Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ALDH4A1	8659	broad.mit.edu	37	1	19212114	19212114	+	Silent	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19212114G>C	uc001bbb.2	-	5	582	c.306C>G	c.(304-306)CTC>CTG	p.L102L	ALDH4A1_uc010ocu.1_Silent_p.L42L|ALDH4A1_uc001bbc.2_Silent_p.L102L	NM_170726	NP_733844	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4A1 isoform a precursor	102					proline biosynthetic process|proline catabolic process	mitochondrial matrix	1-pyrroline-5-carboxylate dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|electron carrier activity				0		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	NADH(DB00157)	TGGCTTTGTTGAGCAGGCTCT	0.622													9	35	---	---	---	---	PASS
KDM1A	23028	broad.mit.edu	37	1	23395630	23395630	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23395630G>T	uc001bgi.2	+	10	1476	c.1327G>T	c.(1327-1329)GAA>TAA	p.E443*	KDM1A_uc001bgj.2_Nonsense_Mutation_p.E467*	NM_015013	NP_055828	O60341	KDM1A_HUMAN	lysine-specific histone demethylase 1 isoform b	443	Potential.|Demethylase activity.				blood coagulation|muscle cell development|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of protein binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nuclear chromatin	androgen receptor binding|chromatin binding|enzyme binding|flavin adenine dinucleotide binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-K9 specific)|ligand-dependent nuclear receptor transcription coactivator activity|MyoD binding|oxidoreductase activity|p53 binding|transcription regulatory region DNA binding			ovary(1)|lung(1)	2						AGAATTGAAAGAACTTCTTAA	0.308													13	65	---	---	---	---	PASS
KIAA0319L	79932	broad.mit.edu	37	1	35915491	35915491	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35915491C>T	uc001byx.2	-	15	2588	c.2330G>A	c.(2329-2331)CGG>CAG	p.R777Q	KIAA0319L_uc001byw.2_Missense_Mutation_p.R219Q|KIAA0319L_uc010ohv.1_Missense_Mutation_p.R419Q	NM_024874	NP_079150	Q8IZA0	K319L_HUMAN	dyslexia susceptibility 2-like	777	PKD 5.|Extracellular (Potential).					cytoplasmic vesicle part|integral to membrane	protein binding			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CACAGTGGTCCGGTCTGTGTC	0.483													27	67	---	---	---	---	PASS
CLSPN	63967	broad.mit.edu	37	1	36226693	36226693	+	Intron	SNP	T	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36226693T>G	uc001bzi.2	-						CLSPN_uc009vux.2_Intron	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin						activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AAGAGGGTTCTTACTTCAATA	0.363													37	62	---	---	---	---	PASS
GPBP1L1	60313	broad.mit.edu	37	1	46093993	46093993	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46093993C>G	uc001coq.2	-	13	2721	c.1360G>C	c.(1360-1362)GAG>CAG	p.E454Q	GPBP1L1_uc001coo.2_Missense_Mutation_p.E198Q	NM_021639	NP_067652	Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1	454					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					TCCTCAAACTCTGCTTTGCAA	0.463													56	277	---	---	---	---	PASS
CYP4B1	1580	broad.mit.edu	37	1	47283815	47283815	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47283815C>G	uc001cqm.3	+	11	1366	c.1282C>G	c.(1282-1284)CTG>GTG	p.L428V	CYP4B1_uc001cqn.3_Missense_Mutation_p.L429V|CYP4B1_uc009vym.2_Missense_Mutation_p.L414V|CYP4B1_uc010omk.1_Missense_Mutation_p.L265V	NM_000779	NP_000770	P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B,	428					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					CTTTGACTCTCTGCGCTTTTC	0.582													89	80	---	---	---	---	PASS
ELAVL4	1996	broad.mit.edu	37	1	50572062	50572062	+	5'Flank	SNP	T	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50572062T>C	uc001csb.2	+						ELAVL4_uc001cry.3_Intron|ELAVL4_uc001crz.3_Intron|ELAVL4_uc001csa.3_Silent_p.F19F|ELAVL4_uc001csc.3_5'Flank	NM_021952	NP_068771	P26378	ELAV4_HUMAN	ELAV-like 4 isoform 1						mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding			ovary(1)|pancreas(1)	2						ACTGCTCATTTATGGTAAGAG	0.448													8	53	---	---	---	---	PASS
C8A	731	broad.mit.edu	37	1	57349275	57349275	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57349275G>C	uc001cyo.2	+	6	908	c.776G>C	c.(775-777)AGC>ACC	p.S259T		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	259	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3						CCAGCCGGCAGCCCTTTATTG	0.403													18	123	---	---	---	---	PASS
SGIP1	84251	broad.mit.edu	37	1	67154905	67154905	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67154905C>T	uc001dcr.2	+	16	1607	c.1390C>T	c.(1390-1392)CGG>TGG	p.R464W	SGIP1_uc010opd.1_Missense_Mutation_p.R64W|SGIP1_uc001dcs.2_Missense_Mutation_p.R64W|SGIP1_uc001dct.2_Missense_Mutation_p.R64W|SGIP1_uc009wat.2_Missense_Mutation_p.R258W	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	464	Pro-rich.				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						ACCTCCTCCCCGGCCTCCATC	0.527													94	336	---	---	---	---	PASS
SGIP1	84251	broad.mit.edu	37	1	67154906	67154906	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67154906G>T	uc001dcr.2	+	16	1608	c.1391G>T	c.(1390-1392)CGG>CTG	p.R464L	SGIP1_uc010opd.1_Missense_Mutation_p.R64L|SGIP1_uc001dcs.2_Missense_Mutation_p.R64L|SGIP1_uc001dct.2_Missense_Mutation_p.R64L|SGIP1_uc009wat.2_Missense_Mutation_p.R258L	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	464	Pro-rich.				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						CCTCCTCCCCGGCCTCCATCC	0.522													94	333	---	---	---	---	PASS
IFI44L	10964	broad.mit.edu	37	1	79095529	79095529	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79095529A>C	uc010oro.1	+	4	831	c.652A>C	c.(652-654)AAG>CAG	p.K218Q	IFI44L_uc010orp.1_5'UTR|IFI44L_uc010orq.1_Intron	NM_006820	NP_006811	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	218						cytoplasm					0						CAATTCAGTCAAGTCTATTTT	0.438													27	84	---	---	---	---	PASS
DNASE2B	58511	broad.mit.edu	37	1	84880393	84880393	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84880393A>G	uc001djt.1	+	6	961	c.928A>G	c.(928-930)ATT>GTT	p.I310V	DNASE2B_uc001dju.1_Missense_Mutation_p.I102V|DNASE2B_uc009wch.1_Missense_Mutation_p.I102V	NM_021233	NP_067056	Q8WZ79	DNS2B_HUMAN	deoxyribonuclease II beta isoform 1 precursor	310					DNA metabolic process	lysosome	deoxyribonuclease II activity				0				all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)		CAAGTGGTGTATTTCCCAAAA	0.403								Direct_reversal_of_damage					3	73	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118567962	118567962	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118567962C>G	uc001ehk.2	-	27	3876	c.3808G>C	c.(3808-3810)GAG>CAG	p.E1270Q		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1270						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTATAGAACTCATAGTGCTTC	0.463													33	119	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144865917	144865917	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144865917T>A	uc001elw.3	-	35	5954	c.5663A>T	c.(5662-5664)AAC>ATC	p.N1888I	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.N1782I|PDE4DIP_uc001elv.3_Missense_Mutation_p.N895I|PDE4DIP_uc001ema.2_Missense_Mutation_p.N75I	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1888	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ACTGTAGAAGTTAGAAGTGGA	0.463			T	PDGFRB	MPD								75	472	---	---	---	---	PASS
LIX1L	128077	broad.mit.edu	37	1	145498774	145498774	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145498774G>A	uc001enr.2	+	6	1084	c.1010G>A	c.(1009-1011)TGC>TAC	p.C337Y	NBPF10_uc001emp.3_Intron|LIX1L_uc009wiu.1_5'Flank	NM_153713	NP_714924	Q8IVB5	LIX1L_HUMAN	Lix1 homolog (mouse) like	337										ovary(1)	1	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCTTCCAACTGCTAGGCATCC	0.458													24	60	---	---	---	---	PASS
HIST2H2AB	317772	broad.mit.edu	37	1	149859324	149859324	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149859324G>C	uc001ete.2	-	1	143	c.143C>G	c.(142-144)GCC>GGC	p.A48G	HIST2H2BE_uc001etc.2_5'Flank	NM_175065	NP_778235	Q8IUE6	H2A2B_HUMAN	histone cluster 2, H2ab	48					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)|breast(1)	2	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			GTACACCGGGGCGCCTGCCCC	0.687													10	75	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152281822	152281822	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152281822G>A	uc001ezu.1	-	3	5576	c.5540C>T	c.(5539-5541)ACG>ATG	p.T1847M		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1847	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCCTGGGACGTGGTGTGGCT	0.552									Ichthyosis				160	343	---	---	---	---	PASS
LY9	4063	broad.mit.edu	37	1	160789114	160789114	+	Nonsense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160789114C>G	uc001fwu.2	+	7	1498	c.1448C>G	c.(1447-1449)TCA>TGA	p.S483*	LY9_uc001fwv.2_Nonsense_Mutation_p.S483*|LY9_uc001fww.2_Nonsense_Mutation_p.S393*|LY9_uc001fwx.2_Nonsense_Mutation_p.S393*|LY9_uc001fwy.1_Nonsense_Mutation_p.S295*|LY9_uc001fwz.2_Nonsense_Mutation_p.S135*	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	483	Cytoplasmic (Potential).				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TTCTCAGGTTCAGTCCCAGCC	0.493													35	86	---	---	---	---	PASS
METTL13	51603	broad.mit.edu	37	1	171755047	171755047	+	Silent	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171755047C>G	uc001ghz.2	+	3	1289	c.942C>G	c.(940-942)CTC>CTG	p.L314L	METTL13_uc001gia.2_Silent_p.L228L|METTL13_uc001gib.2_Silent_p.L158L|METTL13_uc010pml.1_Silent_p.L313L	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN	CGI-01 protein isoform 1	314							methyltransferase activity|protein binding			kidney(1)	1						CCGAGTGGCTCTTTGGCATGG	0.557													6	30	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175092792	175092792	+	Silent	SNP	C	G	G	rs138898390		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175092792C>G	uc001gkl.1	+	12	3020	c.2907C>G	c.(2905-2907)GCC>GCG	p.A969A		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	969	Fibronectin type-III 8.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ACACCAAGGCCCAGACAGGTA	0.627													5	88	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177250258	177250258	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177250258G>A	uc001glf.2	+	8	2258	c.1946G>A	c.(1945-1947)CGA>CAA	p.R649Q	FAM5B_uc001glg.2_Missense_Mutation_p.R544Q	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	649						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						CTACGGAGCCGAATCAAGTCC	0.463													18	81	---	---	---	---	PASS
SEC16B	89866	broad.mit.edu	37	1	177937043	177937043	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177937043C>T	uc001gli.1	-	2	164	c.74G>A	c.(73-75)CGA>CAA	p.R25Q	SEC16B_uc001glk.1_5'UTR|SEC16B_uc009wwz.1_5'UTR|SEC16B_uc001glj.1_Missense_Mutation_p.R25Q|SEC16B_uc001gll.3_Missense_Mutation_p.R25Q	NM_033127	NP_149118	Q96JE7	SC16B_HUMAN	leucine zipper transcription regulator 2	25					protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane				ovary(3)|central_nervous_system(1)	4						CCGAAACCCTCGGTCTGGATC	0.577													19	42	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186308815	186308815	+	Silent	SNP	T	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186308815T>C	uc001grv.2	-	30	4407	c.4110A>G	c.(4108-4110)CAA>CAG	p.Q1370Q		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	1370	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CTTCTGTCAATTGTTGAATAC	0.303			T	NTRK1	papillary thyroid								17	59	---	---	---	---	PASS
C4BPA	722	broad.mit.edu	37	1	207304941	207304941	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207304941C>T	uc001hfo.2	+	8	1134	c.940C>T	c.(940-942)CCT>TCT	p.P314S		NM_000715	NP_000706	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	314	Sushi 5.				complement activation, classical pathway|innate immune response	extracellular region	protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						GGAAACATATCCTAGGCCGAC	0.433													26	58	---	---	---	---	PASS
SYT14	255928	broad.mit.edu	37	1	210267799	210267799	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210267799C>T	uc009xcv.2	+	5	647	c.575C>T	c.(574-576)TCC>TTC	p.S192F	SYT14_uc001hhs.3_Missense_Mutation_p.S237F|SYT14_uc001hht.3_Missense_Mutation_p.S192F|SYT14_uc001hhu.3_RNA|SYT14_uc010psn.1_Missense_Mutation_p.S237F|SYT14_uc010pso.1_Missense_Mutation_p.S154F	NM_153262	NP_694994	Q8NB59	SYT14_HUMAN	synaptotagmin XIV isoform 4	192	Cytoplasmic (Potential).					integral to membrane				ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.085)		TGTGAATTTTCCCACTGCAGC	0.433													25	57	---	---	---	---	PASS
OR2G3	81469	broad.mit.edu	37	1	247769169	247769169	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247769169C>T	uc010pyz.1	+	1	282	c.282C>T	c.(280-282)TAC>TAT	p.Y94Y		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	94	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CGATCACTTACGGTGGTTGTG	0.473													120	259	---	---	---	---	PASS
OR2M5	127059	broad.mit.edu	37	1	248308860	248308860	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248308860A>C	uc010pze.1	+	1	411	c.411A>C	c.(409-411)AGA>AGC	p.R137S		NM_001004690	NP_001004690	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M,	137	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|kidney(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			ATCTCATGAGACCCAAAATTT	0.453													69	374	---	---	---	---	PASS
OR2T2	401992	broad.mit.edu	37	1	248616135	248616135	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248616135T>G	uc001iek.1	+	1	37	c.37T>G	c.(37-39)TTC>GTC	p.F13V		NM_001004136	NP_001004136	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T,	13	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTCCACTAACTTCGTCCTCAC	0.502													8	119	---	---	---	---	PASS
SRBD1	55133	broad.mit.edu	37	2	45616517	45616517	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45616517C>T	uc002rus.2	-	21	2996	c.2920G>A	c.(2920-2922)GAA>AAA	p.E974K	SRBD1_uc010yoc.1_Missense_Mutation_p.E493K	NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	974	S1 motif.				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			ACTTGGACTTCCACTCTTTCT	0.463													32	88	---	---	---	---	PASS
CNNM4	26504	broad.mit.edu	37	2	97464819	97464819	+	Silent	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97464819G>A	uc002swx.2	+	4	1805	c.1707G>A	c.(1705-1707)CTG>CTA	p.L569L	CNNM4_uc010yuy.1_Silent_p.L56L	NM_020184	NP_064569	Q6P4Q7	CNNM4_HUMAN	cyclin M4	569					biomineral tissue development|ion transport|response to stimulus|visual perception	integral to membrane|plasma membrane				breast(2)|ovary(1)	3						GCCCCTCCCTGATATCAGAGA	0.537													25	52	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	124999979	124999979	+	Intron	SNP	T	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124999979T>C	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GGGTAGGACATCTTTTTCCTT	0.418													5	19	---	---	---	---	PASS
GALNT5	11227	broad.mit.edu	37	2	158114721	158114721	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158114721C>T	uc002tzg.2	+	1	382	c.127C>T	c.(127-129)CGG>TGG	p.R43W	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	43	Lumenal (Potential).				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						GATCAACACTCGGGTCATCAA	0.468													53	182	---	---	---	---	PASS
