Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTOR	2475	broad.mit.edu	37	1	11254906	11254906	+	Intron	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11254906G>C	uc001asd.2	-						ANGPTL7_uc001ase.2_Intron	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated						cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						TGTTTCTCATGCCAGGTGGCT	0.498													12	58	---	---	---	---	PASS
TAS1R2	80834	broad.mit.edu	37	1	19168341	19168341	+	Silent	SNP	A	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19168341A>T	uc001bba.1	-	5	1474	c.1473T>A	c.(1471-1473)CCT>CCA	p.P491P		NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2 precursor	491	Extracellular (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	ACATGGACATAGGGATCTGGA	0.592													14	103	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27094437	27094437	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27094437C>G	uc001bmv.1	+	11	3518	c.3145C>G	c.(3145-3147)CTG>GTG	p.L1049V	ARID1A_uc001bmt.1_Missense_Mutation_p.L1049V|ARID1A_uc001bmu.1_Missense_Mutation_p.L1049V|ARID1A_uc001bmw.1_Missense_Mutation_p.L666V	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1049	ARID.				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TAGGAAACCTCTGGACCTCTA	0.547			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								6	175	---	---	---	---	PASS
SYTL1	84958	broad.mit.edu	37	1	27675619	27675619	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27675619G>C	uc001bnw.1	+	6	675	c.508G>C	c.(508-510)GAG>CAG	p.E170Q	SYTL1_uc001bnv.1_Missense_Mutation_p.E158Q|SYTL1_uc009vsu.1_Missense_Mutation_p.E158Q|SYTL1_uc001bnx.2_Missense_Mutation_p.E170Q|SYTL1_uc009vsv.1_Missense_Mutation_p.E170Q	NM_032872	NP_116261	Q8IYJ3	SYTL1_HUMAN	synaptotagmin-like 1	170					exocytosis|intracellular protein transport	extrinsic to plasma membrane|melanosome|soluble fraction	neurexin binding|Rab GTPase binding			ovary(1)	1		Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0908)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.0013)|KIRC - Kidney renal clear cell carcinoma(1967;0.00158)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		TTCAGATCCTGAGGAGGCGTC	0.617													6	97	---	---	---	---	PASS
AHDC1	27245	broad.mit.edu	37	1	27877043	27877043	+	Silent	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27877043C>G	uc009vsy.2	-	6	2553	c.1584G>C	c.(1582-1584)CGG>CGC	p.R528R	AHDC1_uc009vsz.1_Silent_p.R528R	NM_001029882	NP_001025053	Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	528							DNA binding			central_nervous_system(1)	1		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		CTACCACGTTCCGCCCATTGT	0.622													5	78	---	---	---	---	PASS
EYA3	2140	broad.mit.edu	37	1	28343723	28343723	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28343723G>C	uc001bpi.1	-	8	692	c.527C>G	c.(526-528)TCT>TGT	p.S176C	EYA3_uc010ofs.1_Missense_Mutation_p.S123C|EYA3_uc010oft.1_Missense_Mutation_p.S130C|EYA3_uc001bpj.2_Missense_Mutation_p.S130C|EYA3_uc001bpk.1_RNA|EYA3_uc010ofu.1_RNA	NM_001990	NP_001981	Q99504	EYA3_HUMAN	eyes absent 3	176					anatomical structure morphogenesis|double-strand break repair|histone dephosphorylation|multicellular organismal development|positive regulation of DNA repair|regulation of transcription, DNA-dependent|response to ionizing radiation|transcription, DNA-dependent|visual perception	cytoplasm	metal ion binding|protein binding|protein tyrosine phosphatase activity			ovary(2)|skin(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		AGAAGAAGTAGATATCAGGCT	0.378													5	221	---	---	---	---	PASS
HMGB4	127540	broad.mit.edu	37	1	34329862	34329862	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34329862A>G	uc001bxp.2	+	2	1813	c.70A>G	c.(70-72)AGA>GGA	p.R24G	CSMD2_uc001bxm.1_Intron|CSMD2_uc001bxn.1_Intron|HMGB4_uc001bxq.2_Splice_Site	NM_145205	NP_660206	Q8WW32	HMGB4_HUMAN	HMG2 like isoform 1	24						nucleus	DNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GCTGAATTACAGAAACAAATT	0.378													10	112	---	---	---	---	PASS
CLSPN	63967	broad.mit.edu	37	1	36226162	36226162	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36226162G>A	uc001bzi.2	-	8	1440	c.1360C>T	c.(1360-1362)CAT>TAT	p.H454Y	CLSPN_uc009vux.2_Missense_Mutation_p.H454Y	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin	454					activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TCCAGGGCATGAGGTTCAAAT	0.502													5	177	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39851507	39851507	+	Silent	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39851507C>G	uc010oiu.1	+	21	9701	c.9570C>G	c.(9568-9570)CTC>CTG	p.L3190L	MACF1_uc010ois.1_Silent_p.L2688L|MACF1_uc001cda.1_Silent_p.L2575L|MACF1_uc001cdc.1_Silent_p.L1754L	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	4755					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCGATGAACTCTCAGTGCTCA	0.488													3	134	---	---	---	---	PASS
SMAP2	64744	broad.mit.edu	37	1	40881009	40881009	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40881009C>G	uc001cfj.2	+	7	702	c.637C>G	c.(637-639)CTG>GTG	p.L213V	SMAP2_uc010ojh.1_Missense_Mutation_p.L213V|SMAP2_uc001cfk.2_Missense_Mutation_p.L183V|SMAP2_uc010oji.1_Missense_Mutation_p.L130V|SMAP2_uc010ojj.1_Missense_Mutation_p.L29V	NM_022733	NP_073570	Q8WU79	SMAP2_HUMAN	small ArfGAP2	213	Interaction with clathrin heavy chains (By similarity).				regulation of ARF GTPase activity	cytoplasm|nucleus	ARF GTPase activator activity|zinc ion binding				0	Lung NSC(20;1.56e-05)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.04e-17)			GGATTTAGATCTGTTGGCCTC	0.453													18	349	---	---	---	---	PASS
CYP4A22	284541	broad.mit.edu	37	1	47610264	47610264	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47610264G>C	uc001cqv.1	+	8	991	c.940G>C	c.(940-942)GAG>CAG	p.E314Q	CYP4A22_uc009vyo.2_Missense_Mutation_p.E314Q|CYP4A22_uc009vyp.2_Intron	NM_001010969	NP_001010969	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A,	314						endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding			skin(2)|ovary(1)|breast(1)	4						CCTCCGTGCTGAGGTGGACAC	0.552													4	172	---	---	---	---	PASS
SLC44A5	204962	broad.mit.edu	37	1	75716933	75716933	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75716933G>A	uc001dgu.2	-	7	451	c.307C>T	c.(307-309)CCC>TCC	p.P103S	SLC44A5_uc001dgt.2_Missense_Mutation_p.P103S|SLC44A5_uc001dgs.2_Missense_Mutation_p.P61S|SLC44A5_uc001dgr.2_Missense_Mutation_p.P61S|SLC44A5_uc010oqz.1_Missense_Mutation_p.P142S|SLC44A5_uc010ora.1_Missense_Mutation_p.P97S|SLC44A5_uc010orb.1_5'UTR	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	103	Extracellular (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						AACACGGAGGGACTGGTACAG	0.408													5	109	---	---	---	---	PASS
MSH4	4438	broad.mit.edu	37	1	76363588	76363588	+	Intron	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76363588C>G	uc001dhd.1	+							NM_002440	NP_002431	O15457	MSH4_HUMAN	mutS homolog 4						chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			lung(3)|ovary(2)	5						GTTATATATTCCAGGCATTTA	0.279								MMR					4	65	---	---	---	---	PASS
ST6GALNAC3	256435	broad.mit.edu	37	1	76779647	76779647	+	Missense_Mutation	SNP	G	T	T	rs142835503		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76779647G>T	uc001dhh.2	+	2	339	c.176G>T	c.(175-177)CGA>CTA	p.R59L	ST6GALNAC3_uc001dhg.3_Missense_Mutation_p.R59L|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1	59	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						CGGCCCCTTCGAACTCACTAT	0.433													6	98	---	---	---	---	PASS
BCAR3	8412	broad.mit.edu	37	1	94049605	94049605	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94049605C>G	uc001dpz.2	-	6	1278	c.1003G>C	c.(1003-1005)GCC>CCC	p.A335P	BCAR3_uc001dqa.2_Missense_Mutation_p.A335P|BCAR3_uc001dqb.2_Missense_Mutation_p.A335P|BCAR3_uc001dpx.3_Missense_Mutation_p.A11P|BCAR3_uc001dpy.2_Missense_Mutation_p.A244P|BCAR3_uc009wdm.1_Missense_Mutation_p.A11P	NM_003567	NP_003558	O75815	BCAR3_HUMAN	breast cancer antiestrogen resistance 3	335					response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		GACTGGTGGGCTTTGAGGGAC	0.512													5	81	---	---	---	---	PASS
AGL	178	broad.mit.edu	37	1	100368264	100368264	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100368264A>G	uc001dsi.1	+	27	4014	c.3614A>G	c.(3613-3615)CAG>CGG	p.Q1205R	AGL_uc001dsj.1_Missense_Mutation_p.Q1205R|AGL_uc001dsk.1_Missense_Mutation_p.Q1205R|AGL_uc001dsl.1_Missense_Mutation_p.Q1205R|AGL_uc001dsm.1_Missense_Mutation_p.Q1189R|AGL_uc001dsn.1_Missense_Mutation_p.Q1188R	NM_000642	NP_000633	P35573	GDE_HUMAN	amylo-1,6-glucosidase,	1205	4-alpha-glucanotransferase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		GAAGTCATACAGGAAGCAATG	0.408													4	107	---	---	---	---	PASS
CD58	965	broad.mit.edu	37	1	117087219	117087219	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117087219G>A	uc001egm.2	-	2	199	c.78C>T	c.(76-78)ATC>ATT	p.I26I	CD58_uc001egn.2_RNA|CD58_uc010owy.1_Silent_p.I26I|CD58_uc001ego.1_RNA|CD58_uc001egp.3_Silent_p.I26I	NM_001779	NP_001770	P19256	LFA3_HUMAN	CD58 molecule isoform 1	26					blood coagulation|cell-cell adhesion|leukocyte migration	anchored to membrane|integral to plasma membrane	protein binding				0	Lung SC(450;0.225)	all_cancers(81;0.000363)|all_lung(203;0.000118)|all_epithelial(167;0.000149)|Lung NSC(69;0.000577)		Lung(183;0.0086)|LUSC - Lung squamous cell carcinoma(189;0.0528)|Colorectal(144;0.0775)|all cancers(265;0.109)|Epithelial(280;0.118)|COAD - Colon adenocarcinoma(174;0.121)		AAAAACAGCTGATGAAACCTA	0.348													5	25	---	---	---	---	PASS
TRIM45	80263	broad.mit.edu	37	1	117660749	117660749	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117660749G>C	uc001egz.2	-	2	1717	c.1129C>G	c.(1129-1131)CAG>GAG	p.Q377E	TRIM45_uc009whe.2_Missense_Mutation_p.Q377E|TRIM45_uc001eha.2_Missense_Mutation_p.Q273E	NM_025188	NP_079464	Q9H8W5	TRI45_HUMAN	tripartite motif-containing 45 isoform 1	377						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)	1	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		GCTTTCTCCTGAGGACAGAAG	0.468													4	189	---	---	---	---	PASS
PPIAL4G	644591	broad.mit.edu	37	1	143767819	143767819	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143767819G>A	uc001ejt.2	-	1	63	c.30C>T	c.(28-30)ATC>ATT	p.I10I		NM_001123068	NP_001116540	A2BFH1	PAL4G_HUMAN	peptidylprolyl isomerase A (cyclophilin A)-like	10	PPIase cyclophilin-type.				protein folding	cytoplasm	peptidyl-prolyl cis-trans isomerase activity				0						CGTCGACGGTGATGTCAAAAA	0.443													6	284	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144952297	144952297	+	Nonsense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144952297G>C	uc001elw.3	-	4	713	c.422C>G	c.(421-423)TCA>TGA	p.S141*	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Nonsense_Mutation_p.S207*|PDE4DIP_uc001emc.1_Nonsense_Mutation_p.S141*|PDE4DIP_uc001emd.1_Nonsense_Mutation_p.S141*|PDE4DIP_uc001emg.1_Nonsense_Mutation_p.S141*|PDE4DIP_uc001emh.2_Nonsense_Mutation_p.S278*	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	141					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CAGTTTCTCTGAGAGCTCCAG	0.522			T	PDGFRB	MPD								3	109	---	---	---	---	PASS
VPS45	11311	broad.mit.edu	37	1	150048382	150048382	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150048382G>C	uc001etp.2	+	4	934	c.361G>C	c.(361-363)GAG>CAG	p.E121Q	VPS45_uc010pbp.1_RNA|VPS45_uc010pbq.1_Missense_Mutation_p.E85Q|VPS45_uc010pbs.1_Missense_Mutation_p.E85Q|VPS45_uc001etq.2_5'Flank|VPS45_uc009wlm.1_Missense_Mutation_p.E121Q|VPS45_uc010pbr.1_Missense_Mutation_p.E85Q	NM_007259	NP_009190	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45A	121					blood coagulation|intracellular protein transport|vesicle docking involved in exocytosis	endosome membrane|Golgi membrane|integral to membrane of membrane fraction				central_nervous_system(1)|skin(1)	2	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGTTGTGGCTGAGGTTCAGGT	0.388													6	152	---	---	---	---	PASS
CDC42SE1	56882	broad.mit.edu	37	1	151026774	151026774	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151026774C>G	uc001ewo.2	-	5	759	c.189G>C	c.(187-189)ATG>ATC	p.M63I	CDC42SE1_uc001ewp.2_Missense_Mutation_p.M63I	NM_001038707	NP_001033796	Q9NRR8	C42S1_HUMAN	CDC42 small effector 1	63					phagocytosis|regulation of cell shape|signal transduction	cytoplasm|cytoskeleton|plasma membrane	GTPase inhibitor activity				0	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCTTGGATCTCATCTGCTCCT	0.448													9	294	---	---	---	---	PASS
SEMA6C	10500	broad.mit.edu	37	1	151108092	151108092	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151108092C>G	uc001ewu.2	-	14	1708	c.1408G>C	c.(1408-1410)GAG>CAG	p.E470Q	SEMA6C_uc001ewv.2_Missense_Mutation_p.E470Q|SEMA6C_uc001eww.2_Missense_Mutation_p.E430Q|SEMA6C_uc010pcq.1_Missense_Mutation_p.E470Q	NM_030913	NP_112175	Q9H3T2	SEM6C_HUMAN	semaphorin Y precursor	470	Extracellular (Potential).|Sema.					integral to membrane	receptor activity			ovary(1)|skin(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GCATCAATCTCTTCCAGGAGG	0.602													4	180	---	---	---	---	PASS
PIP5K1A	8394	broad.mit.edu	37	1	151196730	151196730	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151196730G>T	uc001exj.2	+	2	547	c.95G>T	c.(94-96)GGA>GTA	p.G32V	PIP5K1A_uc001exi.2_Missense_Mutation_p.G31V|PIP5K1A_uc010pcu.1_Missense_Mutation_p.G32V|PIP5K1A_uc001exk.2_Missense_Mutation_p.G31V	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	32					phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding			ovary(1)|central_nervous_system(1)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			GCAGCATCTGGAATCAAGAGA	0.383													8	186	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152281874	152281874	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152281874C>G	uc001ezu.1	-	3	5524	c.5488G>C	c.(5488-5490)GAG>CAG	p.E1830Q		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1830	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCGATTGCTCATAGTGGGAT	0.582									Ichthyosis				7	802	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152329650	152329650	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152329650C>T	uc001ezw.3	-	3	685	c.612G>A	c.(610-612)CTG>CTA	p.L204L	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	204	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCTTTCTCTCAGTTCTACAG	0.468													11	358	---	---	---	---	PASS
CHRNB2	1141	broad.mit.edu	37	1	154542077	154542077	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154542077C>T	uc001ffg.2	+	2	468	c.204C>T	c.(202-204)ATC>ATT	p.I68I		NM_000748	NP_000739	P17787	ACHB2_HUMAN	neuronal nicotinic acetylcholine receptor beta 2	68	Extracellular (Potential).				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Nicotine(DB00184)	CCCAGCTCATCAGTGTGGTGA	0.542													7	63	---	---	---	---	PASS
KCNN3	3782	broad.mit.edu	37	1	154794573	154794573	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154794573C>T	uc001ffp.2	-	2	1335	c.1021G>A	c.(1021-1023)GAA>AAA	p.E341K	KCNN3_uc001ffo.2_Missense_Mutation_p.E36K|KCNN3_uc009wox.1_Missense_Mutation_p.E341K	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium	346						integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			ACCTGGACTTCACGTGTGTGG	0.562													3	70	---	---	---	---	PASS
CCT3	7203	broad.mit.edu	37	1	156304662	156304662	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156304662C>T	uc001fol.1	-	3	361	c.141G>A	c.(139-141)ATG>ATA	p.M47I	CCT3_uc001fom.1_Missense_Mutation_p.M47I|CCT3_uc001fon.1_Intron|CCT3_uc010phj.1_Missense_Mutation_p.M1I|CCT3_uc010phk.1_Missense_Mutation_p.M1I|CCT3_uc010phl.1_Missense_Mutation_p.M1I|C1orf182_uc001foo.2_5'Flank	NM_005998	NP_005989	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 isoform a	47					'de novo' posttranslational protein folding	cytoskeleton|cytosol|plasma membrane	ATP binding|unfolded protein binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)					AGCCTACCTTCATCATGGACT	0.373													4	138	---	---	---	---	PASS
CD5L	922	broad.mit.edu	37	1	157805955	157805955	+	Intron	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157805955G>T	uc001frk.3	-							NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor						apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GCTGCAAAGAGACGGGTTGTT	0.587													5	54	---	---	---	---	PASS
OR6N2	81442	broad.mit.edu	37	1	158747222	158747222	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158747222G>A	uc010pir.1	-	1	204	c.204C>T	c.(202-204)TTC>TTT	p.F68F		NM_001005278	NP_001005278	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N,	68	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_hematologic(112;0.0378)					ACAACTCCAAGAAGGAAAGAA	0.443													12	233	---	---	---	---	PASS
FCGR2A	2212	broad.mit.edu	37	1	161487879	161487879	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161487879G>A	uc001gan.2	+	7	948	c.895G>A	c.(895-897)GAT>AAT	p.D299N	FCGR2A_uc001gam.2_Missense_Mutation_p.D298N|FCGR2A_uc001gao.2_RNA	NM_001136219	NP_001129691	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor	299	Cytoplasmic (Potential).					integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	ACCTACTGACGATGATAAAAA	0.383													4	148	---	---	---	---	PASS
PBX1	5087	broad.mit.edu	37	1	164532472	164532472	+	Intron	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164532472C>G	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						TTCTTTCTTGCAGAAAACATG	0.353			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								4	141	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177250629	177250629	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177250629C>G	uc001glf.2	+	8	2629	c.2317C>G	c.(2317-2319)CCT>GCT	p.P773A	FAM5B_uc001glg.2_Missense_Mutation_p.P668A	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	773						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						GCTGCCAAACCCTGTGGAATA	0.532													5	150	---	---	---	---	PASS
ABL2	27	broad.mit.edu	37	1	179112101	179112101	+	Intron	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179112101C>T	uc001gmj.3	-						ABL2_uc010pnf.1_Intron|ABL2_uc010png.1_Intron|ABL2_uc010pnh.1_Intron|ABL2_uc009wxe.2_Intron|ABL2_uc001gmg.3_Missense_Mutation_p.E27K|ABL2_uc001gmi.3_Missense_Mutation_p.E27K|ABL2_uc001gmh.3_Missense_Mutation_p.E27K|ABL2_uc010pne.1_Missense_Mutation_p.E27K|ABL2_uc009wxf.1_Missense_Mutation_p.E27K|ABL2_uc001gmk.2_Missense_Mutation_p.E27K	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b						axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	TCTGAGGCCTCAGTGCACAGG	0.458			T	ETV6	AML								7	105	---	---	---	---	PASS
GLUL	2752	broad.mit.edu	37	1	182353797	182353797	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182353797C>G	uc001gpa.1	-	7	1077	c.865G>C	c.(865-867)GAT>CAT	p.D289H	GLUL_uc010pnt.1_Missense_Mutation_p.D76H|GLUL_uc001gpb.1_Missense_Mutation_p.D289H|GLUL_uc001gpc.1_Missense_Mutation_p.D289H|GLUL_uc001gpd.1_Missense_Mutation_p.D289H	NM_001033056	NP_001028228	P15104	GLNA_HUMAN	glutamine synthetase	289					cell proliferation|glutamine biosynthetic process|neurotransmitter uptake	cytosol|Golgi apparatus|mitochondrion	ATP binding|glutamate decarboxylase activity|glutamate-ammonia ligase activity|identical protein binding				0					Asparaginase(DB00023)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)|L-Methionine(DB00134)	CCCTTGGGATCATAGGCACGG	0.512													4	148	---	---	---	---	PASS
RNASEL	6041	broad.mit.edu	37	1	182551334	182551334	+	Silent	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182551334C>G	uc001gpj.1	-	3	1793	c.1626G>C	c.(1624-1626)CTG>CTC	p.L542L	RNASEL_uc009wxz.1_Silent_p.L542L|RNASEL_uc001gpk.2_Silent_p.L542L|RNASEL_uc009wya.1_3'UTR	NM_021133	NP_066956	Q05823	RN5A_HUMAN	ribonuclease L	542	Protein kinase.				mRNA processing|response to virus|type I interferon-mediated signaling pathway	mitochondrion	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|metal ion binding|protein kinase activity|RNA binding			ovary(4)|stomach(1)	5						TTTGAGCTTTCAGATCCTCAA	0.368									Hereditary_Prostate_Cancer				7	248	---	---	---	---	PASS
LGR6	59352	broad.mit.edu	37	1	202288069	202288069	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202288069C>G	uc001gxu.2	+	18	2638	c.2638C>G	c.(2638-2640)CTG>GTG	p.L880V	LGR6_uc001gxv.2_Missense_Mutation_p.L828V|LGR6_uc009xab.2_RNA|LGR6_uc001gxw.2_Missense_Mutation_p.L741V	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled	880	Cytoplasmic (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						GGATCTCATTCTGGAAGCTTC	0.632													3	130	---	---	---	---	PASS
C1orf116	79098	broad.mit.edu	37	1	207196391	207196391	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207196391C>G	uc001hfd.2	-	4	977	c.718G>C	c.(718-720)GAG>CAG	p.E240Q	C1orf116_uc009xcb.1_5'UTR	NM_023938	NP_076427	Q9BW04	SARG_HUMAN	specifically androgen-regulated protein isoform	240						cytoplasm|plasma membrane	receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4	Prostate(682;0.19)					GGAGTCTGCTCTCTTTCCTGG	0.602													10	292	---	---	---	---	PASS
CR2	1380	broad.mit.edu	37	1	207644397	207644397	+	Missense_Mutation	SNP	T	G	G	rs147378770	byFrequency	TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207644397T>G	uc001hfw.2	+	8	1552	c.1458T>G	c.(1456-1458)TTT>TTG	p.F486L	CR2_uc001hfv.2_Missense_Mutation_p.F486L|CR2_uc009xch.2_Missense_Mutation_p.F486L|CR2_uc009xci.1_5'UTR	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	486	Sushi 8.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						AGCACCAATTTGTTAGACCAG	0.453													6	158	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215847680	215847680	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215847680C>G	uc001hku.1	-	63	13960	c.13573G>C	c.(13573-13575)GAT>CAT	p.D4525H		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4525	Fibronectin type-III 30.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTGGTTCGATCTTTGACAAGA	0.522										HNSCC(13;0.011)			5	152	---	---	---	---	PASS
MIA3	375056	broad.mit.edu	37	1	222828095	222828095	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222828095C>T	uc001hnl.2	+	18	4576	c.4567C>T	c.(4567-4569)CTG>TTG	p.L1523L	MIA3_uc001hnm.2_Silent_p.L401L	NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1523	Cytoplasmic (Potential).|Potential.				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)		AGTGGAGATTCTGAATGAGCT	0.393													4	88	---	---	---	---	PASS
DISC1	27185	broad.mit.edu	37	1	231830302	231830302	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231830302C>T	uc001huz.2	+	2	851	c.798C>T	c.(796-798)TTC>TTT	p.F266F	TSNAX-DISC1_uc010pwe.1_Silent_p.F221F|TSNAX-DISC1_uc010pwf.1_Silent_p.F221F|TSNAX-DISC1_uc010pwg.1_Silent_p.F255F|TSNAX-DISC1_uc010pwh.1_Silent_p.F221F|TSNAX-DISC1_uc010pwi.1_Silent_p.F221F|TSNAX-DISC1_uc010pwj.1_Silent_p.F255F|TSNAX-DISC1_uc010pwk.1_Silent_p.F255F|TSNAX-DISC1_uc010pwl.1_RNA|DISC1_uc010pwo.1_Silent_p.F266F|DISC1_uc010pwp.1_Silent_p.F266F|DISC1_uc010pwq.1_Silent_p.F266F|DISC1_uc010pwr.1_Silent_p.F266F|DISC1_uc010pws.1_Silent_p.F266F|DISC1_uc010pwt.1_Silent_p.F266F|DISC1_uc010pwu.1_Intron|DISC1_uc010pwv.1_RNA|DISC1_uc010pww.1_Silent_p.F266F|DISC1_uc010pwx.1_RNA|DISC1_uc010pwy.1_RNA|DISC1_uc010pwz.1_RNA|DISC1_uc010pxa.1_RNA|DISC1_uc001huy.2_Silent_p.F266F|DISC1_uc010pxb.1_Silent_p.F266F|DISC1_uc010pxc.1_Silent_p.F266F|DISC1_uc010pxd.1_5'UTR|DISC1_uc010pxe.1_Silent_p.F266F|DISC1_uc009xfr.2_Silent_p.F221F|DISC1_uc010pxf.1_Silent_p.F266F|DISC1_uc010pxg.1_Silent_p.F266F|DISC1_uc010pxh.1_Silent_p.F266F|DISC1_uc010pxi.1_RNA|DISC1_uc010pxj.1_5'UTR|DISC1_uc010pxk.1_RNA|DISC1_uc010pxl.1_RNA|DISC1_uc010pxm.1_Silent_p.F266F|DISC1_uc010pxn.1_5'UTR|DISC1_uc001hva.2_Silent_p.F266F|DISC1_uc010pwm.1_Silent_p.F266F|DISC1_uc001hux.1_Silent_p.F266F|DISC1_uc001hvc.3_Silent_p.F266F|DISC1_uc010pwn.1_Silent_p.F266F	NM_018662	NP_061132	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1 isoform L	266	Interaction with MAP1A.				microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)				CTCGGCCCTTCAGTCTCTTGG	0.617													4	74	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237886440	237886440	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237886440G>A	uc001hyl.1	+	74	10687	c.10567G>A	c.(10567-10569)GCT>ACT	p.A3523T	RYR2_uc010pxz.1_Missense_Mutation_p.A478T	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3523					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGAGGATCCTGCTATTAGATG	0.393													53	200	---	---	---	---	PASS
OR2L13	284521	broad.mit.edu	37	1	248263470	248263470	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248263470C>T	uc001ids.2	+	3	1130	c.793C>T	c.(793-795)CGC>TGC	p.R265C		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	265	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CAGGAATCTCCGCTCACCAGC	0.473													38	107	---	---	---	---	PASS
TAF1B	9014	broad.mit.edu	37	2	10050867	10050867	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10050867G>A	uc002qzz.2	+	10	1058	c.958G>A	c.(958-960)GAA>AAA	p.E320K	TAF1B_uc010exc.2_Missense_Mutation_p.E320K|TAF1B_uc002qzy.3_Missense_Mutation_p.E320K|TAF1B_uc010yja.1_Missense_Mutation_p.E65K|TAF1B_uc010exd.2_Missense_Mutation_p.E65K	NM_005680	NP_005671	Q53T94	TAF1B_HUMAN	TBP-associated factor 1B	320					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|breast(1)|pancreas(1)	3	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TTCTTCAGATGAAATGCATAG	0.328													5	64	---	---	---	---	PASS
NT5C1B	93034	broad.mit.edu	37	2	18768395	18768395	+	Silent	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18768395G>C	uc002rcz.2	-	3	269	c.165C>G	c.(163-165)CCC>CCG	p.P55P	NT5C1B_uc002rcy.2_Silent_p.P55P|NT5C1B_uc010exr.2_Intron|NT5C1B_uc010yju.1_Intron|NT5C1B_uc002rda.2_Intron|NT5C1B_uc010yjv.1_Silent_p.P55P|NT5C1B_uc010yjw.1_Intron|NT5C1B_uc010exs.2_Silent_p.P55P|NT5C1B_uc002rdb.1_5'Flank	NM_001002006	NP_001002006	Q96P26	5NT1B_HUMAN	5' nucleotidase, cytosolic IB isoform 1	55					purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			skin(2)|ovary(1)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				GACCCTGGAAGGGGCAACATC	0.547													5	29	---	---	---	---	PASS
DPYSL5	56896	broad.mit.edu	37	2	27167566	27167566	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27167566G>T	uc002rhu.3	+	12	1641	c.1483G>T	c.(1483-1485)GAT>TAT	p.D495Y	DPYSL5_uc002rhv.3_Missense_Mutation_p.D495Y	NM_020134	NP_064519	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	495					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTACCTGGGGGATGTCGCTGT	0.567													23	78	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27801100	27801100	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27801100A>G	uc002rkz.3	+	1	1712	c.1661A>G	c.(1660-1662)CAC>CGC	p.H554R		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	554										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					CCTTCAGAGCACCACACAGGG	0.393													4	74	---	---	---	---	PASS
