Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	Oncotatorv0393GAF20hg19Feb2011dbSNPbuild132UniProtRelease2011_6	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	context_orig	context65	gene_name	categ	categ_ignoring_null_categ
RRAS2	22800	broad.mit.edu	37	11	14316347	14316347	+	Silent	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:14316347G>A	uc010rco.1	-	c.276C>T	c.(274-276)GGC>GGT	p.G92G	RRAS2_uc009ygq.2_Silent_p.G9G|RRAS2_uc001mlf.3_Silent_p.G86G	NM_001102669	NP_001096139	P62070	RRAS2_HUMAN	related RAS viral (r-ras) oncogene homolog 2	86						endoplasmic reticulum|plasma membrane	GTP binding|GTPase activity|protein binding			breast(1)	1				Epithelial(150;0.203)										0.02439	-43.894023	7.602806	5	200	KEEP	---	---	---	---	capture		Silent	SNP	14316347	14316347	14157	11	G	A	A	A	483	38	RRAS2	1	1
RAG1	5896	broad.mit.edu	37	11	36597479	36597479	+	Silent	SNP	C	T	T			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:36597479C>T	uc001mwu.3	+	c.2625C>T	c.(2623-2625)TCC>TCT	p.S875S	RAG1_uc001mwt.2_Non-coding_Transcript	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	875					histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4	all_lung(20;0.226)	all_hematologic(20;0.107)				Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)			p.S875S(HS172.T-Tumor)	117				0.108696	17.431219	38.359812	15	123	KEEP	---	---	---	---	capture		Silent	SNP	36597479	36597479	13463	11	C	T	T	T	288	23	RAG1	1	1
OR5D14	219436	broad.mit.edu	37	11	55563607	55563608	+	Missense_Mutation	DNP	TG	AT	AT			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:55563607_55563608TG>AT	uc010rim.1	+	c.576_577TG>AT	c.(574-579)TCTGAT>TCATAT	p.D193Y		NM_001004735	NP_001004735	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D,	193	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3		all_epithelial(135;0.196)												0.083744	-0.424923	71.01482	34	372	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	55563607	55563608	11565	11	TG	AT	AT	AT	704	55	OR5D14	3	3
ALDH3B2	222	broad.mit.edu	37	11	67432828	67432828	+	Silent	SNP	G	T	T			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:67432828G>T	uc001omr.2	-	c.634C>A	c.(634-636)CGG>AGG	p.R212R	ALDH3B2_uc001oms.2_Silent_p.R212R|ALDH3B2_uc009ysa.1_Silent_p.R212R	NM_000695	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3B2	212					alcohol metabolic process|cellular aldehyde metabolic process|lipid metabolic process|oxidation-reduction process		3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase			lung(1)|kidney(1)	2					NADH(DB00157)									0.046875	-7.62411	6.375907	3	61	KEEP	---	---	---	---	capture		Silent	SNP	67432828	67432828	503	11	G	T	T	T	493	38	ALDH3B2	1	1
ALX1	8092	broad.mit.edu	37	12	85677431	85677431	+	Missense_Mutation	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:85677431G>A	uc001tae.3	+	c.308G>A	c.(307-309)CGA>CAA	p.R103Q		NM_006982	NP_008913	Q15699	ALX1_HUMAN	cartilage paired-class homeoprotein 1	103					brain development|cartilage condensation|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		sequence-specific DNA binding transcription factor activity|transcription activator activity|transcription corepressor activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(134;0.134)										0.106383	8.778116	23.242044	10	84	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	85677431	85677431	559	12	G	A	A	A	481	37	ALX1	1	1
KLHL1	57626	broad.mit.edu	37	13	70314633	70314633	+	Missense_Mutation	SNP	G	T	T			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:70314633G>T	uc001vip.2	-	c.1695C>A	c.(1693-1695)AGC>AGA	p.S565R	KLHL1_uc010thm.1_Missense_Mutation_p.S504R	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	565	Kelch 3.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)										0.079365	-1.212588	21.514118	10	116	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	70314633	70314633	8677	13	G	T	T	T	438	34	KLHL1	2	2
