Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TMTC1	83857	broad.mit.edu	37	12	29665042	29665042	+	Silent	SNP	C	A	A			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29665042C>A	uc001rjb.2	-	17	2592	c.2118G>T	c.(2116-2118)GTG>GTT	p.V706V	TMTC1_uc001riz.2_Silent_p.V463V|TMTC1_uc001rja.2_Silent_p.V550V|TMTC1_uc001riy.2_Silent_p.V159V	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	814	TPR 9.					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GTTGCACAGCCACTCTATAGC	0.443													55	139	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	5761921	5761932	+	IGR	DEL	AAGAAGGGAGGG	-	-	rs770716	by1000genomes	TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5761921_5761932delAAGAAGGGAGGG								AJAP1 (918071 upstream) : NPHP4 (160938 downstream)																							gaaggaaggaaagaagggagggaggaaggaag	0.000													4	3	---	---	---	---	
MEAF6	64769	broad.mit.edu	37	1	37961291	37961321	+	Intron	DEL	AAAAAAACAAAAAACAAAAAAAAAAAAAAAC	-	-	rs61058093		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37961291_37961321delAAAAAAACAAAAAACAAAAAAAAAAAAAAAC	uc001cbg.1	-						MEAF6_uc001cbd.1_Intron|MEAF6_uc001cbe.1_Intron|MEAF6_uc009vvd.1_Intron|MEAF6_uc001cbf.1_Intron	NM_022756	NP_073593	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6						histone H2A acetylation|histone H3-K14 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|NuA4 histone acetyltransferase complex|nucleolus	protein binding				0						ctctcaaaaaaaaaaaacaaaaaacaaaaaaaaaaaaaaacaaaaaaaCCA	0.169													5	3	---	---	---	---	
YBX1	4904	broad.mit.edu	37	1	43162183	43162183	+	Intron	DEL	C	-	-	rs113762321		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43162183delC	uc001chs.2	+							NM_004559	NP_004550	P67809	YBOX1_HUMAN	nuclease sensitive element binding protein 1						CRD-mediated mRNA stabilization|negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|positive regulation of cell division|transcription from RNA polymerase II promoter	CRD-mediated mRNA stability complex|extracellular region|histone pre-mRNA 3'end processing complex|nucleoplasm|stress granule|U12-type spliceosomal complex	double-stranded DNA binding|protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			ovary(4)|upper_aerodigestive_tract(1)	5	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CGCAGTTGCGCCCCCCCCCCC	0.418													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	157951861	157951862	+	IGR	DEL	GG	-	-	rs60104291		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157951861_157951862delGG								CD5L (140227 upstream) : KIRREL (11201 downstream)																							GAGAGAGAGagggaggaaggaa	0.030													4	2	---	---	---	---	
GLT25D2	23127	broad.mit.edu	37	1	184006890	184006891	+	5'Flank	INS	-	GA	GA	rs145188965	by1000genomes	TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184006890_184006891insGA	uc001gqr.2	-						GLT25D2_uc010poj.1_5'Flank|GLT25D2_uc001gqs.2_5'Flank	NM_015101	NP_055916	Q8IYK4	GT252_HUMAN	glycosyltransferase 25 domain containing 2						lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity			ovary(1)|breast(1)	2						AGCCtgtgagtgtgtgtgtgtg	0.416													4	3	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	186115161	186115162	+	Intron	INS	-	A	A			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186115161_186115162insA	uc001grq.1	+						HMCN1_uc001grs.1_Intron	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GGTGGAATTAGAAAAAAAAAAA	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12293381	12293382	+	Intron	INS	-	TCCC	TCCC			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12293381_12293382insTCCC	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		ccttccctccttccttccttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	45224046	45224046	+	IGR	DEL	A	-	-	rs34239087		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45224046delA								SIX3 (51656 upstream) : SIX2 (8279 downstream)																							TTATTTGTTTAAAAAAAAAAA	