ALK	238	broad.mit.edu	37	2	29416544	29416544	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29416544G>A	uc002rmy.2	-	29	5316	c.4409C>T	c.(4408-4410)GCC>GTC	p.A1470V	ALK_uc010ymo.1_Missense_Mutation_p.A402V	NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	1470	Cytoplasmic (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	p.V1471fs*45(1)	NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	CCCTTCCACGGCCGGCCCTCT	0.592			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				4	145	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37268374	37268374	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37268374G>A	uc002rpp.1	-	19	2854	c.2758C>T	c.(2758-2760)CAT>TAT	p.H920Y		NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	920							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				ACATAACGATGCAAACAACCA	0.433													4	82	---	---	---	---	PASS
HNRPLL	92906	broad.mit.edu	37	2	38809072	38809072	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38809072G>T	uc002rqw.2	-	6	1195	c.785C>A	c.(784-786)CCA>CAA	p.P262Q	HNRPLL_uc002rqv.2_5'UTR|HNRPLL_uc002rqx.2_Missense_Mutation_p.P257Q	NM_138394	NP_612403	Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	262					mRNA processing|positive regulation of RNA splicing	nucleus|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding			skin(1)	1		all_hematologic(82;0.248)				TCCCAAATATGGTTTAGTGTA	0.328													3	68	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61441575	61441575	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61441575C>G	uc002sbe.2	-	68	8324	c.8302G>C	c.(8302-8304)GAG>CAG	p.E2768Q		NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	2768					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			ATCAGCTTCTCAGTTTTGGAA	0.383													14	54	---	---	---	---	PASS
ARHGAP25	9938	broad.mit.edu	37	2	69046260	69046260	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69046260C>A	uc002seu.2	+	9	1370	c.1006C>A	c.(1006-1008)CCT>ACT	p.P336T	ARHGAP25_uc010fdg.2_Missense_Mutation_p.P337T|ARHGAP25_uc010yql.1_Missense_Mutation_p.P297T|ARHGAP25_uc002sev.2_Missense_Mutation_p.P330T|ARHGAP25_uc002sew.2_Missense_Mutation_p.P329T|ARHGAP25_uc002sex.2_Missense_Mutation_p.P330T|ARHGAP25_uc002sey.2_Missense_Mutation_p.P63T	NM_001007231	NP_001007232	P42331	RHG25_HUMAN	Rho GTPase activating protein 25 isoform a	336	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|breast(2)	4						TTCAGGGACTCCTCAGATCCA	0.493													19	314	---	---	---	---	PASS
SMYD1	150572	broad.mit.edu	37	2	88407937	88407937	+	Missense_Mutation	SNP	G	C	C	rs146456865	byFrequency	TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88407937G>C	uc002ssr.2	+	9	1195	c.1193G>C	c.(1192-1194)CGG>CCG	p.R398P	SMYD1_uc002ssq.1_Intron|SMYD1_uc002sss.2_Missense_Mutation_p.R94P	NM_198274	NP_938015	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	398					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)|skin(1)	4						GCCGTGATGCGGGCAGGGCTG	0.542													4	68	---	---	---	---	PASS
TUBA3E	112714	broad.mit.edu	37	2	130951855	130951855	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130951855G>A	uc002tqv.2	-	4	661	c.560C>T	c.(559-561)TCC>TTC	p.S187F		NM_207312	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	187					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			skin(1)	1	Colorectal(110;0.1)					GGTTAGGATGGAGTTGTAGGG	0.532													21	201	---	---	---	---	PASS
TNFAIP6	7130	broad.mit.edu	37	2	152214240	152214240	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152214240C>T	uc002txk.2	+	1	136	c.60C>T	c.(58-60)TTC>TTT	p.F20F		NM_007115	NP_009046	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6	20					cell adhesion|cell-cell signaling|inflammatory response|signal transduction		hyaluronic acid binding				0				BRCA - Breast invasive adenocarcinoma(221;0.131)		GATGGGGATTCAAGGATGGAA	0.388													11	102	---	---	---	---	PASS
LY75	4065	broad.mit.edu	37	2	160755255	160755255	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160755255G>C	uc002ubc.3	-	2	479	c.410C>G	c.(409-411)TCT>TGT	p.S137C	LY75_uc002ubb.3_Missense_Mutation_p.S137C|LY75_uc010fos.2_Missense_Mutation_p.S137C|LY75_uc010fot.1_Missense_Mutation_p.S137C	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	137	Extracellular (Potential).|Ricin B-type lectin.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		CCAGACATCAGATGCATTTGA	0.517													6	125	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163393571	163393571	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163393571G>A	uc002uch.1	-	3	539	c.327C>T	c.(325-327)AAC>AAT	p.N109N	KCNH7_uc002uci.2_Silent_p.N109N	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	109	Cytoplasmic (Potential).|PAC.				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	TTATGTGAGTGTTACAAATAA	0.333													5	66	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170089935	170089935	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170089935G>A	uc002ues.2	-	30	5297	c.5084C>T	c.(5083-5085)TCG>TTG	p.S1695L		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1695	LDL-receptor class B 14.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TGGTTGTTTCGAAGGATGAAC	0.468													11	75	---	---	---	---	PASS
MAP1D	254042	broad.mit.edu	37	2	172944946	172944946	+	Intron	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172944946C>G	uc002uhk.2	+						MAP1D_uc010zdw.1_Intron	NM_199227	NP_954697	Q6UB28	AMP1D_HUMAN	methionine aminopeptidase 1D precursor						N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis	mitochondrion	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)			TGTTTGCTTTCTGCTCTGTTG	0.423													14	120	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098810	178098810	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098810C>G	uc002ulh.3	-	2	790	c.235G>C	c.(235-237)GAG>CAG	p.E79Q	NFE2L2_uc002ulg.3_Missense_Mutation_p.E63Q|NFE2L2_uc010zfa.1_Missense_Mutation_p.E63Q|NFE2L2_uc002uli.3_Missense_Mutation_p.E63Q|NFE2L2_uc010fra.2_Missense_Mutation_p.E63Q|NFE2L2_uc010frb.2_Missense_Mutation_p.E63Q	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	79					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TCACCTGTCTCTTCATCTAGT	0.443			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			10	90	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179438359	179438359	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179438359C>G	uc010zfg.1	-	275	65020	c.64796G>C	c.(64795-64797)AGA>ACA	p.R21599T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R15294T|TTN_uc010zfi.1_Missense_Mutation_p.R15227T|TTN_uc010zfj.1_Missense_Mutation_p.R15102T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22526							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCATGCCAATCTGCTGGTTTC	0.413													7	458	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179486014	179486014	+	Nonsense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179486014G>C	uc010zfg.1	-	195	37951	c.37727C>G	c.(37726-37728)TCA>TGA	p.S12576*	TTN_uc010zfh.1_Nonsense_Mutation_p.S6271*|TTN_uc010zfi.1_Nonsense_Mutation_p.S6204*|TTN_uc010zfj.1_Nonsense_Mutation_p.S6079*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13503							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTTTCTTTTGATATAGAGCA	0.383													4	47	---	---	---	---	PASS
CASP8	841	broad.mit.edu	37	2	202149536	202149536	+	Intron	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202149536C>G	uc002uxr.1	+						CASP8_uc002uxp.1_Intron|CASP8_uc002uxq.1_Intron|CASP8_uc002uxt.1_Intron|CASP8_uc002uxu.1_Intron|CASP8_uc002uxw.1_Intron|CASP8_uc002uxy.1_Intron|CASP8_uc002uxx.1_Intron|CASP8_uc010ftf.2_Intron	NM_033355	NP_203519	Q14790	CASP8_HUMAN	caspase 8 isoform B precursor						activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding			upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						TTTCACTTTTCAGGGGCTTTG	0.403										HNSCC(4;0.00038)			4	60	---	---	---	---	PASS
CASP8	841	broad.mit.edu	37	2	202149860	202149860	+	Nonsense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202149860C>G	uc002uxr.1	+	9	1333	c.1124C>G	c.(1123-1125)TCA>TGA	p.S375*	CASP8_uc002uxp.1_Nonsense_Mutation_p.S392*|CASP8_uc002uxq.1_Nonsense_Mutation_p.S360*|CASP8_uc002uxt.1_Nonsense_Mutation_p.S434*|CASP8_uc002uxu.1_RNA|CASP8_uc002uxw.1_Nonsense_Mutation_p.S360*|CASP8_uc002uxy.1_Intron|CASP8_uc002uxx.1_Intron|CASP8_uc010ftf.2_Nonsense_Mutation_p.S291*	NM_033355	NP_203519	Q14790	CASP8_HUMAN	caspase 8 isoform B precursor	375					activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding			upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						GAGACTGATTCAGAGGAGCAA	0.448										HNSCC(4;0.00038)			11	114	---	---	---	---	PASS
NOP58	51602	broad.mit.edu	37	2	203141198	203141198	+	Intron	SNP	T	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203141198T>A	uc002uzb.2	+						NOP58_uc010zhv.1_Intron|SNORD70_uc002uzc.2_RNA	NM_015934	NP_057018	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein homolog						cell growth|rRNA processing|snRNP protein import into nucleus	box C/D snoRNP complex|Cajal body|cytoplasm|pre-snoRNP complex	protein binding|snoRNA binding				0						TGAATCTAAGTGATCTGACTC	0.318													6	35	---	---	---	---	PASS
RAPH1	65059	broad.mit.edu	37	2	204305815	204305815	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204305815G>A	uc002vad.2	-	14	2323	c.2098C>T	c.(2098-2100)CAG>TAG	p.Q700*		NM_213589	NP_998754	Q70E73	RAPH1_HUMAN	Ras association and pleckstrin homology domains	700					cell-matrix adhesion|signal transduction	cytoplasm|cytoskeleton|filopodium|lamellipodium|nucleus|plasma membrane				ovary(3)|breast(3)|central_nervous_system(2)|lung(1)|skin(1)	10						ACCAGGATCTGAGGCTTCACT	0.463													11	58	---	---	---	---	PASS
PLEKHM3	389072	broad.mit.edu	37	2	208841936	208841936	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208841936G>A	uc002vcl.2	-	3	1475	c.985C>T	c.(985-987)CAT>TAT	p.H329Y	PLEKHM3_uc002vcm.2_Missense_Mutation_p.H329Y	NM_001080475	NP_001073944	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M,	329					intracellular signal transduction		metal ion binding			ovary(1)	1						TCATCATGATGGCCAAGCCCT	0.527													11	115	---	---	---	---	PASS
TNS1	7145	broad.mit.edu	37	2	218713332	218713332	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218713332G>C	uc002vgt.2	-	17	1931	c.1533C>G	c.(1531-1533)CAC>CAG	p.H511Q	TNS1_uc002vgr.2_Missense_Mutation_p.H511Q|TNS1_uc002vgs.2_Missense_Mutation_p.H511Q|TNS1_uc010zjv.1_Missense_Mutation_p.H511Q|TNS1_uc010fvj.1_Missense_Mutation_p.H579Q|TNS1_uc010fvk.1_Missense_Mutation_p.H636Q|TNS1_uc010fvi.1_Missense_Mutation_p.H198Q	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	511						cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TGCCCGCACTGTGACCATCCT	0.607													22	79	---	---	---	---	PASS
TMPPE	643853	broad.mit.edu	37	3	33134446	33134446	+	Silent	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33134446G>C	uc003cfk.2	-	2	1433	c.1242C>G	c.(1240-1242)CTC>CTG	p.L414L	GLB1_uc003cfh.1_Intron|GLB1_uc003cfi.1_Intron|GLB1_uc003cfj.1_Intron|GLB1_uc011axk.1_Intron|TMPPE_uc011axl.1_Silent_p.L277L	NM_001039770	NP_001034859	Q6ZT21	TMPPE_HUMAN	transmembrane protein with	414						integral to membrane	metal ion binding				0						CCACCTGGTAGAGACCAGCAA	0.552													3	52	---	---	---	---	PASS
TGM4	7047	broad.mit.edu	37	3	44945440	44945440	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44945440T>C	uc003coc.3	+	9	1109	c.1036T>C	c.(1036-1038)TGG>CGG	p.W346R		NM_003241	NP_003232	P49221	TGM4_HUMAN	transglutaminase 4 (prostate)	346					peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	CTACGACGGCTGGCAGGCTGT	0.642													12	125	---	---	---	---	PASS
CDCP1	64866	broad.mit.edu	37	3	45152242	45152242	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45152242G>A	uc003com.2	-	4	882	c.747C>T	c.(745-747)CTC>CTT	p.L249L	CDCP1_uc003con.2_Silent_p.L249L	NM_022842	NP_073753	Q9H5V8	CDCP1_HUMAN	CUB domain-containing protein 1 isoform 1	249	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		GCCACGTCATGAGCTCATCCT	0.552													13	190	---	---	---	---	PASS
TMIE	259236	broad.mit.edu	37	3	46750623	46750623	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46750623G>A	uc010hjk.1	+	3	374	c.219G>A	c.(217-219)ACG>ACA	p.T73T	TMIE_uc010hjj.1_Missense_Mutation_p.A113T	NM_147196	NP_671729	Q8NEW7	TMIE_HUMAN	transmembrane inner ear protein precursor	73	Helical; (Potential).					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(193;0.000688)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)		CAGTCATCACGCTGTGCTGTG	0.612													4	62	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48602858	48602858	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48602858G>A	uc003ctz.2	-	115	8513	c.8512C>T	c.(8512-8514)CAT>TAT	p.H2838Y	UCN2_uc003cty.1_5'Flank	NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2838	Nonhelical region (NC2).				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TCCTCTGCATGAGAGACGCGG	0.642													4	17	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	51392382	51392382	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51392382G>C	uc011bds.1	+	41	4200	c.4177G>C	c.(4177-4179)GAG>CAG	p.E1393Q		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1393	DHR-2.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GATGCTCAGTGAGTTTCCGCA	0.552													6	121	---	---	---	---	PASS
STX19	415117	broad.mit.edu	37	3	93733279	93733279	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93733279G>T	uc003drh.1	-	2	1092	c.835C>A	c.(835-837)CCT>ACT	p.P279T	ARL13B_uc003drc.2_Intron|ARL13B_uc010hop.2_Intron|ARL13B_uc003drd.2_Intron|ARL13B_uc003dre.2_Intron|ARL13B_uc003drf.2_Intron|ARL13B_uc003drg.2_Intron	NM_001001850	NP_001001850	Q8N4C7	STX19_HUMAN	syntaxin 19	279					intracellular protein transport|vesicle-mediated transport	membrane	SNAP receptor activity				0						ACTCTGCAAGGATTTCTTTTT	0.318													6	45	---	---	---	---	PASS
CD96	10225	broad.mit.edu	37	3	111356973	111356973	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111356973A>T	uc003dxw.2	+	13	1653	c.1483A>T	c.(1483-1485)ACT>TCT	p.T495S	CD96_uc003dxx.2_Missense_Mutation_p.T479S|CD96_uc010hpy.1_Missense_Mutation_p.T478S	NM_198196	NP_937839	P40200	TACT_HUMAN	CD96 antigen isoform 1 precursor	495	Extracellular (Potential).|Pro/Ser/Thr-rich.				cell adhesion|immune response|regulation of immune response	integral to plasma membrane				skin(2)|central_nervous_system(1)	3						AGTCCCCACAACTGCCAATGG	0.368									Opitz_Trigonocephaly_syndrome				4	118	---	---	---	---	PASS
DRD3	1814	broad.mit.edu	37	3	113847632	113847632	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113847632G>A	uc003ebd.2	-	8	1557	c.1134C>T	c.(1132-1134)CTC>CTT	p.L378L	DRD3_uc010hqn.1_Silent_p.L378L|DRD3_uc003ebb.1_Silent_p.L345L|DRD3_uc003ebc.1_Silent_p.L378L	NM_000796	NP_000787	P35462	DRD3_HUMAN	dopamine receptor D3 isoform a	378	Helical; Name=7.				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)	TCACAGGGTTGAGGGCGCTAT	0.522													11	449	---	---	---	---	PASS
CD86	942	broad.mit.edu	37	3	121822377	121822377	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121822377T>C	uc003eet.2	+	3	199	c.83T>C	c.(82-84)ATT>ACT	p.I28T	CD86_uc011bjo.1_5'UTR|CD86_uc011bjp.1_Intron|CD86_uc003eeu.2_Missense_Mutation_p.I22T	NM_175862	NP_787058	P42081	CD86_HUMAN	CD86 antigen isoform 1	28	Extracellular (Potential).				interspecies interaction between organisms|positive regulation of cell proliferation|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of lymphotoxin A biosynthetic process|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation		coreceptor activity|protein binding			pancreas(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)	CCTCTGAAGATTCAAGCTTAT	0.423													9	88	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124053267	124053267	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124053267G>C	uc003ehg.2	+	9	1693	c.1566G>C	c.(1564-1566)GAG>GAC	p.E522D	KALRN_uc010hrv.1_Missense_Mutation_p.E522D|KALRN_uc003ehf.1_Missense_Mutation_p.E522D|KALRN_uc011bjy.1_Missense_Mutation_p.E522D	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	522					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						GACGGCTGGAGAGCATCTGGC	0.622													4	85	---	---	---	---	PASS
ALDH1L1	10840	broad.mit.edu	37	3	125879831	125879831	+	5'UTR	SNP	G	T	T	rs35399031		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125879831G>T	uc003eim.1	-	2					ALDH1L1_uc010hse.1_RNA|ALDH1L1_uc011bki.1_5'UTR|ALDH1L1_uc010hsf.1_5'UTR|ALDH1L1_uc003eip.1_5'Flank|ALDH1L1_uc011bkj.1_5'UTR	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1						10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	ATGGTAGCAGGAGGGTTGGAA	0.537													4	61	---	---	---	---	PASS
MBD4	8930	broad.mit.edu	37	3	129156155	129156155	+	Intron	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129156155G>C	uc003emh.1	-						IFT122_uc003eml.2_5'Flank|IFT122_uc003emm.2_5'Flank|IFT122_uc003emn.2_5'Flank|IFT122_uc003emo.2_5'Flank|IFT122_uc003emp.2_5'Flank|IFT122_uc010htc.2_5'Flank|IFT122_uc011bky.1_5'Flank|IFT122_uc003emq.2_5'Flank|MBD4_uc003emi.1_Intron|MBD4_uc003emj.1_Intron|MBD4_uc003emk.1_Intron|MBD4_uc011bkw.1_Intron|IFT122_uc011bkx.1_5'Flank	NM_003925	NP_003916	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4						depyrimidination	nucleoplasm	DNA N-glycosylase activity|endodeoxyribonuclease activity|protein binding|satellite DNA binding			ovary(1)|lung(1)	2						TTGTGGGCTAGAAAATGATAT	0.328								BER_DNA_glycosylases					3	54	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130285672	130285672	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130285672C>T	uc010htl.2	+	4	1440	c.1409C>T	c.(1408-1410)CCC>CTC	p.P470L		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	470	VWFA 3.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						AACATTGCTCCCCATAAGGTG	0.488													17	184	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130300468	130300468	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130300468T>C	uc010htl.2	+	8	3642	c.3611T>C	c.(3610-3612)CTT>CCT	p.L1204P	COL6A6_uc003eni.3_5'Flank	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	1204	VWFA 7.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						CAGACTTTGCTTGAAGGTCAG	0.463													14	170	---	---	---	---	PASS
AMOTL2	51421	broad.mit.edu	37	3	134084662	134084662	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134084662G>A	uc003eqf.2	-	5	1567	c.1450C>T	c.(1450-1452)CAG>TAG	p.Q484*	AMOTL2_uc003eqg.1_Nonsense_Mutation_p.Q426*|AMOTL2_uc003eqh.1_Nonsense_Mutation_p.Q426*|AMOTL2_uc003eqe.1_Nonsense_Mutation_p.Q51*	NM_016201	NP_057285	Q9Y2J4	AMOL2_HUMAN	angiomotin like 2	426	Potential.									large_intestine(1)	1						TACTCACTCTGAGCAAGCAGC	0.582													10	117	---	---	---	---	PASS
RASA2	5922	broad.mit.edu	37	3	141328368	141328368	+	Intron	SNP	A	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141328368A>T	uc003etz.1	+						RASA2_uc010huq.1_Intron|RASA2_uc003eua.1_Intron	NM_006506	NP_006497	Q15283	RASA2_HUMAN	RAS p21 protein activator 2						intracellular signal transduction|negative regulation of Ras protein signal transduction	intracellular membrane-bounded organelle|intrinsic to internal side of plasma membrane|perinuclear region of cytoplasm	metal ion binding|Ras GTPase activator activity			ovary(2)|lung(2)|breast(1)|skin(1)	6						GATGGAAGGTAAATACACAAT	0.308													5	94	---	---	---	---	PASS
SR140	23350	broad.mit.edu	37	3	142741417	142741417	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142741417G>A	uc003evh.1	+	11	1030	c.931G>A	c.(931-933)GAT>AAT	p.D311N	SR140_uc003evi.1_5'UTR|SR140_uc011bnj.1_Missense_Mutation_p.D311N|SR140_uc003evj.1_RNA|SR140_uc003evk.1_Missense_Mutation_p.D310N	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein	311	RRM.				RNA processing	nucleus	nucleotide binding|RNA binding				0						GCCTAGAACTGATGAAGAAAG	0.363													4	154	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	151131013	151131013	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151131013C>G	uc003eyp.2	+	40	6160	c.6122C>G	c.(6121-6123)TCC>TGC	p.S2041C	MED12L_uc011bnz.1_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	2041	Gln-rich.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AACCTTCCCTCCGTGCCCCTG	0.582													6	105	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154884713	154884713	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154884713G>T	uc010hvr.1	+	18	1894	c.1683G>T	c.(1681-1683)CAG>CAT	p.Q561H	MME_uc003fab.1_Missense_Mutation_p.Q561H|MME_uc003fac.1_Missense_Mutation_p.Q561H|MME_uc003fad.1_Missense_Mutation_p.Q561H|MME_uc003fae.1_Missense_Mutation_p.Q561H	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	561	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	GCATTCTGCAGCCCCCCTTCT	0.428													11	93	---	---	---	---	PASS
PHC3	80012	broad.mit.edu	37	3	169815104	169815104	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169815104C>A	uc010hws.1	-	15	2930	c.2866G>T	c.(2866-2868)GAA>TAA	p.E956*	PHC3_uc003fgl.2_Nonsense_Mutation_p.E968*	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3	956	SAM.				multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			AGATGGTCTTCTTTCAGCAAG	0.468													8	325	---	---	---	---	PASS
SLC7A14	57709	broad.mit.edu	37	3	170198250	170198250	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170198250C>T	uc003fgz.2	-	7	2137	c.1821G>A	c.(1819-1821)CTG>CTA	p.L607L	CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	607	Helical; (Potential).					integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			GGGTGCTGATCAGCAGCACCA	0.542													7	139	---	---	---	---	PASS
YEATS2	55689	broad.mit.edu	37	3	183439723	183439723	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183439723C>G	uc003fly.2	+	5	531	c.336C>G	c.(334-336)ATC>ATG	p.I112M		NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	112					histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ATCCTGCTATCAAGAAATTTT	0.358													8	268	---	---	---	---	PASS
ABCF3	55324	broad.mit.edu	37	3	183905220	183905220	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183905220G>A	uc003fmz.2	+	4	470	c.337G>A	c.(337-339)GAA>AAA	p.E113K	ABCF3_uc003fna.2_Missense_Mutation_p.E107K|ABCF3_uc003fnb.2_5'Flank	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),	113							ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCTAAAGAGGGAACAGTCCTC	0.463													51	109	---	---	---	---	PASS
ABCF3	55324	broad.mit.edu	37	3	183905691	183905691	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183905691G>C	uc003fmz.2	+	6	622	c.489G>C	c.(487-489)AAG>AAC	p.K163N	ABCF3_uc003fna.2_Missense_Mutation_p.K157N|ABCF3_uc003fnb.2_5'Flank	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),	163							ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCAGCAGAAAGGAGAGTCGGT	0.488													86	135	---	---	---	---	PASS
ABCF3	55324	broad.mit.edu	37	3	183906897	183906897	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183906897G>A	uc003fmz.2	+	10	1132	c.999G>A	c.(997-999)AGG>AGA	p.R333R	ABCF3_uc003fna.2_Silent_p.R327R|ABCF3_uc003fnb.2_Silent_p.R14R	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),	333	ABC transporter 1.						ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GTGGCTGGAGGATGAGGCTGG	0.557													32	79	---	---	---	---	PASS
ABCF3	55324	broad.mit.edu	37	3	183907068	183907068	+	Intron	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183907068G>C	uc003fmz.2	+						ABCF3_uc003fna.2_Intron|ABCF3_uc003fnb.2_Intron	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),								ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GTTAGATGGTGAGTTTGAAAT	0.498													34	154	---	---	---	---	PASS
ABCF3	55324	broad.mit.edu	37	3	183907074	183907074	+	Intron	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183907074G>A	uc003fmz.2	+						ABCF3_uc003fna.2_Intron|ABCF3_uc003fnb.2_Intron	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),								ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGGTGAGTTTGAAATGGGGCA	0.507													42	159	---	---	---	---	PASS
ABCF3	55324	broad.mit.edu	37	3	183907652	183907652	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183907652G>A	uc003fmz.2	+	14	1457	c.1324G>A	c.(1324-1326)GAC>AAC	p.D442N	ABCF3_uc003fna.2_Missense_Mutation_p.D436N|ABCF3_uc003fnb.2_Missense_Mutation_p.D123N	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),	442							ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGTTTTCATTGACCGGTTTCG	0.572													60	124	---	---	---	---	PASS
RFC4	5984	broad.mit.edu	37	3	186507860	186507860	+	Intron	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186507860G>A	uc003fqz.2	-						RFC4_uc011bsc.1_Intron	NM_002916	NP_002907	P35249	RFC4_HUMAN	replication factor C 4						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|phosphatidylinositol-mediated signaling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|large_intestine(1)	5	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		CTTCCTACGAGAAAAATTTAA	0.383													4	72	---	---	---	---	PASS
OPA1	4976	broad.mit.edu	37	3	193361385	193361385	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193361385G>C	uc003ftm.2	+	13	1515	c.1281G>C	c.(1279-1281)CAG>CAC	p.Q427H	OPA1_uc003ftg.2_Missense_Mutation_p.Q482H|OPA1_uc003fth.2_Missense_Mutation_p.Q446H|OPA1_uc003fti.2_Missense_Mutation_p.Q464H|OPA1_uc003ftj.2_Missense_Mutation_p.Q445H|OPA1_uc003ftk.2_Missense_Mutation_p.Q428H|OPA1_uc003ftl.2_Missense_Mutation_p.Q409H|OPA1_uc003ftn.2_Missense_Mutation_p.Q391H	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1	427	Mitochondrial intermembrane (By similarity).				apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		CTTACATGCAGAATCCTAATG	0.323													3	62	---	---	---	---	PASS
MUC20	200958	broad.mit.edu	37	3	195453355	195453355	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195453355G>C	uc010hzo.2	+	3	1494	c.1368G>C	c.(1366-1368)AAG>AAC	p.K456N	MUC20_uc010hzp.2_Missense_Mutation_p.K421N|MUC20_uc011bte.1_RNA	NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L	627	Involved in oligomerization.|Thr-rich.				protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CCTTAGCCAAGATCACAACCT	0.622													6	148	---	---	---	---	PASS
SENP5	205564	broad.mit.edu	37	3	196612242	196612242	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196612242C>G	uc003fwz.3	+	2	439	c.190C>G	c.(190-192)CTT>GTT	p.L64V	SENP5_uc011bty.1_Missense_Mutation_p.L64V	NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	64					cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			breast(2)|lung(1)	3	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		AAAGAAAGCTCTTCAAATCCA	0.403													3	68	---	---	---	---	PASS
