Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ACAP3	116983	broad.mit.edu	37	1	1235355	1235355	+	Missense_Mutation	SNP	C	T	T	rs12409951		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1235355C>T	uc001aeb.2	-	8	735	c.661G>A	c.(661-663)GAG>AAG	p.E221K	ACAP3_uc001ady.2_5'Flank|ACAP3_uc001aea.2_Missense_Mutation_p.E179K|ACAP3_uc001aec.1_Missense_Mutation_p.E179K	NM_030649	NP_085152	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH	221					filopodium assembly|regulation of ARF GTPase activity|signal transduction		ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding				0						AGGCTCACCTCGGCTGCCAGC	0.642													8	36	---	---	---	---	PASS
MORN1	79906	broad.mit.edu	37	1	2290142	2290142	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2290142C>A	uc001ajb.1	-	9	779	c.758G>T	c.(757-759)CGG>CTG	p.R253L	MORN1_uc009vld.2_Missense_Mutation_p.R229L|MORN1_uc001ajd.1_Missense_Mutation_p.R253L	NM_024848	NP_079124	Q5T089	MORN1_HUMAN	MORN repeat containing 1	253										ovary(2)|central_nervous_system(1)	3	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)		CTGCAGGACCCGGCCGCTCTC	0.612													18	12	---	---	---	---	PASS
GRIK3	2899	broad.mit.edu	37	1	37324827	37324827	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37324827G>A	uc001caz.2	-	7	1121	c.986C>T	c.(985-987)GCC>GTC	p.A329V	GRIK3_uc001cba.1_Missense_Mutation_p.A329V	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	329	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	GATATGGACGGCGTCGTACAG	0.652													63	57	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39797830	39797830	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39797830G>A	uc010oiu.1	+	1	1021	c.890G>A	c.(889-891)GGA>GAA	p.G297E	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	1862	Plectin 5.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CCTGAATCTGGAGAGATCCTC	0.448													92	88	---	---	---	---	PASS
C1orf168	199920	broad.mit.edu	37	1	57224416	57224416	+	Silent	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57224416A>G	uc001cym.3	-	6	1477	c.1071T>C	c.(1069-1071)TAT>TAC	p.Y357Y	C1orf168_uc009vzu.1_Intron|C1orf168_uc001cyl.2_RNA	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN	hypothetical protein LOC199920	357										ovary(3)|skin(2)	5						TTCCAACTTCATAAGTTGCTA	0.318													17	37	---	---	---	---	PASS
LRRIQ3	127255	broad.mit.edu	37	1	74648474	74648474	+	Silent	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74648474A>G	uc001dfy.3	-	3	513	c.321T>C	c.(319-321)AAT>AAC	p.N107N	LRRIQ3_uc001dfz.3_RNA	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	107	LRR 3.									ovary(2)	2						TTGCAAACCCATTGTCATGAA	0.308													31	77	---	---	---	---	PASS
TRIM46	80128	broad.mit.edu	37	1	155156413	155156413	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155156413G>T	uc001fhs.1	+	10	2110	c.2027G>T	c.(2026-2028)AGG>ATG	p.R676M	RAG1AP1_uc010pey.1_Intron|TRIM46_uc001fht.1_RNA|TRIM46_uc010pfa.1_Missense_Mutation_p.R550M|TRIM46_uc001fhu.1_Missense_Mutation_p.R653M|TRIM46_uc001fhw.1_RNA	NM_025058	NP_079334	Q7Z4K8	TRI46_HUMAN	tripartite motif-containing 46	676	B30.2/SPRY.					intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTGACAGGGAGGGATGGCCCC	0.657													25	36	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157773904	157773904	+	Intron	SNP	A	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157773904A>T	uc001frg.2	-						FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			AAACAGCTCTAGAGAGAGGAA	0.483													16	90	---	---	---	---	PASS
CD1D	912	broad.mit.edu	37	1	158151513	158151513	+	Splice_Site	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158151513T>C	uc001frr.2	+	3	827	c.328_splice	c.e3+2	p.Y110_splice	CD1D_uc009wsr.1_Splice_Site_p.Y110_splice|CD1D_uc009wss.2_Splice_Site_p.Y110_splice|CD1D_uc009wst.1_Splice_Site_p.Y6_splice	NM_001766	NP_001757	P15813	CD1D_HUMAN	CD1D antigen precursor						antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding			ovary(1)	1	all_hematologic(112;0.0378)					GCTTATCCTGTGAGCTGAGGG	0.542													22	50	---	---	---	---	PASS
ADAMTS4	9507	broad.mit.edu	37	1	161168117	161168117	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161168117C>G	uc001fyt.3	-	1	729	c.301G>C	c.(301-303)GGT>CGT	p.G101R	ADAMTS4_uc001fyu.2_Missense_Mutation_p.G101R|NDUFS2_uc001fyv.2_5'Flank	NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1	101					proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			ACCTGCACACCGGAGTCCTGC	0.667													13	30	---	---	---	---	PASS
ABL2	27	broad.mit.edu	37	1	179084073	179084073	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179084073C>A	uc001gmj.3	-	9	1788	c.1501G>T	c.(1501-1503)GGA>TGA	p.G501*	ABL2_uc010pnf.1_Nonsense_Mutation_p.G501*|ABL2_uc010png.1_Nonsense_Mutation_p.G480*|ABL2_uc010pnh.1_Nonsense_Mutation_p.G480*|ABL2_uc009wxe.2_Nonsense_Mutation_p.G480*|ABL2_uc001gmg.3_Nonsense_Mutation_p.G486*|ABL2_uc001gmi.3_Nonsense_Mutation_p.G486*|ABL2_uc001gmh.3_Nonsense_Mutation_p.G465*|ABL2_uc010pne.1_Nonsense_Mutation_p.G465*	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b	501	Protein kinase.				axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	ATTCGATATCCTTTTTCTAGT	0.408			T	ETV6	AML								43	150	---	---	---	---	PASS
ESRRG	2104	broad.mit.edu	37	1	216850454	216850454	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216850454C>T	uc001hkw.1	-	2	602	c.436G>A	c.(436-438)GAA>AAA	p.E146K	ESRRG_uc001hky.1_Missense_Mutation_p.E123K|ESRRG_uc009xdp.1_Missense_Mutation_p.E123K|ESRRG_uc001hkz.1_Missense_Mutation_p.E123K|ESRRG_uc010puc.1_Missense_Mutation_p.E123K|ESRRG_uc001hla.1_Missense_Mutation_p.E123K|ESRRG_uc001hlb.1_Missense_Mutation_p.E123K|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Missense_Mutation_p.E123K|ESRRG_uc001hld.1_Missense_Mutation_p.E123K|ESRRG_uc001hkx.1_Missense_Mutation_p.E151K|ESRRG_uc009xdo.1_Missense_Mutation_p.E123K|ESRRG_uc001hle.1_Missense_Mutation_p.E123K	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1	146	Nuclear receptor.|NR C4-type.				positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	TTGCAGGCTTCACATGATGCT	0.478													8	91	---	---	---	---	PASS
PLD5	200150	broad.mit.edu	37	1	242287914	242287914	+	Silent	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242287914T>C	uc001hzn.1	-	6	916	c.789A>G	c.(787-789)TTA>TTG	p.L263L	PLD5_uc001hzl.3_Silent_p.L201L|PLD5_uc001hzm.3_Silent_p.L53L|PLD5_uc001hzo.1_Silent_p.L171L			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;	263						integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			ATATCCTTTGTAAATCTAGGA	0.368													26	100	---	---	---	---	PASS
ZNF496	84838	broad.mit.edu	37	1	247464506	247464506	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247464506G>C	uc001ico.2	-	9	1544	c.1079C>G	c.(1078-1080)TCT>TGT	p.S360C	ZNF496_uc009xgv.2_Missense_Mutation_p.S396C|ZNF496_uc001icp.2_Missense_Mutation_p.S360C	NM_032752	NP_116141	Q96IT1	ZN496_HUMAN	zinc finger protein 496	360					positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			CTCGTCCCCAGAGCTGGAGAG	0.627													6	100	---	---	---	---	PASS
HADHA	3030	broad.mit.edu	37	2	26418042	26418042	+	Silent	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26418042C>G	uc002rgy.2	-	15	1669	c.1539G>C	c.(1537-1539)ACG>ACC	p.T513T	HADHA_uc010yks.1_Silent_p.T426T	NM_000182	NP_000173	P40939	ECHA_HUMAN	mitochondrial trifunctional protein, alpha	513					fatty acid beta-oxidation	fatty acid beta-oxidation multienzyme complex|mitochondrial nucleoid|nucleolus	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acetyltransferase activity|coenzyme binding|enoyl-CoA hydratase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				NADH(DB00157)	TTTTCTCGGTCGTGATAATCT	0.507													41	91	---	---	---	---	PASS
SLC30A3	7781	broad.mit.edu	37	2	27480855	27480855	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27480855C>T	uc002rjk.2	-	4	682	c.496G>A	c.(496-498)GTC>ATC	p.V166I	SLC30A3_uc002rjj.2_5'UTR|SLC30A3_uc010ylh.1_Missense_Mutation_p.V161I	NM_003459	NP_003450	Q99726	ZNT3_HUMAN	solute carrier family 30 (zinc transporter),	166	Helical; (Potential).				regulation of sequestering of zinc ion	cell junction|integral to plasma membrane|late endosome|membrane fraction|synaptic vesicle membrane	zinc transporting ATPase activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCAGGCGGACGAAGGCCAGG	0.627													18	32	---	---	---	---	PASS
IFT172	26160	broad.mit.edu	37	2	27672642	27672642	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27672642T>C	uc002rku.2	-	37	4127	c.4076A>G	c.(4075-4077)GAC>GGC	p.D1359G	IFT172_uc010ezb.2_RNA	NM_015662	NP_056477	Q9UG01	IF172_HUMAN	selective LIM binding factor homolog	1359	TPR 11.				cilium assembly	cilium	binding			large_intestine(1)|ovary(1)	2	Acute lymphoblastic leukemia(172;0.155)					CTTGACAAGGTCCAGATTCAG	0.522													45	102	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40401975	40401975	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40401975G>T	uc002rrx.2	-	4	1968	c.1944C>A	c.(1942-1944)TTC>TTA	p.F648L	uc002rrw.2_Intron|SLC8A1_uc002rry.2_Missense_Mutation_p.F648L|SLC8A1_uc002rrz.2_Missense_Mutation_p.F640L|SLC8A1_uc002rsa.2_Missense_Mutation_p.F640L|SLC8A1_uc002rsd.3_Missense_Mutation_p.F640L|SLC8A1_uc002rsb.1_Missense_Mutation_p.F640L	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	648	Cytoplasmic (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CTGTTATTGTGAAGCCACCTA	0.313													4	158	---	---	---	---	PASS
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48898756	48898756	+	Silent	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48898756T>A	uc010yol.1	+	7	3284	c.3237T>A	c.(3235-3237)GTT>GTA	p.V1079V	STON1-GTF2A1L_uc002rwp.1_Silent_p.V1126V|GTF2A1L_uc002rws.1_Silent_p.V422V|GTF2A1L_uc010yom.1_Silent_p.V388V|GTF2A1L_uc002rwt.2_Silent_p.V422V	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	1079					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GAGATGATGTTAGTGAACAGG	0.333													36	237	---	---	---	---	PASS
SLC1A4	6509	broad.mit.edu	37	2	65217264	65217264	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65217264G>A	uc010yqa.1	+	1	809	c.487G>A	c.(487-489)GTC>ATC	p.V163I	SLC1A4_uc010ypy.1_Intron|SLC1A4_uc010ypz.1_Intron|SLC1A4_uc010fcv.2_Missense_Mutation_p.V163I	NM_003038	NP_003029	P43007	SATT_HUMAN	solute carrier family 1, member 4 isoform 1	163	Extracellular (Potential).				cellular nitrogen compound metabolic process|cognition|synaptic transmission, glutamatergic	intermediate filament|melanosome	chloride channel activity|L-alanine transmembrane transporter activity|L-cystine transmembrane transporter activity|L-hydroxyproline transmembrane transporter activity|L-proline transmembrane transporter activity|L-serine transmembrane transporter activity|L-threonine transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(1)	1					L-Alanine(DB00160)	GCCTCCTCCTGTCCCCAAAGA	0.652													4	17	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90229083	90229083	+	Intron	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90229083G>C	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		GAGGGTCCCCGCTCAGCTCCT	0.567													31	182	---	---	---	---	PASS
LONRF2	164832	broad.mit.edu	37	2	100938034	100938034	+	Silent	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100938034C>A	uc002tal.3	-	1	1162	c.522G>T	c.(520-522)CCG>CCT	p.P174P		NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger	174					proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2						GCCGCACCTGCGGCCGCGCGG	0.751													6	16	---	---	---	---	PASS
GPR45	11250	broad.mit.edu	37	2	105858749	105858749	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105858749C>T	uc002tco.1	+	1	550	c.434C>T	c.(433-435)CCG>CTG	p.P145L		NM_007227	NP_009158	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	145	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3						AAGCTGAACCCGCGCAGGGCC	0.652													11	28	---	---	---	---	PASS
GCC2	9648	broad.mit.edu	37	2	109100746	109100746	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109100746G>C	uc002tec.2	+	13	3746	c.3592G>C	c.(3592-3594)GAA>CAA	p.E1198Q	GCC2_uc002ted.2_Missense_Mutation_p.E1097Q	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	1198	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						ACAGAAACAAGAAACCCTACA	0.269													5	47	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125281905	125281905	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125281905G>C	uc002tno.2	+	9	1714	c.1350G>C	c.(1348-1350)TGG>TGC	p.W450C	CNTNAP5_uc010flu.2_Missense_Mutation_p.W451C	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	450	Laminin G-like 2.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		ATGGCCTGTGGCACTCGGTTA	0.527													19	107	---	---	---	---	PASS
ACMSD	130013	broad.mit.edu	37	2	135659432	135659432	+	3'UTR	SNP	T	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135659432T>G	uc002ttz.2	+	10					ACMSD_uc002tua.2_3'UTR|uc010zbe.1_Intron	NM_138326	NP_612199	Q8TDX5	ACMSD_HUMAN	aminocarboxymuconate semialdehyde decarboxylase						quinolinate metabolic process|tryptophan catabolic process	cytosol	aminocarboxymuconate-semialdehyde decarboxylase activity|metal ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.115)		TTTGAATGACTGAATTTACTA	0.299													23	117	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141356255	141356255	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141356255G>A	uc002tvj.1	-	43	8111	c.7139C>T	c.(7138-7140)TCA>TTA	p.S2380L		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2380	Extracellular (Potential).|LDL-receptor class B 26.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACTGCCATCTGAGAAATACAG	0.398										TSP Lung(27;0.18)			46	118	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152522861	152522861	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152522861T>G	uc010fnx.2	-	41	4965	c.4774A>C	c.(4774-4776)AGT>CGT	p.S1592R		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	1592	Nebulin 41.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCCTGAAGACTGAGAAATCCA	0.428													57	128	---	---	---	---	PASS
FIGN	55137	broad.mit.edu	37	2	164466052	164466052	+	3'UTR	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164466052A>G	uc002uck.1	-	3						NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin							nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						TTTTTTTTCTAAAGAAGTTAT	0.363													4	89	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179499896	179499896	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179499896G>T	uc010zfg.1	-	177	34540	c.34316C>A	c.(34315-34317)TCA>TAA	p.S11439*	TTN_uc010zfh.1_Nonsense_Mutation_p.S5134*|TTN_uc010zfi.1_Nonsense_Mutation_p.S5067*|TTN_uc010zfj.1_Nonsense_Mutation_p.S4942*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12366							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTCACAGGTGAGGGCCTTAG	0.353													4	193	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179642226	179642226	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179642226G>A	uc010zfg.1	-	26	4790	c.4566C>T	c.(4564-4566)CCC>CCT	p.P1522P	TTN_uc010zfh.1_Silent_p.P1476P|TTN_uc010zfi.1_Silent_p.P1476P|TTN_uc010zfj.1_Silent_p.P1476P|TTN_uc002unb.2_Silent_p.P1522P|uc002unc.1_RNA	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1522							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGAATCACTGGGTGTGGCAG	0.383													20	57	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179648821	179648821	+	Silent	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179648821T>C	uc010zfg.1	-	16	2975	c.2751A>G	c.(2749-2751)GAA>GAG	p.E917E	TTN_uc010zfh.1_Silent_p.E871E|TTN_uc010zfi.1_Silent_p.E871E|TTN_uc010zfj.1_Silent_p.E871E|TTN_uc002unb.2_Silent_p.E917E	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	917							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGTGCAGTACTTCAAAGCGCT	0.537													42	131	---	---	---	---	PASS
