	broad.mit.edu	37	2	219616610	219616611	+	Intron	INS	-	TTT	TTT	rs10694172		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219616610_219616611insTTT	uc002viy.2	+						TTLL4_uc010zkl.1_Intron|TTLL4_uc010fvx.2_Intron|TTLL4_uc010zkm.1_Intron	NM_014640	NP_055455	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4						protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity			ovary(2)|skin(1)	3		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		AACAGCttttcttttttttttt	0.233													15	7	---	---	---	---	
IQCA1	79781	broad.mit.edu	37	2	237349775	237349775	+	Intron	DEL	A	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237349775delA	uc002vvz.1	-						IQCA1_uc002vwb.2_Intron|IQCA1_uc002vwa.1_Intron|IQCA1_uc010zni.1_Intron	NM_024726	NP_079002	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1								ATP binding			ovary(1)	1						TTTCTGCAGGAAAAAAAATAG	0.358													4	2	---	---	---	---	
ADCY5	111	broad.mit.edu	37	3	123066917	123066918	+	Intron	DEL	CA	-	-	rs10551109		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123066917_123066918delCA	uc003egh.1	-						ADCY5_uc003egg.1_Intron|ADCY5_uc003egi.1_Intron	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5						activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		tgtgtctgtgcatgtgtgtgta	0.460													28	21	---	---	---	---	
KPNA4	3840	broad.mit.edu	37	3	160220151	160220152	+	Intron	INS	-	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160220151_160220152insT	uc003fdn.2	-							NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			TTTATAGAAGGttttttttttc	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	166465727	166465729	+	IGR	DEL	TTT	-	-	rs11328706		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166465727_166465729delTTT								BCHE (910474 upstream) : ZBBX (492352 downstream)																							tttacttttcttttttttttttt	0.020													5	4	---	---	---	---	
C4orf50	389197	broad.mit.edu	37	4	5981742	5981742	+	Intron	DEL	G	-	-	rs60012784	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5981742delG	uc003git.1	-							NM_207405	NP_997288	Q6ZRC1	CD050_HUMAN	hypothetical protein LOC389197											pancreas(2)|breast(1)	3						GTTTTTTGTTGTTTTTTTTTT	0.373													3	3	---	---	---	---	
KDR	3791	broad.mit.edu	37	4	55981759	55981760	+	Intron	INS	-	TG	TG	rs138075949	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55981759_55981760insTG	uc003has.2	-						KDR_uc003hat.1_Intron|KDR_uc011bzx.1_Intron	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor						angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	gtgtgtgtgtatgtgtgtgtgt	0.272			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			4	2	---	---	---	---	
ANXA3	306	broad.mit.edu	37	4	79475435	79475436	+	Intron	INS	-	T	T			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79475435_79475436insT	uc003hld.2	+						ANXA3_uc003hle.2_Intron|ANXA3_uc010ijk.2_Intron	NM_005139	NP_005130	P12429	ANXA3_HUMAN	annexin A3						defense response to bacterium|neutrophil degranulation|phagocytosis|positive regulation of angiogenesis|positive regulation of endothelial cell migration|positive regulation of sequence-specific DNA binding transcription factor activity	phagocytic vesicle membrane|plasma membrane|specific granule	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity				0						tgtttagcaaatgGGATACCCA	0.183													3	7	---	---	---	---	
UNC5C	8633	broad.mit.edu	37	4	96128052	96128053	+	Intron	DEL	TC	-	-	rs71583693		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96128052_96128053delTC	uc003htp.1	-						UNC5C_uc010ilc.1_Intron	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor						apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CTCCTGGAATTCTTTTTTTTTT	0.411													3	3	---	---	---	---	
KIAA1109	84162	broad.mit.edu	37	4	123208084	123208085	+	Intron	DEL	GT	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123208084_123208085delGT	uc003ieh.2	+						KIAA1109_uc003iel.1_Intron	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein						regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						ACCAAATCAAgtgtgtgtgtgt	0.203													4	2	---	---	---	---	