LMLN	89782	broad.mit.edu	37	3	197712674	197712674	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197712674C>T	uc011buo.1	+	8	864	c.842C>T	c.(841-843)TCT>TTT	p.S281F	LMLN_uc003fyt.2_Missense_Mutation_p.S229F|LMLN_uc010iar.2_Missense_Mutation_p.S281F|LMLN_uc010ias.2_Missense_Mutation_p.S229F|LMLN_uc003fyu.2_Missense_Mutation_p.S41F	NM_033029	NP_149018	Q96KR4	LMLN_HUMAN	leishmanolysin-like isoform 2	281					cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		CAGGGTTTCTCTGCTGGGCTG	0.398													5	141	---	---	---	---	PASS
FAM193A	8603	broad.mit.edu	37	4	2701692	2701692	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2701692G>C	uc010icl.2	+	17	3271	c.2920G>C	c.(2920-2922)GAG>CAG	p.E974Q	FAM193A_uc010ick.2_Missense_Mutation_p.E1174Q|FAM193A_uc003gfd.2_Missense_Mutation_p.E974Q|FAM193A_uc011bvm.1_Missense_Mutation_p.E996Q|FAM193A_uc011bvn.1_Missense_Mutation_p.E974Q|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Missense_Mutation_p.E828Q	NM_003704	NP_003695	P78312	F193A_HUMAN	hypothetical protein LOC8603	974										ovary(3)	3						TGGCTCACTAGAGCAAACTGA	0.517													15	108	---	---	---	---	PASS
HS3ST1	9957	broad.mit.edu	37	4	11401378	11401378	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11401378C>T	uc003gmq.2	-	2	575	c.252G>A	c.(250-252)GAG>GAA	p.E84E		NM_005114	NP_005105	O14792	HS3S1_HUMAN	heparan sulfate D-glucosaminyl	84						Golgi lumen|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			skin(1)	1						GGACCTCGTTCTCCGCGGCCG	0.657													11	69	---	---	---	---	PASS
C1QTNF7	114905	broad.mit.edu	37	4	15444362	15444362	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15444362G>C	uc011bxb.1	+	3	1036	c.809G>C	c.(808-810)GGG>GCG	p.G270A	C1QTNF7_uc003gno.2_Missense_Mutation_p.G277A|C1QTNF7_uc003gnp.2_Missense_Mutation_p.G270A	NM_001135171	NP_001128643	Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7	270	C1q.					collagen					0						TTATTCTCCGGGTTTCTCTTA	0.443													5	118	---	---	---	---	PASS
LDB2	9079	broad.mit.edu	37	4	16510277	16510277	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16510277T>C	uc003goz.2	-	7	1088	c.772A>G	c.(772-774)AGA>GGA	p.R258G	LDB2_uc003gpa.2_Missense_Mutation_p.R258G|LDB2_uc003gpb.2_Missense_Mutation_p.R258G|LDB2_uc011bxh.1_Missense_Mutation_p.R230G|LDB2_uc010iee.2_Missense_Mutation_p.R258G|LDB2_uc003goy.2_Missense_Mutation_p.R133G|LDB2_uc011bxi.1_Missense_Mutation_p.R134G	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a	258							LIM domain binding|transcription cofactor activity				0						TTCCTTTTTCTCCGTTTGGTT	0.483													12	93	---	---	---	---	PASS
SLIT2	9353	broad.mit.edu	37	4	20493390	20493390	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20493390A>G	uc003gpr.1	+	9	986	c.782A>G	c.(781-783)CAG>CGG	p.Q261R	SLIT2_uc003gps.1_Missense_Mutation_p.Q261R	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	261					apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						TTAGGTCACCAGTCATTTATG	0.393													4	130	---	---	---	---	PASS
PCDH7	5099	broad.mit.edu	37	4	30725257	30725257	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30725257A>G	uc003gsk.1	+	1	3221	c.2213A>G	c.(2212-2214)AAT>AGT	p.N738S	PCDH7_uc011bxw.1_Missense_Mutation_p.N691S|PCDH7_uc011bxx.1_Missense_Mutation_p.N738S	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	738	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						GAAAATGACAATGCTCCCACA	0.473													6	104	---	---	---	---	PASS
GRXCR1	389207	broad.mit.edu	37	4	42895496	42895496	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42895496T>G	uc003gwt.2	+	1	213	c.213T>G	c.(211-213)GAT>GAG	p.D71E		NM_001080476	NP_001073945	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	71					cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity			ovary(1)	1						CAGAAGGTGATGAGAATGAGA	0.468													18	182	---	---	---	---	PASS
AFM	173	broad.mit.edu	37	4	74364940	74364940	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74364940G>C	uc003hhb.2	+	11	1430	c.1399G>C	c.(1399-1401)GAG>CAG	p.E467Q		NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor	467	Albumin 3.				vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GCTAAGTGAAGAGTTTGCCTG	0.403													3	68	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79308543	79308543	+	Silent	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79308543G>C	uc003hlb.2	+	29	4103	c.3663G>C	c.(3661-3663)CTG>CTC	p.L1221L	FRAS1_uc003hkw.2_Silent_p.L1221L	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	1220	CSPG 2.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CCTATGTGCTGAGAAATGAAG	0.473													3	85	---	---	---	---	PASS
GK2	2712	broad.mit.edu	37	4	80328291	80328291	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80328291G>A	uc003hlu.2	-	1	1082	c.1064C>T	c.(1063-1065)TCT>TTT	p.S355F		NM_033214	NP_149991	Q14410	GLPK2_HUMAN	glycerol kinase 2	355					glycerol-3-phosphate metabolic process	mitochondrial outer membrane	ATP binding|glycerol kinase activity			ovary(2)|skin(2)	4						ACAGCCATAAGAAGTTCCTAC	0.438													5	95	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85687027	85687027	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85687027G>A	uc003hpd.2	-	32	5532	c.5124C>T	c.(5122-5124)CTC>CTT	p.L1708L		NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	1708						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTCCACCACTGAGTCCTTCTT	0.403													4	94	---	---	---	---	PASS
PTPN13	5783	broad.mit.edu	37	4	87655973	87655973	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87655973C>A	uc003hpz.2	+	14	2576	c.2096C>A	c.(2095-2097)TCC>TAC	p.S699Y	PTPN13_uc003hpy.2_Missense_Mutation_p.S699Y|PTPN13_uc003hqa.2_Missense_Mutation_p.S699Y|PTPN13_uc003hqb.2_Missense_Mutation_p.S699Y	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	699	FERM.					cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		GATGAGACTTCCTTATTGCTG	0.408													7	223	---	---	---	---	PASS
HERC3	8916	broad.mit.edu	37	4	89574214	89574214	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89574214G>A	uc003hrw.1	+	6	824	c.658G>A	c.(658-660)GGG>AGG	p.G220R	HERC3_uc003hrv.2_Missense_Mutation_p.G220R|HERC3_uc011cdn.1_Missense_Mutation_p.G102R	NM_014606	NP_055421	Q15034	HERC3_HUMAN	hect domain and RLD 3	220	RCC1 5.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		GAATAATGCCGGGCAGCTAGG	0.438													9	91	---	---	---	---	PASS
HPGDS	27306	broad.mit.edu	37	4	95220778	95220778	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95220778G>A	uc003hte.1	-	6	544	c.453C>T	c.(451-453)TTC>TTT	p.F151F		NM_014485	NP_055300	O60760	HPGDS_HUMAN	prostaglandin D2 synthase, hematopoietic	151	GST C-terminal.				locomotory behavior|prostaglandin biosynthetic process|signal transduction	cytoplasm|nucleus	calcium ion binding|glutathione transferase activity|magnesium ion binding|prostaglandin-D synthase activity|protein homodimerization activity			ovary(1)	1					Glutathione(DB00143)	TCTCCCAGTAGAAGTCTGCCC	0.388													10	57	---	---	---	---	PASS
ADH4	127	broad.mit.edu	37	4	100057749	100057749	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100057749A>T	uc003hun.2	-	5	526	c.450T>A	c.(448-450)AGT>AGA	p.S150R	uc003hum.1_Intron|ADH4_uc011ced.1_Missense_Mutation_p.S169R	NM_000670	NP_000661	P08319	ADH4_HUMAN	class II alcohol dehydrogenase, pi subunit	150					alcohol catabolic process|cellular aldehyde metabolic process|ethanol oxidation|quinone cofactor metabolic process|retinol metabolic process|xenobiotic metabolic process	cytosol|microtubule cytoskeleton	alcohol dehydrogenase activity, zinc-dependent|all-trans retinal binding|benzaldehyde dehydrogenase activity|NAD binding|NADPH:quinone reductase activity|retinol binding|retinol dehydrogenase activity|zinc ion binding			skin(2)	2				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)	NADH(DB00157)	GAGAGAATGTACTGGTTCCAA	0.388													13	79	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126336234	126336234	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126336234T>C	uc003ifj.3	+	5	6116	c.6116T>C	c.(6115-6117)ATT>ACT	p.I2039T	FAT4_uc011cgp.1_Missense_Mutation_p.I337T	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	2039	Cadherin 19.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						CAAGTCTCCATTATTTTGTTG	0.408													21	181	---	---	---	---	PASS
UCP1	7350	broad.mit.edu	37	4	141489037	141489037	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141489037A>T	uc011chj.1	-	2	297	c.221T>A	c.(220-222)CTC>CAC	p.L74H	UCP1_uc011chk.1_Missense_Mutation_p.L74H	NM_021833	NP_068605	P25874	UCP1_HUMAN	uncoupling protein 1	74	Solcar 1.|Helical; Name=2; (Potential).				brown fat cell differentiation|cellular lipid metabolic process|respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	binding			ovary(1)	1	all_hematologic(180;0.162)					CCCGCTGTAGAGTTTCATCCG	0.562													9	127	---	---	---	---	PASS
FHDC1	85462	broad.mit.edu	37	4	153896413	153896413	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153896413C>T	uc003inf.2	+	11	2045	c.1970C>T	c.(1969-1971)TCA>TTA	p.S657L		NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	657					actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					AGCCTGGGCTCAGCACAGTCC	0.637													4	55	---	---	---	---	PASS
DDX60L	91351	broad.mit.edu	37	4	169305853	169305853	+	Silent	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169305853C>G	uc003irq.3	-	30	4247	c.4026G>C	c.(4024-4026)CTG>CTC	p.L1342L		NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	1342	Helicase C-terminal.						ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		ACTGTCCTCTCAGCTCAGGAA	0.502													5	40	---	---	---	---	PASS
DCTD	1635	broad.mit.edu	37	4	183812586	183812586	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183812586G>A	uc003ivf.2	-	6	677	c.503C>T	c.(502-504)TCA>TTA	p.S168L	DCTD_uc003ivg.2_Missense_Mutation_p.S179L|DCTD_uc010irw.2_Missense_Mutation_p.S109L|DCTD_uc003ivh.2_Missense_Mutation_p.S109L	NM_001921	NP_001912	P32321	DCTD_HUMAN	dCMP deaminase isoform b	168					nucleotide biosynthetic process|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide metabolic process	cytosol	dCMP deaminase activity|zinc ion binding				0		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00666)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.202)		all cancers(43;1.65e-24)|Epithelial(43;3.44e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.39e-10)|Colorectal(24;4.69e-07)|COAD - Colon adenocarcinoma(29;7.07e-05)|STAD - Stomach adenocarcinoma(60;0.000118)|GBM - Glioblastoma multiforme(59;0.000472)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.0419)		GCTGTTAATTGAATCAAAGTC	0.348													5	208	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187540391	187540391	+	Nonsense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187540391G>C	uc003izf.2	-	10	7537	c.7349C>G	c.(7348-7350)TCA>TGA	p.S2450*		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	2450	Extracellular (Potential).|Cadherin 22.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						GTGCAGGTTTGAGAGGGTGAT	0.433										HNSCC(5;0.00058)			24	214	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26886084	26886084	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26886084C>T	uc003jgs.1	-	10	1790	c.1621G>A	c.(1621-1623)GAT>AAT	p.D541N	CDH9_uc011cnv.1_Missense_Mutation_p.D134N	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	541	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						CCTTTATTATCTACAATGGTG	0.303													6	195	---	---	---	---	PASS
RNASEN	29102	broad.mit.edu	37	5	31464342	31464342	+	Splice_Site	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31464342C>A	uc003jhg.2	-	19	2933	c.2574_splice	c.e19+1	p.Q858_splice	RNASEN_uc003jhh.2_Splice_Site_p.Q821_splice|RNASEN_uc003jhi.2_Splice_Site_p.Q821_splice	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						AGTCTCCCCACCTGACAGACA	0.408													13	59	---	---	---	---	PASS
SUB1	10923	broad.mit.edu	37	5	32599095	32599095	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32599095G>A	uc003jhs.2	+	4	352	c.224G>A	c.(223-225)CGC>CAC	p.R75H	SUB1_uc003jht.2_RNA	NM_006713	NP_006704	P53999	TCP4_HUMAN	activated RNA polymerase II transcription	75				R->G: Reduced ssDNA binding.	regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleolus|transcription factor complex	protein binding|single-stranded DNA binding|transcription coactivator activity				0						GTTAGTGTTCGCGATTTTAAA	0.353													7	86	---	---	---	---	PASS
IL7R	3575	broad.mit.edu	37	5	35857078	35857078	+	5'UTR	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35857078G>C	uc003jjs.2	+	1					IL7R_uc011coo.1_5'UTR|IL7R_uc011cop.1_RNA	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor						immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			atctctctcAGAATGACAATT	0.199													5	141	---	---	---	---	PASS
C9	735	broad.mit.edu	37	5	39306829	39306829	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39306829A>T	uc003jlv.3	-	9	1395	c.1306T>A	c.(1306-1308)TAT>AAT	p.Y436N		NM_001737	NP_001728	P02748	CO9_HUMAN	complement component 9 precursor	436	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis|hemolysis by symbiont of host erythrocytes	extracellular region|membrane attack complex					0	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			TCAAATGCATATTTTCTGGTT	0.403													30	113	---	---	---	---	PASS
CARD6	84674	broad.mit.edu	37	5	40852847	40852847	+	Silent	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40852847C>G	uc003jmg.2	+	3	1488	c.1413C>G	c.(1411-1413)CTC>CTG	p.L471L		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	471					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						CCAGAATCCTCAACACACTTC	0.453													15	125	---	---	---	---	PASS
GPBP1	65056	broad.mit.edu	37	5	56557114	56557114	+	Intron	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56557114G>A	uc003jrh.3	+						GPBP1_uc010iwg.2_Intron|GPBP1_uc003jri.3_Intron|GPBP1_uc003jrj.3_Intron|GPBP1_uc003jrk.3_Intron|GPBP1_uc003jrl.3_Intron	NM_022913	NP_075064	Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			large_intestine(1)|central_nervous_system(1)	2		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		GAACAGGTAAGAAAACCTGAA	0.363													4	116	---	---	---	---	PASS
OTP	23440	broad.mit.edu	37	5	76932787	76932787	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76932787C>T	uc003kfg.2	-	2	454	c.306G>A	c.(304-306)CAG>CAA	p.Q102Q		NM_032109	NP_115485	Q5XKR4	OTP_HUMAN	orthopedia homeobox	102						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		GCTTCTGCTTCTGTTGGCCCT	0.677													9	147	---	---	---	---	PASS
TTC37	9652	broad.mit.edu	37	5	94852864	94852864	+	Silent	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94852864G>C	uc003klb.2	-	21	2547	c.2277C>G	c.(2275-2277)CTC>CTG	p.L759L		NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	759							binding			ovary(3)|pancreas(1)	4						CTCCAAGGTGGAGGAGCTCAT	0.358													5	52	---	---	---	---	PASS
PCSK1	5122	broad.mit.edu	37	5	95759116	95759116	+	Silent	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95759116C>G	uc003kls.1	-	4	650	c.444G>C	c.(442-444)GTG>GTC	p.V148V		NM_000439	NP_000430	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	148	Catalytic.				cell-cell signaling|cellular nitrogen compound metabolic process|energy reserve metabolic process|hormone biosynthetic process|peptide biosynthetic process|peptide hormone processing|regulation of insulin secretion	extracellular space|stored secretory granule|transport vesicle	serine-type endopeptidase activity			ovary(2)	2		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AAACAGGTATCACATGAAGGT	0.438													4	46	---	---	---	---	PASS
MATR3	9782	broad.mit.edu	37	5	138654711	138654711	+	Nonsense_Mutation	SNP	A	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138654711A>T	uc003ldu.2	+	11	1850	c.1423A>T	c.(1423-1425)AAA>TAA	p.K475*	MATR3_uc010jfb.2_Nonsense_Mutation_p.K475*|MATR3_uc003ldt.2_Nonsense_Mutation_p.K137*|MATR3_uc003ldw.2_Nonsense_Mutation_p.K475*|MATR3_uc003ldx.2_Nonsense_Mutation_p.K475*|MATR3_uc010jfc.2_Nonsense_Mutation_p.K475*|MATR3_uc003ldy.2_Nonsense_Mutation_p.K152*|MATR3_uc011czb.1_Nonsense_Mutation_p.K187*|MATR3_uc003ldz.2_Nonsense_Mutation_p.K475*|MATR3_uc003lea.2_Nonsense_Mutation_p.K475*|MATR3_uc003leb.2_Nonsense_Mutation_p.K137*|MATR3_uc003lec.2_Nonsense_Mutation_p.K152*	NM_199189	NP_954659	P43243	MATR3_HUMAN	matrin 3	475						nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCAGAAGTATAAAAGAATAAA	0.338													4	45	---	---	---	---	PASS
PCDHAC2	56134	broad.mit.edu	37	5	140346482	140346482	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140346482T>A	uc003lii.2	+	1	371	c.131T>A	c.(130-132)CTG>CAG	p.L44Q	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lih.2_Intron|PCDHAC2_uc011dag.1_Missense_Mutation_p.L44Q	NM_018899	NP_061722	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2 isoform 1	44	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTCCCAGCTGCGATACTCT	0.572													5	12	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140554092	140554092	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140554092C>A	uc003lit.2	+	1	1850	c.1676C>A	c.(1675-1677)CCC>CAC	p.P559H		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	559	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GACAACTCGCCCTTCGTGCTG	0.726													8	90	---	---	---	---	PASS
FAM114A2	10827	broad.mit.edu	37	5	153413451	153413451	+	Intron	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153413451G>A	uc003lvb.2	-						FAM114A2_uc003lvc.2_Intron|FAM114A2_uc003lvd.2_Intron|FAM114A2_uc003lve.2_Intron|FAM114A2_uc011dda.1_Intron	NM_018691	NP_061161	Q9NRY5	F1142_HUMAN	hypothetical protein LOC10827								purine nucleotide binding				0						GTCCTAATGAGAAAAATAACT	0.343													3	41	---	---	---	---	PASS
TIMD4	91937	broad.mit.edu	37	5	156390205	156390205	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156390205G>C	uc003lwh.2	-	1	62	c.5C>G	c.(4-6)TCC>TGC	p.S2C	TIMD4_uc010jii.2_Missense_Mutation_p.S2C	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain	2						integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGGTTCTTTGGACATTTTGAC	0.448													13	138	---	---	---	---	PASS
THG1L	54974	broad.mit.edu	37	5	157158520	157158520	+	Silent	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157158520G>C	uc003lxd.2	+	1	198	c.72G>C	c.(70-72)CTG>CTC	p.L24L	THG1L_uc011ddu.1_5'UTR	NM_017872	NP_060342	Q9NWX6	THG1_HUMAN	interphase cytoplasmic foci protein 45	24					protein homotetramerization|tRNA modification	mitochondrion	GTP binding|metal ion binding|tRNA guanylyltransferase activity				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GACGGTACCTGAGATTGGGGG	0.557													4	167	---	---	---	---	PASS
RNF145	153830	broad.mit.edu	37	5	158585685	158585685	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158585685G>A	uc003lxp.2	-	11	2298	c.1985C>T	c.(1984-1986)TCA>TTA	p.S662L	RNF145_uc011ddy.1_Missense_Mutation_p.S676L|RNF145_uc003lxo.1_Missense_Mutation_p.S690L|RNF145_uc011ddz.1_Missense_Mutation_p.S679L|RNF145_uc010jiq.1_Missense_Mutation_p.S692L	NM_144726	NP_653327	Q96MT1	RN145_HUMAN	ring finger protein 145	662						integral to membrane	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCTCTAGGCTGATTCAACAGG	0.423													18	213	---	---	---	---	PASS
ATP10B	23120	broad.mit.edu	37	5	160047610	160047610	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160047610C>G	uc003lym.1	-	15	3007	c.2160G>C	c.(2158-2160)GAG>GAC	p.E720D	ATP10B_uc010jit.1_Missense_Mutation_p.E37D|ATP10B_uc003lyn.2_Missense_Mutation_p.E278D	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B	720	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CATCAGGGCTCTCAGCCTCGT	0.642													5	63	---	---	---	---	PASS
CDHR2	54825	broad.mit.edu	37	5	176022523	176022523	+	Intron	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176022523C>G	uc003mem.1	+						CDHR2_uc003men.1_Intron	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor						homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2						TCCTCTCCCTCTCCCTGCAGG	0.647													4	137	---	---	---	---	PASS
ZNF346	23567	broad.mit.edu	37	5	176477774	176477774	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176477774G>C	uc003mfi.2	+	5	583	c.540G>C	c.(538-540)ATG>ATC	p.M180I	ZNF346_uc011dfr.1_Missense_Mutation_p.M148I|ZNF346_uc011dfs.1_Missense_Mutation_p.M82I|ZNF346_uc003mfj.2_Intron|ZNF346_uc003mfk.1_Missense_Mutation_p.M205I|ZNF346_uc011dft.1_Intron	NM_012279	NP_036411	Q9UL40	ZN346_HUMAN	zinc finger protein 346	180						cytoplasm|nucleolus	double-stranded RNA binding|zinc ion binding				0	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATAGAGAGATGATAGACCCAG	0.463													11	90	---	---	---	---	PASS
SERPINB6	5269	broad.mit.edu	37	6	2948803	2948803	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2948803C>T	uc003muk.2	-	6	2855	c.860G>A	c.(859-861)CGC>CAC	p.R287H	SERPINB6_uc003mui.2_Missense_Mutation_p.R170H|SERPINB6_uc003muj.2_RNA|SERPINB6_uc003mul.2_Missense_Mutation_p.R287H|SERPINB6_uc003mum.2_Missense_Mutation_p.R287H|SERPINB6_uc003mun.2_Missense_Mutation_p.R287H|SERPINB6_uc003muo.2_Missense_Mutation_p.R287H	NM_004568	NP_004559	P35237	SPB6_HUMAN	serine (or cysteine) proteinase inhibitor, clade	287					regulation of proteolysis	centrosome|cytosol|protein complex	protease binding|serine-type endopeptidase inhibitor activity				0	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	GCCCAGGTTGCGCAGGACACT	0.537													10	207	---	---	---	---	PASS
MYLIP	29116	broad.mit.edu	37	6	16130818	16130818	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16130818G>A	uc003nbq.2	+	2	355	c.118G>A	c.(118-120)GAC>AAC	p.D40N	MYLIP_uc003nbr.2_Intron	NM_013262	NP_037394	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting	40	FERM.				cellular component movement|nervous system development	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|ubiquitin-protein ligase activity|zinc ion binding			pancreas(1)	1	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			CATAGAAGTTGACTATTTTGG	0.478													9	148	---	---	---	---	PASS
FAM65B	9750	broad.mit.edu	37	6	24865603	24865603	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24865603C>T	uc003neo.1	-	7	666	c.490G>A	c.(490-492)GCA>ACA	p.A164T	FAM65B_uc011djs.1_Missense_Mutation_p.A193T|FAM65B_uc011dju.1_Missense_Mutation_p.A198T|FAM65B_uc003nep.2_Missense_Mutation_p.A164T|FAM65B_uc011djt.1_Missense_Mutation_p.A164T	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN	hypothetical protein LOC9750 isoform 1	164					cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1						GGGGATGTTGCGAAGGCTTGC	0.493													4	73	---	---	---	---	PASS
HIST1H2BI	8346	broad.mit.edu	37	6	26273483	26273483	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26273483G>C	uc003nhk.2	+	1	280	c.280G>C	c.(280-282)GAG>CAG	p.E94Q	HIST1H3G_uc003nhi.2_5'Flank	NM_003525	NP_003516	P62807	H2B1C_HUMAN	histone cluster 1, H2bi	94					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding				0						CACTTCCAGGGAGATCCAAAC	0.592													3	127	---	---	---	---	PASS
MOG	4340	broad.mit.edu	37	6	29627140	29627140	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29627140G>A	uc003nnf.2	+	2	311	c.133G>A	c.(133-135)GTC>ATC	p.V45I	MOG_uc003qzk.1_Missense_Mutation_p.V45I|MOG_uc010kle.1_Intron|MOG_uc010klf.1_Intron|MOG_uc003nmy.1_Missense_Mutation_p.V45I|MOG_uc003nmz.2_Missense_Mutation_p.V45I|MOG_uc011dlt.1_5'UTR|MOG_uc003nna.2_Intron|MOG_uc011dlu.1_Intron|MOG_uc011dlv.1_Intron|MOG_uc003nnd.2_Missense_Mutation_p.V45I|MOG_uc003nne.2_Missense_Mutation_p.V45I|MOG_uc003nng.2_Missense_Mutation_p.V45I|MOG_uc003nnh.2_Missense_Mutation_p.V45I|MOG_uc003nni.2_Missense_Mutation_p.V45I|MOG_uc003nnj.2_Missense_Mutation_p.V45I|MOG_uc003nnk.2_Missense_Mutation_p.V45I	NM_206809	NP_996532	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein isoform	45	Ig-like V-type.|Extracellular (Potential).				cell adhesion|central nervous system development|positive regulation of MyD88-dependent toll-like receptor signaling pathway	integral to membrane|plasma membrane				ovary(1)	1						CCGGGCTCTGGTCGGGGATGA	0.547													70	189	---	---	---	---	PASS
C6orf27	80737	broad.mit.edu	37	6	31733830	31733830	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31733830G>A	uc011dog.1	-	16	2567	c.2329C>T	c.(2329-2331)CAC>TAC	p.H777Y		NM_025258	NP_079534	Q9Y334	G7C_HUMAN	G7c protein precursor	777						extracellular region				ovary(3)	3						AGTTCCAGGTGAGCCCTGGAG	0.647													10	126	---	---	---	---	PASS
HSPA1L	3305	broad.mit.edu	37	6	31778604	31778604	+	Silent	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31778604C>G	uc003nxh.2	-	2	1329	c.1146G>C	c.(1144-1146)CTG>CTC	p.L382L	HSPA1L_uc010jte.2_Silent_p.L382L	NM_005527	NP_005518	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	382					response to unfolded protein		ATP binding			ovary(3)|pleura(1)|kidney(1)|skin(1)	6						TGTCCCCCATCAGGATGGCTG	0.597													4	101	---	---	---	---	PASS
SLC39A7	7922	broad.mit.edu	37	6	33169260	33169260	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33169260G>C	uc003odf.2	+	2	355	c.238G>C	c.(238-240)GAC>CAC	p.D80H	RXRB_uc003odb.2_5'Flank|RXRB_uc003odc.2_5'Flank|RXRB_uc003odd.2_5'Flank|RXRB_uc011dqr.1_5'Flank|RXRB_uc011dqs.1_5'Flank|RXRB_uc003ode.1_5'Flank|RXRB_uc011dqt.1_5'Flank|RXRB_uc011dqu.1_5'Flank|SLC39A7_uc003odg.2_Missense_Mutation_p.D80H|SLC39A7_uc011dqv.1_Intron|SLC39A7_uc003odh.2_5'Flank	NM_001077516	NP_001070984	Q92504	S39A7_HUMAN	solute carrier family 39, member 7	80	His-rich.					endoplasmic reticulum membrane|integral to membrane|membrane fraction	protein binding|zinc ion transmembrane transporter activity			large_intestine(1)	1						CCACGATCACGACCATGGACA	0.537													3	128	---	---	---	---	PASS
ETV7	51513	broad.mit.edu	37	6	36336811	36336811	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36336811G>A	uc003omb.2	-	6	851	c.702C>T	c.(700-702)CTC>CTT	p.L234L	ETV7_uc003olz.1_Silent_p.L234L|ETV7_uc003oma.1_Silent_p.L179L|ETV7_uc010jwg.2_RNA|ETV7_uc003omc.2_Silent_p.L179L|ETV7_uc010jwj.2_Silent_p.L175L|ETV7_uc010jwh.2_Silent_p.L153L|ETV7_uc010jwi.2_Silent_p.L157L|ETV7_uc011dtl.1_Silent_p.L83L	NM_016135	NP_057219	Q9Y603	ETV7_HUMAN	ets variant 7	234	ETS.				organ morphogenesis|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						GGGTATCAAGGAGCAGCTGAT	0.537													5	109	---	---	---	---	PASS