PLCD4	84812	broad.mit.edu	37	2	219499248	219499248	+	Silent	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219499248C>A	uc002vij.1	+	13	1986	c.1791C>A	c.(1789-1791)GGC>GGA	p.G597G		NM_032726	NP_116115	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	597	PI-PLC Y-box.				intracellular signal transduction|lipid catabolic process	endoplasmic reticulum|membrane|nucleus	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)	3		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GCCAGAATGGCGGCTGTGGCT	0.517													3	88	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238283095	238283095	+	Silent	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238283095C>G	uc002vwl.2	-	8	3924	c.3639G>C	c.(3637-3639)CTG>CTC	p.L1213L	COL6A3_uc002vwo.2_Silent_p.L1007L|COL6A3_uc010znj.1_Silent_p.L606L|COL6A3_uc002vwq.2_Silent_p.L1007L|COL6A3_uc002vwr.2_Silent_p.L806L	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1213	Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCAGCCTGCTCAGCTCCTCGC	0.607													38	54	---	---	---	---	PASS
MTERFD2	130916	broad.mit.edu	37	2	242036818	242036818	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242036818C>G	uc002wan.1	-	2	1125	c.632G>C	c.(631-633)TGT>TCT	p.C211S	MTERFD2_uc010zoj.1_5'UTR|MTERFD2_uc010zok.1_Missense_Mutation_p.C182S	NM_182501	NP_872307	Q7Z6M4	MTER2_HUMAN	MTERF domain containing 2	182										ovary(1)	1		all_cancers(19;4.67e-31)|all_epithelial(40;8.67e-13)|Breast(86;0.000141)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;2.47e-32)|all cancers(36;1.79e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-14)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;2.81e-06)|Lung(119;0.000509)|LUSC - Lung squamous cell carcinoma(224;0.00442)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0886)		TTCAGGGCAACAGTAAAGCAC	0.443													28	73	---	---	---	---	PASS
SRGAP3	9901	broad.mit.edu	37	3	9036101	9036101	+	Silent	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9036101C>T	uc003brf.1	-	19	3010	c.2334G>A	c.(2332-2334)TCG>TCA	p.S778S	SRGAP3_uc003brg.1_Silent_p.S754S	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	778	SH3.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		ACCAGTCCTCCGAGGCGCGGT	0.582			T	RAF1	pilocytic astrocytoma								60	192	---	---	---	---	PASS
ACY1	95	broad.mit.edu	37	3	52019412	52019412	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52019412G>A	uc003dcp.2	+	4	256	c.195G>A	c.(193-195)TGG>TGA	p.W65*	ABHD14B_uc003dcn.2_5'Flank|ACY1_uc011bea.1_Nonsense_Mutation_p.W155*|ACY1_uc011beb.1_Nonsense_Mutation_p.W65*|ACY1_uc003dcq.2_Nonsense_Mutation_p.W65*	NM_000666	NP_000657	Q03154	ACY1_HUMAN	aminoacylase 1	65					cellular amino acid metabolic process|proteolysis	cytosol	aminoacylase activity|metal ion binding|metallopeptidase activity			breast(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	L-Aspartic Acid(DB00128)	TGTTGACCTGGCCAGGCACCA	0.612													4	80	---	---	---	---	PASS
ATG3	64422	broad.mit.edu	37	3	112267419	112267419	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112267419C>T	uc003dzd.2	-	5	414	c.304G>A	c.(304-306)GAT>AAT	p.D102N	ATG3_uc003dzc.2_Missense_Mutation_p.D102N|ATG3_uc010hqe.2_Missense_Mutation_p.D102N	NM_022488	NP_071933	Q9NT62	ATG3_HUMAN	Apg3p	102					autophagic vacuole assembly|mitochondrial fragmentation involved in apoptosis|protein targeting to membrane|protein ubiquitination	cytoplasmic ubiquitin ligase complex|cytosol	Atg12 ligase activity|Atg8 ligase activity|enzyme binding			ovary(3)	3						CCATCACCATCATCTTCTTCA	0.328													36	193	---	---	---	---	PASS
UPK1B	7348	broad.mit.edu	37	3	118917955	118917955	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118917955G>T	uc003ecc.2	+	7	789	c.700G>T	c.(700-702)GCC>TCC	p.A234S	UPK1B_uc011bix.1_Missense_Mutation_p.A154S|UPK1B_uc003ecd.2_Missense_Mutation_p.A226S	NM_006952	NP_008883	O75841	UPK1B_HUMAN	uroplakin 1B	234	Helical; (Potential).				epithelial cell differentiation	integral to membrane	structural molecule activity				0				GBM - Glioblastoma multiforme(114;0.222)		CTGGGGGGTTGCCTGGTTTGG	0.493													35	66	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130290112	130290112	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130290112C>A	uc010htl.2	+	6	2883	c.2852C>A	c.(2851-2853)GCC>GAC	p.A951D		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	951	VWFA 5.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						ATTGATGGTGCCAATCCCGTG	0.512													29	91	---	---	---	---	PASS
NUDT16	131870	broad.mit.edu	37	3	131102049	131102049	+	3'UTR	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131102049G>A	uc003eof.2	+	2					uc003eoc.1_5'Flank|NUDT16_uc011bln.1_Missense_Mutation_p.G105D|NUDT16_uc003eog.1_Missense_Mutation_p.G118D	NM_152395	NP_689608	Q96DE0	NUD16_HUMAN	nudix-type motif 16							nucleolus|nucleoplasm	hydrolase activity|metal ion binding|RNA binding				0						CTGCGGGATGGTGTAGGAGGC	0.577													38	152	---	---	---	---	PASS
DNAJC13	23317	broad.mit.edu	37	3	132235581	132235581	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132235581A>G	uc003eor.2	+	48	5659	c.5594A>G	c.(5593-5595)AAT>AGT	p.N1865S		NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1865							heat shock protein binding			ovary(1)|breast(1)	2						ATGTTCTGCAATTCAACACAT	0.343													14	62	---	---	---	---	PASS
NPHP3	27031	broad.mit.edu	37	3	132419237	132419237	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132419237C>A	uc003epe.1	-	11	1761	c.1684G>T	c.(1684-1686)GGA>TGA	p.G562*	NPHP3_uc003epd.1_5'UTR|NPHP3_uc003epf.1_Nonsense_Mutation_p.G317*	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3	562					maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						ATGGGCCTTCCCACAAAATGG	0.358													4	164	---	---	---	---	PASS
KIT	3815	broad.mit.edu	37	4	55602936	55602936	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55602936G>A	uc010igr.2	+	19	2733	c.2646G>A	c.(2644-2646)ATG>ATA	p.M882I	KIT_uc010igs.2_Missense_Mutation_p.M878I	NM_000222	NP_000213	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral	882	Protein kinase.|Cytoplasmic (Potential).				male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity			soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTACAAGATGATCAAGGAAG	0.448		1	Mis|O		GIST|AML|TGCT|mastocytosis|mucosal melanoma	GIST|epithelioma	Piebald trait		Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors				30	122	---	---	---	---	PASS
PDCL2	132954	broad.mit.edu	37	4	56448312	56448312	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56448312C>G	uc003hbb.2	-	2	202	c.99G>C	c.(97-99)ATG>ATC	p.M33I		NM_152401	NP_689614	Q8N4E4	PDCL2_HUMAN	phosducin-like 2	33											0	Lung NSC(11;0.00256)|Glioma(25;0.08)|all_epithelial(27;0.0863)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.69e-07)|Lung(4;1.03e-06)|Epithelial(7;0.00669)			AACGTAAAACCATTTCTTCAA	0.358													25	85	---	---	---	---	PASS
HELQ	113510	broad.mit.edu	37	4	84358185	84358185	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84358185T>C	uc003hom.2	-	9	2053	c.1874A>G	c.(1873-1875)AAT>AGT	p.N625S	HELQ_uc010ikb.2_Missense_Mutation_p.N558S|HELQ_uc003hol.3_RNA|HELQ_uc010ikc.2_RNA	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308	625	Helicase C-terminal.						ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						CAGGTTGCCATTGCCAATATT	0.403								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					27	69	---	---	---	---	PASS
PTPN13	5783	broad.mit.edu	37	4	87684053	87684053	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87684053A>C	uc003hpz.2	+	24	4207	c.3727A>C	c.(3727-3729)AGC>CGC	p.S1243R	PTPN13_uc003hpy.2_Missense_Mutation_p.S1243R|PTPN13_uc003hqa.2_Missense_Mutation_p.S1224R|PTPN13_uc003hqb.2_Missense_Mutation_p.S1052R	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	1243						cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		GCGGGAAGGAAGCCTGAGTTC	0.532													42	97	---	---	---	---	PASS
HERC5	51191	broad.mit.edu	37	4	89385004	89385004	+	Splice_Site	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89385004A>G	uc003hrt.2	+	6	934	c.781_splice	c.e6-2	p.D261_splice		NM_016323	NP_057407	Q9UII4	HERC5_HUMAN	hect domain and RLD 5						innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		CCCTTTCCTTAGGATGGGCTG	0.378													35	115	---	---	---	---	PASS
PRSS12	8492	broad.mit.edu	37	4	119273413	119273413	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119273413G>T	uc003ica.1	-	1	510	c.463C>A	c.(463-465)CGT>AGT	p.R155S		NM_003619	NP_003610	P56730	NETR_HUMAN	neurotrypsin precursor	155	Kringle.					membrane	scavenger receptor activity			skin(1)	1						ACCTTGCCACGGGCGTCTCCG	0.692													6	17	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5146420	5146420	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5146420T>C	uc003jdl.2	+	3	491	c.353T>C	c.(352-354)CTA>CCA	p.L118P	ADAMTS16_uc003jdk.1_Missense_Mutation_p.L118P|ADAMTS16_uc003jdj.1_Missense_Mutation_p.L118P	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	118					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						TCCAGCAGCCTAGTGGCTCCT	0.537													90	96	---	---	---	---	PASS
CMBL	134147	broad.mit.edu	37	5	10286472	10286472	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10286472C>T	uc003jes.2	-	4	911	c.460G>A	c.(460-462)GTC>ATC	p.V154I		NM_138809	NP_620164	Q96DG6	CMBL_HUMAN	carboxymethylenebutenolidase	154						cytosol	hydrolase activity|protein binding			skin(1)	1						TTACCATAGACGGACACCCCT	0.493													18	108	---	---	---	---	PASS
TRIM36	55521	broad.mit.edu	37	5	114469806	114469806	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114469806C>A	uc003kqs.2	-	8	1794	c.1285G>T	c.(1285-1287)GTT>TTT	p.V429F	TRIM36_uc011cwc.1_Missense_Mutation_p.V417F|TRIM36_uc003kqt.2_Missense_Mutation_p.V274F	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN	tripartite motif-containing 36 isoform 1	429	Fibronectin type-III.					acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding	p.V429I(1)		ovary(4)|lung(2)|breast(2)	8		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		TTGTTATAAACTTTGCTCTGT	0.328													26	57	---	---	---	---	PASS
SLC27A6	28965	broad.mit.edu	37	5	128362850	128362850	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128362850G>C	uc003kuy.2	+	8	1676	c.1280G>C	c.(1279-1281)CGA>CCA	p.R427P	SLC27A6_uc003kuz.2_Missense_Mutation_p.R427P	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid	427					long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding				0		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		CTCATTTCTCGAGTGAATGCA	0.368													35	80	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140553062	140553062	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140553062G>A	uc003lit.2	+	1	820	c.646G>A	c.(646-648)GAC>AAC	p.D216N		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	216	Extracellular (Potential).|Cadherin 2.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACCGCTTTAGACGGCGGCTC	0.532													25	67	---	---	---	---	PASS
PCDHGA9	56107	broad.mit.edu	37	5	140783976	140783976	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140783976G>A	uc003lkh.1	+	1	1457	c.1457G>A	c.(1456-1458)AGA>AAA	p.R486K	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc011dax.1_Missense_Mutation_p.R486K	NM_018921	NP_061744	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9 isoform 1	486	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGAATTCTAGAGTTATTTAC	0.483													27	54	---	---	---	---	PASS
UNC5A	90249	broad.mit.edu	37	5	176304243	176304243	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176304243G>A	uc003mey.2	+	9	1621	c.1429G>A	c.(1429-1431)GAG>AAG	p.E477K		NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	netrin receptor Unc5h1 precursor	477	ZU5.|Cytoplasmic (Potential).				apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane				skin(1)	1	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAAGATCTATGAGATCTACCT	0.642													33	54	---	---	---	---	PASS
TUBB2A	7280	broad.mit.edu	37	6	3155931	3155931	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3155931C>T	uc003mvc.2	-	3	291	c.205G>A	c.(205-207)GAG>AAG	p.E69K	TUBB2A_uc003mvb.2_Missense_Mutation_p.E62K|TUBB2A_uc003mvd.2_Intron	NM_001069	NP_001060	Q13885	TBB2A_HUMAN	tubulin, beta 2	69					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			skin(1)	1	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				GTGCCAGGCTCCAGATCCACC	0.527													39	64	---	---	---	---	PASS
IP6K3	117283	broad.mit.edu	37	6	33695967	33695967	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33695967C>A	uc010jvf.2	-	4	846	c.310G>T	c.(310-312)GTG>TTG	p.V104L	IP6K3_uc003ofb.2_Missense_Mutation_p.V104L	NM_001142883	NP_001136355	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	104					inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|protein phosphorylation	cytoplasm	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol hexakisphosphate 6-kinase activity|inositol trisphosphate 3-kinase activity				0						CATATGGCCACCGCCGCCGAC	0.632													4	30	---	---	---	---	PASS
TNFRSF21	27242	broad.mit.edu	37	6	47253871	47253871	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47253871C>A	uc003oyv.2	-	2	990	c.557G>T	c.(556-558)TGC>TTC	p.C186F		NM_014452	NP_055267	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily,	186	Extracellular (Potential).|TNFR-Cys 4.				cellular lipid metabolic process	cytoplasm|integral to membrane	protein binding|receptor activity				0			Lung(136;0.189)			GTATGCTTTGCATTTCATCAC	0.547													38	77	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51918945	51918945	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51918945C>T	uc003pah.1	-	20	2131	c.1855G>A	c.(1855-1857)GGC>AGC	p.G619S	PKHD1_uc003pai.2_Missense_Mutation_p.G619S	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	619	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TTCATGTGGCCTTTGTATGCA	0.438													41	138	---	---	---	---	PASS
C6orf142	90523	broad.mit.edu	37	6	54025338	54025338	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54025338C>A	uc003pcg.3	+	6	888	c.775C>A	c.(775-777)CAG>AAG	p.Q259K	C6orf142_uc003pcf.2_Missense_Mutation_p.Q783K|C6orf142_uc003pch.3_Intron|C6orf142_uc011dxa.1_Missense_Mutation_p.Q794K	NM_138569	NP_612636	Q5VWP3	MLIP_HUMAN	hypothetical protein LOC90523	259						nuclear envelope|PML body	protein binding				0	Lung NSC(77;0.0317)					ACAGCTCAGGCAGCAAACTGA	0.408													25	98	---	---	---	---	PASS