OR4K17	390436	broad.mit.edu	37	14	20586121	20586121	+	Missense_Mutation	SNP	C	T	T			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:20586121C>T	uc001vwo.1	+	c.556C>T	c.(556-558)CAC>TAC	p.H186Y		NM_001004715	NP_001004715	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K,	158	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)										0.103774	26.821697	76.534211	33	285	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20586121	20586121	11481	14	C	T	T	T	377	29	OR4K17	2	2
OR10G3	26533	broad.mit.edu	37	14	22038086	22038086	+	Missense_Mutation	SNP	C	G	G			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:22038086C>G	uc010tmb.1	-	c.790G>C	c.(790-792)GAA>CAA	p.E264Q		NM_001005465	NP_001005465	Q8NGC4	O10G3_HUMAN	olfactory receptor, family 10, subfamily G,	264	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|central_nervous_system(1)	2	all_cancers(95;0.000987)			GBM - Glioblastoma multiforme(265;0.0139)										0.026144	-28.441283	9.566304	4	149	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	22038086	22038086	11306	14	C	G	G	G	377	29	OR10G3	3	3
SERPINA6	866	broad.mit.edu	37	14	94780977	94780977	+	Silent	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:94780977G>A	uc001ycv.2	-	c.9C>T	c.(7-9)CTC>CTT	p.L3L	SERPINA6_uc010auv.2_Non-coding_Transcript	NM_001756	NP_001747	P08185	CBG_HUMAN	corticosteroid binding globulin precursor	3					regulation of proteolysis|transport	extracellular space	serine-type endopeptidase inhibitor activity|steroid binding			skin(2)|ovary(1)|central_nervous_system(1)	4		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)									0.077419	-4.405062	23.926568	12	143	KEEP	---	---	---	---	capture		Silent	SNP	94780977	94780977	14581	14	G	A	A	A	522	41	SERPINA6	2	2
MKL2	57496	broad.mit.edu	37	16	14340356	14340356	+	Silent	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:14340356G>A	uc010uza.1	+	c.1239G>A	c.(1237-1239)AAG>AAA	p.K413K	MKL2_uc002dcg.2_Silent_p.K413K|MKL2_uc002dcj.2_5'Flank	NM_014048	NP_054767	Q9ULH7	MKL2_HUMAN	megakaryoblastic leukemia 2 protein	402	SAP.				cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5														0.038462	-11.40266	6.514159	3	75	KEEP	---	---	---	---	capture		Silent	SNP	14340356	14340356	9992	16	G	A	A	A	464	36	MKL2	2	2
CHD9	80205	broad.mit.edu	37	16	53326814	53326814	+	Missense_Mutation	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:53326814G>A	uc002ehb.2	+	c.5360G>A	c.(5359-5361)CGT>CAT	p.R1787H	CHD9_uc002egy.2_Missense_Mutation_p.R1787H|CHD9_uc002ehc.2_Missense_Mutation_p.R1787H|CHD9_uc002ehf.2_Missense_Mutation_p.R901H|CHD9_uc010cbw.2_Missense_Mutation_p.R155H	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1787					cellular lipid metabolic process|chromatin assembly or disassembly|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin|cytoplasm|nucleoplasm	ATP binding|chromatin binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)								1157				0.156627	44.639903	63.323537	26	140	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	53326814	53326814	3466	16	G	A	A	A	520	40	CHD9	1	1
TAOK1	57551	broad.mit.edu	37	17	27829672	27829672	+	Silent	SNP	C	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:27829672C>A	uc002hdz.1	+	c.1269C>A	c.(1267-1269)CCC>CCA	p.P423P	TAOK1_uc010wbe.1_Silent_p.P423P|TAOK1_uc010wbf.1_Silent_p.P423P|TAOK1_uc002heb.1_Silent_p.P249P	NM_020791	NP_065842	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	423					mitotic prometaphase|protein phosphorylation	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)							290				0.045045	-15.497561	9.045429	5	106	KEEP	---	---	---	---	capture		Silent	SNP	27829672	27829672	16068	17	C	A	A	A	275	22	TAOK1	2	2