SCN7A	6332	broad.mit.edu	37	2	167298201	167298201	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167298201C>T	uc002udu.1	-	14	1989	c.1862G>A	c.(1861-1863)AGT>AAT	p.S621N	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	621					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						CCATGAGTTACTAAGAGACCA	0.373													32	80	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179428793	179428793	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179428793C>A	uc010zfg.1	-	275	74586	c.74362G>T	c.(74362-74364)GGT>TGT	p.G24788C	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.G18483C|TTN_uc010zfi.1_Missense_Mutation_p.G18416C|TTN_uc010zfj.1_Missense_Mutation_p.G18291C	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	25715							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACTTTGTACCACCAACATTG	0.408													66	161	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179569463	179569463	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179569463C>G	uc010zfg.1	-	102	26228	c.26004G>C	c.(26002-26004)TTG>TTC	p.L8668F	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.L5329F	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9595							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATTATCTTTCAAAACTGTCT	0.323													6	40	---	---	---	---	PASS
COL3A1	1281	broad.mit.edu	37	2	189855088	189855088	+	Splice_Site	SNP	T	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189855088T>G	uc002uqj.1	+	10	915	c.798_splice	c.e10+2	p.R266_splice	COL3A1_uc010frw.1_5'Flank	NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein						axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	GGACACAGAGTAAGTAGAGTT	0.348													14	65	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225717814	225717814	+	Silent	SNP	A	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225717814A>G	uc010fwz.1	-	17	2153	c.1914T>C	c.(1912-1914)CCT>CCC	p.P638P	DOCK10_uc002vob.2_Silent_p.P632P	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	638							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AAGGCTTGACAGGGATAAAGG	0.333													3	95	---	---	---	---	PASS
GRM7	2917	broad.mit.edu	37	3	7620793	7620793	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7620793G>C	uc003bqm.2	+	8	2474	c.2200G>C	c.(2200-2202)GAA>CAA	p.E734Q	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.E734Q|GRM7_uc003bql.2_Missense_Mutation_p.E734Q|GRM7_uc003bqn.1_Missense_Mutation_p.E317Q|GRM7_uc010hch.1_Missense_Mutation_p.E245Q	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	734	Extracellular (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	AGACTATGATGAACACAAGAC	0.418													30	49	---	---	---	---	PASS
XIRP1	165904	broad.mit.edu	37	3	39228401	39228401	+	Silent	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39228401G>A	uc003cjk.1	-	2	2757	c.2536C>T	c.(2536-2538)CTG>TTG	p.L846L	XIRP1_uc003cji.2_Silent_p.L846L|XIRP1_uc003cjj.2_Intron	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	846							actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TCCTGCACCAGCAGCCCCTGC	0.592													16	26	---	---	---	---	PASS
CACNA1D	776	broad.mit.edu	37	3	53684870	53684870	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53684870A>G	uc003dgv.3	+	4	711	c.548A>G	c.(547-549)TAT>TGT	p.Y183C	CACNA1D_uc003dgu.3_Missense_Mutation_p.Y183C|CACNA1D_uc003dgy.3_Missense_Mutation_p.Y183C	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	183	I.|Helical; Name=S2 of repeat I; (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	ATTATAGCGTATGGATTATTG	0.318													41	79	---	---	---	---	PASS
CBLB	868	broad.mit.edu	37	3	105572277	105572277	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105572277C>T	uc003dwc.2	-	3	722	c.400G>A	c.(400-402)GAA>AAA	p.E134K	CBLB_uc011bhi.1_Missense_Mutation_p.E156K|CBLB_uc003dwd.1_Missense_Mutation_p.E134K|CBLB_uc003dwe.1_Missense_Mutation_p.E134K|CBLB_uc011bhj.1_RNA	NM_170662	NP_733762	Q13191	CBLB_HUMAN	Cas-Br-M (murine) ecotropic retroviral	134	Cbl-PTB.|4H.				cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding			lung(4)|ovary(3)|breast(1)|skin(1)	9						GACTGTTCTTCATACATTCTC	0.338			Mis S		AML								81	213	---	---	---	---	PASS
ARHGAP31	57514	broad.mit.edu	37	3	119121048	119121048	+	Silent	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119121048G>A	uc003ecj.3	+	10	1981	c.1449G>A	c.(1447-1449)GCG>GCA	p.A483A		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	483					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						AGCGCAAGGCGCTGAACATCT	0.602													22	147	---	---	---	---	PASS
DTX3L	151636	broad.mit.edu	37	3	122287849	122287849	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122287849C>T	uc003efk.2	+	3	1002	c.913C>T	c.(913-915)CTG>TTG	p.L305L	DTX3L_uc010hrj.2_Intron	NM_138287	NP_612144	Q8TDB6	DTX3L_HUMAN	deltex 3-like	305					histone monoubiquitination|response to DNA damage stimulus	cytoplasm|nucleus	histone binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)	4				GBM - Glioblastoma multiforme(114;0.0459)		CACAGAACCTCTGAAGCAAGA	0.403													19	121	---	---	---	---	PASS
GRK7	131890	broad.mit.edu	37	3	141535632	141535632	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141535632G>A	uc011bnd.1	+	4	1486	c.1402G>A	c.(1402-1404)GAA>AAA	p.E468K		NM_139209	NP_631948	Q8WTQ7	GRK7_HUMAN	G-protein-coupled receptor kinase 7 precursor	468	AGC-kinase C-terminal.				visual perception	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						TGGCCTAATTGAACCCCCATT	0.443													45	176	---	---	---	---	PASS
GRK7	131890	broad.mit.edu	37	3	141535701	141535701	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141535701G>C	uc011bnd.1	+	4	1555	c.1471G>C	c.(1471-1473)GAG>CAG	p.E491Q		NM_139209	NP_631948	Q8WTQ7	GRK7_HUMAN	G-protein-coupled receptor kinase 7 precursor	491	AGC-kinase C-terminal.				visual perception	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						TGATTTCTCTGAGGTTCGGGG	0.448													69	231	---	---	---	---	PASS
ZIC4	84107	broad.mit.edu	37	3	147114108	147114108	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147114108C>T	uc003ewd.1	-	3	492	c.219G>A	c.(217-219)GCG>GCA	p.A73A	ZIC4_uc003ewc.1_Silent_p.A3A|ZIC4_uc011bno.1_Silent_p.A123A	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	73						nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						GCTCCGGCCGCGCGTACATGT	0.716													4	15	---	---	---	---	PASS
ABCF3	55324	broad.mit.edu	37	3	183907053	183907053	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183907053C>T	uc003fmz.2	+	11	1178	c.1045C>T	c.(1045-1047)CTG>TTG	p.L349L	ABCF3_uc003fna.2_Silent_p.L343L|ABCF3_uc003fnb.2_Silent_p.L30L	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),	349	ABC transporter 1.						ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCCAGATCTTCTGCTGTTAGA	0.483													21	103	---	---	---	---	PASS
EIF4G1	1981	broad.mit.edu	37	3	184038429	184038429	+	Silent	SNP	A	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184038429A>T	uc003fnp.2	+	8	747	c.549A>T	c.(547-549)CGA>CGT	p.R183R	EIF4G1_uc003fno.1_Silent_p.R124R|EIF4G1_uc010hxw.1_Silent_p.R19R|EIF4G1_uc003fnt.2_5'UTR|EIF4G1_uc003fnq.2_Silent_p.R96R|EIF4G1_uc003fnr.2_Silent_p.R19R|EIF4G1_uc010hxx.2_Silent_p.R190R|EIF4G1_uc003fns.2_Silent_p.R143R|EIF4G1_uc010hxy.2_Silent_p.R190R|EIF4G1_uc010hxz.1_Silent_p.R96R|EIF4G1_uc003fnv.3_Silent_p.R183R|EIF4G1_uc003fnu.3_Silent_p.R183R|EIF4G1_uc003fnw.2_Silent_p.R190R|EIF4G1_uc003fnx.2_5'UTR|EIF4G1_uc003fny.3_5'UTR	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	183	PABPC1-binding.				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCCGAATTCGAGATCCAAACC	0.552													33	147	---	---	---	---	PASS
TNK2	10188	broad.mit.edu	37	3	195622267	195622267	+	Intron	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195622267G>A	uc003fvu.1	-						TNK2_uc003fvs.1_5'Flank|TNK2_uc003fvt.1_Silent_p.P7P|TNK2_uc010hzw.1_Intron|TNK2_uc010hzx.1_Intron	NM_005781	NP_005772	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2 isoform 1						positive regulation of peptidyl-tyrosine phosphorylation|protein ubiquitination|small GTPase mediated signal transduction	adherens junction|cytoplasmic vesicle membrane|endosome|nucleus	ATP binding|GTPase inhibitor activity|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|central_nervous_system(3)|lung(2)|stomach(1)|skin(1)	10	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	CCTGCGTCCTGGGGGGCCGGG	0.741													4	12	---	---	---	---	PASS
HTT	3064	broad.mit.edu	37	4	3133031	3133031	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3133031G>T	uc011bvq.1	+	16	2156	c.2011G>T	c.(2011-2013)GAC>TAC	p.D671Y		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	669					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CATCAAAGGTGACATTGGACA	0.378													3	52	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55955889	55955889	+	Silent	SNP	A	G	G	rs150647161		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55955889A>G	uc003has.2	-	24	3575	c.3273T>C	c.(3271-3273)TTT>TTC	p.F1091F	KDR_uc003hat.1_Silent_p.F1091F	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	1091	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	GCAAAACACCAAAAGACCAGA	0.438			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			67	109	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79437159	79437159	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79437159G>A	uc003hlb.2	+	66	10821	c.10381G>A	c.(10381-10383)GAC>AAC	p.D3461N		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	3456	Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						TGTAACCGCTGACTTCCAGGT	0.512													8	8	---	---	---	---	PASS
ZNF827	152485	broad.mit.edu	37	4	146807209	146807209	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146807209C>A	uc003ikn.2	-	4	1416	c.1368G>T	c.(1366-1368)CAG>CAT	p.Q456H	ZNF827_uc003ikm.2_Missense_Mutation_p.Q456H|ZNF827_uc010iox.2_Missense_Mutation_p.Q106H	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827	456					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)					TCAGGAAGTGCTGATGGCAAC	0.562													9	47	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40981503	40981503	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40981503G>T	uc003jmh.2	+	18	2474	c.2360G>T	c.(2359-2361)AGC>ATC	p.S787I		NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	787	Complement control factor I module 2.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				GCTGAGAGCAGCAAATGTGTC	0.488													4	35	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	40998193	40998193	+	Silent	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40998193G>A	uc003jmj.3	-	42	5209	c.4719C>T	c.(4717-4719)ACC>ACT	p.T1573T	HEATR7B2_uc003jmi.3_Silent_p.T1128T	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1573							binding			ovary(6)|central_nervous_system(2)	8						TTCTCAGGAGGGTTTGCAAAG	0.448													257	181	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41052559	41052559	+	Intron	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41052559C>G	uc003jmj.3	-						HEATR7B2_uc003jmi.3_Intron	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2								binding			ovary(6)|central_nervous_system(2)	8						ACTGTAGCCTCTGCATACCAG	0.388													12	186	---	---	---	---	PASS
PARP8	79668	broad.mit.edu	37	5	50128660	50128660	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50128660C>T	uc003jon.3	+	24	2461	c.2279C>T	c.(2278-2280)TCA>TTA	p.S760L	PARP8_uc011cpz.1_Missense_Mutation_p.S652L|PARP8_uc003joo.2_Missense_Mutation_p.S760L|PARP8_uc003jop.2_Missense_Mutation_p.S718L	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	760	PARP catalytic.					intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)				GAGCCAGCTTCAAGCAGTAAA	0.438													19	40	---	---	---	---	PASS
ZFYVE16	9765	broad.mit.edu	37	5	79752839	79752839	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79752839C>T	uc003kgr.3	+	14	4173	c.3871C>T	c.(3871-3873)CAT>TAT	p.H1291Y	ZFYVE16_uc003kgq.3_Missense_Mutation_p.H1291Y|ZFYVE16_uc003kgs.3_Missense_Mutation_p.H1291Y|ZFYVE16_uc003kgt.3_Missense_Mutation_p.H379Y|ZFYVE16_uc003kgu.3_Missense_Mutation_p.H43Y	NM_001105251	NP_001098721	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	1291					BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity				0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		AGCAGATTCTCATCTAGTCTG	0.383													38	51	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90449047	90449047	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90449047G>A	uc003kju.2	+	89	18730	c.18634G>A	c.(18634-18636)GAC>AAC	p.D6212N	GPR98_uc003kjt.2_Missense_Mutation_p.D3918N|GPR98_uc003kjw.2_Missense_Mutation_p.D1873N|GPR98_uc003kjx.2_Missense_Mutation_p.D240N	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	6212	Cytoplasmic (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GGTGCCACCTGACTGGGAGAG	0.478													7	10	---	---	---	---	PASS
ANKRD32	84250	broad.mit.edu	37	5	94022307	94022307	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94022307A>G	uc003kkr.3	+	16	2085	c.2005A>G	c.(2005-2007)ATT>GTT	p.I669V	ANKRD32_uc003kks.2_Missense_Mutation_p.I33V	NM_032290	NP_115666	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	669										ovary(2)	2		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		AGAGATTTTCATTTGCTCCTT	0.378													52	213	---	---	---	---	PASS
PCDHA1	56147	broad.mit.edu	37	5	140168014	140168014	+	Silent	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140168014C>G	uc003lhb.2	+	1	2139	c.2139C>G	c.(2137-2139)CTC>CTG	p.L713L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Silent_p.L713L	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	713	Helical; (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTGGTGCTCACACTGCTGC	0.682													14	52	---	---	---	---	PASS
PCDHB14	56122	broad.mit.edu	37	5	140604601	140604601	+	Silent	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140604601G>C	uc003ljb.2	+	1	1524	c.1524G>C	c.(1522-1524)GCG>GCC	p.A508A	PCDHB14_uc011dal.1_Silent_p.A355A	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	508	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCATCAACGCGGACAATGGCC	0.657													20	126	---	---	---	---	PASS
CDHR2	54825	broad.mit.edu	37	5	176003183	176003183	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176003183C>T	uc003mem.1	+	12	1257	c.1191C>T	c.(1189-1191)GAC>GAT	p.D397D	CDHR2_uc003men.1_Silent_p.D397D	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor	397	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2						ACGACCCGGACAAGGCAGGCG	0.672													13	56	---	---	---	---	PASS
ZNF454	285676	broad.mit.edu	37	5	178392301	178392301	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178392301C>A	uc003mjo.1	+	5	1167	c.896C>A	c.(895-897)CCT>CAT	p.P299H	ZNF454_uc010jkz.1_Missense_Mutation_p.P299H	NM_182594	NP_872400	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	299					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		GGAGAGAAACCTTTTAAATGT	0.383													31	50	---	---	---	---	PASS
DSP	1832	broad.mit.edu	37	6	7571678	7571678	+	Silent	SNP	A	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7571678A>G	uc003mxp.1	+	14	2043	c.1764A>G	c.(1762-1764)CAA>CAG	p.Q588Q	DSP_uc003mxq.1_Silent_p.Q588Q	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	588	Globular 1.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TACATTACCAAGAGTTCATCA	0.448													90	143	---	---	---	---	PASS
HIST1H1E	3008	broad.mit.edu	37	6	26156778	26156778	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26156778C>T	uc003ngq.2	+	1	220	c.160C>T	c.(160-162)CGC>TGC	p.R54C	HIST1H2BD_uc003ngr.2_5'Flank|HIST1H2BD_uc003ngs.2_5'Flank	NM_005321	NP_005312	P10412	H14_HUMAN	histone cluster 1, H1e	54	H15.				nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			large_intestine(1)|ovary(1)	2						CTCCAAGGAGCGCAGCGGCGT	0.607													6	35	---	---	---	---	PASS