0.224													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	71283122	71283123	+	IGR	INS	-	T	T	rs35074164		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71283122_71283123insT								OR7E91P (26064 upstream) : NAGK (12285 downstream)																							GGCACCACCCCCAGGAGTGGTG	0.530													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106219070	106219077	+	Intron	DEL	GGAAAGAA	-	-	rs10178590		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106219070_106219077delGGAAAGAA	uc002tdf.2	-											Homo sapiens hypothetical protein LOC285000, mRNA (cDNA clone IMAGE:3925223), partial cds.																		aaggaaagatggaaagaaggaaagaagg	0.000													2	4	---	---	---	---	
ITGA6	3655	broad.mit.edu	37	2	173368990	173368990	+	3'UTR	DEL	A	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173368990delA	uc002uhp.1	+	25					ITGA6_uc010zdy.1_3'UTR|ITGA6_uc002uho.1_3'UTR|ITGA6_uc010fqm.1_3'UTR	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a						blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			GCGGGGGCCTAAAAAAAAAAA	0.378													9	5	---	---	---	---	
ANKAR	150709	broad.mit.edu	37	2	190541860	190541861	+	Intron	DEL	TG	-	-	rs61285192		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190541860_190541861delTG	uc002uqw.1	+						ANKAR_uc002uqu.2_Intron|ANKAR_uc002uqv.1_Intron	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing							integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			tttttttttttggaacagagtc	0.129													4	2	---	---	---	---	
NOP58	51602	broad.mit.edu	37	2	203149026	203149027	+	Intron	INS	-	T	T			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203149026_203149027insT	uc002uzb.2	+						NOP58_uc010zhv.1_Intron	NM_015934	NP_057018	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein homolog						cell growth|rRNA processing|snRNP protein import into nucleus	box C/D snoRNP complex|Cajal body|cytoplasm|pre-snoRNP complex	protein binding|snoRNA binding				0						TCAGGAAAGTCttttttttttt	0.173													4	2	---	---	---	---	
COX17	10063	broad.mit.edu	37	3	119395963	119395976	+	Intron	DEL	AGGGCAGAGGCCGT	-	-	rs71156766		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119395963_119395976delAGGGCAGAGGCCGT	uc003ecz.1	-							NM_005694	NP_005685	Q14061	COX17_HUMAN	COX17 homolog, cytochrome c oxidase assembly						copper ion transport|generation of precursor metabolites and energy	mitochondrial intermembrane space	copper chaperone activity				0				GBM - Glioblastoma multiforme(114;0.227)		cagaaggcagagggcagaggccgtagggcagagg	0.318													5	6	---	---	---	---	
SLC12A8	84561	broad.mit.edu	37	3	124896475	124896476	+	Intron	INS	-	GGTAAAGCCTAT	GGTAAAGCCTAT	rs143015454	by1000genomes	TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124896475_124896476insGGTAAAGCCTAT	uc003ehv.3	-						SLC12A8_uc003ehw.3_Intron|SLC12A8_uc010hrz.1_Intron	NM_024628	NP_078904	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8						potassium ion transport	integral to membrane	symporter activity				0						CACCAATTGTAGGTAAAGCCTA	0.510													3	3	---	---	---	---	
RAB7A	7879	broad.mit.edu	37	3	128517664	128517665	+	Intron	INS	-	AA	AA	rs9881470		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128517664_128517665insAA	uc003eks.1	+						RAB7A_uc010hsv.1_Intron|RAB7A_uc003ekt.2_Intron	NM_004637	NP_004628	P51149	RAB7A_HUMAN	RAB7, member RAS oncogene family						endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)		tctctaaatttaaaaaaaaaaa	0.173													6	3	---	---	---	---	
NAALADL2	254827	broad.mit.edu	37	3	174940885	174940892	+	Intron	DEL	TGTGTGTG	-	-	rs145681884		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174940885_174940892delTGTGTGTG	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		atagttactctgtgtgtgtgtgtgtgtg	0.000													4	2	---	---	---	---	