ITGAE	3682	broad.mit.edu	37	17	3638115	3638115	+	Missense_Mutation	SNP	T	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:3638115T>A	uc002fwo.3	-	c.2651A>T	c.(2650-2652)CAA>CTA	p.Q884L		NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor	884	Extracellular (Potential).				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		NSCLC(182;635 2928 8995 38788)				37				0.1	17.021021	60.193623	27	243	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	3638115	3638115	8189	17	T	A	A	A	819	63	ITGAE	3	3
BCAS3	54828	broad.mit.edu	37	17	59024579	59024579	+	Splice_Site_SNP	SNP	G	T	T			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:59024579G>T	uc002iyv.3	+	c.1088_splice	c.e14-1	p.G363_splice	BCAS3_uc010wow.1_Splice_Site_SNP_p.G150_splice|BCAS3_uc002iyu.3_Splice_Site_SNP_p.G363_splice|BCAS3_uc002iyw.3_Splice_Site_SNP_p.G359_splice|BCAS3_uc002iyx.1_Splice_Site_SNP_p.G178_splice|BCAS3_uc002iyy.3_Splice_Site_SNP_p.G134_splice	NM_001099432	NP_001092902			breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)	4			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)											0.087591	5.477875	52.635911	24	250	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	59024579	59024579	1373	17	G	T	T	T	455	35	BCAS3	5	2
POLR2A	5430	broad.mit.edu	37	17	7416688	7416688	+	Missense_Mutation	SNP	C	T	T			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:7416688C>T	uc002ghf.3	+	c.5105C>T	c.(5104-5106)ACA>ATA	p.T1702I		NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A	1702	16.|52 X 7 AA approximate tandem repeats of Y-[ST]-P-[STQ]-[ST]-P-[SRTEVKGN].				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)												0.208333	10.863383	12.753111	5	19	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	7416688	7416688	12642	17	C	T	T	T	221	17	POLR2A	2	2
MC5R	4161	broad.mit.edu	37	18	13826014	13826014	+	Silent	SNP	C	T	T			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:13826014C>T	uc010xaf.1	+	c.250C>T	c.(250-252)CTG>TTG	p.L84L		NM_005913	NP_005904	P33032	MC5R_HUMAN	melanocortin 5 receptor	84	Helical; Name=2; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding			ovary(3)	3														0.053571	-4.924958	6.854259	3	53	KEEP	---	---	---	---	capture		Silent	SNP	13826014	13826014	9756	18	C	T	T	T	363	28	MC5R	2	2
ALKBH6	84964	broad.mit.edu	37	19	36501809	36501809	+	Missense_Mutation	SNP	C	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:36501809C>A	uc002ocv.1	-	c.407G>T	c.(406-408)GGG>GTG	p.G136V	C19orf46_uc002ocr.1_5'Flank|C19orf46_uc002ocs.1_5'Flank|C19orf46_uc002ocq.1_5'Flank|C19orf46_uc010een.1_5'Flank|ALKBH6_uc002oct.2_Missense_Mutation_p.G108V|ALKBH6_uc002ocx.1_Missense_Mutation_p.G39V|ALKBH6_uc002ocw.1_Missense_Mutation_p.G136V|ALKBH6_uc010eeo.1_Missense_Mutation_p.G108V|ALKBH6_uc010eep.1_Missense_Mutation_p.G136V	NM_032878	NP_116267	Q3KRA9	ALKB6_HUMAN	alkB, alkylation repair homolog 6 isoform 2	108	Fe2OG dioxygenase.				oxidation-reduction process	cytoplasm|nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0	all_lung(56;1.35e-06)|Lung NSC(56;2.15e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)											0.060241	-6.255154	10.488426	5	78	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	36501809	36501809	534	19	C	A	A	A	286	22	ALKBH6	2	2
U2AF2	11338	broad.mit.edu	37	19	56173908	56173908	+	Missense_Mutation	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:56173908G>A	uc002qlu.2	+	c.527G>A	c.(526-528)GGG>GAG	p.G176E	U2AF2_uc002qlt.2_Missense_Mutation_p.G176E	NM_007279	NP_009210	P26368	U2AF2_HUMAN	U2 (RNU2) small nuclear RNA auxiliary factor 2	176	RRM 1.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm|spliceosomal complex	enzyme binding|nucleotide binding|RNA binding			ovary(1)	1		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)										0.047059	-10.726703	7.812376	4	81	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	56173908	56173908	17380	19	G	A	A	A	559	43	U2AF2	2	2