IL15	3600	broad.mit.edu	37	4	142648991	142648991	+	Intron	DEL	A	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142648991delA	uc003iis.2	+						IL15_uc003iit.2_Intron|IL15_uc010iol.2_Intron|IL15_uc003iiu.2_Intron	NM_000585	NP_000576	P40933	IL15_HUMAN	interleukin 15 preproprotein						cell-cell signaling|immune response|positive regulation of interleukin-17 production	endosome|extracellular space|Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	cytokine activity|cytokine receptor binding|signal transducer activity				0	all_hematologic(180;0.158)					atctcaaaataaaaaAAGAAT	0.114													0	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	179208072	179208072	+	IGR	DEL	A	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179208072delA								LOC285501 (296169 upstream) : None (None downstream)																							AAGGGCAGGCAACATGGGCAT	0.532													4	4	---	---	---	---	
PCDHGA8	9708	broad.mit.edu	37	5	140774072	140774072	+	Frame_Shift_Del	DEL	C	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140774072delC	uc003lkd.1	+	1	2590	c.1692delC	c.(1690-1692)TACfs	p.Y564fs	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Frame_Shift_Del_p.Y564fs	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	564	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGATCCTGTACCCCGCCCTCC	0.657													42	140	---	---	---	---	
PLG	5340	broad.mit.edu	37	6	161127638	161127639	+	Intron	INS	-	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161127638_161127639insA	uc003qtm.3	+							NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen						extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	AATTTACTCACAAATTTATTAA	0.376													18	98	---	---	---	---	
RAPGEF5	9771	broad.mit.edu	37	7	22330863	22330863	+	Intron	DEL	A	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22330863delA	uc003svg.2	-							NM_012294	NP_036426	Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5						nervous system development|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	nucleus	GTP-dependent protein binding|Rap guanyl-nucleotide exchange factor activity			ovary(1)	1						GATGAGACCTAAAAAAAAAAA	0.333													6	3	---	---	---	---	
STAG3L4	64940	broad.mit.edu	37	7	66772494	66772495	+	Intron	INS	-	T	T	rs113583073		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66772494_66772495insT	uc003tvt.3	+						STAG3L4_uc010laj.2_Intron	NM_022906	NP_075057	Q8TBR4	STG34_HUMAN	stromal antigen 3-like 4												0		Lung NSC(55;0.0839)|all_lung(88;0.181)				TGCTTGATTCCTTTTTTTTTTT	0.272													3	3	---	---	---	---	
SPDYE7P	441251	broad.mit.edu	37	7	72334758	72334758	+	RNA	DEL	G	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72334758delG	uc010lal.1	-	1		c.4898delC				NR_003666				Homo sapiens speedy homolog E7 (Xenopus laevis), pseudogene (SPDYE7P), non-coding RNA.												0						CCTGGCCCTCGGGTTCATGCA	0.542													101	144	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	96377119	96377130	+	IGR	DEL	CTTCCTTCCTTT	-	-	rs71956221		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96377119_96377130delCTTCCTTCCTTT								SHFM1 (37916 upstream) : DLX6AS (220698 downstream)																							tccttccttccttccttcctttcttccttcct	0.203													4	2	---	---	---	---	
ATG9B	285973	broad.mit.edu	37	7	150719924	150719924	+	Intron	DEL	A	-	-	rs5888425		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150719924delA	uc011kvc.1	-						ATG9B_uc003wig.3_Intron	NM_173681	NP_775952	Q674R7	ATG9B_HUMAN	ATG9 autophagy related 9 homolog B						autophagic vacuole assembly	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane				ovary(1)	1	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		actctgtcttaaaaaaaaaaa	0.104													4	3	---	---	---	---	
GOLGA7	51125	broad.mit.edu	37	8	41363690	41363691	+	Intron	INS	-	T	T	rs149330272	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41363690_41363691insT	uc003xnu.2	+						GOLGA7_uc003xnv.2_Intron|GOLGA7_uc003xnw.2_Intron	NM_016099	NP_057183	Q7Z5G4	GOGA7_HUMAN	golgi autoantigen, golgin subfamily a, 7							Golgi membrane				breast(1)	1	Ovarian(28;0.014)|Colorectal(14;0.0234)|Lung SC(25;0.211)	all_lung(54;0.000771)|Lung NSC(58;0.0031)|Hepatocellular(245;0.014)|Esophageal squamous(32;0.0559)	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00596)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)			TGTCTCCAACATTTTTTTTTAA	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	79039494	79039495	+	IGR	DEL	AC	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:79039494_79039495delAC								None (None upstream) : PKIA (388841 downstream)																							gactagaaatacacacacacac	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81872441	81872444	+	IGR	DEL	CTTC	-	-	rs72018488		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81872441_81872444delCTTC								ZNF704 (85425 upstream) : PAG1 (7604 downstream)																							tttcttccttcttccttccttcct	0.005													6	3	---	---	---	---	
