Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
RERE	473	broad.mit.edu	37	1	8416169	8416169	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8416169G>T	uc001ape.2	-	22	5287	c.4477C>A	c.(4477-4479)CCA>ACA	p.P1493T	RERE_uc001apf.2_Missense_Mutation_p.P1493T|RERE_uc001apd.2_Missense_Mutation_p.P939T	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	1493	Pro-rich.				multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CCGAAAACTGGGTGGCGAAGC	0.587													6	85	---	---	---	---	PASS
PRAMEF12	390999	broad.mit.edu	37	1	12835767	12835767	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12835767C>A	uc001aui.2	+	2	396	c.369C>A	c.(367-369)TCC>TCA	p.S123S		NM_001080830	NP_001074299	O95522	PRA12_HUMAN	PRAME family member 12	123										ovary(3)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCACTCTCCCCAGAGGCCC	0.537													6	109	---	---	---	---	PASS
PIK3R3	8503	broad.mit.edu	37	1	46511683	46511683	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46511683C>A	uc001cpb.3	-	9	1850	c.1094G>T	c.(1093-1095)CGA>CTA	p.R365L	PIK3R3_uc009vyb.2_Missense_Mutation_p.R306L|PIK3R3_uc009vyc.2_Missense_Mutation_p.R382L|PIK3R3_uc001cpc.3_Missense_Mutation_p.R365L|PIK3R3_uc010olw.1_Missense_Mutation_p.R411L|PIK3R3_uc010olv.1_Missense_Mutation_p.R155L	NM_003629	NP_003620	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3	365	SH2 2.				insulin receptor signaling pathway|platelet activation|T cell costimulation		1-phosphatidylinositol-3-kinase activity|protein binding				0	Acute lymphoblastic leukemia(166;0.155)					TGCTTGTACTCGATTGATATC	0.373													4	81	---	---	---	---	PASS
SLC5A9	200010	broad.mit.edu	37	1	48701497	48701497	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48701497T>C	uc001cro.2	+	10	1290	c.1238T>C	c.(1237-1239)GTG>GCG	p.V413A	SLC5A9_uc010oms.1_RNA|SLC5A9_uc001crn.2_Missense_Mutation_p.V438A|SLC5A9_uc010omt.1_Missense_Mutation_p.V427A|SLC5A9_uc001crp.2_Missense_Mutation_p.V80A|SLC5A9_uc010omu.1_Missense_Mutation_p.V80A	NM_001011547	NP_001011547	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/glucose	413	Cytoplasmic (Potential).					integral to membrane|plasma membrane	low-affinity glucose:sodium symporter activity			ovary(3)	3						ACCATTGATGTGTGGCAGCGC	0.617													15	34	---	---	---	---	PASS
AGBL4	84871	broad.mit.edu	37	1	49201900	49201900	+	Intron	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49201900C>T	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron|BEND5_uc001crx.3_Intron|BEND5_uc001crw.3_Intron	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		TGTTTCCACTCAGTGACCTAC	0.378													28	66	---	---	---	---	PASS
PRPF38A	84950	broad.mit.edu	37	1	52870481	52870481	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52870481G>T	uc001ctv.3	+	1	263	c.60G>T	c.(58-60)CTG>CTT	p.L20L	ORC1L_uc001ctt.2_5'Flank|ORC1L_uc010oni.1_5'Flank|ORC1L_uc001ctu.2_5'Flank|ORC1L_uc009vzd.2_5'Flank|PRPF38A_uc001ctw.3_5'UTR	NM_032864	NP_116253	Q8NAV1	PR38A_HUMAN	PRP38 pre-mRNA processing factor 38 (yeast)	20					mRNA processing|RNA splicing	spliceosomal complex					0						CTCAATATCTGGTGGAGAAGA	0.483											OREG0013487	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	115	---	---	---	---	PASS
USP24	23358	broad.mit.edu	37	1	55572963	55572963	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55572963G>A	uc001cyg.3	-	37	4231	c.4231C>T	c.(4231-4233)CGC>TGC	p.R1411C		NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24	1571					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						TTGATGAGGCGTAAGTGCCCT	0.453													19	46	---	---	---	---	PASS
GBP2	2634	broad.mit.edu	37	1	89579960	89579960	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89579960C>T	uc001dmz.1	-	7	1159	c.888G>A	c.(886-888)CTG>CTA	p.L296L	GBP2_uc001dmy.1_RNA	NM_004120	NP_004111	P32456	GBP2_HUMAN	guanylate binding protein 2,	296					interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)	1		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		TGACGTAGGTCAGCACCAGGC	0.483													8	48	---	---	---	---	PASS
GLMN	11146	broad.mit.edu	37	1	92733508	92733508	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92733508G>T	uc001dor.2	-	11	1175	c.1060C>A	c.(1060-1062)CAG>AAG	p.Q354K	GLMN_uc009wdg.2_RNA|GLMN_uc001dos.2_Missense_Mutation_p.Q354K	NM_053274	NP_444504	Q92990	GLMN_HUMAN	glomulin	354					muscle cell differentiation|negative regulation of T cell proliferation|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of phosphorylation|regulation of gene expression, epigenetic|vasculogenesis	intracellular	hepatocyte growth factor receptor binding			skin(1)	1		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		TCTAAGTACTGGTAAAGTAGA	0.313									Multiple_Glomus_Tumors_(of_the_Skin)_Familial				5	68	---	---	---	---	PASS
SORT1	6272	broad.mit.edu	37	1	109883449	109883449	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109883449G>A	uc001dxm.1	-	10	1210	c.1161C>T	c.(1159-1161)TCC>TCT	p.S387S	SORT1_uc010ovi.1_Silent_p.S250S	NM_002959	NP_002950	Q99523	SORT_HUMAN	sortilin 1 preproprotein	387	BNR 6.|Extracellular (Potential).				endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		CCAAAGACTTGGAATAGACAA	0.483													8	42	---	---	---	---	PASS
ATXN7L2	127002	broad.mit.edu	37	1	110033990	110033990	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110033990C>T	uc001dxr.2	+	10	1820	c.1805C>T	c.(1804-1806)TCG>TTG	p.S602L	ATXN7L2_uc001dxs.2_Missense_Mutation_p.S229L|ATXN7L2_uc001dxt.2_Missense_Mutation_p.S105L|CYB561D1_uc010ovl.1_5'Flank|CYB561D1_uc010ovm.1_5'Flank|CYB561D1_uc001dxu.2_5'Flank|CYB561D1_uc001dxw.2_5'Flank|CYB561D1_uc010ovn.1_5'Flank|CYB561D1_uc010ovo.1_5'Flank|CYB561D1_uc009wfd.2_5'Flank|CYB561D1_uc010ovp.1_5'Flank	NM_153340	NP_699171	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	602										ovary(2)	2		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		AGGGGCCTCTCGGCCAAAACT	0.587													10	45	---	---	---	---	PASS
KCNA3	3738	broad.mit.edu	37	1	111216270	111216270	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111216270C>G	uc001dzv.1	-	1	1386	c.1162G>C	c.(1162-1164)GGG>CGG	p.G388R		NM_002232	NP_002223	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related	388						voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(4)|pancreas(1)	5		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGCGTTTGCCCGAGGATCTGC	0.587													13	71	---	---	---	---	PASS
C1orf88	128344	broad.mit.edu	37	1	111891246	111891246	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111891246C>A	uc001eaw.2	+	4	447	c.367C>A	c.(367-369)CCA>ACA	p.P123T	C1orf88_uc001eax.2_Missense_Mutation_p.P90T|C1orf88_uc009wge.1_Intron|C1orf88_uc001eay.2_Missense_Mutation_p.P36T	NM_181643	NP_857594	Q8TCI5	CA088_HUMAN	hypothetical protein LOC128344	123										ovary(1)|skin(1)	2		all_cancers(81;3.21e-05)|all_epithelial(167;1.19e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0239)|Colorectal(144;0.0301)|all cancers(265;0.0677)|Epithelial(280;0.0897)|COAD - Colon adenocarcinoma(174;0.116)|LUSC - Lung squamous cell carcinoma(189;0.135)		TAAGAACTACCCAAAGGACAC	0.403													9	255	---	---	---	---	PASS
ANKRD35	148741	broad.mit.edu	37	1	145562806	145562806	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145562806C>A	uc001eob.1	+	10	2602	c.2494C>A	c.(2494-2496)CTA>ATA	p.L832I	NBPF10_uc001emp.3_Intron|ANKRD35_uc010oyx.1_Missense_Mutation_p.L675I	NM_144698	NP_653299	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	832										ovary(4)|skin(1)	5	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGCAGCCAGCCTACGGCAACA	0.602													4	8	---	---	---	---	PASS
PLEKHO1	51177	broad.mit.edu	37	1	150131510	150131510	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150131510G>C	uc001ett.2	+	6	1300	c.1022G>C	c.(1021-1023)CGG>CCG	p.R341P	PLEKHO1_uc001etr.2_Missense_Mutation_p.R169P|PLEKHO1_uc001ets.2_Missense_Mutation_p.R158P|PLEKHO1_uc001etu.2_Missense_Mutation_p.R169P	NM_016274	NP_057358	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O	341	Negative regulator of AP-1 activity.					cytoplasm|nucleus|plasma membrane				lung(1)	1	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GACCCCCCTCGGTCTCCGCCG	0.602													6	28	---	---	---	---	PASS
GOLPH3L	55204	broad.mit.edu	37	1	150634405	150634405	+	Splice_Site	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150634405C>A	uc001evj.2	-	4	533	c.316_splice	c.e4-1	p.V106_splice	GOLPH3L_uc010pci.1_Splice_Site_p.V62_splice	NM_018178	NP_060648	Q9H4A5	GLP3L_HUMAN	Golgi phosphoprotein 3-like							Golgi cisterna membrane				ovary(1)	1	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;1.2e-23)|all cancers(9;4.81e-23)|OV - Ovarian serous cystadenocarcinoma(6;1.93e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			TTAGCAGTACCTTTGAGAAAA	0.363													5	60	---	---	---	---	PASS
PSMB4	5692	broad.mit.edu	37	1	151372089	151372089	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151372089C>T	uc001eyc.1	+	1	49	c.26C>T	c.(25-27)TCC>TTC	p.S9F	PSMB4_uc010pda.1_Missense_Mutation_p.S9F|PSMB4_uc001eyb.1_Missense_Mutation_p.S9F	NM_002796	NP_002787	P28070	PSB4_HUMAN	proteasome beta 4 subunit	9					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity			ovary(2)	2	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GGGTCGCGGTCCGGACTTTGG	0.552													12	67	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152276145	152276145	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152276145G>A	uc001ezu.1	-	3	11253	c.11217C>T	c.(11215-11217)CAC>CAT	p.H3739H		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3739	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGCCTGCTCGTGGCGGGATC	0.602									Ichthyosis				87	127	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152326835	152326835	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152326835G>C	uc001ezw.3	-	3	3500	c.3427C>G	c.(3427-3429)CAG>GAG	p.Q1143E	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1143	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TACTCATGCTGTGCAAAGCCA	0.527													23	147	---	---	---	---	PASS
IL6R	3570	broad.mit.edu	37	1	154401669	154401669	+	Intron	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154401669C>A	uc001fez.1	+						IL6R_uc001ffa.1_Intron	NM_000565	NP_000556	P08887	IL6RA_HUMAN	interleukin 6 receptor isoform 1 precursor						acute-phase response|ciliary neurotrophic factor-mediated signaling pathway|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|endocrine pancreas development|hepatic immune response|negative regulation of collagen biosynthetic process|negative regulation of interleukin-8 production|positive regulation of activation of Janus kinase activity|positive regulation of anti-apoptosis|positive regulation of chemokine production|positive regulation of chemokine production|positive regulation of interleukin-6 production|positive regulation of leukocyte chemotaxis|positive regulation of MAPKKK cascade|positive regulation of osteoblast differentiation|positive regulation of smooth muscle cell proliferation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of apoptosis	apical plasma membrane|basolateral plasma membrane|extracellular space|interleukin-6 receptor complex	ciliary neurotrophic factor binding|enzyme binding|protein homodimerization activity			ovary(3)|breast(1)	4	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CTCCCTCCTCCAGAGGTGGCG	0.592													5	52	---	---	---	---	PASS
IQGAP3	128239	broad.mit.edu	37	1	156503909	156503909	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156503909C>T	uc001fpf.2	-	30	3840	c.3765G>A	c.(3763-3765)CAG>CAA	p.Q1255Q		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1255					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCTCTGGCACCTGGCAGGCTC	0.592													7	52	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157771327	157771327	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157771327G>T	uc001frg.2	-	6	1040	c.927C>A	c.(925-927)GTC>GTA	p.V309V	FCRL1_uc001frf.2_RNA|FCRL1_uc001frh.2_Silent_p.V309V|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_RNA	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	309	Helical; (Potential).					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GCCCCTCAATGACTCCTGAGG	0.507													17	37	---	---	---	---	PASS
OR10J1	26476	broad.mit.edu	37	1	159409868	159409868	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159409868G>T	uc010piv.1	+	1	320	c.320G>T	c.(319-321)GGG>GTG	p.G107V	uc001fts.3_Intron	NM_012351	NP_036483	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J,	107	Extracellular (Potential).				sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0429)					TCATTGGCAGGGTGTGCCACA	0.493													5	34	---	---	---	---	PASS
FCGR3A	2214	broad.mit.edu	37	1	161518412	161518412	+	Nonsense_Mutation	SNP	T	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161518412T>A	uc001gat.3	-	4	255	c.118A>T	c.(118-120)AAG>TAG	p.K40*	FCGR3A_uc001gar.2_Nonsense_Mutation_p.K76*|FCGR3A_uc001gas.2_Nonsense_Mutation_p.K75*|FCGR3A_uc009wuh.2_Nonsense_Mutation_p.K39*|FCGR3A_uc009wui.2_Nonsense_Mutation_p.K40*	NM_001127595	NP_001121067	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor	40	Ig-like C2-type 1.|Extracellular (Potential).				immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	ACACTGTCCTTCTCGAGCACC	0.552													17	66	---	---	---	---	PASS
BLZF1	8548	broad.mit.edu	37	1	169356240	169356240	+	Silent	SNP	A	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169356240A>G	uc001gfx.1	+	7	1460	c.1023A>G	c.(1021-1023)CTA>CTG	p.L341L	BLZF1_uc001gfy.2_Silent_p.L341L|BLZF1_uc009wvp.1_Silent_p.*245*	NM_003666	NP_003657	Q9H2G9	GO45_HUMAN	basic leucine zipper nuclear factor 1	341					cell proliferation|Golgi organization|Golgi to plasma membrane protein transport|regulation of cell growth|regulation of transcription from RNA polymerase II promoter	Golgi lumen|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding			skin(1)	1	all_hematologic(923;0.208)					CTTAGGTTCTAAGAATTTTAG	0.328													4	36	---	---	---	---	PASS
C1orf125	126859	broad.mit.edu	37	1	179503957	179503957	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179503957A>T	uc001gmo.2	+	25	3018	c.2891A>T	c.(2890-2892)GAG>GTG	p.E964V	C1orf125_uc009wxg.2_RNA|C1orf125_uc001gmp.2_Missense_Mutation_p.E890V|C1orf125_uc009wxh.2_RNA	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	964	Glu-rich.										0						AAAGATCTAGAGGAATTAGTC	0.244													6	46	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	179966093	179966093	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179966093C>A	uc001gnt.2	+	6	1184	c.801C>A	c.(799-801)TCC>TCA	p.S267S	CEP350_uc001gnr.1_Silent_p.S241S|CEP350_uc009wxl.2_Silent_p.S266S|CEP350_uc001gnu.2_Silent_p.S101S	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	267						centrosome|nucleus|spindle				ovary(4)	4						CTTCTAATTCCCAAAGATTAG	0.378													7	84	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186276847	186276847	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186276847C>A	uc001gru.3	+	7	2047	c.1996C>A	c.(1996-1998)CCC>ACC	p.P666T	PRG4_uc001grt.3_Missense_Mutation_p.P625T|PRG4_uc009wyl.2_Missense_Mutation_p.P573T|PRG4_uc009wym.2_Missense_Mutation_p.P532T|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	666	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|38; approximate.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						GGAGCCTGCTCCCACCACTCC	0.667													5	52	---	---	---	---	PASS
ATP6V1G3	127124	broad.mit.edu	37	1	198509707	198509707	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198509707G>C	uc001gup.2	-	2	180	c.74C>G	c.(73-75)GCC>GGC	p.A25G	ATP6V1G3_uc009wzd.2_Missense_Mutation_p.A25G|ATP6V1G3_uc001guo.2_Missense_Mutation_p.A25G	NM_133262	NP_573569	Q96LB4	VATG3_HUMAN	ATPase, H+ transporting, lysosomal, V1 subunit	25	Potential.				cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase complex	ATPase binding			central_nervous_system(1)	1						ACTCTTCTTGGCTTCCTCTAG	0.378													18	59	---	---	---	---	PASS
LAX1	54900	broad.mit.edu	37	1	203741202	203741202	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203741202A>G	uc001haa.2	+	4	727	c.317A>G	c.(316-318)CAT>CGT	p.H106R	LAX1_uc010pql.1_Missense_Mutation_p.H90R|LAX1_uc001hab.2_Missense_Mutation_p.H30R	NM_017773	NP_060243	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1 isoform a	106	Cytoplasmic (Potential).				B cell activation|immune response|inactivation of MAPK activity|intracellular signal transduction|negative regulation of T cell activation	Golgi apparatus|integral to membrane|plasma membrane	protein kinase binding|SH2 domain binding			central_nervous_system(2)	2	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TCAGGGAGACATGAGTCGAGG	0.493													23	41	---	---	---	---	PASS
MAPKAPK2	9261	broad.mit.edu	37	1	206905078	206905078	+	Intron	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206905078C>A	uc001hem.1	+						MAPKAPK2_uc001hel.1_Intron	NM_032960	NP_116584	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated						activation of MAPK activity|hormone biosynthetic process|innate immune response|leukotriene biosynthetic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|prostanoid metabolic process|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|signal transducer activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			ATGGTAAGCTCGGCAGGCTGG	0.542													4	85	---	---	---	---	PASS
RRP15	51018	broad.mit.edu	37	1	218458651	218458651	+	5'UTR	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218458651G>T	uc001hlj.2	+	1						NM_016052	NP_057136	Q9Y3B9	RRP15_HUMAN	ribosomal RNA processing 15 homolog							mitochondrion|nucleolus	protein binding				0				all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)		CGCTTCCGGCGCAGAAAAATG	0.552													15	15	---	---	---	---	PASS
IARS2	55699	broad.mit.edu	37	1	220287687	220287687	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220287687G>T	uc001hmc.2	+	12	1615	c.1511G>T	c.(1510-1512)GGA>GTA	p.G504V		NM_018060	NP_060530	Q9NSE4	SYIM_HUMAN	mitochondrial isoleucine tRNA synthetase	504					isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity			ovary(2)|skin(2)	4				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	TTTATTCCTGGATCAGCACTG	0.373													34	71	---	---	---	---	PASS
HHIPL2	79802	broad.mit.edu	37	1	222717191	222717191	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222717191G>C	uc001hnh.1	-	2	720	c.662C>G	c.(661-663)TCC>TGC	p.S221C		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	221					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		ATGGACCATGGAGACGGGGTT	0.637													13	32	---	---	---	---	PASS
KIAA1804	84451	broad.mit.edu	37	1	233497839	233497839	+	Missense_Mutation	SNP	T	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233497839T>G	uc001hvt.3	+	5	1613	c.1352T>G	c.(1351-1353)CTG>CGG	p.L451R	KIAA1804_uc001hvs.1_Missense_Mutation_p.L451R	NM_032435	NP_115811	Q5TCX8	M3KL4_HUMAN	mixed lineage kinase 4	451					activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity			lung(5)|central_nervous_system(2)|skin(1)	8		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)				CGGGCGGCTCTGCAGCAGAAG	0.582													4	8	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	240966246	240966246	+	Silent	SNP	T	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240966246T>A	uc001hyv.2	-	16	1647	c.1317A>T	c.(1315-1317)ATA>ATT	p.I439I	RGS7_uc010pyh.1_Silent_p.I413I|RGS7_uc010pyj.1_Silent_p.I355I|RGS7_uc001hyu.2_Silent_p.I439I|RGS7_uc009xgn.1_Silent_p.I386I|RGS7_uc001hyw.2_Silent_p.I439I|RGS7_uc001hyt.2_Silent_p.I271I	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	439	RGS.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			CACTGGATCTTATAAAACGTG	0.348													36	59	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	241033393	241033393	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241033393G>T	uc001hyv.2	-	7	742	c.412C>A	c.(412-414)CAA>AAA	p.Q138K	RGS7_uc010pyh.1_Missense_Mutation_p.Q112K|RGS7_uc010pyj.1_Missense_Mutation_p.Q54K|RGS7_uc001hyu.2_Missense_Mutation_p.Q138K|RGS7_uc009xgn.1_Missense_Mutation_p.Q85K|RGS7_uc001hyw.2_Missense_Mutation_p.Q138K|RGS7_uc001hyt.2_5'Flank	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	138					G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			GCCTTGTTTTGCATTGTTCTC	0.428													32	60	---	---	---	---	PASS
SMYD3	64754	broad.mit.edu	37	1	246078937	246078937	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246078937G>T	uc001ibl.2	-	8	803	c.708C>A	c.(706-708)ACC>ACA	p.T236T	SMYD3_uc001ibk.2_Silent_p.T177T|SMYD3_uc001ibi.2_Silent_p.T47T|SMYD3_uc001ibj.2_Silent_p.T47T	NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	236	SET.					cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		GGTAGCAGATGGTGAGCTGTG	0.473													6	53	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247588746	247588746	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247588746C>A	uc001icr.2	+	5	2139	c.2001C>A	c.(1999-2001)TCC>TCA	p.S667S	NLRP3_uc001ics.2_Silent_p.S667S|NLRP3_uc001icu.2_Silent_p.S667S|NLRP3_uc001icw.2_Silent_p.S667S|NLRP3_uc001icv.2_Silent_p.S667S|NLRP3_uc010pyw.1_Silent_p.S665S|NLRP3_uc001ict.1_Silent_p.S665S	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	667					detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			TGGTTTCTTCCTTTTGCATTG	0.512													5	36	---	---	---	---	PASS
OR14A16	284532	broad.mit.edu	37	1	247978831	247978831	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247978831C>A	uc001idm.1	-	1	201	c.201G>T	c.(199-201)TTG>TTT	p.L67F		NM_001001966	NP_001001966	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A,	67	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GGCAGAGATCCAAGAAAGATA	0.433													5	76	---	---	---	---	PASS
OR2L13	284521	broad.mit.edu	37	1	248263099	248263099	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248263099T>A	uc001ids.2	+	3	759	c.422T>A	c.(421-423)GTG>GAG	p.V141E		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	141	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			ATGATGTGTGTGAAGATGATT	0.488													41	132	---	---	---	---	PASS
OR2M3	127062	broad.mit.edu	37	1	248367107	248367107	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248367107G>T	uc010pzg.1	+	1	738	c.738G>T	c.(736-738)TTG>TTT	p.L246F		NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M,	246	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CTCACCTCTTGGTGGTGGGAA	0.483													18	128	---	---	---	---	PASS
OR2T1	26696	broad.mit.edu	37	1	248570351	248570351	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248570351G>T	uc010pzm.1	+	1	1056	c.1056G>T	c.(1054-1056)AAG>AAT	p.K352N		NM_030904	NP_112166	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T,	352	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GAGCTCTGAAGAGGGCCTTGG	0.517													7	132	---	---	---	---	PASS
OR2T27	403239	broad.mit.edu	37	1	248814146	248814146	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248814146G>A	uc010pzo.1	-	1	40	c.40C>T	c.(40-42)CTT>TTT	p.L14F		NM_001001824	NP_001001824	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T,	14	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AAACCCAGAAGGATAAAGTCG	0.448													8	41	---	---	---	---	PASS
TSSC1	7260	broad.mit.edu	37	2	3197910	3197910	+	Missense_Mutation	SNP	G	T	T	rs148611386	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3197910G>T	uc002qxj.2	-	7	874	c.681C>A	c.(679-681)CAC>CAA	p.H227Q	TSSC1_uc002qxi.2_RNA	NM_003310	NP_003301	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1	227	WD 3.						protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		CCAGCTGTCCGTGGGCATTCT	0.507													4	87	---	---	---	---	PASS
DDX1	1653	broad.mit.edu	37	2	15770902	15770902	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15770902G>T	uc002rce.2	+	26	2383	c.2095G>T	c.(2095-2097)GGA>TGA	p.G699*		NM_004939	NP_004930	Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1	699	Necessary for interaction with HNRNPK.				DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		TGATGCAGGTGGAAGCTATAA	0.403													7	175	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21255260	21255260	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21255260C>A	uc002red.2	-	10	1446	c.1318G>T	c.(1318-1320)GCC>TCC	p.A440S		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	440	Vitellogenin.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TACAAGGTGGCTCGGCTGCGC	0.562													31	48	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21257676	21257676	+	Intron	SNP	A	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21257676A>T	uc002red.2	-							NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor						cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CTATGTGGACAGAAACTCTTA	0.433													13	38	---	---	---	---	PASS
C2orf71	388939	broad.mit.edu	37	2	29296003	29296003	+	Silent	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29296003T>C	uc002rmt.1	-	1	1125	c.1125A>G	c.(1123-1125)CCA>CCG	p.P375P		NM_001029883	NP_001025054	A6NGG8	CB071_HUMAN	hypothetical protein LOC388939	375					response to stimulus|visual perception	photoreceptor outer segment				skin(1)	1						CTTCGGGCTCTGGTGCAAGGT	0.577													12	39	---	---	---	---	PASS
NLRC4	58484	broad.mit.edu	37	2	32449823	32449823	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32449823C>A	uc002roi.2	-	9	3040	c.2794G>T	c.(2794-2796)GGA>TGA	p.G932*	NLRC4_uc002roj.1_Nonsense_Mutation_p.G932*|NLRC4_uc010ezt.1_Nonsense_Mutation_p.G267*	NM_021209	NP_067032	Q9NPP4	NLRC4_HUMAN	caspase recruitment domain protein 12	932	LRR 11.				activation of caspase activity|defense response to bacterium|detection of bacterium|interleukin-1 beta secretion|positive regulation of apoptosis	cytoplasm	ATP binding|magnesium ion binding|protein homodimerization activity			ovary(3)|large_intestine(1)|lung(1)|skin(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GGGTTCTTTCCAAAAAATGCA	0.328													5	55	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33246006	33246006	+	Missense_Mutation	SNP	G	T	T	rs148571124		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33246006G>T	uc002ros.2	+	3	596	c.596G>T	c.(595-597)GGG>GTG	p.G199V		NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	199	EGF-like 1.				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CAGAATGGAGGGATGTGTCTC	0.488													9	259	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37283723	37283723	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37283723C>A	uc002rpp.1	-	16	2355	c.2259G>T	c.(2257-2259)CTG>CTT	p.L753L		NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	753							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				GATCATGCTCCAGAGCCCCAC	0.448													6	139	---	---	---	---	PASS
GALM	130589	broad.mit.edu	37	2	38956735	38956735	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38956735G>T	uc002rqy.2	+	5	924	c.672G>T	c.(670-672)CTG>CTT	p.L224L		NM_138801	NP_620156	Q96C23	GALM_HUMAN	galactose mutarotase	224					hexose metabolic process	cytoplasm	aldose 1-epimerase activity|carbohydrate binding				0		all_hematologic(82;0.248)				CATTCGACCTGAGAAAGCCAG	0.443													6	110	---	---	---	---	PASS
C2orf61	285051	broad.mit.edu	37	2	47357337	47357337	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47357337G>T	uc002rvs.2	-	4	589	c.462C>A	c.(460-462)TCC>TCA	p.S154S	C2orf61_uc010fbd.2_RNA|C2orf61_uc010yog.1_Silent_p.S154S	NM_173649	NP_775920	Q8N801	CB061_HUMAN	hypothetical protein LOC285051 isoform 2	154											0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			ATAATTACCTGGAAGCATATT	0.403													6	60	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50318467	50318467	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50318467G>T	uc010fbp.2	-	3	1414	c.607C>A	c.(607-609)CCT>ACT	p.P203T	NRXN1_uc002rxb.3_Missense_Mutation_p.P910T|NRXN1_uc010fbq.2_Missense_Mutation_p.P1278T|NRXN1_uc002rxe.3_Missense_Mutation_p.P1238T	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor	203	Extracellular (Potential).|Laminin G-like.				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TTACCTGCAGGGTAGCGCTCG	0.448													9	176	---	---	---	---	PASS
ERLEC1	27248	broad.mit.edu	37	2	54036405	54036405	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54036405C>A	uc002rxl.2	+	10	1376	c.1096C>A	c.(1096-1098)CAT>AAT	p.H366N	ASB3_uc002rxi.3_Intron|ERLEC1_uc002rxm.2_Missense_Mutation_p.H366N|ERLEC1_uc002rxn.2_Missense_Mutation_p.H312N	NM_015701	NP_056516	Q96DZ1	ERLEC_HUMAN	erlectin isoform 1	366	PRKCSH 2.				ER-associated protein catabolic process	endoplasmic reticulum lumen	glycoprotein binding|protein binding			ovary(2)	2						ACATCAATACCATGAGGTATA	0.318													5	78	---	---	---	---	PASS
PUS10	150962	broad.mit.edu	37	2	61194650	61194650	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61194650G>T	uc010fci.2	-	6	662	c.602C>A	c.(601-603)CCC>CAC	p.P201H	PUS10_uc002sao.2_Missense_Mutation_p.P201H|PUS10_uc010ypk.1_5'UTR	NM_144709	NP_653310	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10	201					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(2)|large_intestine(1)|kidney(1)	4			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			TCCATCAATGGGAACACCCAG	0.383													7	153	---	---	---	---	PASS
PUS10	150962	broad.mit.edu	37	2	61194689	61194689	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61194689C>A	uc010fci.2	-	6	623	c.563G>T	c.(562-564)TGG>TTG	p.W188L	PUS10_uc002sao.2_Missense_Mutation_p.W188L|PUS10_uc010ypk.1_5'UTR	NM_144709	NP_653310	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10	188					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(2)|large_intestine(1)|kidney(1)	4			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			GTGAGTTATCCATTTGTAGGC	0.363													8	208	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73678881	73678881	+	Nonsense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73678881C>T	uc002sje.1	+	10	5341	c.5230C>T	c.(5230-5232)CAA>TAA	p.Q1744*	ALMS1_uc002sjf.1_Nonsense_Mutation_p.Q1700*|ALMS1_uc002sjg.2_Nonsense_Mutation_p.Q1130*|ALMS1_uc002sjh.1_Nonsense_Mutation_p.Q1130*	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1742	34 X 47 AA approximate tandem repeat.|26.				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						AGCTGTTCCTCAACCAGCTGA	0.428													12	133	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73717021	73717021	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73717021C>A	uc002sje.1	+	12	8049	c.7938C>A	c.(7936-7938)TCC>TCA	p.S2646S	ALMS1_uc002sjf.1_Silent_p.S2602S|ALMS1_uc002sjg.2_Silent_p.S2032S|ALMS1_uc002sjh.1_Silent_p.S2032S	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2644					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						TTTGGAATTCCTTGCAGTTAA	0.423													6	79	---	---	---	---	PASS
DNAH6	1768	broad.mit.edu	37	2	84775477	84775477	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84775477G>T	uc010fgb.2	+	8	1389	c.1252G>T	c.(1252-1254)GAC>TAC	p.D418Y	DNAH6_uc002soo.2_5'UTR|DNAH6_uc002sop.2_5'UTR	NM_001370	NP_001361	Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy polypeptide 6	418	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			central_nervous_system(1)	1						CACTTATGGAGACTCTGAGAA	0.368													24	51	---	---	---	---	PASS
USP39	10713	broad.mit.edu	37	2	85850862	85850862	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85850862C>A	uc002sqe.2	+	4	563	c.527C>A	c.(526-528)CCA>CAA	p.P176Q	USP39_uc002sqb.2_5'UTR|USP39_uc010ysu.1_Missense_Mutation_p.P98Q|USP39_uc010ysv.1_Missense_Mutation_p.P73Q|USP39_uc010fgn.1_Missense_Mutation_p.P176Q|USP39_uc002sqf.2_Missense_Mutation_p.P176Q|USP39_uc002sqg.2_Missense_Mutation_p.P176Q|USP39_uc010fgo.2_Missense_Mutation_p.P176Q	NM_006590	NP_006581	Q53GS9	SNUT2_HUMAN	ubiquitin specific protease 39	176	UBP-type.				spliceosome assembly|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)	1						TACTGCCTTCCAGACAACTAT	0.493													8	151	---	---	---	---	PASS
EIF2AK3	9451	broad.mit.edu	37	2	88885387	88885387	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88885387C>T	uc002stc.3	-	9	1824	c.1622G>A	c.(1621-1623)CGC>CAC	p.R541H		NM_004836	NP_004827	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha	541	Cytoplasmic (Potential).				activation of caspase activity|bone mineralization|calcium-mediated signaling|chondrocyte development|endocrine pancreas development|endoplasmic reticulum organization|endoplasmic reticulum unfolded protein response|ER overload response|insulin secretion|insulin-like growth factor receptor signaling pathway|negative regulation of myelination|negative regulation of translational initiation in response to stress|protein autophosphorylation|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|identical protein binding			ovary(3)	3						GAAAAGCCTGCGCACAATAAA	0.308													16	41	---	---	---	---	PASS
TMEM131	23505	broad.mit.edu	37	2	98412760	98412760	+	Missense_Mutation	SNP	A	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98412760A>C	uc002syh.3	-	28	3350	c.3121T>G	c.(3121-3123)TGT>GGT	p.C1041G		NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	1041						integral to membrane				ovary(4)|central_nervous_system(2)	6						TATCCTTCACATGAGTATCCA	0.303													4	7	---	---	---	---	PASS
IMP4	92856	broad.mit.edu	37	2	131103469	131103469	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131103469T>C	uc002tra.1	+	6	574	c.557T>C	c.(556-558)CTC>CCC	p.L186P		NM_033416	NP_219484	Q96G21	IMP4_HUMAN	IMP4, U3 small nucleolar ribonucleoprotein,	186	Brix.				rRNA processing|translation	nucleolus|ribonucleoprotein complex	aminoacyl-tRNA ligase activity|ATP binding|protein binding			central_nervous_system(2)	2	Colorectal(110;0.1)					AAGCCCCACCTCATCACACAC	0.637													5	25	---	---	---	---	PASS
IMP4	92856	broad.mit.edu	37	2	131103470	131103470	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131103470C>T	uc002tra.1	+	6	575	c.558C>T	c.(556-558)CTC>CTT	p.L186L		NM_033416	NP_219484	Q96G21	IMP4_HUMAN	IMP4, U3 small nucleolar ribonucleoprotein,	186	Brix.				rRNA processing|translation	nucleolus|ribonucleoprotein complex	aminoacyl-tRNA ligase activity|ATP binding|protein binding			central_nervous_system(2)	2	Colorectal(110;0.1)					AGCCCCACCTCATCACACACG	0.637													5	26	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141081591	141081591	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141081591A>T	uc002tvj.1	-	81	13357	c.12385T>A	c.(12385-12387)TAT>AAT	p.Y4129N		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4129	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCTGCTCCATATATATAATCT	0.294										TSP Lung(27;0.18)			34	36	---	---	---	---	PASS
TANK	10010	broad.mit.edu	37	2	162087607	162087607	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162087607G>T	uc002ubr.1	+	7	804	c.646G>T	c.(646-648)GGA>TGA	p.G216*	TANK_uc002ubs.2_Nonsense_Mutation_p.G216*	NM_004180	NP_004171	Q92844	TANK_HUMAN	TRAF interacting protein TANK isoform a	216						cytosol	metal ion binding|protein binding			ovary(1)	1						CACACCAAGAGGACTGTGCAG	0.403													6	91	---	---	---	---	PASS
GORASP2	26003	broad.mit.edu	37	2	171822450	171822450	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171822450C>G	uc002ugk.2	+	10	1309	c.1169C>G	c.(1168-1170)ACC>AGC	p.T390S	GORASP2_uc002ugj.2_Missense_Mutation_p.T322S|GORASP2_uc010zdl.1_Missense_Mutation_p.T402S|GORASP2_uc010zdm.1_Missense_Mutation_p.T346S|GORASP2_uc002ugl.2_Missense_Mutation_p.T322S|GORASP2_uc002ugm.2_Missense_Mutation_p.T172S	NM_015530	NP_056345	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2	390						Golgi membrane				breast(1)|central_nervous_system(1)	2						CTCCCGCCCACCAGCAACGCA	0.637													8	38	---	---	---	---	PASS
SP3	6670	broad.mit.edu	37	2	174777852	174777852	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174777852C>A	uc002uig.2	-	6	2139	c.1975G>T	c.(1975-1977)GGT>TGT	p.G659C	SP3_uc002uie.2_Missense_Mutation_p.G591C|SP3_uc002uif.2_Missense_Mutation_p.G606C|SP3_uc010zel.1_Missense_Mutation_p.G656C	NM_003111	NP_003102	Q02447	SP3_HUMAN	Sp3 transcription factor isoform 1	659	C2H2-type 2.				negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	protein binding|zinc ion binding		EWSR1/SP3(3)	soft_tissue(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.185)			AATCTTTTACCACAGTACATC	0.398													5	67	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098957	178098957	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098957G>A	uc002ulh.3	-	2	643	c.88C>T	c.(88-90)CTT>TTT	p.L30F	NFE2L2_uc002ulg.3_Missense_Mutation_p.L14F|NFE2L2_uc010zfa.1_Missense_Mutation_p.L14F|NFE2L2_uc002uli.3_Missense_Mutation_p.L14F|NFE2L2_uc010fra.2_Missense_Mutation_p.L14F|NFE2L2_uc010frb.2_Missense_Mutation_p.L14F	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	30					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			CTTACTCCAAGATCTATATCT	0.368			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			11	102	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179407938	179407938	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179407938G>T	uc010zfg.1	-	296	89282	c.89058C>A	c.(89056-89058)ACC>ACA	p.T29686T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.T23381T|TTN_uc010zfi.1_Silent_p.T23314T|TTN_uc010zfj.1_Silent_p.T23189T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30613							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGGTTTTAAGGTGACAACCT	0.448													14	504	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179416982	179416982	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179416982G>T	uc010zfg.1	-	284	83165	c.82941C>A	c.(82939-82941)GTC>GTA	p.V27647V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.V21342V|TTN_uc010zfi.1_Silent_p.V21275V|TTN_uc010zfj.1_Silent_p.V21150V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	28574							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTAATGGGGACTGCAATTC	0.408													22	233	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179418220	179418220	+	Intron	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179418220G>T	uc010zfg.1	-						uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAACCAGTAGGTACATACCA	0.348													8	254	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179438954	179438954	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179438954C>A	uc010zfg.1	-	275	64425	c.64201G>T	c.(64201-64203)GGA>TGA	p.G21401*	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.G15096*|TTN_uc010zfi.1_Nonsense_Mutation_p.G15029*|TTN_uc010zfj.1_Nonsense_Mutation_p.G14904*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22328							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCCACCGTCCATTAGGAAGG	0.413													18	102	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179457012	179457012	+	Intron	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179457012G>T	uc010zfg.1	-						uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATCTAAAAAGTGTTAAATAA	0.313													7	64	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179604870	179604870	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179604870C>T	uc010zfh.1	-	46	12801	c.12577G>A	c.(12577-12579)GTG>ATG	p.V4193M	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.V4126M|TTN_uc010zfj.1_Missense_Mutation_p.V4001M|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTATTGCCACGGGCTCTCTT	0.448													33	163	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179611618	179611618	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179611618G>T	uc002unb.2	-	46	15733	c.15509C>A	c.(15508-15510)CCC>CAC	p.P5170H	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCTTCATTGGGTGTACCAAA	0.408													8	184	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179614291	179614291	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179614291C>A	uc002unb.2	-	46	13060	c.12836G>T	c.(12835-12837)GGA>GTA	p.G4279V	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACAGATTCTCCCTGGTCTTG	0.373													21	93	---	---	---	---	PASS
CCDC141	285025	broad.mit.edu	37	2	179736207	179736207	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179736207G>T	uc002unf.1	-	4	484	c.427C>A	c.(427-429)CAG>AAG	p.Q143K		NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	143							protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			AAAATGAACTGGAGGCTCCCT	0.388													10	289	---	---	---	---	PASS
SESTD1	91404	broad.mit.edu	37	2	180036835	180036835	+	Intron	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180036835G>A	uc002uni.3	-							NM_178123	NP_835224	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1						regulation of calcium ion transport via voltage-gated calcium channel activity		phosphatidic acid binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding|protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			TAAAAAAAGAGATTACATTTA	0.318													8	133	---	---	---	---	PASS
PDE1A	5136	broad.mit.edu	37	2	183291305	183291305	+	Intron	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183291305C>A	uc002uos.2	-						PDE1A_uc010zfp.1_Intron|PDE1A_uc002uoq.1_Intron|PDE1A_uc010zfq.1_Intron|PDE1A_uc002uor.2_Missense_Mutation_p.R18I|PDE1A_uc002uov.1_Intron	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 2						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			CATTACTTACCTAAAGATGGG	0.443													9	260	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186672861	186672861	+	Intron	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186672861T>C	uc002upm.2	+						uc010zfu.1_Silent_p.G774G					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		ATTTAATGGGTAAAAGCAATG	0.313													12	30	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189927594	189927594	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189927594C>A	uc002uqk.2	-	29	2249	c.1974G>T	c.(1972-1974)CCG>CCT	p.P658P	COL5A2_uc010frx.2_Silent_p.P234P	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	658					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CACATACCGGCGGGCCCACAG	0.398													4	66	---	---	---	---	PASS
HIBCH	26275	broad.mit.edu	37	2	191117026	191117026	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191117026G>T	uc002uru.2	-	8	608	c.525C>A	c.(523-525)TTC>TTA	p.F175L	HIBCH_uc002urv.2_Missense_Mutation_p.F175L	NM_014362	NP_055177	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-Coenzyme A hydrolase isoform	175					branched chain family amino acid catabolic process	mitochondrial matrix	3-hydroxyisobutyryl-CoA hydrolase activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			CCACATCAGGGAACAGTCCTG	0.363													13	22	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196636525	196636525	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196636525G>A	uc002utj.3	-	61	11393	c.11292C>T	c.(11290-11292)TTC>TTT	p.F3764F	DNAH7_uc002uti.3_Silent_p.F247F	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3764					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						CCTCGATGTCGAAGTTGTTTG	0.448													16	150	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196640718	196640718	+	Intron	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196640718G>A	uc002utj.3	-						DNAH7_uc002uti.3_Intron	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						CTGCAGAGATGAATAACAAGA	0.403													5	58	---	---	---	---	PASS