HLA-G	3135	broad.mit.edu	37	6	29797255	29797255	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29797255G>C	uc003nnw.2	+	5	858	c.680G>C	c.(679-681)TGC>TCC	p.C227S	HLA-G_uc011dmb.1_Missense_Mutation_p.C199S|HLA-G_uc003raj.3_Missense_Mutation_p.C232S|HLA-G_uc003nnz.3_Missense_Mutation_p.C135S|HLA-G_uc010jrn.2_Intron|HLA-G_uc003nny.3_RNA|HLA-G_uc003ran.1_5'Flank	NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	227	Extracellular (Potential).|Ig-like C1-type.|Alpha-3.				antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						ACCCTGAGGTGCTGGGCCCTG	0.592													11	184	---	---	---	---	PASS
GNL1	2794	broad.mit.edu	37	6	30520850	30520850	+	Intron	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30520850G>A	uc003nqh.2	-						GNL1_uc011dmi.1_Intron|GNL1_uc011dmj.1_Intron|GNL1_uc011dmk.1_Intron	NM_005275	NP_005266	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1						response to DNA damage stimulus|signal transduction|T cell mediated immunity	extracellular space|intracellular	GTP binding|structural molecule activity			ovary(3)	3						CCTCCTCTAAGGGCCACATAC	0.567													102	261	---	---	---	---	PASS
PPARD	5467	broad.mit.edu	37	6	35388062	35388062	+	Intron	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35388062C>T	uc003okm.2	+						PPARD_uc003okl.2_Intron|PPARD_uc003okn.2_Intron|PPARD_uc011dtb.1_Intron|PPARD_uc011dtc.1_Intron|PPARD_uc010jvv.1_Intron	NM_006238	NP_006229	Q03181	PPARD_HUMAN	peroxisome proliferative activated receptor,						apoptosis|axon ensheathment|cholesterol metabolic process|decidualization|embryo implantation|fatty acid beta-oxidation|fatty acid transport|generation of precursor metabolites and energy|glucose metabolic process|glucose transport|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fat cell differentiation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|linoleic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1					Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	GTGCAAGGTACGGACTGGGGG	0.627													4	47	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38743618	38743618	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38743618G>T	uc003ooe.1	+	11	1802	c.1202G>T	c.(1201-1203)AGA>ATA	p.R401I		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						ATAAAATTCAGAAATATATAC	0.299													23	135	---	---	---	---	PASS
TAF8	129685	broad.mit.edu	37	6	42044885	42044885	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42044885C>A	uc003ors.2	+	8	857	c.828C>A	c.(826-828)AAC>AAA	p.N276K	TAF8_uc003ort.2_Missense_Mutation_p.T317N|TAF8_uc003oru.1_Missense_Mutation_p.T317N|TAF8_uc003orv.1_Missense_Mutation_p.N276K|TAF8_uc011dun.1_Missense_Mutation_p.N200K	NM_138572	NP_612639	Q7Z7C8	TAF8_HUMAN	TBP-associated factor 8	276					cell differentiation|maintenance of protein location in nucleus|positive regulation of transcription, DNA-dependent|regulation of fat cell differentiation|transcription, DNA-dependent	perinuclear region of cytoplasm|transcription factor TFIID complex	DNA binding|protein binding			ovary(1)	1	Colorectal(47;0.196)		STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00179)			TGCAGCAGAACCCCTCCTTGT	0.507													14	132	---	---	---	---	PASS
YIPF3	25844	broad.mit.edu	37	6	43480208	43480208	+	Silent	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43480208G>A	uc003ovl.1	-	8	1031	c.874C>T	c.(874-876)CTG>TTG	p.L292L	C6orf154_uc003ovk.1_5'Flank|YIPF3_uc011dvk.1_Silent_p.L257L|YIPF3_uc010jyr.1_Silent_p.L298L|YIPF3_uc010jys.1_Silent_p.L135L|YIPF3_uc003ovm.1_Silent_p.L166L|YIPF3_uc010jyt.1_Silent_p.L203L	NM_015388	NP_056203	Q9GZM5	YIPF3_HUMAN	natural killer cell-specific antigen KLIP1	292	Helical; (Potential).				cell differentiation	integral to membrane|plasma membrane|transport vesicle					0	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GCAAAATGCAGATAGAGCAGG	0.567													11	67	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51524604	51524604	+	Silent	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51524604G>C	uc003pah.1	-	61	10596	c.10320C>G	c.(10318-10320)GTC>GTG	p.V3440V		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3440	Extracellular (Potential).		V -> D.		cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CACTGCTAAAGACATCAACAA	0.413													43	77	---	---	---	---	PASS
BMP5	653	broad.mit.edu	37	6	55739436	55739436	+	Silent	SNP	A	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55739436A>C	uc003pcq.2	-	1	940	c.228T>G	c.(226-228)TCT>TCG	p.S76S	BMP5_uc011dxf.1_Silent_p.S76S	NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein	76					cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			AGAGAGGTGCAGAGGACGCTT	0.468													27	134	---	---	---	---	PASS
EYA4	2070	broad.mit.edu	37	6	133833901	133833901	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133833901A>G	uc003qec.3	+	15	1782	c.1324A>G	c.(1324-1326)AAT>GAT	p.N442D	EYA4_uc011ecq.1_Missense_Mutation_p.N388D|EYA4_uc011ecr.1_Missense_Mutation_p.N394D|EYA4_uc003qed.3_Missense_Mutation_p.N442D|EYA4_uc003qee.3_Missense_Mutation_p.N419D|EYA4_uc011ecs.1_Missense_Mutation_p.N448D|uc003qeg.1_Intron	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a	442					anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		CTCTGATGATAATGGGCAGGA	0.343													82	133	---	---	---	---	PASS
TNFAIP3	7128	broad.mit.edu	37	6	138192646	138192646	+	Silent	SNP	G	C	C	rs142122102	by1000genomes	TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138192646G>C	uc003qhr.2	+	2	348	c.282G>C	c.(280-282)GCG>GCC	p.A94A	TNFAIP3_uc003qhs.2_Silent_p.A94A	NM_006290	NP_006281	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	94	TRAF-binding.|OTU.				anti-apoptosis|apoptosis|B-1 B cell homeostasis|negative regulation of B cell activation|negative regulation of bone resorption|negative regulation of CD40 signaling pathway|negative regulation of endothelial cell apoptosis|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of interleukin-2 production|negative regulation of interleukin-6 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of osteoclast proliferation|negative regulation of protein ubiquitination|negative regulation of smooth muscle cell proliferation|negative regulation of toll-like receptor 2 signaling pathway|negative regulation of toll-like receptor 3 signaling pathway|negative regulation of tumor necrosis factor production|negative regulation of type I interferon production|positive regulation of protein catabolic process|protein K48-linked ubiquitination|protein K63-linked deubiquitination|protein oligomerization|regulation of defense response to virus by host|regulation of germinal center formation|regulation of vascular wound healing|tolerance induction to lipopolysaccharide	centrosome|cytosol|nucleus	caspase inhibitor activity|DNA binding|protease binding|protein self-association|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-protein ligase activity|ubiquitin-specific protease activity|zinc ion binding	p.0?(22)		haematopoietic_and_lymphoid_tissue(133)|lung(3)|ovary(1)	137	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		AGCTTGTGGCGCTGAAAACGA	0.507			D|N|F		marginal zone B-cell lymphomas|Hodgkin's lymphoma|primary mediastinal B cell lymphoma								37	102	---	---	---	---	PASS
TMEM181	57583	broad.mit.edu	37	6	159046221	159046221	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159046221G>A	uc003qrm.3	+	12	1462	c.1451G>A	c.(1450-1452)CGT>CAT	p.R484H	TMEM181_uc010kjr.1_Missense_Mutation_p.R315H	NM_020823	NP_065874	Q9P2C4	TM181_HUMAN	G protein-coupled receptor 178	484					pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		TCCGAGCTACGTCACATGCCT	0.542													47	150	---	---	---	---	PASS
MLLT4	4301	broad.mit.edu	37	6	168317906	168317906	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168317906C>T	uc003qwd.2	+	19	2821	c.2679C>T	c.(2677-2679)ATC>ATT	p.I893I	MLLT4_uc003qwb.1_Silent_p.I878I|MLLT4_uc003qwc.1_Silent_p.I894I|MLLT4_uc003qwg.1_Silent_p.I203I	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	894	Dilute.				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		AGCCTTTTATCCCAACGGTGA	0.388			T	MLL	AL								66	125	---	---	---	---	PASS
THBS2	7058	broad.mit.edu	37	6	169637755	169637755	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169637755G>T	uc003qwt.2	-	9	1513	c.1265C>A	c.(1264-1266)ACA>AAA	p.T422K		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	422	TSP type-1 1.				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		GCAAGCCCGTGTCTGGATGGA	0.652													10	67	---	---	---	---	PASS
KIAA0415	9907	broad.mit.edu	37	7	4823974	4823974	+	Silent	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4823974C>G	uc003sne.2	+	6	845	c.762C>G	c.(760-762)GGC>GGG	p.G254G	KIAA0415_uc010ksp.2_RNA	NM_014855	NP_055670	O43299	K0415_HUMAN	hypothetical protein LOC9907	254					cell death|double-strand break repair via homologous recombination	cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.091)|OV - Ovarian serous cystadenocarcinoma(56;8.35e-15)		TGCACAGCGGCCCCGAGGGCC	0.682													4	4	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11452276	11452276	+	Intron	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11452276C>A	uc003ssf.3	-							NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A							integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GATGATGATCCATGTACCTGT	0.423										HNSCC(18;0.044)			14	24	---	---	---	---	PASS
STK31	56164	broad.mit.edu	37	7	23775520	23775520	+	Intron	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23775520G>C	uc003sws.3	+						STK31_uc003swt.3_Intron|STK31_uc011jze.1_Intron|STK31_uc010kuq.2_Intron	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a								ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						TCCAAAGTAAGAATTTAGTCT	0.383													23	80	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38402580	38402580	+	Intron	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38402580C>A	uc003tgp.1	+						uc003tgs.1_Missense_Mutation_p.G80V					Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		TGGACTGACTCCTGATTCCAA	0.453													15	69	---	---	---	---	PASS
SUN3	256979	broad.mit.edu	37	7	48048624	48048624	+	Intron	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48048624G>A	uc003tof.2	-						SUN3_uc010kyq.2_Intron|SUN3_uc003tog.2_Intron|SUN3_uc011kcf.1_Intron	NM_152782	NP_689995	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 1							integral to membrane				central_nervous_system(1)	1						GCAAAAGATCGCACTCACTTT	0.274													7	127	---	---	---	---	PASS
RFC2	5982	broad.mit.edu	37	7	73654437	73654437	+	Intron	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73654437C>A	uc003uaj.2	-						RFC2_uc011kfa.1_Intron|RFC2_uc003uak.2_Intron|RFC2_uc010lbp.2_Intron|RFC2_uc003ual.2_Intron	NM_181471	NP_852136	P35250	RFC2_HUMAN	replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2						TGAACAGAGACGGGACAGTAG	0.567													12	46	---	---	---	---	PASS
PDK4	5166	broad.mit.edu	37	7	95216387	95216387	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95216387A>G	uc003uoa.2	-	10	1350	c.1030T>C	c.(1030-1032)TTT>CTT	p.F344L	PDK4_uc003unz.2_Missense_Mutation_p.F132L	NM_002612	NP_002603	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase 4 precursor	344	Histidine kinase.				glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity				0	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			TCTCCTTGAAAGTACTTTGCA	0.378													3	44	---	---	---	---	PASS
GATS	352954	broad.mit.edu	37	7	99821238	99821238	+	3'UTR	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99821238C>T	uc003uua.3	-	4					GATS_uc003uty.3_RNA|GATS_uc003utz.3_RNA|GATS_uc010lgt.2_RNA|GATS_uc011kjl.1_5'Flank|GATS_uc010lgu.2_RNA	NM_178831	NP_849153	Q8NAP1	GATS_HUMAN	GATS, stromal antigen 3 opposite strand												0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGGTTCTCGGCTGCTACAGTC	0.592													23	100	---	---	---	---	PASS
ATXN7L1	222255	broad.mit.edu	37	7	105516995	105516995	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105516995C>T	uc003vde.2	-	1	37	c.10G>A	c.(10-12)GAG>AAG	p.E4K	ATXN7L1_uc003vdi.2_Missense_Mutation_p.E4K|CDHR3_uc003vdk.2_5'Flank|uc003vdj.1_5'Flank	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1	4											0						CGAGAACGCTCCGACGTCATC	0.388													12	42	---	---	---	---	PASS
CDHR3	222256	broad.mit.edu	37	7	105656363	105656363	+	Intron	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105656363C>T	uc003vdl.3	+						CDHR3_uc003vdk.2_Intron|CDHR3_uc003vdm.3_Intron|CDHR3_uc011klt.1_Intron|CDHR3_uc003vdn.2_Intron	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						GTTTCTATTTCCATTTTTAGA	0.234													13	20	---	---	---	---	PASS
SLC26A3	1811	broad.mit.edu	37	7	107427307	107427307	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107427307C>G	uc003ver.2	-	8	1147	c.936G>C	c.(934-936)AGG>AGC	p.R312S	SLC26A3_uc003ves.2_Missense_Mutation_p.R277S	NM_000111	NP_000102	P40879	S26A3_HUMAN	solute carrier family 26, member 3	312					excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4						CCACTTTAAACCTGTTTTTAA	0.463													19	82	---	---	---	---	PASS
CTTNBP2	83992	broad.mit.edu	37	7	117386086	117386086	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117386086T>G	uc003vjf.2	-	13	3508	c.3416A>C	c.(3415-3417)CAG>CCG	p.Q1139P		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1139										ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GAGTGCAAGCTGATGTACTAT	0.393													60	106	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3008915	3008915	+	Intron	SNP	T	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3008915T>A	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc003wqe.2_Missense_Mutation_p.K1169M|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACATTTTCACTTACCATAGCC	0.423													8	20	---	---	---	---	PASS
GSR	2936	broad.mit.edu	37	8	30546779	30546779	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30546779G>A	uc003xih.1	-	9	1031	c.940C>T	c.(940-942)CCC>TCC	p.P314S		NM_000637	NP_000628	P00390	GSHR_HUMAN	glutathione reductase precursor	314					cell redox homeostasis|nucleobase, nucleoside and nucleotide interconversion	cytosol|mitochondrion	electron carrier activity|glutathione-disulfide reductase activity			ovary(2)|pancreas(2)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Glutathione(DB00143)|NADH(DB00157)	AGCCTACCGGGAACTGCAGTA	0.488													22	80	---	---	---	---	PASS
EFCAB1	79645	broad.mit.edu	37	8	49643960	49643960	+	Missense_Mutation	SNP	C	T	T	rs74697155	byFrequency	TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49643960C>T	uc003xqo.2	-	2	321	c.161G>A	c.(160-162)CGA>CAA	p.R54Q	EFCAB1_uc003xqn.3_Intron|EFCAB1_uc011ldj.1_Intron|EFCAB1_uc010lxx.2_Intron|EFCAB1_uc011ldk.1_Intron	NM_024593	NP_078869	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1 isoform a	54							calcium ion binding				0		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				CAGGATGTTTCGAAATGCATT	0.393													35	92	---	---	---	---	PASS
COL14A1	7373	broad.mit.edu	37	8	121237336	121237336	+	Missense_Mutation	SNP	G	T	T	rs139519867		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121237336G>T	uc003yox.2	+	15	2012	c.1747G>T	c.(1747-1749)GAT>TAT	p.D583Y	COL14A1_uc003yoy.2_Missense_Mutation_p.D261Y	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	583	Fibronectin type-III 4.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GGTTGAAGTCGATCCTATTAC	0.393													37	126	---	---	---	---	PASS
SLA	6503	broad.mit.edu	37	8	134060111	134060111	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134060111C>G	uc003ytz.2	-	6	1148	c.316G>C	c.(316-318)GGC>CGC	p.G106R	TG_uc003ytw.2_Intron|TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron|SLA_uc011lje.1_Missense_Mutation_p.G123R|SLA_uc011ljf.1_5'UTR|SLA_uc011ljg.1_Missense_Mutation_p.G123R|SLA_uc010mdy.1_Missense_Mutation_p.G106R|SLA_uc011ljd.1_Missense_Mutation_p.G146R	NM_001045556	NP_001039021	Q13239	SLAP1_HUMAN	Src-like-adaptor isoform a	106	SH2.					endosome	SH3/SH2 adaptor activity			lung(1)|liver(1)	2	all_epithelial(106;3.51e-21)|Lung NSC(106;4.24e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0279)|Breast(495;0.037)	BRCA - Breast invasive adenocarcinoma(115;0.000701)			ATGAAGGAGCCGACCTTTGTG	0.577													4	74	---	---	---	---	PASS