TSTA3	7264	broad.mit.edu	37	8	144695506	144695507	+	Intron	INS	-	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144695506_144695507insC	uc003yza.2	-						TSTA3_uc003yzb.2_Intron	NM_003313	NP_003304	Q13630	FCL_HUMAN	tissue specific transplantation antigen P35B						'de novo' GDP-L-fucose biosynthetic process|leukocyte cell-cell adhesion		coenzyme binding|electron carrier activity|GDP-4-dehydro-D-rhamnose reductase activity|GDP-L-fucose synthase activity|isomerase activity			pancreas(1)	1	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		NADH(DB00157)	GAGCACCTCCACCCCAGCCCCC	0.599													29	17	---	---	---	---	
TMC1	117531	broad.mit.edu	37	9	75451136	75451137	+	3'UTR	INS	-	T	T	rs71495343		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75451136_75451137insT	uc004aiz.1	+	24					TMC1_uc004aja.1_RNA|TMC1_uc004ajb.1_RNA|TMC1_uc004ajc.1_3'UTR|TMC1_uc010mpa.1_3'UTR	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1						CATTTCGTGACTTTTTTTTTTT	0.356													4	2	---	---	---	---	
CERCAM	51148	broad.mit.edu	37	9	131187045	131187045	+	Intron	DEL	T	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131187045delT	uc004buz.3	+						CERCAM_uc004buy.1_Intron|CERCAM_uc010mxz.2_Intron|CERCAM_uc010mya.1_Intron	NM_016174	NP_057258	Q5T4B2	GT253_HUMAN	cerebral endothelial cell adhesion molecule 1						cellular component movement|leukocyte cell-cell adhesion|lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen|plasma membrane				pancreas(1)	1						TTTCTCTCTCTTTTTTTTTTT	0.075													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	19414308	19414311	+	IGR	DEL	TTCC	-	-	rs10450313	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19414308_19414311delTTCC								ARL5B (447368 upstream) : PLXDC2 (691061 downstream)																							ctttctttctttccttccttcctt	0.069													4	3	---	---	---	---	
COL17A1	1308	broad.mit.edu	37	10	105800349	105800360	+	Intron	DEL	TGGATGGATAGG	-	-	rs71993640		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105800349_105800360delTGGATGGATAGG	uc001kxr.2	-							NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen						cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		gatggatggatggatggataggtggatggatg	0.080													4	2	---	---	---	---	
C10orf46	143384	broad.mit.edu	37	10	120445457	120445457	+	3'UTR	DEL	T	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120445457delT	uc001lds.1	-	9					C10orf46_uc010qst.1_Intron	NM_153810	NP_722517	Q86Y37	CJ046_HUMAN	chromosome 10 open reading frame 46						ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding				0		Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0131)		AGCAGCAACGTTTTTTTTTTT	0.363													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	121312549	121312549	+	IGR	DEL	G	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121312549delG								RGS10 (10327 upstream) : TIAL1 (20429 downstream)																							aaaaaaaaaagaagaagaaga	0.000													4	2	---	---	---	---	
EPS8L2	64787	broad.mit.edu	37	11	725877	725878	+	Intron	INS	-	C	C	rs144060424	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:725877_725878insC	uc001lqt.2	+						EPS8L2_uc001lqu.2_Intron|EPS8L2_uc010qwk.1_Intron|EPS8L2_uc001lqv.2_Intron|EPS8L2_uc001lqw.2_Intron|EPS8L2_uc001lqx.2_Intron|EPS8L2_uc001lqy.2_Intron	NM_022772	NP_073609	Q9H6S3	ES8L2_HUMAN	epidermal growth factor receptor pathway							cytoplasm				pancreas(1)	1		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGGGTCGCAGCCCCCAGCTTC	0.752													4	4	---	---	---	---	
ABCC8	6833	broad.mit.edu	37	11	17452094	17452095	+	Intron	DEL	GT	-	-	rs72866869	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17452094_17452095delGT	uc001mnc.2	-							NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	ctcaacaCTGGTTTTTTTTTTT	0.243													4	2	---	---	---	---	