CCDC150	284992	broad.mit.edu	37	2	197541356	197541356	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197541356G>A	uc002utp.1	+	12	1476	c.1341G>A	c.(1339-1341)GAG>GAA	p.E447E	CCDC150_uc010zgq.1_RNA|CCDC150_uc010zgr.1_RNA|CCDC150_uc010zgs.1_Silent_p.E115E	NM_001080539	NP_001074008	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	447	Potential.										0						TGCAAAAAGAGCTGCTAGAAT	0.428													23	68	---	---	---	---	PASS
PLCL1	5334	broad.mit.edu	37	2	198948853	198948853	+	Silent	SNP	T	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198948853T>G	uc010fsp.2	+	2	903	c.612T>G	c.(610-612)GTT>GTG	p.V204V	PLCL1_uc002uuv.3_Silent_p.V125V	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	204	PH.|Interaction with PPP1C.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	TGGACCTAGTTGCCAATTCAG	0.478													12	79	---	---	---	---	PASS
SPATS2L	26010	broad.mit.edu	37	2	201337626	201337626	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201337626G>T	uc002uvn.3	+	12	1484	c.1132G>T	c.(1132-1134)GCA>TCA	p.A378S	SPATS2L_uc010fst.2_Missense_Mutation_p.A378S|SPATS2L_uc002uvo.3_Missense_Mutation_p.A318S|SPATS2L_uc002uvp.3_Missense_Mutation_p.A378S|SPATS2L_uc002uvq.3_Missense_Mutation_p.A309S|SPATS2L_uc002uvr.3_Missense_Mutation_p.A378S|SPATS2L_uc010zhc.1_Missense_Mutation_p.A408S	NM_015535	NP_056350	Q9NUQ6	SPS2L_HUMAN	SPATS2-like protein isoform a	378						cytoplasm|nucleolus				ovary(2)|pancreas(1)	3						GAATGCGCACGCAGCAACCTC	0.478													6	62	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201507519	201507519	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201507519G>C	uc002uvx.2	+	25	2943	c.2842G>C	c.(2842-2844)GAG>CAG	p.E948Q	AOX1_uc010zhf.1_Missense_Mutation_p.E504Q|AOX1_uc010fsu.2_Missense_Mutation_p.E314Q	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	948					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	ACTATCCCCTGAGAAGGTAAT	0.323													7	43	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210557999	210557999	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210557999G>A	uc002vde.1	+	7	1353	c.1105G>A	c.(1105-1107)GAA>AAA	p.E369K	MAP2_uc002vdc.1_Missense_Mutation_p.E369K|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.E365K	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	369					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	TTTTAAAATTGAAGAGCCCCA	0.458													9	48	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212251789	212251789	+	Missense_Mutation	SNP	T	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212251789T>G	uc002veg.1	-	27	3368	c.3270A>C	c.(3268-3270)GAA>GAC	p.E1090D	ERBB4_uc002veh.1_Missense_Mutation_p.E1074D|ERBB4_uc010zji.1_Missense_Mutation_p.E1080D|ERBB4_uc010zjj.1_Missense_Mutation_p.E1064D	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	1090	Cytoplasmic (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		CCACAGGAGCTTCTGGAATTG	0.502										TSP Lung(8;0.080)			9	112	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216274800	216274800	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216274800G>T	uc002vfa.2	-	14	2245	c.1979C>A	c.(1978-1980)CCA>CAA	p.P660Q	FN1_uc002vfb.2_Missense_Mutation_p.P660Q|FN1_uc002vfc.2_Missense_Mutation_p.P660Q|FN1_uc002vfd.2_Missense_Mutation_p.P660Q|FN1_uc002vfe.2_Missense_Mutation_p.P660Q|FN1_uc002vff.2_Missense_Mutation_p.P660Q|FN1_uc002vfg.2_Missense_Mutation_p.P660Q|FN1_uc002vfh.2_Missense_Mutation_p.P660Q|FN1_uc002vfi.2_Missense_Mutation_p.P660Q|FN1_uc002vfj.2_Missense_Mutation_p.P660Q	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	660	Fibronectin type-III 1.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TAAGTGGCCTGGTATGGTAGC	0.403													5	17	---	---	---	---	PASS
CAPN10	11132	broad.mit.edu	37	2	241530373	241530373	+	Missense_Mutation	SNP	C	A	A	rs151024127	byFrequency	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241530373C>A	uc002vzk.1	+	3	599	c.415C>A	c.(415-417)CGC>AGC	p.R139S	CAPN10_uc010zoh.1_Missense_Mutation_p.R139S|CAPN10_uc002vzl.1_Missense_Mutation_p.R139S|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_Silent_p.P14P|CAPN10_uc002vzo.1_RNA|CAPN10_uc010fzg.1_RNA|CAPN10_uc002vzp.1_RNA|CAPN10_uc002vzq.1_Intron	NM_023083	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10 isoform a	139	Calpain catalytic.				actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		CTGTTTCTCCCGCTGCCAGAG	0.627													4	16	---	---	---	---	PASS
THUMPD3	25917	broad.mit.edu	37	3	9406810	9406810	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9406810C>A	uc003bro.3	+	2	206	c.58C>A	c.(58-60)CAG>AAG	p.Q20K	LOC440944_uc003brm.2_Intron|THUMPD3_uc003brn.3_Missense_Mutation_p.Q20K	NM_001114092	NP_001107564	Q9BV44	THUM3_HUMAN	THUMP domain containing 3	20							methyltransferase activity|protein binding|RNA binding			ovary(1)	1	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.101)		TCATGAGAACCAGAAGTCTGT	0.453													5	78	---	---	---	---	PASS
ZFYVE20	64145	broad.mit.edu	37	3	15116107	15116107	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15116107C>T	uc003bzm.1	-	14	2151	c.1537G>A	c.(1537-1539)GAG>AAG	p.E513K	ZFYVE20_uc010hek.1_Missense_Mutation_p.E513K	NM_022340	NP_071735	Q9H1K0	RBNS5_HUMAN	FYVE-finger-containing Rab5 effector protein	513	UIM.|Potential.|Necessary for the interaction with EHD1.				blood coagulation|endosome transport|protein transport	early endosome membrane|plasma membrane	protein binding|zinc ion binding			skin(2)	2						TCCTCCTCCTCAGCCTGCCTC	0.612													30	34	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62452069	62452069	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62452069A>G	uc003dll.2	-	25	3857	c.3497T>C	c.(3496-3498)ATA>ACA	p.I1166T	CADPS_uc003dlj.1_Missense_Mutation_p.I121T|CADPS_uc003dlk.1_Missense_Mutation_p.I614T|CADPS_uc003dlm.2_Missense_Mutation_p.I1127T|CADPS_uc003dln.2_Missense_Mutation_p.I1087T	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	1166					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TAGTTCGTCTATTTTTGAATG	0.358													12	19	---	---	---	---	PASS
SUCLG2	8801	broad.mit.edu	37	3	67426195	67426195	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67426195C>A	uc003dna.3	-	11	1300	c.1272G>T	c.(1270-1272)AAG>AAT	p.K424N	SUCLG2_uc010hob.2_Missense_Mutation_p.K171N	NM_003848	NP_003839	Q96I99	SUCB2_HUMAN	succinate-CoA ligase, GDP-forming beta subunit	424					succinyl-CoA metabolic process|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|GTP binding|succinate-CoA ligase (GDP-forming) activity			central_nervous_system(1)|skin(1)	2		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)	TGGCCACAGCCTTCTTGGCTG	0.488													12	15	---	---	---	---	PASS
GXYLT2	727936	broad.mit.edu	37	3	72971411	72971411	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72971411C>T	uc003dpg.2	+	3	525	c.525C>T	c.(523-525)ATC>ATT	p.I175I		NM_001080393	NP_001073862	A0PJZ3	GXLT2_HUMAN	glycosyltransferase 8 domain containing 4	175	Lumenal (Potential).				O-glycan processing	integral to membrane	UDP-xylosyltransferase activity				0						TCTACCCCATCACATTTTCTG	0.453													58	118	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89521662	89521662	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89521662C>T	uc003dqy.2	+	16	2964	c.2739C>T	c.(2737-2739)TTC>TTT	p.F913F	EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	913	Cytoplasmic (Potential).|SAM.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TCACTACCTTCCGCACAACAG	0.468										TSP Lung(6;0.00050)			23	77	---	---	---	---	PASS
BBX	56987	broad.mit.edu	37	3	107429440	107429440	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107429440G>T	uc010hpr.2	+	4	460	c.133G>T	c.(133-135)GAG>TAG	p.E45*	BBX_uc003dwk.3_Nonsense_Mutation_p.E45*|BBX_uc003dwl.3_Nonsense_Mutation_p.E45*|BBX_uc010hps.1_Nonsense_Mutation_p.E66*|BBX_uc003dwm.3_Nonsense_Mutation_p.E45*	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1	45	Poly-Glu.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			agaggaagaagaggaagacga	0.294													5	47	---	---	---	---	PASS
GTPBP8	29083	broad.mit.edu	37	3	112710030	112710030	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112710030G>T	uc003dzn.2	+	1	231	c.184G>T	c.(184-186)GGG>TGG	p.G62W	GTPBP8_uc011bhy.1_RNA|GTPBP8_uc003dzp.2_RNA|GTPBP8_uc003dzo.2_Missense_Mutation_p.G62W	NM_014170	NP_054889	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 isoform 1	62					barrier septum formation		GTP binding				0						CGCCCCCTACGGGAGGCAAGA	0.607													4	20	---	---	---	---	PASS
CASR	846	broad.mit.edu	37	3	121973103	121973103	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121973103G>A	uc003eev.3	+	2	439	c.67G>A	c.(67-69)GAC>AAC	p.D23N	CASR_uc003eew.3_Missense_Mutation_p.D23N	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	23	Extracellular (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CTACGGGCCAGACCAGCGAGC	0.537													34	117	---	---	---	---	PASS
TOPBP1	11073	broad.mit.edu	37	3	133362168	133362168	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133362168G>A	uc003eps.2	-	12	2029	c.1897C>T	c.(1897-1899)CTC>TTC	p.L633F		NM_007027	NP_008958	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	633	BRCT 4.				DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						GGTGTGAAGAGAGGATTCGAC	0.373								Other_conserved_DNA_damage_response_genes					5	66	---	---	---	---	PASS
CCDC50	152137	broad.mit.edu	37	3	191093125	191093125	+	Intron	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191093125C>G	uc003fsw.2	+						CCDC50_uc003fsv.2_Missense_Mutation_p.I241M	NM_174908	NP_777568	Q8IVM0	CCD50_HUMAN	Ymer protein short isoform							cytoplasm	protein binding				0	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)		TTCCCACGATCAGTGGTGAAG	0.498													20	22	---	---	---	---	PASS
TMEM44	93109	broad.mit.edu	37	3	194309345	194309345	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194309345G>T	uc010hzn.2	-	11	1510	c.1341C>A	c.(1339-1341)CTC>CTA	p.L447L	TMEM44_uc010hzm.2_3'UTR|TMEM44_uc003fuc.2_Silent_p.L132L|TMEM44_uc003fue.2_Silent_p.L400L|TMEM44_uc003fud.2_Silent_p.L411L|TMEM44_uc003fuf.2_3'UTR|TMEM44_uc011bsv.1_Silent_p.L410L|uc003fug.2_5'Flank	NM_001011655	NP_001011655	Q2T9K0	TMM44_HUMAN	transmembrane protein 44 isoform b	447	Cytoplasmic (Potential).					integral to membrane					0	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		TGCTGCCTTCGAGGTTCACAT	0.507													6	124	---	---	---	---	PASS
HTT	3064	broad.mit.edu	37	4	3105586	3105586	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3105586C>A	uc011bvq.1	+	5	655	c.510C>A	c.(508-510)CTC>CTA	p.L170L		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	168					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GGTTACAGCTCGAGCTCTATA	0.294													4	92	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13604824	13604824	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13604824C>G	uc003gmz.1	-	10	3817	c.3700G>C	c.(3700-3702)GAT>CAT	p.D1234H	BOD1L_uc010idr.1_Missense_Mutation_p.D571H	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	1234							DNA binding			ovary(5)|breast(1)	6						GTTTCAGAATCTATATTCACT	0.393													25	68	---	---	---	---	PASS
LDB2	9079	broad.mit.edu	37	4	16900050	16900050	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16900050C>G	uc003goz.2	-	1	375	c.59G>C	c.(58-60)AGG>ACG	p.R20T	LDB2_uc003gpa.2_Missense_Mutation_p.R20T|LDB2_uc003gpb.2_Missense_Mutation_p.R20T|LDB2_uc011bxh.1_Missense_Mutation_p.R20T|LDB2_uc010iee.2_Missense_Mutation_p.R20T	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a	20							LIM domain binding|transcription cofactor activity				0						TGGTGTATGCCTCCTATAAAA	0.453													8	48	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47667122	47667122	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47667122G>T	uc003gxm.2	-	11	1609	c.1516C>A	c.(1516-1518)CTC>ATC	p.L506I	CORIN_uc011bzf.1_Missense_Mutation_p.L367I|CORIN_uc011bzg.1_Missense_Mutation_p.L439I|CORIN_uc011bzh.1_Missense_Mutation_p.L469I|CORIN_uc011bzi.1_Missense_Mutation_p.L469I	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin	506	Extracellular (Potential).|FZ 2.				peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						AAGAACATGAGGTATTTATAA	0.423													6	100	---	---	---	---	PASS
AFP	174	broad.mit.edu	37	4	74301996	74301996	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74301996C>T	uc003hgz.1	+	1	64	c.17C>T	c.(16-18)TCA>TTA	p.S6L	AFP_uc003hha.1_Missense_Mutation_p.S6L|AFP_uc003hgy.1_Intron	NM_001134	NP_001125	P02771	FETA_HUMAN	alpha-fetoprotein precursor	6					transport		metal ion binding			ovary(1)	1	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGGGTGGAATCAATTTTTTTA	0.318									Alpha-Fetoprotein_Hereditary_Persistence_of				7	40	---	---	---	---	PASS
AFP	174	broad.mit.edu	37	4	74302032	74302032	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74302032C>G	uc003hgz.1	+	1	100	c.53C>G	c.(52-54)TCC>TGC	p.S18C	AFP_uc003hha.1_Missense_Mutation_p.S18C|AFP_uc003hgy.1_Intron	NM_001134	NP_001125	P02771	FETA_HUMAN	alpha-fetoprotein precursor	18					transport		metal ion binding			ovary(1)	1	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTTACTGAATCCAGAACACTG	0.284									Alpha-Fetoprotein_Hereditary_Persistence_of				6	33	---	---	---	---	PASS
AREG	374	broad.mit.edu	37	4	75312365	75312365	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75312365C>T	uc011cbl.1	+	2	386	c.176C>T	c.(175-177)TCA>TTA	p.S59L		NM_001657	NP_001648	P15514	AREG_HUMAN	amphiregulin preproprotein	59					cell proliferation|cell-cell signaling|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|positive regulation of DNA replication	cell surface|extracellular space|integral to membrane	cytokine activity|growth factor activity				0			Lung(101;0.196)			GAGATGTCTTCAGGGAGTGAG	0.483													47	33	---	---	---	---	PASS
COPS4	51138	broad.mit.edu	37	4	83996472	83996472	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83996472G>T	uc003hoa.2	+	10	1249	c.1110G>T	c.(1108-1110)TGG>TGT	p.W370C	COPS4_uc003hob.2_Nonsense_Mutation_p.G420*|COPS4_uc010ijw.2_Missense_Mutation_p.W402C|COPS4_uc010ijx.2_Missense_Mutation_p.G342V	NM_016129	NP_057213	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	370					cullin deneddylation	cytoplasm|signalosome	protein binding			kidney(1)	1		Hepatocellular(203;0.114)				TGCCAACGTGGGATAAGCAGA	0.383													5	41	---	---	---	---	PASS
PTPN13	5783	broad.mit.edu	37	4	87690984	87690984	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87690984G>A	uc003hpz.2	+	29	5032	c.4552G>A	c.(4552-4554)GAA>AAA	p.E1518K	PTPN13_uc003hpy.2_Missense_Mutation_p.E1523K|PTPN13_uc003hqa.2_Missense_Mutation_p.E1499K|PTPN13_uc003hqb.2_Missense_Mutation_p.E1327K|PTPN13_uc003hqc.1_5'UTR	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	1518	PDZ 3.					cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TTTTTCTCGAGAAGATAATCT	0.318													6	57	---	---	---	---	PASS
AFF1	4299	broad.mit.edu	37	4	87967424	87967424	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87967424G>T	uc003hqj.3	+	2	531	c.124G>T	c.(124-126)GGA>TGA	p.G42*	AFF1_uc011ccx.1_Intron|AFF1_uc003hqh.1_Nonsense_Mutation_p.G49*|AFF1_uc011ccy.1_Nonsense_Mutation_p.G49*|AFF1_uc011ccz.1_Nonsense_Mutation_p.G49*|AFF1_uc003hqk.3_Nonsense_Mutation_p.G42*|AFF1_uc011cda.1_Intron	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	42						nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		TCCCCTTTTTGGAGAGCCCTA	0.408													7	130	---	---	---	---	PASS
HERC6	55008	broad.mit.edu	37	4	89317227	89317227	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89317227C>A	uc011cdi.1	+	6	1003	c.820C>A	c.(820-822)CCT>ACT	p.P274T	HERC6_uc003hrp.1_RNA|HERC6_uc011cdj.1_Missense_Mutation_p.P274T|HERC6_uc011cdk.1_RNA|HERC6_uc011cdl.1_RNA	NM_017912	NP_060382	Q8IVU3	HERC6_HUMAN	hect domain and RLD 6 isoform 1	274	RCC1 5.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytosol	ubiquitin-protein ligase activity			lung(3)|ovary(1)|kidney(1)	5		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		CAGCCCCACTCCTGAGAAGAG	0.428													21	53	---	---	---	---	PASS
TBCK	93627	broad.mit.edu	37	4	107229955	107229955	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107229955G>T	uc010ilv.2	-	2	528	c.163C>A	c.(163-165)CAG>AAG	p.Q55K	TBCK_uc003hye.2_Missense_Mutation_p.Q55K|TBCK_uc003hyc.2_Missense_Mutation_p.Q55K|TBCK_uc003hyd.2_5'UTR|TBCK_uc003hyf.2_Missense_Mutation_p.Q55K	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN	TBC domain-containing protein kinase-like	55	Protein kinase.					intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						TCCACATACTGGCAGAGTCTG	0.363													5	65	---	---	---	---	PASS
C4orf31	79625	broad.mit.edu	37	4	121966917	121966917	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121966917C>T	uc003idq.1	-	2	603	c.76G>A	c.(76-78)GAT>AAT	p.D26N		NM_024574	NP_078850	Q8TB73	CD031_HUMAN	hypothetical protein LOC79625 precursor	26											0						AGTTCCTCATCCCGGGTGGGT	0.478													13	18	---	---	---	---	PASS
BBS7	55212	broad.mit.edu	37	4	122782823	122782823	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122782823C>A	uc003ied.2	-	4	351	c.177G>T	c.(175-177)AAG>AAT	p.K59N	BBS7_uc003iee.1_Missense_Mutation_p.K59N|BBS7_uc010inq.1_Missense_Mutation_p.K15N	NM_176824	NP_789794	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7 protein isoform a	59					cilium morphogenesis|digestive tract morphogenesis|fat cell differentiation|heart looping|melanosome transport|pigment granule aggregation in cell center|response to stimulus|visual perception	BBSome|centrosome|cilium membrane	protein binding			ovary(1)	1						CGGGTAAAGTCTTGAACACTG	0.373									Bardet-Biedl_syndrome				7	14	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123246404	123246404	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123246404G>A	uc003ieh.2	+	63	10969	c.10924G>A	c.(10924-10926)GAA>AAA	p.E3642K	KIAA1109_uc003iel.1_Missense_Mutation_p.E1577K|KIAA1109_uc003iem.2_Missense_Mutation_p.E12K	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	3642					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						AGGAGAAACTGAAGAGCTCCC	0.338													6	38	---	---	---	---	PASS
TKTL2	84076	broad.mit.edu	37	4	164393214	164393214	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164393214C>G	uc003iqp.3	-	1	1834	c.1673G>C	c.(1672-1674)GGC>GCC	p.G558A		NM_032136	NP_115512	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	558						cytoplasm	metal ion binding|transketolase activity			ovary(2)|skin(2)|pancreas(1)	5	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GATAACTCGGCCGCCTGTGGC	0.507													15	27	---	---	---	---	PASS
FBXO8	26269	broad.mit.edu	37	4	175160165	175160165	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175160165C>A	uc003itp.2	-	5	1602	c.752G>T	c.(751-753)CGA>CTA	p.R251L	FBXO8_uc003itq.2_Missense_Mutation_p.R210L	NM_012180	NP_036312	Q9NRD0	FBX8_HUMAN	F-box only protein 8	251	SEC7.				regulation of ARF protein signal transduction|ubiquitin-dependent protein catabolic process	cytoplasm|ubiquitin ligase complex	ARF guanyl-nucleotide exchange factor activity			breast(2)	2		Prostate(90;0.00201)|Melanoma(52;0.012)|Renal(120;0.0183)|all_neural(102;0.0887)|all_hematologic(60;0.107)		all cancers(43;7.29e-18)|Epithelial(43;1.85e-15)|OV - Ovarian serous cystadenocarcinoma(60;5.62e-09)|GBM - Glioblastoma multiforme(59;0.00115)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.1)		GCCAAGTTCTCGCATTAAATC	0.388													4	20	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175899083	175899083	+	Nonsense_Mutation	SNP	C	T	T	rs141115697		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175899083C>T	uc003iuc.2	+	5	3077	c.2407C>T	c.(2407-2409)CAG>TAG	p.Q803*	ADAM29_uc003iud.2_Nonsense_Mutation_p.Q803*|ADAM29_uc010irr.2_Nonsense_Mutation_p.Q803*|ADAM29_uc011cki.1_Nonsense_Mutation_p.Q803*	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	803	8.|Cytoplasmic (Potential).|9 X 9 AA approximate repeats.				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		GACACCCTCCCAGAGGCAACC	0.567													16	49	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175899130	175899130	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175899130G>A	uc003iuc.2	+	5	3124	c.2454G>A	c.(2452-2454)ACG>ACA	p.T818T	ADAM29_uc003iud.2_Silent_p.T818T|ADAM29_uc010irr.2_Silent_p.T818T|ADAM29_uc011cki.1_Silent_p.T818T	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	818	Cytoplasmic (Potential).|9 X 9 AA approximate repeats.|9.				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CTCCTGTGACGCCCTCCTAGA	0.587													11	44	---	---	---	---	PASS
SORBS2	8470	broad.mit.edu	37	4	186545420	186545420	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186545420C>A	uc003iyl.2	-	13	2009	c.1151G>T	c.(1150-1152)TGT>TTT	p.C384F	SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Missense_Mutation_p.C484F|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Missense_Mutation_p.C288F|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Missense_Mutation_p.C498F|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2	384						actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		GAGATCGTCACAGCTCCGGGA	0.537													5	12	---	---	---	---	PASS
SLC45A2	51151	broad.mit.edu	37	5	33947345	33947345	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33947345A>G	uc003jid.2	-	6	1383	c.1291T>C	c.(1291-1293)TTT>CTT	p.F431L	SLC45A2_uc003jie.2_Missense_Mutation_p.F431L	NM_016180	NP_057264	Q9UMX9	S45A2_HUMAN	membrane-associated transporter protein isoform	431	Helical; Name=10; (Potential).				melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						ATTACACCAAACAGGCTGCAC	0.512													47	247	---	---	---	---	PASS
SLC1A3	6507	broad.mit.edu	37	5	36677103	36677103	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36677103G>A	uc003jkj.3	+	6	1153	c.677G>A	c.(676-678)CGA>CAA	p.R226Q	SLC1A3_uc011cox.1_Missense_Mutation_p.R119Q|SLC1A3_uc010iuy.2_Missense_Mutation_p.R226Q	NM_004172	NP_004163	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity	226	Extracellular (Potential).				D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		L-Glutamic Acid(DB00142)	ACTCTTACCCGAATCACAGAG	0.488													10	87	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	37017247	37017247	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37017247G>A	uc003jkl.3	+	24	5402	c.4903G>A	c.(4903-4905)GAA>AAA	p.E1635K	NIPBL_uc003jkk.3_Missense_Mutation_p.E1635K	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	1635					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AGGATCTATAGAACGCATTTT	0.333													10	49	---	---	---	---	PASS
OSMR	9180	broad.mit.edu	37	5	38881856	38881856	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38881856G>T	uc003jln.1	+	4	775	c.408G>T	c.(406-408)GAG>GAT	p.E136D	OSMR_uc003jlm.1_Missense_Mutation_p.E136D	NM_003999	NP_003990	Q99650	OSMR_HUMAN	oncostatin M receptor precursor	136	Extracellular (Potential).				cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_lung(31;0.000365)					GTTCCTGGGAGGAAGTCAGTG	0.418													7	121	---	---	---	---	PASS
CARD6	84674	broad.mit.edu	37	5	40843654	40843654	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40843654G>T	uc003jmg.2	+	2	759	c.684G>T	c.(682-684)GTG>GTT	p.V228V		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	228	Asp/Glu-rich.				apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						AAGCCACTGTGGAAGAGGAGG	0.433													5	66	---	---	---	---	PASS
FBXO4	26272	broad.mit.edu	37	5	41927172	41927172	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41927172G>T	uc003jmq.2	+	2	303	c.247G>T	c.(247-249)GGA>TGA	p.G83*	FBXO4_uc003jmp.2_Nonsense_Mutation_p.G83*|FBXO4_uc003jmr.2_Nonsense_Mutation_p.G83*	NM_012176	NP_036308	Q9UKT5	FBX4_HUMAN	F-box only protein 4 isoform 1	83	F-box.				positive regulation of protein ubiquitination|protein polyubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|telomere maintenance|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	protein binding|protein homodimerization activity|ubiquitin-protein ligase activity			liver(1)	1		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				GTGTCAGTTGGGAAGTACAAA	0.373													7	134	---	---	---	---	PASS
NNT	23530	broad.mit.edu	37	5	43659273	43659273	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43659273G>T	uc003joe.2	+	17	2710	c.2455G>T	c.(2455-2457)GGT>TGT	p.G819C	NNT_uc003jof.2_Missense_Mutation_p.G819C	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	819	Helical; (Potential).				tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	GTTGTTCTAGGGTGTGACTTT	0.413													7	160	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45461983	45461983	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45461983G>T	uc003jok.2	-	3	1001	c.976C>A	c.(976-978)CCA>ACA	p.P326T		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	326	Extracellular (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						CAATCTGGTGGGAAGTCCTGC	0.408													42	27	---	---	---	---	PASS
LHFPL2	10184	broad.mit.edu	37	5	77805804	77805804	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77805804C>A	uc003kfo.2	-	4	909	c.233G>T	c.(232-234)CGG>CTG	p.R78L		NM_005779	NP_005770	Q6ZUX7	LHPL2_HUMAN	lipoma HMGIC fusion partner-like 2	78						integral to membrane					0		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)		CAGCGTGTCCCGCTGGAAGTG	0.572													3	15	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82850838	82850838	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82850838G>C	uc003kii.3	+	12	10072	c.9716G>C	c.(9715-9717)TGG>TCG	p.W3239S	VCAN_uc003kij.3_Missense_Mutation_p.W2252S|VCAN_uc010jau.2_Missense_Mutation_p.W1485S|VCAN_uc003kik.3_Missense_Mutation_p.W498S|VCAN_uc003kil.3_Missense_Mutation_p.W1903S	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	3239	C-type lectin.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		GACTTCCGTTGGACTGATGGC	0.413													6	18	---	---	---	---	PASS
MEGF10	84466	broad.mit.edu	37	5	126734484	126734484	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126734484G>T	uc003kuh.3	+	8	1138	c.776G>T	c.(775-777)TGG>TTG	p.W259L	MEGF10_uc010jdc.1_Missense_Mutation_p.W259L|MEGF10_uc010jdd.1_Missense_Mutation_p.W259L|MEGF10_uc003kui.3_Missense_Mutation_p.W259L	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor	259	Extracellular (Potential).|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.|EGF-like 4.				cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		CCTTCTGGCTGGATGGTAAGC	0.507													19	19	---	---	---	---	PASS
MEGF10	84466	broad.mit.edu	37	5	126769147	126769147	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126769147G>T	uc003kuh.3	+	15	2148	c.1786G>T	c.(1786-1788)GAT>TAT	p.D596Y	MEGF10_uc003kui.3_Missense_Mutation_p.D596Y	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor	596	Extracellular (Potential).|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.|EGF-like 11.				cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ATGCTCCCCTGATGATGGCAT	0.562													14	24	---	---	---	---	PASS
PCDHA3	56145	broad.mit.edu	37	5	140181452	140181452	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140181452G>A	uc003lhf.2	+	1	670	c.670G>A	c.(670-672)GGC>AGC	p.G224S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.G224S	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	224	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGCTCACTGGCACGACTCA	0.403													15	31	---	---	---	---	PASS
PCDHA12	56137	broad.mit.edu	37	5	140255775	140255775	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140255775C>T	uc003lic.2	+	1	845	c.718C>T	c.(718-720)CCG>TCG	p.P240S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Missense_Mutation_p.P240S	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	240	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACAATGGTCCGGCGTTTGA	0.428													18	51	---	---	---	---	PASS
SH3RF2	153769	broad.mit.edu	37	5	145428766	145428766	+	Missense_Mutation	SNP	G	T	T	rs146377978		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145428766G>T	uc003lnt.2	+	7	1518	c.1280G>T	c.(1279-1281)CGA>CTA	p.R427L	SH3RF2_uc011dbl.1_Missense_Mutation_p.R427L|SH3RF2_uc011dbm.1_5'Flank|SH3RF2_uc003lnu.2_5'Flank	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	427	SH3 3.						ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTCACCGGGCGAGTCGGCATC	0.612											OREG0016895	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	23	---	---	---	---	PASS
JAKMIP2	9832	broad.mit.edu	37	5	147023671	147023671	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147023671G>C	uc003loq.1	-	7	1556	c.1174C>G	c.(1174-1176)CTA>GTA	p.L392V	JAKMIP2_uc011dbx.1_Missense_Mutation_p.L350V|JAKMIP2_uc003lor.1_Missense_Mutation_p.L392V|uc003lop.1_Intron|JAKMIP2_uc010jgo.1_Missense_Mutation_p.L392V	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein	392	Potential.					Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAAGTTTTAGAAACTCTGTT	0.393													13	24	---	---	---	---	PASS
HAVCR1	26762	broad.mit.edu	37	5	156479362	156479362	+	Intron	SNP	T	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156479362T>A	uc010jij.1	-						HAVCR1_uc011ddl.1_Intron|HAVCR1_uc003lwi.2_Intron	NM_001099414	NP_001092884	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1						interspecies interaction between organisms	integral to membrane	receptor activity			ovary(1)|skin(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCAAACACATCTGTTTTACC	0.443													19	28	---	---	---	---	PASS
TRIM38	10475	broad.mit.edu	37	6	25983517	25983517	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25983517C>T	uc003nfm.2	+	8	1435	c.1000C>T	c.(1000-1002)CCC>TCC	p.P334S	TRIM38_uc003nfn.2_Missense_Mutation_p.P316S|TRIM38_uc010jqd.2_5'UTR	NM_006355	NP_006346	O00635	TRI38_HUMAN	tripartite motif-containing 38	334	B30.2/SPRY.				positive regulation of I-kappaB kinase/NF-kappaB cascade	intracellular	signal transducer activity|zinc ion binding				0						TACTGCCTTCCCCTGTGTCTT	0.478													5	81	---	---	---	---	PASS
HIST1H1C	3006	broad.mit.edu	37	6	26056651	26056651	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26056651G>A	uc003nfw.2	-	1	49	c.6C>T	c.(4-6)TCC>TCT	p.S2S		NM_005319	NP_005310	P16403	H12_HUMAN	histone cluster 1, H1c	2					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(3)|skin(2)	5						GAGCAGTCTCGGACATGTTGA	0.612													9	10	---	---	---	---	PASS
BTN2A2	10385	broad.mit.edu	37	6	26390287	26390287	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26390287C>T	uc003nhq.2	+	5	865	c.779C>T	c.(778-780)ACC>ATC	p.T260I	BTN2A2_uc011dkf.1_Missense_Mutation_p.T144I|BTN2A2_uc011dkg.1_Missense_Mutation_p.T166I|BTN2A2_uc003nhr.2_Missense_Mutation_p.T144I|BTN2A2_uc011dkh.1_Missense_Mutation_p.T50I|BTN2A2_uc003nhs.2_Missense_Mutation_p.T260I|BTN2A2_uc003nht.2_Missense_Mutation_p.T260I|BTN2A2_uc011dki.1_Missense_Mutation_p.T9I	NM_006995	NP_008926	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2 isoform a	260	Extracellular (Potential).				negative regulation of activated T cell proliferation|negative regulation of cellular metabolic process|negative regulation of cytokine secretion	integral to membrane					0						GTCATCCTGACCGCATCTCCC	0.468													14	77	---	---	---	---	PASS
BTN3A3	10384	broad.mit.edu	37	6	26448623	26448623	+	Missense_Mutation	SNP	G	T	T	rs140949337		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26448623G>T	uc003nhz.2	+	6	1043	c.863G>T	c.(862-864)CGA>CTA	p.R288L	BTN3A3_uc003nia.2_Missense_Mutation_p.R246L|BTN3A3_uc011dkn.1_Missense_Mutation_p.R246L	NM_006994	NP_008925	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3 isoform a	288	Cytoplasmic (Potential).					integral to membrane					0						GAAAGAGAGCGAGAGATGAAA	0.493													5	58	---	---	---	---	PASS
OR14J1	442191	broad.mit.edu	37	6	29274478	29274478	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29274478G>C	uc011dln.1	+	1	12	c.12G>C	c.(10-12)TTG>TTC	p.L4F		NM_030946	NP_112208	Q9UGF5	O14J1_HUMAN	olfactory receptor, family 5, subfamily U member	4	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TGGTCAATTTGACTTCAATGA	0.398													32	74	---	---	---	---	PASS
TUBB	203068	broad.mit.edu	37	6	30691668	30691668	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30691668G>T	uc003nrl.2	+	4	956	c.829G>T	c.(829-831)GGA>TGA	p.G277*	TUBB_uc003nrk.1_Nonsense_Mutation_p.G277*|TUBB_uc011dmq.1_Nonsense_Mutation_p.G205*	NM_178014	NP_821133	P07437	TBB5_HUMAN	tubulin, beta	277					cellular component movement|G2/M transition of mitotic cell cycle|microtubule-based movement|natural killer cell mediated cytotoxicity|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|MHC class I protein binding			ovary(1)	1					Colchicine(DB01394)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	CACCAGCCGTGGAAGCCAGCA	0.587													6	66	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33153474	33153474	+	Intron	SNP	T	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33153474T>A	uc003ocx.1	-						COL11A2_uc003ocy.1_Intron|COL11A2_uc003ocz.1_Intron	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1						cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						TCCCTTGAGTTTACCTGATAA	0.567													10	31	---	---	---	---	PASS
SYNGAP1	8831	broad.mit.edu	37	6	33411229	33411229	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33411229G>A	uc011dri.1	+	15	3095	c.2900G>A	c.(2899-2901)CGA>CAA	p.R967Q	SYNGAP1_uc010juy.2_Missense_Mutation_p.R938Q|SYNGAP1_uc010juz.2_Missense_Mutation_p.R679Q	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	967					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4						caccaccaccGAGGTGGAGAG	0.562													18	71	---	---	---	---	PASS
PACSIN1	29993	broad.mit.edu	37	6	34498116	34498116	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34498116G>A	uc003ojo.2	+	7	1091	c.885G>A	c.(883-885)ATG>ATA	p.M295I	PACSIN1_uc003ojp.2_Missense_Mutation_p.M295I	NM_020804	NP_065855	Q9BY11	PACN1_HUMAN	protein kinase C and casein kinase substrate in	295					endocytosis		protein kinase activity				0						GCCCCGGCATGCCCATGAACT	0.617													12	13	---	---	---	---	PASS
CPNE5	57699	broad.mit.edu	37	6	36714347	36714347	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36714347G>A	uc003omr.1	-	16	1093	c.1026C>T	c.(1024-1026)CCC>CCT	p.P342P	CPNE5_uc003omp.1_Silent_p.P50P|CPNE5_uc010jwn.1_5'UTR|CPNE5_uc003omq.1_5'UTR	NM_020939	NP_065990	Q9HCH3	CPNE5_HUMAN	copine V	342	VWFA.									skin(1)	1						TGGACTGTGAGGGGTTCCCTG	0.592													7	20	---	---	---	---	PASS
KCNK17	89822	broad.mit.edu	37	6	39271746	39271746	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39271746G>T	uc003ooo.2	-	4	815	c.675C>A	c.(673-675)GGC>GGA	p.G225G	KCNK17_uc003oop.2_Silent_p.G225G	NM_031460	NP_113648	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	225						integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2						TCACGTAGTCGCCGAAGCCCA	0.622													4	66	---	---	---	---	PASS
PEX6	5190	broad.mit.edu	37	6	42937458	42937458	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42937458C>A	uc003otf.2	-	5	1408	c.1315G>T	c.(1315-1317)GAG>TAG	p.E439*	PEX6_uc010jya.2_RNA	NM_000287	NP_000278	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	439					protein import into peroxisome matrix, translocation|protein stabilization	cytosol|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)	1			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			ACCAAGGCCTCCAGGCCTGGA	0.547													5	61	---	---	---	---	PASS
CUL7	9820	broad.mit.edu	37	6	43008367	43008367	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43008367C>A	uc003otq.2	-	21	4227	c.3924G>T	c.(3922-3924)CTG>CTT	p.L1308L	CUL7_uc010jyg.2_Silent_p.L587L|CUL7_uc011dvb.1_Silent_p.L1392L|CUL7_uc010jyh.2_Silent_p.L301L|KLC4_uc003otr.1_5'Flank	NM_014780	NP_055595	Q14999	CUL7_HUMAN	cullin 7	1308					interspecies interaction between organisms|ubiquitin-dependent protein catabolic process|vasculogenesis	anaphase-promoting complex|mitochondrion	ubiquitin protein ligase binding			ovary(3)|kidney(1)	4			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TAGAGGTGCTCAGGCTCTGCA	0.612													5	75	---	---	---	---	PASS
XPO5	57510	broad.mit.edu	37	6	43534990	43534990	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43534990G>T	uc003ovp.2	-	7	961	c.750C>A	c.(748-750)CTC>CTA	p.L250L		NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5	250					gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			GTATCTCCAGGAGTTTACAGT	0.453													12	49	---	---	---	---	PASS
GPR111	222611	broad.mit.edu	37	6	47649797	47649797	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47649797G>T	uc010jzj.1	+	6	1503	c.1502G>T	c.(1501-1503)TGG>TTG	p.W501L	GPR111_uc010jzk.1_Missense_Mutation_p.W433L|GPR111_uc003oyy.2_RNA	NM_153839	NP_722581	Q8IZF7	GP111_HUMAN	G-protein coupled receptor 111	501	Helical; Name=2; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						GCAGATGTGTGGTTCATTGTG	0.438													4	30	---	---	---	---	PASS
DEFB113	245927	broad.mit.edu	37	6	49937341	49937341	+	5'Flank	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49937341C>G	uc011dwq.1	-							NM_001037729	NP_001032818	Q30KQ7	DB113_HUMAN	beta-defensin 113 precursor						defense response to bacterium	extracellular region					0	Lung NSC(77;0.042)					ATCTTCATTGCTGATGCAGTT	0.353													17	39	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69349136	69349136	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69349136G>T	uc003pev.3	+	3	1017	c.569G>T	c.(568-570)GGG>GTG	p.G190V	BAI3_uc010kak.2_Missense_Mutation_p.G190V	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	190	Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				GAATCATGTGGGATCATGTAT	0.448													6	42	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69949100	69949100	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69949100G>T	uc003pev.3	+	20	3244	c.2796G>T	c.(2794-2796)CAG>CAT	p.Q932H	BAI3_uc010kak.2_Missense_Mutation_p.Q932H|BAI3_uc011dxx.1_Missense_Mutation_p.Q138H|BAI3_uc003pex.1_Missense_Mutation_p.Q62H	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	932	Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				TGGTTGGACAGACTCAGACAC	0.333													5	62	---	---	---	---	PASS
CD109	135228	broad.mit.edu	37	6	74440235	74440235	+	Missense_Mutation	SNP	C	T	T	rs137899447	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74440235C>T	uc003php.2	+	4	870	c.445C>T	c.(445-447)CGC>TGC	p.R149C	CD109_uc010kaz.2_Missense_Mutation_p.R149C|CD109_uc003phq.2_Missense_Mutation_p.R149C|CD109_uc010kba.2_Intron	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor	149						anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						AGTGAAGTTTCGCATTGTTAC	0.373													7	38	---	---	---	---	PASS
TPBG	7162	broad.mit.edu	37	6	83075567	83075567	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83075567G>A	uc003pjn.3	+	3	1825	c.889G>A	c.(889-891)GTC>ATC	p.V297I	TPBG_uc010kbj.2_Missense_Mutation_p.V297I|TPBG_uc003pjo.2_Missense_Mutation_p.V297I	NM_006670	NP_006661	Q13641	TPBG_HUMAN	trophoblast glycoprotein precursor	297	Extracellular (Potential).|LRRCT.				cell adhesion	integral to plasma membrane				central_nervous_system(1)	1		all_cancers(76;0.000805)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0897)		BRCA - Breast invasive adenocarcinoma(397;0.107)		CAATCCCTGGGTCTGCGACTG	0.547													15	46	---	---	---	---	PASS
ME1	4199	broad.mit.edu	37	6	84108236	84108236	+	Splice_Site	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84108236C>A	uc003pjy.2	-	3	319	c.213_splice	c.e3-1	p.R71_splice	ME1_uc011dzb.1_Splice_Site|ME1_uc011dzc.1_Intron	NM_002395	NP_002386	P48163	MAOX_HUMAN	cytosolic malic enzyme 1						carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)	GAGAAGATACCTGTAAAAATT	0.294													5	39	---	---	---	---	PASS
ZNF292	23036	broad.mit.edu	37	6	87967475	87967475	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87967475C>A	uc003plm.3	+	8	4169	c.4128C>A	c.(4126-4128)ATC>ATA	p.I1376I		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	1376	C2H2-type 8; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GGAAATTTATCTGTAGCAGGT	0.458													9	23	---	---	---	---	PASS
GABRR1	2569	broad.mit.edu	37	6	89888538	89888538	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89888538G>T	uc003pna.2	-	10	1846	c.1391C>A	c.(1390-1392)CCA>CAA	p.P464Q	GABRR1_uc011dzv.1_Missense_Mutation_p.P441Q	NM_002042	NP_002033	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 1	464	Helical; (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			pancreas(1)	1		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Picrotoxin(DB00466)	GTATGCTGCTGGAAAGATGAT	0.398													5	50	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90428724	90428724	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90428724C>A	uc003pnn.1	-	42	6199	c.6083G>T	c.(6082-6084)GGG>GTG	p.G2028V		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	2028					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AACACAGCTCCCACGGGAAAG	0.517													7	36	---	---	---	---	PASS
SLC22A16	85413	broad.mit.edu	37	6	110763720	110763720	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110763720C>T	uc003puf.2	-	4	977	c.910G>A	c.(910-912)GCA>ACA	p.A304T	SLC22A16_uc003pue.2_Missense_Mutation_p.A285T	NM_033125	NP_149116	Q86VW1	S22AG_HUMAN	solute carrier family 22, member 16	304					acid secretion|cell differentiation|multicellular organismal development|single fertilization|sperm motility|spermatogenesis	integral to membrane	carnitine transporter activity			ovary(1)	1		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)		ATTTTTTGTGCTTCTTCATAT	0.468													11	44	---	---	---	---	PASS
NKAIN2	154215	broad.mit.edu	37	6	124604269	124604269	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124604269G>T	uc003pzo.2	+	2	450	c.173G>T	c.(172-174)AGA>ATA	p.R58I	NKAIN2_uc003pzn.1_Missense_Mutation_p.R58I|NKAIN2_uc003pzp.2_Missense_Mutation_p.R57I|NKAIN2_uc010keq.2_Missense_Mutation_p.R58I|NKAIN2_uc010ker.2_5'UTR|NKAIN2_uc010kep.1_RNA	NM_001040214	NP_001035304	Q5VXU1	NKAI2_HUMAN	T-cell lymphoma breakpoint-associated target 1	58						integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)		ATTCAATATAGACCTCGTTAC	0.333													10	306	---	---	---	---	PASS
NCOA7	135112	broad.mit.edu	37	6	126206305	126206305	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126206305G>T	uc010kes.2	+	10	1149	c.700G>T	c.(700-702)GGT>TGT	p.G234C	NCOA7_uc003qae.3_Missense_Mutation_p.G234C|NCOA7_uc003qah.2_Missense_Mutation_p.G234C|NCOA7_uc003qai.2_Missense_Mutation_p.G234C|NCOA7_uc010ket.2_Missense_Mutation_p.G130C|NCOA7_uc003qag.2_Missense_Mutation_p.G234C	NM_181782	NP_861447	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7 isoform 1	234					cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		TCTCCTGCAGGGTGTGGTTGG	0.443													15	805	---	---	---	---	PASS
TRMT11	60487	broad.mit.edu	37	6	126329537	126329537	+	Splice_Site	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126329537G>T	uc003qam.2	+	8	801	c.680_splice	c.e8-1	p.G227_splice	TRMT11_uc003qan.2_Splice_Site|TRMT11_uc010kev.2_Splice_Site_p.G227_splice	NM_001031712	NP_001026882	Q7Z4G4	TRM11_HUMAN	tRNA methyltransferase 11						tRNA processing		methyltransferase activity|nucleic acid binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0356)		TGATTTTTCAGGTGGCCTGCT	0.423													12	576	---	---	---	---	PASS
ARHGAP18	93663	broad.mit.edu	37	6	129929122	129929122	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129929122C>G	uc003qbr.2	-	9	1287	c.1198G>C	c.(1198-1200)GCC>CCC	p.A400P	ARHGAP18_uc011ebw.1_Missense_Mutation_p.A400P	NM_033515	NP_277050	Q8N392	RHG18_HUMAN	Rho GTPase activating protein 18	400	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			ovary(2)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		AGCAGGCTGGCGGCATCATGC	0.453													10	49	---	---	---	---	PASS