GNB4	59345	broad.mit.edu	37	3	179119234	179119236	+	Intron	DEL	AAT	-	-	rs74384746		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179119234_179119236delAAT	uc003fjv.3	-						GNB4_uc003fju.3_Intron	NM_021629	NP_067642	Q9HAV0	GBB4_HUMAN	guanine nucleotide-binding protein, beta-4						cellular response to glucagon stimulus|energy reserve metabolic process	plasma membrane	signal transducer activity			skin(2)	2	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			TCAGttaaaaaataataataatt	0.271													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	28669444	28669445	+	IGR	INS	-	TTCC	TTCC	rs5006047		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28669444_28669445insTTCC								None (None upstream) : None (None downstream)																							ccttccttcctttccttccttc	0.114													3	3	---	---	---	---	
ISL1	3670	broad.mit.edu	37	5	50680238	50680238	+	Intron	DEL	A	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50680238delA	uc003jor.2	+						uc003joq.1_5'Flank	NM_002202	NP_002193	P61371	ISL1_HUMAN	islet-1						generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3		Lung NSC(810;0.000845)|Breast(144;0.0411)				GCAATGCTCTaaaaaaaaaaa	0.308													4	3	---	---	---	---	
RASGRF2	5924	broad.mit.edu	37	5	80404654	80404659	+	Intron	DEL	TGTGTG	-	-	rs143382125		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80404654_80404659delTGTGTG	uc003kha.1	+						RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TTACCTACTCtgtgtgtgtgtgtgtg	0.272													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	95170388	95170388	+	IGR	DEL	T	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95170388delT								GLRX (11811 upstream) : C5orf27 (17548 downstream)																							CATATGTTCCttttttttttt	0.174													4	3	---	---	---	---	
SNCAIP	9627	broad.mit.edu	37	5	121787399	121787400	+	Intron	INS	-	A	A			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121787399_121787400insA	uc003ksw.1	+						SNCAIP_uc011cwl.1_Intron|SNCAIP_uc003ksx.1_Intron|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|uc003ktb.1_Intron|SNCAIP_uc003ktc.1_Intron	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein						cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		GAATCCCCAGGAAAAAAAAAAA	0.376													5	5	---	---	---	---	
EXOC2	55770	broad.mit.edu	37	6	598219	598220	+	Intron	INS	-	CTGA	CTGA	rs138580349	by1000genomes	TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:598219_598220insCTGA	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		tggggtgagggctaagaggcac	0.050													4	3	---	---	---	---	
HLA-DQA1	3117	broad.mit.edu	37	6	32606598	32606598	+	Intron	DEL	T	-	-	rs34310302		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32606598delT	uc003obr.2	+						HLA-DQA1_uc003obs.2_Intron|HLA-DQA1_uc003obt.1_Intron	NM_002122	NP_002113	P01909	DQA1_HUMAN	major histocompatibility complex, class II, DQ						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0						gaagCACAGATTAATTATTTG	0.244													4	2	---	---	---	---	
PHF3	23469	broad.mit.edu	37	6	64419319	64419319	+	Intron	DEL	T	-	-	rs34108196		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64419319delT	uc003pep.1	+						PHF3_uc003pen.2_Intron|PHF3_uc011dxs.1_Intron	NM_015153	NP_055968	Q92576	PHF3_HUMAN	PHD finger protein 3						multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			CAGTACAGCATTTTTTTTTTT	0.368													5	3	---	---	---	---	
MAP3K7	6885	broad.mit.edu	37	6	91261583	91261583	+	Intron	DEL	A	-	-	rs35787813		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91261583delA	uc003pnz.1	-						MAP3K7_uc003poa.1_Intron|MAP3K7_uc003pob.1_Intron|MAP3K7_uc003poc.1_Intron	NM_145331	NP_663304	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|histone H3 acetylation|I-kappaB phosphorylation|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytosol|endosome membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)	6		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		AGTGATAAAGAACTAGATTTT	0.274													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65976419	65976420	+	IGR	INS	-	A	A			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65976419_65976420insA								NCRNA00174 (111024 upstream) : LOC493754 (17026 downstream)																							ccatctcgaacaaaaaaaaaaa	0.243													4	2	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	69065040	69065043	+	Intron	DEL	CTGT	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69065040_69065043delCTGT	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GCGCTCCGGGctgtctgtctgtct	0.588													9	5	---	---	---	---	