COPZ1	22818	broad.mit.edu	37	12	54744007	54744007	+	Intron	DEL	T	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54744007delT	uc001sfs.1	+						COPZ1_uc001sft.2_Intron|COPZ1_uc009znm.1_Intron|COPZ1_uc010sot.1_Intron	NM_016057	NP_057141	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol					0						AGTAACTCCCTTTTTTTTTTT	0.438													4	2	---	---	---	---	
CLIP1	6249	broad.mit.edu	37	12	122801516	122801517	+	Intron	INS	-	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122801516_122801517insA	uc001ucg.1	-						CLIP1_uc001uch.1_Intron|CLIP1_uc001uci.1_Intron|CLIP1_uc001ucj.1_Intron	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TAGTCACTCGCAAAAAAAAAAA	0.307													4	2	---	---	---	---	
VSX2	338917	broad.mit.edu	37	14	74711685	74711690	+	Intron	DEL	GAGAGA	-	-	rs72220162		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74711685_74711690delGAGAGA	uc001xpq.2	+							NM_182894	NP_878314	P58304	VSX2_HUMAN	visual system homeobox 2						multicellular organismal development|response to stimulus|visual perception	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00154)		gtgtgtgtgtgagagagagagagaga	0.165													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21914638	21914639	+	IGR	INS	-	CT	CT	rs112777882		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21914638_21914639insCT								NF1P1 (780013 upstream) : LOC646214 (17875 downstream)																							tcctccttctcctcttccttct	0.282													4	3	---	---	---	---	
SNRPN	6638	broad.mit.edu	37	15	25155968	25155968	+	Intron	DEL	A	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25155968delA	uc001ywp.1	+						SNRPN_uc001ywq.1_Intron|SNRPN_uc001ywr.1_Intron|SNRPN_uc001yws.1_Intron|SNRPN_uc001ywt.1_Intron	NM_022807	NP_073718	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N						RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding			ovary(1)	1		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		tattttatCCAAAATGTGTTT	0.224									Prader-Willi_syndrome				3	10	---	---	---	---	
SQRDL	58472	broad.mit.edu	37	15	45983397	45983397	+	3'UTR	DEL	G	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45983397delG	uc001zvt.2	+	11					SQRDL_uc001zvu.2_3'UTR|SQRDL_uc001zvv.2_3'UTR	NM_021199	NP_067022	Q9Y6N5	SQRD_HUMAN	sulfide dehydrogenase like precursor								oxidoreductase activity			ovary(1)	1		Lung NSC(122;0.000117)|all_lung(180;0.000737)|Melanoma(134;0.0417)		all cancers(107;5.89e-18)|GBM - Glioblastoma multiforme(94;1.21e-06)|COAD - Colon adenocarcinoma(120;0.17)|Colorectal(133;0.188)		GCAACCATGTGGGCTACTCAT	0.378													9	13	---	---	---	---	
TLN2	83660	broad.mit.edu	37	15	63047951	63047951	+	Intron	DEL	G	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63047951delG	uc002alb.3	+						TLN2_uc002alc.3_Intron|TLN2_uc002ald.2_5'Flank	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2						cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						GGCGGGGGAAGGGGAACAAGA	0.478													21	15	---	---	---	---	
RASGRF1	5923	broad.mit.edu	37	15	79284239	79284239	+	Intron	DEL	G	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79284239delG	uc002beq.2	-						RASGRF1_uc002bep.2_Intron|RASGRF1_uc010blm.1_Intron|RASGRF1_uc002ber.3_Intron|RASGRF1_uc010unh.1_Intron|RASGRF1_uc002beo.2_Intron	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine						activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						CGAATTGGGTGGGCGGGTGGA	0.602													11	12	---	---	---	---	
ABAT	18	broad.mit.edu	37	16	8861847	8861848	+	Intron	INS	-	A	A			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8861847_8861848insA	uc002czc.3	+						ABAT_uc002czd.3_Intron|ABAT_uc010buh.2_Intron|ABAT_uc010bui.2_Intron	NM_020686	NP_065737	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase precursor						behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	ATTTGTGACTTAAAAAAAAAAA	0.198													4	2	---	---	---	---	