TJAP1	93643	broad.mit.edu	37	6	43472651	43472651	+	Silent	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43472651C>G	uc003ovd.2	+	11	1108	c.732C>G	c.(730-732)CTC>CTG	p.L244L	TJAP1_uc003ovf.2_Silent_p.L234L|TJAP1_uc003ove.2_Silent_p.L234L|TJAP1_uc003ovc.2_Silent_p.L234L|TJAP1_uc010jyp.2_Silent_p.L203L|TJAP1_uc011dvh.1_Silent_p.L234L|TJAP1_uc003ovg.2_Silent_p.L110L|TJAP1_uc011dvi.1_Silent_p.L244L|TJAP1_uc011dvj.1_Silent_p.L44L|TJAP1_uc003ovi.2_Silent_p.L110L	NM_001146016	NP_001139488	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 isoform a	244						Golgi apparatus|tight junction	protein binding				0	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CTCTACTGCTCAATTCAGCCC	0.632													6	152	---	---	---	---	PASS
MUT	4594	broad.mit.edu	37	6	49416531	49416531	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49416531G>C	uc003ozg.3	-	7	1697	c.1442C>G	c.(1441-1443)TCT>TGT	p.S481C		NM_000255	NP_000246	P22033	MUTA_HUMAN	methylmalonyl Coenzyme A mutase precursor	481					fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity				0	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TATCTTACCAGAATCTATTCT	0.333													4	169	---	---	---	---	PASS
CRISP3	10321	broad.mit.edu	37	6	49704215	49704215	+	Silent	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49704215G>T	uc003ozs.2	-	3	93	c.78C>A	c.(76-78)CCC>CCA	p.P26P		NM_006061	NP_006052	P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3 precursor	26					innate immune response	proteinaceous extracellular matrix|specific granule		p.P26P(1)		skin(2)	2	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			CAGTAAAAGCGGGATCCTAAG	0.368													39	192	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51890607	51890607	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51890607A>G	uc003pah.1	-	32	4277	c.4001T>C	c.(4000-4002)CTG>CCG	p.L1334P	PKHD1_uc003pai.2_Missense_Mutation_p.L1334P	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1334	IPT/TIG 8; atypical.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					ATCACAGTTCAGGTTCCCCAG	0.527													3	113	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51900492	51900492	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51900492G>A	uc003pah.1	-	28	3401	c.3125C>T	c.(3124-3126)TCT>TTT	p.S1042F	PKHD1_uc003pai.2_Missense_Mutation_p.S1042F	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1042	IPT/TIG 5.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TTCCAAACTAGAGCCTCGGAT	0.433													11	142	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56469654	56469654	+	Intron	SNP	T	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56469654T>C	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Missense_Mutation_p.T2721A	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GAAATTTCTGTTCCTCCTCCT	0.368													7	92	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79655828	79655828	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79655828C>T	uc003pir.2	-	38	4746	c.4520G>A	c.(4519-4521)AGA>AAA	p.R1507K	PHIP_uc003piq.2_Missense_Mutation_p.R531K|PHIP_uc011dyp.1_Missense_Mutation_p.R1506K|IRAK1BP1_uc010kbg.1_RNA|PHIP_uc003pio.3_Missense_Mutation_p.R393K	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1507					insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TCGGTTGCTTCTGGTTCGAAC	0.428													4	92	---	---	---	---	PASS
TBX18	9096	broad.mit.edu	37	6	85446684	85446684	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85446684G>A	uc003pkl.1	-	8	1543	c.1543C>T	c.(1543-1545)CAG>TAG	p.Q515*	TBX18_uc010kbq.1_Intron	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	515					multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		TAGGAACCCTGATGGGTCTGG	0.483													15	247	---	---	---	---	PASS
FAM162B	221303	broad.mit.edu	37	6	117086374	117086374	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117086374C>A	uc003pxi.2	-	2	364	c.217G>T	c.(217-219)GAC>TAC	p.D73Y		NM_001085480	NP_001078949	Q5T6X4	F162B_HUMAN	hypothetical protein LOC221303	73						integral to membrane					0						ATTTTCTTGTCGAACTGCGAA	0.617													6	56	---	---	---	---	PASS
MCM9	254394	broad.mit.edu	37	6	119243248	119243248	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119243248G>T	uc003pyh.2	-	4	888	c.625C>A	c.(625-627)CAA>AAA	p.Q209K		NM_153255	NP_694987	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	209					DNA replication		ATP binding|DNA binding|nucleoside-triphosphatase activity			ovary(1)	1		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		GATAGCCTTTGAACCTAGCAA	0.338													9	140	---	---	---	---	PASS
C6orf174	387104	broad.mit.edu	37	6	127837647	127837647	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127837647C>T	uc003qbd.2	-	2	978	c.113G>A	c.(112-114)CGA>CAA	p.R38Q		NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor	38						integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		TGACTGAGCTCGCTGCTGCTT	0.662													6	40	---	---	---	---	PASS
C6orf191	253582	broad.mit.edu	37	6	130164698	130164698	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130164698G>A	uc003qbs.2	-	3	253	c.170C>T	c.(169-171)TCA>TTA	p.S57L		NM_001010876	NP_001010876	Q5VVB8	CF191_HUMAN	hypothetical protein LOC253582	57						integral to membrane				large_intestine(1)	1				GBM - Glioblastoma multiforme(226;0.0387)|all cancers(137;0.115)|OV - Ovarian serous cystadenocarcinoma(155;0.131)		GTTGAGCCATGAGGGATTTGT	0.299													17	147	---	---	---	---	PASS
SMOC2	64094	broad.mit.edu	37	6	168947789	168947789	+	Intron	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168947789C>A	uc003qws.1	+						SMOC2_uc003qwr.1_Missense_Mutation_p.L179M	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CTTTTCCGTTCTGAATTCAGA	0.512													9	143	---	---	---	---	PASS
PDCD2	5134	broad.mit.edu	37	6	170892684	170892684	+	Silent	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170892684C>A	uc003qxw.2	-	2	514	c.435G>T	c.(433-435)ACG>ACT	p.T145T	PDCD2_uc003qxv.2_Silent_p.T112T|PDCD2_uc003qxx.1_Silent_p.T145T|PDCD2_uc003qxy.2_Silent_p.T112T|PDCD2_uc003qxz.2_Silent_p.T145T|PDCD2_uc003qya.2_Silent_p.T112T|PDCD2_uc003qyb.1_Silent_p.T68T	NM_002598	NP_002589	Q16342	PDCD2_HUMAN	programmed cell death 2 isoform 1	145	MYND-type.				apoptosis	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding				0		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|BRCA - Breast invasive adenocarcinoma(81;4.82e-06)|GBM - Glioblastoma multiforme(31;0.142)		ATCTGGAGCACGTTTTGGGGC	0.507													3	83	---	---	---	---	PASS
ACTB	60	broad.mit.edu	37	7	5567445	5567445	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5567445C>G	uc003sos.3	-	5	1098	c.1062G>C	c.(1060-1062)CAG>CAC	p.Q354H	ACTB_uc003sor.3_Missense_Mutation_p.Q232H|ACTB_uc003sot.3_Missense_Mutation_p.Q354H|ACTB_uc003soq.3_Missense_Mutation_p.Q232H|ACTB_uc010ksy.2_Missense_Mutation_p.Q232H	NM_001101	NP_001092	P60709	ACTB_HUMAN	beta actin	354					'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton				0		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		TGATCCACATCTGCTGGAAGG	0.577													13	145	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11675950	11675950	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11675950G>A	uc003ssf.3	-	2	1081	c.829C>T	c.(829-831)CGC>TGC	p.R277C		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	277	Extracellular (Potential).|Potential.					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TTCTTCCCGCGTCTCCTTGCT	0.537										HNSCC(18;0.044)			19	137	---	---	---	---	PASS
HIP1	3092	broad.mit.edu	37	7	75186969	75186969	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75186969C>A	uc003uds.1	-	16	1611	c.1570G>T	c.(1570-1572)GGC>TGC	p.G524C	HIP1_uc011kfz.1_Missense_Mutation_p.G401C	NM_005338	NP_005329	O00291	HIP1_HUMAN	huntingtin interacting protein 1	524	Potential.				activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						TTCCGCTGGCCCTGGTCACTG	0.582			T	PDGFRB	CMML								18	184	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82764823	82764823	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82764823C>A	uc003uhx.2	-	3	2332	c.2043G>T	c.(2041-2043)CAG>CAT	p.Q681H	PCLO_uc003uhv.2_Missense_Mutation_p.Q681H	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	627	Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TTGGGGAAGTCTGCTGTGGCT	0.527													6	70	---	---	---	---	PASS
SLC25A13	10165	broad.mit.edu	37	7	95848973	95848973	+	Intron	SNP	T	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95848973T>C	uc003uof.3	-						SLC25A13_uc003uog.3_Intron|SLC25A13_uc011kik.1_Intron	NM_014251	NP_055066	Q9UJS0	CMC2_HUMAN	solute carrier family 25, member 13 isoform 2						ATP biosynthetic process|gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to plasma membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity			central_nervous_system(3)|skin(1)	4	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	ccaaaaattatgaatcagtag	0.224													3	33	---	---	---	---	PASS
BAIAP2L1	55971	broad.mit.edu	37	7	97944898	97944898	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97944898C>G	uc003upj.2	-	7	776	c.513G>C	c.(511-513)CAG>CAC	p.Q171H		NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	171	IMD.				filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			GGATTTCACTCTGACGAGAAG	0.393													3	119	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100684326	100684326	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100684326C>T	uc003uxp.1	+	3	9682	c.9629C>T	c.(9628-9630)ACC>ATC	p.T3210I	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3210	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|52.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GCTGAAGGTACCAGCATTCCA	0.498													10	406	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103290727	103290727	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103290727C>G	uc003vca.2	-	16	2156	c.1996G>C	c.(1996-1998)GAT>CAT	p.D666H	RELN_uc010liz.2_Missense_Mutation_p.D666H	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	666					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TAACCATTATCAATTGCCCAC	0.438													13	102	---	---	---	---	PASS
FOXP2	93986	broad.mit.edu	37	7	114282526	114282526	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114282526G>C	uc003vhb.2	+	7	1211	c.837G>C	c.(835-837)ATG>ATC	p.M279I	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Missense_Mutation_p.M304I|FOXP2_uc003vha.2_Missense_Mutation_p.M187I|FOXP2_uc011kmu.1_Missense_Mutation_p.M296I|FOXP2_uc011kmv.1_Missense_Mutation_p.M278I|FOXP2_uc010ljz.1_Missense_Mutation_p.M187I|FOXP2_uc003vgx.2_Missense_Mutation_p.M279I|FOXP2_uc003vhd.2_Missense_Mutation_p.M279I|FOXP2_uc003vhc.2_Missense_Mutation_p.M304I	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	279					camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						TTCACAGTATGGAAGACAATG	0.428													8	54	---	---	---	---	PASS
IQUB	154865	broad.mit.edu	37	7	123150018	123150018	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123150018G>C	uc003vkn.2	-	3	1046	c.469C>G	c.(469-471)CTT>GTT	p.L157V	IQUB_uc003vko.2_Missense_Mutation_p.L157V|IQUB_uc010lkt.2_RNA|IQUB_uc003vkp.1_Missense_Mutation_p.L157V|IQUB_uc003vkq.2_Missense_Mutation_p.L157V	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	157	Ubiquitin-like.									ovary(3)|large_intestine(1)	4						TGGTCCTTAAGATATTTAAGA	0.308													26	258	---	---	---	---	PASS
LRGUK	136332	broad.mit.edu	37	7	133861738	133861738	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133861738G>C	uc003vrm.1	+	9	1046	c.1030G>C	c.(1030-1032)GAA>CAA	p.E344Q		NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain	344	LRRCT.						ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						GGAAAAGTCTGAATATTGGTT	0.353													3	94	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	152055667	152055667	+	Intron	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152055667G>C	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CTTGAGTTCTGATACCTGTTT	0.383			N		medulloblastoma								5	209	---	---	---	---	PASS
INSIG1	3638	broad.mit.edu	37	7	155094081	155094081	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155094081C>G	uc003wly.2	+	4	869	c.658C>G	c.(658-660)CTA>GTA	p.L220V	INSIG1_uc011kvu.1_Missense_Mutation_p.L68V|INSIG1_uc003wlz.2_Intron	NM_005542	NP_005533	O15503	INSI1_HUMAN	insulin induced gene 1 isoform 1	220	Helical; (Potential).				cell proliferation|ER-nuclear sterol response pathway	endoplasmic reticulum membrane|integral to membrane	protein binding				0	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CATAGCTTTTCTAGCTACGCT	0.438													6	91	---	---	---	---	PASS
AGPAT5	55326	broad.mit.edu	37	8	6605358	6605358	+	Intron	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6605358G>T	uc003wqo.2	+						AGPAT5_uc011kwm.1_Intron	NM_018361	NP_060831	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5						phospholipid biosynthetic process	integral to membrane|mitochondrion	1-acylglycerol-3-phosphate O-acyltransferase activity				0			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		GGGTAAGTGTGTTCACGCACC	0.398													11	74	---	---	---	---	PASS
C8orf58	541565	broad.mit.edu	37	8	22460827	22460827	+	3'UTR	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22460827C>T	uc003xce.2	+	7					C8orf58_uc011kzl.1_3'UTR|C8orf58_uc003xcf.2_3'UTR|KIAA1967_uc003xch.2_5'Flank|KIAA1967_uc003xci.2_5'Flank	NM_001013842	NP_001013864	Q8NAV2	CH058_HUMAN	hypothetical protein LOC541565											skin(1)	1		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00563)|Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		TGAGACCTCTCGGTGCACCTG	0.557													4	60	---	---	---	---	PASS
EGR3	1960	broad.mit.edu	37	8	22548418	22548418	+	Silent	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22548418G>T	uc003xcm.1	-	2	1090	c.732C>A	c.(730-732)GGC>GGA	p.G244G	EGR3_uc011kzn.1_Silent_p.G206G|EGR3_uc011kzo.1_Silent_p.G190G	NM_004430	NP_004421	Q06889	EGR3_HUMAN	early growth response 3	244					circadian rhythm|muscle organ development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Prostate(55;0.0421)|Breast(100;0.102)		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)		GGGGCAGGCTGCCAAAGCCCG	0.662													13	102	---	---	---	---	PASS
HOOK3	84376	broad.mit.edu	37	8	42868513	42868513	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42868513G>C	uc003xpr.2	+	21	2228	c.1986G>C	c.(1984-1986)GAG>GAC	p.E662D		NM_032410	NP_115786	Q86VS8	HOOK3_HUMAN	golgi-associated microtubule-binding protein	662	Potential.|Required for interaction with MSR1.|Required for association with Golgi.				cytoplasmic microtubule organization|early endosome to late endosome transport|endosome organization|endosome to lysosome transport|Golgi localization|interkinetic nuclear migration|lysosome organization|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome|protein transport	cis-Golgi network|FHF complex|microtubule|pericentriolar material	identical protein binding|microtubule binding			ovary(1)|breast(1)	2	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			AGATGGAAGAGAAATATATTG	0.249			T	RET	papillary thyroid								5	118	---	---	---	---	PASS
SDC2	6383	broad.mit.edu	37	8	97621715	97621715	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97621715G>A	uc003yhv.1	+	5	1163	c.545G>A	c.(544-546)GGA>GAA	p.G182E	SDC2_uc011lgu.1_Missense_Mutation_p.G153E	NM_002998	NP_002989	P34741	SDC2_HUMAN	syndecan 2 precursor	182	Cytoplasmic (Potential).					integral to plasma membrane	cytoskeletal protein binding|PDZ domain binding			ovary(2)	2	Breast(36;3.41e-05)				Sargramostim(DB00020)	TATGACCTTGGAGAACGCAAA	0.418													4	82	---	---	---	---	PASS
MTDH	92140	broad.mit.edu	37	8	98656727	98656727	+	5'UTR	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98656727G>C	uc003yhz.2	+	1						NM_178812	NP_848927	Q86UE4	LYRIC_HUMAN	metadherin						lipopolysaccharide-mediated signaling pathway|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of angiogenesis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein kinase B signaling cascade	apical plasma membrane|endoplasmic reticulum membrane|integral to membrane|intercellular canaliculus|nuclear body|nuclear membrane|nucleolus|perinuclear region of cytoplasm|tight junction	NF-kappaB binding|RNA polymerase II transcription factor binding|transcription coactivator activity			liver(1)|central_nervous_system(1)	2	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			CCTCTGACGGGAGGGAAGATG	0.697													3	7	---	---	---	---	PASS
RGS22	26166	broad.mit.edu	37	8	100994303	100994303	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100994303C>T	uc003yjb.1	-	22	3417	c.3222G>A	c.(3220-3222)AAG>AAA	p.K1074K	RGS22_uc003yja.1_Silent_p.K893K|RGS22_uc003yjc.1_Silent_p.K1062K	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	1074	RGS 2.				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TTGTAATCTTCTTCTGGATGA	0.358													3	74	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139833588	139833588	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139833588C>T	uc003yvd.2	-	7	1483	c.1036G>A	c.(1036-1038)GCT>ACT	p.A346T		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	346	TSP N-terminal.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			ACCCTGACAGCATCTTTCATG	0.572										HNSCC(7;0.00092)			10	179	---	---	---	---	PASS
DOCK8	81704	broad.mit.edu	37	9	368110	368110	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:368110G>C	uc003zgf.2	+	15	1884	c.1772G>C	c.(1771-1773)GGA>GCA	p.G591A	DOCK8_uc010mgu.2_5'UTR|DOCK8_uc010mgv.2_Missense_Mutation_p.G523A|DOCK8_uc010mgw.1_5'UTR|DOCK8_uc003zgk.2_5'UTR|DOCK8_uc003zgh.2_RNA	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	591					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TTTATGTGTGGAGAAGATGCT	0.473													11	112	---	---	---	---	PASS
PTPRD	5789	broad.mit.edu	37	9	8523518	8523518	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8523518C>T	uc003zkk.2	-	18	1397	c.686G>A	c.(685-687)CGA>CAA	p.R229Q	PTPRD_uc003zkp.2_Missense_Mutation_p.R229Q|PTPRD_uc003zkq.2_Missense_Mutation_p.R229Q|PTPRD_uc003zkr.2_Missense_Mutation_p.R223Q|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Missense_Mutation_p.R229Q|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Missense_Mutation_p.R229Q|PTPRD_uc003zko.2_Missense_Mutation_p.R226Q	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	229	Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CCAACCTTCTCGCAGCTCTGA	0.368										TSP Lung(15;0.13)			3	29	---	---	---	---	PASS
MOBKL2B	79817	broad.mit.edu	37	9	27455464	27455464	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27455464C>G	uc003zqn.2	-	2	581	c.85G>C	c.(85-87)GAG>CAG	p.E29Q		NM_024761	NP_079037	Q86TA1	MOL2B_HUMAN	MOB1, Mps One Binder kinase activator-like 2B	29							metal ion binding|protein binding			ovary(1)|pleura(1)	2		all_neural(11;9.12e-11)		Lung(218;6.54e-05)|LUSC - Lung squamous cell carcinoma(38;0.000397)		TTGTGCAGCTCAAACCTCTGT	0.552													10	218	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32634386	32634386	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32634386A>G	uc003zrg.1	-	1	1282	c.1192T>C	c.(1192-1194)TCT>CCT	p.S398P	uc003zrh.1_RNA	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	398					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		ATCATTCTAGATTTTATCACA	0.458													34	191	---	---	---	---	PASS
ABCA1	19	broad.mit.edu	37	9	107581073	107581073	+	Nonsense_Mutation	SNP	A	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107581073A>T	uc004bcl.2	-	23	3646	c.3333T>A	c.(3331-3333)TGT>TGA	p.C1111*		NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	1111	ABC transporter 1.				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AGGAGCCCACACAGCACAGCT	0.547													12	73	---	---	---	---	PASS
EPB41L4B	54566	broad.mit.edu	37	9	112018447	112018447	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112018447C>G	uc004bdz.1	-	9	1193	c.898G>C	c.(898-900)GAA>CAA	p.E300Q	EPB41L4B_uc004bea.2_Missense_Mutation_p.E300Q	NM_019114	NP_061987	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	300	FERM.					cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|skin(1)	3						TTAGCTCCTTCAAAGATTAAT	0.368													3	152	---	---	---	---	PASS
TNFSF15	9966	broad.mit.edu	37	9	117552889	117552889	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117552889G>C	uc004bjh.2	-	4	715	c.599C>G	c.(598-600)TCT>TGT	p.S200C	TNFSF15_uc004bjg.2_Missense_Mutation_p.S141C	NM_005118	NP_005109	O95150	TNF15_HUMAN	tumor necrosis factor (ligand) superfamily,	200	Extracellular (Potential).				activation of caspase activity|activation of NF-kappaB-inducing kinase activity|cytokine metabolic process|immune response	extracellular space|integral to plasma membrane	cytokine activity|tumor necrosis factor receptor binding				0						TTCGCATACAGACTTGGTCCC	0.537													4	48	---	---	---	---	PASS
TLR4	7099	broad.mit.edu	37	9	120476482	120476482	+	Silent	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120476482A>G	uc004bjz.2	+	3	2367	c.2076A>G	c.(2074-2076)CTA>CTG	p.L692L	TLR4_uc004bka.2_Silent_p.L652L|TLR4_uc004bkb.2_Silent_p.L492L	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	692	Cytoplasmic (Potential).|TIR.				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						GGAATGAGCTAGTAAAGAATT	0.453													16	93	---	---	---	---	PASS
CRB2	286204	broad.mit.edu	37	9	126132615	126132615	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126132615C>T	uc004bnx.1	+	7	1375	c.1283C>T	c.(1282-1284)CCT>CTT	p.P428L	CRB2_uc004bnw.1_Missense_Mutation_p.P428L	NM_173689	NP_775960	Q5IJ48	CRUM2_HUMAN	crumbs homolog 2 precursor	428	Extracellular (Potential).|EGF-like 9.					extracellular region|integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						CACTGCCCACCTGGTACCCAT	0.632													4	61	---	---	---	---	PASS
DENND1A	57706	broad.mit.edu	37	9	126219678	126219678	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126219678C>T	uc004bnz.1	-	15	1368	c.1135G>A	c.(1135-1137)GAA>AAA	p.E379K	DENND1A_uc011lzl.1_Missense_Mutation_p.E154K|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Missense_Mutation_p.E347K|DENND1A_uc004boa.1_Missense_Mutation_p.E379K|DENND1A_uc004bob.1_Missense_Mutation_p.E349K|DENND1A_uc004boc.2_Missense_Mutation_p.E347K	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1	379						cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						CTGAAACCTTCGCCGGAATTG	0.433													4	130	---	---	---	---	PASS
TRUB2	26995	broad.mit.edu	37	9	131084583	131084583	+	Silent	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131084583C>G	uc004buq.1	-	1	115	c.105G>C	c.(103-105)CTG>CTC	p.L35L	COQ4_uc011max.1_5'Flank|COQ4_uc004bur.3_5'Flank|COQ4_uc004bus.2_5'Flank|COQ4_uc010mxy.2_5'Flank	NM_015679	NP_056494	O95900	TRUB2_HUMAN	TruB pseudouridine (psi) synthase homolog 2	35					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(1)	1						ACTCACCCTTCAGAAGTTGTA	0.562													5	76	---	---	---	---	PASS
NUP188	23511	broad.mit.edu	37	9	131765157	131765157	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131765157C>A	uc004bws.1	+	37	4221	c.4199C>A	c.(4198-4200)TCC>TAC	p.S1400Y	NUP188_uc004bwu.2_Missense_Mutation_p.S743Y	NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1400					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						TACCGCCTGTCCATGTCCCTG	0.582													4	86	---	---	---	---	PASS
GLT6D1	360203	broad.mit.edu	37	9	138516149	138516149	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138516149C>T	uc010nbd.1	-	5	879	c.625G>A	c.(625-627)GAG>AAG	p.E209K		NM_182974	NP_892019	Q7Z4J2	GL6D1_HUMAN	glycosyltransferase 6 domain containing 1	209	Lumenal (Potential).				carbohydrate metabolic process	integral to membrane	transferase activity, transferring hexosyl groups			ovary(1)	1		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;4.3e-07)|Epithelial(140;1.58e-06)|all cancers(34;5.36e-05)		GGCCTCCTCTCATAAGGGAAG	0.527													7	102	---	---	---	---	PASS
NET1	10276	broad.mit.edu	37	10	5496952	5496952	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5496952G>C	uc001iia.2	+	10	1206	c.1068G>C	c.(1066-1068)AAG>AAC	p.K356N	NET1_uc010qar.1_Missense_Mutation_p.K175N|NET1_uc001iib.2_Missense_Mutation_p.K302N|NET1_uc010qas.1_Missense_Mutation_p.K175N	NM_001047160	NP_001040625	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming gene 1 isoform	356	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell growth|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	Rho guanyl-nucleotide exchange factor activity			breast(1)	1						TCAACTTGAAGAAAGGTGAAT	0.428													3	84	---	---	---	---	PASS
KIAA1217	56243	broad.mit.edu	37	10	24783456	24783456	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24783456G>A	uc001iru.3	+	7	2110	c.1707G>A	c.(1705-1707)CAG>CAA	p.Q569Q	KIAA1217_uc001irs.2_Silent_p.Q489Q|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron|KIAA1217_uc001irw.2_Intron|KIAA1217_uc001irz.2_Intron|KIAA1217_uc001irx.2_Intron|KIAA1217_uc001iry.2_Intron	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1	569	Potential.				embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						TGGAGAAACAGATTGCCAGTT	0.413													5	80	---	---	---	---	PASS
LYZL2	119180	broad.mit.edu	37	10	30915842	30915842	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30915842C>A	uc001ivk.2	-	2	154	c.141G>T	c.(139-141)ATG>ATT	p.M47I		NM_183058	NP_898881	Q7Z4W2	LYZL2_HUMAN	lysozyme-like 2	1					cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0		Prostate(175;0.151)				CCGCAGCCTTCATCCTCAAAG	0.537													5	78	---	---	---	---	PASS
RASGEF1A	221002	broad.mit.edu	37	10	43695154	43695154	+	Silent	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43695154C>G	uc001jap.1	-	7	900	c.819G>C	c.(817-819)CTG>CTC	p.L273L	RASGEF1A_uc001jao.1_Silent_p.L281L	NM_145313	NP_660356	Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	273	Ras-GEF.				cell migration|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						CCAGCATGCTCAGGCAGTTGA	0.617													6	41	---	---	---	---	PASS
C10orf107	219621	broad.mit.edu	37	10	63519826	63519826	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63519826G>C	uc010qik.1	+	5	603	c.298G>C	c.(298-300)GAG>CAG	p.E100Q		NM_173554	NP_775825	Q8IVU9	CJ107_HUMAN	hypothetical protein LOC219621	100											0	Prostate(12;0.016)					GCAAGTGATAGAGGTTGTCAA	0.413													10	66	---	---	---	---	PASS
SUPV3L1	6832	broad.mit.edu	37	10	70960210	70960210	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70960210C>T	uc001jpe.1	+	11	1528	c.1473C>T	c.(1471-1473)CTC>CTT	p.L491L	SUPV3L1_uc010qjd.1_Silent_p.L360L	NM_003171	NP_003162	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 precursor	491	Helicase C-terminal.				DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding			urinary_tract(1)|ovary(1)	2						ATGAAGATCTCAGTTTATTAA	0.433													5	64	---	---	---	---	PASS