CYP11B1	1584	broad.mit.edu	37	8	143956706	143956706	+	Silent	SNP	G	A	A	rs138706121		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143956706G>A	uc003yxi.2	-	7	1151	c.1144C>T	c.(1144-1146)CTG>TTG	p.L382L	CYP11B1_uc010mex.2_Silent_p.L81L|CYP11B1_uc003yxh.2_Silent_p.L98L|CYP11B1_uc003yxj.2_Silent_p.L382L|CYP11B1_uc010mey.2_Silent_p.L453L	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	382					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	ACTCGCTCCAGAAACAGACCC	0.607									Familial_Hyperaldosteronism_type_I				4	39	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	145006636	145006636	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145006636C>A	uc003zaf.1	-	16	2490	c.2320G>T	c.(2320-2322)GAG>TAG	p.E774*	PLEC_uc003zab.1_Nonsense_Mutation_p.E637*|PLEC_uc003zac.1_Nonsense_Mutation_p.E641*|PLEC_uc003zad.2_Nonsense_Mutation_p.E637*|PLEC_uc003zae.1_Nonsense_Mutation_p.E605*|PLEC_uc003zag.1_Nonsense_Mutation_p.E615*|PLEC_uc003zah.2_Nonsense_Mutation_p.E623*|PLEC_uc003zaj.2_Nonsense_Mutation_p.E664*	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	774	Spectrin 2.|Globular 1.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						ACCTCCTCCTCCTCCTTCTCA	0.617													24	71	---	---	---	---	PASS
C9orf72	203228	broad.mit.edu	37	9	27550710	27550710	+	Intron	SNP	A	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27550710A>G	uc003zqq.2	-							NM_018325	NP_060795	Q96LT7	CI072_HUMAN	hypothetical protein LOC203228 isoform a											ovary(3)|central_nervous_system(1)	4		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		ATATTCCTgaagaaaagaaga	0.308													8	112	---	---	---	---	PASS
CEP78	84131	broad.mit.edu	37	9	80879233	80879233	+	Splice_Site	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80879233G>A	uc004akx.2	+	13	1901	c.1625_splice	c.e13+1	p.G542_splice	CEP78_uc004aky.3_Splice_Site_p.G543_splice|CEP78_uc010mpp.2_Splice_Site_p.G543_splice|CEP78_uc004akz.1_Splice_Site_p.G30_splice	NM_032171	NP_115547	Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa isoform b						G2/M transition of mitotic cell cycle	centrosome|cytosol				ovary(1)	1						AAGATGCTGGGTTAGTTACTT	0.378													16	35	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7409714	7409714	+	Silent	SNP	G	A	A	rs113302721		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7409714G>A	uc009xio.1	-	4	424	c.333C>T	c.(331-333)TAC>TAT	p.Y111Y	SFMBT2_uc001ijn.1_Silent_p.Y111Y|SFMBT2_uc010qay.1_Silent_p.Y111Y|SFMBT2_uc001ijo.1_Silent_p.Y111Y	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	111	MBT 1.				regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						GGTCCTCCCCGTAACCGCAGT	0.587													11	62	---	---	---	---	PASS
VIM	7431	broad.mit.edu	37	10	17278303	17278303	+	Silent	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17278303G>T	uc001iou.2	+	9	1697	c.1284G>T	c.(1282-1284)CTG>CTT	p.L428L	VIM_uc001iov.1_Intron|VIM_uc001iow.1_RNA|VIM_uc001iox.1_Silent_p.L428L|VIM_uc001ioy.1_Silent_p.L341L|VIM_uc001ioz.1_RNA|VIM_uc001ipb.1_RNA|VIM_uc009xjv.1_Silent_p.L386L|VIM_uc001ipc.1_Intron	NM_003380	NP_003371	P08670	VIME_HUMAN	vimentin	428	Tail.				cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						AAACTAATCTGGATTCACTCC	0.333													63	188	---	---	---	---	PASS
VIM	7431	broad.mit.edu	37	10	17278304	17278304	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17278304G>T	uc001iou.2	+	9	1698	c.1285G>T	c.(1285-1287)GAT>TAT	p.D429Y	VIM_uc001iov.1_Intron|VIM_uc001iow.1_RNA|VIM_uc001iox.1_Missense_Mutation_p.D429Y|VIM_uc001ioy.1_Missense_Mutation_p.D342Y|VIM_uc001ioz.1_RNA|VIM_uc001ipb.1_RNA|VIM_uc009xjv.1_Missense_Mutation_p.D387Y|VIM_uc001ipc.1_Intron	NM_003380	NP_003371	P08670	VIME_HUMAN	vimentin	429	Tail.				cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						AACTAATCTGGATTCACTCCC	0.338													62	189	---	---	---	---	PASS
PTPLA	9200	broad.mit.edu	37	10	17645632	17645632	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17645632G>A	uc001ipg.2	-	4	445	c.410C>T	c.(409-411)TCT>TTT	p.S137F	PTPLA_uc001iph.1_3'UTR	NM_014241	NP_055056	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like, member A	137	Cytoplasmic (Potential).				fatty acid biosynthetic process|multicellular organismal development|signal transduction	endoplasmic reticulum membrane|integral to membrane	lyase activity|protein tyrosine phosphatase activity			central_nervous_system(1)|skin(1)	2						CACAATCACAGAAGTAGGTAC	0.333													16	86	---	---	---	---	PASS
MPP7	143098	broad.mit.edu	37	10	28348669	28348669	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28348669G>A	uc001iua.1	-	16	1612	c.1208C>T	c.(1207-1209)ACC>ATC	p.T403I	MPP7_uc009xkz.1_RNA|MPP7_uc001iub.1_Missense_Mutation_p.T403I|MPP7_uc009xla.2_Missense_Mutation_p.T403I|MPP7_uc010qdv.1_RNA	NM_173496	NP_775767	Q5T2T1	MPP7_HUMAN	palmitoylated membrane protein 7	403	Guanylate kinase-like.				establishment of cell polarity|positive regulation of protein complex assembly|protein localization to adherens junction|tight junction assembly	MPP7-DLG1-LIN7 complex|tight junction	protein complex scaffold|protein domain specific binding|protein heterodimerization activity|signaling adaptor activity			ovary(1)	1						TGCTCTGGTGGTATCTATGAT	0.338													34	64	---	---	---	---	PASS
GDF2	2658	broad.mit.edu	37	10	48414384	48414384	+	Missense_Mutation	SNP	G	T	T	rs139154868		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48414384G>T	uc001jfa.1	-	2	647	c.484C>A	c.(484-486)CCC>ACC	p.P162T		NM_016204	NP_057288	Q9UK05	GDF2_HUMAN	growth differentiation factor 2 precursor	162					activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(2)|skin(1)	3						TCATGAGAGGGGTCCACGTGA	0.502													6	39	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55582652	55582652	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55582652T>G	uc001jju.1	-	33	5229	c.4834A>C	c.(4834-4836)ACT>CCT	p.T1612P	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.T1609P|PCDH15_uc010qhw.1_Missense_Mutation_p.T1572P|PCDH15_uc010qhx.1_Missense_Mutation_p.T1543P|PCDH15_uc010qhy.1_Missense_Mutation_p.T1619P|PCDH15_uc010qhz.1_Missense_Mutation_p.T1614P|PCDH15_uc010qia.1_Missense_Mutation_p.T1592P|PCDH15_uc010qib.1_Missense_Mutation_p.T1589P	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1612	Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CAGATTCCAGTGTTTTCATTT	0.438										HNSCC(58;0.16)			30	184	---	---	---	---	PASS
HNRNPH3	3189	broad.mit.edu	37	10	70097753	70097753	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70097753G>T	uc001jnw.3	+	3	480	c.251G>T	c.(250-252)AGG>ATG	p.R84M	HNRNPH3_uc001jnx.3_Missense_Mutation_p.R84M|HNRNPH3_uc009xpu.2_Translation_Start_Site|HNRNPH3_uc010qiv.1_Intron|HNRNPH3_uc001jny.3_Missense_Mutation_p.R35M	NM_012207	NP_036339	P31942	HNRH3_HUMAN	heterogeneous nuclear ribonucleoprotein H3	84	RRM 1.				nuclear mRNA splicing, via spliceosome	heterogeneous nuclear ribonucleoprotein complex	nucleotide binding|protein binding|RNA binding			ovary(2)	2						ATAGGGCACAGGTGGGGATGG	0.478													28	68	---	---	---	---	PASS
HNRNPH3	3189	broad.mit.edu	37	10	70097754	70097754	+	Splice_Site	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70097754G>T	uc001jnw.3	+	3	480	c.251_splice	c.e3+1	p.R84_splice	HNRNPH3_uc001jnx.3_Splice_Site_p.R84_splice|HNRNPH3_uc009xpu.2_5'UTR|HNRNPH3_uc010qiv.1_Intron|HNRNPH3_uc001jny.3_Splice_Site_p.R35_splice	NM_012207	NP_036339	P31942	HNRH3_HUMAN	heterogeneous nuclear ribonucleoprotein H3						nuclear mRNA splicing, via spliceosome	heterogeneous nuclear ribonucleoprotein complex	nucleotide binding|protein binding|RNA binding			ovary(2)	2						TAGGGCACAGGTGGGGATGGA	0.473													28	68	---	---	---	---	PASS
PPA1	5464	broad.mit.edu	37	10	71969329	71969329	+	Silent	SNP	T	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71969329T>A	uc001jqv.1	-	7	731	c.624A>T	c.(622-624)GCA>GCT	p.A208A		NM_021129	NP_066952	Q15181	IPYR_HUMAN	pyrophosphatase 1	208					diphosphate metabolic process|tRNA aminoacylation for protein translation	cytosol	inorganic diphosphatase activity|magnesium ion binding			breast(1)	1						CTTTAAATTCTGCATTAAACG	0.353													43	64	---	---	---	---	PASS
SEC24C	9632	broad.mit.edu	37	10	75520148	75520148	+	Intron	SNP	A	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75520148A>T	uc001juw.2	+						SEC24C_uc010qkn.1_Intron|SEC24C_uc009xrj.1_Intron|SEC24C_uc001jux.2_Intron|SEC24C_uc010qko.1_Intron|SEC24C_uc010qkp.1_Intron|SEC24C_uc010qkq.1_Intron	NM_004922	NP_004913	P53992	SC24C_HUMAN	SEC24-related protein C						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|zinc ion binding			skin(2)|central_nervous_system(1)	3	Prostate(51;0.0112)					CAAAATGGTGAGTCTTTCCCA	0.502													32	58	---	---	---	---	PASS
C10orf11	83938	broad.mit.edu	37	10	77542758	77542758	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77542758G>T	uc001jxi.2	+	1	240	c.25G>T	c.(25-27)GGC>TGC	p.G9C		NM_032024	NP_114413	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11	9	LRR 1.										0	Prostate(51;0.0095)|all_epithelial(25;0.0221)					GTCACTCAGCGGCAATCATTC	0.408													3	69	---	---	---	---	PASS
CPEB3	22849	broad.mit.edu	37	10	93999117	93999117	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93999117G>C	uc001khw.1	-	2	1164	c.991C>G	c.(991-993)CTG>GTG	p.L331V	CPEB3_uc001khu.1_Missense_Mutation_p.L331V|CPEB3_uc001khv.1_Missense_Mutation_p.L331V|CPEB3_uc010qnn.1_Missense_Mutation_p.L331V	NM_014912	NP_055727	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding	331							nucleotide binding|RNA binding				0		Colorectal(252;0.0869)				AATGGCAACAGATTGTTACCA	0.537													4	24	---	---	---	---	PASS
C10orf90	118611	broad.mit.edu	37	10	128150141	128150141	+	Silent	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128150141G>A	uc001ljq.2	-	5	1669	c.1548C>T	c.(1546-1548)TGC>TGT	p.C516C	C10orf90_uc001ljp.2_Silent_p.C372C|C10orf90_uc010qum.1_Silent_p.C613C|C10orf90_uc001ljo.2_RNA	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611	516										ovary(1)|skin(1)	2		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		CCAAGTCACAGCATGTGTAAT	0.488													4	36	---	---	---	---	PASS
PAOX	196743	broad.mit.edu	37	10	135204834	135204834	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135204834G>A	uc001lmv.2	+	7	1491	c.1411G>A	c.(1411-1413)GGG>AGG	p.G471R	PAOX_uc001lmw.2_RNA|PAOX_uc001lmx.2_Missense_Mutation_p.G418E|PAOX_uc001lmy.2_3'UTR|PAOX_uc001lmz.2_RNA|PAOX_uc001lna.2_RNA|PAOX_uc001lnb.2_RNA|PAOX_uc001lnc.2_RNA|MTG1_uc001lnd.2_5'Flank	NM_152911	NP_690875	Q6QHF9	PAOX_HUMAN	polyamine oxidase isoform 1	609					polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		CCTGTTTGCGGGGGAAGCCAC	0.592													29	121	---	---	---	---	PASS
PDDC1	347862	broad.mit.edu	37	11	774114	774114	+	Splice_Site	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:774114C>T	uc001lrc.2	-	3	167	c.142_splice	c.e3-1	p.G48_splice	PDDC1_uc010qwm.1_Splice_Site|PDDC1_uc001lrd.2_Splice_Site_p.G48_splice|PDDC1_uc001lrf.1_Splice_Site_p.G48_splice|PDDC1_uc001lrg.1_Splice_Site|PDDC1_uc009ycg.2_Splice_Site|PDDC1_uc010qwn.1_Splice_Site|PDDC1_uc010qwo.1_Splice_Site|PDDC1_uc010qwp.1_Splice_Site_p.G48_splice|PDDC1_uc010qwq.1_Splice_Site|PDDC1_uc010qwr.1_Splice_Site_p.G48_splice|PDDC1_uc010qws.1_Splice_Site	NM_182612	NP_872418	Q8NB37	PDDC1_HUMAN	Parkinson disease 7 domain containing 1							extracellular region					0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;3.66e-26)|Epithelial(43;2.43e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-19)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGCTTTCCCCTGGAGAAGCA	0.602													10	37	---	---	---	---	PASS
OR56A4	120793	broad.mit.edu	37	11	6023942	6023942	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6023942G>C	uc010qzv.1	-	1	437	c.437C>G	c.(436-438)TCG>TGG	p.S146W		NM_001005179	NP_001005179	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A,	94	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAAGCTGATCGACCTGAGGTC	0.547													20	65	---	---	---	---	PASS
AMPD3	272	broad.mit.edu	37	11	10514980	10514980	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10514980G>A	uc001mio.1	+	7	1359	c.1024G>A	c.(1024-1026)GAC>AAC	p.D342N	AMPD3_uc010rbz.1_Missense_Mutation_p.D183N|AMPD3_uc001min.1_Missense_Mutation_p.D351N|AMPD3_uc009yfw.1_RNA|AMPD3_uc009yfz.2_RNA|AMPD3_uc001mip.1_Missense_Mutation_p.D349N|AMPD3_uc009yfy.2_Missense_Mutation_p.D342N	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B	342					AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		GACGGAGCCTGACAGGACTGT	0.602													21	90	---	---	---	---	PASS
AMPD3	272	broad.mit.edu	37	11	10526199	10526199	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10526199C>T	uc001mio.1	+	14	2455	c.2120C>T	c.(2119-2121)TCG>TTG	p.S707L	AMPD3_uc010rbz.1_Missense_Mutation_p.S548L|AMPD3_uc001min.1_Missense_Mutation_p.S716L|AMPD3_uc009yfw.1_RNA|AMPD3_uc009yfz.2_RNA|AMPD3_uc001mip.1_Missense_Mutation_p.S714L|AMPD3_uc009yfy.2_Missense_Mutation_p.S707L	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B	707					AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		AGCGGCCTCTCGCATCAGGTA	0.438													14	60	---	---	---	---	PASS
MRGPRX4	117196	broad.mit.edu	37	11	18195510	18195510	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18195510G>A	uc001mnv.1	+	1	1127	c.707G>A	c.(706-708)GGG>GAG	p.G236E		NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	236	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						GGCATTCTGGGGGCCCTAATT	0.532													9	51	---	---	---	---	PASS
KCNA4	3739	broad.mit.edu	37	11	30033613	30033613	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30033613G>T	uc001msk.2	-	2	1765	c.613C>A	c.(613-615)CCT>ACT	p.P205T		NM_002233	NP_002224	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related	205						voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CTCTTTTCAGGGTCTCCCAAC	0.453													8	55	---	---	---	---	PASS
MYBPC3	4607	broad.mit.edu	37	11	47355472	47355472	+	Splice_Site	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47355472C>T	uc001nfa.3	-	27	3049	c.2994_splice	c.e27+1	p.Q998_splice		NM_000256	NP_000247	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac						cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding			ovary(2)|central_nervous_system(1)	3				Lung(87;0.176)		GCCAGTCCCACCTGGAAAGGG	0.597													3	8	---	---	---	---	PASS
CTNND1	1500	broad.mit.edu	37	11	57575873	57575873	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57575873C>T	uc001nmc.3	+	14	2674	c.2103C>T	c.(2101-2103)TAC>TAT	p.Y701Y	CTNND1_uc001nlh.1_Silent_p.Y701Y|CTNND1_uc001nlu.3_Silent_p.Y594Y|CTNND1_uc001nlt.3_Silent_p.Y594Y|CTNND1_uc001nls.3_Silent_p.Y594Y|CTNND1_uc001nlw.3_Silent_p.Y594Y|CTNND1_uc001nmf.3_Silent_p.Y701Y|CTNND1_uc001nmd.3_Silent_p.Y647Y|CTNND1_uc001nlk.3_Silent_p.Y647Y|CTNND1_uc001nme.3_Silent_p.Y695Y|CTNND1_uc001nll.3_Silent_p.Y641Y|CTNND1_uc001nmg.3_Silent_p.Y641Y|CTNND1_uc001nlj.3_Silent_p.Y641Y|CTNND1_uc001nlr.3_Silent_p.Y641Y|CTNND1_uc001nlp.3_Silent_p.Y641Y|CTNND1_uc001nlx.3_Silent_p.Y378Y|CTNND1_uc001nlz.3_Silent_p.Y378Y|CTNND1_uc009ymn.2_Silent_p.Y372Y|CTNND1_uc001nlm.3_Silent_p.Y695Y|CTNND1_uc001nly.3_Silent_p.Y372Y|CTNND1_uc001nmb.3_Silent_p.Y372Y|CTNND1_uc001nma.3_Silent_p.Y372Y|CTNND1_uc001nmi.3_Silent_p.Y600Y|CTNND1_uc001nmh.3_Silent_p.Y695Y|CTNND1_uc001nlq.3_Silent_p.Y600Y|CTNND1_uc001nln.3_Silent_p.Y695Y|CTNND1_uc001nli.3_Silent_p.Y695Y|CTNND1_uc001nlo.3_Silent_p.Y594Y|CTNND1_uc001nlv.3_Silent_p.Y594Y	NM_001085458	NP_001078927	O60716	CTND1_HUMAN	catenin, delta 1 isoform 1ABC	701	ARM 8.				adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)				ATGGTCGATACATCCGCTCTG	0.443													36	98	---	---	---	---	PASS