KATNB1	10300	broad.mit.edu	37	16	57789713	57789713	+	Intron	DEL	C	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57789713delC	uc002eml.1	+							NM_005886	NP_005877	Q9BVA0	KTNB1_HUMAN	katanin p80 subunit B 1						cell division|mitosis|negative regulation of microtubule depolymerization|positive regulation of microtubule depolymerization|protein targeting	katanin complex|microtubule|spindle pole	microtubule binding|protein heterodimerization activity				0		all_neural(199;0.223)				gccacactgtcccccactgcc	0.318													22	11	---	---	---	---	
CNGB1	1258	broad.mit.edu	37	16	57935569	57935570	+	Intron	INS	-	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57935569_57935570insC	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						GCAAGGCCGGGCCCCACCCCAG	0.465													15	9	---	---	---	---	
PKD1L2	114780	broad.mit.edu	37	16	81183625	81183626	+	Intron	DEL	TT	-	-	rs35446881		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81183625_81183626delTT	uc002fgh.1	-						PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						TTGTTCACACtttttttttttt	0.238													4	2	---	---	---	---	
MYH1	4619	broad.mit.edu	37	17	10411186	10411186	+	Intron	DEL	G	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10411186delG	uc002gmo.2	-						uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult							muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						ATTAGACAGAGAAAATGAAGT	0.413													23	85	---	---	---	---	
ALDH3A2	224	broad.mit.edu	37	17	19576700	19576700	+	Intron	DEL	T	-	-	rs66737570		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19576700delT	uc002gwb.1	+						ALDH3A2_uc002gwa.1_Intron|ALDH3A2_uc010cqr.1_Intron|ALDH3A2_uc002gwc.1_Intron|ALDH3A2_uc002gwd.1_Intron	NM_000382	NP_000373	P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3A2 isoform 2						cellular aldehyde metabolic process|central nervous system development|epidermis development|lipid metabolic process|peripheral nervous system development	endoplasmic reticulum membrane|integral to membrane	3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase			ovary(2)	2	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)				NADH(DB00157)	tttatttttgttttttttttg	0.184													6	3	---	---	---	---	
TTYH2	94015	broad.mit.edu	37	17	72218928	72218928	+	Intron	DEL	T	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72218928delT	uc002jkc.2	+						TTYH2_uc010wqw.1_Intron	NM_032646	NP_116035	Q9BSA4	TTYH2_HUMAN	tweety 2 isoform 1							chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4						ATGTTGTCCCTTTTTTTTTTT	0.522													5	3	---	---	---	---	
RNF157	114804	broad.mit.edu	37	17	74160693	74160693	+	Intron	DEL	A	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74160693delA	uc002jqz.2	-						RNF157_uc002jra.2_Intron	NM_052916	NP_443148	Q96PX1	RN157_HUMAN	ring finger protein 157								zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.187)			TTCTTTGATTaaaaaaaaaaa	0.224													3	3	---	---	---	---	
CACNG8	59283	broad.mit.edu	37	19	54483335	54483336	+	Intron	INS	-	GC	GC	rs140673589	by1000genomes	TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54483335_54483336insGC	uc002qcs.1	+						MIR935_hsa-mir-935|MI0005757_5'Flank	NM_031895	NP_114101	Q8WXS5	CCG8_HUMAN	voltage-dependent calcium channel gamma-8						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic density|postsynaptic membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		tgtgtgtgtgtgtgtgcgcgcg	0.559													6	3	---	---	---	---	
E2F1	1869	broad.mit.edu	37	20	32267841	32267842	+	Intron	INS	-	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32267841_32267842insC	uc002wzu.3	-							NM_005225	NP_005216	Q01094	E2F1_HUMAN	E2F transcription factor 1						apoptosis|cell proliferation|G1 phase of mitotic cell cycle|G2 phase of mitotic cell cycle|mRNA stabilization|negative regulation of transcription involved in G1/S phase of mitotic cell cycle|positive regulation of fibroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle	mitochondrion|Rb-E2F complex	sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription factor binding				0						CTCCAGCCAGGCCTGCCACTCT	0.639													7	5	---	---	---	---	