NDUFAF4	29078	broad.mit.edu	37	6	97339016	97339016	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97339016G>A	uc003pow.2	-	3	582	c.492C>T	c.(490-492)TTC>TTT	p.F164F	NDUFAF4_uc003pov.2_RNA	NM_014165	NP_054884	Q9P032	NDUF4_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	164					mitochondrial respiratory chain complex I assembly	mitochondrial membrane	calmodulin binding			ovary(1)	1						CTTCAGGAGGGAAGATTTCGA	0.343													29	109	---	---	---	---	PASS
MAP3K4	4216	broad.mit.edu	37	6	161510413	161510413	+	Silent	SNP	T	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161510413T>G	uc003qtn.2	+	11	3025	c.2883T>G	c.(2881-2883)GCT>GCG	p.A961A	MAP3K4_uc010kkc.1_Silent_p.A961A|MAP3K4_uc003qto.2_Silent_p.A961A|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Silent_p.A414A|MAP3K4_uc003qtp.2_5'Flank	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	961					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AGAGAAAAGCTTTCCAGCAGT	0.473													58	225	---	---	---	---	PASS
STARD3NL	83930	broad.mit.edu	37	7	38254705	38254705	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38254705C>T	uc003tfr.2	+	4	528	c.380C>T	c.(379-381)GCG>GTG	p.A127V	STARD3NL_uc003tfs.2_Missense_Mutation_p.A127V|STARD3NL_uc003tft.2_Missense_Mutation_p.A127V	NM_032016	NP_114405	O95772	MENTO_HUMAN	MLN64 N-terminal homolog	127	MENTAL.|Helical; (Potential).					integral to membrane|late endosome membrane				ovary(1)	1						TGGGCAATAGCGGTGAGTATG	0.483													52	52	---	---	---	---	PASS
BLVRA	644	broad.mit.edu	37	7	43840098	43840098	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43840098G>C	uc003tir.2	+	6	470	c.387G>C	c.(385-387)TTG>TTC	p.L129F	BLVRA_uc010kxv.2_Missense_Mutation_p.L129F	NM_000712	NP_000703	P53004	BIEA_HUMAN	biliverdin reductase A precursor	129					heme catabolic process	cytosol	biliverdin reductase activity|zinc ion binding			ovary(1)	1					NADH(DB00157)	TTGAACTCTTGATGGAGGAAT	0.488													28	50	---	---	---	---	PASS
WBSCR22	114049	broad.mit.edu	37	7	73111966	73111966	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73111966G>A	uc003tyt.2	+	11	791	c.733G>A	c.(733-735)GTG>ATG	p.V245M	WBSCR22_uc003tyu.2_Missense_Mutation_p.V262M|WBSCR22_uc003tyv.2_Missense_Mutation_p.V207M|WBSCR22_uc003tyw.1_Missense_Mutation_p.V108M	NM_017528	NP_059998	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22	245						nucleus	methyltransferase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				GCGGGGAATGGTGAGGAAGAG	0.647													7	65	---	---	---	---	PASS
CCDC132	55610	broad.mit.edu	37	7	92905597	92905597	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92905597C>T	uc003umo.2	+	12	1050	c.922C>T	c.(922-924)CAA>TAA	p.Q308*	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Nonsense_Mutation_p.Q278*|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Intron|CCDC132_uc003umn.2_Nonsense_Mutation_p.Q308*	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	308											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			CCAAAAGCTGCAATATAAGGA	0.343													54	131	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100377230	100377230	+	Silent	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100377230G>T	uc003uwj.2	+	36	6645	c.6480G>T	c.(6478-6480)ACG>ACT	p.T2160T	ZAN_uc003uwk.2_Silent_p.T2160T|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kke.1_Silent_p.T247T	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	2160	Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TAGACCTCACGCCCTTCCTGG	0.677													5	13	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100677564	100677564	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100677564C>A	uc003uxp.1	+	3	2920	c.2867C>A	c.(2866-2868)ACC>AAC	p.T956N	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	956	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|14.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ACACCTGTGACCACTTCTACT	0.498													87	365	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100677565	100677565	+	Silent	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100677565C>A	uc003uxp.1	+	3	2921	c.2868C>A	c.(2866-2868)ACC>ACA	p.T956T	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	956	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|14.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CACCTGTGACCACTTCTACTG	0.502													87	366	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101747623	101747623	+	Silent	SNP	G	C	C	rs143157780	byFrequency	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101747623G>C	uc003uyx.3	+	6	452	c.414G>C	c.(412-414)ACG>ACC	p.T138T	CUX1_uc003uys.3_Silent_p.T149T|CUX1_uc003uyt.2_Silent_p.T149T|CUX1_uc011kkn.1_Silent_p.T112T|CUX1_uc003uyw.2_Silent_p.T103T|CUX1_uc003uyv.2_Silent_p.T133T|CUX1_uc003uyu.2_Silent_p.T149T	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	138	Potential.				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						CAGAGGTTACGATAAAAGCAC	0.393													44	169	---	---	---	---	PASS
LAMB1	3912	broad.mit.edu	37	7	107599895	107599895	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107599895T>C	uc003vew.2	-	20	2824	c.2489A>G	c.(2488-2490)AAT>AGT	p.N830S	LAMB1_uc003vev.2_Missense_Mutation_p.N854S	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	830	Laminin EGF-like 7.				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GCAGAAGGCATTGACAGATCC	0.498													22	81	---	---	---	---	PASS
C7orf60	154743	broad.mit.edu	37	7	112535725	112535725	+	Silent	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112535725T>A	uc003vgo.1	-	3	499	c.372A>T	c.(370-372)GTA>GTT	p.V124V	C7orf60_uc011kms.1_Silent_p.V150V	NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN	hypothetical protein LOC154743	124										ovary(2)|skin(1)	3						TAGTGGCAAGTACAGCTCTTT	0.353													38	137	---	---	---	---	PASS
ANKRD7	56311	broad.mit.edu	37	7	117874559	117874559	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117874559T>C	uc003vji.2	+	2	427	c.254T>C	c.(253-255)ATA>ACA	p.I85T		NM_019644	NP_062618	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	85	ANK 1.				male gonad development						0						CAATGCAAAATAAATGTCCGG	0.343													25	79	---	---	---	---	PASS
SPAM1	6677	broad.mit.edu	37	7	123593967	123593967	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123593967C>T	uc003vld.2	+	4	745	c.343C>T	c.(343-345)CCC>TCC	p.P115S	SPAM1_uc003vle.2_Missense_Mutation_p.P115S|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Missense_Mutation_p.P115S|SPAM1_uc010lku.2_Missense_Mutation_p.P115S	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	115					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	TGGAGGAATCCCCCAGAAGAT	0.398													63	151	---	---	---	---	PASS
CREB3L2	64764	broad.mit.edu	37	7	137590525	137590525	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137590525G>A	uc003vtw.2	-	6	1233	c.838C>T	c.(838-840)CCC>TCC	p.P280S	CREB3L2_uc003vtx.1_Missense_Mutation_p.P280S|CREB3L2_uc003vtv.2_Missense_Mutation_p.P217S	NM_194071	NP_919047	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like	280	Cytoplasmic (Potential).				chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160						GTGGGGATGGGATAGCCCTCA	0.517			T	FUS	fibromyxoid sarcoma								104	234	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151878809	151878809	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151878809G>T	uc003wla.2	-	36	6355	c.6136C>A	c.(6136-6138)CCA>ACA	p.P2046T	MLL3_uc003wkz.2_Missense_Mutation_p.P1107T	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2046	Pro-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GGTTGCATTGGAGTCTTAAAA	0.483			N		medulloblastoma								52	95	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3165292	3165292	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3165292G>T	uc011kwk.1	-	25	4268	c.3878C>A	c.(3877-3879)CCT>CAT	p.P1293H	CSMD1_uc011kwj.1_Missense_Mutation_p.P685H|CSMD1_uc003wqe.2_Missense_Mutation_p.P449H	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1293	Extracellular (Potential).|CUB 8.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGGATAGCCAGGGGACAATAT	0.483													63	75	---	---	---	---	PASS
ADAM9	8754	broad.mit.edu	37	8	38913123	38913123	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38913123G>A	uc003xmr.2	+	14	1501	c.1423G>A	c.(1423-1425)GGA>AGA	p.G475R	ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA|ADAM9_uc003xms.2_RNA	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	475	Extracellular (Potential).|Disintegrin.				activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			TTTATGCCGAGGAAAAACCAG	0.368													60	674	---	---	---	---	PASS
RB1CC1	9821	broad.mit.edu	37	8	53586413	53586413	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53586413T>A	uc003xre.3	-	7	1552	c.994A>T	c.(994-996)ATG>TTG	p.M332L	RB1CC1_uc003xrf.3_Missense_Mutation_p.M332L	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1	332					autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				ACCCTGCTCATAGAATCAAAG	0.318													41	61	---	---	---	---	PASS
OPRK1	4986	broad.mit.edu	37	8	54147674	54147674	+	Intron	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54147674A>G	uc003xrh.1	-						OPRK1_uc003xri.1_Intron|OPRK1_uc010lyc.1_Intron	NM_000912	NP_000903	P41145	OPRK_HUMAN	opioid receptor, kappa 1						behavior|immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception|synaptic transmission|viral genome replication	integral to plasma membrane	kappa-opioid receptor activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Buprenorphine(DB00921)|Butorphanol(DB00611)|Cocaine(DB00907)|Codeine(DB00318)|Dezocine(DB01209)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Meperidine(DB00454)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Tramadol(DB00193)	TTGTGTATCTAAAAGAAAAGA	0.363													25	124	---	---	---	---	PASS
MTBP	27085	broad.mit.edu	37	8	121483082	121483082	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121483082C>T	uc003ypc.1	+	11	1115	c.1070C>T	c.(1069-1071)CCA>CTA	p.P357L	MTBP_uc011lie.1_RNA	NM_022045	NP_071328	Q96DY7	MTBP_HUMAN	Mdm2, transformed 3T3 cell double minute 2, p53	357					cell cycle arrest					skin(2)|ovary(1)	3	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TTTGTATTGCCATGTACCATT	0.353													19	175	---	---	---	---	PASS
KLHL38	340359	broad.mit.edu	37	8	124664915	124664915	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124664915G>A	uc003yqs.1	-	1	276	c.252C>T	c.(250-252)ACC>ACT	p.T84T		NM_001081675	NP_001075144	Q2WGJ6	KLH38_HUMAN	kelch-like 38	84	BTB.										0						TCTGGTCCAGGGTTGGGGGGT	0.582													30	69	---	---	---	---	PASS
KIFC2	90990	broad.mit.edu	37	8	145697332	145697332	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145697332G>C	uc003zcz.2	+	13	1453	c.1388G>C	c.(1387-1389)AGA>ACA	p.R463T	KIFC2_uc003zda.2_5'Flank	NM_145754	NP_665697	Q96AC6	KIFC2_HUMAN	kinesin family member C2	463	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CAGGTCTTCAGAGAGCTGGAA	0.597													68	128	---	---	---	---	PASS
KIFC2	90990	broad.mit.edu	37	8	145697404	145697404	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145697404G>A	uc003zcz.2	+	13	1525	c.1460G>A	c.(1459-1461)GGC>GAC	p.G487D	KIFC2_uc003zda.2_5'Flank	NM_145754	NP_665697	Q96AC6	KIFC2_HUMAN	kinesin family member C2	487	ATP (By similarity).|Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GGCCAGACAGGCACCGGGAAG	0.637													63	120	---	---	---	---	PASS
ARHGAP39	80728	broad.mit.edu	37	8	145773748	145773748	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145773748C>T	uc003zdt.1	-	6	1277	c.722G>A	c.(721-723)CGC>CAC	p.R241H	ARHGAP39_uc011llk.1_Missense_Mutation_p.R241H|ARHGAP39_uc003zds.1_Missense_Mutation_p.R241H	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	241	Pro-rich.				axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0						TCTGCGGGAGCGGACCCCAGG	0.692													6	30	---	---	---	---	PASS
STX17	55014	broad.mit.edu	37	9	102722445	102722445	+	Intron	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102722445T>C	uc004bal.3	+						STX17_uc010msx.2_Intron|STX17_uc011lvd.1_Intron	NM_017919	NP_060389	P56962	STX17_HUMAN	syntaxin 17						intracellular protein transport|vesicle-mediated transport	endoplasmic reticulum|integral to membrane|nucleolus	SNAP receptor activity			large_intestine(1)	1		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				AATGTAAGTATATAACTGTTT	0.303													26	168	---	---	---	---	PASS
LPPR1	54886	broad.mit.edu	37	9	104048410	104048410	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104048410T>C	uc004bbb.2	+	4	676	c.277T>C	c.(277-279)TAT>CAT	p.Y93H	LPPR1_uc011lvi.1_Missense_Mutation_p.Y69H|LPPR1_uc004bbc.2_Missense_Mutation_p.Y93H|LPPR1_uc010mtc.2_Missense_Mutation_p.Y77H	NM_207299	NP_997182	Q8TBJ4	LPPR1_HUMAN	plasticity related gene 3	93						integral to membrane	catalytic activity				0						GATATCCATGTATTTCATAAA	0.373													52	124	---	---	---	---	PASS
LPPR1	54886	broad.mit.edu	37	9	104048506	104048506	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104048506A>G	uc004bbb.2	+	4	772	c.373A>G	c.(373-375)ATA>GTA	p.I125V	LPPR1_uc011lvi.1_Missense_Mutation_p.I101V|LPPR1_uc004bbc.2_Missense_Mutation_p.I125V|LPPR1_uc010mtc.2_Missense_Mutation_p.I109V	NM_207299	NP_997182	Q8TBJ4	LPPR1_HUMAN	plasticity related gene 3	125						integral to membrane	catalytic activity				0						TCGAAGGATCATAAGATTCAC	0.368													45	87	---	---	---	---	PASS
PRPF4	9128	broad.mit.edu	37	9	116049074	116049074	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116049074G>A	uc004bgx.2	+	9	951	c.901G>A	c.(901-903)GCT>ACT	p.A301T	PRPF4_uc004bgy.2_Missense_Mutation_p.A300T	NM_004697	NP_004688	O43172	PRP4_HUMAN	PRP4 pre-mRNA processing factor 4 homolog	301	WD 2.					Cajal body|nuclear speck|spliceosomal complex|U4/U6 snRNP	protein binding			ovary(2)|pancreas(1)	3						CTCTTGTGCGGCTGATGGCTC	0.478													229	424	---	---	---	---	PASS
DENND1A	57706	broad.mit.edu	37	9	126429330	126429330	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126429330C>A	uc004bnz.1	-	8	715	c.482G>T	c.(481-483)AGA>ATA	p.R161I	DENND1A_uc004bny.1_5'UTR|DENND1A_uc011lzm.1_Missense_Mutation_p.R129I|DENND1A_uc004boa.1_Missense_Mutation_p.R161I|DENND1A_uc004bob.1_Missense_Mutation_p.R131I|DENND1A_uc004boc.2_Missense_Mutation_p.R129I	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1	161	DENN.					cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						GGGAAGTTCTCTGGTATCAGG	0.303													4	165	---	---	---	---	PASS
GOLGA2	2801	broad.mit.edu	37	9	131030746	131030746	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131030746C>A	uc011maw.1	-	3	278	c.265G>T	c.(265-267)GGT>TGT	p.G89C	GOLGA2_uc010mxw.2_Intron|GOLGA2_uc004bul.1_5'UTR|GOLGA2_uc004bum.1_5'UTR	NM_004486	NP_004477	Q08379	GOGA2_HUMAN	Golgi autoantigen, golgin subfamily a, 2	89	Potential.					Golgi cisterna membrane	protein binding			ovary(1)	1						GAAGGGACACCGCCAGGTAAC	0.577													20	43	---	---	---	---	PASS