RELA	5970	broad.mit.edu	37	11	65427630	65427630	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65427630C>G	uc001ofg.2	-	5	532	c.392G>C	c.(391-393)AGT>ACT	p.S131T	RELA_uc001ofh.2_Missense_Mutation_p.S131T|RELA_uc010ron.1_Missense_Mutation_p.S142T|RELA_uc009yqr.2_Missense_Mutation_p.S78T|RELA_uc001ofe.2_Missense_Mutation_p.S131T|RELA_uc001off.2_Missense_Mutation_p.S131T|RELA_uc009yqs.1_5'Flank	NM_021975	NP_068810	Q04206	TF65_HUMAN	v-rel reticuloendotheliosis viral oncogene	131	RHD.				anti-apoptosis|cellular defense response|cytokine-mediated signaling pathway|defense response to virus|inflammatory response|innate immune response|interspecies interaction between organisms|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription, DNA-dependent|nerve growth factor receptor signaling pathway|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of inflammatory response|response to interleukin-1|response to UV-B|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|transcription factor complex	activating transcription factor binding|chromatin binding|identical protein binding|NF-kappaB binding|phosphate binding|protein kinase binding|protein N-terminus binding|repressing transcription factor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|ubiquitin protein ligase binding			lung(3)|ovary(1)	4						GATGCGCTGACTGATAGCCTG	0.612													28	80	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92532480	92532480	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92532480A>T	uc001pdj.3	+	9	6318	c.6301A>T	c.(6301-6303)ACT>TCT	p.T2101S		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2101	Cadherin 19.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGAACCCGGGACTCTGATTTA	0.458										TCGA Ovarian(4;0.039)			5	29	---	---	---	---	PASS
C11orf70	85016	broad.mit.edu	37	11	101946619	101946619	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101946619G>C	uc001pgp.2	+	5	479	c.451G>C	c.(451-453)GAC>CAC	p.D151H	C11orf70_uc001pgo.2_Missense_Mutation_p.R95T|C11orf70_uc001pgq.2_Missense_Mutation_p.D113H	NM_032930	NP_116319	Q9BRQ4	CK070_HUMAN	hypothetical protein LOC85016	151										skin(1)	1	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0335)		GCTAGTGGAAGACTCAGAAAA	0.313													17	101	---	---	---	---	PASS
KDELC2	143888	broad.mit.edu	37	11	108357165	108357165	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108357165G>A	uc001pkj.2	-	3	469	c.403C>T	c.(403-405)CCA>TCA	p.P135S	KDELC2_uc001pki.2_Missense_Mutation_p.P79S	NM_153705	NP_714916	Q7Z4H8	KDEL2_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 2 precursor	135						endoplasmic reticulum lumen				ovary(1)	1		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;6.93e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;0.00016)|OV - Ovarian serous cystadenocarcinoma(223;0.132)|Colorectal(284;0.14)		TGGTACACTGGTCCTAGGGAA	0.468													13	66	---	---	---	---	PASS
TECTA	7007	broad.mit.edu	37	11	121028738	121028738	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121028738C>T	uc010rzo.1	+	13	4494	c.4494C>T	c.(4492-4494)TTC>TTT	p.F1498F		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	1498	VWFD 4.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TCCGCACCTTCGACGGCGCCT	0.642													23	18	---	---	---	---	PASS
SCN3B	55800	broad.mit.edu	37	11	123513295	123513295	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123513295C>T	uc001pza.1	-	4	711	c.304G>A	c.(304-306)GAC>AAC	p.D102N	SCN3B_uc001pzb.1_Missense_Mutation_p.D102N	NM_001040151	NP_001035241	Q9NY72	SCN3B_HUMAN	voltage-gated sodium channel beta-3 subunit	102	Ig-like C2-type.|Extracellular (Potential).				axon guidance	integral to membrane|plasma membrane	voltage-gated sodium channel activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)		ATGGACACGTCCTGCAGGTCC	0.572													44	111	---	---	---	---	PASS
IQSEC3	440073	broad.mit.edu	37	12	250351	250351	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:250351G>A	uc001qhw.1	+	2	1150	c.1144G>A	c.(1144-1146)GGT>AGT	p.G382S	IQSEC3_uc001qhu.1_Missense_Mutation_p.G382S|uc001qhv.1_RNA	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	685	SEC7.				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		CACCCCCATCGGTGTGGCCCA	0.602													22	123	---	---	---	---	PASS
CCDC77	84318	broad.mit.edu	37	12	549899	549899	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:549899G>C	uc001qig.2	+	11	1338	c.1158G>C	c.(1156-1158)GAG>GAC	p.E386D	CCDC77_uc009zdk.2_Missense_Mutation_p.E354D|CCDC77_uc010sdp.1_Missense_Mutation_p.E354D|CCDC77_uc010sdq.1_Missense_Mutation_p.E354D	NM_032358	NP_115734	Q9BR77	CCD77_HUMAN	coiled-coil domain containing 77 isoform a	386	Potential.					centrosome				ovary(1)	1	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)			TGAGGAGAGAGATCTTCAAGG	0.453													16	77	---	---	---	---	PASS
NCAPD2	9918	broad.mit.edu	37	12	6638690	6638690	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6638690C>G	uc001qoo.2	+	28	3630	c.3584C>G	c.(3583-3585)TCC>TGC	p.S1195C	NCAPD2_uc010sfd.1_Missense_Mutation_p.S1150C	NM_014865	NP_055680	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	1195					cell division|mitotic chromosome condensation	condensin core heterodimer|cytoplasm	histone binding			ovary(2)|lung(1)|breast(1)|kidney(1)	5						CAGCTCCTCTCCTACATCACC	0.597													31	81	---	---	---	---	PASS
KLRB1	3820	broad.mit.edu	37	12	9754178	9754178	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9754178G>C	uc010sgt.1	-	2	165	c.103C>G	c.(103-105)CCT>GCT	p.P35A		NM_002258	NP_002249	Q12918	KLRB1_HUMAN	killer cell lectin-like receptor subfamily B,	35	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	sugar binding|transmembrane receptor activity				0						TGATGCCAAGGTGAACCCTGA	0.363													8	60	---	---	---	---	PASS
KLRC3	3823	broad.mit.edu	37	12	10588420	10588420	+	Missense_Mutation	SNP	C	G	G	rs147031208		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10588420C>G	uc001qyh.2	-	1	173	c.166G>C	c.(166-168)GAT>CAT	p.D56H	KLRC2_uc010she.1_Missense_Mutation_p.D56H|KLRC2_uc001qyk.2_Missense_Mutation_p.D56H	NM_002261	NP_002252	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C,	56	Cytoplasmic (Potential).				cellular defense response	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|skin(1)	3						TATATTTTATCAATCCCTTGA	0.343													29	201	---	---	---	---	PASS
KIAA0528	9847	broad.mit.edu	37	12	22637741	22637741	+	Silent	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22637741G>A	uc001rfq.2	-	13	1668	c.1440C>T	c.(1438-1440)CTC>CTT	p.L480L	KIAA0528_uc010sir.1_Silent_p.L295L|KIAA0528_uc010sis.1_Silent_p.L480L|KIAA0528_uc010sit.1_Silent_p.L482L|KIAA0528_uc010siu.1_Silent_p.L480L|KIAA0528_uc001rfr.2_Silent_p.L471L|KIAA0528_uc009ziy.1_Silent_p.L482L	NM_014802	NP_055617	Q86YS7	K0528_HUMAN	hypothetical protein LOC9847	480							protein binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						AGCAATATGTGAGATGAGCTG	0.338													34	86	---	---	---	---	PASS
KIAA0528	9847	broad.mit.edu	37	12	22637746	22637746	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22637746G>A	uc001rfq.2	-	13	1663	c.1435C>T	c.(1435-1437)CAT>TAT	p.H479Y	KIAA0528_uc010sir.1_Missense_Mutation_p.H294Y|KIAA0528_uc010sis.1_Missense_Mutation_p.H479Y|KIAA0528_uc010sit.1_Missense_Mutation_p.H481Y|KIAA0528_uc010siu.1_Missense_Mutation_p.H479Y|KIAA0528_uc001rfr.2_Missense_Mutation_p.H470Y|KIAA0528_uc009ziy.1_Missense_Mutation_p.H481Y	NM_014802	NP_055617	Q86YS7	K0528_HUMAN	hypothetical protein LOC9847	479							protein binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						TATGTGAGATGAGCTGGAAAT	0.333													33	82	---	---	---	---	PASS
LRMP	4033	broad.mit.edu	37	12	25243095	25243095	+	Silent	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25243095G>A	uc001rgh.2	+	13	1604	c.570G>A	c.(568-570)TTG>TTA	p.L190L	LRMP_uc010sja.1_Silent_p.L190L|LRMP_uc010sjb.1_Silent_p.L137L|LRMP_uc001rgi.2_RNA|LRMP_uc010sjc.1_Silent_p.L190L|LRMP_uc010sjd.1_Silent_p.L137L	NM_006152	NP_006143	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein	246	Potential.|Cytoplasmic (Potential).				vesicle fusion|vesicle targeting	endoplasmic reticulum membrane|integral to plasma membrane				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					AAGAAAATTTGAAGAAAGAAA	0.313													57	91	---	---	---	---	PASS
C12orf40	283461	broad.mit.edu	37	12	40114814	40114814	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40114814G>T	uc001rmc.2	+	13	1887	c.1720G>T	c.(1720-1722)GCC>TCC	p.A574S	C12orf40_uc009zjv.1_Intron	NM_001031748	NP_001026918	Q86WS4	CL040_HUMAN	hypothetical protein LOC283461	574										ovary(6)	6						GTGCAATTCAGCCCACATTTT	0.383													16	70	---	---	---	---	PASS
SLC11A2	4891	broad.mit.edu	37	12	51399230	51399230	+	Intron	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51399230G>T	uc001rxe.3	-						SLC11A2_uc001rxd.3_Intron|SLC11A2_uc001rxc.3_Intron|SLC11A2_uc001rxf.2_Intron|SLC11A2_uc010smx.1_Intron|SLC11A2_uc001rxh.1_Intron|SLC11A2_uc001rxj.1_Intron|SLC11A2_uc001rxi.2_Intron|SLC11A2_uc001rxk.1_Intron|SLC11A2_uc010smy.1_Intron	NM_000617	NP_000608	P49281	NRAM2_HUMAN	solute carrier family 11 (proton-coupled						activation of caspase activity|cellular iron ion homeostasis|cellular response to oxidative stress|detection of oxygen|ferrous iron import|multicellular organismal iron ion homeostasis|response to hypoxia|response to iron ion	apical plasma membrane|basal part of cell|cell surface|cytoplasmic vesicle|early endosome|late endosome|late endosome membrane|lysosomal membrane|lysosome|nucleus|paraferritin complex|perinuclear region of cytoplasm|perinuclear region of cytoplasm|plasma membrane|recycling endosome|trans-Golgi network	cadmium ion transmembrane transporter activity|cadmium ion transmembrane transporter activity|cobalt ion transmembrane transporter activity|copper ion transmembrane transporter activity|ferrous iron transmembrane transporter activity|ferrous iron transmembrane transporter activity|lead ion transmembrane transporter activity|lead ion transmembrane transporter activity|manganese ion transmembrane transporter activity|manganese ion transmembrane transporter activity|nickel ion transmembrane transporter activity|protein binding|solute:hydrogen symporter activity|vanadium ion transmembrane transporter activity|zinc ion transmembrane transporter activity			large_intestine(1)	1						CTGTACAAGAGAGGAAAAGAG	0.383													4	70	---	---	---	---	PASS
SCN8A	6334	broad.mit.edu	37	12	52162811	52162811	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52162811C>G	uc001ryw.2	+	17	3242	c.3064C>G	c.(3064-3066)CAC>GAC	p.H1022D	SCN8A_uc010snl.1_Missense_Mutation_p.H887D	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	1022					axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	CATGCAGGCCCACTTTAAGCA	0.517													8	37	---	---	---	---	PASS
PMCH	5367	broad.mit.edu	37	12	102590466	102590466	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102590466C>T	uc001tjl.2	-	3	528	c.462G>A	c.(460-462)ATG>ATA	p.M154I	C12orf48_uc001tjg.2_3'UTR|C12orf48_uc010swa.1_3'UTR|C12orf48_uc001tjf.2_3'UTR|C12orf48_uc001tjh.2_3'UTR|C12orf48_uc010swb.1_3'UTR|C12orf48_uc009zuc.2_3'UTR|C12orf48_uc001tjj.2_3'UTR|C12orf48_uc001tjk.2_3'UTR|C12orf48_uc009zud.2_3'UTR	NM_002674	NP_002665	P20382	MCH_HUMAN	pro-melanin-concentrating hormone	154					cell differentiation|neuropeptide signaling pathway|spermatogenesis|synaptic transmission		melanin-concentrating hormone activity				0						CTCTTCCCAGCATACATCTGA	0.343													86	201	---	---	---	---	PASS
BCL7A	605	broad.mit.edu	37	12	122473336	122473336	+	Intron	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122473336G>A	uc001ubp.2	+						BCL7A_uc001ubo.2_Intron	NM_001024808	NP_001019979	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A isoform b						negative regulation of transcription, DNA-dependent					ovary(1)|lung(1)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		CATGCATGGTGAGTGCCCATG	0.547			T	MYC	BNHL								9	26	---	---	---	---	PASS
PIWIL1	9271	broad.mit.edu	37	12	130841573	130841573	+	Silent	SNP	T	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130841573T>C	uc001uik.2	+	13	1605	c.1515T>C	c.(1513-1515)TAT>TAC	p.Y505Y	PIWIL1_uc001uij.1_Silent_p.Y505Y	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	505					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		GAAGAAATTATGAAGCAGCCA	0.358													16	43	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	28897007	28897007	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28897007T>C	uc001usb.3	-	21	3158	c.2873A>G	c.(2872-2874)GAT>GGT	p.D958G	FLT1_uc010aap.2_5'Flank|FLT1_uc010aaq.2_Missense_Mutation_p.D83G|FLT1_uc001usa.3_Missense_Mutation_p.D176G	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	958	Cytoplasmic (Potential).|Protein kinase.				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	GGTGACGCTATCTAGTCTTGG	0.478													37	207	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101763505	101763505	+	Silent	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101763505G>A	uc001vox.1	-	19	2454	c.2265C>T	c.(2263-2265)AGC>AGT	p.S755S		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	755	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GATGCTGCACGCTGAGGATTG	0.512													34	287	---	---	---	---	PASS
RGS6	9628	broad.mit.edu	37	14	72985064	72985064	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72985064G>T	uc001xna.3	+	15	1620	c.1097G>T	c.(1096-1098)TGG>TTG	p.W366L	RGS6_uc010ttn.1_Missense_Mutation_p.W366L|RGS6_uc001xmx.3_Missense_Mutation_p.W366L|RGS6_uc010tto.1_RNA|RGS6_uc001xmy.3_Missense_Mutation_p.W366L|RGS6_uc010ttp.1_Missense_Mutation_p.W297L|RGS6_uc001xmz.1_Missense_Mutation_p.W227L	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6	366	RGS.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		TTCAGGTTCTGGCTGGCTGTC	0.537													3	51	---	---	---	---	PASS
PAPLN	89932	broad.mit.edu	37	14	73729546	73729546	+	Intron	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73729546C>A	uc010ttx.1	+						PAPLN_uc001xnw.3_Intron|PAPLN_uc010arl.2_Intron|PAPLN_uc010ttw.1_Intron|PAPLN_uc010tty.1_Intron|PAPLN_uc010arm.2_Intron|PAPLN_uc010arn.2_Intron	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin							proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		GTGAGGCCCACCTTCCCCAGG	0.647													5	10	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	22482893	22482893	+	IGR	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22482893G>T								OR4N3P (68508 upstream) : MIR1268 (30336 downstream)																							GCTCCGTGTAGGCTGTGCTCA	0.522													42	259	---	---	---	---	PASS
OCA2	4948	broad.mit.edu	37	15	28202861	28202861	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28202861C>T	uc001zbh.3	-	16	1767	c.1657G>A	c.(1657-1659)GTC>ATC	p.V553I	OCA2_uc010ayv.2_Missense_Mutation_p.V529I	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	553	Cytoplasmic (Potential).				eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		AGGCGCCAGACGTGAATCTCG	0.617									Oculocutaneous_Albinism				15	35	---	---	---	---	PASS
NUSAP1	51203	broad.mit.edu	37	15	41650394	41650394	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41650394G>C	uc001zns.3	+	6	828	c.598G>C	c.(598-600)GAT>CAT	p.D200H	NUSAP1_uc001znq.3_Missense_Mutation_p.D5H|NUSAP1_uc001znr.3_Missense_Mutation_p.D200H|NUSAP1_uc010bce.2_Missense_Mutation_p.D200H|NUSAP1_uc001znt.3_Missense_Mutation_p.D185H|NUSAP1_uc001znv.3_Missense_Mutation_p.D199H|NUSAP1_uc001znu.3_Missense_Mutation_p.D199H|NUSAP1_uc010ucw.1_Missense_Mutation_p.D177H|NUSAP1_uc001znw.3_Missense_Mutation_p.D5H	NM_016359	NP_057443	Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1	200					cytokinesis after mitosis|establishment of mitotic spindle localization|mitotic chromosome condensation|positive regulation of mitosis	chromosome|cytoplasm|nucleolus	DNA binding				0		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		GGAGTCCATTGATCAATATAT	0.264													11	45	---	---	---	---	PASS