SUPV3L1	6832	broad.mit.edu	37	10	70967669	70967669	+	Missense_Mutation	SNP	G	C	C	rs150112121		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70967669G>C	uc001jpe.1	+	14	1952	c.1897G>C	c.(1897-1899)GAT>CAT	p.D633H	SUPV3L1_uc010qjd.1_Missense_Mutation_p.D502H	NM_003171	NP_003162	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 precursor	633					DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding			urinary_tract(1)|ovary(1)	2						AGCTGTCCACGATGTCTTGGA	0.383													14	188	---	---	---	---	PASS
P4HA1	5033	broad.mit.edu	37	10	74811014	74811014	+	Intron	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74811014G>C	uc010qka.1	-						P4HA1_uc001jtg.2_Intron|P4HA1_uc001jth.2_Intron|P4HA1_uc010qkb.1_Intron|P4HA1_uc001jti.2_Intron	NM_001142595	NP_001136067	P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha I subunit isoform 2							endoplasmic reticulum lumen|mitochondrion	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity			ovary(1)	1	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GGATCTATTAGAAGAGAAACA	0.289													3	40	---	---	---	---	PASS
ZMYND17	118490	broad.mit.edu	37	10	75184893	75184893	+	Missense_Mutation	SNP	G	A	A	rs137962387	by1000genomes	TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75184893G>A	uc001jud.2	-	6	1192	c.1126C>T	c.(1126-1128)CGT>TGT	p.R376C	ZMYND17_uc001juc.2_Missense_Mutation_p.R376C|ZMYND17_uc009xrh.2_Missense_Mutation_p.R399C|ZMYND17_uc009xrg.2_Missense_Mutation_p.R155C	NM_001024593	NP_001019764	Q4VC12	ZMY17_HUMAN	zinc finger, MYND domain containing 17	376							zinc ion binding			ovary(1)	1	Prostate(51;0.0119)					TTATAGTCACGAAGTAGCAGC	0.413													8	99	---	---	---	---	PASS
CDHR1	92211	broad.mit.edu	37	10	85956342	85956342	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85956342G>C	uc001kcv.2	+	3	233	c.233G>C	c.(232-234)AGA>ACA	p.R78T	CDHR1_uc001kcw.2_Missense_Mutation_p.R78T	NM_033100	NP_149091	Q96JP9	CDHR1_HUMAN	protocadherin 21 precursor	78	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion		calcium ion binding|receptor activity			ovary(1)	1						CCCAGCACTAGAAGCGTCTTT	0.557													7	116	---	---	---	---	PASS
OPALIN	93377	broad.mit.edu	37	10	98105744	98105744	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98105744C>G	uc001kmj.2	-	6	819	c.380G>C	c.(379-381)AGA>ACA	p.R127T	OPALIN_uc010qor.1_Missense_Mutation_p.R117T|OPALIN_uc001kmi.2_Missense_Mutation_p.R117T|OPALIN_uc001kmk.2_Missense_Mutation_p.R104T|OPALIN_uc010qos.1_RNA	NM_033207	NP_149984	Q96PE5	OPALI_HUMAN	transmembrane protein 10 isoform a	127						Golgi apparatus|integral to membrane|plasma membrane					0						TCCCCTCCTTCTTTCCATTTC	0.517													10	160	---	---	---	---	PASS
BAG3	9531	broad.mit.edu	37	10	121429360	121429360	+	Intron	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121429360C>G	uc001lem.2	+						BAG3_uc001lel.2_Intron	NM_004281	NP_004272	O95817	BAG3_HUMAN	BCL2-associated athanogene 3						anti-apoptosis|apoptosis|protein folding	cytosol				ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)		CTTTTTATTTCAGGAGACTCC	0.577													6	94	---	---	---	---	PASS
FAM175B	23172	broad.mit.edu	37	10	126523297	126523297	+	Silent	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126523297A>G	uc001lib.3	+	9	1050	c.1005A>G	c.(1003-1005)CAA>CAG	p.Q335Q		NM_032182	NP_115558	Q15018	F175B_HUMAN	hypothetical protein LOC23172	335						BRISC complex	polyubiquitin binding				0						CTCGACCTCAAGCTGTGGGCT	0.522													10	46	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129902207	129902207	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129902207G>C	uc001lke.2	-	13	8092	c.7897C>G	c.(7897-7899)CAC>GAC	p.H2633D	MKI67_uc001lkf.2_Missense_Mutation_p.H2273D|MKI67_uc009yav.1_Missense_Mutation_p.H2208D|MKI67_uc009yaw.1_Missense_Mutation_p.H1783D	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	2633	14.|16 X 122 AA approximate repeats.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GGTTCTTTGTGTGTGTGTGTG	0.502													7	127	---	---	---	---	PASS
PHRF1	57661	broad.mit.edu	37	11	607998	607998	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:607998G>A	uc001lqe.2	+	14	2673	c.2542G>A	c.(2542-2544)GAG>AAG	p.E848K	PHRF1_uc010qwc.1_Missense_Mutation_p.E847K|PHRF1_uc010qwd.1_Missense_Mutation_p.E846K|PHRF1_uc010qwe.1_Missense_Mutation_p.E844K|PHRF1_uc009ybz.1_Missense_Mutation_p.E638K|PHRF1_uc009yca.1_RNA	NM_020901	NP_065952	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	848							RNA polymerase binding|zinc ion binding				0						CAGCAGCCCCGAGAGGTCTGG	0.662													7	119	---	---	---	---	PASS
TNNT3	7140	broad.mit.edu	37	11	1955618	1955618	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1955618G>A	uc001luu.3	+	12	635	c.423G>A	c.(421-423)CTG>CTA	p.L141L	TNNT3_uc001lun.2_Silent_p.L37L|TNNT3_uc001luw.3_Silent_p.L133L|TNNT3_uc001luo.3_Silent_p.L133L|TNNT3_uc001lup.3_Silent_p.L139L|TNNT3_uc001luq.3_Silent_p.L133L|TNNT3_uc001lur.2_Silent_p.L133L|TNNT3_uc010qxf.1_Silent_p.L139L|TNNT3_uc010qxg.1_Silent_p.L73L	NM_006757	NP_006748	P45378	TNNT3_HUMAN	troponin T3, skeletal, fast isoform 1	152					muscle filament sliding|regulation of ATPase activity|regulation of striated muscle contraction|skeletal muscle contraction	cytosol|troponin complex	calcium-dependent protein binding|tropomyosin binding|troponin C binding|troponin I binding			ovary(1)	1		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)		AGGACGACCTGAAGAAGAAGA	0.587													4	60	---	---	---	---	PASS
TSSC4	10078	broad.mit.edu	37	11	2424480	2424480	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2424480C>G	uc001lwj.2	+	4	978	c.617C>G	c.(616-618)TCC>TGC	p.S206C	TSSC4_uc001lwi.2_Missense_Mutation_p.S142C|TSSC4_uc001lwk.2_Missense_Mutation_p.S206C|TSSC4_uc001lwl.2_Missense_Mutation_p.S206C	NM_005706	NP_005697	Q9Y5U2	TSSC4_HUMAN	tumor suppressing subtransferable candidate 4	206											0		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.00145)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAGGATCCCTCCAGCTGTGGG	0.652													4	83	---	---	---	---	PASS
SLC17A6	57084	broad.mit.edu	37	11	22364891	22364891	+	Silent	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22364891G>T	uc001mqk.2	+	3	851	c.438G>T	c.(436-438)GCG>GCT	p.A146A		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	146	Helical; (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						GCTACATCGCGTCTCGGCTGG	0.587													19	91	---	---	---	---	PASS
OR4S2	219431	broad.mit.edu	37	11	55418443	55418443	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55418443G>C	uc001nhs.1	+	1	64	c.64G>C	c.(64-66)GAG>CAG	p.E22Q		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				CCCAGAGATTGAGAAAGTTTG	0.378													8	66	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62290416	62290416	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62290416C>A	uc001ntl.2	-	5	11773	c.11473G>T	c.(11473-11475)GAT>TAT	p.D3825Y	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	3825					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				AGGTTCACATCCACATCTGGG	0.517													8	414	---	---	---	---	PASS
C11orf48	79081	broad.mit.edu	37	11	62430642	62430642	+	Intron	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62430642G>A	uc001nue.2	-						C11orf48_uc001nuf.2_Intron|METTL12_uc001nug.1_5'Flank|METTL12_uc001nuh.2_5'Flank|SNORA57_uc009yoa.1_5'Flank|METTL12_uc010rmc.1_5'Flank	NM_024099	NP_077004	Q9BQE6	CK048_HUMAN	hypothetical protein LOC79081												0						CTGAGTAAAGGGAAGAAGGAA	0.507													3	71	---	---	---	---	PASS
TAF6L	10629	broad.mit.edu	37	11	62554633	62554633	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62554633C>G	uc001nvc.2	+	11	1835	c.1734C>G	c.(1732-1734)TTC>TTG	p.F578L	TMEM179B_uc001nvd.3_5'Flank	NM_006473	NP_006464	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II	578					chromatin remodeling|histone H3 acetylation|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	histone deacetylase complex|STAGA complex	DNA binding|protein binding|transcription coactivator activity			ovary(3)	3						GGCGCCTTTTCCAGACTGCCT	0.711											OREG0021030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	18	---	---	---	---	PASS
PYGM	5837	broad.mit.edu	37	11	64514192	64514192	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64514192C>A	uc001oax.3	-	20	3285	c.2468G>T	c.(2467-2469)CGG>CTG	p.R823L	RASGRP2_uc009ypu.2_5'Flank|RASGRP2_uc009ypv.2_5'Flank|RASGRP2_uc009ypw.2_5'Flank|RASGRP2_uc001oaw.1_5'Flank|PYGM_uc001oay.3_Missense_Mutation_p.R735L	NM_005609	NP_005600	P11217	PYGM_HUMAN	muscle glycogen phosphorylase isoform 1	823					glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding			ovary(2)	2					Pyridoxal Phosphate(DB00114)	CCAGATCTCCCGGGCATACTG	0.617													12	90	---	---	---	---	PASS
TPCN2	219931	broad.mit.edu	37	11	68853133	68853133	+	Intron	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68853133C>G	uc001oos.2	+						TPCN2_uc010rqg.1_Intron|TPCN2_uc001oot.2_Intron	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GTGTTGTGTTCCCCAGCCTGG	0.637													3	72	---	---	---	---	PASS
RNF121	55298	broad.mit.edu	37	11	71668300	71668300	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71668300G>C	uc001ora.2	+	2	431	c.91G>C	c.(91-93)GAG>CAG	p.E31Q	RNF121_uc001ord.2_Intron|RNF121_uc001orb.2_Intron|RNF121_uc009yst.2_Intron	NM_018320	NP_060790	Q9H920	RN121_HUMAN	ring finger protein 121	31						integral to membrane	zinc ion binding				0						CTCTCCAGAAGAGCAATGGAG	0.443													17	104	---	---	---	---	PASS
C2CD3	26005	broad.mit.edu	37	11	73801934	73801934	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73801934C>G	uc001ouu.2	-	20	3792	c.3565G>C	c.(3565-3567)GAG>CAG	p.E1189Q		NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1189	C2 1.					centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					AGAACTCCCTCTGCTGTTCTT	0.493													9	61	---	---	---	---	PASS
MMP13	4322	broad.mit.edu	37	11	102826338	102826338	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102826338C>T	uc001phl.2	-	1	125	c.97G>A	c.(97-99)GAG>AAG	p.E33K		NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein	33					collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)		AGGTCTTCCTCAGACAAATCA	0.498													4	91	---	---	---	---	PASS
KDELC2	143888	broad.mit.edu	37	11	108348418	108348418	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108348418C>G	uc001pkj.2	-	7	1380	c.1314G>C	c.(1312-1314)AAG>AAC	p.K438N	KDELC2_uc001pki.2_Missense_Mutation_p.K382N	NM_153705	NP_714916	Q7Z4H8	KDEL2_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 2 precursor	438						endoplasmic reticulum lumen				ovary(1)	1		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;6.93e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;0.00016)|OV - Ovarian serous cystadenocarcinoma(223;0.132)|Colorectal(284;0.14)		TTGCAATCTTCTTGGCTTCTT	0.413													15	136	---	---	---	---	PASS
ARHGAP20	57569	broad.mit.edu	37	11	110486303	110486303	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110486303C>T	uc001pkz.1	-	6	804	c.519G>A	c.(517-519)AAG>AAA	p.K173K	ARHGAP20_uc001pky.1_Silent_p.K150K|ARHGAP20_uc009yyb.1_Silent_p.K137K|ARHGAP20_uc001pla.1_Silent_p.K137K	NM_020809	NP_065860	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	173	PH.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)|kidney(2)	5		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		GCCATTTGTCCTTTTGTTCTG	0.313													15	80	---	---	---	---	PASS
SIDT2	51092	broad.mit.edu	37	11	117066728	117066728	+	Silent	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117066728G>C	uc001pqh.1	+	26	2486	c.2445G>C	c.(2443-2445)CTG>CTC	p.L815L	SIDT2_uc001pqi.1_Silent_p.L812L|SIDT2_uc001pqj.1_Silent_p.L127L|uc001pqk.1_RNA	NM_001040455	NP_001035545	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2 precursor	815	Helical; (Potential).					integral to membrane|lysosomal membrane					0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		AGGTGTTGCTGACACTGGATG	0.617													14	150	---	---	---	---	PASS
ABCG4	64137	broad.mit.edu	37	11	119030980	119030980	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119030980C>T	uc001pvs.2	+	13	1817	c.1481C>T	c.(1480-1482)ACG>ATG	p.T494M	ABCG4_uc009zar.2_Missense_Mutation_p.T494M	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN	ATP-binding cassette, subfamily G, member 4	494	Extracellular (Potential).|ABC transmembrane type-2.				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		TACTGGATGACGGGCCAGCCC	0.647													18	91	---	---	---	---	PASS
GRIK4	2900	broad.mit.edu	37	11	120745935	120745935	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120745935A>G	uc001pxn.2	+	11	1434	c.1147A>G	c.(1147-1149)AGG>GGG	p.R383G	GRIK4_uc009zav.1_Missense_Mutation_p.R383G|GRIK4_uc009zaw.1_Missense_Mutation_p.R383G|GRIK4_uc009zax.1_Missense_Mutation_p.R383G	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor	383	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	ACAGTTCACAAGGAATGGTTT	0.493													9	56	---	---	---	---	PASS
ASAM	79827	broad.mit.edu	37	11	122954383	122954383	+	Intron	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122954383C>G	uc001pyt.2	-							NM_024769	NP_079045	Q9H6B4	CLMP_HUMAN	adipocyte-specific adhesion molecule precursor							integral to membrane|tight junction					0		Breast(109;0.0025)|Lung NSC(97;0.0179)|all_lung(97;0.0182)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.73e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		AGGAAGATGACTTACCAATCC	0.463													5	88	---	---	---	---	PASS
ADAMTS8	11095	broad.mit.edu	37	11	130289067	130289067	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130289067C>G	uc001qgg.3	-	2	1199	c.841G>C	c.(841-843)GAG>CAG	p.E281Q		NM_007037	NP_008968	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1	281	Peptidase M12B.				negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		TCGGACACCTCTGGGCCCCAT	0.557													8	239	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2800327	2800327	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2800327G>C	uc009zdu.1	+	50	6941	c.6628G>C	c.(6628-6630)GAG>CAG	p.E2210Q	CACNA1C_uc009zdv.1_Missense_Mutation_p.E2124Q|CACNA1C_uc001qkb.2_Missense_Mutation_p.E2127Q|CACNA1C_uc001qkc.2_Missense_Mutation_p.E2146Q|CACNA1C_uc001qke.2_Missense_Mutation_p.E2116Q|CACNA1C_uc001qkf.2_Missense_Mutation_p.E2135Q|CACNA1C_uc001qjz.2_Missense_Mutation_p.E2127Q|CACNA1C_uc001qkd.2_Missense_Mutation_p.E2146Q|CACNA1C_uc001qkg.2_Missense_Mutation_p.E2133Q|CACNA1C_uc009zdw.1_Missense_Mutation_p.E2168Q|CACNA1C_uc001qkh.2_Missense_Mutation_p.E2135Q|CACNA1C_uc001qkl.2_Missense_Mutation_p.E2175Q|CACNA1C_uc001qkn.2_Missense_Mutation_p.E2127Q|CACNA1C_uc001qko.2_Missense_Mutation_p.E2147Q|CACNA1C_uc001qkp.2_Missense_Mutation_p.E2127Q|CACNA1C_uc001qkr.2_Missense_Mutation_p.E2144Q|CACNA1C_uc001qku.2_Missense_Mutation_p.E2162Q|CACNA1C_uc001qkq.2_Missense_Mutation_p.E2155Q|CACNA1C_uc001qks.2_Missense_Mutation_p.E2127Q|CACNA1C_uc001qkt.2_Missense_Mutation_p.E2146Q|CACNA1C_uc001qki.1_Missense_Mutation_p.E1934Q|CACNA1C_uc001qkj.1_Missense_Mutation_p.E1898Q|CACNA1C_uc001qkk.1_Missense_Mutation_p.E1863Q|CACNA1C_uc001qkm.1_Missense_Mutation_p.E1923Q|CACNA1C_uc010sea.1_Missense_Mutation_p.E818Q|uc001qkx.1_5'Flank|CACNA1C_uc001qky.1_Missense_Mutation_p.E445Q	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	2210	Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	GAGTGAGGAGGAGCTCCAGGA	0.607													3	42	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6078430	6078430	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6078430G>A	uc001qnn.1	-	45	7926	c.7676C>T	c.(7675-7677)TCG>TTG	p.S2559L	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	2559					blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	CTGAAAGCCCGAGGGGCAGAC	0.592													4	43	---	---	---	---	PASS
LTBR	4055	broad.mit.edu	37	12	6499369	6499369	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6499369C>G	uc001qny.1	+	9	1061	c.893C>G	c.(892-894)TCT>TGT	p.S298C	LTBR_uc010sfc.1_Missense_Mutation_p.S279C|LTBR_uc001qnz.1_Missense_Mutation_p.S293C	NM_002342	NP_002333	P36941	TNR3_HUMAN	lymphotoxin beta receptor precursor	298	Cytoplasmic (Potential).				apoptosis|cellular response to mechanical stimulus|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	protein binding|receptor activity			lung(2)	2						CTACCCATTTCTGGAGATGTT	0.607													18	155	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9258841	9258841	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9258841G>T	uc001qvk.1	-	10	1208	c.1095C>A	c.(1093-1095)TTC>TTA	p.F365L	A2M_uc009zgk.1_Missense_Mutation_p.F215L	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	365					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	CCTGCCCAAAGAAGGGAATTC	0.423													4	107	---	---	---	---	PASS
PRB2	653247	broad.mit.edu	37	12	11546167	11546167	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11546167T>A	uc010shk.1	-	3	880	c.845A>T	c.(844-846)AAG>ATG	p.K282M		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TCCTTGTGGCTTTCCTGGAGG	0.617													13	390	---	---	---	---	PASS
ETV6	2120	broad.mit.edu	37	12	12037425	12037425	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12037425C>T	uc001qzz.2	+	6	1330	c.1056C>T	c.(1054-1056)AGC>AGT	p.S352S	ETV6_uc001raa.1_Intron	NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6	352	ETS.					cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				TTTCTGACAGCCGGTACGAAA	0.453			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								10	154	---	---	---	---	PASS
PDE3A	5139	broad.mit.edu	37	12	20766419	20766419	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20766419G>A	uc001reh.1	+	3	1076	c.1054G>A	c.(1054-1056)GAG>AAG	p.E352K		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	352					lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	CGTCATGGGCGAGGCCCACGG	0.532													5	105	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40707762	40707762	+	Intron	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40707762G>T	uc001rmg.3	+						LRRK2_uc009zjw.2_Intron|LRRK2_uc001rmi.2_Intron	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2						activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CTTGTCATTTGTAATTTCATA	0.333													6	28	---	---	---	---	PASS
SLC39A5	283375	broad.mit.edu	37	12	56628613	56628613	+	Silent	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56628613G>C	uc010sqj.1	+	6	734	c.477G>C	c.(475-477)CTG>CTC	p.L159L	SLC39A5_uc010sqi.1_Silent_p.L50L|SLC39A5_uc010sqk.1_Silent_p.L159L	NM_173596	NP_775867	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (metal ion	159	Extracellular (By similarity).				zinc ion transport	basolateral plasma membrane|integral to membrane	metal ion transmembrane transporter activity			ovary(1)|skin(1)	2						TCCAGTGTCTGAACGGCTCCC	0.443													4	271	---	---	---	---	PASS
GLIPR1L2	144321	broad.mit.edu	37	12	75807396	75807396	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75807396T>C	uc001sxr.1	+	3	507	c.499T>C	c.(499-501)TAC>CAC	p.Y167H	GLIPR1L2_uc001sxp.1_Missense_Mutation_p.Y167H|GLIPR1L2_uc001sxq.1_Missense_Mutation_p.Y60H	NM_152436	NP_689649	Q4G1C9	GRPL2_HUMAN	GLI pathogenesis-related 1 like 2	167						integral to membrane				ovary(1)	1						GGACCACTCTTACAAAGTTGG	0.289													11	212	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78574810	78574810	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78574810G>A	uc001syp.2	+	30	5850	c.5677G>A	c.(5677-5679)GAG>AAG	p.E1893K	NAV3_uc001syo.2_Missense_Mutation_p.E1871K|NAV3_uc010sub.1_Missense_Mutation_p.E1350K|NAV3_uc009zsf.2_Missense_Mutation_p.E702K	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1893						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						GAACATCACAGAGGCTGTTAG	0.473										HNSCC(70;0.22)			14	117	---	---	---	---	PASS
APAF1	317	broad.mit.edu	37	12	99077009	99077009	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99077009A>G	uc001tfz.2	+	15	2712	c.2135A>G	c.(2134-2136)CAT>CGT	p.H712R	APAF1_uc001tfy.2_Missense_Mutation_p.H701R|APAF1_uc001tga.2_Missense_Mutation_p.H701R|APAF1_uc001tgb.2_Missense_Mutation_p.H712R|APAF1_uc001tgc.2_Intron|APAF1_uc009zto.2_Missense_Mutation_p.H121R	NM_181861	NP_863651	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1 isoform	712	WD 3.				activation of caspase activity by cytochrome c|defense response|induction of apoptosis by intracellular signals|nervous system development	cytosol|Golgi apparatus|nucleus	ATP binding|caspase activator activity|protein binding			ovary(2)|lung(1)	3					Adenosine triphosphate(DB00171)	AACAGTAGTCATCATCTTCTC	0.393													21	89	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104033905	104033905	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104033905A>T	uc001tjw.2	+	9	1097	c.911A>T	c.(910-912)CAC>CTC	p.H304L		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	304	Extracellular (Potential).				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						CTGAAGTCTCACTGCGAGTGT	0.373													7	85	---	---	---	---	PASS
POLE	5426	broad.mit.edu	37	12	133245210	133245210	+	Intron	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133245210C>G	uc001uks.1	-						POLE_uc010tbq.1_Intron|POLE_uc009zyu.1_Intron	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon						base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)		ACCCAGGCGGCCGACACTCAC	0.612								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	35	---	---	---	---	PASS
ANKLE2	23141	broad.mit.edu	37	12	133306454	133306454	+	Nonsense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133306454G>C	uc001ukx.2	-	11	2361	c.2294C>G	c.(2293-2295)TCA>TGA	p.S765*	ANKLE2_uc009zyw.1_Nonsense_Mutation_p.S120*	NM_015114	NP_055929	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	765						cytoplasm|integral to membrane|nuclear envelope					0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		ATTGATTCTTGAAGTCAGGAT	0.423													4	102	---	---	---	---	PASS
RBM26	64062	broad.mit.edu	37	13	79979847	79979847	+	Silent	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79979847G>C	uc001vkz.2	-	1	77	c.63C>G	c.(61-63)CTC>CTG	p.L21L	RBM26_uc001vky.2_Silent_p.L21L|RBM26_uc001vla.2_Silent_p.L21L|RBM26_uc001vlc.1_Silent_p.L21L|uc001vld.1_5'Flank|uc001vle.2_5'Flank	NM_022118	NP_071401	Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	21					mRNA processing		nucleotide binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		ACATGGGCTCGAGAGTCTTGC	0.567													6	68	---	---	---	---	PASS
OR4K14	122740	broad.mit.edu	37	14	20483014	20483014	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20483014C>A	uc010tky.1	-	1	339	c.339G>T	c.(337-339)ATG>ATT	p.M113I		NM_001004712	NP_001004712	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K,	113	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		CCAGGAGCACCATCTCAGCCC	0.463													11	64	---	---	---	---	PASS
DHRS4	10901	broad.mit.edu	37	14	24435598	24435598	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24435598G>A	uc001wla.2	+	6	671	c.638G>A	c.(637-639)GGA>GAA	p.G213E	DHRS4_uc010aky.2_Intron|DHRS4_uc001wlb.2_Missense_Mutation_p.G179E|DHRS4_uc010akz.2_Intron|DHRS4_uc001wlc.3_Missense_Mutation_p.G213E|DHRS4L2_uc001wld.3_Intron|DHRS4L2_uc001wle.3_Intron	NM_021004	NP_066284	Q9BTZ2	DHRS4_HUMAN	peroxisomal short-chain alcohol dehydrogenase	213						mitochondrion|nuclear membrane|peroxisome	binding|carbonyl reductase (NADPH) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	CTAGCACCTGGACTTATCAAG	0.527													4	143	---	---	---	---	PASS
BMP4	652	broad.mit.edu	37	14	54417514	54417514	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54417514A>C	uc001xal.3	-	3	650	c.463T>G	c.(463-465)TCT>GCT	p.S155A	BMP4_uc010aoh.2_Missense_Mutation_p.S155A|BMP4_uc001xao.3_Missense_Mutation_p.S155A|BMP4_uc001xan.3_Missense_Mutation_p.S155A	NM_130851	NP_570912	P12644	BMP4_HUMAN	bone morphogenetic protein 4 preproprotein	155					activation of MAPKK activity|blood vessel endothelial cell proliferation involved in sprouting angiogenesis|BMP signaling pathway involved in heart induction|BMP signaling pathway involved in nephric duct formation|branching involved in ureteric bud morphogenesis|bronchus development|bud dilation involved in lung branching|cardiac septum development|cartilage development|endocardial cushion development|epithelial cell proliferation involved in lung morphogenesis|intermediate mesodermal cell differentiation|lung alveolus development|lymphoid progenitor cell differentiation|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway|negative regulation of branching involved in ureteric bud morphogenesis|negative regulation of cell proliferation involved in heart morphogenesis|negative regulation of glomerular mesangial cell proliferation|negative regulation of glomerulus development|negative regulation of immature T cell proliferation in thymus|negative regulation of MAP kinase activity|negative regulation of metanephric comma-shaped body morphogenesis|negative regulation of metanephric S-shaped body morphogenesis|negative regulation of mitosis|negative regulation of myoblast differentiation|negative regulation of phosphorylation|negative regulation of striated muscle tissue development|negative regulation of thymocyte apoptosis|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cardiac muscle fiber development|positive regulation of cartilage development|positive regulation of collagen biosynthetic process|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of kidney development|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|protein localization to nucleus|pulmonary artery endothelial tube morphogenesis|secondary heart field specification|SMAD protein signal transduction|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway|steroid hormone mediated signaling pathway	extracellular space|proteinaceous extracellular matrix	BMP receptor binding|chemoattractant activity|cytokine activity|growth factor activity				0						AGCTCTGCAGAGGAGATCACC	0.532													8	48	---	---	---	---	PASS
ARID4A	5926	broad.mit.edu	37	14	58831026	58831026	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58831026C>G	uc001xdp.2	+	20	2473	c.2219C>G	c.(2218-2220)TCT>TGT	p.S740C	ARID4A_uc001xdo.2_Missense_Mutation_p.S740C|ARID4A_uc001xdq.2_Missense_Mutation_p.S740C|ARID4A_uc010apg.1_Missense_Mutation_p.S418C	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	740					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						CCAAAGATTTCTGCACATATA	0.289													3	124	---	---	---	---	PASS
ARID4A	5926	broad.mit.edu	37	14	58831452	58831452	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58831452C>G	uc001xdp.2	+	20	2899	c.2645C>G	c.(2644-2646)TCT>TGT	p.S882C	ARID4A_uc001xdo.2_Missense_Mutation_p.S882C|ARID4A_uc001xdq.2_Missense_Mutation_p.S882C|ARID4A_uc010apg.1_Missense_Mutation_p.S560C	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	882					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						AATACTGTATCTCAAGAAAGG	0.333													3	59	---	---	---	---	PASS