LRRC8E	80131	broad.mit.edu	37	19	7963978	7963978	+	Missense_Mutation	SNP	G	T	T			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:7963978G>T	uc002mir.2	+	c.571G>T	c.(571-573)GCA>TCA	p.A191S		NM_025061	NP_079337	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member	191						integral to membrane				lung(1)|pancreas(1)	2														0.078947	-0.406863	6.476004	3	35	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	7963978	7963978	9401	19	G	T	T	T	546	42	LRRC8E	2	2
CD34	947	broad.mit.edu	37	1	208073342	208073342	+	Missense_Mutation	SNP	C	T	T			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:208073342C>T	uc001hgw.1	-	c.86G>A	c.(85-87)GGG>GAG	p.G29E	CD34_uc001hgx.1_Missense_Mutation_p.G29E|CD34_uc010psj.1_5'UTR	NM_001025109	NP_001020280	P28906	CD34_HUMAN	CD34 antigen isoform a	29					cell-cell adhesion|leukocyte migration|regulation of immune response	external side of plasma membrane|integral to membrane	carbohydrate binding			ovary(1)	1														0.153846	18.005585	25.4544	10	55	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	208073342	208073342	3134	1	C	T	T	T	286	22	CD34	2	2
HSPG2	3339	broad.mit.edu	37	1	22183533	22183533	+	Missense_Mutation	SNP	C	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:22183533C>A	uc009vqd.2	-	c.5553G>T	c.(5551-5553)CAG>CAT	p.Q1851H	HSPG2_uc001bfj.2_Missense_Mutation_p.Q1850H	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	1850	Ig-like C2-type 3.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)	8		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)									0.057143	-7.738434	6.671482	4	66	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	22183533	22183533	7730	1	C	A	A	A	311	24	HSPG2	2	2
CSMD2	114784	broad.mit.edu	37	1	34071024	34071024	+	Silent	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:34071024G>A	uc001bxm.1	-	c.6390C>T	c.(6388-6390)GGC>GGT	p.G2130G	CSMD2_uc001bxn.1_Silent_p.G2132G|CSMD2_uc001bxo.1_Silent_p.G1003G	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2132	Sushi 12.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(5)|pancreas(1)	6		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)												0.098901	5.017276	19.651062	9	82	KEEP	---	---	---	---	capture		Silent	SNP	34071024	34071024	4086	1	G	A	A	A	587	46	CSMD2	2	2
NINL	22981	broad.mit.edu	37	20	25485627	25485627	+	Missense_Mutation	SNP	C	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:25485627C>A	uc002wux.1	-	c.605G>T	c.(604-606)CGG>CTG	p.R202L	NINL_uc010gdn.1_Missense_Mutation_p.R202L|NINL_uc010gdo.1_Missense_Mutation_p.R42L|NINL_uc010ztf.1_Missense_Mutation_p.R218L	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like	202	EF-hand 3.				G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4														0.06	-3.213637	6.905275	3	47	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	25485627	25485627	10821	20	C	A	A	A	299	23	NINL	1	1
BPI	671	broad.mit.edu	37	20	36954764	36954764	+	Missense_Mutation	SNP	C	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:36954764C>A	uc002xib.2	+	c.1103C>A	c.(1102-1104)CCT>CAT	p.P368H		NM_001725	NP_001716	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	368					defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding			ovary(4)	4		Myeloproliferative disorder(115;0.00878)												0.06	-3.819028	6.305919	3	47	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	36954764	36954764	1518	20	C	A	A	A	312	24	BPI	2	2
HIRA	7290	broad.mit.edu	37	22	19398295	19398295	+	Missense_Mutation	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:19398295G>A	uc002zpf.1	-	c.44C>T	c.(43-45)CCG>CTG	p.P15L	HIRA_uc011agx.1_5'UTR|HIRA_uc010grn.1_Missense_Mutation_p.P15L|HIRA_uc010gro.1_5'UTR|HIRA_uc010grp.2_Non-coding_Transcript	NM_003325	NP_003316	P54198	HIRA_HUMAN	HIR histone cell cycle regulation defective	15	WD 1.				chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulator activity			ovary(1)	1	Colorectal(54;0.0993)													0.103976	32.80116	83.843183	34	293	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	19398295	19398295	7405	22	G	A	A	A	507	39	HIRA	1	1