EPB41L2	2037	broad.mit.edu	37	6	131277400	131277400	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131277400G>T	uc003qch.2	-	2	408	c.226C>A	c.(226-228)CGG>AGG	p.R76R	EPB41L2_uc003qcg.1_Silent_p.R76R|EPB41L2_uc011eby.1_Silent_p.R76R|EPB41L2_uc003qci.2_Silent_p.R76R|EPB41L2_uc010kfk.2_Silent_p.R76R|EPB41L2_uc010kfl.1_Silent_p.R76R	NM_001431	NP_001422	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	76					cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		GGTATGAACCGAGAAATACCC	0.348													6	92	---	---	---	---	PASS
SLC35D3	340146	broad.mit.edu	37	6	137245753	137245753	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137245753C>A	uc003qhe.2	+	2	1335	c.1170C>A	c.(1168-1170)CTC>CTA	p.L390L		NM_001008783	NP_001008783	Q5M8T2	S35D3_HUMAN	solute carrier family 35, member D3	390					carbohydrate transport	integral to membrane				ovary(1)|central_nervous_system(1)	2	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000136)|OV - Ovarian serous cystadenocarcinoma(155;0.00365)		ATGCTTACCTCGAGGTATGGA	0.532													4	49	---	---	---	---	PASS
CCDC28A	25901	broad.mit.edu	37	6	139094876	139094876	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139094876C>A	uc003qie.2	+	1	220	c.65C>A	c.(64-66)GCA>GAA	p.A22E	uc003qid.1_5'Flank	NM_015439	NP_056254	Q8IWP9	CC28A_HUMAN	coiled-coil domain containing 28A	22											0				OV - Ovarian serous cystadenocarcinoma(155;0.000201)|GBM - Glioblastoma multiforme(68;0.000306)		CCGCTTGGGGCATGGAGGCTG	0.617													10	38	---	---	---	---	PASS
HIVEP2	3097	broad.mit.edu	37	6	143081653	143081653	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143081653C>A	uc003qjd.2	-	9	6515	c.5772G>T	c.(5770-5772)CAG>CAT	p.Q1924H		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	1924					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TTAAATCTCCCTGGTCGTCAA	0.373													4	19	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152861157	152861157	+	Splice_Site	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152861157C>A	uc010kiw.2	-	4	670	c.68_splice	c.e4-1	p.D23_splice	SYNE1_uc003qot.3_Splice_Site_p.D23_splice|SYNE1_uc003qou.3_Splice_Site_p.D23_splice|SYNE1_uc010kjb.1_Splice_Site_p.D23_splice|SYNE1_uc003qpa.1_Splice_Site_p.D23_splice	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTGCTCATCTAGAAGGAAA	0.343										HNSCC(10;0.0054)			17	46	---	---	---	---	PASS
LPA	4018	broad.mit.edu	37	6	161007644	161007644	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161007644G>T	uc003qtl.2	-	26	4086	c.3966C>A	c.(3964-3966)TAC>TAA	p.Y1322*		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3830	Kringle 34.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GATTCCTGCAGTAGTTCCTGG	0.483													7	49	---	---	---	---	PASS
GPER	2852	broad.mit.edu	37	7	1131687	1131687	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1131687T>A	uc010ksd.1	+	2	712	c.323T>A	c.(322-324)CTG>CAG	p.L108Q	C7orf50_uc003sju.2_Intron|C7orf50_uc011jvt.1_Intron|C7orf50_uc011jvu.1_Intron|GPER_uc003sjz.1_Missense_Mutation_p.L108Q|GPER_uc003ska.1_Missense_Mutation_p.L108Q|GPER_uc003skb.2_Missense_Mutation_p.L108Q	NM_001098201	NP_001091671	Q99527	GPER_HUMAN	G protein-coupled receptor 30	108	Helical; Name=2; (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;2.32e-16)		GACCTCATCCTGGTGGCCGAC	0.577													9	76	---	---	---	---	PASS
AMZ1	155185	broad.mit.edu	37	7	2740399	2740399	+	Intron	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2740399G>A	uc003smr.1	+						AMZ1_uc003sms.1_Intron|AMZ1_uc011jwa.1_5'Flank	NM_133463	NP_597720	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1								metallopeptidase activity|zinc ion binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		GGTACGGGACGCCTGCAGCCA	0.617													6	29	---	---	---	---	PASS
KIAA0415	9907	broad.mit.edu	37	7	4831000	4831000	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4831000G>A	uc003sne.2	+	17	2491	c.2408G>A	c.(2407-2409)GGC>GAC	p.G803D	KIAA0415_uc010ksp.2_RNA|KIAA0415_uc003snf.2_Missense_Mutation_p.G280D	NM_014855	NP_055670	O43299	K0415_HUMAN	hypothetical protein LOC9907	803					cell death|double-strand break repair via homologous recombination	cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.091)|OV - Ovarian serous cystadenocarcinoma(56;8.35e-15)		AGGGAGGCCGGCCTCATGCCA	0.677													5	8	---	---	---	---	PASS
RNF216	54476	broad.mit.edu	37	7	5781325	5781325	+	Intron	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5781325C>G	uc003soy.1	-						RNF216_uc010ksz.1_Intron|RNF216_uc010kta.1_Intron|RNF216_uc011jwj.1_Intron|RNF216_uc003sox.1_Missense_Mutation_p.S108T	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b						apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		AAAATAGCTGCTCTTATCTGA	0.458													29	102	---	---	---	---	PASS
AIMP2	7965	broad.mit.edu	37	7	6054848	6054848	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6054848G>C	uc003spo.2	+	2	320	c.207G>C	c.(205-207)TTG>TTC	p.L69F		NM_006303	NP_006294	Q13155	AIMP2_HUMAN	aminoacyl tRNA synthetase complex-interacting	69					apoptosis|cell differentiation|multicellular organismal development|tRNA aminoacylation for protein translation	cytosol|nucleus	protein binding			ovary(1)	1						TGTATGAGTTGAAAGCTGCAG	0.433													28	111	---	---	---	---	PASS
ELMO1	9844	broad.mit.edu	37	7	36901350	36901350	+	Intron	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36901350G>A	uc003tfk.1	-						ELMO1_uc003tfi.1_Intron|ELMO1_uc003tfj.1_Intron|ELMO1_uc011kbb.1_Intron|ELMO1_uc011kbc.1_Intron|ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						TCCTACAAGAGATGAGAGAAA	0.473													32	96	---	---	---	---	PASS
NUDCD3	23386	broad.mit.edu	37	7	44507852	44507852	+	Intron	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507852C>A	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3												0						CCCAACTGGCCATCAGAGTCA	0.473													6	79	---	---	---	---	PASS
NPC1L1	29881	broad.mit.edu	37	7	44556482	44556482	+	Silent	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44556482G>C	uc003tlb.2	-	17	3476	c.3420C>G	c.(3418-3420)CTC>CTG	p.L1140L	NPC1L1_uc003tlc.2_Silent_p.L1113L|NPC1L1_uc011kbw.1_Silent_p.L1067L|NPC1L1_uc003tla.2_Intron	NM_013389	NP_037521	Q9UHC9	NPCL1_HUMAN	Niemann-Pick C1-like protein 1 isoform 1	1140	Helical; Name=10; (Potential).				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5					Ezetimibe(DB00973)	TGAGCATGAAGAGCCCCTCAG	0.607													7	27	---	---	---	---	PASS
CCM2	83605	broad.mit.edu	37	7	45112369	45112369	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45112369G>T	uc003tmo.2	+	7	936	c.790G>T	c.(790-792)GAA>TAA	p.E264*	CCM2_uc003tmn.2_RNA|CCM2_uc003tmp.2_Nonsense_Mutation_p.E206*|CCM2_uc003tmq.2_Intron|CCM2_uc003tmr.2_Nonsense_Mutation_p.E173*|CCM2_uc011kcc.1_3'UTR|CCM2_uc003tms.2_Nonsense_Mutation_p.E285*	NM_031443	NP_113631	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2 isoform 2	264					endothelial tube morphogenesis|integrin-mediated signaling pathway|stress-activated MAPK cascade|vasculogenesis	cytoplasm	protein binding				0						CTACGAGGTGGAAGCCAGCAC	0.522									Familial_Cerebral_Cavernous_Angioma				17	44	---	---	---	---	PASS
KCTD7	154881	broad.mit.edu	37	7	66103967	66103967	+	Silent	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66103967C>G	uc003tve.2	+	4	780	c.618C>G	c.(616-618)CTC>CTG	p.L206L	RABGEF1_uc003tvf.2_Intron|KCTD7_uc003tvd.3_Silent_p.L206L	NM_153033	NP_694578	Q96MP8	KCTD7_HUMAN	potassium channel tetramerisation domain	206						voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)	3						AGTGTCCGCTCCTCAACTCCC	0.602													239	29	---	---	---	---	PASS
SEMA3D	223117	broad.mit.edu	37	7	84666276	84666276	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84666276C>A	uc003uic.2	-	10	1160	c.1120G>T	c.(1120-1122)GCT>TCT	p.A374S	SEMA3D_uc010led.2_Missense_Mutation_p.A374S|SEMA3D_uc003uib.2_Missense_Mutation_p.A13S	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor	374	Sema.				cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5						TCCTTATGAGCATATGGACCA	0.403													8	42	---	---	---	---	PASS
CCDC132	55610	broad.mit.edu	37	7	92935226	92935226	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92935226G>T	uc003umo.2	+	18	1667	c.1539G>T	c.(1537-1539)TTG>TTT	p.L513F	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Missense_Mutation_p.L483F|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Missense_Mutation_p.L233F	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	513											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			CAGTGACCTTGTTTGAGCAGT	0.403													15	31	---	---	---	---	PASS
DLX6	1750	broad.mit.edu	37	7	96639256	96639256	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96639256C>T	uc003uom.2	+	4	695	c.695C>T	c.(694-696)TCG>TTG	p.S232L	DLX6AS_uc003uol.2_Intron|DLX6AS_uc010lfo.1_Intron	NM_005222	NP_005213	P56179	DLX6_HUMAN	distal-less homeobox 6	142					nervous system development|skeletal system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					GTTTCTGCCTCGGCCAAGGGT	0.617													9	8	---	---	---	---	PASS
TRIM56	81844	broad.mit.edu	37	7	100731192	100731192	+	Missense_Mutation	SNP	A	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100731192A>C	uc003uxq.2	+	3	830	c.599A>C	c.(598-600)CAC>CCC	p.H200P	TRIM56_uc003uxr.2_Missense_Mutation_p.H200P	NM_030961	NP_112223	Q9BRZ2	TRI56_HUMAN	tripartite motif-containing 56	200	B box-type 2.				defense response to virus|interferon-beta production|protein K63-linked ubiquitination|response to type I interferon	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			kidney(1)|central_nervous_system(1)|skin(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)					CACCTGGACCACCCCTGCCTG	0.692													4	3	---	---	---	---	PASS
HBP1	26959	broad.mit.edu	37	7	106836436	106836436	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106836436T>A	uc003vdy.2	+	9	1411	c.1225T>A	c.(1225-1227)TCT>ACT	p.S409T	HBP1_uc011klv.1_Missense_Mutation_p.S419T|HBP1_uc003vdz.2_Missense_Mutation_p.S409T|HBP1_uc003vea.2_Missense_Mutation_p.S409T|HBP1_uc003veb.1_Missense_Mutation_p.S409T	NM_012257	NP_036389	O60381	HBP1_HUMAN	HMG-box transcription factor 1	409					cell cycle arrest|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	DNA binding			skin(1)	1						ATCACAGCTCTCTTCCAATTC	0.458													22	35	---	---	---	---	PASS
IQUB	154865	broad.mit.edu	37	7	123109370	123109370	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123109370G>A	uc003vkn.2	-	9	2056	c.1479C>T	c.(1477-1479)ATC>ATT	p.I493I	IQUB_uc003vko.2_Silent_p.I493I|IQUB_uc010lkt.2_RNA|IQUB_uc003vkp.1_Silent_p.I493I	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	493										ovary(3)|large_intestine(1)	4						CTCTGGCTCTGATGGTGAACT	0.353													22	33	---	---	---	---	PASS
ATP6V0A4	50617	broad.mit.edu	37	7	138429990	138429990	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138429990G>A	uc003vuf.2	-	13	1594	c.1356C>T	c.(1354-1356)ATC>ATT	p.I452I	ATP6V0A4_uc003vug.2_Silent_p.I452I|ATP6V0A4_uc003vuh.2_Silent_p.I452I	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	452	Helical; (Potential).				cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						CCATAAGTAGGATCAGATAGC	0.507													33	62	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142723284	142723284	+	IGR	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142723284C>G								KEL (63781 upstream) : OR9A2 (3 downstream)																							ACTTACAGAACAGCTAATCTT	0.413													11	38	---	---	---	---	PASS
OR6B1	135946	broad.mit.edu	37	7	143701805	143701805	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143701805G>A	uc003wdt.1	+	1	716	c.716G>A	c.(715-717)TGT>TAT	p.C239Y		NM_001005281	NP_001005281	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B,	239	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.0783)					TTCTCCACTTGTGCCTCCCAT	0.433													25	69	---	---	---	---	PASS
PPP1R3B	79660	broad.mit.edu	37	8	8998583	8998583	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8998583G>T	uc003wsn.3	-	2	744	c.579C>A	c.(577-579)TCC>TCA	p.S193S	PPP1R3B_uc003wso.3_Silent_p.S192S	NM_024607	NP_078883	Q86XI6	PPR3B_HUMAN	protein phosphatase 1, regulatory (inhibitor)	193	CBM21.				glycogen metabolic process					ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(149;0.0717)|READ - Rectum adenocarcinoma(644;0.241)		TGATGTCGAAGGAGAACGTGT	0.478													6	79	---	---	---	---	PASS
ADAM7	8756	broad.mit.edu	37	8	24324415	24324415	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24324415G>T	uc003xeb.2	+	6	606	c.493G>T	c.(493-495)GGT>TGT	p.G165C	ADAM7_uc003xea.1_Missense_Mutation_p.G165C	NM_003817	NP_003808	Q9H2U9	ADAM7_HUMAN	a disintegrin and metalloproteinase domain 7	165	Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(1)|kidney(1)	5		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		GGTGCCGTATGGTGCCAATTA	0.368													5	82	---	---	---	---	PASS
WRN	7486	broad.mit.edu	37	8	31015003	31015003	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31015003G>C	uc003xio.3	+	33	4727	c.3939G>C	c.(3937-3939)CAG>CAC	p.Q1313H	WRN_uc010lvk.2_Missense_Mutation_p.Q780H	NM_000553	NP_000544	Q14191	WRN_HUMAN	Werner syndrome protein	1313					base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		CAGAGGTTCAGAAGATTATTG	0.502			Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				15	18	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35608161	35608161	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35608161G>T	uc003xjr.1	+	13	2325	c.1997G>T	c.(1996-1998)TGT>TTT	p.C666F	UNC5D_uc003xjs.1_Missense_Mutation_p.C661F|UNC5D_uc003xju.1_Missense_Mutation_p.C242F	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	666	Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CCCTTTGCGTGTCATGTGCTC	0.488													149	63	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35624481	35624481	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35624481T>C	uc003xjr.1	+	15	2703	c.2375T>C	c.(2374-2376)CTG>CCG	p.L792P	UNC5D_uc003xjs.1_Missense_Mutation_p.L787P|UNC5D_uc003xju.1_Missense_Mutation_p.L368P	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	792	Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GCCTTCTCCCTGGAGCGTTAT	0.582													14	122	---	---	---	---	PASS
ADAM32	203102	broad.mit.edu	37	8	39131877	39131877	+	Intron	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39131877G>T	uc003xmt.3	+						ADAM32_uc011lch.1_Intron|ADAM32_uc003xmu.3_Intron|ADAM32_uc003xmv.2_Intron	NM_145004	NP_659441	Q8TC27	ADA32_HUMAN	a disintegrin and metalloprotease domain 32						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			CCAGTAAGTAGGTTAGAAGAG	0.308													6	101	---	---	---	---	PASS
ADAM18	8749	broad.mit.edu	37	8	39495087	39495087	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39495087T>C	uc003xni.2	+	9	692	c.692T>C	c.(691-693)CTG>CCG	p.L231P	ADAM18_uc010lww.2_RNA|ADAM18_uc010lwx.2_Missense_Mutation_p.L207P	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	a disintegrin and metalloprotease domain 18	231	Peptidase M12B.|Extracellular (Potential).				cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			ACTGTTATACTGTCTTCCTTG	0.313													8	33	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41804152	41804152	+	Silent	SNP	A	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41804152A>C	uc010lxb.2	-	13	2497	c.1953T>G	c.(1951-1953)CCT>CCG	p.P651P	MYST3_uc010lxc.2_Silent_p.P651P|MYST3_uc003xon.3_Silent_p.P651P|MYST3_uc010lxd.2_Silent_p.P651P	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	651	Mediates interaction with BRPF1, required for histone H3 acetyltransferase activity.|Catalytic.|Interaction with RUNX1-1.				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			GCTGGTATTGAGGAAGAATCA	0.378													7	38	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	8	48114354	48114354	+	IGR	SNP	A	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48114354A>G								BEYLA (346947 upstream) : KIAA0146 (59188 downstream)																							CTGGGTCACCACAGACTGAGA	0.557													10	35	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48691225	48691225	+	Intron	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48691225C>A	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				GGCCCGCCTACAAAAGAGACA	0.547								NHEJ					6	13	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52387662	52387662	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52387662C>T	uc003xqu.3	-	7	665	c.564G>A	c.(562-564)CTG>CTA	p.L188L		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	188	LRRCT.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CCAGCCACATCAGATCACAGT	0.517													5	34	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69002947	69002947	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69002947G>T	uc003xxv.1	+	20	2274	c.2247G>T	c.(2245-2247)ACG>ACT	p.T749T	PREX2_uc003xxu.1_Silent_p.T749T|PREX2_uc011lez.1_Silent_p.T684T	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	749	PDZ 2.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						GGCGGCCAACGAAGGTAAGTG	0.473													10	32	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69002948	69002948	+	Nonsense_Mutation	SNP	A	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69002948A>T	uc003xxv.1	+	20	2275	c.2248A>T	c.(2248-2250)AAG>TAG	p.K750*	PREX2_uc003xxu.1_Nonsense_Mutation_p.K750*|PREX2_uc011lez.1_Nonsense_Mutation_p.K685*	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	750	PDZ 2.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						GCGGCCAACGAAGGTAAGTGG	0.468													9	31	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87751931	87751931	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87751931T>A	uc003ydx.2	-	2	209	c.163A>T	c.(163-165)ACC>TCC	p.T55S		NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	55	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding	p.T55P(1)		ovary(2)|pancreas(1)	3						GTTGACTTGGTTTTGAGAGAT	0.313													13	35	---	---	---	---	PASS
CNBD1	168975	broad.mit.edu	37	8	87917412	87917412	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87917412G>T	uc003ydy.2	+	3	310	c.262G>T	c.(262-264)GAG>TAG	p.E88*		NM_173538	NP_775809	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	88										ovary(3)	3						TTTCAAACAGGAGGAACAAAG	0.368													8	17	---	---	---	---	PASS
RBM12B	389677	broad.mit.edu	37	8	94747128	94747128	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94747128C>A	uc003yfz.2	-	3	1704	c.1511G>T	c.(1510-1512)CGA>CTA	p.R504L		NM_203390	NP_976324	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	504							nucleotide binding|RNA binding				0	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			ATGGTCACCTCGCTCACGTGA	0.403													6	93	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100443757	100443757	+	Intron	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100443757G>T	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron|VPS13B_uc003yiu.1_Intron|VPS13B_uc003yix.1_Intron	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AGCTATTCTCGTACTCAGAAT	0.313													14	30	---	---	---	---	PASS
TRHR	7201	broad.mit.edu	37	8	110100339	110100339	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110100339T>C	uc003ymz.3	+	1	614	c.598T>C	c.(598-600)TAT>CAT	p.Y200H		NM_003301	NP_003292	P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	200	Helical; Name=5; (Potential).					integral to plasma membrane	thyrotropin-releasing hormone receptor activity			skin(2)|lung(1)	3			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			TGGTGTCTTTTATGTTGTGCC	0.388													11	39	---	---	---	---	PASS
SYBU	55638	broad.mit.edu	37	8	110588198	110588198	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110588198C>A	uc003ynj.3	-	7	1092	c.929G>T	c.(928-930)CGA>CTA	p.R310L	SYBU_uc003yni.3_Missense_Mutation_p.R307L|SYBU_uc003ynk.3_Missense_Mutation_p.R191L|SYBU_uc010mco.2_Missense_Mutation_p.R309L|SYBU_uc003ynl.3_Missense_Mutation_p.R309L|SYBU_uc010mcp.2_Missense_Mutation_p.R310L|SYBU_uc010mcq.2_Missense_Mutation_p.R310L|SYBU_uc003yno.3_Missense_Mutation_p.R191L|SYBU_uc010mcr.2_Missense_Mutation_p.R310L|SYBU_uc003ynm.3_Missense_Mutation_p.R309L|SYBU_uc003ynn.3_Missense_Mutation_p.R309L|SYBU_uc010mcs.2_Missense_Mutation_p.R191L|SYBU_uc010mct.2_Missense_Mutation_p.R310L|SYBU_uc010mcu.2_Missense_Mutation_p.R309L|SYBU_uc003ynp.3_Missense_Mutation_p.R242L|SYBU_uc010mcv.2_Missense_Mutation_p.R310L|SYBU_uc003ynh.3_Missense_Mutation_p.R104L|SYBU_uc011lhw.1_Missense_Mutation_p.R180L	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein	310	Sufficient for interaction with STX1A.|Potential.|Sufficient for interaction with KIF5B.					cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1						CCAGTCCTCTCGCATGCGGGC	0.443													4	47	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113303805	113303805	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113303805A>T	uc003ynu.2	-	56	9067	c.8908T>A	c.(8908-8910)TTT>ATT	p.F2970I	CSMD3_uc003yns.2_Missense_Mutation_p.F2172I|CSMD3_uc003ynt.2_Missense_Mutation_p.F2930I|CSMD3_uc011lhx.1_Missense_Mutation_p.F2801I	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2970	Extracellular (Potential).|Sushi 20.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GAAGATCCAAATAAAAAATAT	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			14	49	---	---	---	---	PASS
PHF20L1	51105	broad.mit.edu	37	8	133816985	133816985	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133816985G>T	uc003ytt.2	+	8	1172	c.847G>T	c.(847-849)GGT>TGT	p.G283C	PHF20L1_uc003ytr.2_Missense_Mutation_p.G257C|PHF20L1_uc010mdv.2_Missense_Mutation_p.G257C|PHF20L1_uc003yts.2_Missense_Mutation_p.G283C|PHF20L1_uc011lja.1_Missense_Mutation_p.G257C|PHF20L1_uc003ytu.1_RNA|PHF20L1_uc003ytv.2_Missense_Mutation_p.G122C	NM_016018	NP_057102	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1 isoform 1	283							nucleic acid binding|zinc ion binding			ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			CAAGATTACTGGTAAACTACA	0.338													8	108	---	---	---	---	PASS
PTK2	5747	broad.mit.edu	37	8	141678480	141678480	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141678480T>C	uc003yvu.2	-	30	2983	c.2753A>G	c.(2752-2754)GAC>GGC	p.D918G	PTK2_uc011ljp.1_Missense_Mutation_p.D226G|PTK2_uc003yvo.2_Missense_Mutation_p.D546G|PTK2_uc011ljq.1_Missense_Mutation_p.D616G|PTK2_uc003yvp.2_Missense_Mutation_p.D586G|PTK2_uc003yvq.2_Missense_Mutation_p.D423G|PTK2_uc003yvr.2_Missense_Mutation_p.D861G|PTK2_uc003yvs.2_Missense_Mutation_p.D872G|PTK2_uc003yvt.2_Missense_Mutation_p.D940G|PTK2_uc003yvv.2_Missense_Mutation_p.D821G|PTK2_uc011ljr.1_Missense_Mutation_p.D931G	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a	918	Interaction with TGFB1I1.|Interaction with RGNEF (By similarity).				axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			ATTCGACCGGTCCAGGTTGGC	0.542											OREG0019022	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	43	---	---	---	---	PASS
NFKBIL2	4796	broad.mit.edu	37	8	145667759	145667759	+	Silent	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145667759G>C	uc011llg.1	-	6	630	c.615C>G	c.(613-615)CGC>CGG	p.R205R		NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	205	TPR 5.				cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CCAGGTTGTAGCGGGCGCGGA	0.647													5	21	---	---	---	---	PASS
C9orf123	90871	broad.mit.edu	37	9	7799633	7799633	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7799633C>A	uc003zki.2	-	1	146	c.102G>T	c.(100-102)GCG>GCT	p.A34A	C9orf123_uc003zkj.2_Silent_p.A34A			Q96GE9	CI123_HUMAN	Homo sapiens cDNA FLJ46908 fis, clone FEBRA2004867.	34						integral to membrane					0		all_cancers(3;0.0539)|Lung NSC(3;3.36e-05)|all_lung(3;0.000156)|all_epithelial(3;0.0356)		GBM - Glioblastoma multiforme(50;0.0561)		GGGAGGTCGGCGCTCCGGGTG	0.672													6	11	---	---	---	---	PASS
PLIN2	123	broad.mit.edu	37	9	19120960	19120960	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19120960G>T	uc003zno.2	-	5	692	c.513C>A	c.(511-513)CTC>CTA	p.L171L	PLIN2_uc011lna.1_Silent_p.L143L|PLIN2_uc011lnb.1_Intron	NM_001122	NP_001113	Q99541	PLIN2_HUMAN	adipose differentiation-related protein	171					cellular lipid metabolic process	endoplasmic reticulum|extracellular region|lipid particle				ovary(2)	2						CACTGCTCACGAGCTGCATCA	0.498													4	74	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21971065	21971065	+	Missense_Mutation	SNP	T	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971065T>G	uc003zpk.2	-	2	505	c.293A>C	c.(292-294)CAC>CCC	p.H98P	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Silent_p.A153A	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	98	ANK 3.		H -> P (in CMM2).|H -> Q (in CMM2).		cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.?(13)|p.H98R(2)|p.H83fs*2(2)|p.H98Y(1)|p.H98H(1)|p.H98P(1)|p.L97fs*21(1)|p.T93_D105del(1)|p.A68fs*3(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCCGGCCCGGTGCAGCACCAC	0.746		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			4	3	---	---	---	---	PASS
C9orf128	392307	broad.mit.edu	37	9	35825821	35825821	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35825821C>A	uc010mlc.2	-	2	623	c.338G>T	c.(337-339)CGA>CTA	p.R113L	C9orf128_uc003zyj.2_RNA|C9orf128_uc011lpg.1_Missense_Mutation_p.R113L	NM_001012446	NP_001012448	A6H8Z2	CI128_HUMAN	hypothetical protein LOC392307	113											0	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			GACATAGTCTCGTGATTGGGG	0.493											OREG0019180	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	281	---	---	---	---	PASS
RECK	8434	broad.mit.edu	37	9	36087870	36087870	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36087870C>A	uc003zyv.2	+	9	903	c.817C>A	c.(817-819)CCT>ACT	p.P273T	RECK_uc003zyw.2_Missense_Mutation_p.P145T|RECK_uc003zyx.2_RNA	NM_021111	NP_066934	O95980	RECK_HUMAN	RECK protein precursor	273	5 X Knot repeats.					anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			ATCTGTTCACCCTGGAGTCAC	0.453													6	90	---	---	---	---	PASS
RECK	8434	broad.mit.edu	37	9	36118794	36118794	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36118794G>T	uc003zyv.2	+	18	2380	c.2294G>T	c.(2293-2295)GGT>GTT	p.G765V	RECK_uc003zyw.2_Missense_Mutation_p.G637V|RECK_uc003zyx.2_RNA	NM_021111	NP_066934	O95980	RECK_HUMAN	RECK protein precursor	765	Kazal-like 3.					anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			GGGCACAATGGTGAGACCTAC	0.542													35	34	---	---	---	---	PASS
TDRD7	23424	broad.mit.edu	37	9	100232913	100232913	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100232913G>A	uc004axj.2	+	9	1928	c.1703G>A	c.(1702-1704)TGT>TAT	p.C568Y	TDRD7_uc011lux.1_Missense_Mutation_p.C494Y|TDRD7_uc010msp.1_Intron|TDRD7_uc011luy.1_5'UTR	NM_014290	NP_055105	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	568	Tudor 1.				lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding			ovary(2)|pancreas(1)	3		Acute lymphoblastic leukemia(62;0.158)				CCGAAGTTTTGTTCACTCTCA	0.318													20	31	---	---	---	---	PASS
ZNF618	114991	broad.mit.edu	37	9	116812065	116812065	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116812065A>T	uc004bid.2	+	15	2582	c.2483A>T	c.(2482-2484)AAG>ATG	p.K828M	ZNF618_uc004bic.2_Missense_Mutation_p.K735M|ZNF618_uc011lxi.1_Missense_Mutation_p.K795M|ZNF618_uc011lxj.1_Missense_Mutation_p.K796M|ZNF618_uc010mvb.2_Missense_Mutation_p.K418M	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	828					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATCATCGGCAAGGTCTGTGAG	0.642													11	49	---	---	---	---	PASS
TRIM32	22954	broad.mit.edu	37	9	119461418	119461418	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119461418G>T	uc004bjx.2	+	2	1555	c.1397G>T	c.(1396-1398)AGG>ATG	p.R466M	ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjs.1_Intron|ASTN2_uc004bjt.1_Intron|TRIM32_uc004bjw.2_Missense_Mutation_p.R466M	NM_001099679	NP_001093149	Q13049	TRI32_HUMAN	tripartite motif-containing 32	466	NHL 3.				fat cell differentiation|innate immune response|negative regulation of apoptosis|negative regulation of fibroblast proliferation|positive regulation of cell cycle|positive regulation of cell growth|positive regulation of cell migration|positive regulation of neurogenesis|positive regulation of neuron differentiation|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein catabolic process|positive regulation of proteolysis|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to tumor necrosis factor|response to UV	nucleus	myosin binding|protein self-association|RNA binding|Tat protein binding|transcription coactivator activity|translation initiation factor binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(2)|kidney(1)	3						GCCTGTCACAGGAGCCAGCTG	0.512									Bardet-Biedl_syndrome				6	75	---	---	---	---	PASS
OR1L6	392390	broad.mit.edu	37	9	125512589	125512589	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125512589C>A	uc011lzc.1	+	1	571	c.571C>A	c.(571-573)CTA>ATA	p.L191I		NM_001004453	NP_001004453	Q8NGR2	OR1L6_HUMAN	olfactory receptor, family 1, subfamily L,	191	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CATCTCCCACCTACATTCCCT	0.507													6	87	---	---	---	---	PASS
GARNL3	84253	broad.mit.edu	37	9	130098406	130098406	+	Splice_Site	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130098406G>T	uc011mae.1	+	11	1275	c.874_splice	c.e11-1	p.V292_splice	GARNL3_uc011mad.1_Splice_Site_p.V270_splice|GARNL3_uc004bqt.1_Splice_Site_p.V73_splice	NM_032293	NP_115669	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity|small GTPase regulator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						GCTCACTACAGGTGGAAAGGA	0.423													5	68	---	---	---	---	PASS
RAPGEF1	2889	broad.mit.edu	37	9	134471736	134471736	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134471736C>G	uc004cbc.2	-	14	2210	c.2080G>C	c.(2080-2082)GGA>CGA	p.G694R	RAPGEF1_uc004cbb.2_Missense_Mutation_p.G712R|RAPGEF1_uc010mzm.2_RNA|RAPGEF1_uc010mzn.2_Missense_Mutation_p.G869R|RAPGEF1_uc004cbd.2_Missense_Mutation_p.G699R	NM_005312	NP_005303	Q13905	RPGF1_HUMAN	guanine nucleotide-releasing factor 2 isoform a	694	N-terminal Ras-GEF.				activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding			lung(3)|ovary(2)|breast(1)|skin(1)	7		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		CCAGATCCTCCGCGGACGTCC	0.552													30	19	---	---	---	---	PASS
EHMT1	79813	broad.mit.edu	37	9	140637893	140637893	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140637893G>T	uc011mfc.1	+	5	931	c.894G>T	c.(892-894)CTG>CTT	p.L298L	EHMT1_uc004coa.2_Silent_p.L298L|EHMT1_uc004cob.1_Silent_p.L267L|EHMT1_uc010ncn.1_RNA	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	298					DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		CCTATAGCCTGGTTCCTAAGA	0.318													5	48	---	---	---	---	PASS
FBXO18	84893	broad.mit.edu	37	10	5959446	5959446	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5959446G>A	uc001iis.2	+	11	1947	c.1852G>A	c.(1852-1854)GAG>AAG	p.E618K	FBXO18_uc001iir.2_Missense_Mutation_p.E544K|FBXO18_uc009xig.2_Missense_Mutation_p.E544K|FBXO18_uc001iit.2_Missense_Mutation_p.E669K	NM_178150	NP_835363	Q8NFZ0	FBX18_HUMAN	F-box only protein, helicase, 18 isoform 2	618					DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(2)|skin(1)	3						GTGCACAGAAGAGGCGCACCA	0.562													7	15	---	---	---	---	PASS
PFKFB3	5209	broad.mit.edu	37	10	6263484	6263484	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6263484C>T	uc001ije.2	+	9	1356	c.972C>T	c.(970-972)ATC>ATT	p.I324I	PFKFB3_uc001ijd.2_Silent_p.I304I|PFKFB3_uc009xii.2_RNA|PFKFB3_uc010qaw.1_Silent_p.I338I|PFKFB3_uc001ijf.2_Silent_p.I324I|PFKFB3_uc001ijg.2_5'Flank|PFKFB3_uc009xij.2_5'Flank|PFKFB3_uc009xik.2_5'Flank|PFKFB3_uc009xil.2_5'Flank	NM_004566	NP_004557	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,	324	Fructose-2,6-bisphosphatase.				fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(2)|central_nervous_system(1)	3						TCAATGAGATCGACGCGGTGA	0.662													6	11	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7679270	7679270	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7679270G>T	uc001ijq.2	-	5	652	c.573C>A	c.(571-573)ATC>ATA	p.I191I	ITIH5_uc001ijr.1_Silent_p.I191I	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	191					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						CGCTCTCCAGGATATTCACGT	0.652													14	34	---	---	---	---	PASS
SUV39H2	79723	broad.mit.edu	37	10	14923614	14923614	+	Intron	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14923614G>T	uc001inh.2	+						SUV39H2_uc001ing.2_Silent_p.V49V|SUV39H2_uc001ini.2_5'UTR|SUV39H2_uc001inj.2_Intron	NM_024670	NP_078946	Q9H5I1	SUV92_HUMAN	suppressor of variegation 3-9 homolog 2						cell cycle|cell differentiation|chromatin assembly or disassembly|chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin|chromosome, centromeric region|nucleus	histone methyltransferase activity (H3-K9 specific)|protein binding|zinc ion binding			breast(2)|ovary(1)	3						ATTATGAGGTGGAATACTTGT	0.353													7	107	---	---	---	---	PASS
OLAH	55301	broad.mit.edu	37	10	15107717	15107717	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15107717C>T	uc001inu.2	+	6	791	c.537C>T	c.(535-537)ATC>ATT	p.I179I	ACBD7_uc010qby.1_Intron|OLAH_uc001int.2_Silent_p.I232I	NM_001039702	NP_001034791	Q9NV23	SAST_HUMAN	oleoyl-ACP hydrolase isoform 2	179					fatty acid biosynthetic process		myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity				0						GTAGTCCCATCATAAGGGCAG	0.353													6	49	---	---	---	---	PASS
STAM	8027	broad.mit.edu	37	10	17730044	17730044	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17730044G>T	uc001ipj.1	+	5	532	c.316G>T	c.(316-318)GAA>TAA	p.E106*	STAM_uc010qcf.1_5'UTR	NM_003473	NP_003464	Q92783	STAM1_HUMAN	signal transducing adaptor molecule 1	106	VHS.				cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	SH3/SH2 adaptor activity			large_intestine(1)|ovary(1)	2						TAAAGTATGTGAAAAATTAAA	0.303													5	84	---	---	---	---	PASS
SLC39A12	221074	broad.mit.edu	37	10	18284589	18284589	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18284589G>T	uc001ipo.2	+	10	1811	c.1538G>T	c.(1537-1539)AGC>ATC	p.S513I	SLC39A12_uc001ipn.2_Missense_Mutation_p.S476I|SLC39A12_uc001ipp.2_Missense_Mutation_p.S512I|SLC39A12_uc010qck.1_Missense_Mutation_p.S379I	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	513	Extracellular (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						AAATAGAAAAGCCCAGAAGAT	0.353													7	63	---	---	---	---	PASS
NEBL	10529	broad.mit.edu	37	10	21108409	21108409	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21108409C>A	uc001iqi.2	-	20	2396	c.1999G>T	c.(1999-2001)GTA>TTA	p.V667L	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron|NEBL_uc001iql.1_RNA	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	667	Nebulin 19.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						GTCATGCTTACCGGAGTGGCC	0.438													22	115	---	---	---	---	PASS
SLC25A16	8034	broad.mit.edu	37	10	70253288	70253288	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70253288A>T	uc001joi.2	-	5	913	c.461T>A	c.(460-462)GTT>GAT	p.V154D	SLC25A16_uc010qix.1_Missense_Mutation_p.V20D|SLC25A16_uc010qiy.1_Missense_Mutation_p.V56D|SLC25A16_uc001joj.2_Missense_Mutation_p.V56D	NM_152707	NP_689920	P16260	GDC_HUMAN	solute carrier family 25, member 16	154	Helical; Name=3; (Potential).|Solcar 2.				coenzyme biosynthetic process|pantothenate metabolic process	integral to membrane|mitochondrial inner membrane	binding|solute:solute antiporter activity				0						GCGGACCCTAACCATGTCAAG	0.353													15	53	---	---	---	---	PASS
CCAR1	55749	broad.mit.edu	37	10	70482337	70482337	+	Intron	SNP	C	T	T	rs113619196		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70482337C>T	uc001joo.2	+						CCAR1_uc001jol.1_Intron|CCAR1_uc001jom.1_Intron|CCAR1_uc009xpx.1_Intron|CCAR1_uc001jon.1_Intron|CCAR1_uc010qiz.1_Intron|CCAR1_uc010qja.1_Intron|CCAR1_uc010qjb.1_Intron	NM_018237	NP_060707	Q8IX12	CCAR1_HUMAN	cell-cycle and apoptosis regulatory protein 1						apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding			ovary(6)|large_intestine(1)	7						ACAGCCAGGTCAGGCTTCTAA	0.348													30	37	---	---	---	---	PASS
C10orf54	64115	broad.mit.edu	37	10	73521605	73521605	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73521605C>T	uc001jsd.2	-	2	402	c.261G>A	c.(259-261)CGG>CGA	p.R87R	CDH23_uc001jrx.3_Intron|C10orf54_uc001jse.2_5'UTR|C10orf54_uc009xqm.2_Intron|C10orf54_uc001jsf.1_Silent_p.R87R	NM_022153	NP_071436	Q9H7M9	GI24_HUMAN	platelet receptor Gi24 precursor	87	Ig-like.|Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)|central_nervous_system(1)	3						TGCGGATGGGCCGGCGCTCTG	0.652													10	38	---	---	---	---	PASS
TSPAN14	81619	broad.mit.edu	37	10	82248984	82248984	+	5'UTR	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82248984C>T	uc001kcj.3	+	2					TSPAN14_uc009xss.2_5'UTR|TSPAN14_uc001kci.3_5'UTR	NM_030927	NP_112189	Q8NG11	TSN14_HUMAN	tetraspanin 14 isoform 1							integral to membrane				ovary(1)|central_nervous_system(1)	2			Colorectal(32;0.229)			TTCTGCTTCTCAGAAGATGCA	0.463													3	4	---	---	---	---	PASS
OPN4	94233	broad.mit.edu	37	10	88415918	88415918	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88415918G>T	uc001kdq.2	+	2	378	c.151G>T	c.(151-153)GGG>TGG	p.G51W	OPN4_uc001kdp.2_Missense_Mutation_p.G51W|OPN4_uc010qmk.1_Missense_Mutation_p.G51W	NM_033282	NP_150598	Q9UHM6	OPN4_HUMAN	opsin 4 isoform 1	51	Extracellular (Potential).				phototransduction|protein-chromophore linkage|regulation of circadian rhythm|rhythmic process|visual perception	integral to membrane|plasma membrane	11-cis retinal binding|G-protein coupled photoreceptor activity			ovary(1)	1						GCAGGCACCTGGGACTTGGGC	0.413													4	20	---	---	---	---	PASS
LCOR	84458	broad.mit.edu	37	10	98715105	98715105	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98715105A>G	uc001kms.1	+	8	1249	c.728A>G	c.(727-729)AAG>AGG	p.K243R	LCOR_uc001kmr.2_Missense_Mutation_p.K243R|C10orf12_uc009xvg.1_Intron|LCOR_uc001kmt.1_Missense_Mutation_p.K243R|LCOR_uc001kmu.1_Missense_Mutation_p.K243R	NM_032440	NP_115816	Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	243						nucleus	DNA binding			ovary(3)	3		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		GATGGAAAAAAGGATGTGAGC	0.433													19	33	---	---	---	---	PASS
CWF19L1	55280	broad.mit.edu	37	10	101996952	101996952	+	Intron	SNP	A	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101996952A>G	uc001kqq.1	-						CWF19L1_uc001kqs.1_Intron|CWF19L1_uc001kqr.1_Intron|CWF19L1_uc001kqt.1_Intron|CWF19L1_uc010qpn.1_Intron|SNORA12_uc001kqu.1_RNA	NM_018294	NP_060764	Q69YN2	C19L1_HUMAN	CWF19-like 1, cell cycle control								catalytic activity				0		Colorectal(252;0.117)		Epithelial(162;3.78e-10)|all cancers(201;3.1e-08)		AAGGCTTAAGAGAGATATCTC	0.443													10	63	---	---	---	---	PASS
SCD	6319	broad.mit.edu	37	10	102120670	102120670	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102120670G>C	uc001kqy.2	+	6	1550	c.1060G>C	c.(1060-1062)GGA>CGA	p.G354R		NM_005063	NP_005054	O00767	ACOD_HUMAN	stearoyl-CoA desaturase 1	354	Cytoplasmic (Potential).				fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity				0		Colorectal(252;0.0323)		Epithelial(162;1.97e-10)|all cancers(201;1.73e-08)		AACCGGAGATGGAAACTACAA	0.473													12	27	---	---	---	---	PASS
SCD	6319	broad.mit.edu	37	10	102120671	102120671	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102120671G>T	uc001kqy.2	+	6	1551	c.1061G>T	c.(1060-1062)GGA>GTA	p.G354V		NM_005063	NP_005054	O00767	ACOD_HUMAN	stearoyl-CoA desaturase 1	354	Cytoplasmic (Potential).				fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity				0		Colorectal(252;0.0323)		Epithelial(162;1.97e-10)|all cancers(201;1.73e-08)		ACCGGAGATGGAAACTACAAG	0.473													12	27	---	---	---	---	PASS
COL17A1	1308	broad.mit.edu	37	10	105836091	105836091	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105836091C>A	uc001kxr.2	-	5	468	c.299G>T	c.(298-300)AGG>ATG	p.R100M	COL17A1_uc010qqv.1_Missense_Mutation_p.R100M|COL17A1_uc009xxp.1_Missense_Mutation_p.R100M	NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	100	Cytoplasmic (Potential).|Nonhelical region (NC16).				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GTGAGTTTTCCTTTCAAAGGT	0.522													5	72	---	---	---	---	PASS
PNLIP	5406	broad.mit.edu	37	10	118321053	118321053	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118321053G>A	uc001lcm.2	+	12	1282	c.1239G>A	c.(1237-1239)CAG>CAA	p.Q413Q		NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor	413	PLAT.				lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	GGGACTTGCAGATGGTTAAAT	0.373													17	33	---	---	---	---	PASS
CARS	833	broad.mit.edu	37	11	3050251	3050251	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3050251G>T	uc001lxh.2	-	8	831	c.757C>A	c.(757-759)CAG>AAG	p.Q253K	CARS_uc001lxe.2_Missense_Mutation_p.Q243K|CARS_uc001lxf.2_Missense_Mutation_p.Q336K|CARS_uc001lxg.2_Missense_Mutation_p.Q253K|CARS_uc010qxo.1_Missense_Mutation_p.Q336K|CARS_uc010qxp.1_Missense_Mutation_p.Q266K|uc001lxi.1_5'Flank	NM_001751	NP_001742	P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase isoform b	253					cysteinyl-tRNA aminoacylation	cytoplasm|cytosol	ATP binding|cysteine-tRNA ligase activity|metal ion binding|protein homodimerization activity|protein homodimerization activity|tRNA binding|tRNA binding		CARS/ALK(5)	soft_tissue(5)|ovary(2)	7		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	ACAATCTTCTGGACAAAGTTC	0.527			T	ALK	ALCL								6	89	---	---	---	---	PASS
STIM1	6786	broad.mit.edu	37	11	4104506	4104506	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4104506G>T	uc001lyv.2	+	10	1820	c.1252G>T	c.(1252-1254)GAG>TAG	p.E418*	STIM1_uc009yef.2_Nonsense_Mutation_p.E418*|STIM1_uc009yeg.2_Nonsense_Mutation_p.E245*	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor	418	Cytoplasmic (Potential).				activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		AGCACTGAGCGAGGTGACAGC	0.542													4	52	---	---	---	---	PASS
NLRP10	338322	broad.mit.edu	37	11	7981752	7981752	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7981752G>A	uc001mfv.1	-	2	1424	c.1407C>T	c.(1405-1407)TTC>TTT	p.F469F		NM_176821	NP_789791	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	469	NACHT.						ATP binding			lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AAAAGTCCTGGAAGCTGATGT	0.512													13	72	---	---	---	---	PASS
MRVI1	10335	broad.mit.edu	37	11	10622459	10622459	+	Intron	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10622459C>G	uc010rcc.1	-						MRVI1_uc001miw.2_Intron|MRVI1_uc010rcb.1_Intron|MRVI1_uc009ygb.1_Intron|MRVI1_uc001mix.2_Intron|MRVI1_uc001miz.2_Intron|MRVI1_uc009ygc.1_Intron|MRVI1_uc010rcd.1_Intron|MRVI1_uc009ygd.1_Intron|MRVI1_uc010rce.1_Intron	NM_001100167	NP_001093637	Q9Y6F6	MRVI1_HUMAN	JAW1-related protein isoform c						platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		GAGCCTAGGTCCTTACCAGAG	0.507													12	33	---	---	---	---	PASS