NKAIN3	286183	broad.mit.edu	37	8	63502435	63502448	+	Intron	DEL	TGTGTGTGTGTGTG	-	-	rs72423486		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63502435_63502448delTGTGTGTGTGTGTG	uc010lyq.1	+							NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				ATAGGTATATtgtgtgtgtgtgtgtgtgtgtgtg	0.248													9	4	---	---	---	---	
TOP1MT	116447	broad.mit.edu	37	8	144403663	144403666	+	Intron	DEL	CACG	-	-	rs72210604		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144403663_144403666delCACG	uc003yxz.2	-						TOP1MT_uc011lkd.1_Intron|TOP1MT_uc011lke.1_Intron|TOP1MT_uc010mfb.2_Intron|TOP1MT_uc011lkf.1_Intron|TOP1MT_uc010mfd.1_Intron	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor						DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	gcacgccacacacgcacgccacac	0.137													7	4	---	---	---	---	
DOCK8	81704	broad.mit.edu	37	9	400149	400151	+	Intron	DEL	CAT	-	-	rs138625763	by1000genomes	TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:400149_400151delCAT	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc010mgw.1_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ccacctccaccatcaccaccacc	0.000													4	2	---	---	---	---	
CNTNAP3	79937	broad.mit.edu	37	9	39287911	39287911	+	Intron	DEL	T	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39287911delT	uc004abi.2	-						CNTNAP3_uc004abj.2_Intron|CNTNAP3_uc011lqr.1_Intron|CNTNAP3_uc004abk.1_Intron|CNTNAP3_uc011lqs.1_Intron	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor						cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TTACCGATAATAAAAAAAAAA	0.378													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	47197749	47197752	+	IGR	DEL	TTCC	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:47197749_47197752delTTCC								KGFLP1 (449364 upstream) : None (None downstream)																							ttttttttttttccttccttcctt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69876385	69876386	+	IGR	INS	-	TCT	TCT			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69876385_69876386insTCT								LOC100133920 (211436 upstream) : FOXD4L5 (299323 downstream)																							TTCTTCTCTTCTCTTCTTGTTT	0.277													4	2	---	---	---	---	
TTC16	158248	broad.mit.edu	37	9	130485247	130485247	+	Intron	DEL	A	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130485247delA	uc004brq.1	+						PTRH1_uc011mah.1_Intron|TTC16_uc011mai.1_Intron|TTC16_uc004brr.1_Intron|TTC16_uc010mxn.1_Intron	NM_144965	NP_659402	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16								binding				0						aatccatctcaaaaaaaaaaa	0.239													5	3	---	---	---	---	
SNAPC4	6621	broad.mit.edu	37	9	139277995	139277997	+	In_Frame_Del	DEL	GCT	-	-	rs35266724		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139277995_139277997delGCT	uc004chh.2	-	15	1633_1635	c.1624_1626delAGC	c.(1624-1626)AGCdel	p.S542del		NM_003086	NP_003077	Q5SXM2	SNPC4_HUMAN	small nuclear RNA activating complex,	542					snRNA transcription from RNA polymerase II promoter|snRNA transcription from RNA polymerase III promoter	snRNA-activating protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CGTCCTCCTCgctgctgctgctg	0.473													8	4	---	---	---	---	
KIAA1462	57608	broad.mit.edu	37	10	30362631	30362632	+	Intron	INS	-	TTCCTTCC	TTCCTTCC			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30362631_30362632insTTCCTTCC	uc001iuz.2	-									Q9P266	K1462_HUMAN	RecName: Full=Uncharacterized protein KIAA1462;											ovary(4)	4						tccttccttccttccttctttc	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42392302	42392302	+	IGR	DEL	G	-	-	rs72505279		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42392302delG								None (None upstream) : LOC441666 (435013 downstream)																							aacatcgaatggaatcgaatg	0.000													6	5	---	---	---	---	