CEP152	22995	broad.mit.edu	37	15	49030440	49030440	+	3'UTR	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49030440C>T	uc001zwy.2	-	26					CEP152_uc001zwz.2_3'UTR	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa						centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		AAATACTGTACCATAATTAGT	0.343													8	33	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63084980	63084980	+	Silent	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63084980G>C	uc002alb.3	+	43	5877	c.5877G>C	c.(5875-5877)ACG>ACC	p.T1959T	TLN2_uc002alc.3_Silent_p.T352T	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1959					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						GTGCCGTCACGGAAAAGGTAA	0.562													9	32	---	---	---	---	PASS
SGK269	79834	broad.mit.edu	37	15	77471165	77471165	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77471165G>C	uc002bcm.2	-	3	3412	c.3104C>G	c.(3103-3105)TCT>TGT	p.S1035C	SGK269_uc002bcn.2_Missense_Mutation_p.S1035C	NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	1035			S -> F (in a metastatic melanoma sample; somatic mutation).		cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	p.S1035F(1)			0				STAD - Stomach adenocarcinoma(199;0.124)		TGATGGAGAAGAATGACTCCT	0.403													23	58	---	---	---	---	PASS
MEF2A	4205	broad.mit.edu	37	15	100246988	100246988	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100246988G>A	uc010urw.1	+	9	1302	c.943G>A	c.(943-945)GTG>ATG	p.V315M	MEF2A_uc010urv.1_Missense_Mutation_p.V245M|MEF2A_uc010bos.2_Missense_Mutation_p.V305M|MEF2A_uc002bvf.2_Missense_Mutation_p.V307M|MEF2A_uc002bve.2_Missense_Mutation_p.V313M|MEF2A_uc002bvg.2_Missense_Mutation_p.V305M|MEF2A_uc002bvi.2_Missense_Mutation_p.V305M|MEF2A_uc010bot.2_Missense_Mutation_p.V237M	NM_005587	NP_005578	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A isoform 1	315					apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			TACCCCAGTCGTGTCTGTGAC	0.498													12	33	---	---	---	---	PASS
BTBD12	84464	broad.mit.edu	37	16	3658855	3658855	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3658855G>T	uc002cvp.2	-	2	738	c.111C>A	c.(109-111)AGC>AGA	p.S37R	BTBD12_uc002cvq.1_Missense_Mutation_p.S37R	NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	37	Interaction with C20orf94, ERCC4 and MSH2.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						CAGTTTTAAGGCTTTCAGGCT	0.468								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				19	120	---	---	---	---	PASS
POLR3E	55718	broad.mit.edu	37	16	22319508	22319508	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22319508C>A	uc002dkk.2	+	4	283	c.127C>A	c.(127-129)CCG>ACG	p.P43T	POLR3E_uc002dkj.1_Missense_Mutation_p.P43T|POLR3E_uc002dkm.2_Missense_Mutation_p.P7T|POLR3E_uc010vbr.1_Missense_Mutation_p.P43T|POLR3E_uc002dkl.2_Missense_Mutation_p.P43T|POLR3E_uc010vbs.1_Intron|POLR3E_uc010vbt.1_Missense_Mutation_p.F3L	NM_018119	NP_060589	Q9NVU0	RPC5_HUMAN	RNA polymerase III polypeptide E	43					innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA-directed RNA polymerase activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.012)		CGATGACATTCCGCACCTCTC	0.627													14	74	---	---	---	---	PASS
CNGB1	1258	broad.mit.edu	37	16	57951265	57951265	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57951265C>A	uc002emt.2	-	21	2138	c.2073G>T	c.(2071-2073)TGG>TGT	p.W691C	CNGB1_uc010cdh.2_Missense_Mutation_p.W685C	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform	691	Helical; Name=H2; (Potential).				sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						CCATCAGCAGCCAGTGGTGGA	0.557													20	86	---	---	---	---	PASS
FUK	197258	broad.mit.edu	37	16	70500096	70500096	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70500096C>G	uc002eyy.2	+	5	405	c.347C>G	c.(346-348)CCC>CGC	p.P116R	FUK_uc010vmb.1_Missense_Mutation_p.P99R|FUK_uc010cft.2_Missense_Mutation_p.P148R|FUK_uc002eyz.2_Intron	NM_145059	NP_659496	Q8N0W3	FUK_HUMAN	fucokinase	116						cytoplasm	ATP binding|fucokinase activity			ovary(1)	1		Ovarian(137;0.0694)				GTGGAGAACCCCGAGGCCCCC	0.637													41	55	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72845910	72845910	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72845910A>C	uc002fck.2	-	6	4230	c.3557T>G	c.(3556-3558)CTG>CGG	p.L1186R	ZFHX3_uc002fcl.2_Missense_Mutation_p.L272R	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	1186				EEAIEDVEGPSETAADPEELAKDQEGGASSSQAEKELTDSP -> GEWSHRHGRPRLGLGVHLLETSRGLLFEGDVTDPAGPH VPY (in Ref. 5).	muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				AGAATCTGTCAGCTCCTTCTC	0.522													23	54	---	---	---	---	PASS
RFWD3	55159	broad.mit.edu	37	16	74695345	74695345	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74695345C>A	uc002fda.2	-	2	101	c.3G>T	c.(1-3)ATG>ATT	p.M1I	RFWD3_uc010cgq.2_Missense_Mutation_p.M1I	NM_018124	NP_060594	Q6PCD5	RFWD3_HUMAN	ring finger and WD repeat domain 3	1					DNA repair|mitotic cell cycle G1/S transition DNA damage checkpoint|response to ionizing radiation	nucleus	MDM2 binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|breast(1)	3						CTTCATGAGCCATCACTAGAG	0.393													67	206	---	---	---	---	PASS
TRPV1	7442	broad.mit.edu	37	17	3474819	3474819	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3474819T>A	uc010vrr.1	-	14	2873	c.2346A>T	c.(2344-2346)AGA>AGT	p.R782S	TRPV1_uc010vro.1_Missense_Mutation_p.R793S|TRPV1_uc010vrp.1_Missense_Mutation_p.R722S|TRPV1_uc010vrq.1_Missense_Mutation_p.R780S|TRPV1_uc010vrs.1_Missense_Mutation_p.R782S|TRPV1_uc010vrt.1_Missense_Mutation_p.R782S|TRPV1_uc010vru.1_Missense_Mutation_p.R782S	NM_080706	NP_542437	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel,	782	Interaction with calmodulin (By similarity).|Cytoplasmic (Potential).|Required for PIP2-mediated channel inhibition (By similarity).				cell surface receptor linked signaling pathway|chemosensory behavior|thermoception	cell junction|dendritic spine membrane|integral to plasma membrane|postsynaptic membrane	ATP binding|calcium channel activity|calmodulin binding			ovary(1)	1				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	ACGCCTCACCTCTGCTTGACC	0.642													7	5	---	---	---	---	PASS
AIPL1	23746	broad.mit.edu	37	17	6337412	6337412	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6337412A>C	uc002gcp.2	-	2	198	c.103T>G	c.(103-105)TTT>GTT	p.F35V	AIPL1_uc002gcq.2_Intron|AIPL1_uc002gcr.2_Missense_Mutation_p.F35V|AIPL1_uc010clk.2_Intron|AIPL1_uc010cll.2_Missense_Mutation_p.F35V|AIPL1_uc002gcs.2_Missense_Mutation_p.F35V	NM_014336	NP_055151	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting	35					protein farnesylation|protein folding|visual perception	cytoplasm|nucleus	farnesylated protein binding|unfolded protein binding				0				COAD - Colon adenocarcinoma(228;0.141)		CGGAAATGAAAGATCACCTAG	0.567													7	15	---	---	---	---	PASS
PHF23	79142	broad.mit.edu	37	17	7139897	7139897	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7139897A>C	uc002gfa.2	-	4	576	c.349T>G	c.(349-351)TCT>GCT	p.S117A	DVL2_uc002gez.1_5'Flank|DVL2_uc010vtr.1_5'Flank|DVL2_uc010clz.1_5'Flank|PHF23_uc010vtt.1_Intron|PHF23_uc010cma.2_5'UTR	NM_024297	NP_077273	Q9BUL5	PHF23_HUMAN	PHD finger protein 23	117							zinc ion binding				0						TGCAGACGAGAGAAAGTGGAC	0.527													55	100	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578457	7578457	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578457C>T	uc002gim.2	-	5	667	c.473G>A	c.(472-474)CGC>CAC	p.R158H	TP53_uc002gig.1_Missense_Mutation_p.R158H|TP53_uc002gih.2_Missense_Mutation_p.R158H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R26H|TP53_uc010cng.1_Missense_Mutation_p.R26H|TP53_uc002gii.1_Missense_Mutation_p.R26H|TP53_uc010cnh.1_Missense_Mutation_p.R158H|TP53_uc010cni.1_Missense_Mutation_p.R158H|TP53_uc002gij.2_Missense_Mutation_p.R158H|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R65H|TP53_uc002gio.2_Missense_Mutation_p.R26H|TP53_uc010vug.1_Missense_Mutation_p.R119H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	158	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R158H(58)|p.R158L(55)|p.R158C(17)|p.R158G(10)|p.R158P(9)|p.0?(7)|p.R158R(6)|p.R158fs*12(5)|p.R158_A159insX(4)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.R158fs*11(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.R158F(1)|p.P151_V173del23(1)|p.R158fs*24(1)|p.R65L(1)|p.R156_R158delRVR(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.R158_A159insXX(1)|p.V157_M160delVRAM(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.R26L(1)|p.V157fs*21(1)|p.R158fs*8(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCCATGGCGCGGACGCGGGT	0.627		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			36	45	---	---	---	---	PASS
ERBB2	2064	broad.mit.edu	37	17	37864713	37864713	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37864713C>T	uc002hso.2	+	3	603	c.365C>T	c.(364-366)CCG>CTG	p.P122L	ERBB2_uc002hsm.2_Missense_Mutation_p.P92L|ERBB2_uc010cwa.2_Missense_Mutation_p.P107L|ERBB2_uc002hsp.2_5'UTR|ERBB2_uc010cwb.2_Missense_Mutation_p.P122L|ERBB2_uc010wek.1_Intron|ERBB2_uc002hsl.2_Missense_Mutation_p.P92L|ERBB2_uc002hsn.1_Missense_Mutation_p.P122L	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	122	Extracellular (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	AATGGAGACCCGCTGAACAAT	0.602		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			62	93	---	---	---	---	PASS
DLX4	1748	broad.mit.edu	37	17	48050472	48050472	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48050472G>T	uc002ipv.2	+	2	590	c.319G>T	c.(319-321)GAG>TAG	p.E107*	DLX4_uc002ipw.2_Nonsense_Mutation_p.E35*	NM_138281	NP_612138	Q92988	DLX4_HUMAN	distal-less homeobox 4 isoform a	107					multicellular organismal development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GGAACCCTCCGAGCGGCGCCC	0.662													15	19	---	---	---	---	PASS
ANKRD12	23253	broad.mit.edu	37	18	9254528	9254528	+	Silent	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9254528C>G	uc002knv.2	+	9	1520	c.1263C>G	c.(1261-1263)GTC>GTG	p.V421V	ANKRD12_uc002knw.2_Silent_p.V398V|ANKRD12_uc002knx.2_Silent_p.V398V|ANKRD12_uc010dkx.1_Silent_p.V128V	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	421						nucleus				ovary(2)|central_nervous_system(1)	3						CATCTAGGGTCTTATATTCAA	0.323													25	152	---	---	---	---	PASS
KIAA1632	57724	broad.mit.edu	37	18	43510806	43510806	+	Intron	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43510806C>A	uc002lbm.2	-						KIAA1632_uc002lbo.1_Intron	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724						autophagy						0						TCTGCAAGTTCATATCAAGAA	0.333													9	29	---	---	---	---	PASS
KIAA1468	57614	broad.mit.edu	37	18	59942704	59942704	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59942704G>A	uc002lil.2	+	22	3180	c.2965G>A	c.(2965-2967)GAG>AAG	p.E989K	KIAA1468_uc002lik.1_Missense_Mutation_p.E985K|KIAA1468_uc010xel.1_Missense_Mutation_p.E989K|KIAA1468_uc002lim.2_Missense_Mutation_p.E667K	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614	989							binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				TAGAATGTTTGAGGTATGTCA	0.363													13	56	---	---	---	---	PASS
SOCS6	9306	broad.mit.edu	37	18	67993357	67993357	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67993357G>A	uc002lkr.1	+	2	1769	c.1453G>A	c.(1453-1455)GTC>ATC	p.V485I	SOCS6_uc010dqq.2_Missense_Mutation_p.V485I	NM_004232	NP_004223	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	485	SH2.				defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm				large_intestine(1)|lung(1)	2		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				AACTTACCCCGTCAGACTGAC	0.458													15	73	---	---	---	---	PASS
KCNG2	26251	broad.mit.edu	37	18	77659474	77659474	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77659474C>G	uc010xfl.1	+	2	1059	c.1059C>G	c.(1057-1059)TTC>TTG	p.F353L		NM_012283	NP_036415	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G,	353					energy reserve metabolic process|regulation of heart contraction|regulation of insulin secretion	voltage-gated potassium channel complex	delayed rectifier potassium channel activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		GCCGCGACTTCTCCAGCGTGC	0.716													5	20	---	---	---	---	PASS
SBNO2	22904	broad.mit.edu	37	19	1108809	1108809	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1108809C>T	uc002lrk.3	-	31	3823	c.3585G>A	c.(3583-3585)CGG>CGA	p.R1195R	SBNO2_uc002lri.3_5'UTR|SBNO2_uc002lrj.3_Silent_p.R1138R|SBNO2_uc010dse.2_Silent_p.R1178R|SBNO2_uc010xgj.1_Intron	NM_014963	NP_055778	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 isoform 1	1195					macrophage activation involved in immune response|negative regulation of transcription, DNA-dependent|regulation of inflammatory response|transcription, DNA-dependent						0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGTCTTCAGCCGCACGATCT	0.716													9	12	---	---	---	---	PASS
KIAA1543	57662	broad.mit.edu	37	19	7671655	7671655	+	Intron	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7671655G>A	uc002mgv.3	+						KIAA1543_uc002mgu.3_Intron	NM_020902	NP_065953	Q9P1Y5	CAMP3_HUMAN	NEZHA isoform 2						epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1						CTGCCTCTCTGGCCTCAGTGC	0.587													14	42	---	---	---	---	PASS
KANK3	256949	broad.mit.edu	37	19	8389685	8389685	+	Silent	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8389685G>A	uc010dwa.2	-	9	2178	c.2112C>T	c.(2110-2112)ATC>ATT	p.I704I		NM_198471	NP_940873	Q6NY19	KANK3_HUMAN	ankyrin repeat domain 47	704	ANK 3.										0						GGCCATGGCTGATGGCCAGCA	0.637													23	63	---	---	---	---	PASS
ACTL9	284382	broad.mit.edu	37	19	8808794	8808794	+	Silent	SNP	G	T	T	rs141160056	by1000genomes	TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8808794G>T	uc002mkl.2	-	1	379	c.258C>A	c.(256-258)CCC>CCA	p.P86P		NM_178525	NP_848620	Q8TC94	ACTL9_HUMAN	actin-like 9	86						cytoplasm|cytoskeleton				large_intestine(2)|pancreas(1)	3						CCGAGGTGGCGGGTTTCTTGG	0.662													3	41	---	---	---	---	PASS
ZNF561	93134	broad.mit.edu	37	19	9727722	9727722	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9727722C>T	uc002mlu.2	-	4	445	c.240G>A	c.(238-240)GTG>GTA	p.V80V	ZNF561_uc010dwu.2_Silent_p.V11V|ZNF561_uc010xkr.1_5'UTR	NM_152289	NP_689502	Q8N587	ZN561_HUMAN	zinc finger protein 561	80	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TACTCTTACCCACAGAGGCCA	0.299													17	63	---	---	---	---	PASS
HOOK2	29911	broad.mit.edu	37	19	12878912	12878912	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12878912T>A	uc002muy.2	-	12	1301	c.1130A>T	c.(1129-1131)CAG>CTG	p.Q377L	HOOK2_uc010xmq.1_5'Flank|HOOK2_uc002muz.2_Missense_Mutation_p.Q377L	NM_013312	NP_037444	Q96ED9	HOOK2_HUMAN	hook homolog 2 isoform 1	377	Sufficient for interaction with microtubules.|Potential.				early endosome to late endosome transport|endocytosis|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|protein transport	centrosome|FHF complex|microtubule	identical protein binding|microtubule binding			ovary(1)|breast(1)|skin(1)	3						GGCCTCCTCCTGCCGCTGGCC	0.542													153	54	---	---	---	---	PASS