CD44	960	broad.mit.edu	37	11	35250813	35250813	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35250813C>A	uc001mvu.2	+	18	2596	c.2162C>A	c.(2161-2163)CCA>CAA	p.P721Q	CD44_uc001mvv.2_Missense_Mutation_p.P678Q|CD44_uc001mvw.2_Missense_Mutation_p.P472Q|CD44_uc001mvx.2_Missense_Mutation_p.P340Q|CD44_uc001mvy.2_Silent_p.S133S|CD44_uc001mwc.3_Missense_Mutation_p.P408Q|CD44_uc010rer.1_Missense_Mutation_p.P319Q|CD44_uc009ykh.2_RNA	NM_000610	NP_000601	P16070	CD44_HUMAN	CD44 antigen isoform 1 precursor	721	Cytoplasmic (Potential).				cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)	TCAGAAACTCCAGACCAGTTT	0.478													7	168	---	---	---	---	PASS
SYT13	57586	broad.mit.edu	37	11	45274068	45274068	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45274068G>A	uc001myq.2	-	4	876	c.750C>T	c.(748-750)TCC>TCT	p.S250S	SYT13_uc009yku.1_Silent_p.S106S	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	250	Cytoplasmic (Potential).|C2 1.					transport vesicle				ovary(1)	1						CGCTGTGACGGGAGAAGCGGT	0.687											OREG0020928	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	33	---	---	---	---	PASS
C11orf49	79096	broad.mit.edu	37	11	47073976	47073976	+	Nonsense_Mutation	SNP	C	T	T	rs14051		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47073976C>T	uc001ndp.2	+	3	293	c.187C>T	c.(187-189)CGA>TGA	p.R63*	C11orf49_uc001nds.2_Nonsense_Mutation_p.R63*|C11orf49_uc001ndq.2_Nonsense_Mutation_p.R63*|C11orf49_uc001ndr.2_Nonsense_Mutation_p.R63*|C11orf49_uc010rgx.1_5'UTR|C11orf49_uc010rgy.1_Nonsense_Mutation_p.R54*|C11orf49_uc010rgz.1_Intron	NM_024113	NP_077018	Q9H6J7	CK049_HUMAN	hypothetical protein LOC79096 isoform 3	63											0						CATTCTCTTTCGAGAATTCAG	0.453													28	60	---	---	---	---	PASS
OR4A15	81328	broad.mit.edu	37	11	55136361	55136361	+	Silent	SNP	A	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55136361A>C	uc010rif.1	+	1	1002	c.1002A>C	c.(1000-1002)GTA>GTC	p.V334V		NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A,	334	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GTAAAAAAGTAAGCTTAGCTG	0.368													15	59	---	---	---	---	PASS
OR5D14	219436	broad.mit.edu	37	11	55563596	55563596	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55563596G>C	uc010rim.1	+	1	565	c.565G>C	c.(565-567)GTG>CTG	p.V189L		NM_001004735	NP_001004735	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D,	189	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3		all_epithelial(135;0.196)				TCTCATCTCTGTGTCTGGCTC	0.448													19	84	---	---	---	---	PASS
OR5D18	219438	broad.mit.edu	37	11	55587562	55587562	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55587562G>A	uc010rin.1	+	1	457	c.457G>A	c.(457-459)GGA>AGA	p.G153R		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	153	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				CTATGCCTGGGGAGTCTCATG	0.478													12	84	---	---	---	---	PASS
UBE2L6	9246	broad.mit.edu	37	11	57319960	57319960	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57319960C>A	uc001nkn.1	-	4	429	c.333G>T	c.(331-333)CTG>CTT	p.L111L	UBE2L6_uc001nko.1_Silent_p.L45L	NM_004223	NP_004214	O14933	UB2L6_HUMAN	ubiquitin-conjugating enzyme E2L 6 isoform 1	111					negative regulation of type I interferon production	cytosol	protein binding|ubiquitin-protein ligase activity			ovary(1)	1						GTCTATTCACCAGCACATTGA	0.572													5	92	---	---	---	---	PASS
OR4D9	390199	broad.mit.edu	37	11	59282973	59282973	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59282973G>T	uc010rkv.1	+	1	588	c.588G>T	c.(586-588)GAG>GAT	p.E196D		NM_001004711	NP_001004711	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D,	196	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCACTCTGGAGCTCCTGATGA	0.468													15	72	---	---	---	---	PASS
NUDT22	84304	broad.mit.edu	37	11	63994119	63994119	+	5'UTR	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63994119C>G	uc001nyp.3	+	2					TRPT1_uc010rnc.1_5'Flank|TRPT1_uc010rnd.1_5'Flank|TRPT1_uc001nyn.2_5'Flank|TRPT1_uc001nyo.2_5'Flank|TRPT1_uc010rne.1_5'Flank|TRPT1_uc010rnf.1_5'Flank|NUDT22_uc009ypd.2_5'UTR|NUDT22_uc009ype.2_5'UTR|NUDT22_uc001nyq.3_5'UTR|NUDT22_uc010rng.1_5'Flank	NM_032344	NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety								hydrolase activity				0						CTGCCCCGTTCAGACCATGGA	0.687													16	23	---	---	---	---	PASS
EIF1AD	84285	broad.mit.edu	37	11	65766854	65766854	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65766854G>T	uc001ogm.1	-	5	605	c.320C>A	c.(319-321)TCT>TAT	p.S107Y	EIF1AD_uc001ogn.1_Missense_Mutation_p.S107Y|BANF1_uc001ogo.2_5'Flank|BANF1_uc001ogp.2_5'Flank	NM_032325	NP_115701	Q8N9N8	EIF1A_HUMAN	eukaryotic translation initiation factor 1A	107						nucleus	translation initiation factor activity				0						AGCCACTTCAGAGAAGGCCTC	0.498													9	290	---	---	---	---	PASS
C11orf80	79703	broad.mit.edu	37	11	66571479	66571479	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66571479G>T	uc001ojf.2	+	9	863	c.856G>T	c.(856-858)GGT>TGT	p.G286C	C11orf80_uc001ojg.2_Missense_Mutation_p.G52C|C11orf80_uc001ojh.2_Missense_Mutation_p.G53C|C11orf80_uc001oji.2_Missense_Mutation_p.G53C|C11orf80_uc010rpk.1_Missense_Mutation_p.G121C	NM_024650	NP_078926	Q8N6T0	CK080_HUMAN	hypothetical protein LOC79703	131											0						ACCAAATTTTGGTACAATTGA	0.368													6	171	---	---	---	---	PASS
TPCN2	219931	broad.mit.edu	37	11	68840410	68840410	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68840410C>T	uc001oos.2	+	13	1287	c.1171C>T	c.(1171-1173)CTC>TTC	p.L391F	TPCN2_uc009ysk.1_RNA|TPCN2_uc001oor.2_Missense_Mutation_p.L306F|TPCN2_uc010rqg.1_Missense_Mutation_p.L391F|TPCN2_uc001oot.2_RNA	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	391	Cytoplasmic (Potential).				cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CAGTGTTCTGCTCTCAGCTGA	0.607													9	27	---	---	---	---	PASS
CHRDL2	25884	broad.mit.edu	37	11	74413877	74413877	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74413877G>T	uc001ovi.2	-	9	1335	c.1082C>A	c.(1081-1083)TCG>TAG	p.S361*	CHRDL2_uc001ovg.2_Nonsense_Mutation_p.S245*|CHRDL2_uc001ovh.2_Nonsense_Mutation_p.S361*|CHRDL2_uc001ovj.1_RNA|CHRDL2_uc001ovk.1_Nonsense_Mutation_p.S296*			Q6WN34	CRDL2_HUMAN	RecName: Full=Chordin-like protein 2; AltName: Full=Chordin-related protein 2; AltName: Full=Breast tumor novel factor 1;          Short=BNF-1; Flags: Precursor;	361					cartilage development|cell differentiation|ossification	extracellular region|mitochondrion					0	Hepatocellular(1;0.098)					CACCAAGTCCGAGGCCTCGTG	0.632											OREG0021223	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	60	---	---	---	---	PASS
USP35	57558	broad.mit.edu	37	11	77921353	77921353	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77921353A>T	uc009yva.1	+	10	2698	c.2452A>T	c.(2452-2454)ATG>TTG	p.M818L	USP35_uc001oze.2_Missense_Mutation_p.M574L|USP35_uc001ozc.2_Missense_Mutation_p.M386L|USP35_uc010rsp.1_Missense_Mutation_p.M250L|USP35_uc001ozd.2_Missense_Mutation_p.M429L|USP35_uc001ozf.2_Missense_Mutation_p.M549L	NM_020798	NP_065849	Q9P2H5	UBP35_HUMAN	ubiquitin specific protease 35	818					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)	3	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			CCTGCGCACCATGCGGCGCCG	0.647													12	41	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92531931	92531931	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92531931C>G	uc001pdj.3	+	9	5769	c.5752C>G	c.(5752-5754)CTG>GTG	p.L1918V		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1918	Cadherin 17.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACCCCCTGAACTGACATACAG	0.423										TCGA Ovarian(4;0.039)			17	39	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92533017	92533017	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92533017G>T	uc001pdj.3	+	9	6855	c.6838G>T	c.(6838-6840)GTA>TTA	p.V2280L		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2280	Cadherin 20.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGTTAATGATGTAAATGACAA	0.418										TCGA Ovarian(4;0.039)			11	35	---	---	---	---	PASS
SORL1	6653	broad.mit.edu	37	11	121460075	121460075	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121460075G>C	uc001pxx.2	+	29	4134	c.4054G>C	c.(4054-4056)GAT>CAT	p.D1352H	SORL1_uc010rzp.1_Missense_Mutation_p.D198H|SORL1_uc010rzq.1_5'Flank	NM_003105	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor containing LDLR class	1352	Extracellular (Potential).|LDL-receptor class A 7.				cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity			ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TGATTGCGGCGATTATTCTGA	0.483													31	92	---	---	---	---	PASS
GRAMD1B	57476	broad.mit.edu	37	11	123476185	123476185	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123476185C>A	uc001pyx.2	+	9	1222	c.893C>A	c.(892-894)TCG>TAG	p.S298*	GRAMD1B_uc001pyw.2_Nonsense_Mutation_p.S305*|GRAMD1B_uc010rzw.1_Nonsense_Mutation_p.S258*|GRAMD1B_uc010rzx.1_Nonsense_Mutation_p.S258*|GRAMD1B_uc009zbe.1_Nonsense_Mutation_p.S294*|GRAMD1B_uc001pyy.2_5'Flank	NM_020716	NP_065767	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	298						integral to membrane				ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GCCCCCGTCTCGGTATGGGCA	0.562													4	81	---	---	---	---	PASS
ARHGAP32	9743	broad.mit.edu	37	11	128839232	128839232	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128839232G>A	uc009zcp.2	-	22	5834	c.5834C>T	c.(5833-5835)TCC>TTC	p.S1945F	ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.2_Missense_Mutation_p.S904F|ARHGAP32_uc001qez.2_Missense_Mutation_p.S1596F	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1	1945	Interaction with FYN.				cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						CATCTCTTTGGAGAGCCTTAC	0.507													15	41	---	---	---	---	PASS
VPS26B	112936	broad.mit.edu	37	11	134114844	134114844	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134114844C>T	uc001qhe.2	+	5	1190	c.734C>T	c.(733-735)CCG>CTG	p.P245L		NM_052875	NP_443107	Q4G0F5	VP26B_HUMAN	vacuolar protein sorting 26 homolog B	245					protein transport|vacuolar transport	cytosol|retromer complex					0	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;2.43e-10)|all cancers(11;2.94e-09)|BRCA - Breast invasive adenocarcinoma(10;9.57e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00164)|Lung(977;0.216)		GAGTCCATCCCGATCCGGCTC	0.582											OREG0021548	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	28	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6058963	6058963	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6058963G>T	uc001qnn.1	-	51	8492	c.8242C>A	c.(8242-8244)CAC>AAC	p.H2748N	VWF_uc010set.1_3'UTR	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	2748	CTCK.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	TGGCAGTAGTGGATATCCACC	0.522													5	67	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9223104	9223104	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9223104G>T	uc001qvk.1	-	32	4287	c.4174C>A	c.(4174-4176)CTG>ATG	p.L1392M	A2M_uc001qvj.1_Missense_Mutation_p.L434M|A2M_uc009zgk.1_Missense_Mutation_p.L1242M	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	1392					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	GTTGGCTTCAGGGGAATGAAG	0.453													5	22	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26780971	26780971	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26780971G>T	uc001rhg.2	-	23	3476	c.3059C>A	c.(3058-3060)CCA>CAA	p.P1020Q		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	1020	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					GATACCTGATGGTAGTAAAGT	0.318													13	204	---	---	---	---	PASS
BICD1	636	broad.mit.edu	37	12	32490544	32490544	+	Silent	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32490544C>G	uc001rku.2	+	7	2445	c.2364C>G	c.(2362-2364)CTC>CTG	p.L788L	BICD1_uc001rkv.2_Silent_p.L788L|BICD1_uc010skd.1_RNA|BICD1_uc001rkw.1_Silent_p.L70L	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1	788	Potential.|Interacts with RAB6A.				anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			AGCAAAAACTCGCCCTGACCC	0.498													12	38	---	---	---	---	PASS
SLC2A13	114134	broad.mit.edu	37	12	40422151	40422151	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40422151C>T	uc010skm.1	-	3	928	c.877G>A	c.(877-879)GAT>AAT	p.D293N	SLC2A13_uc001rmf.2_Missense_Mutation_p.D293N	NM_052885	NP_443117	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose	293	Cytoplasmic (Potential).					integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)				TTGATGCTATCATATTCCTCA	0.383										HNSCC(50;0.14)			30	83	---	---	---	---	PASS
PUS7L	83448	broad.mit.edu	37	12	44142419	44142419	+	Intron	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44142419C>A	uc001rnq.3	-						PUS7L_uc001rnr.3_Intron|PUS7L_uc001rns.3_Intron|PUS7L_uc009zkb.2_Intron	NM_001098615	NP_001092085	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S.						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			pancreas(1)	1	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		AAAGCTGAAACAAAAAAAAAA	0.308													5	18	---	---	---	---	PASS
TMEM106C	79022	broad.mit.edu	37	12	48360006	48360006	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48360006G>T	uc001rqp.2	+	5	661	c.546G>T	c.(544-546)GAG>GAT	p.E182D	TMEM106C_uc001rqo.2_Intron|TMEM106C_uc001rqr.2_Missense_Mutation_p.E182D|TMEM106C_uc001rqq.2_Intron	NM_024056	NP_076961	Q9BVX2	T106C_HUMAN	transmembrane protein 106C isoform a	182						endoplasmic reticulum membrane|integral to membrane					0		Acute lymphoblastic leukemia(13;0.11)		GBM - Glioblastoma multiforme(48;0.241)		CTCGGAGTGAGCAACTGGTAT	0.493													8	33	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49420064	49420064	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49420064G>T	uc001rta.3	-	48	15685	c.15685C>A	c.(15685-15687)CGC>AGC	p.R5229S		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	5229	FYR N-terminal.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						ATAGAACAGCGATAGCAGCAG	0.582			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			4	53	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49446494	49446494	+	Splice_Site	SNP	T	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49446494T>A	uc001rta.3	-	9	1113	c.1113_splice	c.e9-1	p.R371_splice		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2						chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GGTGAAAATCTGCAGAGGGTA	0.597			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			6	14	---	---	---	---	PASS
LMBR1L	55716	broad.mit.edu	37	12	49491879	49491879	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49491879C>A	uc001rth.3	-	16	1592	c.1250G>T	c.(1249-1251)CGC>CTC	p.R417L	LMBR1L_uc001rtg.3_Missense_Mutation_p.R412L|LMBR1L_uc001rti.3_Missense_Mutation_p.R397L	NM_018113	NP_060583	Q6UX01	LMBRL_HUMAN	lipocalin-interacting membrane receptor	417	Extracellular (Potential).				endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1						CAGGTCAAAGCGAGTGAGCCC	0.557											OREG0021783	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	52	132	---	---	---	---	PASS
KRT77	374454	broad.mit.edu	37	12	53091605	53091605	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53091605C>A	uc001saw.2	-	2	648	c.619G>T	c.(619-621)GGA>TGA	p.G207*	KRT77_uc009zmi.2_5'UTR	NM_175078	NP_778253	Q7Z794	K2C1B_HUMAN	keratin 77	207	Linker 1.|Rod.					keratin filament	structural molecule activity			ovary(1)	1						TTGTTGGTTCCAGTTGAGGTG	0.567													7	169	---	---	---	---	PASS
SOAT2	8435	broad.mit.edu	37	12	53516877	53516877	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53516877C>T	uc001sbv.2	+	13	1337	c.1249C>T	c.(1249-1251)CGG>TGG	p.R417W	SOAT2_uc009zms.2_RNA	NM_003578	NP_003569	O75908	SOAT2_HUMAN	acyl-CoA:cholesterol acyltransferase 2	417					cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|macrophage derived foam cell differentiation|very-low-density lipoprotein particle assembly	brush border|endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			ovary(1)	1						CCTTGGTGCCCGGGCCCGAGG	0.532													7	9	---	---	---	---	PASS
CSAD	51380	broad.mit.edu	37	12	53565707	53565707	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53565707G>A	uc001sby.2	-	6	536	c.410C>T	c.(409-411)GCC>GTC	p.A137V	CSAD_uc001sbw.2_Intron|CSAD_uc009zmt.2_5'UTR|CSAD_uc010snx.1_Missense_Mutation_p.A164V|CSAD_uc001sbz.2_Missense_Mutation_p.A137V|CSAD_uc009zmu.2_Intron|CSAD_uc001sca.3_RNA|CSAD_uc010sny.1_Missense_Mutation_p.A137V	NM_015989	NP_057073	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	137					carboxylic acid metabolic process		pyridoxal phosphate binding|sulfinoalanine decarboxylase activity			ovary(1)	1					L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	GCCCACCAGGGCCCGCAGTTT	0.557									Hereditary_Prostate_Cancer				10	43	---	---	---	---	PASS
ITGA5	3678	broad.mit.edu	37	12	54792386	54792386	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54792386G>T	uc001sga.2	-	28	3006	c.2938C>A	c.(2938-2940)CGT>AGT	p.R980S		NM_002205	NP_002196	P08648	ITA5_HUMAN	integrin alpha 5 precursor	980	Extracellular (Potential).				angiogenesis|axon guidance|blood coagulation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|wound healing, spreading of epidermal cells	alphav-beta3 integrin-vitronectin complex|integrin complex|ruffle	platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			ovary(2)	2						CTCACCTGACGCTCTTTTTGG	0.582													9	20	---	---	---	---	PASS
HELB	92797	broad.mit.edu	37	12	66725230	66725230	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66725230C>T	uc001sti.2	+	12	2995	c.2967C>T	c.(2965-2967)GTC>GTT	p.V989V	HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B	989					DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		TCCCTGTAGTCACAGACCACG	0.562													7	31	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70928645	70928645	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70928645C>T	uc001swb.3	-	28	5548	c.5518G>A	c.(5518-5520)GAG>AAG	p.E1840K	uc001svz.2_Intron|PTPRB_uc010sto.1_Missense_Mutation_p.E1750K|PTPRB_uc010stp.1_Missense_Mutation_p.E1750K|PTPRB_uc001swc.3_Missense_Mutation_p.E2058K|PTPRB_uc001swa.3_Missense_Mutation_p.E1970K	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1840	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ATGGTCCACTCAGGCAGGACG	0.507													19	48	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78400703	78400703	+	Nonsense_Mutation	SNP	T	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78400703T>A	uc001syp.2	+	8	1558	c.1385T>A	c.(1384-1386)TTG>TAG	p.L462*	NAV3_uc001syo.2_Nonsense_Mutation_p.L462*	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	462						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AAAAAGTCTTTGCTACAGCCA	0.418										HNSCC(70;0.22)			29	73	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78594382	78594382	+	Intron	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78594382C>A	uc001syp.2	+						NAV3_uc001syo.2_Intron|NAV3_uc010sub.1_Intron|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						GTATAGTACTCAATTTTCATT	0.308										HNSCC(70;0.22)			7	24	---	---	---	---	PASS
IKBIP	121457	broad.mit.edu	37	12	99007382	99007382	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99007382T>C	uc001tfv.2	-	3	1144	c.1034A>G	c.(1033-1035)CAC>CGC	p.H345R	IKBIP_uc001tfw.2_3'UTR	NM_201612	NP_963906	Q70UQ0	IKIP_HUMAN	IKK interacting protein isoform 2	345					induction of apoptosis|response to X-ray	endoplasmic reticulum membrane|integral to membrane	protein binding				0						ATCTGAAATGTGTGCTATTTC	0.274													17	50	---	---	---	---	PASS
NUP37	79023	broad.mit.edu	37	12	102505967	102505967	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102505967C>A	uc001tjc.2	-	2	265	c.200G>T	c.(199-201)CGA>CTA	p.R67L	NUP37_uc009zub.1_Missense_Mutation_p.R67L	NM_024057	NP_076962	Q8NFH4	NUP37_HUMAN	nucleoporin 37kDa	67					carbohydrate metabolic process|cell division|chromosome segregation|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	protein binding			ovary(1)	1						GTGAAATGTTCGAAGTGTTTT	0.368													4	66	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104093009	104093009	+	Intron	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104093009C>A	uc001tjw.2	+							NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						TGACCAGGTACGATCCTTTTA	0.453													11	22	---	---	---	---	PASS
CORO1C	23603	broad.mit.edu	37	12	109042780	109042780	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109042780C>A	uc001tnj.2	-	9	1114	c.1018G>T	c.(1018-1020)GAG>TAG	p.E340*	CORO1C_uc009zva.2_Nonsense_Mutation_p.E393*|CORO1C_uc010sxf.1_Nonsense_Mutation_p.E303*	NM_014325	NP_055140	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C isoform 1	340					actin cytoskeleton organization|phagocytosis|signal transduction	actin cytoskeleton	actin filament binding			skin(3)	3						CACTTTCTCTCATGAAGTTTG	0.328													5	44	---	---	---	---	PASS
HNF1A	6927	broad.mit.edu	37	12	121434449	121434449	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121434449A>T	uc001tzg.2	+	6	1236	c.1213A>T	c.(1213-1215)ATG>TTG	p.M405L	HNF1A_uc001tze.1_Missense_Mutation_p.M405L|HNF1A_uc001tzf.2_Missense_Mutation_p.M405L|HNF1A_uc010szn.1_Missense_Mutation_p.M405L	NM_000545	NP_000536	P20823	HNF1A_HUMAN	hepatic nuclear factor-1-alpha	405					glucose homeostasis|glucose import|insulin secretion|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|renal glucose absorption	cytoplasm|nucleus|protein complex	DNA binding|protein dimerization activity|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			liver(92)|large_intestine(15)|endometrium(6)|breast(2)|lung(1)	116	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GAACCTCATCATGGCCTCACT	0.637									Hepatic_Adenoma_Familial_Clustering_of				5	15	---	---	---	---	PASS
TMEM120B	144404	broad.mit.edu	37	12	122181523	122181523	+	Intron	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122181523C>T	uc001ubc.3	+						TMEM120B_uc009zxh.2_Intron	NM_001080825	NP_001074294	A0PK00	T120B_HUMAN	transmembrane protein 120B							integral to membrane					0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		CCCCGGGTCCCCTGTTCTTCA	0.393													27	60	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124359853	124359853	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124359853G>T	uc001uft.3	+	46	7685	c.7660G>T	c.(7660-7662)GGG>TGG	p.G2554W		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2554	AAA 3 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ATATGACCGTGGGAAGGAGCT	0.443													4	18	---	---	---	---	PASS
XPO4	64328	broad.mit.edu	37	13	21436984	21436984	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21436984C>A	uc001unq.3	-	3	225	c.189G>T	c.(187-189)GTG>GTT	p.V63V	XPO4_uc010tcr.1_5'UTR	NM_022459	NP_071904	Q9C0E2	XPO4_HUMAN	exportin 4	63					protein transport	cytoplasm|nucleus	protein binding			large_intestine(1)|ovary(1)|kidney(1)	3		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		GGACATAGTCCACTTTACTAG	0.348													7	170	---	---	---	---	PASS
SPATA13	221178	broad.mit.edu	37	13	24860516	24860516	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24860516C>A	uc001upg.1	+	5	998	c.591C>A	c.(589-591)CCC>CCA	p.P197P	SPATA13_uc001upd.1_Silent_p.P822P|C1QTNF9_uc001upe.2_RNA|SPATA13_uc010tcy.1_Silent_p.P143P|SPATA13_uc010tcz.1_Silent_p.P143P|SPATA13_uc010tda.1_Silent_p.P141P|SPATA13_uc001uph.2_Silent_p.P119P|SPATA13_uc010tdb.1_Silent_p.P119P|SPATA13_uc009zzz.1_5'Flank	NM_153023	NP_694568	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	197	SH3.				cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		CCTGGTTCCCCGCGAGCTTCG	0.557													3	15	---	---	---	---	PASS
PABPC3	5042	broad.mit.edu	37	13	25670378	25670378	+	Nonsense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25670378C>G	uc001upy.2	+	1	103	c.42C>G	c.(40-42)TAC>TAG	p.Y14*		NM_030979	NP_112241	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	14	RRM 1.				mRNA metabolic process	cytoplasm	nucleotide binding|poly(A) RNA binding			ovary(3)|skin(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		CCTCGCTCTACGTGGGGGACC	0.637													11	20	---	---	---	---	PASS
SHISA2	387914	broad.mit.edu	37	13	26620919	26620919	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26620919C>A	uc001uqm.1	-	2	705	c.620G>T	c.(619-621)TGC>TTC	p.C207F		NM_001007538	NP_001007539	Q6UWI4	SHSA2_HUMAN	shisa homolog 2 precursor	207	Cytoplasmic (Potential).				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2						TTCCGGCAAGCAACAGTTGGT	0.602													7	33	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	28919617	28919617	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28919617G>T	uc001usb.3	-	16	2605	c.2320C>A	c.(2320-2322)CTC>ATC	p.L774I	FLT1_uc001usa.3_5'UTR	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	774	Helical; (Potential).				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	GTTAATAGGAGCCAGAAGAGA	0.413													8	18	---	---	---	---	PASS
FRY	10129	broad.mit.edu	37	13	32709039	32709039	+	Splice_Site	SNP	A	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32709039A>T	uc001utx.2	+	9	1382	c.886_splice	c.e9-2	p.E296_splice	FRY_uc010tdw.1_Splice_Site	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TCTGCTTCCCAGGAATGTGCA	0.393													22	57	---	---	---	---	PASS
PDS5B	23047	broad.mit.edu	37	13	33344601	33344601	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33344601G>T	uc010abf.2	+	32	4125	c.3967G>T	c.(3967-3969)GCA>TCA	p.A1323S	PDS5B_uc010abg.2_RNA	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog	1323					cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TGGACCTCCAGCACCAGAGGA	0.453													11	55	---	---	---	---	PASS
LECT1	11061	broad.mit.edu	37	13	53307398	53307398	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53307398C>A	uc001vhf.2	-	3	421	c.310G>T	c.(310-312)GGA>TGA	p.G104*	LECT1_uc001vhg.2_Nonsense_Mutation_p.G104*|LECT1_uc001vhh.2_Nonsense_Mutation_p.G131*	NM_007015	NP_008946	O75829	LECT1_HUMAN	leukocyte cell derived chemotaxin 1 isoform 1	104	BRICHOS.				cartilage development|proteoglycan metabolic process	endomembrane system|extracellular region|integral to membrane				ovary(2)	2		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.38e-08)		GCTCCACTTCCCATTTTAAAG	0.388													6	93	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70681347	70681347	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70681347C>G	uc001vip.2	-	1	1279	c.485G>C	c.(484-486)GGA>GCA	p.G162A	KLHL1_uc010thm.1_Missense_Mutation_p.G162A|ATXN8OS_uc010aej.1_RNA	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	162					actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GTGTCCACATCCTTCACCTGT	0.517													25	40	---	---	---	---	PASS
CLDN10	9071	broad.mit.edu	37	13	96086185	96086185	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96086185G>A	uc001vmg.2	+	1	333	c.98G>A	c.(97-99)CGA>CAA	p.R33Q	CLDN10_uc010tii.1_Missense_Mutation_p.R33Q	NM_182848	NP_878268	P78369	CLD10_HUMAN	claudin 10 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			GTGACCACGCGAGCCTCCTCG	0.562													8	29	---	---	---	---	PASS
TMCO3	55002	broad.mit.edu	37	13	114149892	114149892	+	5'UTR	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114149892G>T	uc001vtu.3	+	2					TMCO3_uc001vtt.3_5'UTR	NM_017905	NP_060375	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3							integral to membrane	solute:hydrogen antiporter activity				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			CTCCGGACCTGGATCATGAAG	0.567													7	31	---	---	---	---	PASS
RASA3	22821	broad.mit.edu	37	13	114781703	114781703	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114781703C>T	uc001vui.2	-	13	1382	c.1251G>A	c.(1249-1251)TTG>TTA	p.L417L	RASA3_uc010tkk.1_Silent_p.L385L|RASA3_uc001vuj.2_Silent_p.L34L	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	417	Ras-GAP.				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			CTCCGTCTTTCAACTTCACAG	0.517													4	15	---	---	---	---	PASS
ZNF828	283489	broad.mit.edu	37	13	115091231	115091231	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115091231A>T	uc010ahb.2	+	3	2243	c.1914A>T	c.(1912-1914)AAA>AAT	p.K638N	ZNF828_uc001vuv.2_Missense_Mutation_p.K638N|ZNF828_uc010tko.1_Missense_Mutation_p.K638N	NM_001164144	NP_001157616	Q96JM3	ZN828_HUMAN	zinc finger protein 828	638	Mediates localization to the chromosome and the spindle and negatively regulates chromosome alignment.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation|protein localization to kinetochore|protein localization to microtubule|sister chromatid biorientation	condensed chromosome kinetochore|cytoplasm|nucleus|spindle	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_epithelial(44;0.122)|all_lung(25;0.123)	BRCA - Breast invasive adenocarcinoma(86;0.104)	OV - Ovarian serous cystadenocarcinoma(48;0.193)|Epithelial(10;0.197)		AGTACATAAAAACAGATTTGG	0.393													10	73	---	---	---	---	PASS
OR11H12	440153	broad.mit.edu	37	14	19378014	19378014	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19378014A>G	uc010tkp.1	+	1	421	c.421A>G	c.(421-423)ATC>GTC	p.I141V		NM_001013354	NP_001013372	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H,	141	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GTACCTTGCTATCTGCCGTCC	0.453													11	148	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23884304	23884304	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23884304C>T	uc001wjx.2	-	37	5565	c.5459G>A	c.(5458-5460)CGG>CAG	p.R1820Q		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1820	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CTCCAGCTCCCGCACCCGCGC	0.627													10	81	---	---	---	---	PASS
NOVA1	4857	broad.mit.edu	37	14	26917955	26917955	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26917955G>T	uc001wpy.2	-	5	1052	c.734C>A	c.(733-735)CCA>CAA	p.P245Q	NOVA1_uc001wpz.2_Missense_Mutation_p.P221Q|NOVA1_uc001wqa.2_Missense_Mutation_p.P123Q	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1	248					locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		GCCACTTTGTGGATCCTCTTG	0.453													5	52	---	---	---	---	PASS
NID2	22795	broad.mit.edu	37	14	52520558	52520558	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52520558C>G	uc001wzo.2	-	5	1402	c.1168G>C	c.(1168-1170)GAG>CAG	p.E390Q	NID2_uc010tqs.1_Missense_Mutation_p.E390Q|NID2_uc010tqt.1_Missense_Mutation_p.E390Q|NID2_uc001wzp.2_Missense_Mutation_p.E390Q	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor	390						basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)					CTTCTGGTCTCTCTCTCATCC	0.547													14	31	---	---	---	---	PASS
SAMD4A	23034	broad.mit.edu	37	14	55231189	55231189	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55231189G>T	uc001xbb.2	+	7	1525	c.1524G>T	c.(1522-1524)TTG>TTT	p.L508F	SAMD4A_uc001xbc.2_Missense_Mutation_p.L420F|SAMD4A_uc001xbg.2_Missense_Mutation_p.L100F	NM_015589	NP_056404	Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4 isoform	509					positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity				0						CACAGCTCTTGGTCTCCAGAC	0.388													6	169	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64599130	64599130	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64599130G>T	uc001xgm.2	+	77	14718	c.14488G>T	c.(14488-14490)GGT>TGT	p.G4830C	SYNE2_uc001xgl.2_Missense_Mutation_p.G4830C|SYNE2_uc010apy.2_Missense_Mutation_p.G1215C|SYNE2_uc010apz.1_Missense_Mutation_p.G722C	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4830	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ACGCCAATGTGGTATGAAGCT	0.403													6	77	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68220848	68220848	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68220848G>T	uc001xka.2	-	38	7207	c.7068C>A	c.(7066-7068)ACC>ACA	p.T2356T	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkb.2_Silent_p.T202T	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2356					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GAGGCAAAGTGGTGATTTGAG	0.488													8	185	---	---	---	---	PASS
PTPN21	11099	broad.mit.edu	37	14	88945368	88945368	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88945368T>A	uc001xwv.3	-	13	2738	c.2407A>T	c.(2407-2409)ACG>TCG	p.T803S	PTPN21_uc010twc.1_Missense_Mutation_p.T599S	NM_007039	NP_008970	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type	803						cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4						CGGCCTGACGTGGTGAGGTCG	0.652													9	22	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94008943	94008943	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94008943G>A	uc001ybv.1	+	11	1208	c.1125G>A	c.(1123-1125)CTG>CTA	p.L375L	KIAA1409_uc001ybs.1_Silent_p.L375L	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	552						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		TGGAAAAGCTGAAGCCTCAGT	0.498													20	61	---	---	---	---	PASS
MKRN3	7681	broad.mit.edu	37	15	23811260	23811260	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23811260G>T	uc001ywh.3	+	1	807	c.331G>T	c.(331-333)GAG>TAG	p.E111*	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Nonsense_Mutation_p.E111*	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	111	C3H1-type 1.					ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GCAGTGCAAGGAGGGGGAGAA	0.597													31	46	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	25488797	25488797	+	Intron	SNP	A	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25488797A>T	uc001zae.2	+						SNORD115-40_uc001zai.1_RNA|SNORD115-41_uc001zaj.1_5'Flank					Homo sapiens clone Rt-16 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.																		TCCTGAAGAGAGGTGATGACT	0.517													28	293	---	---	---	---	PASS
GANC	2595	broad.mit.edu	37	15	42618491	42618491	+	Intron	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42618491G>T	uc001zpi.2	+						GANC_uc001zpj.1_Intron	NM_198141	NP_937784	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C						carbohydrate metabolic process		carbohydrate binding|maltose alpha-glucosidase activity			central_nervous_system(2)	2		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)		TTCATGTCCTGACAGCTTGTG	0.403													31	66	---	---	---	---	PASS
TGM5	9333	broad.mit.edu	37	15	43527770	43527770	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43527770C>A	uc001zrd.1	-	10	1619	c.1611G>T	c.(1609-1611)AAG>AAT	p.K537N	TGM5_uc001zrc.1_Missense_Mutation_p.K194N|TGM5_uc001zre.1_Missense_Mutation_p.K455N	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1	537					epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	CTTTGAGGTCCTTGAACTGGG	0.557													12	23	---	---	---	---	PASS
TP53BP1	7158	broad.mit.edu	37	15	43707872	43707872	+	Nonsense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43707872G>C	uc001zrs.2	-	23	5142	c.4994C>G	c.(4993-4995)TCA>TGA	p.S1665*	TP53BP1_uc010udp.1_Nonsense_Mutation_p.S1665*|TP53BP1_uc001zrq.3_Nonsense_Mutation_p.S1670*|TP53BP1_uc001zrr.3_Nonsense_Mutation_p.S1670*|TP53BP1_uc010udq.1_Nonsense_Mutation_p.S1670*|TP53BP1_uc001zrp.2_Nonsense_Mutation_p.S82*	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	1665					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TCTTTTGCCTGAGAGAACTCC	0.537								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					4	91	---	---	---	---	PASS
GLDN	342035	broad.mit.edu	37	15	51676070	51676070	+	Silent	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51676070T>C	uc002aba.2	+	4	691	c.522T>C	c.(520-522)AAT>AAC	p.N174N	GLDN_uc010bez.1_Missense_Mutation_p.M157T|GLDN_uc002abb.2_Silent_p.N50N	NM_181789	NP_861454	Q6ZMI3	GLDN_HUMAN	gliomedin	174	Extracellular (Potential).|Collagen-like 1.				cell differentiation|nervous system development	collagen|integral to membrane|plasma membrane				ovary(2)	2				all cancers(107;0.00194)|GBM - Glioblastoma multiforme(94;0.00942)		AAGGAGCAAATGGAAAAAGAG	0.468													7	12	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53889379	53889379	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53889379G>T	uc002acj.2	-	18	3087	c.3045C>A	c.(3043-3045)TCC>TCA	p.S1015S		NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	1015										lung(1)|skin(1)	2				all cancers(107;0.0511)		TCTCTGCCATGGACACTGGTT	0.448													7	153	---	---	---	---	PASS
LRRC49	54839	broad.mit.edu	37	15	71302258	71302258	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71302258A>G	uc002asw.2	+	13	1767	c.1520A>G	c.(1519-1521)AAT>AGT	p.N507S	LRRC49_uc002asu.2_Missense_Mutation_p.N497S|LRRC49_uc002asx.2_Missense_Mutation_p.N463S|LRRC49_uc010ukf.1_Missense_Mutation_p.N512S|LRRC49_uc002asy.2_Missense_Mutation_p.N213S|LRRC49_uc002asz.2_Missense_Mutation_p.N479S	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	507						cytoplasm|microtubule				ovary(1)	1						CCAGTTGTCAATTTTACACTC	0.373													21	44	---	---	---	---	PASS
SGK269	79834	broad.mit.edu	37	15	77471444	77471444	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77471444T>A	uc002bcm.2	-	3	3133	c.2825A>T	c.(2824-2826)GAC>GTC	p.D942V	SGK269_uc002bcn.2_Missense_Mutation_p.D942V	NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	942					cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		TTTCTCTTTGTCATCCTCCTC	0.522													11	35	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86122678	86122678	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86122678C>T	uc002blv.1	+	7	1549	c.1379C>T	c.(1378-1380)TCC>TTC	p.S460F	AKAP13_uc002blt.1_Missense_Mutation_p.S460F|AKAP13_uc002blu.1_Missense_Mutation_p.S460F	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	460					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						GCCCAGTATTCCTCTGGAGGT	0.522													7	114	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86124952	86124952	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86124952C>T	uc002blv.1	+	7	3823	c.3653C>T	c.(3652-3654)GCC>GTC	p.A1218V	AKAP13_uc002blt.1_Missense_Mutation_p.A1218V|AKAP13_uc002blu.1_Missense_Mutation_p.A1218V|AKAP13_uc010bne.1_5'Flank	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	1218					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						GTCATGCGAGCCCCGCCTTCA	0.612													6	34	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86125189	86125189	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86125189C>T	uc002blv.1	+	7	4060	c.3890C>T	c.(3889-3891)ACA>ATA	p.T1297I	AKAP13_uc002blt.1_Missense_Mutation_p.T1297I|AKAP13_uc002blu.1_Missense_Mutation_p.T1297I|AKAP13_uc010bne.1_5'Flank	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	1297					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						AGTGCTTTTACAGAAAAAGTG	0.552													14	84	---	---	---	---	PASS
C15orf51	196968	broad.mit.edu	37	15	100332419	100332419	+	RNA	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100332419C>A	uc010urx.1	-	5		c.1773G>T			C15orf51_uc010ury.1_RNA	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0						TATGGACCTCCTGGAGGAGAA	0.557													22	81	---	---	---	---	PASS
RHOT2	89941	broad.mit.edu	37	16	723528	723528	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:723528G>T	uc002cip.2	+	19	1846	c.1779G>T	c.(1777-1779)GGG>GGT	p.G593G	RHOT2_uc002ciq.2_Silent_p.G486G|RHOT2_uc010bqy.2_Silent_p.G372G|RHBDL1_uc002cir.1_5'Flank|RHBDL1_uc010uun.1_5'Flank|RHBDL1_uc002cis.1_5'Flank	NM_138769	NP_620124	Q8IXI1	MIRO2_HUMAN	ras homolog gene family, member T2	593	Miro 2.|Helical; Anchor for type IV membrane protein; (Potential).				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			pancreas(1)	1		Hepatocellular(780;0.0218)				GGCTCCGGGGGCTGCTGGGGG	0.622													12	46	---	---	---	---	PASS
HCFC1R1	54985	broad.mit.edu	37	16	3073520	3073520	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3073520C>A	uc002csx.1	-	3	240	c.107G>T	c.(106-108)CGA>CTA	p.R36L	HCFC1R1_uc002csy.1_Missense_Mutation_p.R36L|HCFC1R1_uc002csz.1_Intron|THOC6_uc002ctb.2_5'Flank|THOC6_uc002ctd.2_5'Flank|THOC6_uc002ctc.2_5'Flank|THOC6_uc002cta.2_5'Flank	NM_001002018	NP_001002018	Q9NWW0	HPIP_HUMAN	host cell factor C1 regulator 1 (XPO1 dependant)	36						cytoplasm|nucleus					0						CACAGCTCCTCGGAGAGGGGA	0.632													3	11	---	---	---	---	PASS
GLYR1	84656	broad.mit.edu	37	16	4871572	4871572	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4871572C>T	uc002cxx.3	-	8	745	c.708G>A	c.(706-708)ACG>ACA	p.T236T	GLYR1_uc002cxy.2_RNA|GLYR1_uc002cxz.1_Intron|GLYR1_uc002cya.2_Silent_p.T236T|GLYR1_uc010uxv.1_Silent_p.T155T	NM_032569	NP_115958	Q49A26	GLYR1_HUMAN	cytokine-like nuclear factor n-pac	236					pentose-phosphate shunt	nucleus	coenzyme binding|DNA binding|methylated histone residue binding|phosphogluconate dehydrogenase (decarboxylating) activity				0						TCAACTTCTTCGTGATTGCCT	0.448													7	38	---	---	---	---	PASS
PALB2	79728	broad.mit.edu	37	16	23614791	23614791	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23614791G>T	uc002dlx.1	-	13	3750	c.3550C>A	c.(3550-3552)CAC>AAC	p.H1184N		NM_024675	NP_078951	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	1184	Interaction with RAD51 and BRCA2.|WD 7.				double-strand break repair via homologous recombination	nucleoplasm	DNA binding|protein binding			lung(3)|breast(3)|ovary(2)|skin(1)|kidney(1)|pancreas(1)	11				GBM - Glioblastoma multiforme(48;0.0167)		TATGAATAGTGGTATACAAAT	0.358			F|N|Mis			Wilms tumor|medulloblastoma|AML ,breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia_type_N|Fanconi_Anemia|PALB2-associated_Familial_Breast_and_Pancreatic_Cancer|Pancreatic_Cancer_Familial_Clustering_of				5	47	---	---	---	---	PASS
TAOK2	9344	broad.mit.edu	37	16	29997772	29997772	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29997772G>T	uc002dva.1	+	16	2962	c.2179G>T	c.(2179-2181)GAG>TAG	p.E727*	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TAOK2_uc002dvb.1_Nonsense_Mutation_p.E727*|TAOK2_uc002dvc.1_Nonsense_Mutation_p.E727*|TAOK2_uc010bzm.1_Nonsense_Mutation_p.E734*|TAOK2_uc002dvd.1_Nonsense_Mutation_p.E554*	NM_016151	NP_057235	Q9UL54	TAOK2_HUMAN	TAO kinase 2 isoform 2	727					actin cytoskeleton organization|activation of MAPKK activity|apoptosis|cell migration|focal adhesion assembly|positive regulation of JNK cascade|protein targeting to membrane|regulation of cell growth|regulation of cell shape|response to stress	cytoplasmic vesicle membrane|cytoskeleton|dendrite|integral to membrane|nucleolus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1						GCGTGAGCAAGAGTTGCGGCA	0.677													7	56	---	---	---	---	PASS
STX1B	112755	broad.mit.edu	37	16	31008036	31008036	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31008036C>G	uc010cad.2	-	7	617	c.505G>C	c.(505-507)GAG>CAG	p.E169Q	STX1B_uc010vfd.1_Missense_Mutation_p.E169Q	NM_052874	NP_443106	P61266	STX1B_HUMAN	syntaxin 1B	169	Cytoplasmic (Potential).				intracellular protein transport|neurotransmitter transport|synaptic transmission	integral to plasma membrane	extracellular-glutamate-gated ion channel activity|SNAP receptor activity				0						TTCCCGCTCTCCAGCATGTCT	0.607													8	35	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49671724	49671724	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49671724G>T	uc002efs.2	-	5	1637	c.1339C>A	c.(1339-1341)CTG>ATG	p.L447M	ZNF423_uc010vgn.1_Missense_Mutation_p.L330M	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	447	C2H2-type 10.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				ATGGAGTCCAGGCAGATCTGA	0.562													5	55	---	---	---	---	PASS
NKD1	85407	broad.mit.edu	37	16	50583328	50583328	+	Intron	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50583328C>T	uc002egg.1	+							NM_033119	NP_149110	Q969G9	NKD1_HUMAN	naked cuticle homolog 1						Wnt receptor signaling pathway	cytoplasm|plasma membrane	calcium ion binding|protein binding				0		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		TCGTCCCCGTCCCAGGTGACA	0.687													6	18	---	---	---	---	PASS