HERC4	26091	broad.mit.edu	37	10	69705574	69705578	+	Intron	DEL	AACAT	-	-	rs35496892		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69705574_69705578delAACAT	uc001jng.3	-						HERC4_uc009xpq.2_Intron|HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron	NM_022079	NP_071362	Q5GLZ8	HERC4_HUMAN	hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3						caaatcaaaaaacatacgacagata	0.000													3	3	---	---	---	---	
PPFIBP2	8495	broad.mit.edu	37	11	7661256	7661257	+	Intron	DEL	CC	-	-	rs66917736		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7661256_7661257delCC	uc001mfj.3	+						PPFIBP2_uc010rbb.1_Intron|PPFIBP2_uc001mfk.1_Intron|PPFIBP2_uc010rbc.1_Intron|PPFIBP2_uc010rbd.1_Intron|PPFIBP2_uc010rbe.1_Intron|PPFIBP2_uc001mfl.3_Intron|PPFIBP2_uc009yfj.1_Intron	NM_003621	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2						cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding			ovary(2)|breast(2)	4				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGTCCCACCTCCCCAGAGGCTC	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	59066192	59066193	+	IGR	INS	-	GGGAGGAAG	GGGAGGAAG	rs72425250		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59066192_59066193insGGGAGGAAG								MPEG1 (85698 upstream) : OR5AN1 (65739 downstream)																							aaagaaagaaagaaagaaagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127462186	127462187	+	IGR	INS	-	AGG	AGG	rs146290646	by1000genomes	TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127462186_127462187insAGG								KIRREL3 (588831 upstream) : ETS1 (866469 downstream)																							ggaaggaagaaagggagggaag	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	47144923	47144926	+	IGR	DEL	GAAG	-	-	rs35061598		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47144923_47144926delGAAG								SLC38A2 (378278 upstream) : SLC38A4 (13618 downstream)																							aggaaggaaagaaggaaggaagga	0.196													6	6	---	---	---	---	
LETMD1	25875	broad.mit.edu	37	12	51449474	51449476	+	Intron	DEL	CTG	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51449474_51449476delCTG	uc001rxm.2	+						LETMD1_uc010smz.1_Intron|LETMD1_uc010sna.1_Intron|LETMD1_uc001rxl.2_Intron|LETMD1_uc009zlv.2_Intron|LETMD1_uc001rxs.2_Intron|LETMD1_uc009zlw.2_Intron|LETMD1_uc001rxn.2_Intron|LETMD1_uc001rxo.2_Intron|LETMD1_uc001rxp.2_Intron|LETMD1_uc001rxq.2_Intron|LETMD1_uc001rxr.2_Intron|LETMD1_uc001rxt.2_Intron	NM_015416	NP_056231	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1 isoform 1							integral to membrane|mitochondrial outer membrane	protein binding			central_nervous_system(2)	2						aaaaaaaaaaCTGAAAAAGAAAA	0.197													4	2	---	---	---	---	
CUX2	23316	broad.mit.edu	37	12	111508198	111508213	+	Intron	DEL	TTCCTTCCTTCCTTCC	-	-	rs55667059		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111508198_111508213delTTCCTTCCTTCCTTCC	uc001tsa.1	+							NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						ccttccttctttccttccttccttccttccttcctt	0.042													1	5	---	---	---	---	
ZNF268	10795	broad.mit.edu	37	12	133779994	133779994	+	Frame_Shift_Del	DEL	C	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133779994delC	uc010tcf.1	+	6	2052	c.1722delC	c.(1720-1722)CACfs	p.H574fs	ZNF268_uc010tbv.1_Frame_Shift_Del_p.H413fs|ZNF268_uc010tbw.1_Frame_Shift_Del_p.H413fs|ZNF268_uc010tbx.1_Frame_Shift_Del_p.H434fs|ZNF268_uc010tby.1_Frame_Shift_Del_p.H413fs|ZNF268_uc010tbz.1_Frame_Shift_Del_p.H413fs|ZNF268_uc010tca.1_Frame_Shift_Del_p.H413fs|ZNF268_uc010tcb.1_Frame_Shift_Del_p.H434fs|ZNF268_uc010tcc.1_Frame_Shift_Del_p.H413fs|ZNF268_uc010tcd.1_Frame_Shift_Del_p.H413fs|ZNF268_uc010tce.1_Frame_Shift_Del_p.H413fs|ZNF268_uc010tcg.1_Frame_Shift_Del_p.H413fs|ZNF268_uc010tch.1_Frame_Shift_Del_p.H574fs	NM_003415	NP_003406	Q14587	ZN268_HUMAN	zinc finger protein 268 isoform a	574	C2H2-type 11.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		TTATTTCACACCAGAGAACTC	0.433													4	2	---	---	---	---	