BPIL2	254240	broad.mit.edu	37	22	32833811	32833811	+	Missense_Mutation	SNP	A	T	T			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:32833811A>T	uc003amn.2	-	c.683T>A	c.(682-684)CTG>CAG	p.L228Q	BPIL2_uc010gwo.2_Missense_Mutation_p.L42Q|BPIL2_uc011amb.1_5'UTR	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing	228						extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)	1														0.091954	4.633405	19.220278	8	79	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32833811	32833811	1520	22	A	T	T	T	91	7	BPIL2	3	3
TTN	7273	broad.mit.edu	37	2	179440815	179440815	+	Silent	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:179440815G>A	uc010zfg.1	-	c.62340C>T	c.(62338-62340)GCC>GCT	p.A20780A	TTN_uc010zfh.1_Silent_p.A14475A|TTN_uc010zfi.1_Silent_p.A14408A|TTN_uc010zfj.1_Silent_p.A14283A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1559										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)						p.A20780A(JHUEM2-Tumor)	8722				0.087719	6.496793	35.90113	15	156	KEEP	---	---	---	---	capture		Silent	SNP	179440815	179440815	17290	2	G	A	A	A	496	39	TTN	1	1
PMS1	5378	broad.mit.edu	37	2	190742066	190742066	+	Missense_Mutation	SNP	C	G	G			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:190742066C>G	uc002urh.3	+	c.2703C>G	c.(2701-2703)ATC>ATG	p.I901M	PMS1_uc002urk.3_Missense_Mutation_p.I862M|PMS1_uc002uri.3_Missense_Mutation_p.I739M|PMS1_uc010zgc.1_Missense_Mutation_p.I725M|PMS1_uc010zgd.1_Missense_Mutation_p.I725M|PMS1_uc002urj.2_Non-coding_Transcript|PMS1_uc010frz.2_Missense_Mutation_p.I217M|PMS1_uc002url.2_Missense_Mutation_p.I524M|PMS1_uc002urm.2_Non-coding_Transcript	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a	901					mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)							236				0.09375	10.994699	32.237006	12	116	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	190742066	190742066	12568	2	C	G	G	G	408	32	PMS1	3	3
RASA2	5922	broad.mit.edu	37	3	141295935	141295935	+	Missense_Mutation	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:141295935G>A	uc010huq.1	+	c.1577G>A	c.(1576-1578)CGA>CAA	p.R526Q	RASA2_uc003etz.1_Missense_Mutation_p.R526Q|RASA2_uc003eua.1_Missense_Mutation_p.R526Q|RASA2_uc011bnc.1_Missense_Mutation_p.R118Q	NM_006506	NP_006497	Q15283	RASA2_HUMAN	RAS p21 protein activator 2	526	Ras-GAP.				intracellular signal transduction|negative regulation of Ras protein signal transduction	intracellular membrane-bounded organelle|intrinsic to internal side of plasma membrane|perinuclear region of cytoplasm	metal ion binding|Ras GTPase activator activity			ovary(2)|lung(1)	3														0.093333	11.294666	48.722485	21	204	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	141295935	141295935	13521	3	G	A	A	A	481	37	RASA2	1	1
SLC9A9	285195	broad.mit.edu	37	3	143550932	143550932	+	Nonsense_Mutation	SNP	C	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:143550932C>A	uc003evn.2	-	c.307G>T	c.(307-309)GAA>TAA	p.E103*	SLC9A9_uc011bnk.1_Intron	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen	103					regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)	2														0.10559	15.649532	40.542142	17	144	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	143550932	143550932	15218	3	C	A	A	A	377	29	SLC9A9	5	2
CDC23	8697	broad.mit.edu	37	5	137527959	137527959	+	Nonsense_Mutation	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:137527959G>A	uc003lcl.2	-	c.1285C>T	c.(1285-1287)CGA>TGA	p.R429*		NM_004661	NP_004652	Q9UJX2	CDC23_HUMAN	cell division cycle protein 23	429	TPR 7.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1 phase of mitotic cell cycle|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase plate congression|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of exit from mitosis	anaphase-promoting complex|cytosol|nucleoplasm	binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)											0.156522	32.086092	45.027438	18	97	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	137527959	137527959	3189	5	G	A	A	A	480	37	CDC23	5	1