CASP14	23581	broad.mit.edu	37	19	15164318	15164318	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15164318G>C	uc010dzv.1	+	3	361	c.53G>C	c.(52-54)CGC>CCC	p.R18P	CASP14_uc002naf.2_Missense_Mutation_p.R18P	NM_012114	NP_036246	P31944	CASPE_HUMAN	caspase 14 precursor	18					apoptosis|cell differentiation|epidermis development|proteolysis	cytoplasm|nucleus	cysteine-type endopeptidase activity			skin(2)|ovary(1)|lung(1)	4						TCAGGTGCCCGCCTGGCCCTA	0.433													45	248	---	---	---	---	PASS
CYP4F12	66002	broad.mit.edu	37	19	15791259	15791259	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15791259C>T	uc002nbl.2	+	5	516	c.455C>T	c.(454-456)ACG>ATG	p.T152M	CYP4F12_uc010xoo.1_Missense_Mutation_p.T152M|CYP4F12_uc010xop.1_3'UTR	NM_023944	NP_076433			cytochrome P450, family 4, subfamily F,											skin(3)|ovary(2)|central_nervous_system(2)	7	Acute lymphoblastic leukemia(2;0.0367)					CGGATGCTGACGCCCGCCTTC	0.542													18	57	---	---	---	---	PASS
MYO9B	4650	broad.mit.edu	37	19	17265133	17265133	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17265133G>C	uc010eak.2	+	6	1259	c.1107G>C	c.(1105-1107)TTG>TTC	p.L369F	MYO9B_uc002nfi.2_Missense_Mutation_p.L369F|MYO9B_uc002nfj.1_Missense_Mutation_p.L369F	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	369	Myosin head-like.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						AGCATAACTTGAAGATTGAAG	0.567													26	138	---	---	---	---	PASS
ANO8	57719	broad.mit.edu	37	19	17442022	17442022	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17442022C>G	uc002ngf.2	-	7	865	c.706G>C	c.(706-708)GAC>CAC	p.D236H	ANO8_uc010eap.2_RNA	NM_020959	NP_066010	Q9HCE9	ANO8_HUMAN	anoctamin 8	236	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(3)	3						TCACAGATGTCATCTGCCAGG	0.572													60	65	---	---	---	---	PASS
TM6SF2	53345	broad.mit.edu	37	19	19381156	19381156	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19381156C>T	uc002nmd.1	-	3	345	c.295G>A	c.(295-297)GAG>AAG	p.E99K	HAPLN4_uc002nmc.2_5'UTR	NM_001001524	NP_001001524	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	99						integral to membrane					0			Epithelial(12;0.0151)			CCAAGTACCTCCTTGGTGTAG	0.607													70	31	---	---	---	---	PASS
CYP2A6	1548	broad.mit.edu	37	19	41352006	41352006	+	Intron	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41352006C>T	uc002opl.3	-						CYP2A6_uc010ehe.1_Intron|CYP2A6_uc010ehf.1_Intron	NM_000762	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A,						coumarin catabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|enzyme binding|heme binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Chlorzoxazone(DB00356)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Formoterol(DB00983)|Halothane(DB01159)|Letrozole(DB01006)|Methoxsalen(DB00553)|Metyrapone(DB01011)|Nicotine(DB00184)|Pilocarpine(DB01085)|Tolbutamide(DB01124)|Tranylcypromine(DB00752)	TCTCCTCCTGCAGGGAGAGGG	0.552													19	33	---	---	---	---	PASS
CBLC	23624	broad.mit.edu	37	19	45284515	45284515	+	Silent	SNP	T	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45284515T>C	uc002ozs.2	+	3	615	c.552T>C	c.(550-552)CCT>CCC	p.P184P	CBLC_uc010ejt.2_Silent_p.P184P	NM_012116	NP_036248	Q9ULV8	CBLC_HUMAN	Cas-Br-M (murine) ecotropic retroviral	184	EF-hand-like.|Cbl-PTB.				cell surface receptor linked signaling pathway|negative regulation of epidermal growth factor receptor activity|negative regulation of MAP kinase activity|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	calcium ion binding|epidermal growth factor receptor binding|phosphotyrosine binding|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|skin(1)	6	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				CCTGCCACCCTGTGGAACCAG	0.652			M		AML								4	113	---	---	---	---	PASS
NKPD1	284353	broad.mit.edu	37	19	45656363	45656363	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45656363C>T	uc010xxi.1	-	4	1332	c.1332G>A	c.(1330-1332)CTG>CTA	p.L444L		NM_198478	NP_940880			NTPase, KAP family P-loop domain containing 1												0		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		GGTAGATCTCCAGGAAGCACA	0.637													3	13	---	---	---	---	PASS
PRKCG	5582	broad.mit.edu	37	19	54395051	54395051	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54395051C>G	uc002qcq.1	+	6	935	c.653C>G	c.(652-654)ACG>AGG	p.T218R	PRKCG_uc010eqz.1_Missense_Mutation_p.T218R|PRKCG_uc010yef.1_Missense_Mutation_p.T218R|PRKCG_uc010yeg.1_Missense_Mutation_p.T218R|PRKCG_uc010yeh.1_Missense_Mutation_p.T105R	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	218	C2.				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		GTGAAAGCCACGCTAAACCCT	0.537													35	93	---	---	---	---	PASS
ZIM3	114026	broad.mit.edu	37	19	57647047	57647047	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57647047C>G	uc002qnz.1	-	5	1044	c.658G>C	c.(658-660)GAA>CAA	p.E220Q		NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	220					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TAGGGCCTTTCCTCTGCGTGA	0.428													48	156	---	---	---	---	PASS
CST8	10047	broad.mit.edu	37	20	23472426	23472426	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23472426C>T	uc002wth.1	+	2	479	c.122C>T	c.(121-123)TCA>TTA	p.S41L		NM_005492	NP_005483	O60676	CST8_HUMAN	cystatin 8 precursor	41						extracellular region	cysteine-type endopeptidase inhibitor activity				0	Colorectal(13;0.0431)|Lung NSC(19;0.235)					GTCAATGCCTCAAATGCCAAC	0.507													59	116	---	---	---	---	PASS
TTPAL	79183	broad.mit.edu	37	20	43108970	43108970	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43108970G>A	uc002xmc.1	+	3	455	c.331G>A	c.(331-333)GAA>AAA	p.E111K	TTPAL_uc002xmd.1_Missense_Mutation_p.E111K|TTPAL_uc010ggr.1_5'UTR	NM_024331	NP_077307	Q9BTX7	TTPAL_HUMAN	tocopherol (alpha) transfer protein-like	111						intracellular	transporter activity			breast(1)	1						AAGCTGGCCCGAAGTCTTCAA	0.577													14	85	---	---	---	---	PASS
UBE2C	11065	broad.mit.edu	37	20	44444263	44444263	+	Silent	SNP	G	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44444263G>A	uc002xpm.2	+	4	380	c.300G>A	c.(298-300)ACG>ACA	p.T100T	UBE2C_uc002xpl.2_Intron|UBE2C_uc002xpn.2_Silent_p.T61T|UBE2C_uc002xpo.2_Silent_p.T71T|UBE2C_uc002xpp.2_Intron|UBE2C_uc002xpq.2_Silent_p.T61T	NM_007019	NP_008950	O00762	UBE2C_HUMAN	ubiquitin-conjugating enzyme E2C isoform 1	100					activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cyclin catabolic process|exit from mitosis|free ubiquitin chain polymerization|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|positive regulation of exit from mitosis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|protein K48-linked ubiquitination|spindle organization	anaphase-promoting complex|cytosol|nucleoplasm	ATP binding|protein binding|ubiquitin-protein ligase activity				0		Myeloproliferative disorder(115;0.0122)				AGTTCCTCACGCCCTGCTATC	0.517													20	124	---	---	---	---	PASS
PHACTR3	116154	broad.mit.edu	37	20	58416495	58416495	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58416495C>T	uc002yau.2	+	11	1959	c.1492C>T	c.(1492-1494)CTG>TTG	p.L498L	PHACTR3_uc002yat.2_Silent_p.L495L|PHACTR3_uc010zzw.1_Silent_p.L457L|PHACTR3_uc002yav.2_Silent_p.L457L|PHACTR3_uc002yaw.2_Silent_p.L457L|PHACTR3_uc002yax.2_Silent_p.L387L|PHACTR3_uc002yay.2_Silent_p.L67L	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1	498	Required for PP1CA binding and inhibition of PP1 activity.|RPEL 4.					nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			CAGAAAAATTCTGATACGATT	0.403													8	66	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60893681	60893681	+	Silent	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60893681C>G	uc002ycq.2	-	53	7135	c.7068G>C	c.(7066-7068)CTG>CTC	p.L2356L		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	2356	Domain II and I.|Potential.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGAGGCTGCTCAGCTGCTCCT	0.667													23	29	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60893954	60893954	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60893954C>T	uc002ycq.2	-	52	7054	c.6987G>A	c.(6985-6987)CGG>CGA	p.R2329R		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	2329	Domain II and I.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCCCCAGGTCCCGGGCCCGCA	0.701													8	9	---	---	---	---	PASS
NTSR1	4923	broad.mit.edu	37	20	61341012	61341012	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61341012C>A	uc002ydf.2	+	1	824	c.453C>A	c.(451-453)TGC>TGA	p.C151*		NM_002531	NP_002522	P30989	NTR1_HUMAN	neurotensin receptor 1	151	Helical; Name=3; (Potential).					endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	neurotensin receptor activity, G-protein coupled			skin(2)|lung(1)|central_nervous_system(1)	4	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			GCGACGCCTGCACCTACGCCA	0.667													19	41	---	---	---	---	PASS
RGS19	10287	broad.mit.edu	37	20	62705589	62705589	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62705589C>T	uc002yhy.2	-	5	637	c.370G>A	c.(370-372)GAG>AAG	p.E124K	RGS19_uc002yhz.2_Missense_Mutation_p.E102K|RGS19_uc002yia.2_Missense_Mutation_p.E124K|RGS19_uc002yib.2_Missense_Mutation_p.E124K	NM_005873	NP_005864	P49795	RGS19_HUMAN	G protein signalling regulator 19	124	RGS.				autophagy|G-protein coupled receptor protein signaling pathway|negative regulation of signal transduction|small GTPase mediated signal transduction	Golgi apparatus|membrane fraction|plasma membrane	GTPase activator activity|protein binding|signal transducer activity			skin(1)	1	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					TTCAGCTCCTCGCAGGCCAAC	0.602													23	49	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	41719705	41719705	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41719705C>G	uc002yyq.1	-	6	1554	c.1102G>C	c.(1102-1104)GAA>CAA	p.E368Q	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	368	Extracellular (Potential).|Ig-like C2-type 4.				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				ATAAGGTTTTCGTGGTTGATC	0.512													107	181	---	---	---	---	PASS
CCT8L2	150160	broad.mit.edu	37	22	17071946	17071946	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17071946C>T	uc002zlp.1	-	1	1755	c.1495G>A	c.(1495-1497)GTC>ATC	p.V499I		NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN	T-complex protein 1	499					cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity			ovary(1)	1	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				TGGGCTTTGACTATTAGGGTG	0.507													58	110	---	---	---	---	PASS
APOL2	23780	broad.mit.edu	37	22	36624152	36624152	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36624152C>A	uc003aoz.2	-	5	648	c.312G>T	c.(310-312)GAG>GAT	p.E104D	APOL2_uc011amm.1_Missense_Mutation_p.E216D|APOL2_uc003apa.2_Missense_Mutation_p.E104D	NM_030882	NP_112092	Q9BQE5	APOL2_HUMAN	apolipoprotein L2	104					acute-phase response|cholesterol metabolic process|lipid transport|lipoprotein metabolic process|maternal process involved in female pregnancy|multicellular organismal development	endoplasmic reticulum membrane|extracellular region	high-density lipoprotein particle binding|lipid binding|receptor binding				0						GCTCAACCTCCTCTGCAAGGG	0.547													4	89	---	---	---	---	PASS
CRELD2	79174	broad.mit.edu	37	22	50316902	50316902	+	Missense_Mutation	SNP	G	A	A	rs143760812	byFrequency	TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50316902G>A	uc003bja.2	+	7	844	c.709G>A	c.(709-711)GAG>AAG	p.E237K	CRELD2_uc003biz.3_Missense_Mutation_p.E237K|CRELD2_uc010haj.2_Missense_Mutation_p.E237K|CRELD2_uc010hal.2_Missense_Mutation_p.E286K|CRELD2_uc010hak.2_Intron|CRELD2_uc010ham.2_Missense_Mutation_p.E237K	NM_024324	NP_077300	Q6UXH1	CREL2_HUMAN	cysteine-rich with EGF-like domains 2 isoform b	237	FU 1.					endoplasmic reticulum|extracellular region	calcium ion binding				0		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.198)|LUAD - Lung adenocarcinoma(64;0.247)		GTGTGCGGCCGAGCCGCCTCC	0.692													23	19	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3248135	3248135	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3248135A>T	uc004crg.3	-	4	790	c.633T>A	c.(631-633)AAT>AAA	p.N211K		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	211						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCAAGTAAAGATTCTCCAGAA	0.468													8	28	---	---	---	---	PASS
ACE2	59272	broad.mit.edu	37	X	15609979	15609979	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15609979C>A	uc004cxa.1	-	4	608	c.440G>T	c.(439-441)GGT>GTT	p.G147V	ACE2_uc004cxb.2_Missense_Mutation_p.G147V	NM_021804	NP_068576	Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2 precursor	147	Extracellular (Potential).				angiotensin-mediated drinking behavior|proteolysis|receptor biosynthetic process|regulation of cell proliferation|virion attachment, binding of host cell surface receptor	cell surface|extracellular space|integral to membrane|membrane raft|plasma membrane	carboxypeptidase activity|glycoprotein binding|metallopeptidase activity|peptidyl-dipeptidase activity|viral receptor activity|zinc ion binding			ovary(3)	3	Hepatocellular(33;0.183)				Moexipril(DB00691)	TTCATTCAAACCTGTTATCCC	0.378													102	191	---	---	---	---	PASS
SSX7	280658	broad.mit.edu	37	X	52681966	52681966	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52681966G>C	uc004dqx.1	-	3	297	c.138C>G	c.(136-138)ATC>ATG	p.I46M		NM_173358	NP_775494	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	46	KRAB-related.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding			skin(1)	1	Ovarian(276;0.236)					ACACATAGCTGATTTTCTCCA	0.373													46	101	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54359719	54359719	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54359719C>T	uc004dtd.1	-	2	827	c.388G>A	c.(388-390)GAA>AAA	p.E130K	WNK3_uc004dtc.1_Missense_Mutation_p.E130K	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	130					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						GCTTCTTCTTCCATTTCCTTT	0.358													21	73	---	---	---	---	PASS
DGAT2L6	347516	broad.mit.edu	37	X	69420307	69420307	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69420307T>C	uc004dxx.1	+	4	567	c.470T>C	c.(469-471)ATG>ACG	p.M157T		NM_198512	NP_940914	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	157					lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)	1						GTGATGTCAATGGGTGAGTAT	0.398													12	50	---	---	---	---	PASS
KIF4A	24137	broad.mit.edu	37	X	69615553	69615553	+	Silent	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69615553C>T	uc004dyg.2	+	21	2392	c.2265C>T	c.(2263-2265)GTC>GTT	p.V755V	KIF4A_uc010nkw.2_Silent_p.V755V	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	755	Potential.|Interaction with PRC1.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4						AGGTTATGGTCAGTACTGAGG	0.443													11	64	---	---	---	---	PASS
ZMYM3	9203	broad.mit.edu	37	X	70466282	70466282	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70466282C>G	uc004dzh.1	-	15	2580	c.2493G>C	c.(2491-2493)AAG>AAC	p.K831N	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Missense_Mutation_p.K831N|ZMYM3_uc004dzj.1_Missense_Mutation_p.K819N	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	831					multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)					ACATGGCAGCCTTGTTTTTGC	0.572													9	45	---	---	---	---	PASS
RPA4	29935	broad.mit.edu	37	X	96139743	96139743	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96139743T>C	uc004efv.3	+	1	732	c.434T>C	c.(433-435)ATT>ACT	p.I145T	DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efu.3_Intron|DIAPH2_uc004efs.2_Intron	NM_013347	NP_037479	Q13156	RFA4_HUMAN	replication protein A4, 34kDa	145					DNA damage checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair	DNA replication factor A complex|nucleoplasm	single-stranded DNA binding				0						GTATTGAAAATTCATGTCCTA	0.448								Other_identified_genes_with_known_or_suspected_DNA_repair_function					20	88	---	---	---	---	PASS