CHD9	80205	broad.mit.edu	37	16	53272410	53272410	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53272410G>T	uc002ehb.2	+	11	2953	c.2789G>T	c.(2788-2790)TGG>TTG	p.W930L	CHD9_uc002egy.2_Missense_Mutation_p.W930L|CHD9_uc002eha.1_Missense_Mutation_p.W930L|CHD9_uc002ehc.2_Missense_Mutation_p.W930L|CHD9_uc002ehf.2_Missense_Mutation_p.W44L|CHD9_uc002ehd.2_Missense_Mutation_p.W456L|CHD9_uc002ehe.1_Missense_Mutation_p.W44L	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	930	Helicase ATP-binding.				cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				TTTCGTACGTGGACTGATATT	0.403													6	141	---	---	---	---	PASS
SLC9A5	6553	broad.mit.edu	37	16	67286512	67286512	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67286512G>A	uc002esm.2	+	2	318	c.255G>A	c.(253-255)CTG>CTA	p.L85L	SLC9A5_uc010cee.2_5'UTR|SLC9A5_uc010vji.1_5'UTR	NM_004594	NP_004585	Q14940	SL9A5_HUMAN	solute carrier family 9 (sodium/hydrogen	85	Helical; (Potential).				regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			ovary(1)|pancreas(1)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		TGCTGGGCCTGGTGCTAGGGG	0.522													28	57	---	---	---	---	PASS
FAM65A	79567	broad.mit.edu	37	16	67575630	67575630	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67575630C>A	uc010vjp.1	+	12	1181	c.1085C>A	c.(1084-1086)TCC>TAC	p.S362Y	FAM65A_uc010cei.1_Missense_Mutation_p.S184Y|FAM65A_uc002eth.2_Missense_Mutation_p.S342Y|FAM65A_uc010cej.2_Missense_Mutation_p.S345Y|FAM65A_uc002eti.1_Missense_Mutation_p.S305Y|FAM65A_uc010vjq.1_Missense_Mutation_p.S356Y|FAM65A_uc002etj.1_Missense_Mutation_p.S341Y|FAM65A_uc002etk.2_Missense_Mutation_p.S341Y	NM_024519	NP_078795	Q6ZS17	FA65A_HUMAN	hypothetical protein LOC79567	346						cytoplasm	binding			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		AAGCGCTTCTCCACCTATAGC	0.592													5	50	---	---	---	---	PASS
ADAT1	23536	broad.mit.edu	37	16	75637051	75637051	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75637051C>A	uc002feo.1	-	10	1410	c.1308G>T	c.(1306-1308)GTG>GTT	p.V436V	ADAT1_uc002fep.1_Silent_p.V287V	NM_012091	NP_036223	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	436	A to I editase.				tRNA processing		metal ion binding|RNA binding|tRNA-specific adenosine deaminase activity			ovary(1)|skin(1)	2						TGAAGAGTTCCACTTTGCTGA	0.413													8	212	---	---	---	---	PASS
DPEP1	1800	broad.mit.edu	37	16	89702987	89702987	+	Silent	SNP	C	T	T	rs150009384	byFrequency	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89702987C>T	uc010cin.2	+	5	620	c.417C>T	c.(415-417)GGC>GGT	p.G139G	DPEP1_uc002fnr.3_Silent_p.G139G|DPEP1_uc002fns.3_Silent_p.G139G	NM_001128141	NP_001121613	P16444	DPEP1_HUMAN	dipeptidase 1 precursor	139					proteolysis	anchored to membrane|apical plasma membrane|microvillus membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity|protein binding			large_intestine(1)	1		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)	GCCTGATCGGCGTGGAGGGCG	0.657													6	11	---	---	---	---	PASS
SUPT6H	6830	broad.mit.edu	37	17	27026896	27026896	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27026896C>A	uc002hby.2	+	33	4636	c.4546C>A	c.(4546-4548)CAG>AAG	p.Q1516K	SUPT6H_uc010crt.2_Missense_Mutation_p.Q1516K	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog	1516					chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)					GGATCACTACCAGGATCCTGT	0.527													6	114	---	---	---	---	PASS
KRTAP1-3	81850	broad.mit.edu	37	17	39190915	39190915	+	Silent	SNP	A	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39190915A>G	uc002hvv.2	-	1	193	c.159T>C	c.(157-159)AGT>AGC	p.S53S		NM_030966	NP_112228	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	63			Missing (in allele KAP1.9).	GFPSFSTSGTCSS -> DFLASQLVDLQL (in Ref. 1).		extracellular region|keratin filament	structural constituent of epidermis				0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGCAGGTCCCACTAGTTGAGA	0.627													16	28	---	---	---	---	PASS
CNP	1267	broad.mit.edu	37	17	40125782	40125782	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40125782G>T	uc002hyl.1	+	4	1250	c.1106G>T	c.(1105-1107)CGG>CTG	p.R369L	CNP_uc010wfz.1_Missense_Mutation_p.R246L|CNP_uc002hym.1_Missense_Mutation_p.R349L|CNP_uc010wga.1_Missense_Mutation_p.R134L|CNP_uc002hyn.1_Missense_Mutation_p.R134L	NM_033133	NP_149124	P09543	CN37_HUMAN	2',3'-cyclic nucleotide 3' phosphodiesterase	369					cell killing|cyclic nucleotide catabolic process|RNA metabolic process|synaptic transmission	extracellular space|melanosome	2',3'-cyclic-nucleotide 3'-phosphodiesterase activity|ATP binding|protein binding				0		all_cancers(22;2.38e-06)|all_epithelial(22;6.79e-05)|Breast(137;0.000143)		UCEC - Uterine corpus endometrioid carcinoma (308;0.171)		GAGCTAAGCCGGGGCAAGCTC	0.622													3	12	---	---	---	---	PASS
NFE2L1	4779	broad.mit.edu	37	17	46135698	46135698	+	Silent	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46135698T>C	uc002imz.3	+	6	1665	c.1014T>C	c.(1012-1014)AGT>AGC	p.S338S	NFE2L1_uc002ina.3_Silent_p.S308S|NFE2L1_uc002inb.3_Silent_p.S308S|NFE2L1_uc010wle.1_Silent_p.S150S|NFE2L1_uc010wlf.1_Silent_p.S182S	NM_003204	NP_003195	Q14494	NF2L1_HUMAN	nuclear factor erythroid 2-like 1	338					anatomical structure morphogenesis|heme biosynthetic process|inflammatory response|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			skin(1)	1						TCCTGTACAGTGCCCCTCCTG	0.582													19	56	---	---	---	---	PASS
TTLL6	284076	broad.mit.edu	37	17	46847099	46847099	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46847099T>C	uc010wlo.1	-	15	2436	c.2401A>G	c.(2401-2403)AAC>GAC	p.N801D	TTLL6_uc002iob.2_Missense_Mutation_p.N494D|TTLL6_uc010dbi.2_Intron|TTLL6_uc002ioc.2_Missense_Mutation_p.N554D|TTLL6_uc002iod.2_Intron	NM_001130918	NP_001124390	Q8N841	TTLL6_HUMAN	tubulin tyrosine ligase-like family, member 6	753						cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity				0						CGTGACAGGTTATTCATCCCC	0.338													13	52	---	---	---	---	PASS
NGFR	4804	broad.mit.edu	37	17	47583905	47583905	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47583905C>T	uc002ioz.3	+	3	578	c.453C>T	c.(451-453)GAC>GAT	p.D151D		NM_002507	NP_002498	P08138	TNR16_HUMAN	nerve growth factor receptor precursor	151	Extracellular (Potential).|TNFR-Cys 4.				anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|membrane protein intracellular domain proteolysis|negative regulation of axonogenesis|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis	cell surface|cytosol|endosome|extracellular region|integral to plasma membrane|nucleoplasm				ovary(1)|lung(1)	2	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					AGTGCCCCGACGGCACGTATT	0.711													10	17	---	---	---	---	PASS
MBTD1	54799	broad.mit.edu	37	17	49281158	49281158	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49281158G>T	uc002itr.3	-	8	1077	c.733C>A	c.(733-735)CCT>ACT	p.P245T	MBTD1_uc002itp.3_Missense_Mutation_p.P81T|MBTD1_uc002itq.3_Missense_Mutation_p.P245T	NM_017643	NP_060113	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	245	MBT 1.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			TTACTTCTAGGAGGAACAAGA	0.348													6	138	---	---	---	---	PASS
BRIP1	83990	broad.mit.edu	37	17	59821886	59821886	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59821886T>C	uc002izk.1	-	15	2305	c.2164A>G	c.(2164-2166)ACA>GCA	p.T722A	BRIP1_uc002izl.1_Missense_Mutation_p.T103A	NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	722					DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1						ACAATGACTGTCTTCACCAAC	0.353			F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				26	92	---	---	---	---	PASS
MARCH10	162333	broad.mit.edu	37	17	60813646	60813646	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60813646T>C	uc010ddr.2	-	6	1821	c.1583A>G	c.(1582-1584)CAT>CGT	p.H528R	MARCH10_uc002jag.3_Missense_Mutation_p.H528R|MARCH10_uc010dds.2_Missense_Mutation_p.H566R|MARCH10_uc002jah.2_Missense_Mutation_p.H527R|uc002jaj.1_RNA|uc002jak.2_RNA	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190	528							ligase activity|zinc ion binding				0						GAAATAATTATGGTTTTCGGC	0.453													14	57	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76464812	76464812	+	5'Flank	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76464812C>A	uc010dhp.1	-						DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TTCTCCACCTCGTCCTCCATA	0.532													5	58	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	78282825	78282825	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78282825G>T	uc002jyf.2	+	14	2652	c.2509G>T	c.(2509-2511)GAG>TAG	p.E837*	uc002jyg.1_Nonsense_Mutation_p.E568*	NM_020954	NP_066005			hypothetical protein LOC57714																		CAGGATTCCCGAGGAGGCCTT	0.478													5	95	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78348267	78348267	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78348267C>A	uc002jyh.1	+	25	7394	c.7171C>A	c.(7171-7173)CAG>AAG	p.Q2391K	uc002jyi.1_Intron|RNF213_uc010dhw.1_Missense_Mutation_p.Q773K	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GGGGCTGCGGCAGGACCACCC	0.552													7	24	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78355400	78355400	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78355400G>A	uc002jyh.1	+	32	8293	c.8070G>A	c.(8068-8070)CAG>CAA	p.Q2690Q	uc002jyi.1_Intron|RNF213_uc010dhw.1_Silent_p.Q1072Q	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCTTTCTGCAGCAGCACATCC	0.572													21	46	---	---	---	---	PASS
RAB12	201475	broad.mit.edu	37	18	8609907	8609907	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8609907G>A	uc002knp.2	+	1	465	c.182G>A	c.(181-183)CGC>CAC	p.R61H	RAB12_uc002kno.1_Missense_Mutation_p.R157H	NM_001025300	NP_001020471	Q6IQ22	RAB12_HUMAN	RAB12, member RAS oncogene family	61					protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding				0						CTGATGGAGCGCTTCACCGAC	0.706													4	10	---	---	---	---	PASS
C18orf8	29919	broad.mit.edu	37	18	21096395	21096395	+	Intron	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21096395C>T	uc010xax.1	+						C18orf8_uc010xau.1_Intron|C18orf8_uc010xav.1_Intron|C18orf8_uc010xaw.1_Intron|C18orf8_uc002kul.2_Intron	NM_013326	NP_037458	Q96DM3	MIC1_HUMAN	colon cancer-associated protein Mic1											ovary(1)	1	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CATGTATGTCCGTGTCAGAGA	0.448											OREG0024894	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	30	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31323263	31323263	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31323263A>G	uc010dmg.1	+	12	3506	c.3451A>G	c.(3451-3453)AAA>GAA	p.K1151E	ASXL3_uc002kxq.2_Missense_Mutation_p.K858E	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	1151					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						CCCTGAAACAAAAATGGAAGG	0.502													7	21	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31325671	31325671	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31325671G>T	uc010dmg.1	+	12	5914	c.5859G>T	c.(5857-5859)AAG>AAT	p.K1953N	ASXL3_uc002kxq.2_Missense_Mutation_p.K1660N	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	1953					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						CCTCTTCCAAGACCCCAGTGG	0.527													11	61	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31325735	31325735	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31325735G>C	uc010dmg.1	+	12	5978	c.5923G>C	c.(5923-5925)GTT>CTT	p.V1975L	ASXL3_uc002kxq.2_Missense_Mutation_p.V1682L	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	1975					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						ATTGGGAGAGGTTAGTCTTTC	0.507													16	89	---	---	---	---	PASS
KIAA1632	57724	broad.mit.edu	37	18	43469849	43469849	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43469849C>A	uc002lbm.2	-	28	4966	c.4866G>T	c.(4864-4866)AAG>AAT	p.K1622N	KIAA1632_uc010xcq.1_Missense_Mutation_p.K176N|KIAA1632_uc010xcr.1_RNA|KIAA1632_uc010xcs.1_RNA|KIAA1632_uc002lbn.2_Missense_Mutation_p.K497N	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724	1622	Potential.				autophagy						0						GCTTCACTTCCTTCCGTAAAA	0.398													7	69	---	---	---	---	PASS
WDR7	23335	broad.mit.edu	37	18	54424511	54424511	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54424511C>G	uc002lgk.1	+	15	2898	c.2687C>G	c.(2686-2688)TCT>TGT	p.S896C	WDR7_uc010dpk.1_RNA|WDR7_uc002lgl.1_Missense_Mutation_p.S896C	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1	896										ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		TCTATCATTTCTTTGGCAAAT	0.443													22	44	---	---	---	---	PASS
CCBE1	147372	broad.mit.edu	37	18	57103145	57103145	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57103145G>T	uc002lib.2	-	11	1286	c.1216C>A	c.(1216-1218)CCA>ACA	p.P406T	CCBE1_uc010dpq.2_Missense_Mutation_p.P135T|CCBE1_uc002lia.2_Missense_Mutation_p.P259T	NM_133459	NP_597716	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	406					lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)				ATGTGCTATGGGTAGAAGTCT	0.493													10	218	---	---	---	---	PASS
CDH19	28513	broad.mit.edu	37	18	64172361	64172361	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64172361C>G	uc002lkc.1	-	12	2145	c.2007G>C	c.(2005-2007)AAG>AAC	p.K669N	CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_3'UTR	NM_021153	NP_066976	Q9H159	CAD19_HUMAN	cadherin 19, type 2 preproprotein	669	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)				TTTTCCGAGTCTTGCGTTCCC	0.463													11	93	---	---	---	---	PASS
CBLN2	147381	broad.mit.edu	37	18	70205487	70205487	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70205487A>G	uc002lku.2	-	4	834	c.599T>C	c.(598-600)CTC>CCC	p.L200P	CBLN2_uc002lkv.2_Missense_Mutation_p.L200P	NM_182511	NP_872317	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	200	C1q.					integral to membrane					0		Esophageal squamous(42;0.131)				CTCAAGTTTGAGATGCACTTT	0.527													14	50	---	---	---	---	PASS
ABCA7	10347	broad.mit.edu	37	19	1058728	1058728	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1058728G>T	uc002lqw.3	+	38	5492	c.5261G>T	c.(5260-5262)CGA>CTA	p.R1754L	ABCA7_uc002lqy.2_Missense_Mutation_p.R207L|ABCA7_uc010dsc.2_RNA	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	1754					phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCAGCACCGAAGCCAACTC	0.587													4	47	---	---	---	---	PASS
TMEM146	257062	broad.mit.edu	37	19	5724885	5724885	+	Intron	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5724885C>A	uc002mda.2	+						TMEM146_uc010duj.1_Intron	NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor							integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						TATGTGGCTCCATGCTTAAAT	0.289													5	65	---	---	---	---	PASS
XAB2	56949	broad.mit.edu	37	19	7688675	7688675	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7688675G>A	uc002mgx.2	-	8	1087	c.1061C>T	c.(1060-1062)CCA>CTA	p.P354L		NM_020196	NP_064581	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	354					transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	catalytic step 2 spliceosome|nucleoplasm	protein binding			central_nervous_system(2)|breast(1)|skin(1)	4						CACGTGGTGTGGGTTTTGGCG	0.667								Direct_reversal_of_damage|NER					4	13	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9059671	9059671	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9059671G>T	uc002mkp.2	-	3	27979	c.27775C>A	c.(27775-27777)CCC>ACC	p.P9259T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9261	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCTCCTGTGGGGTAGGTGATA	0.468													6	80	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9070727	9070727	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9070727C>T	uc002mkp.2	-	3	16923	c.16719G>A	c.(16717-16719)GGG>GGA	p.G5573G		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5575	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTGATGTAGCCCCAGGAGTAG	0.512													13	156	---	---	---	---	PASS
LPPR2	64748	broad.mit.edu	37	19	11468427	11468427	+	Intron	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11468427C>A	uc002mre.1	+						LPPR2_uc002mrf.1_Intron|LPPR2_uc010dxy.1_5'Flank	NM_022737	NP_073574	Q96GM1	LPPR2_HUMAN	lipid phosphate phosphatase-related protein type							integral to membrane	phosphatidate phosphatase activity			large_intestine(1)	1						TGAGGACCCCCGTACCTCTCC	0.577													4	19	---	---	---	---	PASS
USE1	55850	broad.mit.edu	37	19	17327016	17327016	+	Silent	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17327016G>T	uc002nfo.2	+	4	330	c.270G>T	c.(268-270)CTG>CTT	p.L90L	USE1_uc002nfn.2_Silent_p.L90L|USE1_uc010eal.1_Silent_p.L90L	NM_018467	NP_060937	Q9NZ43	USE1_HUMAN	unconventional SNARE in the ER 1 homolog	90	Cytoplasmic (Potential).				lysosomal transport|protein catabolic process|protein transport|secretion by cell|vesicle-mediated transport	endoplasmic reticulum membrane|integral to membrane	protein binding				0						ACCAGTTCCTGGCCCCTGGCC	0.617													11	24	---	---	---	---	PASS
USE1	55850	broad.mit.edu	37	19	17327017	17327017	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17327017G>T	uc002nfo.2	+	4	331	c.271G>T	c.(271-273)GCC>TCC	p.A91S	USE1_uc002nfn.2_Missense_Mutation_p.A91S|USE1_uc010eal.1_Missense_Mutation_p.A91S	NM_018467	NP_060937	Q9NZ43	USE1_HUMAN	unconventional SNARE in the ER 1 homolog	91	Cytoplasmic (Potential).				lysosomal transport|protein catabolic process|protein transport|secretion by cell|vesicle-mediated transport	endoplasmic reticulum membrane|integral to membrane	protein binding				0						CCAGTTCCTGGCCCCTGGCCG	0.617													12	24	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22940797	22940797	+	Silent	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22940797T>C	uc010xrh.1	-	5	1641	c.1641A>G	c.(1639-1641)AAA>AAG	p.K547K		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TTATCTCATGTTTTCTAAGGG	0.368													11	36	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23544231	23544231	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23544231G>C	uc002nre.2	-	4	1663	c.1550C>G	c.(1549-1551)CCC>CGC	p.P517R	ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Missense_Mutation_p.P485R	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	517						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				AAATTTGTAGGGTTTCTCTCC	0.353													8	44	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23578154	23578154	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23578154C>G	uc002nre.2	-	1	116	c.3G>C	c.(1-3)ATG>ATC	p.M1I	ZNF91_uc010xrj.1_Missense_Mutation_p.M1I	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	1						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				GGGTTCCTGGCATCTTAGCTG	0.612													15	63	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30934469	30934469	+	5'UTR	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30934469G>A	uc002nsu.1	+	2					ZNF536_uc010edd.1_5'UTR	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					TCTTTTCAGGGATGGAAGAAG	0.592													15	52	---	---	---	---	PASS
FFAR3	2865	broad.mit.edu	37	19	35849930	35849930	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35849930C>T	uc002nzd.2	+	2	213	c.138C>T	c.(136-138)CGC>CGT	p.R46R	FFAR3_uc010xsu.1_RNA	NM_005304	NP_005295	O14843	FFAR3_HUMAN	free fatty acid receptor 3	46	Cytoplasmic.					integral to plasma membrane	G-protein coupled receptor activity|lipid binding				0	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			TGCAGCGCCGCCCGGTGGCCG	0.642													14	132	---	---	---	---	PASS
SIRT2	22933	broad.mit.edu	37	19	39384173	39384173	+	Intron	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39384173C>A	uc002ojt.1	-						SIRT2_uc010egh.1_Intron|SIRT2_uc010egi.1_Intron|SIRT2_uc002ojs.1_Missense_Mutation_p.R16L|SIRT2_uc002oju.1_Intron|SIRT2_uc010egj.1_Intron|SIRT2_uc002ojv.1_Intron	NM_012237	NP_036369	Q8IXJ6	SIRT2_HUMAN	sirtuin 2 isoform 1						cell division|chromatin silencing at rDNA|chromatin silencing at telomere|mitosis|negative regulation of striated muscle tissue development|protein ADP-ribosylation|regulation of exit from mitosis|regulation of phosphorylation|response to redox state	chromatin silencing complex|cytoplasm|microtubule	histone acetyltransferase binding|histone deacetylase binding|NAD+ binding|NAD-dependent histone deacetylase activity|transcription factor binding|tubulin deacetylase activity|ubiquitin binding|zinc ion binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)			GTCCACTGACCGGAAAGAAGA	0.478													3	13	---	---	---	---	PASS
LGALS14	56891	broad.mit.edu	37	19	40195190	40195190	+	Intron	SNP	T	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40195190T>C	uc002omg.2	+						LGALS14_uc002omf.2_Intron	NM_020129	NP_064514	Q8TCE9	PPL13_HUMAN	lectin, galactoside-binding, soluble, 14 isoform							nucleus	sugar binding			ovary(1)|skin(1)	2	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)			ACCCGTGAGTTGAAAAGTCAC	0.418													8	30	---	---	---	---	PASS
PSMC4	5704	broad.mit.edu	37	19	40478439	40478439	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40478439C>T	uc002omq.2	+	3	336	c.299C>T	c.(298-300)ACA>ATA	p.T100I	PSMC4_uc002omr.2_Missense_Mutation_p.T69I	NM_006503	NP_006494	P43686	PRS6B_HUMAN	proteasome 26S ATPase subunit 4 isoform 1	100					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding			ovary(1)	1	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GATCAGAATACAGCCATCGTG	0.488													7	22	---	---	---	---	PASS
LYPD4	147719	broad.mit.edu	37	19	42342205	42342205	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42342205G>A	uc002orp.1	-	4	1326	c.342C>T	c.(340-342)CTC>CTT	p.L114L	LYPD4_uc002orq.1_Silent_p.L79L	NM_173506	NP_775777	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4 precursor	114						anchored to membrane|plasma membrane				ovary(1)	1						GGTTGTTGCAGAGATAAGACC	0.552													17	62	---	---	---	---	PASS
CIC	23152	broad.mit.edu	37	19	42794659	42794659	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42794659G>C	uc002otf.1	+	10	1779	c.1739G>C	c.(1738-1740)GGT>GCT	p.G580A		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	580	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)|lung(1)|central_nervous_system(1)|skin(1)	11		Prostate(69;0.00682)				GGGGCTGGGGGTCCAGCGACA	0.677			T	DUX4	soft tissue sarcoma								15	31	---	---	---	---	PASS
IGFL1	374918	broad.mit.edu	37	19	46733753	46733753	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46733753C>A	uc002pee.2	+	3	325	c.302C>A	c.(301-303)TCG>TAG	p.S101*		NM_198541	NP_940943	Q6UW32	IGFL1_HUMAN	IGF-like family member 1 precursor	101						extracellular space	protein binding				0		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.00242)|all cancers(93;0.0132)|GBM - Glioblastoma multiforme(486;0.0294)|Epithelial(262;0.201)		GCCCGGACCTCGGATGACAGG	0.587													5	102	---	---	---	---	PASS
C5AR1	728	broad.mit.edu	37	19	47823500	47823500	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47823500G>T	uc002pgj.1	+	2	515	c.466G>T	c.(466-468)GCC>TCC	p.A156S		NM_001736	NP_001727	P21730	C5AR_HUMAN	complement component 5 receptor 1	156	Helical; Name=4; (Potential).				activation of MAPK activity|activation of phospholipase C activity|cellular defense response|elevation of cytosolic calcium ion concentration|immune response|sensory perception of chemical stimulus	integral to plasma membrane	C5a anaphylatoxin receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		GGCCTGGATCGCCTGTGCCGT	0.607													10	45	---	---	---	---	PASS
CARD8	22900	broad.mit.edu	37	19	48737714	48737714	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48737714G>A	uc002pie.3	-	3	335	c.22C>T	c.(22-24)CAT>TAT	p.H8Y	CARD8_uc002pii.3_Missense_Mutation_p.P99L|CARD8_uc010xzi.1_Missense_Mutation_p.H8Y|CARD8_uc010els.2_5'Flank|CARD8_uc010xzj.1_Missense_Mutation_p.P99L|CARD8_uc010xzk.1_Missense_Mutation_p.H32Y|CARD8_uc002pif.3_Missense_Mutation_p.H8Y|CARD8_uc002pig.3_5'UTR|CARD8_uc002pih.3_Missense_Mutation_p.P49L|CARD8_uc010xzl.1_Missense_Mutation_p.P49L|CARD8_uc010xzm.1_Missense_Mutation_p.P99L	NM_014959	NP_055774	Q9Y2G2	CARD8_HUMAN	caspase recruitment domain family, member 8	8					negative regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion	cytoplasm|nucleus	caspase activator activity|NACHT domain binding|protein homodimerization activity				0		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)		GAACAATAATGGCTCTGCCTC	0.458													17	57	---	---	---	---	PASS
SLC6A16	28968	broad.mit.edu	37	19	49793961	49793961	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49793961C>A	uc002pmz.2	-	11	2076	c.1842G>T	c.(1840-1842)TGG>TGT	p.W614C	SLC6A16_uc002pna.2_Missense_Mutation_p.W614C	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	614	Helical; Name=11; (Potential).					integral to membrane|intracellular	neurotransmitter:sodium symporter activity			skin(2)|ovary(1)|kidney(1)	4		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		ACAGATGGGGCCACAGCCAAC	0.537													3	9	---	---	---	---	PASS
ZNF761	388561	broad.mit.edu	37	19	53958064	53958064	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53958064G>T	uc010eqp.2	+	7	761	c.303G>T	c.(301-303)TGG>TGT	p.W101C	ZNF761_uc010ydy.1_Missense_Mutation_p.W47C|ZNF761_uc002qbt.1_Missense_Mutation_p.W47C	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761	101					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)		AATTTCAATGGCAAGAAGATG	0.363													23	57	---	---	---	---	PASS
NLRP12	91662	broad.mit.edu	37	19	54313983	54313983	+	Nonsense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54313983C>T	uc002qch.3	-	3	1150	c.930G>A	c.(928-930)TGG>TGA	p.W310*	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Nonsense_Mutation_p.W310*|NLRP12_uc002qcj.3_Nonsense_Mutation_p.W310*|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Nonsense_Mutation_p.W310*	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	310	NACHT.				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		AGCAGAGGCACCAGGGTCCCT	0.572													10	25	---	---	---	---	PASS
ZNF471	57573	broad.mit.edu	37	19	57037235	57037235	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57037235A>T	uc002qnh.2	+	5	1932	c.1799A>T	c.(1798-1800)CAG>CTG	p.Q600L		NM_020813	NP_065864	Q9BX82	ZN471_HUMAN	zinc finger protein 471	600	C2H2-type 15.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		AGGCCCTATCAGTGTTTTGAA	0.423													22	42	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57328739	57328739	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57328739C>A	uc002qnu.2	-	7	1422	c.1071G>T	c.(1069-1071)AGG>AGT	p.R357S	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.R328S|PEG3_uc002qnv.2_Missense_Mutation_p.R357S|PEG3_uc002qnw.2_Missense_Mutation_p.R233S|PEG3_uc002qnx.2_Missense_Mutation_p.R231S|PEG3_uc010etr.2_Missense_Mutation_p.R357S	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	357					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TCACTGACTCCCTCTTGTTCA	0.458													20	47	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57641512	57641512	+	Missense_Mutation	SNP	A	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57641512A>C	uc002qny.2	+	4	1825	c.1469A>C	c.(1468-1470)AAG>ACG	p.K490T		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	490					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CAGATGTGTAAGCAGAAGAGT	0.393													18	110	---	---	---	---	PASS
ZIK1	284307	broad.mit.edu	37	19	58099930	58099930	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58099930C>A	uc002qpg.2	+	3	193	c.96C>A	c.(94-96)ATC>ATA	p.I32I	ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_5'UTR|ZIK1_uc002qpi.2_Silent_p.I19I|ZIK1_uc002qpj.2_Intron	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein	32	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TTGAGGACATCGCCATTTACT	0.522													25	63	---	---	---	---	PASS
C20orf186	149954	broad.mit.edu	37	20	31690829	31690829	+	Intron	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31690829C>A	uc010zue.1	+							NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor							cytoplasm|extracellular region	lipid binding				0						ATGTAAGTACCATGTTTAGTT	0.522													6	124	---	---	---	---	PASS
TRPC4AP	26133	broad.mit.edu	37	20	33623108	33623108	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33623108G>T	uc002xbk.2	-	8	903	c.869C>A	c.(868-870)GCC>GAC	p.A290D	TRPC4AP_uc010zuq.1_5'UTR|TRPC4AP_uc002xbl.2_Missense_Mutation_p.A290D|TRPC4AP_uc010zur.1_Missense_Mutation_p.A251D|TRPC4AP_uc002xbm.1_Missense_Mutation_p.A290D	NM_015638	NP_056453	Q8TEL6	TP4AP_HUMAN	TRPC4-associated protein isoform a	290	Interaction with TNFRSF1A (By similarity).				protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GCTGAGAAGGGCCGCTGCCAG	0.483													13	22	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40710638	40710638	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40710638C>A	uc002xkg.2	-	30	4340	c.4156G>T	c.(4156-4158)GGA>TGA	p.G1386*	PTPRT_uc010ggj.2_Nonsense_Mutation_p.G1405*|PTPRT_uc010ggi.2_Nonsense_Mutation_p.G589*	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1386	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CAGAAGGTTCCACTACGGCCT	0.478													5	54	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40713348	40713348	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40713348C>A	uc002xkg.2	-	29	4294	c.4110G>T	c.(4108-4110)AGG>AGT	p.R1370S	PTPRT_uc010ggj.2_Missense_Mutation_p.R1389S|PTPRT_uc010ggi.2_Missense_Mutation_p.R573S	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1370	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TACGTCCCTCCCTCCCGTCAT	0.607													4	17	---	---	---	---	PASS
ARFGEF2	10564	broad.mit.edu	37	20	47612310	47612310	+	Intron	SNP	T	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47612310T>G	uc002xtx.3	+						ARFGEF2_uc010zyf.1_Intron	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine						exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TTTTGTGCATTGTGTTTCAGG	0.453													29	58	---	---	---	---	PASS
NPBWR2	2832	broad.mit.edu	37	20	62737703	62737703	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62737703C>T	uc011abt.1	-	1	482	c.482G>A	c.(481-483)CGG>CAG	p.R161Q		NM_005286	NP_005277	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	161	Cytoplasmic (Potential).					plasma membrane	opioid receptor activity|protein binding			large_intestine(1)	1	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					CTTCGCCCCCCGGTAGGTGCG	0.632													7	8	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10920107	10920107	+	Nonsense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10920107G>A	uc002yip.1	-	19	1515	c.1147C>T	c.(1147-1149)CAG>TAG	p.Q383*	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Nonsense_Mutation_p.Q365*|TPTE_uc002yir.1_Nonsense_Mutation_p.Q345*|TPTE_uc010gkv.1_Nonsense_Mutation_p.Q245*	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	383	Phosphatase tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTTACTCCCTGAAATTTTTCG	0.378													7	85	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40570785	40570785	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40570785G>T	uc002yxk.1	-	40	5696	c.5557C>A	c.(5557-5559)CCT>ACT	p.P1853T	BRWD1_uc010goc.1_Missense_Mutation_p.P496T|BRWD1_uc002yxl.2_Missense_Mutation_p.P1853T	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1853					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				ATAGCAATAGGGTCACAGTTC	0.363													8	106	---	---	---	---	PASS
C21orf57	54059	broad.mit.edu	37	21	47707005	47707005	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47707005C>A	uc002ziv.2	+	2	607	c.178C>A	c.(178-180)CCA>ACA	p.P60T	C21orf57_uc002zit.1_Missense_Mutation_p.P60T|C21orf57_uc002ziu.1_Missense_Mutation_p.P60T|C21orf57_uc002ziw.2_Intron|C21orf57_uc002zix.2_Missense_Mutation_p.P60T|C21orf57_uc010gqh.2_Intron|C21orf57_uc002ziy.2_Missense_Mutation_p.P60T|MCM3AP_uc002zir.1_5'Flank	NM_058181	NP_478061	P58557	YBEY_HUMAN	hypothetical protein LOC54059 isoform 1	60							metal ion binding|metalloendopeptidase activity				0	Breast(49;0.112)			Colorectal(79;0.236)		TAGAAATGTCCCAACCGATGT	0.363													5	46	---	---	---	---	PASS
VPREB1	7441	broad.mit.edu	37	22	22599440	22599440	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22599440G>A	uc002zvx.1	+	2	155	c.129G>A	c.(127-129)CTG>CTA	p.L43L	LOC96610_uc011aim.1_Intron	NM_007128	NP_009059	P12018	VPREB_HUMAN	immunoglobulin iota chain precursor	43	Ig-like V-type.|Complementarity-determining-1.				immune response	extracellular region	antigen binding|protein binding				0	all_hematologic(9;0.0312)|Acute lymphoblastic leukemia(84;0.155)	all_cancers(3;3.14e-14)|Acute lymphoblastic leukemia(3;2.97e-57)|all_hematologic(3;5.9e-52)		READ - Rectum adenocarcinoma(21;0.145)		CCTGCACCCTGAGGAACGACC	0.592													11	89	---	---	---	---	PASS
SLC2A11	66035	broad.mit.edu	37	22	24210776	24210776	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24210776G>T	uc002zyn.3	+	3	328	c.229G>T	c.(229-231)GGA>TGA	p.G77*	SLC2A11_uc002zyl.1_Nonsense_Mutation_p.G84*|SLC2A11_uc002zym.3_Nonsense_Mutation_p.G84*|SLC2A11_uc002zyo.3_RNA|SLC2A11_uc011ajc.1_Nonsense_Mutation_p.G84*|SLC2A11_uc011ajd.1_Nonsense_Mutation_p.G71*|SLC2A11_uc002zyp.3_Nonsense_Mutation_p.G80*	NM_001024938	NP_001020109	Q9BYW1	GTR11_HUMAN	glucose transporter protein 10 isoform c	77	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	sugar transmembrane transporter activity			ovary(1)	1						GTATCCCCTGGGAGGCCTCTT	0.567													5	35	---	---	---	---	PASS
C22orf28	51493	broad.mit.edu	37	22	32802670	32802670	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32802670G>T	uc003amm.2	-	4	450	c.319C>A	c.(319-321)CCT>ACT	p.P107T	C22orf28_uc011ama.1_RNA	NM_014306	NP_055121	Q9Y3I0	RTCB_HUMAN	hypothetical protein LOC51493	107					cell-matrix adhesion|substrate adhesion-dependent cell spreading|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|tRNA-splicing ligase complex	ATP binding|metal ion binding|RNA ligase (ATP) activity|vinculin binding				0						ACTGCTTCAGGGTCATTCATA	0.343													7	137	---	---	---	---	PASS
LARGE	9215	broad.mit.edu	37	22	34157471	34157471	+	5'UTR	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34157471G>A	uc003and.3	-	3					LARGE_uc003ane.3_5'UTR|LARGE_uc010gwp.2_5'UTR|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_5'UTR	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				CATCCTCTCAGAAGTGGCAAT	0.527													15	45	---	---	---	---	PASS
RBM9	23543	broad.mit.edu	37	22	36177730	36177730	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36177730C>A	uc003aon.3	-	4	638	c.526G>T	c.(526-528)GAG>TAG	p.E176*	RBM9_uc003aog.3_Nonsense_Mutation_p.E86*|RBM9_uc003aol.3_Nonsense_Mutation_p.E105*|RBM9_uc003aoj.3_Nonsense_Mutation_p.E105*|RBM9_uc003aok.3_Nonsense_Mutation_p.E106*|RBM9_uc003aoh.3_Nonsense_Mutation_p.E105*|RBM9_uc003aom.3_Nonsense_Mutation_p.E105*|RBM9_uc010gwu.2_Nonsense_Mutation_p.E85*|RBM9_uc003aoo.3_Nonsense_Mutation_p.E175*|RBM9_uc003aop.3_Nonsense_Mutation_p.E105*	NM_001082578	NP_001076047	O43251	RFOX2_HUMAN	RNA binding motif protein 9 isoform 5	115					estrogen receptor signaling pathway|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of cell proliferation|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding|transcription corepressor activity|transcription factor binding				0						GATTTACTCTCTGAATTTTCA	0.453													8	176	---	---	---	---	PASS
MICALL1	85377	broad.mit.edu	37	22	38333762	38333762	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38333762G>T	uc003aui.2	+	15	2517	c.2433G>T	c.(2431-2433)GAG>GAT	p.E811D		NM_033386	NP_203744	Q8N3F8	MILK1_HUMAN	molecule interacting with Rab13	811	Potential.					cytoplasm|cytoskeleton	protein binding|zinc ion binding			breast(1)	1	Melanoma(58;0.045)					GGGAGGAAGAGGAAGACAAGA	0.338													8	198	---	---	---	---	PASS
DMC1	11144	broad.mit.edu	37	22	38934604	38934604	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38934604C>A	uc003avz.1	-	10	775	c.600G>T	c.(598-600)ATG>ATT	p.M200I	DMC1_uc011anv.1_Missense_Mutation_p.M145I	NM_007068	NP_008999	Q14565	DMC1_HUMAN	DMC1 dosage suppressor of mck1 homolog	200					reciprocal meiotic recombination	condensed nuclear chromosome	ATP binding|DNA binding|DNA-dependent ATPase activity|protein binding			ovary(1)	1	Melanoma(58;0.0286)					CAAGTAGCTCCATCTGATGTT	0.383								Homologous_recombination					8	188	---	---	---	---	PASS
MCHR1	2847	broad.mit.edu	37	22	41077580	41077580	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41077580C>T	uc003ayz.2	+	2	1185	c.917C>T	c.(916-918)TCC>TTC	p.S306F	MCHR1_uc003aza.2_Missense_Mutation_p.S195F|uc003azb.1_RNA	NM_005297	NP_005288	Q99705	MCHR1_HUMAN	G protein-coupled receptor 24	306	Cytoplasmic (Potential).				elevation of cytosolic calcium ion concentration|feeding behavior|generation of precursor metabolites and energy|inhibition of adenylate cyclase activity by G-protein signaling pathway	integral to plasma membrane|nonmotile primary cilium	neuropeptide receptor activity				0						CGCATGACGTCCTCAGTGGCC	0.602													7	51	---	---	---	---	PASS
CRELD2	79174	broad.mit.edu	37	22	50318061	50318061	+	Nonsense_Mutation	SNP	G	T	T	rs113168785	byFrequency	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50318061G>T	uc003bja.2	+	8	961	c.826G>T	c.(826-828)GAG>TAG	p.E276*	CRELD2_uc010haj.2_Nonsense_Mutation_p.E276*|CRELD2_uc010hal.2_Nonsense_Mutation_p.E325*|CRELD2_uc010hak.2_Nonsense_Mutation_p.E248*|CRELD2_uc010ham.2_Intron	NM_024324	NP_077300	Q6UXH1	CREL2_HUMAN	cysteine-rich with EGF-like domains 2 isoform b	276	FU 2.					endoplasmic reticulum|extracellular region	calcium ion binding				0		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.198)|LUAD - Lung adenocarcinoma(64;0.247)		AAACTGTAAAGAGTGTATCTC	0.602													4	13	---	---	---	---	PASS
SELO	83642	broad.mit.edu	37	22	50649059	50649059	+	Splice_Site	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50649059G>T	uc011arr.1	+	5	1129	c.1071_splice	c.e5-1	p.R357_splice	SELO_uc010hap.2_Splice_Site_p.R168_splice|SELO_uc003bjy.2_Splice_Site_p.R37_splice|SELO_uc003bjz.2_Splice_Site_p.R37_splice	NM_031454	NP_113642	Q9BVL4	SELO_HUMAN	selenoprotein O												0		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		CCGTGTGGCAGGTACGACCCC	0.672											OREG0026676	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	19	---	---	---	---	PASS
MAPK8IP2	23542	broad.mit.edu	37	22	51040245	51040245	+	Silent	SNP	A	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51040245A>G	uc003bmx.2	+	2	210	c.93A>G	c.(91-93)GAA>GAG	p.E31E	MAPK8IP2_uc003bmy.2_5'Flank	NM_012324	NP_036456	Q13387	JIP2_HUMAN	mitogen-activated protein kinase 8 interacting	31	Asp/Glu-rich (acidic).				behavioral fear response|dendrite morphogenesis|MAPKKK cascade|nonassociative learning|positive regulation of anti-apoptosis|regulation of excitatory postsynaptic membrane potential|regulation of JNK cascade|regulation of receptor activity|regulation of synaptic transmission, glutamatergic|signal complex assembly|social behavior	cytoplasm|postsynaptic density	beta-amyloid binding|kinesin binding|MAP-kinase scaffold activity|protein kinase activator activity|protein kinase binding			large_intestine(2)|central_nervous_system(1)	3		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		OV - Ovarian serous cystadenocarcinoma(4;1.28e-70)|Epithelial(4;3.46e-65)|GBM - Glioblastoma multiforme(4;4.83e-06)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GCCTGGAAGAATTTGACGACG	0.587													4	76	---	---	---	---	PASS
STS	412	broad.mit.edu	37	X	7268042	7268042	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7268042G>A	uc004cry.3	+	10	1737	c.1492G>A	c.(1492-1494)GAC>AAC	p.D498N		NM_000351	NP_000342	P08842	STS_HUMAN	steryl-sulfatase precursor	498	Lumenal.				female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)	CACCCATCACGACCCACCTTT	0.493									Ichthyosis				15	19	---	---	---	---	PASS
TLR7	51284	broad.mit.edu	37	X	12905841	12905841	+	Silent	SNP	G	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12905841G>A	uc004cvc.2	+	3	2353	c.2214G>A	c.(2212-2214)CTG>CTA	p.L738L		NM_016562	NP_057646	Q9NYK1	TLR7_HUMAN	toll-like receptor 7 precursor	738	LRR 25.|Extracellular (Potential).			L -> P (in Ref. 2; AAF78035).	cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity			ovary(2)|lung(2)|breast(1)	5					Imiquimod(DB00724)	TCAGGAGTCTGACGAAGTATT	0.423													20	50	---	---	---	---	PASS
TXLNG	55787	broad.mit.edu	37	X	16846272	16846272	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16846272C>A	uc004cxq.1	+	4	605	c.554C>A	c.(553-555)GCC>GAC	p.A185D	TXLNG_uc010ney.1_Missense_Mutation_p.A53D	NM_018360	NP_060830	Q9NUQ3	TXLNG_HUMAN	gamma-taxilin	185	Potential.				cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane				lung(1)	1						AAGAAGCAAGCCCAGATTGTG	0.418													21	42	---	---	---	---	PASS
WAS	7454	broad.mit.edu	37	X	48544493	48544493	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48544493C>A	uc004dkm.3	+	6	586	c.529C>A	c.(529-531)CTG>ATG	p.L177M		NM_000377	NP_000368	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome protein	177					blood coagulation|defense response|epidermis development|immune response|T cell receptor signaling pathway	actin cytoskeleton|cytosol	identical protein binding|small GTPase regulator activity			ovary(1)	1		all_lung(315;1.27e-10)				GCTCCCACCCCTGCCCCTGCA	0.448			Mis|N|F|S			lymphoma			Wiskott-Aldrich_syndrome				4	18	---	---	---	---	PASS
KLF8	11279	broad.mit.edu	37	X	56295866	56295866	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56295866G>C	uc004dur.2	+	4	1648	c.702G>C	c.(700-702)GAG>GAC	p.E234D	KLF8_uc010nkg.2_3'UTR|KLF8_uc011mop.1_Missense_Mutation_p.E234D|KLF8_uc010nkh.2_RNA	NM_007250	NP_009181	O95600	KLF8_HUMAN	Kruppel-like factor 8 isoform 1	234					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						ACAGTGAGGAGAGTACAATTG	0.433													8	15	---	---	---	---	PASS
ZXDA	7789	broad.mit.edu	37	X	57935671	57935671	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57935671C>A	uc004dve.2	-	1	1397	c.1184G>T	c.(1183-1185)GGC>GTC	p.G395V		NM_007156	NP_009087	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	395	C2H2-type 5.|Required for interaction with ZXDC.				positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						CTTCTTGCAGCCAGAAAACGC	0.572													16	32	---	---	---	---	PASS
AWAT2	158835	broad.mit.edu	37	X	69262236	69262236	+	Silent	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69262236C>A	uc004dxt.1	-	6	654	c.648G>T	c.(646-648)GGG>GGT	p.G216G		NM_001002254	NP_001002254	Q6E213	AWAT2_HUMAN	wax synthase 2	216						endoplasmic reticulum membrane|integral to membrane	long-chain-alcohol O-fatty-acyltransferase activity				0						TTAGAGGCACCCTGCAGAGCA	0.542													4	27	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76763844	76763844	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76763844T>A	uc004ecp.3	-	35	7696	c.7464A>T	c.(7462-7464)CAA>CAT	p.Q2488H	ATRX_uc004ecq.3_Missense_Mutation_p.Q2450H|ATRX_uc004eco.3_Missense_Mutation_p.Q2273H	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	2488					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TTGATTTCCCTTGGGAAGGTC	0.398			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						31	62	---	---	---	---	PASS