PPP2R4	5524	broad.mit.edu	37	9	131873318	131873318	+	5'Flank	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131873318G>C	uc004bxm.1	+						CRAT_uc004bxg.2_5'Flank|CRAT_uc004bxk.3_5'Flank|CRAT_uc004bxh.2_5'Flank|CRAT_uc004bxj.2_5'Flank|PPP2R4_uc004bxl.1_Intron|PPP2R4_uc011mbo.1_5'Flank|PPP2R4_uc010myr.1_5'Flank|PPP2R4_uc004bxn.1_5'Flank|PPP2R4_uc004bxo.1_5'Flank|PPP2R4_uc011mbp.1_5'Flank|PPP2R4_uc011mbq.1_5'Flank|PPP2R4_uc010mys.1_5'Flank	NM_178001	NP_821068	Q15257	PTPA_HUMAN	protein phosphatase 2A, regulatory subunit B'						ATP catabolic process|negative regulation of phosphoprotein phosphatase activity|negative regulation of protein dephosphorylation|positive regulation of apoptosis|positive regulation of phosphoprotein phosphatase activity|positive regulation of protein dephosphorylation	calcium channel complex|cytoplasm|nucleus|protein phosphatase type 2A complex|soluble fraction	ATP binding|peptidyl-prolyl cis-trans isomerase activity|protein heterodimerization activity|protein homodimerization activity|protein phosphatase 2A binding|protein phosphatase type 2A regulator activity|protein tyrosine phosphatase activator activity|receptor binding			ovary(1)|lung(1)|pancreas(1)	3		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		GGAGGTAGTGGTGTGCACCTT	0.522											OREG0003932	type=REGULATORY REGION|Gene=CRAT|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	19	78	---	---	---	---	PASS
SLC39A12	221074	broad.mit.edu	37	10	18250558	18250558	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18250558G>T	uc001ipo.2	+	3	583	c.310G>T	c.(310-312)GAT>TAT	p.D104Y	SLC39A12_uc001ipn.2_Missense_Mutation_p.D104Y|SLC39A12_uc001ipp.2_Missense_Mutation_p.D104Y|SLC39A12_uc010qck.1_5'UTR	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	104	Extracellular (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						AAATTTTGAAGATCAGCTTAG	0.358													37	101	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26377272	26377272	+	Silent	SNP	G	T	T	rs146797033	byFrequency	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26377272G>T	uc001isn.2	+	15	1860	c.1500G>T	c.(1498-1500)GCG>GCT	p.A500A	MYO3A_uc009xko.1_Silent_p.A500A|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Silent_p.A500A	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	500	Myosin head-like.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						CTTCTGGAGCGGTAGTGGGAG	0.383													36	87	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37438704	37438704	+	Splice_Site	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37438704G>T	uc001iza.1	+	11	1504	c.1405_splice	c.e11-1	p.P469_splice		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						ACCCCATTTAGCCTGCCATTG	0.279													34	114	---	---	---	---	PASS
PPYR1	5540	broad.mit.edu	37	10	47086886	47086886	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47086886C>T	uc001jee.2	+	3	522	c.103C>T	c.(103-105)CAG>TAG	p.Q35*	ANXA8_uc001jed.3_Intron|PPYR1_uc009xna.2_Nonsense_Mutation_p.Q35*	NM_005972	NP_005963	P50391	NPY4R_HUMAN	pancreatic polypeptide receptor 1	35	Extracellular (Potential).				blood circulation|digestion|feeding behavior	integral to plasma membrane				ovary(1)|skin(1)	2						TGAACATTGCCAGGATTCCGT	0.532													9	184	---	---	---	---	PASS
C10orf53	282966	broad.mit.edu	37	10	50916591	50916591	+	Nonsense_Mutation	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50916591T>A	uc001jid.1	+	3	462	c.402T>A	c.(400-402)TGT>TGA	p.C134*		NM_182554	NP_872360	Q8N6V4	CJ053_HUMAN	chromosome 10 open reading frame 53 isoform a	Error:Variant_position_missing_in_Q8N6V4_after_alignment											0		all_neural(218;0.107)				ccaatctttgtgacctgggtt	0.000													18	165	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55582055	55582055	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55582055G>C	uc001jju.1	-	33	5826	c.5431C>G	c.(5431-5433)CTA>GTA	p.L1811V	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.L1808V|PCDH15_uc010qhw.1_Missense_Mutation_p.L1771V|PCDH15_uc010qhx.1_Missense_Mutation_p.L1742V|PCDH15_uc010qhy.1_Missense_Mutation_p.L1818V|PCDH15_uc010qhz.1_Missense_Mutation_p.L1813V|PCDH15_uc010qia.1_Missense_Mutation_p.L1791V|PCDH15_uc010qib.1_Missense_Mutation_p.L1788V	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1811	Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				aatggaggtagaagaggtggT	0.169										HNSCC(58;0.16)			7	30	---	---	---	---	PASS
OIT3	170392	broad.mit.edu	37	10	74684033	74684033	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74684033C>A	uc001jte.1	+	7	1216	c.998C>A	c.(997-999)CCC>CAC	p.P333H	OIT3_uc009xqs.1_Intron	NM_152635	NP_689848	Q8WWZ8	OIT3_HUMAN	oncoprotein-induced transcript 3 precursor	333	ZP.					nuclear envelope	calcium ion binding			ovary(2)	2	Prostate(51;0.0198)					ACAGGTCTACCCAAGCAGACC	0.552													21	161	---	---	---	---	PASS
PSD	5662	broad.mit.edu	37	10	104174911	104174911	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104174911C>A	uc001kvg.1	-	4	1360	c.833G>T	c.(832-834)GGG>GTG	p.G278V	PSD_uc001kvh.1_5'UTR|PSD_uc009xxd.1_Missense_Mutation_p.G278V	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	278					regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		GGCTGCTCGCCCCACAGCCAC	0.657													13	60	---	---	---	---	PASS
ADD3	120	broad.mit.edu	37	10	111884035	111884035	+	Intron	SNP	A	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111884035A>T	uc001kyt.3	+						ADD3_uc001kys.3_Intron|ADD3_uc001kyu.2_Intron|ADD3_uc001kyv.2_Intron|ADD3_uc001kyw.2_Intron|ADD3_uc001kyx.2_Intron	NM_016824	NP_058432	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma) isoform a							cytoskeleton	actin binding|calmodulin binding|metal ion binding|structural constituent of cytoskeleton			ovary(2)|skin(2)|large_intestine(1)	5		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		AAATCACGGTATGCCAGTATT	0.343													19	144	---	---	---	---	PASS
BCCIP	56647	broad.mit.edu	37	10	127524721	127524721	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127524721T>A	uc001ljb.3	+	7	846	c.823T>A	c.(823-825)TGT>AGT	p.C275S	BCCIP_uc001ljd.3_Intron|BCCIP_uc010qui.1_Intron|BCCIP_uc001ljc.3_Intron|BCCIP_uc010quj.1_Intron	NM_078468	NP_510868	Q9P287	BCCIP_HUMAN	BRCA2 and CDKN1A-interacting protein isoform	275					cell cycle|DNA repair|neuroendocrine cell differentiation|regulation of cyclin-dependent protein kinase activity	nuclear cyclin-dependent protein kinase holoenzyme complex	kinase regulator activity|protein binding			ovary(1)|breast(1)	2		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				GAGCGACACTTGTCTGGGAGG	0.423													31	190	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129905711	129905711	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129905711C>G	uc001lke.2	-	13	4588	c.4393G>C	c.(4393-4395)GAA>CAA	p.E1465Q	MKI67_uc001lkf.2_Missense_Mutation_p.E1105Q|MKI67_uc009yav.1_Missense_Mutation_p.E1040Q|MKI67_uc009yaw.1_Missense_Mutation_p.E615Q	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	1465	16 X 122 AA approximate repeats.|4.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GCCAGGTCTTCTAGGGGTTGG	0.498													57	231	---	---	---	---	PASS
OR52A1	23538	broad.mit.edu	37	11	5173278	5173278	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5173278T>C	uc010qyy.1	-	1	322	c.322A>G	c.(322-324)ACA>GCA	p.T108A		NM_012375	NP_036507	Q9UKL2	O52A1_HUMAN	olfactory receptor, family 52, subfamily A,	108	Helical; Name=3; (Potential).				sensory perception of smell	integral to plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2		Medulloblastoma(188;0.00106)|Breast(177;0.0155)|all_neural(188;0.0189)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCCTGCAATGTGTGGATGAAC	0.453													4	32	---	---	---	---	PASS
TRIM22	10346	broad.mit.edu	37	11	5730645	5730645	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5730645G>C	uc001mbr.2	+	8	1541	c.1264G>C	c.(1264-1266)GAG>CAG	p.E422Q	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron|TRIM22_uc009yes.2_Missense_Mutation_p.E418Q|TRIM22_uc010qzm.1_Missense_Mutation_p.E250Q|TRIM22_uc009yeu.2_Missense_Mutation_p.E233Q|OR56B1_uc001mbs.1_Intron|OR56B1_uc009yev.1_Intron	NM_006074	NP_006065	Q8IYM9	TRI22_HUMAN	tripartite motif-containing 22	422	B30.2/SPRY.				immune response|interspecies interaction between organisms|protein trimerization|response to virus	Cajal body|Golgi apparatus|nuclear speck	ligase activity|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding				0		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		TAATGCTTTTGAGGACTCCTC	0.408													15	177	---	---	---	---	PASS
OR56A1	120796	broad.mit.edu	37	11	6048128	6048128	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6048128G>A	uc010qzw.1	-	1	807	c.807C>T	c.(805-807)AAC>AAT	p.N269N		NM_001001917	NP_001001917	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A,	269	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)	3		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCTGGCCACGTTTGTCAACA	0.522													49	114	---	---	---	---	PASS
DENND5A	23258	broad.mit.edu	37	11	9200611	9200611	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9200611G>A	uc001mhl.2	-	7	1720	c.1465C>T	c.(1465-1467)CGT>TGT	p.R489C	DENND5A_uc010rbw.1_Missense_Mutation_p.R489C|DENND5A_uc010rbx.1_RNA	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1	489										liver(1)	1						GGGTCTTCACGCACTTCCAAC	0.363													44	118	---	---	---	---	PASS
MRGPRX4	117196	broad.mit.edu	37	11	18194896	18194896	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18194896G>A	uc001mnv.1	+	1	513	c.93G>A	c.(91-93)ACG>ACA	p.T31T		NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	31	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						TGAGCTTCACGGTGCTGACGT	0.547													64	192	---	---	---	---	PASS
LGR4	55366	broad.mit.edu	37	11	27395522	27395522	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27395522A>C	uc001mrj.3	-	14	1738	c.1253T>G	c.(1252-1254)CTA>CGA	p.L418R	LGR4_uc001mrk.3_Missense_Mutation_p.L394R	NM_018490	NP_060960	Q9BXB1	LGR4_HUMAN	leucine-rich repeat-containing G protein-coupled	418	LRR 15.|Extracellular (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			ovary(1)	1						ATCCACTTACAGGTTAGTTAT	0.328													96	347	---	---	---	---	PASS
OR4B1	119765	broad.mit.edu	37	11	48238741	48238741	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48238741C>T	uc010rhs.1	+	1	380	c.380C>T	c.(379-381)CCT>CTT	p.P127L		NM_001005470	NP_001005470	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B,	127	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|pancreas(1)	4						ATTTGCAAGCCTCTTCATTAT	0.463													61	112	---	---	---	---	PASS
OR8H2	390151	broad.mit.edu	37	11	55872975	55872975	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55872975T>C	uc010riy.1	+	1	457	c.457T>C	c.(457-459)TTT>CTT	p.F153L		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	153	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					TGTGATTGGCTTTATAGACTC	0.443										HNSCC(53;0.14)			82	245	---	---	---	---	PASS
OR5R1	219479	broad.mit.edu	37	11	56184866	56184866	+	Silent	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56184866C>T	uc010rji.1	-	1	843	c.843G>A	c.(841-843)GTG>GTA	p.V281V		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	281	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					ACATGGGGATCACCACTGTGT	0.388													22	213	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62287374	62287374	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62287374T>C	uc001ntl.2	-	5	14815	c.14515A>G	c.(14515-14517)ATG>GTG	p.M4839V	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4839					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				ATTTCAGGCATCTTGAACTTG	0.463													57	189	---	---	---	---	PASS
DHCR7	1717	broad.mit.edu	37	11	71152283	71152283	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71152283C>T	uc001oqk.2	-	6	866	c.616G>A	c.(616-618)GCC>ACC	p.A206T	DHCR7_uc001oql.2_Missense_Mutation_p.A206T	NM_001163817	NP_001157289	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	206					cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|nuclear outer membrane	7-dehydrocholesterol reductase activity|protein binding			ovary(1)|liver(1)	2					NADH(DB00157)	CAGTCTCTGGCGCTGGTGGGG	0.562									Smith-Lemli-Opitz_syndrome				36	67	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105782633	105782633	+	Intron	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105782633G>C	uc001pix.2	+						GRIA4_uc001piu.1_Nonstop_Mutation_p.*434S|GRIA4_uc001piw.2_Intron|GRIA4_uc009yxk.1_Nonstop_Mutation_p.*434S	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform						glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	TTAAGAAATTGATCAAGAAAG	0.363													47	103	---	---	---	---	PASS
ROBO4	54538	broad.mit.edu	37	11	124756583	124756583	+	Silent	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124756583C>T	uc001qbg.2	-	16	2711	c.2571G>A	c.(2569-2571)CTG>CTA	p.L857L	ROBO4_uc010sas.1_Silent_p.L712L|ROBO4_uc001qbh.2_3'UTR|ROBO4_uc001qbi.2_Silent_p.L415L	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	857					angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GAGGTGGGCACAGCAAGACTC	0.667													10	24	---	---	---	---	PASS
FLI1	2313	broad.mit.edu	37	11	128680570	128680570	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128680570C>T	uc010sbu.1	+	9	1387	c.1046C>T	c.(1045-1047)ACC>ATC	p.T349I	FLI1_uc010sbt.1_Missense_Mutation_p.T156I|FLI1_uc010sbv.1_Missense_Mutation_p.T316I|FLI1_uc009zci.2_Missense_Mutation_p.T283I	NM_002017	NP_002008	Q01543	FLI1_HUMAN	Friend leukemia virus integration 1	349	ETS.				hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/FLI1(2266)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		AACATTATGACCAAAGTGCAC	0.517			T	EWSR1	Ewing sarcoma								7	37	---	---	---	---	PASS
MRPS35	60488	broad.mit.edu	37	12	27863870	27863870	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27863870G>T	uc001rih.2	+	1	142	c.94G>T	c.(94-96)GTC>TTC	p.V32F	MRPS35_uc001rii.2_Missense_Mutation_p.V32F	NM_021821	NP_068593	P82673	RT35_HUMAN	mitochondrial ribosomal protein S35 precursor	32					DNA damage response, detection of DNA damage	mitochondrial small ribosomal subunit					0	Lung SC(9;0.0873)					GGCCACTCCGGTCCCGACACC	0.657													13	27	---	---	---	---	PASS
FGD4	121512	broad.mit.edu	37	12	32764098	32764098	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32764098T>A	uc001rkz.2	+	10	1696	c.1219T>A	c.(1219-1221)TAT>AAT	p.Y407N	FGD4_uc001rlc.2_Missense_Mutation_p.Y492N|FGD4_uc001rky.2_Missense_Mutation_p.Y159N|FGD4_uc001rla.2_Missense_Mutation_p.Y63N|FGD4_uc010ske.1_Missense_Mutation_p.Y519N|FGD4_uc001rlb.1_RNA	NM_139241	NP_640334	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	407					actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					CTTAGAGATTTATGAAATGTT	0.363													23	130	---	---	---	---	PASS
SDR9C7	121214	broad.mit.edu	37	12	57324196	57324196	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57324196T>A	uc010sqw.1	-	2	374	c.374A>T	c.(373-375)GAC>GTC	p.D125V		NM_148897	NP_683695	Q8NEX9	DR9C7_HUMAN	short chain dehydrogenase/reductase family 9C,	125						cytoplasm	binding|oxidoreductase activity			central_nervous_system(1)	1						CTTCACAAAGTCATCCTTGGT	0.557													32	56	---	---	---	---	PASS
TBC1D15	64786	broad.mit.edu	37	12	72274315	72274315	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72274315C>G	uc001swu.2	+	4	346	c.337C>G	c.(337-339)CTG>GTG	p.L113V	TBC1D15_uc009zrv.2_Translation_Start_Site|TBC1D15_uc010stt.1_Missense_Mutation_p.L99V|TBC1D15_uc001swv.2_Missense_Mutation_p.L113V|TBC1D15_uc001sww.2_Translation_Start_Site	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1	91							protein binding|Rab GTPase activator activity				0						ATCAGAACATCTGAACAGTTA	0.328													10	54	---	---	---	---	PASS