PCDH1	5097	broad.mit.edu	37	5	141233671	141233671	+	Missense_Mutation	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:141233671G>A	uc003llp.2	-	c.3650C>T	c.(3649-3651)TCG>TTG	p.S1217L		NM_032420	NP_115796	Q08174	PCDH1_HUMAN	protocadherin 1 isoform 2 precursor	Error:Variant_position_missing_in_Q08174_after_alignment					cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding			ovary(5)	5		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		Ovarian(132;1609 1739 4190 14731 45037)								0.222222	8.689461	9.968163	4	14	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	141233671	141233671	11926	5	G	A	A	A	481	37	PCDH1	1	1
CDKAL1	54901	broad.mit.edu	37	6	20758841	20758841	+	Missense_Mutation	SNP	C	T	T			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:20758841C>T	uc003ndc.1	+	c.484C>T	c.(484-486)CGT>TGT	p.R162C	CDKAL1_uc003ndd.1_Missense_Mutation_p.R162C|CDKAL1_uc003nde.1_Missense_Mutation_p.R92C	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein	162	MTTase N-terminal.				RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|catalytic activity|metal ion binding			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)											0.09589	3.867705	15.828122	7	66	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20758841	20758841	3281	6	C	T	T	T	403	31	CDKAL1	1	1
SLC17A1	6568	broad.mit.edu	37	6	25813423	25813423	+	Missense_Mutation	SNP	A	G	G			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:25813423A>G	uc003nfh.3	-	c.635T>C	c.(634-636)GTA>GCA	p.V212A	SLC17A1_uc011djy.1_Intron|SLC17A1_uc010jqb.1_Missense_Mutation_p.V210A|SLC17A1_uc010jqc.1_Missense_Mutation_p.V210A	NM_005074	NP_005065	Q14916	NPT1_HUMAN	solute carrier family 17 (sodium phosphate),	212	Helical; (Potential).				sodium ion transport|urate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(3)|pancreas(1)	4														0.111111	8.445185	15.169671	5	40	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	25813423	25813423	14912	6	A	G	G	G	182	14	SLC17A1	4	4
PHF1	5252	broad.mit.edu	37	6	33380553	33380553	+	Missense_Mutation	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:33380553G>A	uc003oeh.2	+	c.320G>A	c.(319-321)TGT>TAT	p.C107Y	PHF1_uc011drh.1_Non-coding_Transcript|PHF1_uc003oei.2_Missense_Mutation_p.C107Y|PHF1_uc010jux.2_Intron	NM_024165	NP_077084	O43189	PHF1_HUMAN	PHD finger protein 1 isoform b	107	PHD-type 1.				chromatin modification|regulation of transcription, DNA-dependent	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(999;0.0443)												0.063636	-8.337167	13.438503	7	103	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	33380553	33380553	12243	6	G	A	A	A	624	48	PHF1	2	2
LAMB4	22798	broad.mit.edu	37	7	107720171	107720171	+	Missense_Mutation	SNP	C	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:107720171C>A	uc010ljo.1	-	c.1762G>T	c.(1762-1764)GGG>TGG	p.G588W	LAMB4_uc003vey.2_Missense_Mutation_p.G588W	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	588	Laminin IV type B.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)	7														0.056604	-4.619059	6.327908	3	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	107720171	107720171	8936	7	C	A	A	A	273	21	LAMB4	2	2
TMEM106B	54664	broad.mit.edu	37	7	12270022	12270022	+	Missense_Mutation	SNP	A	G	G			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:12270022A>G	uc011jxk.1	+	c.590A>G	c.(589-591)TAC>TGC	p.Y197C	TMEM106B_uc003ssh.2_Missense_Mutation_p.Y197C	NM_018374	NP_060844	Q9NUM4	T106B_HUMAN	transmembrane protein 106B	197				Y -> N (in Ref. 2; BAD96983).		integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (126;0.185)										0.065574	-8.452545	15.75307	8	114	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	12270022	12270022	16551	7	A	G	G	G	182	14	TMEM106B	4	4