TRPC5	7224	broad.mit.edu	37	X	111195573	111195573	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111195573C>T	uc004epl.1	-	2	995	c.76G>A	c.(76-78)GAG>AAG	p.E26K	TRPC5_uc004epm.1_Missense_Mutation_p.E26K	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	26	Cytoplasmic (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						AGCTCTGTCTCAGCCCTCACA	0.517													23	103	---	---	---	---	PASS
ZCCHC16	340595	broad.mit.edu	37	X	111698850	111698850	+	Silent	SNP	T	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111698850T>G	uc004epo.1	+	3	1335	c.894T>G	c.(892-894)TCT>TCG	p.S298S		NM_001004308	NP_001004308	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16	298							nucleic acid binding|zinc ion binding			ovary(1)	1						CCAAACGTTCTCGAGCTCCGG	0.493													5	55	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117764395	117764395	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117764395G>C	uc004eqp.2	+	35	3891	c.3828G>C	c.(3826-3828)CAG>CAC	p.Q1276H	DOCK11_uc004eqq.2_Missense_Mutation_p.Q1055H	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1276					blood coagulation	cytosol	GTP binding			ovary(3)	3						GCCTGGATCAGTATGAAATCA	0.403													30	256	---	---	---	---	PASS
GLUD2	2747	broad.mit.edu	37	X	120182719	120182719	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:120182719C>A	uc004eto.2	+	1	1258	c.1181C>A	c.(1180-1182)CCC>CAC	p.P394H		NM_012084	NP_036216	P49448	DHE4_HUMAN	glutamate dehydrogenase 2 precursor	394					glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding			pancreas(1)	1					L-Glutamic Acid(DB00142)|NADH(DB00157)	TCCAACGCACCCAGAGTCAAA	0.483													57	234	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123515073	123515073	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123515073C>T	uc004euj.2	-	31	7555	c.7491G>A	c.(7489-7491)ATG>ATA	p.M2497I	ODZ1_uc011muj.1_Missense_Mutation_p.M2503I|ODZ1_uc010nqy.2_Missense_Mutation_p.M2504I	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	2497	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						ATCGGGGAGTCATAGGTAGTT	0.468													43	225	---	---	---	---	PASS
F9	2158	broad.mit.edu	37	X	138643729	138643729	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138643729T>G	uc004fas.1	+	8	914	c.885T>G	c.(883-885)AAT>AAG	p.N295K	F9_uc004fat.1_Missense_Mutation_p.N257K	NM_000133	NP_000124	P00740	FA9_HUMAN	coagulation factor IX preproprotein	295	Peptidase S1.				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)	AAAAGCGAAATGTGATTCGAA	0.348													34	108	---	---	---	---	PASS
ATP2B3	492	broad.mit.edu	37	X	152822364	152822364	+	Intron	SNP	C	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152822364C>T	uc004fht.1	+						ATP2B3_uc004fhs.1_Intron	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b						ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGCCCTGATCTGTCTTCCAG	0.622													5	4	---	---	---	---	PASS
TCTEX1D1	200132	broad.mit.edu	37	1	67242226	67242227	+	Intron	DEL	AT	-	-	rs72385752		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67242226_67242227delAT	uc001dcv.2	+						TCTEX1D1_uc009wau.2_Intron|TCTEX1D1_uc009wav.2_Intron	NM_152665	NP_689878	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1												0						CATATTCTACATATAtgtgtgt	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	110663163	110663164	+	IGR	INS	-	CAA	CAA	rs59697253		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110663163_110663164insCAA								UBL4B (6595 upstream) : SLC6A17 (29968 downstream)																							accatcactaccaccaccatca	0.050													4	2	---	---	---	---	
KCNK2	3776	broad.mit.edu	37	1	215256538	215256538	+	5'Flank	DEL	C	-	-			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215256538delC	uc001hkq.2	+						KCNK2_uc001hko.2_Intron|KCNK2_uc009xdm.2_Intron|KCNK2_uc001hkp.2_Intron|KCNK2_uc010pua.1_5'Flank|KCNK2_uc001hkr.3_5'Flank	NM_001017425	NP_001017425	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2 isoform								outward rectifier potassium channel activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)	TTCTCACGCTCCCCCCCCCGC	0.632													4	3	---	---	---	---	
LY75	4065	broad.mit.edu	37	2	160634565	160634566	+	Intron	DEL	CC	-	-	rs35013477		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160634565_160634566delCC	uc002ubb.3	-						LY75_uc010fos.2_Intron|CD302_uc002uba.2_Intron|CD302_uc010zco.1_Intron	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor						endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		TAAAAATAAACCCTTTTATTAG	0.233													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	12185378	12185381	+	IGR	DEL	GGAA	-	-			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12185378_12185381delGGAA								HS3ST1 (754841 upstream) : None (None downstream)																							aggaaagaagggaaggaaggaagg	0.010													5	5	---	---	---	---	
C7	730	broad.mit.edu	37	5	40979699	40979699	+	Intron	DEL	T	-	-	rs35148902		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40979699delT	uc003jmh.2	+						C7_uc011cpn.1_Intron	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor						complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				AGTTTCCACCTTTTTTTTTTT	0.313													7	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	166471034	166471041	+	IGR	DEL	TAAGGACA	-	-	rs2910053		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166471034_166471041delTAAGGACA								None (None upstream) : ODZ2 (240802 downstream)																							aaataaaTAGTaaggacagaaggaagga	0.115													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	131704858	131704859	+	IGR	INS	-	GAA	GAA			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131704858_131704859insGAA								AKAP7 (100185 upstream) : ARG1 (189506 downstream)																							aaggaaggaaggaaggaaggaa	0.168													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	26316301	26316302	+	IGR	INS	-	AAAT	AAAT	rs142084046	by1000genomes	TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26316301_26316302insAAAT								CBX3 (63327 upstream) : SNX10 (15213 downstream)																							TGCCCCCTCAAaaataaataaa	0.267													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57004988	57004989	+	IGR	INS	-	AA	AA			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57004988_57004989insAA								DKFZp434L192 (440011 upstream) : ZNF479 (182339 downstream)																							gacttcatctcaaaaaaaaaTG	0.213													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64975077	64975078	+	IGR	INS	-	AGAC	AGAC			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64975077_64975078insAGAC								ZNF92 (109080 upstream) : INTS4L2 (137699 downstream)																							AGTGCACCCGAAAACAAAGATG	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	126533987	126533988	+	IGR	INS	-	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126533987_126533988insT								TRIB1 (83345 upstream) : None (None downstream)																							ttccttccttccttccttcctt	0.005													4	3	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8331407	8331416	+	Intron	DEL	TTATTTTCAC	-	-	rs10976963		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8331407_8331416delTTATTTTCAC	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTTCCTCTGATTATTTTCACTTATTTTCAC	0.276										TSP Lung(15;0.13)			3	6	---	---	---	---	
SMC5	23137	broad.mit.edu	37	9	72961328	72961329	+	Intron	INS	-	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72961328_72961329insA	uc004ahr.2	+						SMC5_uc011lry.1_5'Flank	NM_015110	NP_055925	Q8IY18	SMC5_HUMAN	SMC5 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			ovary(2)|central_nervous_system(1)	3						TGCCTCCCCTCAAAAAAAAAAG	0.386													4	2	---	---	---	---	
CELF2	10659	broad.mit.edu	37	10	11363483	11363483	+	Intron	DEL	A	-	-	rs113196940		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11363483delA	uc001iki.3	+						CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron|CELF2_uc010qbl.1_Intron|CELF2_uc010qbm.1_Intron|CELF2_uc001iko.3_Intron|CELF2_uc001ikp.3_Intron|CELF2_uc010qbn.1_Intron|CELF2_uc010qbo.1_Intron|CELF2_uc010qbp.1_Intron	NM_001025077	NP_001020248	O95319	CELF2_HUMAN	CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0						ATTCATGTTTaaaaaaaaaaa	0.214													4	2	---	---	---	---	
TCERG1L	256536	broad.mit.edu	37	10	133055212	133055215	+	Intron	DEL	GAAG	-	-	rs141999228		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133055212_133055215delGAAG	uc001lkp.2	-						TCERG1L_uc009yax.1_Intron	NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		ggaagagaaagaaggaaggaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	49122422	49122422	+	IGR	DEL	G	-	-			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49122422delG								OR4A47 (611150 upstream) : FOLH1 (45766 downstream)																							TAGATGTCATGGGGAAGGATG	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	90017337	90017337	+	IGR	DEL	A	-	-			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90017337delA								CHORDC1 (60805 upstream) : MIR1261 (584952 downstream)																							TCATTAACATAAAAAAAAaag	0.164													4	2	---	---	---	---	
DYNC2H1	79659	broad.mit.edu	37	11	103102103	103102107	+	Intron	DEL	GATAA	-	-			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103102103_103102107delGATAA	uc001pho.2	+						DYNC2H1_uc001phn.1_Intron|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1						cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GTGTATTTTGGATAATGCTGAGAGT	0.337													8	7	---	---	---	---	
CCDC84	338657	broad.mit.edu	37	11	118882090	118882091	+	Intron	INS	-	T	T			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118882090_118882091insT	uc001pul.2	+						CCDC84_uc010ryk.1_Intron|CCDC84_uc010ryl.1_Intron|CCDC84_uc010rym.1_Intron	NM_198489	NP_940891	Q86UT8	CCD84_HUMAN	coiled-coil domain containing 84											ovary(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		tcttcttcttcttttttttttg	0.233													4	2	---	---	---	---	
PPHLN1	51535	broad.mit.edu	37	12	42693022	42693024	+	Intron	DEL	AAG	-	-			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42693022_42693024delAAG	uc001rmy.2	+							NM_201439	NP_958847	Q8NEY8	PPHLN_HUMAN	periphilin 1 isoform 3						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		aaaaaagaaaaagaaggaaggaa	0.000													5	3	---	---	---	---	
TMPO	7112	broad.mit.edu	37	12	98914050	98914051	+	Intron	INS	-	CCTTCCTT	CCTTCCTT			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98914050_98914051insCCTTCCTT	uc001tfj.2	+						TMPO_uc001tfi.1_Intron|TMPO_uc001tfk.2_Intron|TMPO_uc001tfl.2_Intron|TMPO_uc001tfh.1_Intron	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta							integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						CCATATTTTTCccttccttcct	0.040													5	3	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109877328	109877339	+	5'Flank	DEL	CCACAGCCTCTA	-	-			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109877328_109877339delCCACAGCCTCTA	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						GTGGTCATCTCCACAGCCTCTACCACTTTGGC	0.311													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	100240691	100240698	+	IGR	DEL	TTCCTTCC	-	-	rs113490674		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100240691_100240698delTTCCTTCC								TM9SF2 (25415 upstream) : CLYBL (18238 downstream)																							ctttctttctttccttccttccttcctt	0.058													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	70027697	70027698	+	IGR	INS	-	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70027697_70027698insA								UPF0639 (32482 upstream) : C14orf162 (8834 downstream)																							gaccctgtctcaaaaaaacaaa	0.173													19	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	86538163	86538164	+	IGR	INS	-	GAGAGAGAGAAA	GAGAGAGAGAAA	rs140881841	by1000genomes	TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86538163_86538164insGAGAGAGAGAAA								FLRT2 (443894 upstream) : None (None downstream)																							aggaagaaagggagagagagaa	0.084													4	2	---	---	---	---	
PARP16	54956	broad.mit.edu	37	15	65563598	65563598	+	Intron	DEL	T	-	-			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65563598delT	uc002aoo.2	-						PARP16_uc002aop.2_Intron|PARP16_uc002aoq.2_Intron	NM_017851	NP_060321	Q8N5Y8	PAR16_HUMAN	poly (ADP-ribose) polymerase family, member 16							integral to membrane	NAD+ ADP-ribosyltransferase activity			lung(2)	2						atctgaaaggttttttttttg	0.095													4	2	---	---	---	---	
RAB26	25837	broad.mit.edu	37	16	2202694	2202695	+	Intron	INS	-	A	A			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2202694_2202695insA	uc002cou.2	+						RAB26_uc010bsf.2_Intron	NM_014353	NP_055168	Q9ULW5	RAB26_HUMAN	RAB26, member RAS oncogene family						exocrine system development|protein transport|regulation of exocytosis|small GTPase mediated signal transduction	intrinsic to plasma membrane	GTP binding|protein binding				0						actcttgtctcaaaaaaaaaaa	0.228													4	2	---	---	---	---	
CHP2	63928	broad.mit.edu	37	16	23767559	23767560	+	Intron	INS	-	G	G			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23767559_23767560insG	uc002dmb.1	+							NM_022097	NP_071380	O43745	CHP2_HUMAN	hepatocellular carcinoma antigen gene 520								calcium ion binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(48;0.0144)		AGATGTACCCACACCAGGGACA	0.554													18	9	---	---	---	---	
VAT1L	57687	broad.mit.edu	37	16	77850682	77850683	+	Intron	INS	-	A	A	rs71884745		TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77850682_77850683insA	uc002ffg.1	+							NM_020927	NP_065978	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport protein 1 homolog (T.								oxidoreductase activity|zinc ion binding			central_nervous_system(1)	1						TTGCCAAaaagaaaaaaaaaag	0.243													4	2	---	---	---	---	
GNA11	2767	broad.mit.edu	37	19	3121218	3121219	+	3'UTR	INS	-	GT	GT			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3121218_3121219insGT	uc002lxd.2	+	7					uc010xhe.1_5'Flank	NM_002067	NP_002058	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein),						activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			eye(70)|skin(16)	86		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)		CACGGGGCAGGACCTTCCTTCC	0.639			Mis		uveal melanoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19831670	19831671	+	IGR	INS	-	AGA	AGA			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19831670_19831671insAGA								SLC24A3 (128130 upstream) : RIN2 (38539 downstream)																							aggaaggaaggaaggaaggaag	0.025													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	31635644	31635645	+	IGR	DEL	TC	-	-	rs59724145	by1000genomes	TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31635644_31635645delTC								CLDN8 (47326 upstream) : KRTAP24-1 (17984 downstream)																							GCTTCTTTCTTCTCTCTCTCTC	0.396													4	2	---	---	---	---	
PARVB	29780	broad.mit.edu	37	22	44536179	44536179	+	Intron	DEL	C	-	-			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44536179delC	uc003ben.2	+						PARVB_uc003bem.2_Intron|PARVB_uc010gzn.2_Intron|PARVB_uc003beo.2_Intron	NM_013327	NP_037459	Q9HBI1	PARVB_HUMAN	parvin, beta isoform b						cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding				0		Ovarian(80;0.0246)|all_neural(38;0.0423)				GCACAGCCCACCCCCACCTTT	0.552													9	5	---	---	---	---	
MXRA5	25878	broad.mit.edu	37	X	3247360	3247361	+	Intron	INS	-	GAAG	GAAG			TCGA-39-5035-01	TCGA-39-5035-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3247360_3247361insGAAG	uc004crg.3	-							NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor							extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				gaaggaaaaaagaaggaaggaa	0.000													4	3	---	---	---	---	