STARD13	90627	broad.mit.edu	37	13	33751993	33751994	+	Intron	INS	-	G	G	rs60339663		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33751993_33751994insG	uc001uuw.2	-						STARD13_uc001uuu.2_Intron|STARD13_uc001uuv.2_Intron|STARD13_uc001uux.2_Intron|STARD13_uc010tec.1_Intron|STARD13_uc010abh.1_Intron	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		gaaggaaggaaggaaggaagga	0.000													4	3	---	---	---	---	
ABCC4	10257	broad.mit.edu	37	13	95848985	95848991	+	Intron	DEL	AGAAGGG	-	-	rs113892410		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95848985_95848991delAGAAGGG	uc001vmd.3	-						ABCC4_uc010afk.2_Intron|ABCC4_uc001vme.2_Intron|ABCC4_uc010tih.1_Intron|ABCC4_uc001vmf.2_Intron|ABCC4_uc010afl.1_Intron|ABCC4_uc010afm.1_Intron	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	gaaggaaggaagaagggagggagggaa	0.135													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	42526000	42526000	+	IGR	DEL	A	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42526000delA								LRFN5 (152250 upstream) : None (None downstream)																							tgaaggaaggaaggaaggaag	0.005													4	2	---	---	---	---	
CCNDBP1	23582	broad.mit.edu	37	15	43481303	43481304	+	Intron	INS	-	AAAA	AAAA			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43481303_43481304insAAAA	uc001zqv.2	+						CCNDBP1_uc001zqu.2_Intron|CCNDBP1_uc010bdc.2_Intron|CCNDBP1_uc010bdb.2_Intron|CCNDBP1_uc010udl.1_Intron|CCNDBP1_uc001zqw.2_Intron|CCNDBP1_uc001zqx.2_Intron|CCNDBP1_uc010bdd.2_Intron|CCNDBP1_uc001zqy.2_Intron	NM_012142	NP_036274	O95273	CCDB1_HUMAN	cyclin D-type binding-protein 1 isoform 1						cell cycle	cytoplasm|nucleus	protein binding			ovary(1)|kidney(1)	2		all_cancers(109;3.31e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.42e-07)		aaaaaaaaaagaaaaagaaaga	0.149													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	82620383	82620384	+	RNA	INS	-	ACCCAGG	ACCCAGG			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82620383_82620384insACCCAGG	uc010bls.1	+	1		c.476_477insACCCAGG								Homo sapiens mRNA for FLJ00317 protein.																		GCCTGCCCTGAACCCAGGACCC	0.663													4	4	---	---	---	---	
ZNF598	90850	broad.mit.edu	37	16	2049882	2049883	+	In_Frame_Ins	INS	-	TCC	TCC	rs141374045	by1000genomes	TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2049882_2049883insTCC	uc002cof.1	-	11	1682_1683	c.1667_1668insGGA	c.(1666-1668)GAC>GAGGAC	p.555_556insE	ZNF598_uc002coe.1_5'UTR	NM_178167	NP_835461	Q86UK7	ZN598_HUMAN	zinc finger protein 598	555_556						intracellular	zinc ion binding			lung(1)|breast(1)	2						CCGGGCCGCCGTCCTCCTCCTC	0.703													4	5	---	---	---	---	
SHISA9	729993	broad.mit.edu	37	16	13003716	13003717	+	Intron	INS	-	TTCCTTCT	TTCCTTCT	rs150070757	by1000genomes	TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13003716_13003717insTTCCTTCT	uc010uyy.1	+						SHISA9_uc002dcd.2_3'UTR	NM_001145204	NP_001138676	B4DS77	SHSA9_HUMAN	shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0						tccttccttccttccttccttc	0.020													5	4	---	---	---	---	
GGA2	23062	broad.mit.edu	37	16	23486511	23486511	+	Intron	DEL	T	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23486511delT	uc002dlq.2	-						GGA2_uc010bxo.1_Intron	NM_015044	NP_055859	Q9UJY4	GGA2_HUMAN	ADP-ribosylation factor binding protein 2						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|clathrin-coated vesicle|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.0386)		GTTATATGCCttttttttttt	0.179													6	3	---	---	---	---	