ZNF425	155054	broad.mit.edu	37	7	148800831	148800831	+	Missense_Mutation	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:148800831G>A	uc003wfj.2	-	c.2132C>T	c.(2131-2133)GCC>GTC	p.A711V		NM_001001661	NP_001001661	Q6IV72	ZN425_HUMAN	zinc finger protein 425	711	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)											0.196581	49.949996	59.917328	23	94	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	148800831	148800831	18492	7	G	A	A	A	546	42	ZNF425	2	2
EGFR	1956	broad.mit.edu	37	7	55210075	55210075	+	Missense_Mutation	SNP	T	G	G			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:55210075T>G	uc003tqk.2	+	c.185T>G	c.(184-186)CTT>CGT	p.L62R	EGFR_uc003tqh.2_Missense_Mutation_p.L62R|EGFR_uc003tqi.2_Missense_Mutation_p.L62R|EGFR_uc003tqj.2_Missense_Mutation_p.L62R|EGFR_uc010kzg.1_Missense_Mutation_p.L62R|EGFR_uc011kco.1_Missense_Mutation_p.L9R	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	62	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.L62R(1)		lung(8200)|central_nervous_system(103)|upper_aerodigestive_tract(37)|prostate(32)|ovary(31)|thyroid(23)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|stomach(6)|urinary_tract(6)|skin(5)|adrenal_gland(5)|kidney(4)|soft_tissue(4)|bone(3)|NS(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)|pancreas(1)	8515	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)			8		608	TCGA GBM(3;<1E-8)|TSP Lung(4;<1E-8)			0.152838	62.752722	89.200605	35	194	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55210075	55210075	5156	7	T	G	G	G	728	56	EGFR	4	4
EGFR	1956	broad.mit.edu	37	7	55259515	55259515	+	Missense_Mutation	SNP	T	G	G	rs121434568		TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:55259515T>G	uc003tqk.2	+	c.2573T>G	c.(2572-2574)CTG>CGG	p.L858R	EGFR_uc010kzg.1_Missense_Mutation_p.L813R|EGFR_uc011kco.1_Missense_Mutation_p.L805R	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	858	Cytoplasmic (Potential).|Protein kinase.		L -> R (found in a lung cancer sample; somatic mutation).|L -> M (found in a lung cancer sample).		activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.L858R(3084)|p.L858Q(3)|p.L858A(2)|p.L858W(1)|p.L858P(1)|p.L858L(1)|p.L858K(1)|p.L858G(1)|p.H805I(1)		lung(8200)|central_nervous_system(103)|upper_aerodigestive_tract(37)|prostate(32)|ovary(31)|thyroid(23)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|stomach(6)|urinary_tract(6)|skin(5)|adrenal_gland(5)|kidney(4)|soft_tissue(4)|bone(3)|NS(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)|pancreas(1)	8515	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)		L858R(NCIH1975_LUNG)	8		608	TCGA GBM(3;<1E-8)|TSP Lung(4;<1E-8)			0.121739	21.869785	37.986117	14	101	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55259515	55259515	5156	7	T	G	G	G	715	55	EGFR	4	4
DCAF4L2	138009	broad.mit.edu	37	8	88885731	88885731	+	Missense_Mutation	SNP	C	T	T			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:88885731C>T	uc003ydz.2	-	c.469G>A	c.(469-471)GTG>ATG	p.V157M		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	157										ovary(1)	1														0.060345	-9.750649	13.673583	7	109	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	88885731	88885731	4443	8	C	T	T	T	247	19	DCAF4L2	1	1
KIAA1797	54914	broad.mit.edu	37	9	20986383	20986383	+	Missense_Mutation	SNP	C	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:20986383C>A	uc003zog.1	+	c.4825C>A	c.(4825-4827)CAG>AAG	p.Q1609K	KIAA1797_uc003zoh.1_Missense_Mutation_p.Q1045K	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	1609						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)										0.051724	-5.924238	6.407082	3	55	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20986383	20986383	8569	9	C	A	A	A	325	25	KIAA1797	2	2