PARP4	143	broad.mit.edu	37	13	25029274	25029274	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25029274C>A	uc001upl.2	-	22	2745	c.2639G>T	c.(2638-2640)TGT>TTT	p.C880F	PARP4_uc010tdc.1_Missense_Mutation_p.C880F	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	880	VWFA.				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		GCAGTCAAGACAAATAATCAC	0.502													60	131	---	---	---	---	PASS
HMGB1	3146	broad.mit.edu	37	13	31036834	31036834	+	Silent	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31036834G>T	uc001usw.2	-	4	496	c.312C>A	c.(310-312)CTC>CTA	p.L104L	HMGB1_uc001usz.2_Silent_p.L104L|HMGB1_uc001usv.2_Silent_p.L104L|HMGB1_uc001usx.2_Silent_p.L104L|HMGB1_uc001usy.2_Silent_p.L65L|HMGB1_uc001uta.1_Silent_p.L104L	NM_002128	NP_002119	P09429	HMGB1_HUMAN	high-mobility group box 1	104	HMG box 2.				base-excision repair, DNA ligation|dendritic cell chemotaxis|DNA fragmentation involved in apoptotic nuclear change|DNA topological change|inflammatory response to antigenic stimulus|innate immune response|myeloid dendritic cell activation|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|neuron projection development|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of DNA binding|positive regulation of transcription from RNA polymerase II promoter|V(D)J recombination	cell surface|condensed chromosome|extracellular space|nucleolus|nucleoplasm	chemoattractant activity|cytokine activity|damaged DNA binding|DNA bending activity|double-stranded DNA binding|RAGE receptor binding|repressing transcription factor binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			ovary(1)	1		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		CAGAGCAGAAGAGGAAGAAGG	0.373													36	51	---	---	---	---	PASS
FNDC3A	22862	broad.mit.edu	37	13	49710725	49710725	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49710725A>G	uc001vcm.2	+	6	1053	c.748A>G	c.(748-750)ACA>GCA	p.T250A	FNDC3A_uc001vcl.1_Missense_Mutation_p.T250A|FNDC3A_uc001vcn.2_Missense_Mutation_p.T250A|FNDC3A_uc001vco.2_RNA|FNDC3A_uc001vcp.1_Missense_Mutation_p.T194A|FNDC3A_uc001vcq.2_Missense_Mutation_p.T194A	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	250						Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		ACAAGTTGATACAGAAATTGA	0.353													29	68	---	---	---	---	PASS
PRKD1	5587	broad.mit.edu	37	14	30066893	30066893	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30066893G>A	uc001wqh.2	-	16	2419	c.2238C>T	c.(2236-2238)ACC>ACT	p.T746T		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	746	Protein kinase.				cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		GGTAAGCGGGGGTACCCACCA	0.488													68	102	---	---	---	---	PASS
PYGL	5836	broad.mit.edu	37	14	51387348	51387348	+	Intron	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51387348G>T	uc001wyu.2	-						PYGL_uc010tqq.1_Intron|PYGL_uc001wyv.2_Intron|PYGL_uc010anz.1_Intron	NM_002863	NP_002854	P06737	PYGL_HUMAN	liver glycogen phosphorylase isoform 1						glucose homeostasis|glucose metabolic process|glycogen catabolic process	cytosol|soluble fraction	AMP binding|ATP binding|bile acid binding|drug binding|glucose binding|glycogen phosphorylase activity|protein homodimerization activity|purine base binding|pyridoxal phosphate binding			skin(1)	1	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)|Pyridoxal Phosphate(DB00114)|Riboflavin(DB00140)	TTAACTAGGGGAAAGTTAGAG	0.453													20	102	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64522939	64522939	+	Nonsense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64522939C>G	uc001xgm.2	+	49	10252	c.10022C>G	c.(10021-10023)TCA>TGA	p.S3341*	SYNE2_uc001xgl.2_Nonsense_Mutation_p.S3341*|SYNE2_uc010apw.1_Nonsense_Mutation_p.S47*	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3341	Cytoplasmic (Potential).|Potential.				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCTAAGAACTCAGCAATGAAG	0.403													26	70	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64608107	64608107	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64608107A>G	uc001xgm.2	+	81	15255	c.15025A>G	c.(15025-15027)ATC>GTC	p.I5009V	SYNE2_uc001xgl.2_Missense_Mutation_p.I5009V|SYNE2_uc010apy.2_Missense_Mutation_p.I1394V|SYNE2_uc001xgn.2_5'UTR|SYNE2_uc001xgo.2_RNA	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5009	Spectrin 1.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GACTGCCGTTATCAGTATCGG	0.348													69	143	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64625421	64625421	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64625421A>G	uc001xgm.2	+	86	16101	c.15871A>G	c.(15871-15873)ATG>GTG	p.M5291V	SYNE2_uc001xgl.2_Missense_Mutation_p.M5291V|SYNE2_uc010apy.2_Missense_Mutation_p.M1676V|SYNE2_uc001xgn.2_Missense_Mutation_p.M253V|SYNE2_uc001xgo.2_RNA|SYNE2_uc001xgp.2_Missense_Mutation_p.M20V	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5291	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGAAGTGAATATGATGACAAT	0.418													25	94	---	---	---	---	PASS
IFI27L2	83982	broad.mit.edu	37	14	94594942	94594942	+	Silent	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94594942G>C	uc001ycq.2	-	3	164	c.108C>G	c.(106-108)TCC>TCG	p.S36S		NM_032036	NP_114425	Q9H2X8	I27L2_HUMAN	TLH29 protein precursor	36						integral to membrane					0						CTGCTATGGAGGACGCGGCGA	0.637													11	53	---	---	---	---	PASS
SERPINA6	866	broad.mit.edu	37	14	94770791	94770791	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94770791G>T	uc001ycv.2	-	5	1286	c.1182C>A	c.(1180-1182)AGC>AGA	p.S394R	SERPINA6_uc010auv.2_RNA	NM_001756	NP_001747	P08185	CBG_HUMAN	corticosteroid binding globulin precursor	394					regulation of proteolysis|transport	extracellular space	serine-type endopeptidase inhibitor activity|steroid binding			skin(3)|ovary(1)|central_nervous_system(1)	5		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	GGAAAAGGCTGCTCCAGGTGA	0.537													25	117	---	---	---	---	PASS
HHIPL1	84439	broad.mit.edu	37	14	100129256	100129256	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100129256C>A	uc010avs.2	+	6	1611	c.1546C>A	c.(1546-1548)CAG>AAG	p.Q516K	HHIPL1_uc001ygl.1_Missense_Mutation_p.Q516K	NM_001127258	NP_001120730	Q96JK4	HIPL1_HUMAN	HHIP-like protein 1 isoform a	516					carbohydrate metabolic process	extracellular region|membrane	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding|scavenger receptor activity			skin(2)	2		Melanoma(154;0.128)				AGGCCAGTGGCAGTACAGTGA	0.592													38	116	---	---	---	---	PASS
CHP	11261	broad.mit.edu	37	15	41523623	41523623	+	Missense_Mutation	SNP	G	C	C	rs139642745		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41523623G>C	uc001znl.2	+	1	187	c.43G>C	c.(43-45)GAG>CAG	p.E15Q	EXD1_uc001znk.2_5'Flank|EXD1_uc010ucv.1_5'Flank	NM_007236	NP_009167	Q99653	CHP1_HUMAN	calcium binding protein P22	15					potassium ion transport|small GTPase mediated signal transduction		potassium channel regulator activity			ovary(1)	1		all_cancers(109;1.19e-18)|all_epithelial(112;5.87e-16)|Lung NSC(122;8.86e-12)|all_lung(180;2.47e-10)|Melanoma(134;0.0574)|Colorectal(260;0.0946)|Ovarian(310;0.143)		GBM - Glioblastoma multiforme(113;1.68e-06)|LUSC - Lung squamous cell carcinoma(244;0.008)|Lung(196;0.00802)|BRCA - Breast invasive adenocarcinoma(123;0.169)		CGAAGAGCTCGAGGAGATCAA	0.652													2	16	---	---	---	---	PASS
CGNL1	84952	broad.mit.edu	37	15	57730751	57730751	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57730751A>G	uc002aeg.2	+	2	630	c.554A>G	c.(553-555)AAT>AGT	p.N185S	CGNL1_uc010bfw.2_Missense_Mutation_p.N185S	NM_032866	NP_116255	Q0VF96	CGNL1_HUMAN	cingulin-like 1	185	Head.					myosin complex|tight junction	motor activity			skin(6)|ovary(4)|central_nervous_system(1)	11				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		GGCATCAACAATAAGAAGCCT	0.443													61	105	---	---	---	---	PASS
C15orf27	123591	broad.mit.edu	37	15	76496130	76496130	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76496130T>C	uc002bbq.2	+	11	1225	c.1070T>C	c.(1069-1071)ATA>ACA	p.I357T	C15orf27_uc010bkp.2_Missense_Mutation_p.I173T|C15orf27_uc002bbr.2_Missense_Mutation_p.I173T|C15orf27_uc002bbs.2_Missense_Mutation_p.I35T	NM_152335	NP_689548	Q2M3C6	CO027_HUMAN	hypothetical protein LOC123591	357						integral to membrane					0						ACGGCCGCAATAGACATTCAC	0.597													56	107	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86262404	86262404	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86262404G>T	uc002blv.1	+	23	6269	c.6099G>T	c.(6097-6099)CAG>CAT	p.Q2033H	AKAP13_uc002blu.1_Missense_Mutation_p.Q2037H|AKAP13_uc010bnf.1_Missense_Mutation_p.Q654H|AKAP13_uc002blw.1_Missense_Mutation_p.Q498H|AKAP13_uc002blx.1_Missense_Mutation_p.Q278H	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	2033	Interaction with ESR1.|DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						TTGAGCAGCAGATGGTAGAAA	0.483													23	45	---	---	---	---	PASS
CHD2	1106	broad.mit.edu	37	15	93467787	93467787	+	Intron	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93467787C>G	uc002bsp.2	+						CHD2_uc002bsm.1_Intron|CHD2_uc002bsn.2_Intron|CHD2_uc002bso.1_Intron|CHD2_uc010urb.1_Intron	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2						regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			AAGAAGGTATCTACTTTGCCC	0.458													34	47	---	---	---	---	PASS
NME3	4832	broad.mit.edu	37	16	1820909	1820909	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1820909C>T	uc002cmm.2	-	4	540	c.365G>A	c.(364-366)CGC>CAC	p.R122H	NME3_uc010brv.2_RNA|EME2_uc002cmq.1_5'Flank|EME2_uc010brw.1_5'Flank	NM_002513	NP_002504	Q13232	NDK3_HUMAN	nucleoside diphosphate kinase 3	122		ATP (By similarity).			apoptosis|CTP biosynthetic process|GTP biosynthetic process|induction of apoptosis|UTP biosynthetic process		ATP binding|metal ion binding|nucleoside diphosphate kinase activity				0						GAAATCCCCGCGGATGGTGCC	0.726													15	41	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18846334	18846334	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18846334A>G	uc002dfm.2	-	49	8573	c.8210T>C	c.(8209-8211)GTT>GCT	p.V2737A	SMG1_uc010bwb.2_Missense_Mutation_p.V2597A|SMG1_uc010bwa.2_Missense_Mutation_p.V1468A	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	2737					DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						ATCTTCACAAACTGGCACAGT	0.413													66	309	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18870957	18870957	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18870957G>A	uc002dfm.2	-	27	4237	c.3874C>T	c.(3874-3876)CAA>TAA	p.Q1292*	SMG1_uc010bwb.2_Nonsense_Mutation_p.Q1152*|SMG1_uc010bwa.2_Nonsense_Mutation_p.Q23*	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	1292	FAT.|Interaction with SMG8 and SMG9.		Q -> P.		DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						CTTAACAATTGAACTTCAATG	0.373													23	49	---	---	---	---	PASS
TMC7	79905	broad.mit.edu	37	16	19027840	19027840	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19027840C>G	uc002dfq.2	+	3	510	c.380C>G	c.(379-381)TCT>TGT	p.S127C	TMC7_uc010vao.1_Missense_Mutation_p.S127C|TMC7_uc002dfp.2_Missense_Mutation_p.S127C|TMC7_uc010vap.1_Missense_Mutation_p.S17C	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a	127	Extracellular (Potential).					integral to membrane				skin(2)|ovary(1)	3						AGCAGCAAGTCTTGGAAGAGG	0.507													27	53	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	20996734	20996734	+	Missense_Mutation	SNP	C	T	T	rs146558827		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20996734C>T	uc010vbe.1	-	48	7330	c.7330G>A	c.(7330-7332)GCC>ACC	p.A2444T	DNAH3_uc010vbd.1_5'Flank	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2444	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		GACAGTTTGGCGGCACTTTGC	0.527													15	26	---	---	---	---	PASS
ALDOA	226	broad.mit.edu	37	16	30080950	30080950	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30080950C>T	uc002dvw.2	+	10	1883	c.755C>T	c.(754-756)GCG>GTG	p.A252V	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|ALDOA_uc002dvx.2_Missense_Mutation_p.A252V|ALDOA_uc002dvy.2_Missense_Mutation_p.A252V|ALDOA_uc002dvz.2_Missense_Mutation_p.A252V|ALDOA_uc002dwa.3_Missense_Mutation_p.A252V|ALDOA_uc002dwb.1_Missense_Mutation_p.A252V|ALDOA_uc002dwc.2_Missense_Mutation_p.A252V|ALDOA_uc010veg.1_Missense_Mutation_p.A306V|ALDOA_uc002dwd.2_Missense_Mutation_p.A256V	NM_184043	NP_908932	P04075	ALDOA_HUMAN	fructose-bisphosphate aldolase A	252					actin filament organization|ATP biosynthetic process|fructose 1,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|muscle cell homeostasis|platelet activation|platelet degranulation|protein homotetramerization|regulation of cell shape|striated muscle contraction	actin cytoskeleton|cytosol|extracellular vesicular exosome|I band|platelet alpha granule lumen	actin binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding|tubulin binding			lung(1)	1						ATTGCCATGGCGACCGTCACA	0.577											OREG0023729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	62	---	---	---	---	PASS
GPT2	84706	broad.mit.edu	37	16	46943685	46943685	+	Silent	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46943685C>T	uc002eel.2	+	6	760	c.666C>T	c.(664-666)GTC>GTT	p.V222V	GPT2_uc002eem.2_Silent_p.V122V	NM_133443	NP_597700	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase 2 isoform 1	222					2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	ATTCAGCTGTCATCTCTGAGC	0.582													35	118	---	---	---	---	PASS
GFOD2	81577	broad.mit.edu	37	16	67709234	67709234	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67709234C>T	uc002eub.2	-	3	1277	c.982G>A	c.(982-984)GAC>AAC	p.D328N	GFOD2_uc002eua.1_RNA|GFOD2_uc002euc.2_Missense_Mutation_p.D223N	NM_030819	NP_110446	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain	328						proteinaceous extracellular matrix	binding|oxidoreductase activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		GGGGTGCGGTCCCAGGTGCGG	0.667													43	100	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578212G>A	uc002gim.2	-	6	831	c.637C>T	c.(637-639)CGA>TGA	p.R213*	TP53_uc002gig.1_Nonsense_Mutation_p.R213*|TP53_uc002gih.2_Nonsense_Mutation_p.R213*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R81*|TP53_uc010cng.1_Nonsense_Mutation_p.R81*|TP53_uc002gii.1_Nonsense_Mutation_p.R81*|TP53_uc010cnh.1_Nonsense_Mutation_p.R213*|TP53_uc010cni.1_Nonsense_Mutation_p.R213*|TP53_uc002gij.2_Nonsense_Mutation_p.R213*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.R120*|TP53_uc002gio.2_Nonsense_Mutation_p.R81*|TP53_uc010vug.1_Nonsense_Mutation_p.R174*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	213	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R213*(186)|p.R213L(25)|p.R213Q(22)|p.R213fs*34(10)|p.0?(7)|p.R213P(5)|p.R81*(2)|p.R120*(2)|p.R213G(2)|p.K164_P219del(1)|p.D208_V216delDRNTFRHSV(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R213*33(1)|p.D208fs*1(1)|p.R213>L(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ACACTATGTCGAAAAGTGTTT	0.532		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			20	48	---	---	---	---	PASS