MYLK3	91807	broad.mit.edu	37	16	46792217	46792226	+	Intron	DEL	CTCTCTCTCT	-	-	rs72201706		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46792217_46792226delCTCTCTCTCT	uc010vge.1	-									Q32MK0	MYLK3_HUMAN	SubName: Full=cDNA FLJ50066, highly similar to Homo sapiens cardiac-MyBP-C associated Ca/CaM kinase (MLCK), mRNA;						cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			stomach(2)|skin(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	7		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				cacacacacactctctctctctctctctct	0.295													3	3	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7642926	7642926	+	Intron	DEL	T	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7642926delT	uc002giu.1	+						DNAH2_uc002git.2_Intron|DNAH2_uc010vuk.1_Intron	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TTTCTTCTTCTTTTTTTTTTT	0.413													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	41181654	41181657	+	IGR	DEL	GAAG	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41181654_41181657delGAAG								SYT4 (324039 upstream) : None (None downstream)																							ggaaaggaaagaaggaaggaagga	0.000													1	6	---	---	---	---	
SKA1	220134	broad.mit.edu	37	18	47918723	47918723	+	3'UTR	DEL	T	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47918723delT	uc002let.2	+	7					SKA1_uc002leu.2_3'UTR|SKA1_uc010xdl.1_3'UTR	NM_145060	NP_659497	Q96BD8	SKA1_HUMAN	spindle and KT associated 1						cell division|chromosome segregation|mitotic anaphase|mitotic prometaphase|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytosol|spindle microtubule	microtubule binding				0						ttttgtttccttttttttttt	0.095													4	2	---	---	---	---	
SERPINB5	5268	broad.mit.edu	37	18	61164733	61164733	+	Intron	DEL	A	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61164733delA	uc002liz.3	+							NM_002639	NP_002630	P36952	SPB5_HUMAN	serine (or cysteine) proteinase inhibitor, clade						cellular component movement|regulation of proteolysis	cytoplasm|extracellular space	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1						AACGTTTCTGAAAAAAAAAAA	0.413													4	2	---	---	---	---	
SLC25A41	284427	broad.mit.edu	37	19	6426272	6426277	+	3'UTR	DEL	CAGCCT	-	-	rs140041202		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6426272_6426277delCAGCCT	uc010dus.2	-	7					KHSRP_uc002mer.3_5'Flank|SLC25A41_uc010dut.2_3'UTR	NM_173637	NP_775908	Q8N5S1	S2541_HUMAN	solute carrier family 25, member 41						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0						CCCCCACCCCCAGCCTGCTTTTGCCA	0.626													2	4	---	---	---	---	
ARHGEF18	23370	broad.mit.edu	37	19	7511782	7511782	+	Intron	DEL	A	-	-	rs111788607		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7511782delA	uc002mgi.2	+						ARHGEF18_uc010xjm.1_Intron|ARHGEF18_uc002mgh.2_Intron|ARHGEF18_uc002mgj.1_5'Flank	NM_001130955	NP_001124427	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor 18						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		Renal(5;0.0902)				atgctgtctcaaaaaaaaaaa	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	20442507	20442507	+	IGR	DEL	T	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20442507delT								LOC284441 (72004 upstream) : ZNF826 (8571 downstream)																							GCAGCTCGtgttttttttttg	0.308													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	20990110	20990111	+	IGR	INS	-	G	G			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20990110_20990111insG								ZNF626 (145708 upstream) : ZNF85 (115969 downstream)																							ACAAATGTGAAAATGTGGCAAA	0.381													18	10	---	---	---	---	
ZFP30	22835	broad.mit.edu	37	19	38133953	38133954	+	Intron	INS	-	A	A	rs72477911		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38133953_38133954insA	uc002ogv.1	-						ZFP30_uc002ogw.1_Intron|ZFP30_uc002ogx.1_Intron|ZFP30_uc010xtt.1_Intron	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	zinc finger protein 30 homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			gactccgtctcaaaaaaaaaaa	0.124													5	5	---	---	---	---	