PCIF1	63935	broad.mit.edu	37	20	44576331	44576331	+	Frame_Shift_Del	DEL	G	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44576331delG	uc002xqs.2	+	17	2366	c.2052delG	c.(2050-2052)TCGfs	p.S684fs	PCIF1_uc002xqt.2_3'UTR|PCIF1_uc002xqu.2_Frame_Shift_Del_p.S153fs	NM_022104	NP_071387	Q9H4Z3	PCIF1_HUMAN	phosphorylated CTD interacting factor 1	684	Poly-Ser.|Nuclear localization signal (Potential).					nucleus				skin(1)	1						CGTCCTCCTCGGAGGCCAAGG	0.672													17	59	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60308704	60308707	+	Intron	DEL	GGAA	-	-	rs72457653		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60308704_60308707delGGAA	uc002ybn.1	+						CDH4_uc002ybo.1_Intron|CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			ATGGATGAATGgaaggaaggaagg	0.309													4	4	---	---	---	---	
GAB4	128954	broad.mit.edu	37	22	17447383	17447383	+	Intron	DEL	G	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17447383delG	uc002zlw.2	-						GAB4_uc010gqs.1_3'UTR	NM_001037814	NP_001032903	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member											large_intestine(1)|ovary(1)	2		all_epithelial(15;0.112)|Lung NSC(13;0.248)				CACCTTGGCTGGGGGCTGCTG	0.547													1	6	---	---	---	---	
GGT5	2687	broad.mit.edu	37	22	24629351	24629351	+	Intron	DEL	C	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24629351delC	uc002zzo.3	-						GGT5_uc002zzp.3_Intron|GGT5_uc002zzr.3_Intron|GGT5_uc002zzq.3_Intron|GGT5_uc011ajm.1_Intron|GGT5_uc011ajn.1_Intron	NM_004121	NP_004112	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5 isoform b						glutathione biosynthetic process|hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	integral to membrane|plasma membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(2)|skin(1)	3						GGCTCCGTGTCCCCCCGTGCC	0.632													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49467098	49467099	+	IGR	INS	-	C	C			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49467098_49467099insC								FAM19A5 (319356 upstream) : C22orf34 (341077 downstream)																							cttccttccttcttccttcctc	0.074													4	2	---	---	---	---	
TRAPPC2	6399	broad.mit.edu	37	X	13734919	13734920	+	Intron	INS	-	TTTG	TTTG	rs142846606		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13734919_13734920insTTTG	uc010nek.1	-						TRAPPC2_uc010nej.1_5'Flank|TRAPPC2_uc010nel.1_Intron|TRAPPC2_uc010nem.1_Intron	NM_001011658	NP_001011658	Q6IBE5	Q6IBE5_HUMAN	trafficking protein particle complex 2 isoform						ER to Golgi vesicle-mediated transport	intracellular					0						TGCTTTTATACTTTGTTATTGT	0.282													3	5	---	---	---	---	
SCML2	10389	broad.mit.edu	37	X	18343207	18343207	+	Intron	DEL	A	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18343207delA	uc004cyl.2	-						SCML2_uc004cyk.3_Intron|SCML2_uc010nfd.1_Intron|SCML2_uc011miz.1_Intron	NM_006089	NP_006080	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2						anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(33;0.183)					CTCTTAAAAGAAAAAAAAAAA	0.269													18	8	---	---	---	---	
PORCN	64840	broad.mit.edu	37	X	48370108	48370108	+	Intron	DEL	G	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48370108delG	uc010nie.1	+						PORCN_uc004djq.1_Intron|PORCN_uc004djr.1_Intron|PORCN_uc004djs.1_Intron|PORCN_uc004djt.1_Intron|PORCN_uc011mlx.1_Intron|PORCN_uc004dju.1_Intron|PORCN_uc004djv.1_Intron|PORCN_uc004djw.1_Intron	NM_203475	NP_982301	Q9H237	PORCN_HUMAN	porcupine isoform D						Wnt receptor signaling pathway	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(2)|central_nervous_system(1)	3						GGGACAGGTTGGGCATGGGCT	0.552											OREG0019764	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	11	---	---	---	---	
CACNA1F	778	broad.mit.edu	37	X	49089819	49089819	+	5'UTR	DEL	C	-	-			TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49089819delC	uc004dnb.2	-	1					CACNA1F_uc010nip.2_5'UTR|CCDC22_uc011mna.1_5'Flank|CCDC22_uc004dnc.1_5'Flank|CCDC22_uc004dnd.1_5'Flank	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	CCCCTCTCTTCCCCCAGCTTT	0.572													63	70	---	---	---	---	
STAG2	10735	broad.mit.edu	37	X	123191971	123191971	+	Intron	DEL	T	-	-	rs6655781		TCGA-34-2600-01	TCGA-34-2600-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123191971delT	uc004etz.3	+						STAG2_uc004eua.2_Intron|STAG2_uc004eub.2_Intron|STAG2_uc004euc.2_Intron|STAG2_uc004eud.2_Intron|STAG2_uc004eue.2_Intron	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b						cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						ACTCCCCCAATTTTTTTTTTT	0.229													3	3	---	---	---	---	