NOS2	4843	broad.mit.edu	37	17	26099414	26099414	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26099414G>T	uc002gzu.2	-	14	1888	c.1624C>A	c.(1624-1626)CTC>ATC	p.L542I	NOS2_uc010crh.1_Missense_Mutation_p.L542I|NOS2_uc010wab.1_Missense_Mutation_p.L542I	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	542	Flavodoxin-like.				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	GTCGCAAAGAGGATGGTGACT	0.582													23	57	---	---	---	---	PASS
TMEM132E	124842	broad.mit.edu	37	17	32963126	32963126	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32963126G>A	uc002hif.2	+	9	2136	c.1808G>A	c.(1807-1809)AGC>AAC	p.S603N		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor	603	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		GTGGTGGCCAGCCTGGCCCTC	0.647													9	23	---	---	---	---	PASS
MLLT6	4302	broad.mit.edu	37	17	36873238	36873238	+	Intron	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36873238A>G	uc002hqi.3	+						MLLT6_uc002hqj.2_Intron|MLLT6_uc002hqk.3_5'Flank	NM_005937	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						regulation of transcription, DNA-dependent	nucleus	protein binding|zinc ion binding			breast(3)|prostate(1)|lung(1)|skin(1)	6	Breast(7;4.43e-21)					GGGGCAGGTTAGTGACCCCTG	0.587			T	MLL	AL								15	36	---	---	---	---	PASS
NXPH3	11248	broad.mit.edu	37	17	47656181	47656181	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47656181C>T	uc002ipa.2	+	2	562	c.278C>T	c.(277-279)TCA>TTA	p.S93L	NXPH3_uc010wlw.1_Missense_Mutation_p.S93L	NM_007225	NP_009156	O95157	NXPH3_HUMAN	neurexophilin 3 precursor	93	III.				neuropeptide signaling pathway	extracellular region				pancreas(1)|skin(1)	2	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					CCCCCACCCTCAGCCAAGGTG	0.617													11	42	---	---	---	---	PASS
DGKE	8526	broad.mit.edu	37	17	54926589	54926589	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54926589C>T	uc002iur.2	+	7	1274	c.1094C>T	c.(1093-1095)CCC>CTC	p.P365L	DGKE_uc002ius.1_Missense_Mutation_p.P365L	NM_003647	NP_003638	P52429	DGKE_HUMAN	diacylglycerol kinase epsilon	365					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|phospholipid biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding|protein binding			breast(2)	2	Breast(9;3.59e-07)					TTAAGAAAACCCAAGGTATGT	0.383													11	102	---	---	---	---	PASS
UNK	85451	broad.mit.edu	37	17	73811302	73811302	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73811302G>T	uc002jpm.2	+	8	1157	c.1157G>T	c.(1156-1158)CGA>CTA	p.R386L		NM_001080419	NP_001073888	Q9C0B0	UNK_HUMAN	zinc finger CCCH-type domain containing 5	310	C3H1-type 5.						nucleic acid binding|zinc ion binding				0			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGCTGTCCCCGAGGACCCTTC	0.637													58	168	---	---	---	---	PASS
SEPT9	10801	broad.mit.edu	37	17	75398373	75398373	+	Silent	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75398373G>T	uc002jts.3	+	3	435	c.309G>T	c.(307-309)CCG>CCT	p.P103P	SEPT9_uc010wtk.1_Silent_p.P84P|SEPT9_uc002jtt.3_5'UTR|SEPT9_uc002jtu.3_Silent_p.P85P|SEPT9_uc002jtv.2_Silent_p.P96P|SEPT9_uc002jtw.2_5'UTR|SEPT9_uc002jtx.1_5'UTR|SEPT9_uc010wtl.1_5'Flank	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	septin 9 isoform a	103					cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)			CGGCCGAGCCGGTGTCCCGGC	0.697													3	6	---	---	---	---	PASS
P4HB	5034	broad.mit.edu	37	17	79805231	79805231	+	Intron	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79805231C>A	uc002kbn.1	-						P4HB_uc002kbl.1_5'Flank|P4HB_uc002kbm.1_Intron	NM_000918	NP_000909	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta subunit precursor						cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			AAACTGTGGACAGAAAGAGGG	0.592													17	53	---	---	---	---	PASS
ADCYAP1	116	broad.mit.edu	37	18	909481	909481	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:909481G>A	uc010dkg.2	+	5	495	c.376G>A	c.(376-378)GAG>AAG	p.E126K	ADCYAP1_uc010dkh.2_Missense_Mutation_p.E126K	NM_001099733	NP_001093203	P18509	PACA_HUMAN	adenylate cyclase activating polypeptide	126					activation of adenylate cyclase activity|cell-cell signaling|female pregnancy|nerve growth factor receptor signaling pathway|regulation of G-protein coupled receptor protein signaling pathway	extracellular region|soluble fraction	neuropeptide hormone activity|peptide hormone receptor binding				0						GGACGACGCGGAGCCGCTCTC	0.667													28	62	---	---	---	---	PASS
PIK3C3	5289	broad.mit.edu	37	18	39593460	39593460	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39593460G>A	uc002lap.2	+	11	1283	c.1225G>A	c.(1225-1227)GAT>AAT	p.D409N	PIK3C3_uc010xcl.1_Missense_Mutation_p.D346N	NM_002647	NP_002638	Q8NEB9	PK3C3_HUMAN	catalytic phosphatidylinositol 3-kinase 3	409					cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding			lung(8)|ovary(1)|breast(1)	10						TGAAAATTTTGATGATATAAA	0.313										TSP Lung(28;0.18)			24	260	---	---	---	---	PASS
CCDC11	220136	broad.mit.edu	37	18	47792749	47792749	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47792749A>G	uc002lee.2	-	1	117	c.26T>C	c.(25-27)GTA>GCA	p.V9A		NM_145020	NP_659457	Q96M91	CCD11_HUMAN	coiled-coil domain containing 11	9										ovary(1)|pancreas(1)|skin(1)	3				STAD - Stomach adenocarcinoma(97;2.66e-05)|Colorectal(21;7.57e-05)|Lung(128;0.00932)|READ - Rectum adenocarcinoma(32;0.164)		CTCCCGCTGTACGGTGCCAAA	0.632													37	154	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56274624	56274624	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56274624C>T	uc002lhj.3	-	3	371	c.157G>A	c.(157-159)GAT>AAT	p.D53N		NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	53	Ig-like 1.						ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						CCACTCCCATCGATGGCCTGA	0.373													33	116	---	---	---	---	PASS
PRTN3	5657	broad.mit.edu	37	19	847957	847957	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:847957G>A	uc002lqa.1	+	5	783	c.759G>A	c.(757-759)AAG>AAA	p.K253K		NM_002777	NP_002768	P24158	PRTN3_HUMAN	myeloblastin	253					collagen catabolic process|positive regulation of cell proliferation|proteolysis		protein binding|serine-type endopeptidase activity			ovary(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGAGGCCAAGGGCCGCCCCT	0.662													3	10	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8171120	8171120	+	Intron	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8171120G>T	uc002mjf.2	-							NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						GTCGATGTCTGTCAGGAAGTA	0.587													16	32	---	---	---	---	PASS
RGL3	57139	broad.mit.edu	37	19	11527689	11527689	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11527689G>A	uc002mrp.2	-	3	256	c.192C>T	c.(190-192)AGC>AGT	p.S64S	RGL3_uc002mrn.2_5'UTR|RGL3_uc002mrm.2_5'UTR|RGL3_uc002mro.2_Silent_p.S64S|RGL3_uc002mrq.2_Silent_p.S64S	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation	64					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						CCCTCACCTTGCTGGTTCGAT	0.637													17	28	---	---	---	---	PASS
CACNA1A	773	broad.mit.edu	37	19	13616887	13616887	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13616887G>T	uc010dze.2	-	1	388	c.152C>A	c.(151-153)TCA>TAA	p.S51*	CACNA1A_uc002mwy.3_Nonsense_Mutation_p.S51*	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	51	Cytoplasmic (Potential).				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	CTGCGCCATTGACTGCTTGTA	0.687													5	26	---	---	---	---	PASS
PIK3R2	5296	broad.mit.edu	37	19	18277041	18277041	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18277041G>C	uc002nia.1	+	12	2000	c.1488G>C	c.(1486-1488)CAG>CAC	p.Q496H	PIK3R2_uc002nib.1_RNA|PIK3R2_uc010ebi.1_RNA	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	496					fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)	6						AGCAGGGCCAGACTCAAGAGA	0.567													31	57	---	---	---	---	PASS
LRP3	4037	broad.mit.edu	37	19	33698458	33698458	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33698458G>T	uc010edh.2	+	7	2383	c.2290G>T	c.(2290-2292)GAT>TAT	p.D764Y	LRP3_uc002nuk.3_Missense_Mutation_p.D638Y	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	764	Cytoplasmic (Potential).				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)					GGCCAGCGATGATGAGGCCCT	0.657													11	41	---	---	---	---	PASS
ZNF546	339327	broad.mit.edu	37	19	40519754	40519754	+	Missense_Mutation	SNP	G	A	A	rs144973655		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40519754G>A	uc002oms.2	+	7	833	c.577G>A	c.(577-579)GTT>ATT	p.V193I	ZNF546_uc002omt.2_Missense_Mutation_p.V167I	NM_178544	NP_848639	Q86UE3	ZN546_HUMAN	zinc finger protein 546	193					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GATGGGATGCGTTAGTCAAAT	0.358													30	87	---	---	---	---	PASS
SYT3	84258	broad.mit.edu	37	19	51132654	51132654	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51132654G>A	uc002pst.2	-	4	1812	c.1178C>T	c.(1177-1179)TCG>TTG	p.S393L	SYT3_uc002psv.2_Missense_Mutation_p.S393L|SYT3_uc010ycd.1_Missense_Mutation_p.S393L	NM_032298	NP_115674	Q9BQG1	SYT3_HUMAN	synaptotagmin III	393	C2 1.|Cytoplasmic (Potential).	Calcium 3 (By similarity).				cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|breast(1)	3		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GTCGTGCCGCGAGAAGCGGTC	0.637													24	28	---	---	---	---	PASS
ZNF71	58491	broad.mit.edu	37	19	57133481	57133481	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57133481G>T	uc002qnm.3	+	3	1064	c.826G>T	c.(826-828)GGG>TGG	p.G276W		NM_021216	NP_067039	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	276	C2H2-type 6.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		CCCCGAGTGCGGGCGAGCCTT	0.662													30	33	---	---	---	---	PASS
JAG1	182	broad.mit.edu	37	20	10622443	10622443	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10622443G>A	uc002wnw.2	-	22	3186	c.2670C>T	c.(2668-2670)ATC>ATT	p.I890I	JAG1_uc010gcd.1_Silent_p.I448I	NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor	890	Extracellular (Potential).				angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						TTGAGCAGGCGATCCGTCCAT	0.527									Alagille_Syndrome				25	185	---	---	---	---	PASS
C20orf7	79133	broad.mit.edu	37	20	13782282	13782282	+	Missense_Mutation	SNP	G	A	A	rs149637004		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13782282G>A	uc002wom.2	+	7	703	c.670G>A	c.(670-672)GAC>AAC	p.D224N	C20orf7_uc002wol.1_3'UTR|C20orf7_uc002won.2_Missense_Mutation_p.D196N|C20orf7_uc002woo.2_RNA	NM_024120	NP_077025	Q5TEU4	CT007_HUMAN	hypothetical protein LOC79133 isoform 1	224					mitochondrial respiratory chain complex I assembly	extrinsic to mitochondrial inner membrane	methyltransferase activity				0		Myeloproliferative disorder(85;0.00878)				TGCTGTCAATGACCTGGGACA	0.438													27	101	---	---	---	---	PASS
C20orf160	140706	broad.mit.edu	37	20	30616874	30616874	+	Silent	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30616874G>C	uc002wxf.2	+	7	1159	c.1146G>C	c.(1144-1146)GCG>GCC	p.A382A	C20orf160_uc002wxg.2_5'UTR	NM_080625	NP_542192	Q9NUG4	CT160_HUMAN	hypothetical protein LOC140706	Error:Variant_position_missing_in_Q9NUG4_after_alignment										central_nervous_system(3)|ovary(1)	4						CCACTGCAGCGGCAGCGACCA	0.493													30	226	---	---	---	---	PASS
SLC12A5	57468	broad.mit.edu	37	20	44676612	44676612	+	Intron	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44676612G>A	uc010zxl.1	+						SLC12A5_uc010zxm.1_Intron|SLC12A5_uc002xrb.2_Intron	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride						potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCACTTCCCGGCTCCCAGGGC	0.622													3	30	---	---	---	---	PASS
CEBPB	1051	broad.mit.edu	37	20	48808476	48808476	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48808476G>A	uc002xvi.1	+	1	1101	c.906G>A	c.(904-906)AAG>AAA	p.K302K	CEBPB_uc002xvh.2_RNA	NM_005194	NP_005185	P17676	CEBPB_HUMAN	CCAAT/enhancer binding protein beta	302					acute-phase response|immune response		sequence-specific enhancer binding RNA polymerase II transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(9;5.72e-08)|STAD - Stomach adenocarcinoma(23;0.19)			CGCAGCACAAGGTCCTGGAGC	0.637													11	39	---	---	---	---	PASS
KRTAP13-1	140258	broad.mit.edu	37	21	31768611	31768611	+	Silent	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31768611C>T	uc002yoa.2	+	1	220	c.207C>T	c.(205-207)TCC>TCT	p.S69S		NM_181599	NP_853630	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	69	3.|5 X 10 AA approximate repeats.					intermediate filament				ovary(1)	1						GCCAGACATCCTATGTGGAGT	0.602													28	39	---	---	---	---	PASS
KRTAP13-1	140258	broad.mit.edu	37	21	31768915	31768915	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31768915T>C	uc002yoa.2	+	1	524	c.511T>C	c.(511-513)TAC>CAC	p.Y171H		NM_181599	NP_853630	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	171						intermediate filament				ovary(1)	1						ATCAGGCTTCTACTATTGATC	0.443													11	31	---	---	---	---	PASS
SIK1	150094	broad.mit.edu	37	21	44837498	44837498	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44837498C>T	uc002zdf.2	-	13	2028	c.1901G>A	c.(1900-1902)AGC>AAC	p.S634N		NM_173354	NP_775490	P57059	SIK1_HUMAN	salt-inducible kinase 1	634					anoikis|cell cycle|cell differentiation|intracellular protein kinase cascade|multicellular organismal development|regulation of cell differentiation|regulation of mitotic cell cycle	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(2)|testis(2)|ovary(1)|central_nervous_system(1)|skin(1)	7						CAGGCCTGGGCTCTGTGCAGG	0.736													4	10	---	---	---	---	PASS
RRP1	8568	broad.mit.edu	37	21	45217800	45217800	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45217800G>T	uc002zds.2	+	8	723	c.630G>T	c.(628-630)TTG>TTT	p.L210F	RRP1_uc011aez.1_Missense_Mutation_p.L210F|RRP1_uc010gpk.1_Missense_Mutation_p.L60F|RRP1_uc010gpl.1_Missense_Mutation_p.L108F|RRP1_uc010gpm.1_Missense_Mutation_p.L77F	NM_003683	NP_003674	P56182	RRP1_HUMAN	ribosomal RNA processing 1 homolog	210					rRNA processing	nucleolus|preribosome, small subunit precursor					0				COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)		CCTTGGTTTTGAACAACATCA	0.582													3	51	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47783431	47783431	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47783431C>G	uc002zji.3	+	14	2298	c.2191C>G	c.(2191-2193)CTA>GTA	p.L731V	PCNT_uc002zjj.2_Missense_Mutation_p.L613V	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	731	Glu-rich.|Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					CCAGAAGGAACTAAATAATGC	0.383													46	123	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21082056	21082056	+	Intron	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21082056C>T	uc002zsz.3	-						PI4KA_uc002zsy.3_Intron	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha						phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			ACGTGGGCTACACTACCTTGA	0.502													23	68	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26304368	26304368	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26304368T>C	uc003abz.1	+	32	5478	c.5228T>C	c.(5227-5229)CTG>CCG	p.L1743P	MYO18B_uc003aca.1_Missense_Mutation_p.L1624P|MYO18B_uc010guy.1_Missense_Mutation_p.L1625P|MYO18B_uc010guz.1_Missense_Mutation_p.L1623P|MYO18B_uc011aka.1_Missense_Mutation_p.L897P|MYO18B_uc011akb.1_Missense_Mutation_p.L1256P	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1743	Potential.|Tail.|Gln-rich.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						GAGGAGGAACTGGAGGATGTC	0.602													4	5	---	---	---	---	PASS