APOC2	344	broad.mit.edu	37	19	45452269	45452270	+	Intron	INS	-	CCT	CCT	rs10622462		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45452269_45452270insCCT	uc002pah.2	+							NM_000483	NP_000474	P02655	APOC2_HUMAN	apolipoprotein C-II precursor						cholesterol efflux|chylomicron remnant clearance|high-density lipoprotein particle clearance|lipid catabolic process|lipoprotein metabolic process|negative regulation of cholesterol transport|negative regulation of lipid metabolic process|negative regulation of receptor-mediated endocytosis|negative regulation of very-low-density lipoprotein particle clearance|phospholipid efflux|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of phospholipase activity|positive regulation of phospholipid catabolic process|positive regulation of triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	chylomicron|intermediate-density lipoprotein particle|low-density lipoprotein particle|spherical high-density lipoprotein particle|very-low-density lipoprotein particle	lipase inhibitor activity|lipid binding|lipoprotein lipase activator activity|phospholipase activator activity|phospholipase binding|protein homodimerization activity			kidney(1)	1	Lung NSC(12;0.00858)|all_lung(12;0.0197)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)		ggcccccagcccgtcctccctc	0.015													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	4008764	4008783	+	IGR	DEL	CTTCCTTCTTTCCTTCCTTC	-	-	rs71195879		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4008764_4008783delCTTCCTTCTTTCCTTCCTTC								RNF24 (12548 upstream) : SMOX (120667 downstream)																							GAATGGGTTTcttccttctttccttccttccttccttcct	0.236													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	60532402	60532403	+	IGR	DEL	AG	-	-	rs71195424		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60532402_60532403delAG								MIR1257 (3684 upstream) : TAF4 (17452 downstream)																							TCGGACAGACAGATAATGAAAT	0.054													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	61857900	61857923	+	IGR	DEL	TCCCTCCCACCCCTTTCCTCCTCC	-	-	rs28671604	by1000genomes	TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61857900_61857923delTCCCTCCCACCCCTTTCCTCCTCC								YTHDF1 (10362 upstream) : BIRC7 (9353 downstream)																							ttcctcctcttccctcccacccctttcctcctcctccctcccac	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	21052399	21052399	+	IGR	DEL	G	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21052399delG								POM121L4P (6390 upstream) : TMEM191A (3003 downstream)																							AGCTGCTGGTGGGGAGGTCTT	0.647													4	2	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36691447	36691448	+	Intron	INS	-	GT	GT	rs146428638	by1000genomes	TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36691447_36691448insGT	uc003apg.2	-							NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						AGAGGGCCACGgtgtgtgtgtg	0.554			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				5	4	---	---	---	---	
DHRSX	207063	broad.mit.edu	37	X	2232507	2232510	+	Intron	DEL	GGGA	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2232507_2232510delGGGA	uc004cqf.3	-							NM_145177	NP_660160	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				aggaaggaaggggagaaggaagga	0.000													1	6	---	---	---	---	
FLJ44635	392490	broad.mit.edu	37	X	71364555	71364560	+	Intron	DEL	CACACA	-	-	rs72199965		TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71364555_71364560delCACACA	uc004eal.1	+							NM_207422	NP_997305	Q56UQ5	TPT1L_HUMAN	hypothetical protein LOC392490											lung(1)	1	Renal(35;0.156)					GCCCATAATGcacacacacacacaca	0.325													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10028735	10028737	+	IGR	DEL	TTC	-	-			TCGA-34-5241-01	TCGA-34-5241-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10028735_10028737delTTC								TTTY22 (377881 upstream) : None (None downstream)																							TTTCTTCCTATTCTTCTTGGTTG	0.360													7	4	---	---	---	---	