RHOJ	57381	broad.mit.edu	37	14	63747706	63747706	+	Silent	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63747706G>T	uc001xgb.1	+	3	698	c.255G>T	c.(253-255)CTG>CTT	p.L85L		NM_020663	NP_065714	Q9H4E5	RHOJ_HUMAN	ras homolog gene family, member J precursor	85					actin cytoskeleton organization|regulation of cell shape|regulation of small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)		ACAACCAGCTGAGGCCACTCT	0.517													4	107	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65246548	65246548	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65246548G>A	uc001xht.2	-	20	4422	c.4368C>T	c.(4366-4368)ATC>ATT	p.I1456I	SPTB_uc001xhr.2_Silent_p.I1456I|SPTB_uc001xhs.2_Silent_p.I1456I|SPTB_uc001xhu.2_Silent_p.I1456I|SPTB_uc010aqi.2_Silent_p.I117I	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	1456	Spectrin 12.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		ACCGCTTCTCGATGCTCAAGT	0.567													7	164	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65253537	65253537	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65253537G>A	uc001xht.2	-	15	3200	c.3146C>T	c.(3145-3147)TCC>TTC	p.S1049F	SPTB_uc001xhr.2_Missense_Mutation_p.S1049F|SPTB_uc001xhs.2_Missense_Mutation_p.S1049F|SPTB_uc001xhu.2_Missense_Mutation_p.S1049F	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	1049	Spectrin 8.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GCCCTGCAGGGATTGCTGCAG	0.607													5	109	---	---	---	---	PASS
MPP5	64398	broad.mit.edu	37	14	67768824	67768824	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67768824G>C	uc001xjc.2	+	6	1256	c.790G>C	c.(790-792)GAT>CAT	p.D264H	MPP5_uc001xjd.2_Missense_Mutation_p.D230H|ATP6V1D_uc001xje.2_Intron	NM_022474	NP_071919	Q8N3R9	MPP5_HUMAN	membrane protein, palmitoylated 5	264	PDZ.				tight junction assembly	cytoplasm|endomembrane system|tight junction	protein domain specific binding			ovary(1)	1				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)		AAAGGCTCGTGATATTCCGTT	0.373													3	91	---	---	---	---	PASS
MLH3	27030	broad.mit.edu	37	14	75514843	75514843	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75514843C>A	uc001xrd.1	-	2	1732	c.1516G>T	c.(1516-1518)GAA>TAA	p.E506*	MLH3_uc001xre.1_Nonsense_Mutation_p.E506*|MLH3_uc010tuy.1_RNA	NM_001040108	NP_001035197	Q9UHC1	MLH3_HUMAN	mutL homolog 3 isoform 1	506					mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)		AAAAACATTTCTAAACTGGTT	0.388								MMR					6	128	---	---	---	---	PASS
ESRRB	2103	broad.mit.edu	37	14	76928997	76928997	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76928997G>A	uc001xsq.1	+	3	574	c.507G>A	c.(505-507)CTG>CTA	p.L169L	ESRRB_uc001xsr.2_Silent_p.L169L|ESRRB_uc001xso.2_RNA	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta	169						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		TGGGGATGCTGAAGGAAGGTA	0.587													10	257	---	---	---	---	PASS
GSTZ1	2954	broad.mit.edu	37	14	77795519	77795519	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77795519G>C	uc001xtj.2	+	6	678	c.396G>C	c.(394-396)CAG>CAC	p.Q132H	GSTZ1_uc001xtk.2_Missense_Mutation_p.Q90H|GSTZ1_uc010ass.2_Missense_Mutation_p.Q77H|GSTZ1_uc001xtm.2_Missense_Mutation_p.Q77H	NM_145870	NP_665877	O43708	MAAI_HUMAN	glutathione transferase zeta 1 isoform 1	132	GST C-terminal.				glutathione metabolic process|L-phenylalanine catabolic process|tyrosine catabolic process	cytosol|mitochondrion	glutathione peroxidase activity|glutathione transferase activity|maleylacetoacetate isomerase activity|protein homodimerization activity				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)	Glutathione(DB00143)	CCTGGGCCCAGAACGCCATCA	0.582													7	108	---	---	---	---	PASS
SETD3	84193	broad.mit.edu	37	14	99865093	99865093	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99865093G>C	uc001ygc.2	-	13	1878	c.1708C>G	c.(1708-1710)CTC>GTC	p.L570V		NM_032233	NP_115609	Q86TU7	SETD3_HUMAN	SET domain containing 3 isoform a	570					peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity				0		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				TCTTGATTGAGACTTTCATTT	0.473													5	201	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102515856	102515856	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102515856G>C	uc001yks.2	+	75	13616	c.13452G>C	c.(13450-13452)GAG>GAC	p.E4484D		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	4484					cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						ACTTCAGCGAGAGGATCAAAC	0.607													3	54	---	---	---	---	PASS
ASPG	374569	broad.mit.edu	37	14	104571026	104571026	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104571026C>T	uc001yoq.1	+	9	1064	c.1004C>T	c.(1003-1005)TCG>TTG	p.S335L	ASPG_uc001yoo.1_Missense_Mutation_p.S363L|ASPG_uc001yop.1_Missense_Mutation_p.S335L|ASPG_uc001yor.1_Missense_Mutation_p.S335L	NM_001080464	NP_001073933	Q86U10	LPP60_HUMAN	60 kDa lysophospholipase	335	Asparaginase.				lipid catabolic process		1-alkyl-2-acetylglycerophosphocholine esterase activity|asparaginase activity|lysophospholipase activity				0						GCCAAGCTATCGTATGTGCTG	0.662													6	37	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106066464	106066464	+	Intron	SNP	T	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106066464T>C	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Missense_Mutation_p.H423R|uc001yrx.1_Missense_Mutation_p.H370R|uc010axp.1_5'Flank|uc001yrv.1_5'Flank|uc001yru.2_RNA|uc010axq.1_Intron					Parts of antibodies, mostly variable regions.												0						TGCTGCCTCATGGACTGCACG	0.617													15	84	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107218845	107218845	+	RNA	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107218845C>A	uc010tyt.1	-	12		c.869G>T								Parts of antibodies, mostly variable regions.												0						CAGCCCCTTCCCTGGAGCTTG	0.582													23	120	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28513702	28513702	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28513702C>T	uc001zbj.2	-	12	1613	c.1507G>A	c.(1507-1509)GAT>AAT	p.D503N	HERC2_uc001zbl.1_Missense_Mutation_p.D198N	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	503	WD 3.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TGGTGACCATCAGAATGGGCA	0.532													4	65	---	---	---	---	PASS
GJD2	57369	broad.mit.edu	37	15	35045123	35045123	+	Silent	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35045123C>A	uc001zis.1	-	2	522	c.522G>T	c.(520-522)CTG>CTT	p.L174L	uc001zit.1_5'Flank	NM_020660	NP_065711	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	174	Cytoplasmic (Potential).				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity				0		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		GGTGTGGAGTCAGCTCCTTAA	0.468													27	205	---	---	---	---	PASS
MGA	23269	broad.mit.edu	37	15	42052646	42052646	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42052646G>C	uc010ucy.1	+	20	7498	c.7317G>C	c.(7315-7317)ATG>ATC	p.M2439I	MGA_uc010ucz.1_Missense_Mutation_p.M2230I|MGA_uc010uda.1_Missense_Mutation_p.M1055I	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1	2400	Helix-loop-helix motif.					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		GTGGTGAAATGAGGGATCTCT	0.433													5	127	---	---	---	---	PASS
TTBK2	146057	broad.mit.edu	37	15	43093926	43093926	+	Intron	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43093926C>A	uc001zqo.2	-						TTBK2_uc010bcy.2_Intron|TTBK2_uc001zqp.2_Intron|TTBK2_uc010bcz.1_Intron	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2						cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		ATCTCCTCTTCATACAGCTGC	0.512													21	121	---	---	---	---	PASS
SPG11	80208	broad.mit.edu	37	15	44890849	44890849	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44890849C>G	uc001ztx.2	-	22	3903	c.3872G>C	c.(3871-3873)AGC>ACC	p.S1291T	SPG11_uc010ueh.1_Missense_Mutation_p.S1291T|SPG11_uc010uei.1_Missense_Mutation_p.S1291T|SPG11_uc001zty.1_Missense_Mutation_p.S20T	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1	1291	Cytoplasmic (Potential).				cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TCTGATAAAGCTGTACTGAGC	0.428													8	92	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48829910	48829910	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48829910T>C	uc001zwx.1	-	7	962	c.634A>G	c.(634-636)ACA>GCA	p.T212A		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	212	TB 1.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CGGCCGACTGTGGCACAGCAG	0.577													22	160	---	---	---	---	PASS
MAPK6	5597	broad.mit.edu	37	15	52357078	52357078	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52357078C>G	uc002abp.2	+	6	2841	c.2047C>G	c.(2047-2049)CAC>GAC	p.H683D		NM_002748	NP_002739	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	683					cell cycle		ATP binding|MAP kinase activity			lung(3)|ovary(1)	4				all cancers(107;0.0028)		CCCACAGTTTCACAGTCCAGT	0.468													8	74	---	---	---	---	PASS
TBC1D21	161514	broad.mit.edu	37	15	74166053	74166053	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74166053G>A	uc002avz.2	+	1	86	c.3G>A	c.(1-3)ATG>ATA	p.M1I	TBC1D21_uc010ulc.1_Missense_Mutation_p.M1I	NM_153356	NP_699187	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21	1						intracellular	Rab GTPase activator activity			ovary(2)	2						CAGGGGCCATGACCACCCTCT	0.552											OREG0023267	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	24	---	---	---	---	PASS
NRG4	145957	broad.mit.edu	37	15	76248359	76248359	+	Intron	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76248359A>G	uc002bbo.2	-						NRG4_uc010bkm.1_Intron|NRG4_uc002bbn.2_Intron|NRG4_uc010bkn.2_Intron|NRG4_uc010bko.2_Intron	NM_138573	NP_612640	Q8WWG1	NRG4_HUMAN	neuregulin 4							extracellular region|integral to membrane|plasma membrane	growth factor activity				0						TTTCCTGACAATAAAGAGGAG	0.408													8	77	---	---	---	---	PASS
IQGAP1	8826	broad.mit.edu	37	15	90969481	90969481	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90969481G>C	uc002bpl.1	+	3	396	c.295G>C	c.(295-297)GAA>CAA	p.E99Q		NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	99	CH.				energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CTATGATCGAGAACAGACCAG	0.423													3	77	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2806571	2806571	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2806571G>A	uc002crk.2	+	2	755	c.206G>A	c.(205-207)CGA>CAA	p.R69Q	SRRM2_uc002crj.1_Intron|SRRM2_uc002crl.1_Missense_Mutation_p.R69Q|SRRM2_uc010bsu.1_Intron	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	69	Potential.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						GTCGAGCTGCGATGCCTCGAG	0.627													8	100	---	---	---	---	PASS
NLRC3	197358	broad.mit.edu	37	16	3613598	3613598	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3613598G>A	uc010btn.2	-	5	1751	c.1340C>T	c.(1339-1341)TCG>TTG	p.S447L		NM_178844	NP_849172	Q7RTR2	NLRC3_HUMAN	NOD3 protein	447	NACHT.				I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						GGCCACTGACGATGCCAACGT	0.582													5	20	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18861663	18861663	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18861663C>T	uc002dfm.2	-	34	5542	c.5179G>A	c.(5179-5181)GAA>AAA	p.E1727K	SMG1_uc010bwb.2_Missense_Mutation_p.E1587K|SMG1_uc010bwa.2_Missense_Mutation_p.E458K|SMG1_uc002dfo.3_Missense_Mutation_p.E25K	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	1727	FAT.|Interaction with SMG8 and SMG9.				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						ATAACTCCTTCAGTTGCACTT	0.408													4	76	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21033341	21033341	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21033341G>C	uc010vbe.1	-	40	5728	c.5728C>G	c.(5728-5730)CCC>GCC	p.P1910A		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1910					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		AGGTGGATGGGAGATGTCTGG	0.488													7	66	---	---	---	---	PASS
CLN3	1201	broad.mit.edu	37	16	28497729	28497729	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28497729C>T	uc002dpo.2	-	8	939	c.616G>A	c.(616-618)GGC>AGC	p.G206S	uc010vct.1_Intron|CLN3_uc002dpl.2_Missense_Mutation_p.G128S|CLN3_uc010vcu.1_Missense_Mutation_p.G106S|CLN3_uc002dpn.2_Intron|CLN3_uc002dpm.2_Missense_Mutation_p.G152S|CLN3_uc010vcv.1_Missense_Mutation_p.G182S|CLN3_uc010byd.2_Missense_Mutation_p.G206S|CLN3_uc002dpp.2_Missense_Mutation_p.G206S|CLN3_uc002dpt.1_Missense_Mutation_p.G106S|CLN3_uc002dpq.1_Intron|CLN3_uc010bye.1_Missense_Mutation_p.G206S|CLN3_uc002dpr.1_Intron|CLN3_uc010byf.1_Intron|CLN3_uc002dps.1_Intron|CLN3_uc002dpu.1_Intron|CLN3_uc002dpw.1_Intron|CLN3_uc010vcw.1_Missense_Mutation_p.G152S|CLN3_uc002dqa.2_Missense_Mutation_p.G257S|CLN3_uc010vcx.1_Missense_Mutation_p.G106S|CLN3_uc002dpx.1_Intron|CLN3_uc002dpy.1_Intron|CLN3_uc002dpz.1_RNA	NM_000086	NP_000077	Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	206					amyloid precursor protein catabolic process|arginine transport|associative learning|autophagic vacuole fusion|cell death|cellular amino acid metabolic process|cytosolic calcium ion homeostasis|galactosylceramide metabolic process|globoside metabolic process|glucosylceramide metabolic process|ionotropic glutamate receptor signaling pathway|lysosomal lumen acidification|lysosomal lumen pH elevation|negative regulation of catalytic activity|negative regulation of macroautophagy|negative regulation of neuron apoptosis|negative regulation of proteolysis|neuromuscular process controlling balance|neurotransmitter metabolic process|protein catabolic process|protein folding|protein processing|receptor-mediated endocytosis|regulation of action potential|sphingomyelin metabolic process|vacuolar transport	autophagic vacuole|caveola|cytosol|early endosome|Golgi membrane|Golgi stack|integral to endoplasmic reticulum membrane|late endosome|lysosomal membrane|membrane fraction|mitochondrion|neuron projection|nucleus|synaptic vesicle|trans-Golgi network	unfolded protein binding				0						GGGGAGAGGCCGGCCTGGGTG	0.687													6	48	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30712191	30712191	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30712191C>A	uc002dze.1	+	3	431	c.46C>A	c.(46-48)CAG>AAG	p.Q16K		NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	16					interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			CCCAGTCCTACAGACACAGGT	0.532													3	54	---	---	---	---	PASS
ABCC11	85320	broad.mit.edu	37	16	48250159	48250159	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48250159C>G	uc002eff.1	-	6	1167	c.817G>C	c.(817-819)GAA>CAA	p.E273Q	ABCC11_uc002efg.1_Missense_Mutation_p.E273Q|ABCC11_uc002efh.1_Missense_Mutation_p.E273Q|ABCC11_uc010vgk.1_5'Flank|ABCC11_uc010vgl.1_Missense_Mutation_p.E273Q	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11	273	ABC transmembrane type-1 1.|Helical; (Potential).					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				CACACCCCTTCAAACAGGTAG	0.502									Cerumen_Type				6	179	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72992324	72992324	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72992324C>G	uc002fck.2	-	2	2394	c.1721G>C	c.(1720-1722)AGT>ACT	p.S574T	ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	574					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				GACGCCCTCACTGTTAAAGCT	0.507													11	78	---	---	---	---	PASS
PLCG2	5336	broad.mit.edu	37	16	81973631	81973631	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81973631C>G	uc002fgt.2	+	30	3600	c.3448C>G	c.(3448-3450)CAT>GAT	p.H1150D		NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	1150	C2.				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						CTTTCTTGCTCATGCCACTTA	0.423													7	149	---	---	---	---	PASS
INPP5K	51763	broad.mit.edu	37	17	1416780	1416780	+	Silent	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1416780G>C	uc002fsr.2	-	3	617	c.228C>G	c.(226-228)CTC>CTG	p.L76L	INPP5K_uc002fss.2_5'UTR|INPP5K_uc002fsq.2_5'UTR|INPP5K_uc010cjr.2_5'UTR|INPP5K_uc010vql.1_Intron|INPP5K_uc010vqm.1_Silent_p.L76L|INPP5K_uc010cjs.2_Intron	NM_016532	NP_057616	Q9BT40	INP5K_HUMAN	inositol polyphosphate-5-phosphatase K isoform	76	Catalytic (Potential).				actin cytoskeleton organization	cytosol|endoplasmic reticulum|membrane fraction|neuron projection|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol bisphosphate phosphatase activity|inositol bisphosphate phosphatase activity|inositol trisphosphate phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|lipid phosphatase activity|protein binding				0						GCACATCCATGAGGAAACTGC	0.493													4	211	---	---	---	---	PASS
TEKT1	83659	broad.mit.edu	37	17	6718550	6718550	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6718550G>A	uc002gdt.2	-	5	671	c.561C>T	c.(559-561)ATC>ATT	p.I187I	TEKT1_uc010vth.1_Silent_p.I41I	NM_053285	NP_444515	Q969V4	TEKT1_HUMAN	tektin 1	187					microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|skin(1)	2		Myeloproliferative disorder(207;0.0255)				GCGAGAAGCAGATATCATCTA	0.488													16	159	---	---	---	---	PASS
GAS7	8522	broad.mit.edu	37	17	9923193	9923193	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9923193G>A	uc002gmg.1	-	2	366	c.205C>T	c.(205-207)CCG>TCG	p.P69S	GAS7_uc010vvd.1_Missense_Mutation_p.P21S|GAS7_uc002gmi.2_Missense_Mutation_p.P5S|GAS7_uc002gmj.1_Missense_Mutation_p.P9S|GAS7_uc010coh.1_Missense_Mutation_p.P9S	NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c	69	Poly-Pro.				cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						TCTCCCGGCGGAGGGGGGACC	0.542			T	MLL	AML*								16	76	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10307706	10307706	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10307706C>G	uc002gmm.2	-	22	2724	c.2629G>C	c.(2629-2631)GAG>CAG	p.E877Q	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	877	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						ATTTTTTCCTCTAGCTCCTTC	0.438									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				10	83	---	---	---	---	PASS
FBXW10	10517	broad.mit.edu	37	17	18682174	18682174	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18682174A>G	uc002guk.2	+	14	2954	c.2722A>G	c.(2722-2724)ATA>GTA	p.I908V	FBXW10_uc002guj.2_Missense_Mutation_p.I907V|FBXW10_uc002gul.2_Missense_Mutation_p.I917V|FBXW10_uc010cqh.1_Missense_Mutation_p.I855V|FAM18B_uc002gum.2_5'Flank	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10	908										ovary(1)	1						CCAGTCCACCATACCCCAGCC	0.502													9	203	---	---	---	---	PASS
ERAL1	26284	broad.mit.edu	37	17	27182147	27182147	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27182147C>A	uc002hcy.1	+	1	105	c.95C>A	c.(94-96)CCT>CAT	p.P32H	ERAL1_uc002hcx.1_Missense_Mutation_p.P32H|ERAL1_uc002hcz.1_RNA|ERAL1_uc002hda.1_5'Flank|ERAL1_uc002hdb.1_5'Flank	NM_005702	NP_005693	O75616	ERAL1_HUMAN	Era-like 1	32					ribosomal small subunit assembly	mitochondrial inner membrane|mitochondrial matrix	GTP binding|ribosomal small subunit binding|rRNA binding			skin(1)	1	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.12e-05)|all cancers(11;5.32e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.105)			CGGGTGATCCCTTTTTCCTCA	0.627													12	84	---	---	---	---	PASS
KRT24	192666	broad.mit.edu	37	17	38855808	38855808	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38855808T>C	uc002hvd.2	-	6	1306	c.1249A>G	c.(1249-1251)ATC>GTC	p.I417V		NM_019016	NP_061889	Q2M2I5	K1C24_HUMAN	keratin 24	417	Rod.|Coil 2.					cytoplasm|intermediate filament	structural molecule activity				0		Breast(137;0.00526)				TCACCCCAGATCTGGCAGATC	0.567													12	198	---	---	---	---	PASS
KRT31	3881	broad.mit.edu	37	17	39553742	39553742	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39553742G>C	uc002hwn.2	-	1	103	c.50C>G	c.(49-51)TCC>TGC	p.S17C	KRT31_uc010cxn.2_Missense_Mutation_p.S17C	NM_002277	NP_002268	Q15323	K1H1_HUMAN	keratin 31	17	Head.				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000496)				GGGCCGGGAGGAGCAGCTGGT	0.652													6	51	---	---	---	---	PASS
KRT14	3861	broad.mit.edu	37	17	39739351	39739351	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39739351C>G	uc002hxf.1	-	7	1377	c.1316G>C	c.(1315-1317)AGA>ACA	p.R439T	JUP_uc010wfs.1_Intron|KRT14_uc010cxp.1_Intron	NM_000526	NP_000517	P02533	K1C14_HUMAN	keratin 14	439	Tail.|Interaction with Type I keratins and keratin filaments.				epidermis development|hemidesmosome assembly|intermediate filament bundle assembly	cytosol|keratin filament|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(1)	1		Breast(137;0.000307)				CTTACCATCTCTGGATGACTG	0.577													8	140	---	---	---	---	PASS
AARSD1	80755	broad.mit.edu	37	17	41122314	41122314	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41122314C>T	uc002icf.2	-	7	771	c.553G>A	c.(553-555)GAT>AAT	p.D185N	AARSD1_uc002icd.2_Missense_Mutation_p.D124N|AARSD1_uc002ice.2_Missense_Mutation_p.D94N|AARSD1_uc010whg.1_Missense_Mutation_p.D185N|AARSD1_uc002icg.2_RNA|AARSD1_uc002ich.2_Missense_Mutation_p.D147N|AARSD1_uc010whh.1_Missense_Mutation_p.D152N	NM_025267	NP_079543	Q9BTE6	AASD1_HUMAN	alanyl-tRNA synthetase domain containing 1	Error:Variant_position_missing_in_Q9BTE6_after_alignment					alanyl-tRNA aminoacylation	cytoplasm	alanine-tRNA ligase activity|ATP binding|metal ion binding|nucleic acid binding				0		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		ACATCCAAATCATCCATGGCA	0.453													45	432	---	---	---	---	PASS
SPOP	8405	broad.mit.edu	37	17	47688717	47688717	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47688717C>A	uc010dbk.2	-	7	1215	c.583G>T	c.(583-585)GAG>TAG	p.E195*	SPOP_uc002ipb.2_Nonsense_Mutation_p.E195*|SPOP_uc002ipc.2_Nonsense_Mutation_p.E195*|SPOP_uc002ipd.2_Nonsense_Mutation_p.E195*|SPOP_uc002ipe.2_Nonsense_Mutation_p.E195*|SPOP_uc002ipf.2_Nonsense_Mutation_p.E195*|SPOP_uc002ipg.2_Nonsense_Mutation_p.E195*	NM_003563	NP_003554	O43791	SPOP_HUMAN	speckle-type POZ protein	195	BTB.				mRNA processing	nucleus	protein binding			prostate(2)|ovary(2)|lung(2)	6						CGGGAATTCTCCCACAGTCCT	0.483										Prostate(2;0.17)			48	221	---	---	---	---	PASS
TMEM49	81671	broad.mit.edu	37	17	57842496	57842496	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57842496G>C	uc002ixu.3	+	6	852	c.579G>C	c.(577-579)ATG>ATC	p.M193I	TMEM49_uc010wog.1_Missense_Mutation_p.M1I|TMEM49_uc010woh.1_Intron|TMEM49_uc010woi.1_Missense_Mutation_p.M96I|TMEM49_uc010woj.1_Missense_Mutation_p.M59I	NM_030938	NP_112200	Q96GC9	VMP1_HUMAN	transmembrane protein 49	193	Extracellular (Potential).				autophagy|cell adhesion	endoplasmic reticulum|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane|vacuolar membrane					0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;1.15e-09)|all cancers(12;1.15e-08)			AAGCCTGCATGTGGGTAAGAT	0.373													24	52	---	---	---	---	PASS
TEX2	55852	broad.mit.edu	37	17	62265629	62265629	+	Missense_Mutation	SNP	C	T	T	rs149542859		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62265629C>T	uc002jec.2	-	5	2496	c.2323G>A	c.(2323-2325)GAC>AAC	p.D775N	TEX2_uc002jed.2_Missense_Mutation_p.D782N|TEX2_uc002jee.2_Missense_Mutation_p.D775N	NM_018469	NP_060939	Q8IWB9	TEX2_HUMAN	testis expressed sequence 2	775					signal transduction|sphingolipid metabolic process	integral to membrane				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		ACGCTGTAGTCGAGAAGCATC	0.622													4	102	---	---	---	---	PASS
HELZ	9931	broad.mit.edu	37	17	65156379	65156379	+	Silent	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65156379G>C	uc010wqk.1	-	17	2365	c.2178C>G	c.(2176-2178)CTC>CTG	p.L726L	HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Silent_p.L725L	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					AAAAATACCTGAGAGGTCTTG	0.338													4	54	---	---	---	---	PASS
HELZ	9931	broad.mit.edu	37	17	65184632	65184632	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65184632G>A	uc010wqk.1	-	12	1152	c.965C>T	c.(964-966)TCA>TTA	p.S322L	HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.S322L	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					GACTTCTTGTGATACCTGGGT	0.408													11	306	---	---	---	---	PASS
KIAA0195	9772	broad.mit.edu	37	17	73489113	73489113	+	Silent	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73489113C>G	uc002jnz.3	+	16	2291	c.2016C>G	c.(2014-2016)CTC>CTG	p.L672L	KIAA0195_uc010wsa.1_Silent_p.L682L|KIAA0195_uc010wsb.1_Silent_p.L312L|KIAA0195_uc002job.3_5'Flank	NM_014738	NP_055553	Q12767	K0195_HUMAN	hypothetical protein LOC9772	672					ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism			ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGGGGCGGCTCTCCTGTGTCA	0.607													17	59	---	---	---	---	PASS
ENGASE	64772	broad.mit.edu	37	17	77075610	77075610	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77075610C>G	uc002jwv.2	+	4	464	c.456C>G	c.(454-456)TTC>TTG	p.F152L	ENGASE_uc002jwu.1_Missense_Mutation_p.F152L|ENGASE_uc010wtz.1_Intron|ENGASE_uc002jww.2_5'Flank	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	152				F -> L (in Ref. 2; BAB15158).		cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						CCTATGCTTTCTACCACTGGC	0.453													18	211	---	---	---	---	PASS
CETN1	1068	broad.mit.edu	37	18	580595	580595	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:580595G>A	uc002kko.1	+	1	229	c.187G>A	c.(187-189)GAA>AAA	p.E63K		NM_004066	NP_004057	Q12798	CETN1_HUMAN	centrin 1	63	EF-hand 1.				cell division|mitosis	spindle pole	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding			upper_aerodigestive_tract(1)|ovary(1)	2						GCTGGGCTTCGAACCCAGGAA	0.552													7	59	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6975960	6975960	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6975960G>A	uc002knm.2	-	45	6559	c.6465C>T	c.(6463-6465)CTC>CTT	p.L2155L	LAMA1_uc010wzj.1_Silent_p.L1631L	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2155	Laminin G-like 1.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CGAGGTAGAAGAGAAGATTAT	0.418													4	139	---	---	---	---	PASS
MOCOS	55034	broad.mit.edu	37	18	33775227	33775227	+	Silent	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33775227C>G	uc002kzq.3	+	2	173	c.150C>G	c.(148-150)GTC>GTG	p.V50V		NM_017947	NP_060417	Q96EN8	MOCOS_HUMAN	molybdenum cofactor sulfurase	50					Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	CAGGAACTGTCTATCTTGACC	0.368													3	160	---	---	---	---	PASS
TCEB3B	51224	broad.mit.edu	37	18	44560278	44560278	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44560278G>A	uc002lcr.1	-	1	1711	c.1358C>T	c.(1357-1359)ACG>ATG	p.T453M	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	453					regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding			ovary(2)|large_intestine(1)|pancreas(1)	4						GCTGGGCACCGTTTTCGGCCC	0.602													16	117	---	---	---	---	PASS