MEI1	150365	broad.mit.edu	37	22	42166741	42166741	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42166741C>A	uc003baz.1	+	20	2345	c.2320C>A	c.(2320-2322)CTA>ATA	p.L774I	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc011apd.1_RNA|MEI1_uc003bbb.1_Missense_Mutation_p.L160I|MEI1_uc003bbc.1_Missense_Mutation_p.L142I|MEI1_uc010gym.1_Missense_Mutation_p.L142I|MEI1_uc003bbd.1_Missense_Mutation_p.L17I	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1	774							binding			central_nervous_system(1)|skin(1)	2						AGACCTGCAGCTAGTCTATAC	0.483													3	53	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	31341742	31341742	+	Missense_Mutation	SNP	G	A	A	rs128626254		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31341742G>A	uc004dda.1	-	62	9441	c.9197C>T	c.(9196-9198)TCG>TTG	p.S3066L	DMD_uc004dcq.1_Missense_Mutation_p.S337L|DMD_uc004dcr.1_Missense_Mutation_p.S606L|DMD_uc004dcs.1_Missense_Mutation_p.S606L|DMD_uc004dct.1_Missense_Mutation_p.S606L|DMD_uc004dcu.1_Missense_Mutation_p.S606L|DMD_uc004dcv.1_Missense_Mutation_p.S606L|DMD_uc004dcw.2_Missense_Mutation_p.S1722L|DMD_uc004dcx.2_Missense_Mutation_p.S1725L|DMD_uc004dcz.2_Missense_Mutation_p.S2943L|DMD_uc004dcy.1_Missense_Mutation_p.S3062L|DMD_uc004ddb.1_Missense_Mutation_p.S3058L	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	3066	Interaction with SYNM (By similarity).|WW.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTTGTTTGGCGAGATGGCTCT	0.403													20	28	---	---	---	---	PASS
PIM2	11040	broad.mit.edu	37	X	48775922	48775922	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48775922C>A	uc004dls.2	-	2	364	c.62G>T	c.(61-63)GGA>GTA	p.G21V		NM_006875	NP_006866	Q9P1W9	PIM2_HUMAN	serine/threonine protein kinase pim-2	21					anti-apoptosis|cell proliferation|male meiosis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|response to virus		ATP binding|protein serine/threonine kinase activity			lung(3)|stomach(1)	4						ATCCTTGCCTCCTACGCAGGC	0.677													3	24	---	---	---	---	PASS
AR	367	broad.mit.edu	37	X	66943546	66943546	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66943546C>A	uc004dwu.1	+	8	3741	c.2626C>A	c.(2626-2628)CAG>AAG	p.Q876K	AR_uc004dwv.1_Missense_Mutation_p.Q344K	NM_000044	NP_000035	P10275	ANDR_HUMAN	androgen receptor isoform 1	875	Ligand-binding.|Interaction with MYST2.				cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)	AGAGCTGCATCAGTTCACTTT	0.483									Androgen_Insensitivity_Syndrome				71	72	---	---	---	---	PASS
PHKA1	5255	broad.mit.edu	37	X	71932781	71932781	+	Splice_Site	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71932781T>C	uc004eax.3	-	2	380	c.79_splice	c.e2-1	p.N27_splice	PHKA1_uc004eay.3_Splice_Site_p.N27_splice|PHKA1_uc011mqi.1_Splice_Site_p.N27_splice	NM_002637	NP_002628	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle) isoform						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)|skin(1)	4	Renal(35;0.156)					CACTGGATTCTGCAAGGTCAA	0.463													14	13	---	---	---	---	PASS
MAGEE2	139599	broad.mit.edu	37	X	75003366	75003366	+	Missense_Mutation	SNP	C	A	A	rs150153753	byFrequency	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75003366C>A	uc004ecj.1	-	1	1706	c.1521G>T	c.(1519-1521)GAG>GAT	p.E507D		NM_138703	NP_619648	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	507										ovary(1)|skin(1)	2						TGGCTCTGGCCTCCTCATCTT	0.458													23	30	---	---	---	---	PASS
ARHGEF6	9459	broad.mit.edu	37	X	135758808	135758808	+	Silent	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135758808C>T	uc004fab.2	-	18	2382	c.1920G>A	c.(1918-1920)TCG>TCA	p.S640S	ARHGEF6_uc011mwd.1_Silent_p.S513S|ARHGEF6_uc011mwe.1_Silent_p.S486S	NM_004840	NP_004831	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor 6	640					apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)					ATTCCTCCTCCGATGGTTTTC	0.323													25	47	---	---	---	---	PASS
SPANXN2	494119	broad.mit.edu	37	X	142795447	142795447	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142795447G>A	uc004fbz.2	-	2	985	c.231C>T	c.(229-231)TCC>TCT	p.S77S		NM_001009615	NP_001009615	Q5MJ10	SPXN2_HUMAN	SPANX-N2 protein	77										ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					CGGGATTGATGGAGTTCTCTC	0.438													66	166	---	---	---	---	PASS
TSPY2	64591	broad.mit.edu	37	Y	6115610	6115610	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:6115610A>G	uc004fqr.1	+	3	618	c.572A>G	c.(571-573)GAA>GGA	p.E191G	TSPY2_uc004fqs.1_Missense_Mutation_p.E191G	NM_022573	NP_072095	A6NKD2	TSPY2_HUMAN	testis specific protein, Y-linked 2	191					cell differentiation|gonadal mesoderm development|nucleosome assembly|spermatogenesis	cytoplasm|nucleus					0						CAGGTGGAAGAAGAGAAGCAT	0.448													25	105	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	41730645	41730645	+	IGR	DEL	T	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41730645delT								SCMH1 (22857 upstream) : EDN2 (213804 downstream)																							TCTGAGCTGCttttttttttt	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148855788	148855788	+	IGR	DEL	G	-	-	rs56347163		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148855788delG								NBPF16 (97477 upstream) : LOC645166 (72498 downstream)																							ccgcggcggcggggggggcgg	0.388													4	2	---	---	---	---	
HIST2H3C	126961	broad.mit.edu	37	1	149821913	149821916	+	5'Flank	DEL	GGAG	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149821913_149821916delGGAG	uc001esy.2	+						HIST2H2AA3_uc001esx.2_5'Flank	NM_021059	NP_066403	Q71DI3	H32_HUMAN	histone cluster 2, H3c						blood coagulation|nucleosome assembly	nucleoplasm|nucleosome	DNA binding|protein binding				0	Breast(34;0.0124)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.221)			GGCGACCCGCggagggagggaggg	0.490													5	3	---	---	---	---	
C1orf21	81563	broad.mit.edu	37	1	184528723	184528724	+	Intron	INS	-	CCTT	CCTT	rs141160537	by1000genomes	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184528723_184528724insCCTT	uc001gqv.1	+							NM_030806	NP_110433	Q9H246	CA021_HUMAN	chromosome 1 open reading frame 21												0		Breast(1374;0.00262)		Colorectal(1306;4.8e-08)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)		ctctcttcctcccttccttcct	0.010													6	3	---	---	---	---	
FMN2	56776	broad.mit.edu	37	1	240601268	240601268	+	Intron	DEL	C	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240601268delC	uc010pyd.1	+						FMN2_uc010pye.1_Intron|FMN2_uc010pyg.1_Intron	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AATAATTGTGCATGAATAAAA	0.363													55	25	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	243251423	243251423	+	RNA	DEL	A	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243251423delA	uc001hzq.1	-	8		c.1209delT								Homo sapiens cDNA FLJ52610 complete cds.																		actccatctcaaaaaaaaaaa	0.179													6	3	---	---	---	---	
HEATR5B	54497	broad.mit.edu	37	2	37277042	37277042	+	Intron	DEL	T	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37277042delT	uc002rpp.1	-							NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				ATTATTATTAtttttttttta	0.134													6	3	---	---	---	---	
ZNF35	7584	broad.mit.edu	37	3	44693999	44694000	+	Intron	DEL	CT	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44693999_44694000delCT	uc003cnq.2	+						ZNF35_uc003cnr.2_Intron	NM_003420	NP_003411	P13682	ZNF35_HUMAN	zinc finger protein 35						cellular response to retinoic acid|spermatogenesis	nucleus|perinuclear region of cytoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(412;0.0228)		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)		TGTAACCACACTACCCCCTACC	0.446													246	109	---	---	---	---	
SHQ1	55164	broad.mit.edu	37	3	72841935	72841936	+	Intron	INS	-	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72841935_72841936insA	uc003dpf.2	-						SHQ1_uc010hod.2_Intron	NM_018130	NP_060600	Q6PI26	SHQ1_HUMAN	SHQ1 homolog						ribonucleoprotein complex assembly	cytosol|nucleoplasm	protein binding			ovary(2)|large_intestine(1)	3		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		acctccatctcaaaaaaaaaaa	0.139													6	3	---	---	---	---	
CRYBG3	131544	broad.mit.edu	37	3	97605803	97605804	+	Intron	INS	-	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97605803_97605804insT	uc003drx.2	+							NM_153605	NP_705833			beta-gamma crystallin domain containing 3												0						CAGGTATAGAATTCTGAGATGT	0.361													5	6	---	---	---	---	
IFT122	55764	broad.mit.edu	37	3	129178588	129178591	+	Intron	DEL	CTTC	-	-	rs113395513		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129178588_129178591delCTTC	uc003emm.2	+						IFT122_uc003eml.2_Intron|IFT122_uc003emn.2_Intron|IFT122_uc003emo.2_Intron|IFT122_uc003emp.2_Intron|IFT122_uc010htc.2_Intron|IFT122_uc011bky.1_Intron|IFT122_uc003emq.2_Intron|IFT122_uc011bkx.1_Intron|IFT122_uc011bkz.1_5'Flank	NM_052989	NP_443715	Q9HBG6	IF122_HUMAN	WD repeat domain 10 isoform 2						camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				ovary(1)|skin(1)	2						tccctcccttcttccttccttcct	0.010													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180863907	180863907	+	IGR	DEL	A	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180863907delA								DNAJC19 (156377 upstream) : SOX2OT (417602 downstream)																							tagaaaatccaaaaaaaaaaa	0.005													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38735141	38735143	+	IGR	DEL	TGT	-	-	rs60307444		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38735141_38735143delTGT								KLF3 (32013 upstream) : TLR10 (39120 downstream)																							gtggtggtggtgttggtgttggt	0.000													4	4	---	---	---	---	
UGDH	7358	broad.mit.edu	37	4	39507525	39507525	+	Intron	DEL	A	-	-	rs35867925		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39507525delA	uc003guk.1	-						UGDH_uc011byp.1_Intron|UGDH_uc003gul.1_Intron	NM_003359	NP_003350	O60701	UGDH_HUMAN	UDP-glucose dehydrogenase						glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4					NADH(DB00157)	CCTATGGATTAAAAAAAAAAA	0.229													6	3	---	---	---	---	
OCIAD1	54940	broad.mit.edu	37	4	48859542	48859543	+	Intron	INS	-	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48859542_48859543insT	uc003gyo.2	+						OCIAD1_uc003gyr.2_Intron|OCIAD1_uc003gyp.2_Intron|OCIAD1_uc003gys.2_Intron|OCIAD1_uc003gyq.2_Intron|OCIAD1_uc010igk.2_Intron	NM_017830	NP_060300	Q9NX40	OCAD1_HUMAN	OCIA domain containing 1 isoform 1							endosome	protein binding				0						GTTATCAGttcttttttttttt	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53429800	53429801	+	IGR	INS	-	GAAG	GAAG	rs56736867		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53429800_53429801insGAAG								SPATA18 (466343 upstream) : USP46 (27328 downstream)																							aaggaaggaaggaaaggaaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	72742235	72742238	+	IGR	DEL	TCCT	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72742235_72742238delTCCT								GC (72477 upstream) : NPFFR2 (155283 downstream)																							ccttccttcctcctttccttcctt	0.000													5	3	---	---	---	---	
BMPR1B	658	broad.mit.edu	37	4	95883224	95883231	+	Intron	DEL	TTCCTTCC	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95883224_95883231delTTCCTTCC	uc003htm.3	+							NM_001203	NP_001194	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB						BMP signaling pathway|cartilage condensation|eye development|limb morphogenesis|ovarian cumulus expansion|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	receptor complex	ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta receptor activity			lung(4)|skin(2)|stomach(1)|breast(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		tttcttttctttccttccttccttcctt	0.000													3	6	---	---	---	---	
MAP9	79884	broad.mit.edu	37	4	156274607	156274609	+	Intron	DEL	ATT	-	-	rs33994283		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156274607_156274609delATT	uc003ios.2	-						MAP9_uc011cin.1_Intron|MAP9_uc010iqa.1_Intron|MAP9_uc003iot.1_Intron	NM_001039580	NP_001034669	Q49MG5	MAP9_HUMAN	aster-associated protein						cell division|mitosis	cytoplasm|microtubule|spindle				ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		TCTGATATTCATTATACTTAGAA	0.167													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	15005630	15005637	+	IGR	DEL	CCTGCCTT	-	-	rs13178306	by1000genomes	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15005630_15005637delCCTGCCTT								ANKH (133743 upstream) : FBXL7 (494668 downstream)																							tgcctgcctgcctgccttccttccttcc	0.005													2	5	---	---	---	---	
C5orf42	65250	broad.mit.edu	37	5	37210166	37210167	+	Intron	INS	-	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37210166_37210167insA	uc011cpa.1	-						C5orf42_uc003jks.2_Intron|C5orf42_uc011coz.1_Intron|C5orf42_uc011cpb.1_Intron	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250											ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			AAAATGGAAGCAAAAAAAAAGT	0.337													49	26	---	---	---	---	
SLC35B3	51000	broad.mit.edu	37	6	8419695	8419695	+	Intron	DEL	C	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8419695delC	uc010joe.2	-						SLC35B3_uc003mya.2_Intron|SLC35B3_uc003myc.2_Intron|SLC35B3_uc003myb.2_Intron|SLC35B3_uc011did.1_Intron|SLC35B3_uc003myd.2_Intron	NM_001142541	NP_001136013	Q9H1N7	S35B3_HUMAN	solute carrier family 35, member B3						transmembrane transport	Golgi membrane|integral to membrane					0	Ovarian(93;0.0569)					GAATGTATTACTTTTGTAAAA	0.264													8	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	40357493	40357493	+	IGR	DEL	A	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40357493delA								TDRG1 (9862 upstream) : LRFN2 (1880 downstream)																							agagaagaggaaaaaacagga	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	113527049	113527050	+	IGR	INS	-	CTCCT	CTCCT			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:113527049_113527050insCTCCT								RFPL4B (854551 upstream) : MARCKS (651477 downstream)																							ttccttcctccctcctctcctc	0.158													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	150825358	150825358	+	IGR	DEL	A	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150825358delA								IYD (99594 upstream) : PLEKHG1 (95641 downstream)																							CCCTTTTAAGAAAAAAAAAAC	0.194													4	2	---	---	---	---	
GBAS	2631	broad.mit.edu	37	7	56052411	56052412	+	Intron	DEL	AA	-	-	rs34985300		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56052411_56052412delAA	uc003tre.1	+						GBAS_uc003trf.1_Intron	NM_001483	NP_001474	O75323	NIPS2_HUMAN	nipsnap homolog 2							integral to plasma membrane|membrane fraction|mitochondrion	protein binding			central_nervous_system(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			attctgtctcaaaaaaaaaaaa	0.114													4	5	---	---	---	---	
SPDYE7P	441251	broad.mit.edu	37	7	72333390	72333390	+	RNA	DEL	C	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72333390delC	uc010lal.1	-	1		c.6266delG				NR_003666				Homo sapiens speedy homolog E7 (Xenopus laevis), pseudogene (SPDYE7P), non-coding RNA.												0						AAGGACCCCACCCCCCTCCCC	0.493													38	36	---	---	---	---	