G6PD	2539	broad.mit.edu	37	X	153764207	153764207	+	Missense_Mutation	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:153764207G>A	uc004flx.1	-	c.302C>T	c.(301-303)GCC>GTC	p.A101V	G6PD_uc004fly.1_Missense_Mutation_p.A71V	NM_000402	NP_000393	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase isoform a	71					cellular response to oxidative stress|cholesterol biosynthetic process|cytokine production|erythrocyte maturation|glucose 6-phosphate metabolic process|glutathione metabolic process|negative regulation of protein glutathionylation|pentose-phosphate shunt, oxidative branch|ribose phosphate biosynthetic process	centrosome|cytosol|internal side of plasma membrane|intracellular membrane-bounded organelle	glucose binding|glucose-6-phosphate dehydrogenase activity|NADP binding|protein homodimerization activity			ovary(4)	4	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)													0.066667	-3.848204	7.832061	4	56	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	153764207	153764207	6397	23	G	A	A	A	546	42	G6PD	2	2
DMD	1756	broad.mit.edu	37	X	31496381	31496381	+	Nonsense_Mutation	SNP	T	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:31496381T>A	uc004dda.1	-	c.8779A>T	c.(8779-8781)AGA>TGA	p.R2927*	DMD_uc004dcq.1_Nonsense_Mutation_p.R198*|DMD_uc004dcr.1_Nonsense_Mutation_p.R467*|DMD_uc004dcs.1_Nonsense_Mutation_p.R467*|DMD_uc004dct.1_Nonsense_Mutation_p.R467*|DMD_uc004dcu.1_Nonsense_Mutation_p.R467*|DMD_uc004dcv.1_Nonsense_Mutation_p.R467*|DMD_uc004dcw.2_Nonsense_Mutation_p.R1583*|DMD_uc004dcx.2_Nonsense_Mutation_p.R1586*|DMD_uc004dcz.2_Nonsense_Mutation_p.R2804*|DMD_uc004dcy.1_Nonsense_Mutation_p.R2923*|DMD_uc004ddb.1_Nonsense_Mutation_p.R2919*	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	2927	Spectrin 21.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)												0.074074	-4.749168	20.403604	10	125	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	31496381	31496381	4760	23	T	A	A	A	700	54	DMD	5	3
MXRA5	25878	broad.mit.edu	37	X	3235707	3235707	+	Silent	SNP	G	A	A			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:3235707G>A	uc004crg.3	-	c.6015C>T	c.(6013-6015)CAC>CAT	p.H2005H		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2005	Ig-like C2-type 4.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(23;0.00031)|Lung NSC(23;0.000946)												0.122449	7.621401	14.454651	6	43	KEEP	---	---	---	---	capture		Silent	SNP	3235707	3235707	10397	23	G	A	A	A	516	40	MXRA5	1	1
RUNDC1	146923	broad.mit.edu	37	17	41132982	41132982	+	Frame_Shift_Del	DEL	C	-	-			TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:41132982_41132982delC	uc002ici.1	+	c.389_389delC	c.(388-390)GCCfs	p.A130fs	AARSD1_uc002icd.2_5'Flank|AARSD1_uc002ice.2_5'Flank|AARSD1_uc002icf.2_5'Flank|AARSD1_uc010whg.1_5'Flank|AARSD1_uc002icg.2_5'Flank|AARSD1_uc002ich.2_5'Flank|AARSD1_uc010whh.1_5'Flank|RUNDC1_uc010whi.1_5'UTR	NM_173079	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	130											0		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)										0.33			2	4		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	41132982	41132982	14222	17	C	-	-	-	338	26	RUNDC1	5	5
TPRX1	284355	broad.mit.edu	37	19	48305543	48305566	+	In_Frame_Del	DEL	GGGCCTGGGATCGGGCCTGGGTTC	-	-	rs75909117;rs12463317		TCGA-38-4627-01	TCGA-38-4627-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:48305543_48305566delGGGCCTGGGATCGGGCCTGGGTTC	uc002php.1	-	c.702_725delGAACCCAGGCCCGATCCCAGGCCC	c.(700-726)CCGAACCCAGGCCCGATCCCAGGCCCA>CCA	p.234_242PNPGPIPGP>P		NM_198479	NP_940881	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox	234_242	Gly-rich.				regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		Esophageal Squamous(123;175 2281 3051 32395)								0.43			3	4		---	---	---	---	capture_indel		In_Frame_Del	DEL	48305543	48305566	16966	19	GGGCCTGGGATCGGGCCTGGGTTC	-	-	-	611	47	TPRX1	5	5