ACAA2	10449	broad.mit.edu	37	18	47323859	47323859	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47323859G>C	uc002ldw.3	-	3	686	c.289C>G	c.(289-291)CAG>GAG	p.Q97E	ACAA2_uc002ldx.3_Missense_Mutation_p.Q94E	NM_006111	NP_006102	P42765	THIM_HUMAN	acetyl-coenzyme A acyltransferase 2	97					anti-apoptosis|cholesterol biosynthetic process		acetyl-CoA C-acyltransferase activity|protein binding			ovary(1)	1						ACAATGGACTGAAAACCAGAA	0.388													6	147	---	---	---	---	PASS
SERPINB4	6318	broad.mit.edu	37	18	61325788	61325788	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61325788C>G	uc002ljg.2	-	4	454	c.428G>C	c.(427-429)AGT>ACT	p.S143T	SERPINB3_uc002lji.2_Missense_Mutation_p.S143T|SERPINB3_uc010dqa.2_Missense_Mutation_p.S143T|SERPINB3_uc010dqb.2_3'UTR			P48594	SPB4_HUMAN	SubName: Full=Squamous cell carcinoma antigen 2;	143					immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|lung(1)	3						CTTCTTTCGACTTTCTTCTGG	0.398													6	80	---	---	---	---	PASS
CDH7	1005	broad.mit.edu	37	18	63491903	63491903	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63491903G>T	uc002ljz.2	+	6	1142	c.817G>T	c.(817-819)GAG>TAG	p.E273*	CDH7_uc002lka.2_Nonsense_Mutation_p.E273*|CDH7_uc002lkb.2_Nonsense_Mutation_p.E273*	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	273	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				TAACGTCCCAGAGTCATTACC	0.383													4	87	---	---	---	---	PASS
CCDC102B	79839	broad.mit.edu	37	18	66504390	66504390	+	Silent	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66504390G>T	uc002lkk.2	+	4	613	c.390G>T	c.(388-390)GCG>GCT	p.A130A	CCDC102B_uc002lki.2_Silent_p.A130A|CCDC102B_uc002lkj.1_Silent_p.A130A	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	130	Potential.									ovary(1)|lung(1)|skin(1)	3		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				TAGAGATGGCGATGAAAGAAT	0.448													16	76	---	---	---	---	PASS
APC2	10297	broad.mit.edu	37	19	1453249	1453249	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1453249G>A	uc002lsr.1	+	3	353	c.145G>A	c.(145-147)GTC>ATC	p.V49I	APC2_uc002lss.1_5'UTR|APC2_uc002lst.1_Missense_Mutation_p.V49I|APC2_uc002lsu.1_Missense_Mutation_p.V49I	NM_005883	NP_005874	O95996	APC2_HUMAN	adenomatosis polyposis coli 2	49	Potential.				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding			breast(3)|pancreas(1)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGCAGGAGGTCCTGAAGCA	0.682													3	6	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9072935	9072935	+	Silent	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9072935G>T	uc002mkp.2	-	3	14715	c.14511C>A	c.(14509-14511)ACC>ACA	p.T4837T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	4839	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTGAACCGGTGGTCCCCACAT	0.463													16	100	---	---	---	---	PASS
ZNF266	10781	broad.mit.edu	37	19	9525174	9525174	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9525174C>G	uc002mll.2	-	4	693	c.427G>C	c.(427-429)GAT>CAT	p.D143H	ZNF266_uc002mlm.2_Missense_Mutation_p.D143H|ZNF266_uc002mln.2_Missense_Mutation_p.D143H|ZNF266_uc002mlo.2_Missense_Mutation_p.D143H|ZNF266_uc010dwp.2_Missense_Mutation_p.D143H|ZNF266_uc010dwq.2_Missense_Mutation_p.D143H	NM_198058	NP_932175	Q14584	ZN266_HUMAN	zinc finger protein 266	143					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CAAACAACATCTGGGTTCAGG	0.438													3	128	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10073506	10073506	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10073506G>C	uc002mmq.1	-	65	4926	c.4840C>G	c.(4840-4842)CGA>GGA	p.R1614G		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	1614	Fibrillar collagen NC1.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			TTCTTCCCTCGACGGAATGTG	0.547													3	30	---	---	---	---	PASS
PLVAP	83483	broad.mit.edu	37	19	17477002	17477002	+	Silent	SNP	G	A	A	rs138246020		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17477002G>A	uc002ngk.1	-	2	422	c.372C>T	c.(370-372)GTC>GTT	p.V124V		NM_031310	NP_112600	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	124	Extracellular (Potential).					caveola|integral to membrane|perinuclear region of cytoplasm					0						TCGTGTAGATGACCTGCCCGG	0.542													6	210	---	---	---	---	PASS
TSSK6	83983	broad.mit.edu	37	19	19626179	19626179	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19626179C>G	uc002nmr.2	-	1	291	c.58G>C	c.(58-60)GAG>CAG	p.E20Q	TSSK6_uc002nmq.2_RNA|NDUFA13_uc002nms.2_5'Flank|NDUFA13_uc010xqx.1_5'Flank|NDUFA13_uc010xqy.1_5'Flank	NM_032037	NP_114426	Q9BXA6	TSSK6_HUMAN	testis-specific serine kinase 6	20	ATP (By similarity).|Protein kinase.				multicellular organismal development|sperm chromatin condensation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			stomach(1)	1						TAGCTGCCCTCTCCAATTGTG	0.632													5	99	---	---	---	---	PASS
ZNF506	440515	broad.mit.edu	37	19	19905854	19905854	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19905854C>G	uc010eci.2	-	4	990	c.842G>C	c.(841-843)GGA>GCA	p.G281A	ZNF506_uc002nog.2_Intron|ZNF506_uc002noh.3_Missense_Mutation_p.G249A	NM_001099269	NP_001092739	Q5JVG8	ZN506_HUMAN	zinc finger protein 506 isoform 1	281					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|zinc ion binding				0						TGGTTTCTCTCCAGTATGAAT	0.368													3	51	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23543988	23543988	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23543988C>A	uc002nre.2	-	4	1906	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Missense_Mutation_p.G566V	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	598						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				AGACTTCTCTCCAGTATGAAT	0.363													8	55	---	---	---	---	PASS
TYROBP	7305	broad.mit.edu	37	19	36398144	36398144	+	Missense_Mutation	SNP	G	C	C	rs151172291	byFrequency	TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36398144G>C	uc002ocm.2	-	4	308	c.252C>G	c.(250-252)ATC>ATG	p.I84M	TYROBP_uc002ocn.2_Missense_Mutation_p.I83M	NM_003332	NP_003323	O43914	TYOBP_HUMAN	TYRO protein tyrosine kinase binding protein	84	Cytoplasmic (Potential).				axon guidance|cell junction assembly|cellular defense response|intracellular signal transduction|regulation of immune response	integral to plasma membrane|intracellular	identical protein binding|receptor signaling protein activity				0	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CGGTCTCAGTGATACGCTGTT	0.537													4	34	---	---	---	---	PASS
HKR1	284459	broad.mit.edu	37	19	37853479	37853479	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37853479T>C	uc002ogb.2	+	6	1051	c.782T>C	c.(781-783)CTT>CCT	p.L261P	HKR1_uc002ofx.2_5'UTR|HKR1_uc002ofy.2_5'UTR|HKR1_uc002oga.2_Missense_Mutation_p.L243P|HKR1_uc010xto.1_Missense_Mutation_p.L243P|HKR1_uc002ogc.2_Missense_Mutation_p.L242P|HKR1_uc010xtp.1_Missense_Mutation_p.L200P|HKR1_uc002ogd.2_Missense_Mutation_p.L200P	NM_181786	NP_861451	P10072	HKR1_HUMAN	GLI-Kruppel family member HKR1	261					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCAAACCTCCTTAGCCTCCAG	0.448													7	74	---	---	---	---	PASS
CD79A	973	broad.mit.edu	37	19	42383185	42383185	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42383185G>A	uc002orv.2	+	2	390	c.205G>A	c.(205-207)GTC>ATC	p.V69I	CD79A_uc002oru.2_Missense_Mutation_p.V69I	NM_001783	NP_001774	P11912	CD79A_HUMAN	CD79A antigen isoform 1 precursor	69	Ig-like C2-type.|Extracellular (Potential).			V -> I (in Ref. 3; AAA60270).	B cell differentiation|B cell proliferation|B cell receptor signaling pathway	B cell receptor complex|external side of plasma membrane|integral to membrane|membrane raft|multivesicular body	transmembrane receptor activity			ovary(2)|pancreas(1)	3						CTGGTGGCGCGTCCTCCATGG	0.602			O|S		DLBCL								22	91	---	---	---	---	PASS
ATP1A3	478	broad.mit.edu	37	19	42492696	42492696	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42492696C>G	uc002osg.2	-	2	179	c.25G>C	c.(25-27)GAC>CAC	p.D9H	ATP1A3_uc010xwf.1_Missense_Mutation_p.D20H|ATP1A3_uc010xwg.1_5'UTR|ATP1A3_uc010xwh.1_Missense_Mutation_p.D22H|ATP1A3_uc002osh.2_Missense_Mutation_p.D9H	NM_152296	NP_689509	P13637	AT1A3_HUMAN	Na+/K+ -ATPase alpha 3 subunit	9	Cytoplasmic (Potential).				ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2						TTGGGTGAGTCCTTGTCATCT	0.612													19	226	---	---	---	---	PASS
PPFIA3	8541	broad.mit.edu	37	19	49637913	49637913	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49637913G>C	uc002pmr.2	+	12	1727	c.1395G>C	c.(1393-1395)GAG>GAC	p.E465D	PPFIA3_uc010yai.1_RNA|PPFIA3_uc010emt.2_Missense_Mutation_p.E389D|PPFIA3_uc010yaj.1_RNA|PPFIA3_uc002pms.2_Missense_Mutation_p.E333D	NM_003660	NP_003651	O75145	LIPA3_HUMAN	PTPRF interacting protein alpha 3	465	Potential.					cell surface|cytoplasm	protein binding			lung(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		TGAGCGAGGAGATAGCCAACA	0.602													4	165	---	---	---	---	PASS
SIGLEC10	89790	broad.mit.edu	37	19	51917069	51917069	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51917069A>C	uc002pwo.2	-	10	2334	c.1718T>G	c.(1717-1719)ATT>AGT	p.I573S	SIGLEC10_uc002pwp.2_Missense_Mutation_p.I515S|SIGLEC10_uc002pwq.2_Missense_Mutation_p.I420S|SIGLEC10_uc002pwr.2_Missense_Mutation_p.I478S|SIGLEC10_uc010ycy.1_Missense_Mutation_p.I388S|SIGLEC10_uc010ycz.1_Missense_Mutation_p.I430S|SIGLEC10_uc010eow.2_Missense_Mutation_p.I290S|SIGLEC10_uc002pws.1_Missense_Mutation_p.I314S	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	573	Cytoplasmic (Potential).				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		CTTCGGTAGAATCTTCATGCT	0.443													9	70	---	---	---	---	PASS
ZNF616	90317	broad.mit.edu	37	19	52618120	52618120	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52618120C>G	uc002pym.2	-	4	2580	c.2297G>C	c.(2296-2298)AGA>ACA	p.R766T	ZNF616_uc002pyn.2_RNA	NM_178523	NP_848618	Q08AN1	ZN616_HUMAN	zinc finger protein 616	766	C2H2-type 21.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		TCCAGTATGTCTTATTCGATG	0.368													5	107	---	---	---	---	PASS
ZNF528	84436	broad.mit.edu	37	19	52919907	52919907	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52919907G>C	uc002pzh.2	+	7	2228	c.1802G>C	c.(1801-1803)GGA>GCA	p.G601A	ZNF528_uc002pzi.2_Missense_Mutation_p.G368A	NM_032423	NP_115799	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	601					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		ATTCACATTGGAGAGAAACCT	0.418													4	99	---	---	---	---	PASS
LAIR1	3903	broad.mit.edu	37	19	54867877	54867877	+	Splice_Site	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54867877C>A	uc002qfk.1	-	8	937	c.627_splice	c.e8-1	p.R209_splice	LAIR1_uc002qfl.1_Splice_Site_p.R192_splice|LAIR1_uc002qfm.1_Splice_Site_p.R208_splice|LAIR1_uc002qfn.1_Splice_Site_p.R191_splice|LAIR1_uc010yex.1_Splice_Site_p.R202_splice|LAIR1_uc002qfo.2_Splice_Site_p.R191_splice	NM_002287	NP_002278	Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like							integral to membrane|plasma membrane	protein binding|receptor activity			ovary(4)	4	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		CAGGTCAGGCCTAAGAGGAAA	0.597													14	50	---	---	---	---	PASS
NLRP11	204801	broad.mit.edu	37	19	56320725	56320725	+	Silent	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56320725G>C	uc010ygf.1	-	5	1962	c.1251C>G	c.(1249-1251)CTC>CTG	p.L417L	NLRP11_uc002qlz.2_Silent_p.L318L|NLRP11_uc002qmb.2_Silent_p.L318L|NLRP11_uc002qmc.2_RNA|NLRP11_uc010ete.1_RNA	NM_145007	NP_659444	P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	417	NACHT.						ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		CAACACATCTGAGGTCTTCAC	0.468													3	99	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57326512	57326512	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57326512C>A	uc002qnu.2	-	7	3649	c.3298G>T	c.(3298-3300)GAT>TAT	p.D1100Y	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.D1071Y|PEG3_uc002qnv.2_Missense_Mutation_p.D1100Y|PEG3_uc002qnw.2_Missense_Mutation_p.D976Y|PEG3_uc002qnx.2_Missense_Mutation_p.D974Y|PEG3_uc010etr.2_Missense_Mutation_p.D1100Y	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	1100					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TCAGGGTCATCCTTCTGAGGG	0.512													13	141	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57326513	57326513	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57326513C>A	uc002qnu.2	-	7	3648	c.3297G>T	c.(3295-3297)AAG>AAT	p.K1099N	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.K1070N|PEG3_uc002qnv.2_Missense_Mutation_p.K1099N|PEG3_uc002qnw.2_Missense_Mutation_p.K975N|PEG3_uc002qnx.2_Missense_Mutation_p.K973N|PEG3_uc010etr.2_Missense_Mutation_p.K1099N	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	1099					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CAGGGTCATCCTTCTGAGGGT	0.507													14	138	---	---	---	---	PASS
ZNF324	25799	broad.mit.edu	37	19	58982276	58982276	+	Silent	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58982276G>C	uc002qsw.1	+	4	511	c.417G>C	c.(415-417)GTG>GTC	p.V139V	ZNF324_uc002qsx.1_5'Flank	NM_014347	NP_055162	O75467	Z324A_HUMAN	zinc finger protein 324	139					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CCACGGGGGTGTCGGTGATCT	0.637													6	144	---	---	---	---	PASS
NRSN2	80023	broad.mit.edu	37	20	334113	334113	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:334113C>T	uc002wdi.3	+	4	987	c.449C>T	c.(448-450)CCC>CTC	p.P150L	NRSN2_uc002wdj.2_RNA|NRSN2_uc002wdl.2_Intron	NM_024958	NP_079234	Q9GZP1	NRSN2_HUMAN	neurensin 2	150						integral to membrane|plasma membrane|transport vesicle					0		all_cancers(10;0.0834)				AAGGCAGAGCCCTTGGACCCC	0.617													7	85	---	---	---	---	PASS
C20orf94	128710	broad.mit.edu	37	20	10602001	10602001	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10602001G>C	uc010zre.1	+	7	625	c.445G>C	c.(445-447)GAG>CAG	p.E149Q		NM_001009608	NP_001009608	Q5VYV7	CT094_HUMAN	hypothetical protein LOC128710	149							protein binding				0						TTACTTTGCTGAGTGTGCAGA	0.408													4	53	---	---	---	---	PASS
ASXL1	171023	broad.mit.edu	37	20	31024034	31024034	+	Missense_Mutation	SNP	G	C	C	rs117901891	byFrequency	TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31024034G>C	uc002wxs.2	+	12	3945	c.3519G>C	c.(3517-3519)TTG>TTC	p.L1173F	ASXL1_uc010geb.2_Missense_Mutation_p.L1064F	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	1173					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						TAAGGGCTTTGAAGGAGCCTC	0.527			F|N|Mis		MDS|CMML								8	111	---	---	---	---	PASS
SUN5	140732	broad.mit.edu	37	20	31590668	31590668	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31590668C>T	uc002wyi.2	-	2	228	c.135G>A	c.(133-135)ATG>ATA	p.M45I		NM_080675	NP_542406	Q8TC36	SUN5_HUMAN	sperm associated antigen 4-like	45					spermatogenesis					skin(1)	1						CTTGCTCACTCATGTTTGGGG	0.353													7	80	---	---	---	---	PASS
C20orf71	128861	broad.mit.edu	37	20	31814288	31814288	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31814288G>C	uc002wyr.2	+	5	821	c.613G>C	c.(613-615)GAA>CAA	p.E205Q	C20orf71_uc002wys.2_Missense_Mutation_p.E169Q	NM_178466	NP_848561	Q9BQP9	SPLC3_HUMAN	short long palate, lung and nasal epithelium	205						extracellular region	lipid binding			ovary(1)|skin(1)	2						ACACATGGTAGAAAGTCAGGT	0.378													5	69	---	---	---	---	PASS
PXMP4	11264	broad.mit.edu	37	20	32295600	32295600	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32295600G>T	uc002wzv.2	-	4	674	c.551C>A	c.(550-552)TCC>TAC	p.S184Y	PXMP4_uc002wzw.2_3'UTR|PXMP4_uc010zuh.1_3'UTR	NM_007238	NP_009169	Q9Y6I8	PXMP4_HUMAN	peroxisomal membrane protein 4 isoform a	184						integral to membrane|membrane fraction|mitochondrial inner membrane|peroxisomal membrane	protein transporter activity				0						GGTCATGGAGGACTGCAGCGA	0.582													24	174	---	---	---	---	PASS
ZNF341	84905	broad.mit.edu	37	20	32336822	32336822	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32336822A>T	uc002wzy.2	+	4	453	c.433A>T	c.(433-435)ATG>TTG	p.M145L	ZNF341_uc002wzx.2_Missense_Mutation_p.M145L|ZNF341_uc010geq.2_Missense_Mutation_p.M55L|ZNF341_uc010ger.2_RNA	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	145	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CATGTCTGCCATGTCAGCCTT	0.587													17	87	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33345744	33345744	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33345744C>T	uc002xav.2	-	8	3378	c.807G>A	c.(805-807)CAG>CAA	p.Q269Q	NCOA6_uc002xaw.2_Silent_p.Q269Q|NCOA6_uc010gew.1_Silent_p.Q226Q	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	TBP/GTF2A-binding region.|NCOA1-binding region.|Gln-rich.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						gctgctgctgctgttgttgtt	0.313													4	71	---	---	---	---	PASS
TRPC4AP	26133	broad.mit.edu	37	20	33596469	33596469	+	Silent	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33596469G>A	uc002xbk.2	-	13	1627	c.1593C>T	c.(1591-1593)TTC>TTT	p.F531F	TRPC4AP_uc002xbj.2_5'Flank|TRPC4AP_uc010zuq.1_Silent_p.F122F|TRPC4AP_uc002xbl.2_Silent_p.F523F|TRPC4AP_uc010zur.1_Silent_p.F492F|TRPC4AP_uc002xbm.1_Silent_p.F531F	NM_015638	NP_056453	Q8TEL6	TP4AP_HUMAN	TRPC4-associated protein isoform a	531					protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)			AGACTCACCTGAAAGACGACT	0.512													9	139	---	---	---	---	PASS
MANBAL	63905	broad.mit.edu	37	20	35929762	35929762	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35929762C>G	uc002xgu.2	+	3	308	c.96C>G	c.(94-96)TTC>TTG	p.F32L	MANBAL_uc002xgv.2_Missense_Mutation_p.F32L|MANBAL_uc002xgw.2_RNA|MANBAL_uc010gfx.2_RNA|MANBAL_uc010gfy.2_RNA	NM_022077	NP_071360	Q9NQG1	MANBL_HUMAN	mannosidase, beta A, lysosomal-like	32	Helical; (Potential).					integral to membrane					0		Myeloproliferative disorder(115;0.00878)				GAGCCATCTTCCAGCTCATCT	0.607													6	129	---	---	---	---	PASS
LBP	3929	broad.mit.edu	37	20	36989428	36989428	+	Intron	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36989428C>A	uc002xic.1	+							NM_004139	NP_004130	P18428	LBP_HUMAN	lipopolysaccharide-binding protein precursor						acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				CCAGGTAGGACACCCCATCCA	0.373													12	136	---	---	---	---	PASS
PPP1R16B	26051	broad.mit.edu	37	20	37518254	37518254	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37518254G>C	uc002xje.2	+	3	456	c.267G>C	c.(265-267)AAG>AAC	p.K89N	PPP1R16B_uc010ggc.2_Missense_Mutation_p.K89N	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor	89					regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				ACTTCCTGAAGAATAAGGTCA	0.607													8	334	---	---	---	---	PASS
SLC12A5	57468	broad.mit.edu	37	20	44666022	44666022	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44666022C>T	uc010zxl.1	+	6	755	c.679C>T	c.(679-681)CTG>TTG	p.L227L	SLC12A5_uc002xra.2_Silent_p.L204L|SLC12A5_uc010zxm.1_Intron|SLC12A5_uc002xrb.2_Silent_p.L204L	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	227	Helical; (Potential).				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CGAAATCCTGCTGGTAAGAGA	0.423													3	52	---	---	---	---	PASS
ARFGEF2	10564	broad.mit.edu	37	20	47611021	47611021	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47611021C>G	uc002xtx.3	+	22	3159	c.3007C>G	c.(3007-3009)CAG>GAG	p.Q1003E	ARFGEF2_uc010zyf.1_Missense_Mutation_p.Q296E	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	1003					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			GGAGCTCGCTCAGCTGATAGG	0.493													4	112	---	---	---	---	PASS
C20orf200	253868	broad.mit.edu	37	20	61143831	61143831	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61143831G>C	uc002ycz.1	-	3	508	c.17C>G	c.(16-18)ACA>AGA	p.T6R	C20orf200_uc002ycy.2_RNA	NM_152757	NP_689970			hypothetical protein LOC253868												0	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;7.17e-06)			GAGGTGCCCTGTGGCCAGAGT	0.662													10	137	---	---	---	---	PASS
LIPI	149998	broad.mit.edu	37	21	15561661	15561661	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15561661C>A	uc002yjm.2	-	2	199	c.189G>T	c.(187-189)GAG>GAT	p.E63D	LIPI_uc010gkw.1_5'UTR	NM_198996	NP_945347	Q6XZB0	LIPI_HUMAN	lipase, member I	42					lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity			ovary(2)	2				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		TCAGAATGGTCTCTATTCTCG	0.328													11	94	---	---	---	---	PASS
NRIP1	8204	broad.mit.edu	37	21	16337172	16337172	+	Silent	SNP	C	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16337172C>T	uc002yjx.2	-	4	3940	c.3342G>A	c.(3340-3342)ACG>ACA	p.T1114T		NM_003489	NP_003480	P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	1114					androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		androgen receptor binding|estrogen receptor binding|glucocorticoid receptor binding|transcription coactivator activity|transcription corepressor activity				0				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		AAGAAGCTTTCGTTTCTGCAG	0.438													9	121	---	---	---	---	PASS
ITSN1	6453	broad.mit.edu	37	21	35172220	35172220	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35172220G>C	uc002yta.1	+	19	2559	c.2291G>C	c.(2290-2292)GGA>GCA	p.G764A	DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Missense_Mutation_p.G764A|ITSN1_uc010gmg.2_Missense_Mutation_p.G727A|ITSN1_uc010gmh.2_RNA|ITSN1_uc002ysw.2_Missense_Mutation_p.G764A|ITSN1_uc010gmi.2_Missense_Mutation_p.G727A|ITSN1_uc010gmj.2_Missense_Mutation_p.G648A|ITSN1_uc002ysy.2_Missense_Mutation_p.G764A|ITSN1_uc002ysx.2_Missense_Mutation_p.G727A|ITSN1_uc002ytb.1_Missense_Mutation_p.G764A|ITSN1_uc002ytc.1_Missense_Mutation_p.G764A|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Missense_Mutation_p.G727A|ITSN1_uc010gml.2_RNA|ITSN1_uc002ytj.2_Missense_Mutation_p.G764A|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Missense_Mutation_p.G698A|ITSN1_uc002ytf.1_5'Flank	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	764	SH3 1.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						ATCCAGCCAGGAGACATAGTC	0.413													3	121	---	---	---	---	PASS
ZNF295	49854	broad.mit.edu	37	21	43411868	43411868	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43411868C>A	uc002zab.3	-	3	2551	c.2337G>T	c.(2335-2337)GAG>GAT	p.E779D	ZNF295_uc002yzz.3_Missense_Mutation_p.E578D|ZNF295_uc002yzy.3_Missense_Mutation_p.E779D|ZNF295_uc002zaa.3_Missense_Mutation_p.E779D	NM_001098402	NP_001091872	Q9ULJ3	ZN295_HUMAN	zinc finger protein 295 isoform L	779	C2H2-type 5.				negative regulation of transcription, DNA-dependent|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|nucleus	methyl-CpG binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3						TGCGCATGCACTCGAGGCAGG	0.537													31	217	---	---	---	---	PASS
ZNF295	49854	broad.mit.edu	37	21	43411872	43411872	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43411872A>C	uc002zab.3	-	3	2547	c.2333T>G	c.(2332-2334)CTC>CGC	p.L778R	ZNF295_uc002yzz.3_Missense_Mutation_p.L577R|ZNF295_uc002yzy.3_Missense_Mutation_p.L778R|ZNF295_uc002zaa.3_Missense_Mutation_p.L778R	NM_001098402	NP_001091872	Q9ULJ3	ZN295_HUMAN	zinc finger protein 295 isoform L	778	C2H2-type 5.				negative regulation of transcription, DNA-dependent|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|nucleus	methyl-CpG binding|protein binding|zinc ion binding	p.L778F(1)		ovary(1)|central_nervous_system(1)|skin(1)	3						CATGCACTCGAGGCAGGTCAG	0.532													32	230	---	---	---	---	PASS
KRTAP10-5	386680	broad.mit.edu	37	21	45999956	45999956	+	Missense_Mutation	SNP	G	T	T	rs117046341	by1000genomes	TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45999956G>T	uc002zfl.1	-	1	526	c.500C>A	c.(499-501)CCC>CAC	p.P167H	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198694	NP_941967	P60370	KR105_HUMAN	keratin associated protein 10-5	167	22 X 5 AA repeats of C-C-X(3).					keratin filament					0						CTGCTGGCAGGGGGAGGAGGT	0.597													12	218	---	---	---	---	PASS
ZNF280B	140883	broad.mit.edu	37	22	22843402	22843402	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22843402C>G	uc002zwc.1	-	4	1098	c.322G>C	c.(322-324)GAA>CAA	p.E108Q	LOC96610_uc011aim.1_Intron	NM_080764	NP_542942	Q86YH2	Z280B_HUMAN	zinc finger protein 280B	108					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		GATCTCGATTCAAGTTGGGAA	0.398													4	153	---	---	---	---	PASS
LIMK2	3985	broad.mit.edu	37	22	31667137	31667137	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31667137A>G	uc003akh.2	+	12	1478	c.1333A>G	c.(1333-1335)ATG>GTG	p.M445V	LIMK2_uc003akg.2_Missense_Mutation_p.M362V|LIMK2_uc003aki.2_Missense_Mutation_p.M199V|LIMK2_uc003akj.2_Missense_Mutation_p.M424V|LIMK2_uc003akk.2_Missense_Mutation_p.M424V|LIMK2_uc011aln.1_Missense_Mutation_p.M362V	NM_005569	NP_005560	P53671	LIMK2_HUMAN	LIM domain kinase 2 isoform 2a	445	Protein kinase.					mitochondrion|nucleus	ATP binding|protein serine/threonine kinase activity|zinc ion binding			ovary(2)	2						TTTGCACTCTATGTGCATCAT	0.547													3	94	---	---	---	---	PASS
XRCC6	2547	broad.mit.edu	37	22	42049691	42049691	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42049691C>G	uc003bao.1	+	9	1358	c.1288C>G	c.(1288-1290)CCA>GCA	p.P430A	XRCC6_uc003bap.1_Missense_Mutation_p.P389A|XRCC6_uc011apc.1_Missense_Mutation_p.P380A|XRCC6_uc003baq.1_Missense_Mutation_p.P430A|XRCC6_uc003bar.1_Missense_Mutation_p.P430A|XRCC6_uc003bas.1_Missense_Mutation_p.P380A	NM_001469	NP_001460	P12956	XRCC6_HUMAN	ATP-dependent DNA helicase II, 70 kDa subunit	430	Ku.				DNA ligation|double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|provirus integration|telomere maintenance|transcription, DNA-dependent	DNA-dependent protein kinase-DNA ligase 4 complex|Ku70:Ku80 complex|membrane fraction|nuclear telomere cap complex|transcription factor complex	5'-deoxyribose-5-phosphate lyase activity|ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|transcription regulatory region DNA binding			skin(2)|ovary(1)|lung(1)|kidney(1)	5						GGTGACTCCTCCAGGTATGTG	0.294								Direct_reversal_of_damage|NHEJ					5	77	---	---	---	---	PASS
RPL23AP82	284942	broad.mit.edu	37	22	51237496	51237496	+	RNA	SNP	C	T	T	rs145825199	byFrequency	TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51237496C>T	uc003bni.2	+	4		c.951C>T			RPL23AP82_uc003bns.2_RNA|RPL23AP82_uc010hbj.2_RNA	NR_026981				Homo sapiens cDNA FLJ75396 complete cds.												0						GGCATATGTTCGACTTGCTCC	0.433													11	115	---	---	---	---	PASS
DHRSX	207063	broad.mit.edu	37	X	2209583	2209583	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2209583G>C	uc004cqf.3	-	4	397	c.348C>G	c.(346-348)TTC>TTG	p.F116L		NM_145177	NP_660160	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked	116							binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TCTTCATCTTGAACTTCTGCA	0.423													4	283	---	---	---	---	PASS