CADPS2	93664	broad.mit.edu	37	7	122111296	122111296	+	Intron	DEL	T	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122111296delT	uc010lkp.2	-						CADPS2_uc011knx.1_Intron|CADPS2_uc003vkg.3_Intron|CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						TTCTCTGTCGTTTTTTTTTTT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	125460585	125460585	+	IGR	DEL	G	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125460585delG								POT1 (890548 upstream) : GRM8 (618067 downstream)																							gaggaaggaaggaaggaagga	0.010													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	128104748	128104751	+	IGR	DEL	AGGA	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128104748_128104751delAGGA								C7orf68 (6277 upstream) : METTL2B (12032 downstream)																							gaaggaaggtaggaaggaaggaag	0.010													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	130459233	130459233	+	IGR	DEL	C	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130459233delC								KLF14 (40373 upstream) : MIR29A (102273 downstream)																							tcttccccttcccctcctcct	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	36428695	36428698	+	IGR	DEL	GTGT	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36428695_36428698delGTGT								UNC5D (776515 upstream) : KCNU1 (213144 downstream)																							TAAATGCACAgtgtgtgtgtgtgt	0.250													4	2	---	---	---	---	
TACC1	6867	broad.mit.edu	37	8	38656125	38656126	+	Intron	DEL	GT	-	-	rs144365251		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38656125_38656126delGT	uc010lwp.2	+						TACC1_uc011lby.1_Intron|TACC1_uc003xma.2_Intron|TACC1_uc003xlz.2_Intron|TACC1_uc003xmc.3_Intron|TACC1_uc011lbz.1_Intron|TACC1_uc003xmb.3_Intron|TACC1_uc003xme.1_Intron|TACC1_uc003xmd.1_Intron|TACC1_uc010lwo.1_Intron|TACC1_uc003xmf.3_Intron|TACC1_uc011lca.1_Intron|TACC1_uc011lcb.1_Intron	NM_006283	NP_006274	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing						cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			TGGGTTCtgcgtgtgtgtgtgt	0.332													4	4	---	---	---	---	
UBE2W	55284	broad.mit.edu	37	8	74782628	74782628	+	Intron	DEL	A	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74782628delA	uc003xzv.2	-						UBE2W_uc003xzt.2_Intron|UBE2W_uc003xzu.2_Intron|UBE2W_uc003xzw.2_Intron	NM_018299	NP_060769	Q96B02	UBE2W_HUMAN	ubiquitin-conjugating enzyme E2W (putative)						protein K11-linked ubiquitination|protein monoubiquitination		ATP binding|protein binding|ubiquitin-protein ligase activity				0	Breast(64;0.0311)		Epithelial(68;0.0235)|all cancers(69;0.0687)|BRCA - Breast invasive adenocarcinoma(89;0.069)			TAGAAATCAGAAAAAAAAAAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	110948437	110948440	+	IGR	DEL	AGGA	-	-	rs147604132	by1000genomes	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110948437_110948440delAGGA								SYBU (244417 upstream) : KCNV1 (30795 downstream)																							ggagggagggaggaaggaaggaag	0.103													6	6	---	---	---	---	
DENND1A	57706	broad.mit.edu	37	9	126220283	126220284	+	Intron	INS	-	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126220283_126220284insT	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						ttttcttttccttttttttttt	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	10122369	10122372	+	IGR	DEL	TGTG	-	-	rs112177808		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10122369_10122372delTGTG								None (None upstream) : SFTA1P (704030 downstream)																							tgtgtgtgtttgtgtgtgtgtgtg	0.314													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	4895796	4895797	+	IGR	DEL	GT	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4895796_4895797delGT								OR51S1 (25358 upstream) : OR51T1 (7252 downstream)																							tggtgtgttggtgtgtgtgtgt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	104109887	104109888	+	IGR	INS	-	TTCT	TTCT			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104109887_104109888insTTCT								PDGFD (74860 upstream) : CASP12 (646554 downstream)																							tccttccttccttccttccttc	0.040													8	4	---	---	---	---	
TMPRSS13	84000	broad.mit.edu	37	11	117772788	117772789	+	3'UTR	DEL	CA	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117772788_117772789delCA	uc001prs.1	-	13					TMPRSS13_uc009yzr.1_3'UTR	NM_001077263	NP_001070731	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13						proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			pancreas(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		cacacatatgcacacacacaca	0.416													4	2	---	---	---	---	
PPHLN1	51535	broad.mit.edu	37	12	42692995	42692996	+	Intron	INS	-	A	A	rs5797787		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42692995_42692996insA	uc001rmy.2	+							NM_201439	NP_958847	Q8NEY8	PPHLN_HUMAN	periphilin 1 isoform 3						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		aagactctgtcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
LOC284232	284232	broad.mit.edu	37	13	19420047	19420053	+	RNA	DEL	TTCGTAT	-	-	rs117180361	by1000genomes	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19420047_19420053delTTCGTAT	uc010tcj.1	-	1		c.26057_26063delATACGAA				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						ATAACATTTCTTCGTATTTTATATTTT	0.246													3	3	---	---	---	---	
NHLRC3	387921	broad.mit.edu	37	13	39618216	39618217	+	Intron	INS	-	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39618216_39618217insC	uc001uxc.2	+						NHLRC3_uc001uxb.1_Intron|NHLRC3_uc001uxd.2_Intron|NHLRC3_uc001uxe.2_Intron	NM_001012754	NP_001012772	Q5JS37	NHLC3_HUMAN	NHL repeat containing 3 isoform a							extracellular region				skin(1)	1		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;2.37e-08)|Epithelial(112;3.14e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00101)|BRCA - Breast invasive adenocarcinoma(63;0.00335)|GBM - Glioblastoma multiforme(144;0.0128)		ATATATTTTTACCGTTTATAGA	0.376													204	116	---	---	---	---	
LCP1	3936	broad.mit.edu	37	13	46716269	46716269	+	Intron	DEL	A	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46716269delA	uc001vaz.3	-						LCP1_uc010ack.2_Intron|LCP1_uc001vay.3_Intron|LCP1_uc001vba.3_Intron	NM_002298	NP_002289	P13796	PLSL_HUMAN	L-plastin						regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding			lung(4)|ovary(3)	7		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		gataggactgaaaaaaaaaaA	0.134			T	BCL6	NHL 								9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	43769943	43769943	+	IGR	DEL	T	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43769943delT								None (None upstream) : None (None downstream)																							TGTGGGTTGATTTTTTTTTCT	0.328													5	3	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48054097	48054099	+	Intron	DEL	AAG	-	-	rs149404019		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48054097_48054099delAAG	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvx.1_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TTTCCAAAAAAAGAAGAAATTAA	0.291													2	6	---	---	---	---	
IQCH	64799	broad.mit.edu	37	15	67553431	67553432	+	Intron	INS	-	A	A	rs11380255		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67553431_67553432insA	uc002aqo.1	+						IQCH_uc010ujv.1_Intron|IQCH_uc002aqn.1_Intron|IQCH_uc002aqq.1_Intron|IQCH_uc002aqp.1_Intron|IQCH_uc002aqm.2_Intron	NM_001031715	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H isoform 1											skin(3)|ovary(1)	4				Colorectal(3;0.0856)		aattccatctcaaaaaaaaaaa	0.149													5	3	---	---	---	---	
RGMA	56963	broad.mit.edu	37	15	93616283	93616284	+	Intron	INS	-	AGG	AGG	rs142070156	by1000genomes	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93616283_93616284insAGG	uc002bss.1	-						RGMA_uc002bsq.1_5'UTR|RGMA_uc010boi.1_Intron|RGMA_uc002bsr.1_Intron|RGMA_uc010urc.1_Intron	NM_020211	NP_064596	Q96B86	RGMA_HUMAN	RGM domain family, member A precursor						axon guidance	anchored to membrane|endoplasmic reticulum|plasma membrane					0	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			TTCAGAAAAAAAGAAGAAAATA	0.535													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98845069	98845070	+	IGR	INS	-	GAGGAGGAA	GAGGAGGAA	rs141877439	by1000genomes	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98845069_98845070insGAGGAGGAA								ARRDC4 (328002 upstream) : FAM169B (135321 downstream)																							aggaggaagaggaggaggagga	0.129													4	4	---	---	---	---	
ZZEF1	23140	broad.mit.edu	37	17	3967494	3967494	+	Intron	DEL	A	-	-	rs112787658		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3967494delA	uc002fxe.2	-						ZZEF1_uc002fxh.2_5'Flank|ZZEF1_uc002fxi.2_Intron|ZZEF1_uc002fxj.1_Intron	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1								calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TTCTTTAAAGAAAAAAAAAAA	0.149													6	4	---	---	---	---	
MYH13	8735	broad.mit.edu	37	17	10277810	10277811	+	5'Flank	INS	-	CTTC	CTTC	rs78781642	by1000genomes	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10277810_10277811insCTTC	uc002gmk.1	-							NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle						muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						AAGTATTTTCTcttccttcctt	0.188													4	4	---	---	---	---	
APOH	350	broad.mit.edu	37	17	64217500	64217507	+	Intron	DEL	AGGAAGGA	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64217500_64217507delAGGAAGGA	uc002jfn.3	-							NM_000042	NP_000033	P02749	APOH_HUMAN	apolipoprotein H precursor						blood coagulation, intrinsic pathway|negative regulation of angiogenesis|negative regulation of blood coagulation|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of myeloid cell apoptosis|negative regulation of smooth muscle cell apoptosis|plasminogen activation|positive regulation of lipoprotein lipase activity|triglyceride metabolic process|triglyceride transport	cell surface|chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	eukaryotic cell surface binding|glycoprotein binding|heparin binding|lipoprotein lipase activator activity|phospholipid binding				0			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			ggagggagggaggaaggaaggaaggaag	0.101													6	4	---	---	---	---	
EXOC7	23265	broad.mit.edu	37	17	74090830	74090830	+	Intron	DEL	T	-	-	rs35625794		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74090830delT	uc002jqs.2	-						EXOC7_uc010dgv.1_Intron|EXOC7_uc002jqq.2_Intron|EXOC7_uc010wsw.1_Intron|EXOC7_uc010wsx.1_Intron|EXOC7_uc002jqr.2_Intron|EXOC7_uc010wsv.1_Intron|EXOC7_uc002jqu.2_Intron	NM_001145297	NP_001138769	Q9UPT5	EXOC7_HUMAN	exocyst complex component 7 isoform 4						exocytosis|protein transport	centriolar satellite|cytosol|exocyst|plasma membrane	protein binding				0			LUSC - Lung squamous cell carcinoma(166;0.187)			TTTCAAAGtcttttttttttt	0.234													5	5	---	---	---	---	
SF3A2	8175	broad.mit.edu	37	19	2248165	2248185	+	In_Frame_Del	DEL	CCAGCCCCCGGGGTTCACCCA	-	-	rs144349304		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2248165_2248185delCCAGCCCCCGGGGTTCACCCA	uc002lvg.2	+	9	1137_1157	c.1015_1035delCCAGCCCCCGGGGTTCACCCA	c.(1015-1035)CCAGCCCCCGGGGTTCACCCAdel	p.PAPGVHP360del	AMH_uc002lvh.2_5'Flank|hsa-mir-4321|MI0015852_5'Flank	NM_007165	NP_009096	Q15428	SF3A2_HUMAN	splicing factor 3a, subunit 2	360_366	Pro-rich.				nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex	nucleic acid binding|zinc ion binding				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTCCACCCTCCAGCCCCCGGGGTTCACCCACCAGCCCCCG	0.742													3	4	---	---	---	---	
ARRDC5	645432	broad.mit.edu	37	19	4903042	4903042	+	5'Flank	DEL	T	-	-	rs150232990		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4903042delT	uc002mbm.2	-							NM_001080523	NP_001073992	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5						signal transduction						0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		TCACTGGttcttttttttttt	0.279													4	2	---	---	---	---	
SAFB	6294	broad.mit.edu	37	19	5667205	5667205	+	Intron	DEL	C	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5667205delC	uc002mcf.2	+						SAFB_uc002mcg.2_Intron|SAFB_uc002mce.3_Intron|SAFB_uc010xir.1_Intron|SAFB_uc010xis.1_Intron|SAFB_uc010xit.1_Intron|SAFB_uc010xiu.1_Intron	NM_002967	NP_002958	Q15424	SAFB1_HUMAN	scaffold attachment factor B						chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding			ovary(1)|liver(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		CAGTACCTGACCCCCCCCCCG	0.657													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36522208	36522211	+	IGR	DEL	TCCC	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36522208_36522211delTCCC								CTNNBL1 (21689 upstream) : VSTM2L (9288 downstream)																							cttccttccttccctccttccttc	0.054													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11085461	11085462	+	Intron	INS	-	AAA	AAA	rs10446207	by1000genomes	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085461_11085462insAAA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ccatcaccactaccactaccac	0.069													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40499414	40499415	+	IGR	INS	-	T	T	rs147438953	by1000genomes	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40499414_40499415insT								ETS2 (302538 upstream) : PSMG1 (47975 downstream)																							Ttttttttttgttttgttttgt	0.307													4	2	---	---	---	---	
PRDM15	63977	broad.mit.edu	37	21	43226471	43226479	+	Intron	DEL	CACCACCAT	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43226471_43226479delCACCACCAT	uc002yzq.1	-						PRDM15_uc002yzo.2_Intron|PRDM15_uc002yzp.2_Intron|PRDM15_uc002yzr.1_Intron	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ccatcaccaccaccaccatcaccaccacc	0.000													4	2	---	---	---	---	
DGCR2	9993	broad.mit.edu	37	22	19055488	19055488	+	Intron	DEL	C	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19055488delC	uc002zoq.1	-						DGCR2_uc002zor.1_Intron|DGCR2_uc011agr.1_Intron	NM_005137	NP_005128	P98153	IDD_HUMAN	integral membrane protein DGCR2 precursor						cell adhesion|organ morphogenesis	integral to membrane	receptor activity|sugar binding			large_intestine(1)	1	Colorectal(54;0.0993)					CTCATTCATTCCCCTCACTGG	0.602													12	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	95046560	95046563	+	IGR	DEL	GGAA	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:95046560_95046563delGGAA								MIR548M (728335 upstream) : LOC643486 (545523 downstream)																							agggagggatggaaggaaggaagg	0.103													4	2	---	---	---	---	
TSPAN6	7105	broad.mit.edu	37	X	99887403	99887403	+	Intron	DEL	A	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99887403delA	uc004ega.1	-						TSPAN6_uc010nna.1_Intron	NM_003270	NP_003261	O43657	TSN6_HUMAN	transmembrane 4 superfamily member 6						positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	signal transducer activity			ovary(1)	1						actccatctcaaaaaaaaaaa	0.159													6	3	---	---	---	---	
ARHGAP36	158763	broad.mit.edu	37	X	130219333	130219333	+	Intron	DEL	A	-	-			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130219333delA	uc004evz.2	+						ARHGAP36_uc004ewa.2_Intron|ARHGAP36_uc004ewb.2_Intron|ARHGAP36_uc004ewc.2_Intron	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN	hypothetical protein LOC158763 precursor						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3						CTCTCAGGTCAAAAAAAAAAA	0.393													4	3	---	---	---	---	