BRWD3	254065	broad.mit.edu	37	X	79936891	79936891	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79936891C>A	uc004edt.2	-	40	4866	c.4603G>T	c.(4603-4605)GAC>TAC	p.D1535Y	BRWD3_uc010nmi.1_RNA|BRWD3_uc004edo.2_Missense_Mutation_p.D1131Y|BRWD3_uc004edp.2_Missense_Mutation_p.D1364Y|BRWD3_uc004edq.2_Missense_Mutation_p.D1131Y|BRWD3_uc010nmj.1_Missense_Mutation_p.D1131Y|BRWD3_uc004edr.2_Missense_Mutation_p.D1205Y|BRWD3_uc004eds.2_Missense_Mutation_p.D1131Y|BRWD3_uc004edu.2_Missense_Mutation_p.D1205Y|BRWD3_uc004edv.2_Missense_Mutation_p.D1131Y|BRWD3_uc004edw.2_Missense_Mutation_p.D1131Y|BRWD3_uc004edx.2_Missense_Mutation_p.D1131Y|BRWD3_uc004edy.2_Missense_Mutation_p.D1131Y|BRWD3_uc004edz.2_Missense_Mutation_p.D1205Y|BRWD3_uc004eea.2_Missense_Mutation_p.D1205Y|BRWD3_uc004eeb.2_Missense_Mutation_p.D1131Y	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1535										ovary(4)	4						TTCCCTGGGTCATGGCTATTT	0.393													24	60	---	---	---	---	PASS
BEX1	55859	broad.mit.edu	37	X	102317936	102317936	+	Silent	SNP	C	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102317936C>T	uc004ejt.1	-	3	507	c.267G>A	c.(265-267)GTG>GTA	p.V89V		NM_018476	NP_060946	Q9HBH7	BEX1_HUMAN	brain expressed, X-linked 1	89					cell differentiation|nervous system development	cytoplasm|nucleus				ovary(1)	1						TCAGCTGTCTCACCTCCTCCC	0.512													33	73	---	---	---	---	PASS
DCAF12L1	139170	broad.mit.edu	37	X	125686327	125686327	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125686327C>A	uc004eul.2	-	1	516	c.265G>T	c.(265-267)GAG>TAG	p.E89*		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	89										skin(3)|ovary(1)	4						AGTTGGCGCTCCGTCAGCAGC	0.657													11	15	---	---	---	---	PASS
MST4	51765	broad.mit.edu	37	X	131206864	131206864	+	Silent	SNP	G	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131206864G>C	uc004ewk.1	+	10	1351	c.1050G>C	c.(1048-1050)CTG>CTC	p.L350L	MST4_uc004ewl.1_Silent_p.L273L|MST4_uc011mux.1_Silent_p.L372L|MST4_uc010nrj.1_Intron|MST4_uc004ewm.1_Silent_p.L288L	NM_016542	NP_057626	Q9P289	MST4_HUMAN	serine/threonine protein kinase MST4 isoform 1	350					cellular component disassembly involved in apoptosis|regulation of apoptosis	cytosol|Golgi membrane	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(3)|stomach(2)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(192;0.000127)					TGCAAACCCTGAGTTGTTTGT	0.284													15	40	---	---	---	---	PASS
PHF6	84295	broad.mit.edu	37	X	133511795	133511795	+	Intron	SNP	C	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133511795C>A	uc004exj.2	+						PHF6_uc004exk.2_Intron|PHF6_uc011mvk.1_Intron|PHF6_uc004exh.2_Intron|PHF6_uc010nrr.2_Intron|PHF6_uc004exi.2_Intron	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					GGTAAGTATACCGGCAGCAAC	0.368													27	41	---	---	---	---	PASS
ZNF75D	7626	broad.mit.edu	37	X	134425494	134425494	+	Intron	SNP	G	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134425494G>T	uc004eyp.2	-						ZNF75D_uc004eym.2_Intron|ZNF75D_uc004eyn.2_5'UTR|ZNF75D_uc004eyo.2_Intron	NM_007131	NP_009062	P51815	ZN75D_HUMAN	zinc finger protein 75						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GCACAGCTGTGGGTAGAAAAT	0.413													5	22	---	---	---	---	PASS
SLC6A8	6535	broad.mit.edu	37	X	152959701	152959701	+	Missense_Mutation	SNP	C	G	G	rs3179358		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152959701C>G	uc004fib.3	+	9	1649	c.1371C>G	c.(1369-1371)ATC>ATG	p.I457M	SLC6A8_uc004fic.3_Missense_Mutation_p.I447M|SLC6A8_uc011myx.1_Missense_Mutation_p.I342M|SLC6A8_uc010nuj.2_RNA	NM_005629	NP_005620	P48029	SC6A8_HUMAN	solute carrier family 6 member 8 isoform 1	457	Helical; (Potential).				creatine metabolic process|muscle contraction	integral to plasma membrane	creatine:sodium symporter activity|neurotransmitter:sodium symporter activity			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	GCTTTGTCATCGATCTCTCCA	0.617													39	59	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	9441709	9441709	+	IGR	DEL	A	-	-	rs111811868		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9441709delA								SPSB1 (12121 upstream) : SLC25A33 (157819 downstream)																							actccaactcaaaaaaaaaaa	0.199													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	10980597	10980597	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10980597delT								CASZ1 (123890 upstream) : C1orf127 (25936 downstream)																							ttattgtgTATTTTTTTTTTT	0.149													3	3	---	---	---	---	
CAPZB	832	broad.mit.edu	37	1	19779037	19779037	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19779037delA	uc010ocz.1	-						CAPZB_uc001bce.2_Intron|CAPZB_uc009vpk.2_Intron	NM_004930	NP_004921	P47756	CAPZB_HUMAN	F-actin capping protein beta subunit						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement	cytosol|F-actin capping protein complex|WASH complex	actin binding				0		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)		CAGGCCTTCCACTGCCACGTA	0.552													4	2	---	---	---	---	
EIF4G3	8672	broad.mit.edu	37	1	21278251	21278252	+	Intron	INS	-	T	T	rs138291886		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21278251_21278252insT	uc001bec.2	-						EIF4G3_uc010odi.1_Intron|EIF4G3_uc010odj.1_Intron|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bef.2_Intron|EIF4G3_uc001bee.2_Intron|EIF4G3_uc001beg.2_Intron|EIF4G3_uc010odk.1_Intron|EIF4G3_uc001beh.2_Intron	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		AAAAAGGGGGGGGCAGGGTAAG	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	24363873	24363874	+	IGR	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24363873_24363874delTG								PNRC2 (73926 upstream) : MYOM3 (18658 downstream)																							tgtgtgtgtatgtgtgtgtgtT	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30103574	30103574	+	IGR	DEL	C	-	-	rs3039773		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30103574delC								PTPRU (450259 upstream) : None (None downstream)																							tcctcctcctccccccccccc	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37820217	37820218	+	IGR	INS	-	CA	CA	rs139412803	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37820217_37820218insCA								GRIK3 (320373 upstream) : ZC3H12A (119901 downstream)																							acacacacaagcacacacacac	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	40805627	40805627	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40805627delA								COL9A2 (22567 upstream) : SMAP2 (34101 downstream)																							ttagcactctacaaggtcctg	0.000													4	2	---	---	---	---	
CCDC30	728621	broad.mit.edu	37	1	42954701	42954701	+	Intron	DEL	C	-	-	rs66945844		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42954701delC	uc001chm.2	+						CCDC30_uc001chn.2_5'Flank	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30												0						ttctgtcctacctcctatatt	0.129													1	5	---	---	---	---	
EIF2B3	8891	broad.mit.edu	37	1	45379174	45379174	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45379174delA	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron|EIF2B3_uc001cmw.2_Intron	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					gttttaatggaaaaaaaAAAA	0.095													4	2	---	---	---	---	
EIF2B3	8891	broad.mit.edu	37	1	45427876	45427877	+	Intron	INS	-	CATCAT	CATCAT	rs138231502	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45427876_45427877insCATCAT	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron|EIF2B3_uc001cmw.2_Intron	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					atcatcatcaacatcatcatca	0.153													3	4	---	---	---	---	
AGBL4	84871	broad.mit.edu	37	1	49390822	49390823	+	Intron	DEL	AC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49390822_49390823delAC	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		ATATATacatacacacacacac	0.030													4	2	---	---	---	---	
FAF1	11124	broad.mit.edu	37	1	51054928	51054928	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51054928delC	uc009vyx.1	-						FAF1_uc009vyw.1_Intron|FAF1_uc001cse.1_Intron|FAF1_uc010onc.1_Intron	NM_007051	NP_008982	Q9UNN5	FAF1_HUMAN	FAS-associated factor 1						apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		TGTGTTGTGTCCCTGGGCCAA	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	54942005	54942006	+	IGR	INS	-	AC	AC	rs140346624	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54942005_54942006insAC								SSBP3 (69913 upstream) : ACOT11 (65924 downstream)																							acacgcacacaacacacacaca	0.040													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	59100374	59100381	+	IGR	DEL	CACACACG	-	-	rs72090844		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59100374_59100381delCACACACG								TACSTD2 (57208 upstream) : MYSM1 (25209 downstream)																							cacacacacacacacacgcacacacaca	0.130													2	4	---	---	---	---	
FGGY	55277	broad.mit.edu	37	1	59827872	59827873	+	Intron	INS	-	CTCTT	CTCTT	rs143898997	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59827872_59827873insCTCTT	uc001czi.3	+						FGGY_uc001czg.2_Intron|FGGY_uc001czh.2_Intron|FGGY_uc009wac.2_Intron|FGGY_uc001czj.3_Intron|FGGY_uc001czk.3_Intron|FGGY_uc001czl.3_Intron	NM_018291	NP_060761	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing						carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)					tcttctttctcctatttaattt	0.059													4	2	---	---	---	---	
KANK4	163782	broad.mit.edu	37	1	62744869	62744872	+	Intron	DEL	CGCA	-	-	rs71783988	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62744869_62744872delCGCA	uc001dah.3	-						KANK4_uc001dai.3_Intron	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38											ovary(3)|skin(2)|lung(1)	6						AGCTAGCGCGCGcacacacacaca	0.407													3	4	---	---	---	---	
PDE4B	5142	broad.mit.edu	37	1	66535660	66535661	+	Intron	DEL	GT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66535660_66535661delGT	uc001dcn.2	+						PDE4B_uc009war.2_Intron|PDE4B_uc001dco.2_Intron|PDE4B_uc001dcp.2_Intron	NM_001037341	NP_001032418	Q07343	PDE4B_HUMAN	phosphodiesterase 4B isoform 1						signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)	GTATGTGCAAGTGTGTGCATGT	0.332													4	2	---	---	---	---	
MIER1	57708	broad.mit.edu	37	1	67423495	67423495	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67423495delT	uc001dde.2	+						MIER1_uc010opf.1_Intron|MIER1_uc009way.2_Intron|MIER1_uc001ddc.2_Intron|MIER1_uc001ddh.2_Intron|MIER1_uc001ddf.2_Intron|MIER1_uc001ddg.2_Intron|MIER1_uc010opg.1_Intron|MIER1_uc001ddj.1_Intron|MIER1_uc001ddi.2_Intron	NM_001077700	NP_001071168	Q8N108	MIER1_HUMAN	mesoderm induction early response 1 isoform b						positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)	1						CCAAGGCCACTTTTTAATTAT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	73101396	73101397	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73101396_73101397insA								NEGR1 (352991 upstream) : None (None downstream)																							atgaagaaactgagacacaaag	0.163													4	2	---	---	---	---	
ELTD1	64123	broad.mit.edu	37	1	79471614	79471615	+	Intron	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79471614_79471615insA	uc001diq.3	-							NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain						neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		CAAATGTGAACAAAAAAAAATG	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	79528852	79528852	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79528852delA								ELTD1 (56357 upstream) : None (None downstream)																							CTTTCTACAGAAAATGATGGT	0.323													4	2	---	---	---	---	
LPHN2	23266	broad.mit.edu	37	1	81822978	81822978	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81822978delT	uc001dis.2	+									O95490	LPHN2_HUMAN	SubName: Full=cDNA FLJ41428 fis, clone BRHIP2005236, highly similar to Latrophilin-2;						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GGCTCCCAGATTCCCTCTCTC	0.393													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	83590793	83590794	+	IGR	DEL	GC	-	-	rs148123217		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:83590793_83590794delGC								None (None upstream) : TTLL7 (744265 downstream)																							gaagctggtggcatggctcagt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	88878047	88878048	+	IGR	DEL	GC	-	-	rs113458010		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88878047_88878048delGC								None (None upstream) : PKN2 (271874 downstream)																							acagacacatgcgcgcgcgcgc	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	89768046	89768046	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89768046delG								GBP5 (29502 upstream) : GBP6 (61390 downstream)																							ggtgctgattggtgcatttac	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	90548333	90548333	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90548333delG								ZNF326 (54239 upstream) : BARHL2 (629247 downstream)																							AATAATTTTTGGTTTCAAAGA	0.393													4	2	---	---	---	---	
ZNF644	84146	broad.mit.edu	37	1	91400910	91400910	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91400910delA	uc001dnw.2	-						ZNF644_uc001dnv.2_Intron|ZNF644_uc001dnx.2_Intron	NM_201269	NP_958357	Q9H582	ZN644_HUMAN	zinc finger protein 644 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TCTGGTGGGGAAAAAAAAAGT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	93266754	93266754	+	IGR	DEL	A	-	-	rs67919948		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93266754delA								EVI5 (8793 upstream) : RPL5 (30840 downstream)																							actccgtctcaaaaaaaaaaa	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	120677056	120677056	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120677056delT								NOTCH2 (64780 upstream) : FAM72B (161949 downstream)																							ttaatttacattcccactagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121140484	121140485	+	IGR	DEL	AA	-	-	rs111761276		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121140484_121140485delAA								FCGR1B (204540 upstream) : LOC647121 (120425 downstream)																							tgatggggttaaaaaaaaaaaa	0.020													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142663276	142663277	+	Intron	DEL	AA	-	-	rs61807144		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142663276_142663277delAA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		CATTTTTAGCAAAGTTGTTGCA	0.540													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142709561	142709562	+	Intron	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142709561_142709562insA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		ATACAGTTCTGCTGCATAGTGA	0.411													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143175100	143175100	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143175100delT	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		tgaccatttgtccagattaca	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143413594	143413594	+	IGR	DEL	G	-	-	rs112862668		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143413594delG								None (None upstream) : LOC100286793 (234045 downstream)																							tcagagccttggtctggactc	0.000													4	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144527481	144527481	+	Intron	DEL	A	-	-	rs58060514		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144527481delA	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						caatccttccacctcagccta	0.000													6	5	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144681814	144681814	+	Intron	DEL	G	-	-	rs67467472		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144681814delG	uc009wig.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF9_uc009wii.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						TTACTAGTACGTTTTTAGTGA	0.348													2	4	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145046822	145046823	+	Intron	INS	-	T	T	rs71582781		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145046822_145046823insT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						atggctacaaattttttgctac	0.010													7	4	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145087200	145087200	+	Intron	DEL	G	-	-	rs58890996		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145087200delG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						tttgtcctttgtaatatggtg	0.000													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145268060	145268060	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145268060delC	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GTGGAATCCACCCACATTGAA	0.204													4	4	---	---	---	---	
NBPF15	284565	broad.mit.edu	37	1	148556867	148556868	+	5'Flank	INS	-	TGTC	TGTC	rs111615504		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148556867_148556868insTGTC	uc001esb.1	+							NM_001102663	NP_001096133	Q8N660	NBPFF_HUMAN	hypothetical protein LOC728936							cytoplasm					0	all_hematologic(923;0.032)					TGATTTCCCTGTATCTGTCTTT	0.475													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148901093	148901093	+	Intron	DEL	T	-	-	rs113935923		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148901093delT	uc009wkv.1	+											Homo sapiens cDNA, FLJ17483.																		TTTTCCATCATTTTTTTTTTT	0.458													7	4	---	---	---	---	
LOC728855	728855	broad.mit.edu	37	1	149598878	149598878	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149598878delG	uc001esk.3	+						LOC728855_uc001esl.3_Intron|LOC728855_uc009wlc.2_Intron|LOC728855_uc009wld.2_Intron	NR_024510				Homo sapiens mRNA, chromosome 1 specific transcript KIAA0493.												0						atacattgttgggtttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	150139565	150139566	+	IGR	INS	-	A	A	rs80211228		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150139565_150139566insA								PLEKHO1 (7749 upstream) : ANP32E (51152 downstream)																							cctgtctctacaaaaaaaaaat	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	150449411	150449411	+	IGR	DEL	T	-	-	rs5777731		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150449411delT								RPRD2 (372 upstream) : TARS2 (10509 downstream)																							CAGACGTTCCTTTTTTTTTTA	0.423													3	3	---	---	---	---	
SNX27	81609	broad.mit.edu	37	1	151621221	151621221	+	Intron	DEL	A	-	-	rs34407525		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151621221delA	uc001eyn.1	+						SNX27_uc001eyo.2_Intron|SNX27_uc001eyp.2_Intron	NM_030918	NP_112180	Q96L92	SNX27_HUMAN	sorting nexin family member 27						cell communication|protein transport|signal transduction	cytosol|early endosome	phosphatidylinositol binding|protein binding			ovary(2)|central_nervous_system(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			gatgcactttattcctttgtg	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	151946629	151946630	+	IGR	INS	-	G	G	rs139772374		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151946629_151946630insG								THEM4 (64516 upstream) : S100A10 (8757 downstream)																							gatgaagactagggattgtgtt	0.000													4	2	---	---	---	---	
SNAPIN	23557	broad.mit.edu	37	1	153632384	153632385	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153632384_153632385insT	uc001fcq.2	+							NM_012437	NP_036569	O95295	SNAPN_HUMAN	SNAP-associated protein						intracellular protein transport|synaptic vesicle exocytosis	BLOC-1 complex|cell junction|perinuclear region of cytoplasm|synaptic vesicle membrane|synaptosome	SNARE binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			taatttttgtatttttttgtag	0.000													3	3	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153790790	153790790	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153790790delC	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCAAGGttttctttttttttt	0.189													3	3	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154728263	154728264	+	Intron	INS	-	A	A	rs150370646	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154728263_154728264insA	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			agagagagaggggaggaggagg	0.030													5	4	---	---	---	---	
ARHGEF2	9181	broad.mit.edu	37	1	155943674	155943674	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155943674delG	uc001fmt.2	-						ARHGEF2_uc001fmr.2_Intron|ARHGEF2_uc001fms.2_Intron|ARHGEF2_uc001fmu.2_Intron|ARHGEF2_uc010pgt.1_Intron|ARHGEF2_uc010pgu.1_Intron	NM_001162383	NP_001155855	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor 2						actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding			ovary(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TAAGGGATGAGGAAACAGTGA	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161408608	161408608	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161408608delT								C1orf192 (70944 upstream) : FCGR2A (66597 downstream)																							gagatgtaggtggagaagcta	0.000													4	2	---	---	---	---	
ATF6	22926	broad.mit.edu	37	1	161738308	161738308	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161738308delT	uc001gbr.2	+						ATF6_uc001gbq.1_Intron	NM_007348	NP_031374	P18850	ATF6A_HUMAN	activating transcription factor 6						positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)			ACAGTTGCTGTTTTGGATGTT	0.239													4	2	---	---	---	---	
NME7	29922	broad.mit.edu	37	1	169170290	169170290	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169170290delG	uc001gfu.2	-						NME7_uc010plq.1_Intron|NME7_uc001gft.2_Intron	NM_013330	NP_037462	Q9Y5B8	NDK7_HUMAN	nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)					gcaacatagagagaccctatc	0.000													4	2	---	---	---	---	
KIFAP3	22920	broad.mit.edu	37	1	169890752	169890753	+	3'UTR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169890752_169890753insA	uc001ggv.2	-	20					KIFAP3_uc010plx.1_3'UTR	NM_014970	NP_055785	Q92845	KIFA3_HUMAN	kinesin-associated protein 3						blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GGCAAAGATCCAAAATTAACCC	0.376													8	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	170615511	170615512	+	IGR	INS	-	CA	CA	rs138844883	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170615511_170615512insCA								GORAB (92537 upstream) : PRRX1 (17801 downstream)																							ggtcattcacccacacacacac	0.000													4	3	---	---	---	---	
DNM3	26052	broad.mit.edu	37	1	172295384	172295384	+	Intron	DEL	A	-	-	rs66774735		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172295384delA	uc001gie.2	+						DNM3_uc001gif.2_Intron	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						GTTGCTCAGGAAAAATTTTCC	0.373													4	3	---	---	---	---	
RFWD2	64326	broad.mit.edu	37	1	176142773	176142774	+	Intron	INS	-	A	A	rs76105168		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176142773_176142774insA	uc001gku.1	-						RFWD2_uc001gkv.1_Intron|RFWD2_uc001gkw.1_Intron|RFWD2_uc001gkt.1_Intron	NM_022457	NP_071902	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2 isoform a						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	centrosome|cytosol|focal adhesion|nuclear speck	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0						ggcgctgtctcaaaaaaaaaaa	0.069													4	2	---	---	---	---	
ASTN1	460	broad.mit.edu	37	1	176994611	176994611	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176994611delT	uc001glc.2	-						ASTN1_uc001glb.1_Intron|ASTN1_uc001gld.1_Intron|ASTN1_uc009wwx.1_Intron|ASTN1_uc001gle.3_Intron	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1						cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						gtttcttggcttttttttttC	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	181287152	181287152	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181287152delC								IER5 (227175 upstream) : CACNA1E (165564 downstream)																							cccgtcttcgccctcccatcc	0.179													4	2	---	---	---	---	
SMG7	9887	broad.mit.edu	37	1	183446533	183446534	+	Intron	INS	-	TG	TG	rs143157038	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183446533_183446534insTG	uc001gqg.2	+						SMG7_uc010pob.1_Intron|SMG7_uc001gqf.2_Intron|SMG7_uc001gqh.2_Intron|SMG7_uc001gqi.2_Intron|SMG7_uc010poc.1_Intron	NM_173156	NP_775179	Q92540	SMG7_HUMAN	SMG-7 homolog isoform 1						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|intermediate filament cytoskeleton|nucleus	protein phosphatase 2A binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						CTGTtttgttttgtgtgtgtgt	0.193													4	2	---	---	---	---	
RGL1	23179	broad.mit.edu	37	1	183763382	183763382	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183763382delG	uc001gqm.2	+						RGL1_uc010pof.1_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron	NM_015149	NP_055964	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation						cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11						ttaatctcatggaaaagaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	184096868	184096869	+	IGR	INS	-	TC	TC	rs146928343	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184096868_184096869insTC								TSEN15 (53527 upstream) : C1orf21 (259281 downstream)																							ttgagacagggtcactctgttg	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	184622655	184622656	+	IGR	DEL	GT	-	-	rs112791294		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184622655_184622656delGT								C1orf21 (24500 upstream) : EDEM3 (36971 downstream)																							TTAtgtgtgcgtgtgtgtgtgt	0.248													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	188692620	188692620	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188692620delT								None (None upstream) : None (None downstream)																							ACATCCTTTGTTTTTTTTTTT	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	189292384	189292384	+	IGR	DEL	T	-	-	rs74138292	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189292384delT								None (None upstream) : FAM5C (774413 downstream)																							AGAATGGTCATTTTTTTTCTT	0.323													4	2	---	---	---	---	
ASPM	259266	broad.mit.edu	37	1	197067992	197067992	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197067992delC	uc001gtu.2	-						ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly						mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						actcacactactctcctgaac	0.000													3	5	---	---	---	---	
NEK7	140609	broad.mit.edu	37	1	198182022	198182028	+	Intron	DEL	TCATCAT	-	-	rs113317925		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198182022_198182028delTCATCAT	uc001gun.3	+							NM_133494	NP_598001	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7							cytoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|lung(1)|ovary(1)	4						acctcagctatcatcattgcctgagtc	0.000													5	4	---	---	---	---	
NR5A2	2494	broad.mit.edu	37	1	200050896	200050896	+	Intron	DEL	T	-	-	rs34689872		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200050896delT	uc001gvb.2	+						NR5A2_uc001gvc.2_Intron|NR5A2_uc009wzh.2_Intron|NR5A2_uc010pph.1_Intron	NM_205860	NP_995582	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2						embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Prostate(682;0.19)					ATAGTCTACCTTTTTTTTTTT	0.323													3	3	---	---	---	---	
FMOD	2331	broad.mit.edu	37	1	203170148	203170148	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203170148delA	uc010pqi.1	-							NM_002023		Q06828	FMOD_HUMAN	fibromodulin precursor						transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix				ovary(2)|breast(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.171)			agtgtgttggaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	204749928	204749929	+	IGR	DEL	TC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204749928_204749929delTC								MDM4 (72267 upstream) : NFASC (47853 downstream)																							tctctctctttctcTCTCTCTC	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	208894645	208894645	+	IGR	DEL	A	-	-	rs150649903		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208894645delA								PLXNA2 (476980 upstream) : LOC642587 (707523 downstream)																							aactgatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
HHAT	55733	broad.mit.edu	37	1	210533216	210533217	+	Intron	INS	-	A	A	rs138163269	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210533216_210533217insA	uc009xcx.2	+						HHAT_uc010psq.1_Intron|HHAT_uc001hhz.3_Intron|HHAT_uc010psr.1_Intron|HHAT_uc010pss.1_Intron|HHAT_uc009xcy.2_Intron|HHAT_uc010pst.1_Intron|HHAT_uc010psu.1_Intron	NM_001122834	NP_001116306	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		tgggaaaaaacaaaaaaaaaac	0.000													3	8	---	---	---	---	
RD3	343035	broad.mit.edu	37	1	211655775	211655776	+	Intron	INS	-	AG	AG			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211655775_211655776insAG	uc001him.2	-						RD3_uc001hin.2_Intron|RD3_uc009xda.2_Intron	NM_183059	NP_898882	Q7Z3Z2	RD3_HUMAN	retinal degeneration 3						response to stimulus|visual perception					ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.00284)|all cancers(67;0.0279)|Epithelial(68;0.0689)		TGGTGAAGCATAGAGTCAGCAC	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	213822601	213822602	+	IGR	INS	-	A	A	rs34487604		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213822601_213822602insA								RPS6KC1 (375794 upstream) : PROX1 (338684 downstream)																							AGTCTCCACTTAAAAAAAAAAA	0.431													4	2	---	---	---	---	
PROX1	5629	broad.mit.edu	37	1	214173387	214173388	+	Intron	DEL	AC	-	-	rs71737737		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214173387_214173388delAC	uc001hkh.2	+							NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1						aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		TCTCTCTCTTacacacacacac	0.332													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	214432537	214432537	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214432537delA								PROX1 (222777 upstream) : SMYD2 (22028 downstream)																							atccacactcactgtcttggt	0.050													4	2	---	---	---	---	
KCNK2	3776	broad.mit.edu	37	1	215256544	215256545	+	5'Flank	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215256544_215256545insT	uc001hkq.2	+						KCNK2_uc001hko.2_Intron|KCNK2_uc009xdm.2_Intron|KCNK2_uc001hkp.2_Intron|KCNK2_uc010pua.1_5'Flank|KCNK2_uc001hkr.3_5'Flank	NM_001017425	NP_001017425	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2 isoform								outward rectifier potassium channel activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)	CGCTCCCCCCCCCGCCCCCTCC	0.639													3	4	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	215857146	215857146	+	Intron	DEL	T	-	-	rs75473916		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215857146delT	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTTCTTCCCCTTTATTGCCAT	0.259										HNSCC(13;0.011)			2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	218744192	218744193	+	IGR	INS	-	TT	TT	rs55668224		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218744192_218744193insTT								TGFB2 (126233 upstream) : LYPLAL1 (602999 downstream)																							CTTTCATGAGAttttttttttt	0.149													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	219761931	219761931	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219761931delG								LYPLAL1 (375725 upstream) : SLC30A10 (96838 downstream)																							CTGCCTGAAAGCTTTCACGGC	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	221041805	221041816	+	IGR	DEL	GTGTGTGTGTGT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221041805_221041816delGTGTGTGTGTGT								MOSC1 (54065 upstream) : HLX (10927 downstream)																							tcaccatgccgtgtgtgtgtgtgtgtgtgtgt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223180426	223180428	+	IGR	DEL	TTC	-	-	rs10569479		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223180426_223180428delTTC								DISP1 (1091 upstream) : TLR5 (103156 downstream)																							CCTGGAAGTGTTCTTCTGCATTC	0.443													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	224201255	224201256	+	IGR	INS	-	T	T	rs147564611		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224201255_224201256insT								TP53BP2 (167581 upstream) : FBXO28 (100535 downstream)																							aagcaatggaaggaatggaatg	0.000													3	4	---	---	---	---	
DEGS1	8560	broad.mit.edu	37	1	224376544	224376545	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224376544_224376545insT	uc001hoj.2	+						DEGS1_uc001hoi.2_Intron	NM_144780	NP_659004	O15121	DEGS1_HUMAN	degenerative spermatocyte homolog 1, lipid						sphingolipid metabolic process|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	electron carrier activity|protein binding|sphingolipid delta-4 desaturase activity				0	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)		cgatttctctgttttcttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	226246106	226246106	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226246106delC								C1orf55 (59040 upstream) : H3F3A (4315 downstream)																							ctcctgacctcaggtgattca	0.040													4	2	---	---	---	---	
SNAP47	116841	broad.mit.edu	37	1	227914118	227914121	+	5'Flank	DEL	GGGA	-	-	rs111240843		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227914118_227914121delGGGA	uc001hqz.2	+						SNAP47_uc001hra.2_5'Flank|LOC100130093_uc001hqx.3_5'Flank|LOC100130093_uc001hqy.3_5'Flank	NM_053052	NP_444280	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa							endomembrane system|membrane|perinuclear region of cytoplasm				ovary(1)	1						ccaaagtactgggattacaggcgt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230157540	230157540	+	IGR	DEL	A	-	-	rs35097890		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230157540delA								URB2 (361594 upstream) : GALNT2 (35996 downstream)																							agaccatcttaaaaaaaaaaa	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	235109281	235109281	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235109281delG								IRF2BP2 (364010 upstream) : TOMM20 (163379 downstream)																							GAGGTGGAGTGGGGTGAGGTG	0.507													4	2	---	---	---	---	
GGPS1	9453	broad.mit.edu	37	1	235492949	235492949	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235492949delA	uc001hwv.2	+						ARID4B_uc001hwq.2_5'Flank|ARID4B_uc001hwr.2_5'Flank|ARID4B_uc001hws.3_5'Flank|ARID4B_uc001hwu.1_5'Flank|GGPS1_uc001hww.2_Intron|GGPS1_uc001hwx.2_Intron|GGPS1_uc001hwy.2_5'UTR	NM_001037277	NP_001032354	O95749	GGPPS_HUMAN	geranylgeranyl diphosphate synthase 1 isoform A						cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	dimethylallyltranstransferase activity|farnesyltranstransferase activity|geranyltranstransferase activity|metal ion binding			central_nervous_system(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;1.39e-05)			cttTTCCAATATGAAGAACTG	0.229													1	5	---	---	---	---	
CHRM3	1131	broad.mit.edu	37	1	239903760	239903760	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239903760delT	uc001hyp.2	+						CHRM3_uc001hyo.1_Intron	NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	TTGAGGGTGGttttttttttt	0.199													4	2	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241156414	241156417	+	Intron	DEL	GGAA	-	-	rs71172668	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241156414_241156417delGGAA	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			agggagggagggaaggaaggaagg	0.083													3	3	---	---	---	---	
PLD5	200150	broad.mit.edu	37	1	242654169	242654169	+	Intron	DEL	T	-	-	rs34887885		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242654169delT	uc001hzn.1	-						PLD5_uc001hzo.1_Intron			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			gcgccttaggttttgcattcc	0.114													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	243149618	243149621	+	IGR	DEL	AAAG	-	-	rs12041256		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243149618_243149621delAAAG								PLD5 (461620 upstream) : CEP170 (138110 downstream)																							aaaaaataaaaaagaaagaaaGTT	0.127													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	244069107	244069108	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244069107_244069108insT								AKT3 (62554 upstream) : ZNF238 (145453 downstream)																							gttcctgtcccttttttttttt	0.000													4	4	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245343612	245343613	+	Intron	INS	-	AT	AT			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245343612_245343613insAT	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			gagagagagagagagagGagtg	0.193													4	2	---	---	---	---	
CNST	163882	broad.mit.edu	37	1	246806141	246806141	+	Intron	DEL	A	-	-	rs11305964		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246806141delA	uc001ibp.2	+						CNST_uc001ibo.3_Intron	NM_152609	NP_689822	Q6PJW8	CNST_HUMAN	hypothetical protein LOC163882 isoform 1						positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding				0						gtggtgatggatggtgatgat	0.229													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	246984669	246984670	+	IGR	INS	-	ACAC	ACAC	rs139954811	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246984669_246984670insACAC								LOC149134 (28984 upstream) : AHCTF1 (17732 downstream)																							GTGGTTCTGGAacacacacaca	0.322													6	3	---	---	---	---	
AHCTF1	25909	broad.mit.edu	37	1	247037123	247037123	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247037123delC	uc001ibu.1	-						AHCTF1_uc001ibv.1_Intron|AHCTF1_uc009xgs.1_Intron|AHCTF1_uc001ibw.1_Intron	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS						cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			GTTATCCCCTCCACAAAAACG	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	1599220	1599221	+	IGR	INS	-	ACAC	ACAC	rs150120102	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1599220_1599221insACAC								TPO (52722 upstream) : PXDN (36439 downstream)																							gacacacgcaaacacaccacag	0.054													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2503925	2503925	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2503925delC								MYT1L (168880 upstream) : TSSC1 (688816 downstream)																							acaaatgctgccagtatcttt	0.000													4	2	---	---	---	---	
TSSC1	7260	broad.mit.edu	37	2	3365246	3365246	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3365246delA	uc002qxj.2	-							NM_003310	NP_003301	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		TTCTCCTTGGAaaaaaaaaaa	0.313													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	3977372	3977373	+	IGR	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3977372_3977373delTG								ALLC (227114 upstream) : None (None downstream)																							ctagctcctctgtgaccgctgg	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8389149	8389150	+	Intron	INS	-	T	T	rs138407784	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8389149_8389150insT	uc010eww.1	-						uc002qyy.1_Intron					Homo sapiens cDNA FLJ45673 fis, clone D9OST2003989.																		GGAAAGTTGGATTTTTATTTCC	0.396													3	3	---	---	---	---	
KIDINS220	57498	broad.mit.edu	37	2	8980011	8980012	+	5'Flank	INS	-	T	T	rs111936794		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8980011_8980012insT	uc002qzc.2	-						KIDINS220_uc010yiv.1_5'Flank|KIDINS220_uc002qzd.2_5'Flank|KIDINS220_uc010yiw.1_5'Flank	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa						activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GGAAATAtttcttttttttttt	0.079													3	3	---	---	---	---	
ASAP2	8853	broad.mit.edu	37	2	9445647	9445648	+	Intron	INS	-	A	A	rs142522217	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9445647_9445648insA	uc002qzh.2	+						ASAP2_uc002qzi.2_Intron	NM_003887	NP_003878	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0						GGGGTATAGATATTGGTGGAGG	0.465													6	3	---	---	---	---	
PDIA6	10130	broad.mit.edu	37	2	10955680	10955681	+	5'Flank	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10955680_10955681insT	uc002rau.2	-						PDIA6_uc010yjg.1_5'Flank|PDIA6_uc002rav.2_Intron|PDIA6_uc010yjh.1_Intron|PDIA6_uc002raw.2_Intron	NM_005742	NP_005733	Q15084	PDIA6_HUMAN	protein disulfide isomerase A6 precursor						cell redox homeostasis|glycerol ether metabolic process|protein folding	endoplasmic reticulum lumen|ER-Golgi intermediate compartment|melanosome|plasma membrane	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		cCCCCttttacttttttttttg	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	14691548	14691550	+	IGR	DEL	TGT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14691548_14691550delTGT								None (None upstream) : FAM84A (81306 downstream)																							ATTttgttgctgttgttgttgtt	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16576560	16576561	+	IGR	INS	-	CACACACCT	CACACACCT	rs67690429		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16576560_16576561insCACACACCT								MYCN (489432 upstream) : FAM49A (157340 downstream)																							ccatagagacacacacaccata	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	18379960	18379961	+	IGR	INS	-	GTATTTAT	GTATTTAT	rs150125719	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18379960_18379961insGTATTTAT								KCNS3 (265736 upstream) : NT5C1B (356030 downstream)																							GCAAAGCCCAAGTATTTATGGA	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20227192	20227193	+	IGR	DEL	CA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20227192_20227193delCA								MATN3 (14737 upstream) : LAPTM4A (5219 downstream)																							ATAatatttgcacagtaattta	0.213													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	21858961	21858961	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21858961delC								APOB (592016 upstream) : None (None downstream)																							acgtgatgttccctcttcaat	0.005													4	2	---	---	---	---	
ATAD2B	54454	broad.mit.edu	37	2	23983637	23983639	+	Intron	DEL	CAC	-	-	rs151107077		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23983637_23983639delCAC	uc002rek.3	-						ATAD2B_uc010yki.1_Intron|ATAD2B_uc002rei.3_Intron|ATAD2B_uc002rej.3_Intron	NM_017552	NP_060022	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					cacacacacacacacCACTTCCT	0.187													4	2	---	---	---	---	
EPT1	85465	broad.mit.edu	37	2	26578610	26578610	+	Intron	DEL	T	-	-	rs60182041		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26578610delT	uc010ykz.1	+						EPT1_uc010eyl.1_Intron	NM_033505	NP_277040	Q9C0D9	EPT1_HUMAN	selenoprotein I						phospholipid biosynthetic process	integral to membrane	ethanolaminephosphotransferase activity|metal ion binding				0						TCTCTCTCTCTCCCttttttt	0.224													3	3	---	---	---	---	
WDR43	23160	broad.mit.edu	37	2	29129301	29129301	+	Intron	DEL	T	-	-	rs113220687		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29129301delT	uc002rmo.2	+							NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43							nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					cagccttaaattttttttttt	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	30312966	30312966	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30312966delC								ALK (168534 upstream) : YPEL5 (56784 downstream)																							CTTCCCACTTCACCCCAGTAC	0.537													4	2	---	---	---	---	
XDH	7498	broad.mit.edu	37	2	31574950	31574950	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31574950delT	uc002rnv.1	-							NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase						purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	cccttctctgttttttccatt	0.000													4	2	---	---	---	---	