MAP3K15	389840	broad.mit.edu	37	X	19443781	19443781	+	5'UTR	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19443781C>G	uc004czk.1	-	8					MAP3K15_uc004czj.1_5'UTR	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase								ATP binding|MAP kinase kinase kinase activity|metal ion binding			ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					GCTCCCTTTTCTTCCCAACAA	0.433													7	23	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32360357	32360357	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32360357C>A	uc004dda.1	-	41	6026	c.5782G>T	c.(5782-5784)GCA>TCA	p.A1928S	DMD_uc004dcw.2_Missense_Mutation_p.A584S|DMD_uc004dcx.2_Missense_Mutation_p.A587S|DMD_uc004dcz.2_Missense_Mutation_p.A1805S|DMD_uc004dcy.1_Missense_Mutation_p.A1924S|DMD_uc004ddb.1_Missense_Mutation_p.A1920S|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1928	Spectrin 13.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTACGCACTGCATTCAGCTCC	0.527													6	37	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32380894	32380894	+	Intron	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32380894G>A	uc004dda.1	-						DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCTTGGAGTAGATCTTCCTAC	0.463													11	80	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37028984	37028984	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37028984G>T	uc004ddl.1	+	1	2515	c.2501G>T	c.(2500-2502)AGC>ATC	p.S834I		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	834										ovary(3)	3						GGTACATCAAGCACAATGGAG	0.512													32	62	---	---	---	---	PASS
P2RY10	27334	broad.mit.edu	37	X	78216921	78216921	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78216921C>G	uc004ede.2	+	4	1273	c.904C>G	c.(904-906)CCA>GCA	p.P302A	P2RY10_uc004edf.2_Missense_Mutation_p.P302A	NM_014499	NP_055314	O00398	P2Y10_HUMAN	G-protein coupled purinergic receptor P2Y10	302	Helical; Name=7; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(2)|breast(1)	5						CCTTTTGGATCCAATTCTTTA	0.493													7	186	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106065219	106065219	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106065219G>A	uc004emo.2	+	4	538	c.373G>A	c.(373-375)GAA>AAA	p.E125K	MORC4_uc004emp.3_Intron|TBC1D8B_uc004emm.2_Missense_Mutation_p.E125K|TBC1D8B_uc004emn.2_Missense_Mutation_p.E125K	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	125						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						ATTAATTGCTGAAGAGGGAAA	0.308													12	37	---	---	---	---	PASS
PLS3	5358	broad.mit.edu	37	X	114871183	114871183	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114871183G>C	uc004eqd.2	+	8	1174	c.784G>C	c.(784-786)GAG>CAG	p.E262Q	PLS3_uc010nqg.2_Intron|PLS3_uc011mtf.1_Missense_Mutation_p.E240Q|PLS3_uc004eqe.2_Missense_Mutation_p.E262Q|PLS3_uc011mtg.1_Missense_Mutation_p.E235Q|PLS3_uc011mth.1_Missense_Mutation_p.E217Q	NM_005032	NP_005023	P13797	PLST_HUMAN	plastin 3	262	Actin-binding 1.					cytoplasm	actin binding|calcium ion binding			lung(1)|breast(1)	2						TGAGACTTTGGAGGAACTTAT	0.383													12	122	---	---	---	---	PASS
PLS3	5358	broad.mit.edu	37	X	114871194	114871194	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114871194G>A	uc004eqd.2	+	8	1185	c.795G>A	c.(793-795)ATG>ATA	p.M265I	PLS3_uc010nqg.2_Intron|PLS3_uc011mtf.1_Missense_Mutation_p.M243I|PLS3_uc004eqe.2_Missense_Mutation_p.M265I|PLS3_uc011mtg.1_Missense_Mutation_p.M238I|PLS3_uc011mth.1_Missense_Mutation_p.M220I	NM_005032	NP_005023	P13797	PLST_HUMAN	plastin 3	265	Actin-binding 1.					cytoplasm	actin binding|calcium ion binding			lung(1)|breast(1)	2						AGGAACTTATGAAATTGTCTC	0.378													14	127	---	---	---	---	PASS
GLUD2	2747	broad.mit.edu	37	X	120182952	120182952	+	Missense_Mutation	SNP	G	C	C	rs10657		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:120182952G>C	uc004eto.2	+	1	1491	c.1414G>C	c.(1414-1416)GAG>CAG	p.E472Q		NM_012084	NP_036216	P49448	DHE4_HUMAN	glutamate dehydrogenase 2 precursor	472					glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding			pancreas(1)	1					L-Glutamic Acid(DB00142)|NADH(DB00157)	GTCTGTTCAAGAGAGTTTAGA	0.413													6	106	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140996143	140996143	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140996143G>C	uc004fbt.2	+	4	3239	c.2953G>C	c.(2953-2955)GAG>CAG	p.E985Q	MAGEC1_uc010nsl.1_Missense_Mutation_p.E52Q	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	985	MAGE.						protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CCTCACCTCTGAGGGGTGTCT	0.478										HNSCC(15;0.026)			5	141	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140996154	140996154	+	Silent	SNP	G	C	C			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140996154G>C	uc004fbt.2	+	4	3250	c.2964G>C	c.(2962-2964)CTG>CTC	p.L988L	MAGEC1_uc010nsl.1_Silent_p.L55L	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	988	MAGE.						protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					AGGGGTGTCTGAGTGATGAGC	0.473										HNSCC(15;0.026)			4	135	---	---	---	---	PASS
MAGEA1	4100	broad.mit.edu	37	X	152483001	152483001	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152483001C>G	uc004fhf.2	-	3	230	c.10G>C	c.(10-12)GAG>CAG	p.E4Q		NM_004988	NP_004979	P43355	MAGA1_HUMAN	melanoma antigen family A, 1	4						cytoplasm|plasma membrane				central_nervous_system(7)|ovary(1)|lung(1)|breast(1)	10	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTCCTCTGCTCAAGAGACATG	0.622													3	63	---	---	---	---	PASS
KDM5D	8284	broad.mit.edu	37	Y	21868202	21868202	+	Silent	SNP	C	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:21868202C>G	uc004fug.2	-	27	4587	c.4299G>C	c.(4297-4299)CGG>CGC	p.R1433R	KDM5D_uc011naz.1_Silent_p.R1464R|KDM5D_uc010nwy.2_Silent_p.R1376R|KDM5D_uc004fuf.2_Silent_p.R608R	NM_004653	NP_004644	Q9BY66	KDM5D_HUMAN	jumonji, AT rich interactive domain 1D isoform	1433					chromatin modification|spermatogenesis	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1					Vitamin C(DB00126)	GGCTCCTTGTCCGACTCCCTT	0.537													2	4	---	---	---	---	PASS
SCNN1D	6339	broad.mit.edu	37	1	1225562	1225563	+	Intron	INS	-	CC	CC			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1225562_1225563insCC	uc001adu.1	+						SCNN1D_uc001adt.1_Intron|SCNN1D_uc001adw.2_Intron|SCNN1D_uc001adx.2_Intron|SCNN1D_uc001adv.2_Intron	NM_002978	NP_002969			sodium channel, nonvoltage-gated 1, delta												0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		ccctgctccgtcccgtgtccct	0.243													4	2	---	---	---	---	
USP34	9736	broad.mit.edu	37	2	61552411	61552412	+	Intron	INS	-	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61552411_61552412insA	uc002sbe.2	-							NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			taaattaaactaaaaaaaaaaa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64603286	64603288	+	IGR	DEL	CAC	-	-	rs141929982		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64603286_64603288delCAC								PELI1 (231681 upstream) : HSPC159 (78039 downstream)																							ccaccaccatcaccaccatcacc	0.000													7	5	---	---	---	---	
FLJ40330	645784	broad.mit.edu	37	2	89083945	89083946	+	Intron	INS	-	GC	GC			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89083945_89083946insGC	uc010fhf.2	+						FLJ40330_uc010fhg.2_Intron|FLJ40330_uc010fhh.2_Intron					Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						GTATTCCTTTTTTTTCAGTGTA	0.347													3	3	---	---	---	---	
REV1	51455	broad.mit.edu	37	2	100017907	100017907	+	Intron	DEL	A	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100017907delA	uc002tad.2	-						REV1_uc002tac.2_Intron	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1						DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						TGACTTTGGCAAAAAAAAAAA	0.184								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	4	---	---	---	---	
OBFC2A	64859	broad.mit.edu	37	2	192548842	192548842	+	Intron	DEL	A	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192548842delA	uc002usx.2	+						OBFC2A_uc002usw.2_Intron|OBFC2A_uc002usy.2_Intron|OBFC2A_uc002usz.2_Intron|OBFC2A_uc002uta.2_Intron	NM_001031716	NP_001026886	Q96AH0	SOSB2_HUMAN	oligonucleotide/oligosaccharide-binding fold						double-strand break repair via homologous recombination|G2/M transition checkpoint|response to ionizing radiation	SOSS complex	single-stranded DNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.061)|Epithelial(96;0.244)			tttgttaattaaaaaaaaaaa	0.234													4	2	---	---	---	---	
NOP58	51602	broad.mit.edu	37	2	203149027	203149027	+	Intron	DEL	T	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203149027delT	uc002uzb.2	+						NOP58_uc010zhv.1_Intron	NM_015934	NP_057018	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein homolog						cell growth|rRNA processing|snRNP protein import into nucleus	box C/D snoRNP complex|Cajal body|cytoplasm|pre-snoRNP complex	protein binding|snoRNA binding				0						CAGGAAAGTCttttttttttt	0.174													6	5	---	---	---	---	
HPS3	84343	broad.mit.edu	37	3	148859306	148859307	+	Intron	INS	-	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148859306_148859307insT	uc003ewu.1	+						HPS3_uc003ewt.1_Intron|HPS3_uc011bnq.1_Intron	NM_032383	NP_115759	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3 protein							cytoplasm				ovary(5)|large_intestine(1)	6			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			CTTTAACAAAGttttttttttt	0.248									Hermansky-Pudlak_syndrome				4	3	---	---	---	---	
GOLIM4	27333	broad.mit.edu	37	3	167764594	167764595	+	Intron	INS	-	AA	AA	rs10663226		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167764594_167764595insAA	uc003ffe.2	-						GOLIM4_uc011bpe.1_Intron|GOLIM4_uc011bpf.1_Intron|GOLIM4_uc011bpg.1_Intron	NM_014498	NP_055313	O00461	GOLI4_HUMAN	golgi integral membrane protein 4						transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus				breast(4)|skin(1)	5						TTTTGGCAGCCAAAAAAAAAAA	0.322													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	119428155	119428156	+	IGR	INS	-	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119428155_119428156insT								PRSS12 (154233 upstream) : CEP170L (9339 downstream)																							AGCATAAAttcttttttttttt	0.183													4	2	---	---	---	---	
KIAA1109	84162	broad.mit.edu	37	4	123159136	123159137	+	Intron	INS	-	A	A	rs11455945		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123159136_123159137insA	uc003ieh.2	+						KIAA1109_uc003iei.1_Intron|KIAA1109_uc010ins.1_Intron|KIAA1109_uc003iek.2_5'Flank	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein						regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						gactccatctcaaaaaaaaaaa	0.124													3	3	---	---	---	---	
SDHA	6389	broad.mit.edu	37	5	218381	218382	+	5'UTR	INS	-	C	C	rs3214561		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:218381_218382insC	uc003jao.3	+	1					CCDC127_uc003jam.1_5'Flank|SDHA_uc003jan.2_5'UTR|SDHA_uc011clv.1_5'UTR|SDHA_uc011clw.1_5'UTR|SDHA_uc003jap.3_5'UTR	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,						nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	AGGCGCGGTATCCCCCCTCCCC	0.748									Familial_Paragangliomas				7	6	---	---	---	---	
RAPGEF6	51735	broad.mit.edu	37	5	130897900	130897900	+	Intron	DEL	A	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130897900delA	uc003kvn.1	-						RAPGEF6_uc003kvp.1_Intron|RAPGEF6_uc003kvo.1_Intron|RAPGEF6_uc010jdi.1_Intron|RAPGEF6_uc010jdj.1_Intron|RAPGEF6_uc003kvr.2_Intron|RAPGEF6_uc011cxe.1_Intron|RAPGEF6_uc010jdk.2_Intron	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		AAAAAGAAAGAAAAAAAAAAA	0.264													4	2	---	---	---	---	
FLT4	2324	broad.mit.edu	37	5	180049928	180049928	+	Intron	DEL	A	-	-	rs307828		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180049928delA	uc003mma.3	-						FLT4_uc003mlz.3_Intron|FLT4_uc003mmb.1_Intron|FLT4_uc011dgy.1_Intron	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	GCTGTGCACCACCCCCCCCAA	0.587									Congenital_Hereditary_Lymphedema				6	3	---	---	---	---	
SLC35B3	51000	broad.mit.edu	37	6	8417377	8417377	+	Intron	DEL	A	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8417377delA	uc010joe.2	-						SLC35B3_uc003mya.2_Intron|SLC35B3_uc003myc.2_Intron|SLC35B3_uc003myb.2_Intron|SLC35B3_uc011did.1_Intron|SLC35B3_uc003myd.2_Intron	NM_001142541	NP_001136013	Q9H1N7	S35B3_HUMAN	solute carrier family 35, member B3						transmembrane transport	Golgi membrane|integral to membrane					0	Ovarian(93;0.0569)					TGATTTAATGAAAAAAAAATG	0.259													5	3	---	---	---	---	
C6orf170	221322	broad.mit.edu	37	6	121643099	121643100	+	Intron	INS	-	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121643099_121643100insT	uc003pyo.1	-						C6orf170_uc003pyq.1_Intron	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322						multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		TAATTTTTGGCTTTTTTTTTTC	0.317													4	2	---	---	---	---	
MAP3K5	4217	broad.mit.edu	37	6	136977762	136977762	+	Intron	DEL	T	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136977762delT	uc003qhc.2	-						MAP3K5_uc011edj.1_5'Flank|MAP3K5_uc011edk.1_Intron|MAP3K5_uc010kgw.1_Intron	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		GTTTTCACACttttttttttt	0.154													5	3	---	---	---	---	
RHBDD2	57414	broad.mit.edu	37	7	75512836	75512837	+	Intron	INS	-	A	A	rs143886218		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75512836_75512837insA	uc003udw.1	+						RHBDD2_uc003udv.1_Intron	NM_001040456	NP_001035546	Q6NTF9	RHBD2_HUMAN	rhomboid domain containing 2 isoform a							integral to membrane	serine-type endopeptidase activity				0						gactccatctcaaaaaaaaaaa	0.238													4	2	---	---	---	---	
PODXL	5420	broad.mit.edu	37	7	131196372	131196372	+	Intron	DEL	T	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131196372delT	uc003vqw.3	-						PODXL_uc003vqx.3_Intron	NM_001018111	NP_001018121	O00592	PODXL_HUMAN	podocalyxin-like isoform 1 precursor						cell adhesion|epithelial tube formation|negative regulation of cell-cell adhesion|positive regulation of cell migration|positive regulation of cell-cell adhesion mediated by integrin|regulation of microvillus assembly	actin cytoskeleton|apical plasma membrane|centrosome|filopodium|integral to plasma membrane|lamellipodium|membrane raft|microvillus membrane|nucleolus|ruffle				breast(2)|pancreas(1)	3	Melanoma(18;0.162)					TTTTTCTGTCTTTTTTTTTTC	0.274													4	2	---	---	---	---	
UBE3C	9690	broad.mit.edu	37	7	156962829	156962829	+	Intron	DEL	C	-	-	rs66735407		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156962829delC	uc010lqs.2	+						UBE3C_uc003wnf.2_Intron|UBE3C_uc003wng.2_Intron	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C						protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		ttttttttttctttttAACCA	0.174													4	3	---	---	---	---	
FGFR1	2260	broad.mit.edu	37	8	38285295	38285296	+	Intron	INS	-	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38285295_38285296insT	uc003xlp.2	-						FGFR1_uc011lbo.1_Intron|FGFR1_uc011lbp.1_Intron|FGFR1_uc011lbq.1_Intron|FGFR1_uc010lwk.2_Intron|FGFR1_uc011lbr.1_Intron|FGFR1_uc011lbs.1_Intron|FGFR1_uc011lbt.1_Intron|FGFR1_uc011lbu.1_Intron|FGFR1_uc011lbv.1_Intron|FGFR1_uc011lbw.1_Intron|FGFR1_uc011lbx.1_Intron|FGFR1_uc003xlv.2_Intron|FGFR1_uc003xlu.2_Intron|FGFR1_uc003xlw.1_Intron	NM_023110	NP_075598	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1 isoform 1						axon guidance|cell growth|insulin receptor signaling pathway|MAPKKK cascade|positive regulation of cell proliferation|skeletal system development	extracellular region|integral to plasma membrane|membrane fraction	ATP binding|fibroblast growth factor receptor activity|heparin binding|protein homodimerization activity			lung(5)|central_nervous_system(5)|stomach(2)|breast(2)|ovary(1)	15	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)	CTTTATTTGCATTTTTTTGTAT	0.208		1	T	BCR|FOP|ZNF198|CEP1	MPD|NHL		Pfeiffer syndrome|Kallman syndrome						6	4	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48647674	48647675	+	Intron	DEL	GT	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48647674_48647675delGT	uc003xqd.2	+						KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Intron|KIAA0146_uc011ldg.1_Intron|KIAA0146_uc003xqg.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				gtgtgtgtgggtgtgtgtgtgt	0.342													3	3	---	---	---	---	
WNK2	65268	broad.mit.edu	37	9	96081235	96081236	+	3'UTR	INS	-	G	G			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96081235_96081236insG	uc011lud.1	+	29					WNK2_uc004atj.2_Intron|WNK2_uc004atk.2_3'UTR|C9orf129_uc010mre.2_Intron	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2						intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						GGTTCAAATCTATTATTCCATC	0.396													4	2	---	---	---	---	
NEK6	10783	broad.mit.edu	37	9	127088481	127088482	+	Intron	INS	-	CCCC	CCCC	rs71490844		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127088481_127088482insCCCC	uc004bog.2	+						NEK6_uc004bof.2_Intron|NEK6_uc004boh.2_Intron|NEK6_uc010mwj.2_Intron|NEK6_uc010mwk.2_Intron|NEK6_uc004boi.2_Intron	NM_014397	NP_055212	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6 isoform 2						apoptosis|cell division|chromosome segregation|mitosis|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of mitotic metaphase/anaphase transition	cytoplasm|nucleus	ATP binding|kinesin binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|kidney(1)	3						AGTGGCTCAATCCCCCCCCCCC	0.629													4	2	---	---	---	---	
EGFL7	51162	broad.mit.edu	37	9	139565480	139565480	+	Intron	DEL	G	-	-	rs71988346		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139565480delG	uc004cid.2	+						EGFL7_uc004cif.2_Intron|EGFL7_uc004cig.2_Intron|EGFL7_uc010nbp.2_Intron|EGFL7_uc004cie.2_Intron|EGFL7_uc004cih.2_Intron	NM_201446	NP_958854	Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7						angiogenesis|vasculogenesis		calcium ion binding			ovary(1)	1	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		AGGCATTGGTGGGGGGGGGGG	0.667													3	3	---	---	---	---	
ANKRD26	22852	broad.mit.edu	37	10	27355272	27355275	+	Intron	DEL	ATTA	-	-	rs148879688		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27355272_27355275delATTA	uc001ith.2	-						ANKRD26_uc001itg.2_Intron|ANKRD26_uc009xku.1_Intron	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26							centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						CACATACTTTATTAATTATGAACT	0.289													3	6	---	---	---	---	
RAB18	22931	broad.mit.edu	37	10	27822484	27822484	+	Intron	DEL	A	-	-	rs5784015		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27822484delA	uc001itv.2	+						RAB18_uc001itw.2_Intron|RAB18_uc010qdq.1_Intron|RAB18_uc010qdr.1_Intron	NM_021252	NP_067075	Q9NP72	RAB18_HUMAN	RAB18, member RAS oncogene family						endocytosis|protein transport|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction	intracellular|plasma membrane	ATP binding|GTP binding|GTPase activity|transcription factor binding				0						TGTATGCTTTAAAAAAAAAAC	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38931303	38931304	+	IGR	INS	-	T	T	rs142011881		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38931303_38931304insT								LOC399744 (190223 upstream) : None (None downstream)																							ATGGAAAAAAATTGTAAAGTAT	0.272													10	5	---	---	---	---	
GLUD1	2746	broad.mit.edu	37	10	88820205	88820205	+	Intron	DEL	T	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88820205delT	uc001keh.2	-						GLUD1_uc001keg.2_Intron|GLUD1_uc010qmp.1_Intron	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor						glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	TGTTTGCTTGTTTTTTTTTTT	0.209													4	2	---	---	---	---	
NXF1	10482	broad.mit.edu	37	11	62564538	62564539	+	Intron	INS	-	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62564538_62564539insA	uc001nvf.1	-						NXF1_uc001nvg.1_Intron|NXF1_uc009yog.1_Intron	NM_006362	NP_006353	Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1 isoform 1						gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding			skin(3)	3						agacactgtccaaaaaaaaaaa	0.198													5	3	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69998440	69998441	+	Intron	INS	-	AA	AA	rs71463662		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69998440_69998441insAA	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						gactccatctcaaaaaaaaaaa	0.119													5	3	---	---	---	---	
LRP6	4040	broad.mit.edu	37	12	12291106	12291106	+	Intron	DEL	A	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12291106delA	uc001rah.3	-						BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Intron	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein						cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				ctccgtctccaaaaaaaaaaa	0.139													4	2	---	---	---	---	
FAIM2	23017	broad.mit.edu	37	12	50291547	50291548	+	Intron	INS	-	C	C	rs144837790	by1000genomes	TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50291547_50291548insC	uc001rvj.1	-						FAIM2_uc001rvi.1_Intron|FAIM2_uc001rvk.1_Intron	NM_012306	NP_036438	Q9BWQ8	FAIM2_HUMAN	Fas apoptotic inhibitory molecule 2						anti-apoptosis|apoptosis	cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|ovary(1)|skin(1)	3						AGCCAAGCGCACCCCCCCCCAG	0.564													4	2	---	---	---	---	
ZMYM5	9205	broad.mit.edu	37	13	20409967	20409967	+	Intron	DEL	T	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20409967delT	uc010tcn.1	-						ZMYM5_uc001umm.1_Intron	NM_001142684	NP_001136156	Q9UJ78	ZMYM5_HUMAN	zinc finger protein 237 isoform 3							nucleus	zinc ion binding				0		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		AGGGAAAAGAttttttttttt	0.189													3	3	---	---	---	---	
DCUN1D2	55208	broad.mit.edu	37	13	114117216	114117216	+	Intron	DEL	A	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114117216delA	uc001vtr.1	-						DCUN1D2_uc001vts.1_Intron|DCUN1D2_uc010agw.1_Intron	NM_001014283	NP_001014305	Q6PH85	DCNL2_HUMAN	DCN1, defective in cullin neddylation 1, domain												0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.029)|GBM - Glioblastoma multiforme(44;0.234)			CCTGGGGAGGAAAAAAAAATA	0.313													4	2	---	---	---	---	
BTBD7	55727	broad.mit.edu	37	14	93709546	93709547	+	Intron	INS	-	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93709546_93709547insT	uc001ybo.2	-						BTBD7_uc010aur.2_Intron|BTBD7_uc010two.1_Intron|BTBD7_uc001ybp.2_Intron	NM_001002860	NP_001002860	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7 isoform 1											pancreas(1)	1		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		ttctgtttttgttttttttttt	0.124													6	3	---	---	---	---	
CATSPER2	117155	broad.mit.edu	37	15	43927354	43927354	+	Intron	DEL	T	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43927354delT	uc001zsh.2	-						STRC_uc010udz.1_5'Flank|CATSPER2_uc010bdm.2_Intron|CATSPER2_uc001zsi.2_Intron|CATSPER2_uc001zsj.2_Intron	NM_172095	NP_742093	Q96P56	CTSR2_HUMAN	sperm-associated cation channel 2 isoform 2						cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|protein binding|voltage-gated ion channel activity			ovary(1)	1		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		acttaggatcttttttttttt	0.000											OREG0003957	type=REGULATORY REGION|Gene=AK093318|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	2	---	---	---	---	
DRG2	1819	broad.mit.edu	37	17	17996994	17996994	+	Intron	DEL	T	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17996994delT	uc002gsh.1	+						DRG2_uc010vxg.1_Intron|DRG2_uc002gsi.1_Intron|DRG2_uc002gsj.1_Intron	NM_001388	NP_001379	P55039	DRG2_HUMAN	developmentally regulated GTP binding protein 2						signal transduction		GTP binding			ovary(1)	1	all_neural(463;0.228)					agcagagAGATTTTTTTTTTT	0.289													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	19091624	19091625	+	IGR	INS	-	A	A			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19091624_19091625insA								GRAPL (29476 upstream) : EPN2 (49065 downstream)																							TCCTGCTTGGCATGTCGCGAGA	0.480													4	2	---	---	---	---	
UTP6	55813	broad.mit.edu	37	17	30216088	30216089	+	Intron	INS	-	A	A	rs76051459		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30216088_30216089insA	uc002hgr.2	-						UTP6_uc002hgq.2_5'Flank|UTP6_uc010cst.2_Intron|UTP6_uc010wbw.1_Intron	NM_018428	NP_060898	Q9NYH9	UTP6_HUMAN	hepatocellular carcinoma-associated antigen 66						rRNA processing	nucleolus	binding			ovary(1)	1		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				aagactgtctcaaaaaaaaaaa	0.005													4	2	---	---	---	---	
HNRNPM	4670	broad.mit.edu	37	19	8520609	8520610	+	Intron	INS	-	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8520609_8520610insT	uc010dwe.2	+						HNRNPM_uc010dwc.1_Intron|HNRNPM_uc010xke.1_Intron|HNRNPM_uc010dwd.2_Intron	NM_005968	NP_005959	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding				0						CCCCACCTCAgttttttttttt	0.381													4	2	---	---	---	---	
ZNF562	54811	broad.mit.edu	37	19	9764668	9764669	+	Intron	INS	-	T	T	rs145922849		TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9764668_9764669insT	uc010xks.1	-						ZNF562_uc002mly.2_Intron|ZNF562_uc002mlx.2_Intron|ZNF562_uc010xkt.1_Intron|ZNF562_uc010xku.1_Intron|ZNF562_uc010xkv.1_Intron|ZNF562_uc010xkw.1_Intron	NM_001130032	NP_001123504	Q6V9R5	ZN562_HUMAN	zinc finger protein 562 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTAATGTTTAAttttttttttt	0.119													5	5	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17750846	17750846	+	Intron	DEL	T	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17750846delT	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						TTCTATGGCAttttttttttt	0.254													4	2	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17753824	17753825	+	Intron	INS	-	T	T			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17753824_17753825insT	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						GCAGTGGGCAAttttttttttt	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	34341658	34341658	+	IGR	DEL	A	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34341658delA								RBM39 (11465 upstream) : PHF20 (18265 downstream)																							GAAATTAtggaaaaaaaaaaa	0.169													5	3	---	---	---	---	
COL6A1	1291	broad.mit.edu	37	21	47410424	47410424	+	Intron	DEL	C	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47410424delC	uc002zhu.1	+							NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	gtgaaggtgacccggggaggg	0.104													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	97677254	97677254	+	IGR	DEL	T	-	-			TCGA-39-5022-01	TCGA-39-5022-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:97677254delT								DIAPH2 (821658 upstream) : None (None downstream)																							TTCAGttttcttttttttttt	0.219													5	3	---	---	---	---	