XDH	7498	broad.mit.edu	37	2	31578525	31578525	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31578525delA	uc002rnv.1	-							NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase						purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	atggaatattaaaaaaaatgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	35551867	35551868	+	IGR	INS	-	T	T	rs146867730	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35551867_35551868insT								None (None upstream) : None (None downstream)																							tgccaatggtcttttttttgct	0.000													4	2	---	---	---	---	
HEATR5B	54497	broad.mit.edu	37	2	37307919	37307920	+	Intron	INS	-	A	A	rs72247503		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37307919_37307920insA	uc002rpp.1	-							NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				atgtacagattaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	37763312	37763313	+	IGR	INS	-	AAAAC	AAAAC	rs139751555	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37763312_37763313insAAAAC								QPCT (162848 upstream) : CDC42EP3 (107430 downstream)																							actccgtctcaaaaacaaaaca	0.203													4	3	---	---	---	---	
THADA	63892	broad.mit.edu	37	2	43682658	43682659	+	Intron	DEL	CA	-	-	rs66901994		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43682658_43682659delCA	uc002rsw.3	-						THADA_uc010far.2_Intron|THADA_uc002rsx.3_Intron|THADA_uc002rsy.3_Intron|THADA_uc010fas.1_Intron|THADA_uc002rsz.2_Intron|THADA_uc010fat.1_Intron|THADA_uc002rta.2_Intron	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				CTCTCTCTCTcacacacacaca	0.337													2	4	---	---	---	---	
LRPPRC	10128	broad.mit.edu	37	2	44145660	44145660	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44145660delA	uc002rtr.2	-						LRPPRC_uc010yob.1_Intron	NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein						mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GCCTTTAGGGAAAGGAACCAA	0.318													4	2	---	---	---	---	
TTC7A	57217	broad.mit.edu	37	2	47208369	47208370	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47208369_47208370insT	uc002rvo.2	+						TTC7A_uc002rvm.2_Intron|TTC7A_uc002rvn.1_Intron|TTC7A_uc010fbb.2_Intron|TTC7A_uc010fbc.2_Intron|TTC7A_uc002rvp.2_Intron|TTC7A_uc002rvq.2_Intron	NM_020458	NP_065191	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A								binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			acacagatgtattttttttttt	0.015													4	2	---	---	---	---	
CALM2	805	broad.mit.edu	37	2	47398314	47398315	+	Intron	INS	-	A	A	rs34274859		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47398314_47398315insA	uc002rvt.2	-						C2orf61_uc010fbd.2_Intron|CALM2_uc010fbe.2_Intron	NM_001743	NP_001734	P62158	CALM_HUMAN	calmodulin 2						activation of phospholipase C activity|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen catabolic process|muscle contraction|negative regulation of ryanodine-sensitive calcium-release channel activity|nerve growth factor receptor signaling pathway|nitric oxide metabolic process|platelet activation|platelet degranulation|positive regulation of ryanodine-sensitive calcium-release channel activity|regulation of cytokinesis|regulation of nitric-oxide synthase activity|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to calcium ion|synaptic transmission	centrosome|cytosol|extracellular region|nucleoplasm|plasma membrane|spindle microtubule|spindle pole	calcium ion binding|N-terminal myristoylation domain binding|phospholipase binding|protein domain specific binding|thioesterase binding|titin binding	p.0?(2)			0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)		Aprindine(DB01429)|Bepridil(DB01244)|Dibucaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Miconazole(DB01110)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)	TTAAAGTGATTAAAAAAAAAAA	0.327													2	4	---	---	---	---	
FSHR	2492	broad.mit.edu	37	2	49217159	49217159	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49217159delC	uc002rww.2	-						FSHR_uc002rwx.2_Intron|FSHR_uc010fbn.2_Intron|FSHR_uc010fbo.1_Intron	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1						female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	TACACCCCTTCCCCATCTCCT	0.388									Gonadal_Dysgenesis_46_XX				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	54621997	54621998	+	IGR	INS	-	ACC	ACC	rs35889040		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54621997_54621998insACC								C2orf73 (33283 upstream) : SPTBN1 (61456 downstream)																							agtctggtaatacattagcgag	0.000													4	3	---	---	---	---	
CCDC85A	114800	broad.mit.edu	37	2	56559078	56559078	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56559078delC	uc002rzn.2	+							NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A											breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CCTGCCCCCTCCCCGCCCCCC	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60092574	60092574	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60092574delA								None (None upstream) : BCL11A (585729 downstream)																							TAAAGTTAAGAAAACAGAGGC	0.433													4	2	---	---	---	---	
EHBP1	23301	broad.mit.edu	37	2	63165942	63165942	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63165942delA	uc002sby.2	+						EHBP1_uc010fcp.2_Intron|EHBP1_uc002sbz.2_Intron|EHBP1_uc002scb.2_Intron	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1							cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			tttgtgggggaaaaaaaaaag	0.000									Hereditary_Prostate_Cancer				4	2	---	---	---	---	
EHBP1	23301	broad.mit.edu	37	2	63187412	63187412	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63187412delT	uc002sby.2	+						EHBP1_uc010fcp.2_Intron|EHBP1_uc002sbz.2_Intron|EHBP1_uc002scb.2_Intron	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1							cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			acctctctcatttttttcatt	0.000									Hereditary_Prostate_Cancer				4	2	---	---	---	---	
EHBP1	23301	broad.mit.edu	37	2	63188664	63188665	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63188664_63188665insT	uc002sby.2	+						EHBP1_uc010fcp.2_Intron|EHBP1_uc002sbz.2_Intron|EHBP1_uc002scb.2_Intron	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1							cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TGTGTTTTTCATTTTTTTCCAC	0.312									Hereditary_Prostate_Cancer				4	2	---	---	---	---	
TIA1	7072	broad.mit.edu	37	2	70477291	70477291	+	5'Flank	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70477291delT	uc002sgj.3	-						TIA1_uc002sgk.3_5'Flank|TIA1_uc002sgl.3_5'Flank|TIA1_uc002sgm.3_5'Flank|TIA1_uc010yqt.1_5'Flank	NM_022173	NP_071505	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding						apoptosis|induction of apoptosis|regulation of nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|poly(A) RNA binding|protein binding				0						tctttctttcttttttttttt	0.000													4	2	---	---	---	---	
TGFA	7039	broad.mit.edu	37	2	70727414	70727414	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70727414delC	uc002sgs.3	-						TGFA_uc010fdq.2_Intron|TGFA_uc010fdr.2_Intron|TGFA_uc002sgt.3_Intron|TGFA_uc002sgu.2_Intron|TGFA_uc002sgv.2_Intron|TGFA_uc002sgw.2_Intron	NM_003236	NP_003227	P01135	TGFA_HUMAN	transforming growth factor, alpha isoform 1						activation of MAPK activity|cell proliferation|positive regulation of cell division|positive regulation of epidermal growth factor receptor activity|positive regulation of epithelial cell proliferation|positive regulation of mitosis	cell surface|extracellular space|integral to membrane|plasma membrane	epidermal growth factor receptor binding|growth factor activity|MAP kinase kinase activity|signal transducer activity			prostate(1)	1						TACTTAAAAACAAAAATATTA	0.358													4	2	---	---	---	---	
ADD2	119	broad.mit.edu	37	2	70962845	70962847	+	Intron	DEL	TTT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70962845_70962847delTTT	uc002sgz.2	-						ADD2_uc010fds.1_Intron|ADD2_uc002sgy.2_Intron|ADD2_uc002sha.2_Intron|ADD2_uc002shc.1_Intron|ADD2_uc002shd.1_Intron|ADD2_uc010fdu.1_Intron	NM_001617	NP_001608	P35612	ADDB_HUMAN	adducin 2 isoform a						actin filament bundle assembly|barbed-end actin filament capping|positive regulation of protein binding	cytoplasm|F-actin capping protein complex|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding			ovary(2)|pancreas(1)	3						ATTCCCCCGCttttttttttttg	0.232													4	2	---	---	---	---	
ATP6V1B1	525	broad.mit.edu	37	2	71175371	71175374	+	Intron	DEL	TTTT	-	-	rs67940202		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71175371_71175374delTTTT	uc002shj.2	+						ATP6V1B1_uc002shi.1_Intron|ATP6V1B1_uc010fdv.2_Intron|ATP6V1B1_uc010fdw.2_Intron|ATP6V1B1_uc010fdx.2_Intron	NM_001692	NP_001683	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1						ATP hydrolysis coupled proton transport|calcium ion homeostasis|cellular iron ion homeostasis|excretion|inner ear morphogenesis|insulin receptor signaling pathway|ossification|pH reduction|sensory perception of sound|transferrin transport	apical plasma membrane|basolateral plasma membrane|cytosol|endomembrane system|lateral plasma membrane|microvillus|proton-transporting V-type ATPase, V1 domain|vacuolar proton-transporting V-type ATPase complex	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			skin(1)	1						AAATGATCACtttttttttttctt	0.113											OREG0014685	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	3	---	---	---	---	
SLC4A5	57835	broad.mit.edu	37	2	74530144	74530145	+	Intron	DEL	TG	-	-	rs111285099		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74530144_74530145delTG	uc002sko.1	-						SLC4A5_uc002skl.2_Intron|SLC4A5_uc002skn.2_Intron|SLC4A5_uc010ffc.1_Intron|SLC4A5_uc002skp.1_Intron|SLC4A5_uc002sks.1_Intron	NM_021196	NP_067019	Q9BY07	S4A5_HUMAN	sodium bicarbonate transporter 4 isoform a							apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9						TGAGCAGGACtgtgtgtgtgtg	0.282													4	2	---	---	---	---	
PCGF1	84759	broad.mit.edu	37	2	74736531	74736531	+	5'Flank	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74736531delT	uc002slz.2	-						PCGF1_uc002sly.2_5'Flank	NM_032673	NP_116062	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1						histone H2A monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PcG protein complex	protein C-terminus binding|zinc ion binding			ovary(1)	1						aatggctccctccttctttca	0.060													4	2	---	---	---	---	
TACR1	6869	broad.mit.edu	37	2	75378995	75378995	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75378995delG	uc002sng.2	-						TACR1_uc002snh.2_Intron	NM_001058	NP_001049	P25103	NK1R_HUMAN	tachykinin receptor 1 isoform long						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|detection of abiotic stimulus|mechanosensory behavior	integral to plasma membrane	protein binding			ovary(1)	1					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	ccaagaccatgggaacctacc	0.000													2	4	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	80848886	80848887	+	Intron	INS	-	A	A	rs143702194	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80848886_80848887insA	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Intron|CTNNA2_uc010ysj.1_Intron	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						CTATGGGGGATAAAAAAGTGTA	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	81977699	81977700	+	IGR	DEL	AA	-	-	rs112846335		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:81977699_81977700delAA								None (None upstream) : None (None downstream)																							TATGAGGACTAAAAAAAAAAAA	0.178													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	85116934	85116934	+	IGR	DEL	A	-	-	rs35890132		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85116934delA								C2orf89 (8682 upstream) : TMSB10 (15829 downstream)																							ATAAAAAGACAAAAAAAAAAA	0.214													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	85701191	85701192	+	IGR	INS	-	ACAC	ACAC	rs148093783		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85701191_85701192insACAC								SH2D6 (37041 upstream) : MAT2A (65096 downstream)																							AGCACATCTATacacacacaca	0.361													4	3	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87815869	87815869	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87815869delA	uc002srs.3	+						NCRNA00152_uc002ssk.3_Intron|NCRNA00152_uc010fgy.2_Intron|NCRNA00152_uc010fgz.2_Intron			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						TAAAATGGCTAAAATGTTTTT	0.398													4	2	---	---	---	---	
C2orf51	200523	broad.mit.edu	37	2	88825335	88825337	+	Intron	DEL	AAG	-	-	rs35903656		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88825335_88825337delAAG	uc002stb.1	+							NM_152670	NP_689883	Q96LM6	TSC21_HUMAN	chromosome 2 open reading frame 51							nucleus				skin(1)	1						TTTTTGGTACAAGAAGAAGAAGA	0.300													4	2	---	---	---	---	
FLJ40330	645784	broad.mit.edu	37	2	89074860	89074860	+	Intron	DEL	A	-	-	rs33948055		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89074860delA	uc002stf.2	+						FLJ40330_uc010fhf.2_Intron|FLJ40330_uc010fhg.2_Intron|FLJ40330_uc010fhh.2_Intron					Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						CTGGAAGCAGAAGGTGGAAGA	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89878590	89878594	+	IGR	DEL	TCAAC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89878590_89878594delTCAAC								FLJ40330 (772465 upstream) : None (None downstream)																							ccgagtggaatcaactggaatggaa	0.000													9	5	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91847507	91847508	+	Intron	INS	-	GG	GG	rs138679921	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91847507_91847508insGG	uc002sts.3	-						LOC654342_uc002stt.2_Intron|LOC654342_uc010yub.1_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						CTTTGTAACCCGGGGGGGTCCC	0.629													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92241904	92241905	+	IGR	INS	-	AC	AC			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92241904_92241905insAC								FKSG73 (111410 upstream) : None (None downstream)																							ttctctttctttctttctttct	0.000													8	4	---	---	---	---	
KCNIP3	30818	broad.mit.edu	37	2	95979664	95979665	+	Intron	DEL	CA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95979664_95979665delCA	uc002sup.2	+							NM_013434	NP_038462	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3 isoform 1						apoptosis|signal transduction|transcription, DNA-dependent	endoplasmic reticulum|Golgi apparatus|nucleus|plasma membrane	calcium ion binding|DNA binding|potassium channel activity|transcription corepressor activity|voltage-gated ion channel activity			breast(2)|ovary(1)	3				READ - Rectum adenocarcinoma(193;0.13)		AGCCATTCCTcacacacacaca	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96593321	96593321	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96593321delT	uc002sva.1	-						uc010yug.1_Intron|uc002svc.1_5'Flank					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		AGAAATACACTGAAAAAAAAG	0.338													12	6	---	---	---	---	
INPP4A	3631	broad.mit.edu	37	2	99181316	99181316	+	Intron	DEL	T	-	-	rs3214545		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99181316delT	uc002syy.2	+						INPP4A_uc010yvj.1_Intron|INPP4A_uc010yvk.1_Intron|INPP4A_uc002syx.2_Intron|INPP4A_uc010fik.2_Intron	NM_001134224	NP_001127696	Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type 1						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			kidney(1)	1						ATACCAGTAATGCGTGCTTAT	0.502													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	101246162	101246169	+	IGR	DEL	TCCCTCCC	-	-	rs113834618		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101246162_101246169delTCCCTCCC								PDCL3 (52961 upstream) : NPAS2 (190444 downstream)																							cttccttctttccctccctccctccctc	0.250													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	101785027	101785027	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101785027delT								TBC1D8 (17181 upstream) : C2orf29 (84318 downstream)																							gtgtccaaggttttgggatcc	0.000													4	2	---	---	---	---	
MAP4K4	9448	broad.mit.edu	37	2	102503487	102503488	+	Intron	DEL	AA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102503487_102503488delAA	uc002tbg.2	+						MAP4K4_uc002tbc.2_Intron|MAP4K4_uc002tbd.2_Intron|MAP4K4_uc002tbe.2_Intron|MAP4K4_uc002tbf.2_Intron|MAP4K4_uc010yvy.1_Intron|MAP4K4_uc002tbh.2_Intron|MAP4K4_uc002tbi.2_Intron|MAP4K4_uc010yvz.1_Intron|MAP4K4_uc002tbk.2_Intron|MAP4K4_uc002tbl.2_Intron	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase						intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						actccgtctcaaaaaaaaaaaa	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	105400638	105400638	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105400638delG								LOC150568 (271424 upstream) : POU3F3 (71331 downstream)																							GCTCACACTTGGTAGGGGCCA	0.378													5	3	---	---	---	---	
UXS1	80146	broad.mit.edu	37	2	106782272	106782273	+	Intron	INS	-	G	G	rs142942979	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106782272_106782273insG	uc002tdm.2	-						UXS1_uc002tdn.2_Intron|UXS1_uc002tdo.2_Intron|UXS1_uc010ywh.1_Intron	NM_025076	NP_079352	Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1						cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity			ovary(2)	2						CAAGGAGGGAAGCGGGGGTGGC	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	108697374	108697374	+	IGR	DEL	T	-	-	rs5833272		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108697374delT								SLC5A7 (66935 upstream) : SULT1C3 (166277 downstream)																							gatcttgttcttttttgtgac	0.000													2	7	---	---	---	---	
SH3RF3	344558	broad.mit.edu	37	2	109838617	109838618	+	Intron	INS	-	AG	AG	rs137945597	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109838617_109838618insAG	uc010ywt.1	+							NM_001099289	NP_001092759	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1						cgcatgaagacagagtagagtg	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	111961475	111961478	+	IGR	DEL	TTTG	-	-	rs111601733		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111961475_111961478delTTTG								BCL2L11 (35453 upstream) : LOC541471 (3881 downstream)																							GCAGCtgttttttgtttgtttgtt	0.353													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	112459721	112459722	+	IGR	INS	-	GA	GA			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112459721_112459722insGA								LOC541471 (207029 upstream) : ANAPC1 (66919 downstream)																							gaagagaggaggagagagagag	0.421											OREG0014894	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
MERTK	10461	broad.mit.edu	37	2	112661957	112661957	+	Intron	DEL	T	-	-	rs34477025		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112661957delT	uc002thk.1	+						MERTK_uc002thl.1_Intron	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor						cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						CAGAAAAttcttttttttttt	0.129													4	2	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	115292674	115292675	+	Intron	INS	-	AAC	AAC			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115292674_115292675insAAC	uc002tla.1	+						DPP10_uc002tlb.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						ttctacaaaaaaaaacattgtt	0.045													4	2	---	---	---	---	
TMEM177	80775	broad.mit.edu	37	2	120451642	120451645	+	Intron	DEL	ACAC	-	-	rs147833710	byFrequency	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120451642_120451645delACAC	uc002tme.2	+									Q53S58	TM177_HUMAN	Homo sapiens cDNA FLJ32751 fis, clone TESTI2001621.							integral to membrane				ovary(1)	1	Colorectal(110;0.196)					catgcaacatacacacacaacata	0.142													2	6	---	---	---	---	
GLI2	2736	broad.mit.edu	37	2	121526405	121526406	+	Intron	DEL	GC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121526405_121526406delGC	uc010yyu.1	+						GLI2_uc002tmp.1_Intron			P10070	GLI2_HUMAN	SubName: Full=cDNA FLJ60878, highly similar to Homo sapiens GLI-Kruppel family member GLI2, mRNA;						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				gtgtgtgtgtgcgtgtgtgtgC	0.510													8	4	---	---	---	---	
GLI2	2736	broad.mit.edu	37	2	121711889	121711889	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121711889delG	uc010flp.2	+						GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc002tmv.1_Intron|GLI2_uc010flo.1_Intron|GLI2_uc002tmw.1_Intron	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				GGAAGGAGTAGGGGAGGGAAC	0.602													9	4	---	---	---	---	
CLASP1	23332	broad.mit.edu	37	2	122339853	122339854	+	Intron	DEL	GA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122339853_122339854delGA	uc002tnc.2	-						CLASP1_uc010yyy.1_Intron|CLASP1_uc010yyz.1_Intron|CLASP1_uc010yza.1_Intron|CLASP1_uc010yzb.1_Intron|CLASP1_uc010yzc.1_Intron|CLASP1_uc002tng.1_Intron	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1						axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					aCAGgaaagggagagagagaga	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122562016	122562017	+	IGR	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122562016_122562017delTG								TSN (36590 upstream) : None (None downstream)																							TGAGAGTTCCTGTGTGTGTGTG	0.485													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	123452360	123452365	+	IGR	DEL	TCTTCT	-	-	rs71398071		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:123452360_123452365delTCTTCT								TSN (926934 upstream) : None (None downstream)																							ttcctcttcctcttcttcttcttctt	0.131													4	5	---	---	---	---	
CNTNAP5	129684	broad.mit.edu	37	2	125088349	125088350	+	Intron	INS	-	A	A	rs144699625	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125088349_125088350insA	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		agaaatcatgcaaaaaaaaatg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	126577672	126577673	+	IGR	DEL	TA	-	-	rs145157619	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126577672_126577673delTA								CNTNAP5 (904811 upstream) : GYPC (836011 downstream)																							ctttatgtggtatgtgtgtgtg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	128678731	128678732	+	IGR	DEL	TT	-	-	rs76979000		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128678731_128678732delTT								AMMECR1L (35217 upstream) : SAP130 (20059 downstream)																							GGtttttctctttttttttttt	0.074													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129334189	129334190	+	IGR	DEL	TC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129334189_129334190delTC								HS6ST1 (258018 upstream) : None (None downstream)																							ACTGGACTGGTCTCTCTCTCTC	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130057550	130057555	+	IGR	DEL	CTGCCT	-	-	rs72228230		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130057550_130057555delCTGCCT								HS6ST1 (981379 upstream) : LOC389033 (622880 downstream)																							CCATGTACCCCTGCCTCTGCCTATGT	0.646													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130602842	130602843	+	IGR	DEL	GT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130602842_130602843delGT								None (None upstream) : LOC389033 (77592 downstream)																							gtatgtgcacgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130635056	130635056	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130635056delC								None (None upstream) : LOC389033 (45379 downstream)																							TCTACCCCAGCCCTCTCTCCC	0.592													4	2	---	---	---	---	
PLEKHB2	55041	broad.mit.edu	37	2	131940448	131940450	+	Intron	DEL	ATA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131940448_131940450delATA	uc002tsh.2	+									Q96CS7	PKHB2_HUMAN	SubName: Full=Putative uncharacterized protein PLEKHB2;							membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.0828)		atttgaagagatactgaattaag	0.069													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132126722	132126733	+	IGR	DEL	GATGAAAGGTAA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132126722_132126733delGATGAAAGGTAA								LOC150786 (4991 upstream) : LOC401010 (73001 downstream)																							GGGCTATAATGATGAAAGGTAAGATGAAATGG	0.439													4	2	---	---	---	---	
C2orf27A	29798	broad.mit.edu	37	2	132483726	132483726	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132483726delA	uc002ttf.1	+							NM_013310	NP_037442	Q580R0	CB027_HUMAN	hypothetical protein LOC29798												0						TTGAAAAGAGAAACCAAGCTA	0.343													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133024323	133024324	+	IGR	DEL	AT	-	-	rs138928865		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133024323_133024324delAT								NCRNA00164 (8781 upstream) : GPR39 (149823 downstream)																							agagagagagatagacagacag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133031286	133031286	+	IGR	DEL	C	-	-	rs149913786		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133031286delC								NCRNA00164 (15744 upstream) : GPR39 (142861 downstream)																							agggttgcaacaaaatgatga	0.090													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133096618	133096619	+	IGR	INS	-	AC	AC	rs143620722	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133096618_133096619insAC								NCRNA00164 (81076 upstream) : GPR39 (77528 downstream)																							ATACAATTTTTacacacacaca	0.064													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133110298	133110298	+	IGR	DEL	G	-	-	rs146336734		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133110298delG								NCRNA00164 (94756 upstream) : GPR39 (63849 downstream)																							ggcaccACCAGGGGGGCCCTC	0.368													2	4	---	---	---	---	
NCKAP5	344148	broad.mit.edu	37	2	134171173	134171173	+	Intron	DEL	A	-	-	rs113817802		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134171173delA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002ttt.1_Intron|NCKAP5_uc002tts.1_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1								protein binding				0						aaaaccaggtaaaaaaaaaaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134694607	134694608	+	IGR	INS	-	A	A	rs140547090	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134694607_134694608insA								NCKAP5 (368576 upstream) : MGAT5 (317222 downstream)																							caagaagaaggaagcactgttc	0.000													3	6	---	---	---	---	
TMEM163	81615	broad.mit.edu	37	2	135523024	135523024	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135523024delA	uc002tty.2	-									Q8TC26	TM163_HUMAN	Homo sapiens DC29 mRNA, complete cds.							integral to membrane					0				BRCA - Breast invasive adenocarcinoma(221;0.154)		actctgtctgaaaaaaaaaaa	0.005													4	2	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	142402298	142402299	+	Intron	INS	-	CA	CA	rs3039268		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142402298_142402299insCA	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAGTCATTGATcacacacacac	0.248										TSP Lung(27;0.18)			4	2	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	142469521	142469522	+	Intron	INS	-	AC	AC	rs146715225	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142469521_142469522insAC	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		Aacacacacagacacacacaca	0.327										TSP Lung(27;0.18)			5	3	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	142560786	142560786	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142560786delT	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCAATCGACCTTTTTTTTTTT	0.438										TSP Lung(27;0.18)			5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	146395555	146395556	+	IGR	DEL	GT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:146395555_146395556delGT								None (None upstream) : PABPC1P2 (949069 downstream)																							gcacgcatgcgtgtgtgtgtgt	0.248													4	2	---	---	---	---	
LYPD6	130574	broad.mit.edu	37	2	150318651	150318652	+	Intron	INS	-	A	A	rs149120833	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150318651_150318652insA	uc002twy.2	+						LYPD6_uc010fnt.2_Intron|LYPD6_uc002twz.2_Intron|LYPD6_uc002txa.2_Intron	NM_194317	NP_919298	Q86Y78	LYPD6_HUMAN	LY6/PLAUR domain containing 6 precursor							extracellular region					0				BRCA - Breast invasive adenocarcinoma(221;0.0667)		tttctatgtagaaaattccaac	0.000													4	2	---	---	---	---	
KCNH7	90134	broad.mit.edu	37	2	163624975	163624976	+	Intron	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163624975_163624976insA	uc002uch.1	-						KCNH7_uc002uci.2_Intron|uc002ucj.1_5'Flank	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	AATTCAACACCAACTCTGGAAT	0.401													4	2	---	---	---	---	
LASS6	253782	broad.mit.edu	37	2	169516207	169516208	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169516207_169516208insT	uc002ueb.1	+						LASS6_uc002uec.1_Intron	NM_203463	NP_982288	Q6ZMG9	CERS6_HUMAN	longevity assurance homolog 6							endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			skin(1)	1						ttttgtttttgtttttttttta	0.069													4	2	---	---	---	---	
UBR3	130507	broad.mit.edu	37	2	170849490	170849491	+	Intron	INS	-	G	G	rs79863052		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170849490_170849491insG	uc010zdi.1	+						UBR3_uc002ufr.3_Intron|UBR3_uc010fqa.2_Intron|UBR3_uc002uft.3_Intron	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3						sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						aggccggtcttgaacttctggc	0.000													3	4	---	---	---	---	
PDK1	5163	broad.mit.edu	37	2	173488497	173488498	+	Intron	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173488497_173488498insA	uc010zea.1	+							NM_002610		Q15118	PDK1_HUMAN	pyruvate dehydrogenase kinase 1 precursor						glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|small GTPase mediated signal transduction	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			lung(3)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.12)			ATACAGATATGAAAAAAAAATG	0.371									Autosomal_Dominant_Polycystic_Kidney_Disease				4	2	---	---	---	---	
ZAK	51776	broad.mit.edu	37	2	174089705	174089706	+	Intron	INS	-	AGA	AGA	rs144208446	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174089705_174089706insAGA	uc002uhz.2	+						ZAK_uc002uhy.2_3'UTR|ZAK_uc010zei.1_3'UTR|uc002uib.2_Intron	NM_016653	NP_057737	Q9NYL2	MLTK_HUMAN	MLK-related kinase isoform 1						activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)			TGTACATTTAGAGGTTAAAAGA	0.312													4	4	---	---	---	---	
CHN1	1123	broad.mit.edu	37	2	175790734	175790735	+	Intron	INS	-	TA	TA			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175790734_175790735insTA	uc002uji.2	-						CHN1_uc010zeq.1_Intron|CHN1_uc002ujj.2_Intron	NM_001822	NP_001813	P15882	CHIN_HUMAN	chimerin (chimaerin) 1 isoform a						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.226)			TGCATAAATGTTATATGCTATT	0.158			T	TAF15	extraskeletal myxoid chondrosarcoma								1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	177314344	177314344	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177314344delC								MTX2 (111593 upstream) : MIR1246 (151364 downstream)																							agggaggacaccataaatgca	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	177345088	177345088	+	IGR	DEL	G	-	-	rs11404086		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177345088delG								MTX2 (142337 upstream) : MIR1246 (120620 downstream)																							ttttttttttgtttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	177896831	177896832	+	IGR	INS	-	TC	TC	rs149778811	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177896831_177896832insTC								MIR1246 (431051 upstream) : HNRNPA3 (180590 downstream)																							ATGTGGAAATGTTCAGGAAGAG	0.376													0	9	---	---	---	---	
AGPS	8540	broad.mit.edu	37	2	178317504	178317504	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178317504delT	uc002ull.2	+						AGPS_uc010zfb.1_Intron	NM_003659	NP_003650	O00116	ADAS_HUMAN	alkyldihydroxyacetone phosphate synthase						ether lipid biosynthetic process	peroxisomal matrix|peroxisomal membrane|plasma membrane	alkylglycerone-phosphate synthase activity|flavin adenine dinucleotide binding|oxidoreductase activity			ovary(2)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			ctttttgggatttttttttaa	0.000													4	2	---	---	---	---	
AGPS	8540	broad.mit.edu	37	2	178317998	178317998	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178317998delT	uc002ull.2	+						AGPS_uc010zfb.1_Intron	NM_003659	NP_003650	O00116	ADAS_HUMAN	alkyldihydroxyacetone phosphate synthase						ether lipid biosynthetic process	peroxisomal matrix|peroxisomal membrane|plasma membrane	alkylglycerone-phosphate synthase activity|flavin adenine dinucleotide binding|oxidoreductase activity			ovary(2)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			ctctggctacttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	178471580	178471581	+	IGR	DEL	TT	-	-	rs71821195		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178471580_178471581delTT								TTC30B (54056 upstream) : TTC30A (7446 downstream)																							TTTTGCTTCGTTTTTTGTAGGC	0.431													2	5	---	---	---	---	
OSBPL6	114880	broad.mit.edu	37	2	179148113	179148113	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179148113delA	uc002ulx.2	+						OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Intron|OSBPL6_uc010zfe.1_Intron|OSBPL6_uc002ulz.2_5'Flank	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform						lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			CTCAATAAGTAAAAAAAAAAA	0.348													4	3	---	---	---	---	
PLEKHA3	65977	broad.mit.edu	37	2	179364229	179364230	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179364229_179364230insT	uc002umn.2	+							NM_019091	NP_061964	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A							cytoplasm|membrane				ovary(1)|kidney(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			GCCATTTTACCTTTTTTAGATG	0.109													4	2	---	---	---	---	
PPP1R1C	151242	broad.mit.edu	37	2	182858753	182858755	+	Intron	DEL	AAG	-	-	rs10593877		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182858753_182858755delAAG	uc002uoo.2	+						PPP1R1C_uc002uon.2_Intron|PPP1R1C_uc002uop.1_Intron|PPP1R1C_uc010frm.1_Intron|PPP1R1C_uc010frn.1_Intron	NM_001080545	NP_001074014	Q8WVI7	PPR1C_HUMAN	protein phosphatase 1, regulatory (inhibitor)						signal transduction	cytoplasm	protein phosphatase inhibitor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0628)			AGAAAAAAAAAAGATCTATAGTA	0.345													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	183424791	183424792	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183424791_183424792insT								PDE1A (37284 upstream) : DNAJC10 (156207 downstream)																							GATAGGGATTCttttttttttt	0.163													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	183463290	183463290	+	IGR	DEL	A	-	-	rs75507815		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183463290delA								PDE1A (75783 upstream) : DNAJC10 (117709 downstream)																							actctgtctcaaaaaaaaaaa	0.179													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	184199262	184199262	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184199262delT								NUP35 (172855 upstream) : None (None downstream)																							acaggatatcttttttttttt	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	186424519	186424520	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186424519_186424520insA								ZNF804A (620307 upstream) : ZC3H15 (926365 downstream)																							TTAATGTGCTGAAAAAAAAAGA	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	196407569	196407569	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196407569delT								None (None upstream) : SLC39A10 (113963 downstream)																							tatttctctcttcttgctagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	198237139	198237140	+	IGR	INS	-	T	T	rs139794375	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198237139_198237140insT								ANKRD44 (61644 upstream) : SF3B1 (19560 downstream)																							CTTTTCTTTCCTTTTAATGGCA	0.297													6	5	---	---	---	---	
C2orf80	389073	broad.mit.edu	37	2	209036457	209036458	+	Intron	INS	-	CCACTCCAT	CCACTCCAT	rs149518601	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209036457_209036458insCCACTCCAT	uc002vcr.2	-							NM_001099334	NP_001092804	Q0P641	CB080_HUMAN	hypothetical protein LOC389073											skin(1)	1						accagtgtgagccaGCCCACTC	0.218													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	209064075	209064078	+	IGR	DEL	CCTT	-	-	rs12328626		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209064075_209064078delCCTT								C2orf80 (9302 upstream) : IDH1 (36876 downstream)																							ttccttcctcccttccttccttcc	0.064													6	5	---	---	---	---	
PTH2R	5746	broad.mit.edu	37	2	209477903	209477904	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209477903_209477904insT	uc010fuo.1	+									P49190	PTH2R_HUMAN	Homo sapiens cDNA FLJ60238 complete cds, highly similar to Parathyroid hormone receptor precursor.							integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		ttttttctttcttttttttttg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	212113860	212113862	+	IGR	DEL	TTT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212113860_212113862delTTT								CPS1 (570031 upstream) : ERBB4 (126580 downstream)																							GGCTAGAttcttttttttttttt	0.187													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	217474994	217474994	+	IGR	DEL	T	-	-	rs71401155		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217474994delT								RPL37A (108808 upstream) : IGFBP2 (23133 downstream)																							tctttctttcttttttttttt	0.368													7	4	---	---	---	---	
DIS3L2	129563	broad.mit.edu	37	2	233173933	233173934	+	Intron	INS	-	C	C	rs141494978	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233173933_233173934insC	uc010fxz.2	+						DIS3L2_uc002vsm.3_Intron|DIS3L2_uc002vso.2_Intron	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN	DIS3 mitotic control homolog (S.								exonuclease activity|ribonuclease activity|RNA binding			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		ccctttgcccactaggtagtga	0.020													4	2	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241719196	241719196	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241719196delC	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		TCCCACACTTCCCCACACTGG	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	1687408	1687409	+	IGR	DEL	GT	-	-	rs72072047		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1687408_1687409delGT								CNTN6 (242131 upstream) : CNTN4 (453141 downstream)																							CAAGTGGAGGgtgtgtgtgtgt	0.238													4	2	---	---	---	---	
CRBN	51185	broad.mit.edu	37	3	3207849	3207850	+	Intron	DEL	AT	-	-	rs61404872		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3207849_3207850delAT	uc003bpq.2	-						CRBN_uc003bpr.2_Intron|CRBN_uc010hbw.2_Intron|CRBN_uc011aso.1_Intron	NM_016302	NP_057386	Q96SW2	CRBN_HUMAN	cereblon						proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	Cul4A-RING ubiquitin ligase complex|cytoplasm|membrane|nucleus	ATP-dependent peptidase activity|protein binding			ovary(1)	1				Epithelial(13;0.00244)|OV - Ovarian serous cystadenocarcinoma(96;0.00617)|all cancers(10;0.0079)		caattcccacatgtcatgggag	0.084													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	8909840	8909841	+	IGR	DEL	CA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8909840_8909841delCA								OXTR (98540 upstream) : RAD18 (11720 downstream)																							cttacagattcacacacacaga	0.104													3	3	---	---	---	---	
ATG7	10533	broad.mit.edu	37	3	11540732	11540736	+	Intron	DEL	CTATC	-	-	rs146034852		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11540732_11540736delCTATC	uc003bwc.2	+						ATG7_uc003bwd.2_Intron|ATG7_uc011aum.1_Intron	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a						autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						ccacattcctctatcctttcctgtt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	21433661	21433661	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21433661delT								None (None upstream) : VENTXP7 (13557 downstream)																							GAGAAGTCTGTTACACAGGTC	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	24852042	24852042	+	IGR	DEL	T	-	-	rs78070219		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24852042delT								THRB (315589 upstream) : RARB (363781 downstream)																							CCAGGTGGAGTTTCCCTGCCT	0.378													2	4	---	---	---	---	
RBMS3	27303	broad.mit.edu	37	3	29842496	29842497	+	Intron	INS	-	CA	CA	rs145346426	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29842496_29842497insCA	uc003cel.2	+						RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Intron|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793	Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)				acacacgcatgcacacacacac	0.356													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	30376153	30376154	+	IGR	INS	-	AG	AG	rs142409660	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30376153_30376154insAG								RBMS3 (329534 upstream) : TGFBR2 (271840 downstream)																							ctagaagatttagagtgcgagg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	30554776	30554776	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30554776delA								RBMS3 (508157 upstream) : TGFBR2 (93218 downstream)																							tgctttctgtagggaaagttg	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	35530029	35530030	+	IGR	INS	-	A	A	rs78404557		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35530029_35530030insA								None (None upstream) : ARPP21 (151051 downstream)																							aagaaaacggcaaaaaaaaaaa	0.213													4	4	---	---	---	---	
DNAH12	201625	broad.mit.edu	37	3	57400859	57400872	+	Intron	DEL	TGTGTGTGTGTGAG	-	-	rs72509751		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57400859_57400872delTGTGTGTGTGTGAG	uc003dit.2	-							NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						tgtgtgtgtttgtgtgtgtgtgagtgtgtgtgtg	0.369													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	64072901	64072902	+	IGR	DEL	AA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64072901_64072902delAA								PSMD6 (63243 upstream) : PRICKLE2 (6625 downstream)																							GGTGAGAGAGAATTTTTAAATG	0.406													4	2	---	---	---	---	
FAM19A4	151647	broad.mit.edu	37	3	68867925	68867925	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68867925delC	uc003dnh.1	-						FAM19A4_uc003dni.1_Intron	NM_182522	NP_872328	Q96LR4	F19A4_HUMAN	family with sequence similarity 19 (chemokine							extracellular region				skin(2)	2		Lung NSC(201;0.0198)		BRCA - Breast invasive adenocarcinoma(55;1.38e-05)|Epithelial(33;0.000124)|LUSC - Lung squamous cell carcinoma(21;0.0248)|KIRC - Kidney renal clear cell carcinoma(39;0.0729)|Kidney(39;0.0904)		gcatggtgtaccccaaaacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	73690387	73690387	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73690387delT								PDZRN3 (16315 upstream) : CNTN3 (621335 downstream)																							gtagatactgttactctcatt	0.129													4	2	---	---	---	---	
CNTN3	5067	broad.mit.edu	37	3	74491298	74491299	+	Intron	DEL	AC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74491298_74491299delAC	uc003dpm.1	-							NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor						cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		GCATGCAAGTacacacacacac	0.317													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	76252300	76252300	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:76252300delA								ZNF717 (417630 upstream) : ROBO2 (836994 downstream)																							TATGTCTTTCAAATccccccc	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	90474134	90474134	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90474134delC								EPHA3 (942852 upstream) : None (None downstream)																							tccttttccaccacaggcctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	95552470	95552471	+	IGR	INS	-	T	T	rs11385886		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95552470_95552471insT								LOC255025 (657391 upstream) : EPHA6 (980954 downstream)																							TTTTGCAACAATTTTTTTTTTC	0.342													4	2	---	---	---	---	
EPHA6	285220	broad.mit.edu	37	3	97306084	97306085	+	Intron	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97306084_97306085insA	uc010how.1	+						EPHA6_uc011bgo.1_Intron|EPHA6_uc011bgp.1_Intron|EPHA6_uc003drs.3_Intron|EPHA6_uc003drr.3_Intron|EPHA6_uc003drt.2_Intron|EPHA6_uc010hox.1_Intron	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						gactccgtctcaaaaaaaaaaa	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	99094886	99094887	+	IGR	INS	-	AC	AC	rs138335377	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99094886_99094887insAC								DCBLD2 (474353 upstream) : COL8A1 (262567 downstream)																							catacacacagacacacacaca	0.262													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	108508249	108508250	+	IGR	DEL	TC	-	-	rs147545470	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108508249_108508250delTC								RETNLB (32119 upstream) : TRAT1 (33381 downstream)																							tgtgtgtgtgtctctctctctc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	110472923	110472923	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110472923delA								None (None upstream) : PVRL3 (317942 downstream)																							AATTGTCAAGAAAAAAAAAAG	0.323													4	2	---	---	---	---	
STXBP5L	9515	broad.mit.edu	37	3	121051711	121051711	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121051711delA	uc003eec.3	+						STXBP5L_uc011bji.1_Intron	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like						exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		taagaacgtgaaaaaaaaaag	0.000													2	4	---	---	---	---	
CD86	942	broad.mit.edu	37	3	121783091	121783091	+	Intron	DEL	A	-	-	rs62787161		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121783091delA	uc003eet.2	+						CD86_uc011bjo.1_Intron|CD86_uc011bjp.1_Intron	NM_175862	NP_787058	P42081	CD86_HUMAN	CD86 antigen isoform 1						interspecies interaction between organisms|positive regulation of cell proliferation|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of lymphotoxin A biosynthetic process|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation		coreceptor activity|protein binding			pancreas(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)	CACCAAGAGGAAAAAAAAAAA	0.403													6	4	---	---	---	---	
ADCY5	111	broad.mit.edu	37	3	123128973	123128973	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123128973delC	uc003egh.1	-						ADCY5_uc003egg.1_Intron	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5						activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		CAGTGAGAGGCCCCCATCTGC	0.602													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	134404429	134404429	+	IGR	DEL	A	-	-	rs35224201		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134404429delA								KY (33951 upstream) : EPHB1 (109831 downstream)																							TGGTTTGGGGACAGAAGAGCT	0.453													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	135087412	135087412	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135087412delA								EPHB1 (108107 upstream) : PPP2R3A (597155 downstream)																							ATTGTCTTTTAAAGGACTTGA	0.468													4	2	---	---	---	---	
PCCB	5096	broad.mit.edu	37	3	136011078	136011079	+	Intron	INS	-	T	T	rs11385401		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136011078_136011079insT	uc003eqy.1	+						PCCB_uc003eqz.1_Intron|PCCB_uc011bmc.1_Intron|PCCB_uc011bmd.1_Intron	NM_000532	NP_000523	P05166	PCCB_HUMAN	propionyl Coenzyme A carboxylase, beta						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|propionyl-CoA carboxylase activity				0					Biotin(DB00121)|L-Valine(DB00161)	TGTGTCTCTAGTTTTTTTTTtt	0.109													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	136888826	136888827	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136888826_136888827insT								IL20RB (158906 upstream) : SOX14 (594752 downstream)																							cttttgctctatttttttgaga	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137418837	137418838	+	IGR	DEL	AC	-	-	rs144949551		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137418837_137418838delAC								IL20RB (688917 upstream) : SOX14 (64741 downstream)																							ATCCCTATCTacacacacacac	0.144													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	141486246	141486246	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141486246delT								RNF7 (21004 upstream) : GRK7 (10797 downstream)																							ttgttttttgttttttttttt	0.149													3	3	---	---	---	---	
SR140	23350	broad.mit.edu	37	3	142774049	142774049	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142774049delT	uc003evh.1	+						SR140_uc003evi.1_Intron|SR140_uc003evj.1_Intron|SR140_uc003evk.1_Intron	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein						RNA processing	nucleus	nucleotide binding|RNA binding				0						TTGGCATACATTTTTTTTTTT	0.318													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	146122743	146122743	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146122743delT								PLSCR4 (153777 upstream) : PLSCR2 (28339 downstream)																							ggtggggatgtttgaccctta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	147757376	147757377	+	IGR	DEL	AG	-	-	rs143133003		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147757376_147757377delAG								ZIC1 (622872 upstream) : AGTR1 (658281 downstream)																							CCTGCTCTTCAGAGAAAGTATT	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	148049213	148049213	+	IGR	DEL	A	-	-	rs55677399		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148049213delA								ZIC1 (914709 upstream) : AGTR1 (366445 downstream)																							GAAGTTTTTTAAAAAAAAAAA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	148273703	148273706	+	IGR	DEL	TGTG	-	-	rs149867550		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148273703_148273706delTGTG								None (None upstream) : AGTR1 (141952 downstream)																							AGCCTTGCTCtgtgtgtgtgtgtg	0.240													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	150213137	150213138	+	IGR	INS	-	TT	TT	rs143096654	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150213137_150213138insTT								TSC22D2 (35524 upstream) : SERP1 (46643 downstream)																							TCTGTGTCTGCTttgttcttcc	0.337													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	150259467	150259470	+	IGR	DEL	TAAG	-	-	rs148602927		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150259467_150259470delTAAG								TSC22D2 (81854 upstream) : SERP1 (311 downstream)																							ACTGTGGTACTAAGTAAGTTTAGA	0.358													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	154711028	154711028	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154711028delA								GPR149 (563524 upstream) : MME (30885 downstream)																							tctcaccaggaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	154939767	154939767	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154939767delG								MME (38249 upstream) : PLCH1 (257904 downstream)																							acttgattgtggtggataagc	0.000													3	4	---	---	---	---	
PLCH1	23007	broad.mit.edu	37	3	155335262	155335263	+	Intron	INS	-	AG	AG	rs141935392	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155335262_155335263insAG	uc011bok.1	-						PLCH1_uc011boj.1_Intron|PLCH1_uc011bol.1_Intron	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			tttggtttttcagtcaagaaaa	0.000													2	4	---	---	---	---	
VEPH1	79674	broad.mit.edu	37	3	157196471	157196471	+	Intron	DEL	C	-	-	rs5853786		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157196471delC	uc003fbj.1	-						VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron|VEPH1_uc003fbm.2_Intron|VEPH1_uc003fbn.2_Intron	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1							plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			GTGTCAGTGACATTGTTGAAC	0.363													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161351653	161351653	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161351653delA								OTOL1 (129925 upstream) : None (None downstream)																							agggaaaaataaataactcgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	162129698	162129701	+	IGR	DEL	TAAC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162129698_162129701delTAAC								OTOL1 (907970 upstream) : None (None downstream)																							AAACACTTCTTAACTAATAAGCTA	0.152													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	163220921	163220922	+	IGR	DEL	AC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163220921_163220922delAC								None (None upstream) : MIR1263 (668337 downstream)																							acacatacgtacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	165232463	165232463	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165232463delC	uc003fel.2	-											full-length cDNA clone CS0DA002YJ24 of Neuroblastoma of Homo sapiens (human).																		ctttctctttcccttcctccc	0.000													4	2	---	---	---	---	
ZBBX	79740	broad.mit.edu	37	3	167037791	167037792	+	Intron	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167037791_167037792delTG	uc003fep.2	-						ZBBX_uc011bpc.1_Intron|ZBBX_uc003feq.2_Intron	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing							intracellular	zinc ion binding			ovary(2)	2						tatgtggatttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
WDR49	151790	broad.mit.edu	37	3	167290268	167290268	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167290268delA	uc003fev.1	-						WDR49_uc003feu.1_Intron|WDR49_uc011bpd.1_Intron|WDR49_uc003few.1_Intron	NM_178824	NP_849146	Q8IV35	WDR49_HUMAN	WD repeat domain 49											large_intestine(1)|ovary(1)|skin(1)	3						AAGCAAAGGGAAAATGTTCAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	167923638	167923638	+	IGR	DEL	T	-	-	rs112301721		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167923638delT								GOLIM4 (110221 upstream) : MIR551B (346004 downstream)																							cacttcgtgattttttttttt	0.000													4	2	---	---	---	---	
SKIL	6498	broad.mit.edu	37	3	170101825	170101826	+	Intron	INS	-	A	A	rs112613264		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170101825_170101826insA	uc003fgu.2	+						SKIL_uc011bps.1_Intron|SKIL_uc003fgv.2_Intron|SKIL_uc003fgw.2_Intron	NM_005414	NP_005405	P12757	SKIL_HUMAN	SKI-like isoform 1						cell cycle arrest|negative regulation of cell differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of axonogenesis|protein heterotrimerization|protein homotrimerization|regulation of apoptosis|regulation of apoptosis|response to antibiotic|response to growth factor stimulus|skeletal muscle tissue development	cytoplasm|PML body	chromatin binding|nucleotide binding|protein complex binding|protein domain specific binding|SMAD binding|transcription corepressor activity|transcription repressor activity			ovary(2)|skin(1)	3	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			AATTACTTGCCAAAAAAAAAAA	0.238													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	170635085	170635086	+	IGR	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170635085_170635086delTG								EIF5A2 (8659 upstream) : SLC2A2 (79051 downstream)																							ctgctaattttgtgtgtgtgtg	0.000													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	176947194	176947195	+	IGR	INS	-	T	T	rs140717766	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176947194_176947195insT								TBL1XR1 (32146 upstream) : None (None downstream)																							TTAACACATTCTTTCCTTCCGA	0.252													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	181659740	181659740	+	IGR	DEL	A	-	-	rs4855061	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181659740delA								SOX2OT (200737 upstream) : ATP11B (851551 downstream)																							CTTTGAGGTGAAAAAAAAAAA	0.338													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	181781256	181781257	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181781256_181781257insA								SOX2OT (322253 upstream) : ATP11B (730034 downstream)																							CTAAGTATTGCAAAAAAAAAAA	0.218													4	2	---	---	---	---	
EIF2B5	8893	broad.mit.edu	37	3	183850346	183850346	+	5'Flank	DEL	A	-	-	rs80261846		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183850346delA	uc003fmp.2	+						EIF2B5_uc010hxs.2_5'Flank|EIF2B5_uc003fmq.2_5'Flank	NM_003907	NP_003898	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B,						astrocyte development|myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|positive regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus|RNA metabolic process	cytosol|eukaryotic translation initiation factor 2B complex|nucleus	guanyl-nucleotide exchange factor activity|transferase activity|translation initiation factor activity|translation initiation factor binding			ovary(5)	5	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			tctcaaaaagaaaaaaaaaaa	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184335365	184335367	+	IGR	DEL	AAG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184335365_184335367delAAG								EPHB3 (35170 upstream) : MAGEF1 (92789 downstream)																							tgagaaaagaaagaagaagaggg	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184351414	184351419	+	IGR	DEL	TGTGTG	-	-	rs71950851		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184351414_184351419delTGTGTG								EPHB3 (51219 upstream) : MAGEF1 (76737 downstream)																							tgtgtgcatatgtgtgtgtgtgtgtg	0.447													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	185740811	185740812	+	IGR	DEL	GG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185740811_185740812delGG								TRA2B (84887 upstream) : ETV5 (23296 downstream)																							ctactgccctgggttagaggca	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186198311	186198312	+	Intron	INS	-	A	A	rs140770247		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186198311_186198312insA	uc003fqd.1	-											Homo sapiens cDNA FLJ32735 fis, clone TESTI2001229.																		agacagtgtctaaaaaaaaaaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186204359	186204360	+	Intron	INS	-	G	G	rs111354223		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186204359_186204360insG	uc003fqd.1	-											Homo sapiens cDNA FLJ32735 fis, clone TESTI2001229.																		gaaggaaggaaggacagactac	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186212456	186212457	+	5'Flank	DEL	AG	-	-	rs4012487		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186212456_186212457delAG	uc003fqd.1	-											Homo sapiens cDNA FLJ32735 fis, clone TESTI2001229.																		aaaaaaaaaaagaaTGTATCAT	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	187128961	187128961	+	IGR	DEL	A	-	-	rs63236963		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187128961delA								RTP4 (39594 upstream) : SST (257735 downstream)																							actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188483085	188483086	+	Intron	INS	-	AC	AC	rs148010488	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188483085_188483086insAC	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		TGTCTcacacaacacacacaca	0.322			T	HMGA2|MLL|C12orf9	lipoma|leukemia								6	3	---	---	---	---	
TPRG1	285386	broad.mit.edu	37	3	188890973	188890974	+	Intron	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188890973_188890974delTG	uc003frv.1	+						TPRG1_uc003frw.1_Intron	NM_198485	NP_940887	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		ATGTTTCCTCtgtgtgtgtgtg	0.272													4	2	---	---	---	---	
LEPREL1	55214	broad.mit.edu	37	3	189697057	189697058	+	Intron	INS	-	A	A	rs144573288	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189697057_189697058insA	uc011bsk.1	-						LEPREL1_uc003fsg.2_Intron	NM_018192	NP_060662	Q8IVL5	P3H2_HUMAN	leprecan-like 1 isoform a						collagen metabolic process|negative regulation of cell proliferation|peptidyl-proline hydroxylation	basement membrane|endoplasmic reticulum|Golgi apparatus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			breast(3)|ovary(1)	4	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	tactaaaacacaaaaaaaaaat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	190533792	190533792	+	IGR	DEL	A	-	-	rs11344607		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190533792delA								IL1RAP (157949 upstream) : LOC647309 (36734 downstream)																							gctttgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TM4SF19	116211	broad.mit.edu	37	3	196053261	196053268	+	Intron	DEL	GTGTGTGT	-	-	rs138694105		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196053261_196053268delGTGTGTGT	uc003fwl.1	-						TM4SF19_uc003fwj.2_Intron|TM4SF19_uc010iad.1_Intron|TM4SF19_uc011btv.1_Intron	NM_138461	NP_612470	Q96DZ7	T4S19_HUMAN	transmembrane 4 L six family member 19							integral to membrane					0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		CTGAGAACGAgtgtgtgtgtgtgtgtgt	0.332													4	4	---	---	---	---	
ZNF718	255403	broad.mit.edu	37	4	152684	152684	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152684delT	uc003fzt.3	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc010iaz.2_Intron|ZNF718_uc003fzw.3_Intron	NM_001039127	NP_001034216	Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		ttctttagccttttttttttt	0.095													4	2	---	---	---	---	
LRPAP1	4043	broad.mit.edu	37	4	3537000	3537025	+	5'Flank	DEL	TATAGATTGTTATTCTCTCCAGGCAA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3537000_3537025delTATAGATTGTTATTCTCTCCAGGCAA	uc003ghi.2	-							NM_002337	NP_002328	P30533	AMRP_HUMAN	low density lipoprotein receptor-related protein						negative regulation of protein binding|negative regulation of very-low-density lipoprotein particle clearance|protein folding|vesicle-mediated transport	cell surface|integral to membrane|plasma membrane	asialoglycoprotein receptor activity|heparin binding|low-density lipoprotein particle receptor binding|receptor antagonist activity|unfolded protein binding|very-low-density lipoprotein particle receptor binding			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.165)		GAGTTTGGACTATAGATTGTTATTCTCTCCAGGCAAAGGCAGGAAG	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3583719	3583725	+	Intron	DEL	GGAAGGA	-	-	rs66844729		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3583719_3583725delGGAAGGA	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																		AAAGGGGGCTGGAAGGAGGGGCGGGCG	0.589													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3606059	3606062	+	IGR	DEL	CATT	-	-	rs74571371		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3606059_3606062delCATT								LRPAP1 (71835 upstream) : ADRA2C (162013 downstream)																							ttcatttacccattcattcattca	0.422													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3607372	3607373	+	IGR	DEL	CC	-	-	rs36097846		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3607372_3607373delCC								LRPAP1 (73148 upstream) : ADRA2C (160702 downstream)																							GGCTCCACGTCCCCCTGCCTGA	0.683													4	2	---	---	---	---	
PPP2R2C	5522	broad.mit.edu	37	4	6433874	6433874	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6433874delC	uc003gjc.2	-						PPP2R2C_uc011bwd.1_Intron|PPP2R2C_uc011bwe.1_Intron	NM_020416	NP_065149	Q9Y2T4	2ABG_HUMAN	gamma isoform of regulatory subunit B55, protein						signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						TTGATGAGCGCCTCTCTGGCT	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	10187123	10187123	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10187123delC								WDR1 (68550 upstream) : ZNF518B (254382 downstream)																							CCTGTATTCTCCCCTTGATGT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	13108184	13108185	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13108184_13108185insT								None (None upstream) : HSP90AB2P (226852 downstream)																							gcacaaatatattttttccatc	0.005													4	2	---	---	---	---	
CLRN2	645104	broad.mit.edu	37	4	17524837	17524837	+	Intron	DEL	T	-	-	rs113987711		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17524837delT	uc003gpg.1	+							NM_001079827	NP_001073296	A0PK11	CLRN2_HUMAN	clarin 2							integral to membrane					0						tttctttttcttttttttttt	0.214													4	2	---	---	---	---	
PI4K2B	55300	broad.mit.edu	37	4	25179343	25179344	+	Intron	INS	-	CACA	CACA	rs142288246	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25179343_25179344insCACA	uc011bxs.1	+						uc003grj.2_Intron	NM_018323	NP_060793	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta							cytoplasm|membrane	1-phosphatidylinositol 4-kinase activity|ATP binding			ovary(2)|skin(2)	4		Breast(46;0.173)				gcacagagctgcacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	47439070	47439070	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47439070delA								GABRB1 (10625 upstream) : COMMD8 (13745 downstream)																							CACCTCACCTAAAACTTCATT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49239290	49239290	+	5'Flank	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49239290delA	uc003gyy.2	-											DQ587539																		gccagaaattaaaaaagtgct	0.055													11	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49261389	49261389	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49261389delA								CWH43 (197296 upstream) : None (None downstream)																							attttgtctcaaaaaaaaaaa	0.000													9	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49635654	49635658	+	IGR	DEL	AAAAG	-	-	rs141646049		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49635654_49635658delAAAAG								CWH43 (571561 upstream) : None (None downstream)																							ggaatggaataaaagggaatggaat	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53565316	53565317	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53565316_53565317insA								USP46 (39814 upstream) : KIAA0114 (13304 downstream)																							AGATATAGCTGAAAAAAAAAAT	0.312													4	2	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54464403	54464403	+	Intron	DEL	T	-	-	rs34653341		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54464403delT	uc003haa.2	+						LNX1_uc003hah.3_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	ctgactgtgattttttttttt	0.000			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			3	3	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54923254	54923254	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54923254delT	uc003haa.2	+						CHIC2_uc003haj.1_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	AATTAAAAAATAAACAGACCA	0.378			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	56193382	56193383	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56193382_56193383insT								KDR (201620 upstream) : SRD5A3 (19026 downstream)																							gtatgaagttgttttttttttg	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57825862	57825862	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57825862delT								REST (27523 upstream) : C4orf14 (3655 downstream)																							ctaaattaaattttttttttt	0.000													3	3	---	---	---	---	
UGT2B15	7366	broad.mit.edu	37	4	69519661	69519661	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69519661delC	uc011cal.1	-							NM_001076	NP_001067	P54855	UDB15_HUMAN	UDP glycosyltransferase 2B15 precursor						steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity				0						TCAATCCCTTCAAAATTAGTC	0.328													14	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	74148467	74148467	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74148467delA								ANKRD17 (23965 upstream) : ALB (121505 downstream)																							ggaaagacataatgctggctc	0.000													4	2	---	---	---	---	
AFM	173	broad.mit.edu	37	4	74356139	74356139	+	Intron	DEL	G	-	-	rs33912811		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74356139delG	uc003hhb.2	+							NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor						vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAttttgtttgtttgtttgtt	0.144													4	2	---	---	---	---	
CDKL2	8999	broad.mit.edu	37	4	76530540	76530541	+	Intron	INS	-	AC	AC	rs140806852	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76530540_76530541insAC	uc003hiq.2	-						CDKL2_uc011cbp.1_Intron|CDKL2_uc010iix.1_Intron	NM_003948	NP_003939	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2						sex differentiation|signal transduction	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(2)|stomach(2)|breast(2)|skin(1)	7			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			tccatctcaaaacacacacaca	0.114													5	3	---	---	---	---	
ART3	419	broad.mit.edu	37	4	76969979	76969980	+	Intron	INS	-	C	C	rs151126779	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76969979_76969980insC	uc003hjk.2	+						ART3_uc003hji.2_Intron|ART3_uc003hjj.2_Intron	NM_001130017	NP_001123489	Q13508	NAR3_HUMAN	ADP-ribosyltransferase 3 isoform c						protein ADP-ribosylation	anchored to membrane|integral to plasma membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity			ovary(2)	2			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			agtggcccttatgatgcattct	0.000													0	6	---	---	---	---	
FAM13A	10144	broad.mit.edu	37	4	90003737	90003738	+	Intron	INS	-	TCTC	TCTC	rs150021019	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90003737_90003738insTCTC	uc003hsh.1	-									O94988	FA13A_HUMAN	Homo sapiens mRNA for KIAA0914 protein, partial cds.						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						GCATAGTATTTTCTCTCTCTCT	0.218													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	97200768	97200769	+	IGR	INS	-	GG	GG			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97200768_97200769insGG								PDHA2 (438144 upstream) : None (None downstream)																							CATGTGTGTGTTTACATAGGGA	0.366													4	2	---	---	---	---	
TBCK	93627	broad.mit.edu	37	4	107218242	107218242	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107218242delT	uc010ilv.2	-						TBCK_uc003hye.2_Intron|TBCK_uc003hyc.2_Intron|TBCK_uc003hyd.2_Intron|TBCK_uc003hyf.2_Intron	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN	TBC domain-containing protein kinase-like							intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						tctgtaaatctttacctcttc	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	139631637	139631637	+	IGR	DEL	T	-	-	rs112640446		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139631637delT								SLC7A11 (468134 upstream) : CCRN4L (305306 downstream)																							AAAGGTGGGGTTTTGGTACAG	0.318													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	148160637	148160637	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148160637delA								TTC29 (293603 upstream) : MIR548G (105144 downstream)																							ACAAGTGATTAGGTGGTCGGA	0.433													4	2	---	---	---	---	
RPS3A	6189	broad.mit.edu	37	4	152025591	152025592	+	Intron	INS	-	T	T	rs13111229		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152025591_152025592insT	uc003ilz.2	+							NM_001006	NP_000997	P61247	RS3A_HUMAN	ribosomal protein S3a						cell differentiation|endocrine pancreas development|induction of apoptosis|translational elongation|translational initiation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_hematologic(180;0.093)					CAGttttttggttttttttttt	0.401													4	2	---	---	---	---	
GUCY1B3	2983	broad.mit.edu	37	4	156724143	156724143	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156724143delT	uc003ipc.2	+						GUCY1B3_uc011cio.1_Intron|GUCY1B3_uc011cip.1_Intron|GUCY1B3_uc003ipd.2_Intron|GUCY1B3_uc010iqf.2_Intron|GUCY1B3_uc010iqg.2_Intron|GUCY1B3_uc011ciq.1_Intron	NM_000857	NP_000848	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3						blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		CAGATTTGCGTTTAGATAACA	0.313													4	2	---	---	---	---	
GPM6A	2823	broad.mit.edu	37	4	176720440	176720440	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176720440delA	uc003iuf.2	-						GPM6A_uc003iug.2_Intron|GPM6A_uc003iuh.2_Intron|uc003iui.2_Intron	NM_201591	NP_963885	P51674	GPM6A_HUMAN	glycoprotein M6A isoform 2							cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		CTTTTTGGCCAAAAAATACAT	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	182735741	182735742	+	IGR	DEL	GT	-	-	rs67027356		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:182735741_182735742delGT								None (None upstream) : MGC45800 (324417 downstream)																							ttttaaatgcgtgtgtgtgtgt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	186045507	186045507	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186045507delA								HELT (103549 upstream) : SLC25A4 (18891 downstream)																							GCAGTCCTTTAAATTCTGCAC	0.308													4	2	---	---	---	---	
FAT1	2195	broad.mit.edu	37	4	187571612	187571613	+	Intron	DEL	AG	-	-	rs143781804		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187571612_187571613delAG	uc003izf.2	-							NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor						actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						AAGACAGAACAGACTCTTTGAT	0.366										HNSCC(5;0.00058)			2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190669373	190669375	+	IGR	DEL	ACA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190669373_190669375delACA								None (None upstream) : FRG1 (192599 downstream)																							aaagaaatgcacaacatcactaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190821788	190821788	+	Intron	DEL	T	-	-	rs146157445	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190821788delT	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		TCTTTTGGGGTTTTTTTGTTT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190825682	190825683	+	Intron	INS	-	T	T	rs138468383		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190825682_190825683insT	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		AACTACTGTGATATTTTTTAGA	0.347													4	2	---	---	---	---	
FRG1	2483	broad.mit.edu	37	4	190875086	190875086	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190875086delG	uc003izs.2	+							NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1						rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TGACAAATGAGGAAAATATTT	0.294													3	5	---	---	---	---	
TERT	7015	broad.mit.edu	37	5	1273208	1273209	+	Intron	INS	-	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1273208_1273209insC	uc003jcb.1	-						TERT_uc003jbz.1_Intron|TERT_uc003jca.1_Intron|TERT_uc003jcc.1_Intron|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_Intron	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1						anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CACACATCAGACCCCACAACCG	0.500									TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1938165	1938165	+	IGR	DEL	C	-	-	rs5865399		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1938165delC								IRX4 (55285 upstream) : IRX2 (808116 downstream)																							GTCTAGGACTCTACCTGTTAA	0.498													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4222595	4222595	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4222595delT								IRX1 (621079 upstream) : LOC340094 (811877 downstream)																							AGCAGAGAGCTTTTTTTTTTT	0.318													4	2	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5298778	5298780	+	Intron	DEL	TTG	-	-	rs10595383		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5298778_5298780delTTG	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						CATCTCTTTATTGTTGAATGGGC	0.345													4	2	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5305654	5305655	+	Intron	INS	-	AC	AC	rs113675807		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5305654_5305655insAC	uc003jdl.2	+							NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						tcccacaccatacacacacaca	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6830698	6830701	+	5'Flank	DEL	ACAC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6830698_6830701delACAC	hsa-mir-4278|MI0015888	-																													gcacacacagacacacatgcatgc	0.196													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7031768	7031769	+	IGR	DEL	CA	-	-	rs71709155		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7031768_7031769delCA								PAPD7 (274607 upstream) : ADCY2 (364574 downstream)																							cacgcacacgcacacacacaca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8387811	8387811	+	RNA	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8387811delC	uc003jeh.1	-	3		c.180delG								Homo sapiens cDNA clone IMAGE:5297486.																		CTGCCTCCCACCAGGATGTAG	0.478													5	5	---	---	---	---	
SEMA5A	9037	broad.mit.edu	37	5	9382055	9382056	+	Intron	DEL	TG	-	-	rs71968009		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9382055_9382056delTG	uc003jek.2	-							NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor						cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						AGAATCATTTtgtgtgtgtgtg	0.238													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10180076	10180076	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10180076delA								LOC285692 (276140 upstream) : FAM173B (46362 downstream)																							aaatggaaagaaaaaaaaaaa	0.000													4	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10641914	10641914	+	IGR	DEL	A	-	-	rs112089497		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10641914delA								ROPN1L (176777 upstream) : DAP (37429 downstream)																							TCTTGGAAATAAAAAAAAAAA	0.279													3	3	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11332388	11332388	+	Intron	DEL	A	-	-	rs5865932		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11332388delA	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						actccgtctcaaaaaaaaaaa	0.239													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	12513735	12513735	+	IGR	DEL	T	-	-	rs112538917		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12513735delT								CTNND2 (609625 upstream) : None (None downstream)																							aaagaggctcttttttttttt	0.144													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	12887073	12887073	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12887073delT								CTNND2 (982963 upstream) : DNAH5 (803364 downstream)																							tcagccttcctttttttttca	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	13136259	13136259	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13136259delA								None (None upstream) : DNAH5 (554178 downstream)																							gaatgcctttaagcagttttc	0.000													4	2	---	---	---	---	
DNAH5	1767	broad.mit.edu	37	5	13738196	13738197	+	Intron	INS	-	A	A	rs71600022		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13738196_13738197insA	uc003jfd.2	-						DNAH5_uc003jfc.2_Intron	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					aataaaatgttaaaaaaaaaAA	0.188									Kartagener_syndrome				3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	14082298	14082299	+	IGR	INS	-	T	T	rs141276452	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14082298_14082299insT								DNAH5 (137709 upstream) : TRIO (61530 downstream)																							atgaaactggattttttttttc	0.000													6	15	---	---	---	---	
ANKH	56172	broad.mit.edu	37	5	14718938	14718939	+	Intron	INS	-	C	C	rs139321298		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14718938_14718939insC	uc003jfm.3	-						ANKH_uc003jfl.3_Intron	NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein						locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						tcccaacaccacccccccccca	0.000													3	4	---	---	---	---	
ANKH	56172	broad.mit.edu	37	5	14798600	14798601	+	Intron	INS	-	T	T	rs78753908		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14798600_14798601insT	uc003jfm.3	-							NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein						locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						CGCGGTCTCtattttttttttt	0.356													7	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	14904596	14904598	+	IGR	DEL	GAG	-	-	rs145372451		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14904596_14904598delGAG								ANKH (32709 upstream) : FBXL7 (595707 downstream)																							CTGATGGGCAGAGGAGGGATGTA	0.369													2	14	---	---	---	---	
FAM134B	54463	broad.mit.edu	37	5	16559409	16559409	+	Intron	DEL	A	-	-	rs11310060		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16559409delA	uc003jfs.2	-							NM_001034850	NP_001030022	Q9H6L5	F134B_HUMAN	hypothetical protein LOC54463 isoform 1						sensory perception of pain	cis-Golgi network|endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3						AGCTAGGGGCAAAAAAAACCT	0.279													2	8	---	---	---	---	
FAM134B	54463	broad.mit.edu	37	5	16574311	16574312	+	Intron	INS	-	G	G	rs148900475	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16574311_16574312insG	uc003jfs.2	-							NM_001034850	NP_001030022	Q9H6L5	F134B_HUMAN	hypothetical protein LOC54463 isoform 1						sensory perception of pain	cis-Golgi network|endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3						TAATCTGGGGTGCCTCAGCAGG	0.470													2	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	16981060	16981062	+	IGR	DEL	AAC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16981060_16981062delAAC								MYO10 (44675 upstream) : LOC285696 (149075 downstream)																							tgtctcaaggaacaacaacaaca	0.133													6	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	16985293	16985293	+	IGR	DEL	T	-	-	rs80167623		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16985293delT								MYO10 (48908 upstream) : LOC285696 (144844 downstream)																							tctcagtgggttttctggtct	0.000													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	17450916	17450916	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17450916delG								BASP1 (173981 upstream) : None (None downstream)																							tcagacccttggcggtttttg	0.005													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	18363290	18363291	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18363290_18363291insA								None (None upstream) : None (None downstream)																							GCCTAGTAAAGAAAAAAAAAAA	0.401													4	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	19314666	19314667	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19314666_19314667insA								None (None upstream) : CDH18 (158490 downstream)																							aggaaggaaggaaggaaggaag	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20444889	20444889	+	IGR	DEL	T	-	-	rs145488447		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20444889delT								CDH18 (456582 upstream) : GUSBP1 (897053 downstream)																							tttttctttcttttttttttt	0.299													3	4	---	---	---	---	
GUSBP1	728411	broad.mit.edu	37	5	21529382	21529383	+	Intron	DEL	TG	-	-	rs149059727		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21529382_21529383delTG	uc011cnn.1	+						GUSBP1_uc003jgh.3_Intron					Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0						tggcttcttttgtgtctttaag	0.153													4	2	---	---	---	---	
CDH12	1010	broad.mit.edu	37	5	22226110	22226111	+	Intron	DEL	AT	-	-	rs148075349		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22226110_22226111delAT	uc003jgk.2	-							NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						AACATCAGACATAGAATATTCA	0.287										HNSCC(59;0.17)			7	4	---	---	---	---	
CDH12	1010	broad.mit.edu	37	5	22416768	22416769	+	Intron	INS	-	A	A	rs146384744	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22416768_22416769insA	uc003jgk.2	-							NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						aaggaatacataaaaaaaataa	0.000										HNSCC(59;0.17)			0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	23793921	23793922	+	IGR	INS	-	A	A	rs77714727	byFrequency	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23793921_23793922insA								PRDM9 (265217 upstream) : CDH10 (693288 downstream)																							agtttatttgcccattcacctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	25018354	25018354	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25018354delT								CDH10 (373443 upstream) : None (None downstream)																							tgcctggctatttttttgttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	25511364	25511364	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25511364delC								CDH10 (866453 upstream) : None (None downstream)																							ctaatttacactcccaccaac	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	27961423	27961423	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27961423delT								CDH9 (922734 upstream) : None (None downstream)																							agatcctgaattttttttttt	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	31128288	31128288	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31128288delA								None (None upstream) : CDH6 (65508 downstream)																							ttttagacataatatcatgca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	31157495	31157495	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31157495delA								None (None upstream) : CDH6 (36301 downstream)																							CTTCCAAATCAAAAAAAAAAA	0.393													4	2	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	31872249	31872250	+	Intron	DEL	GT	-	-	rs71987627		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31872249_31872250delGT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						AAGGTGAGTGgtgtgtgtgtgt	0.426													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	33027728	33027732	+	IGR	DEL	CTTAC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33027728_33027732delCTTAC								C5orf23 (235909 upstream) : TARS (413070 downstream)																							CCCTTATGCTCTTACCTTACCTTAC	0.293													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	33266891	33266891	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33266891delT								C5orf23 (475072 upstream) : TARS (173911 downstream)																							gattaatagctccctgaggag	0.050													4	2	---	---	---	---	
ADAMTS12	81792	broad.mit.edu	37	5	33607321	33607322	+	Intron	INS	-	CAATG	CAATG	rs148668371	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33607321_33607322insCAATG	uc003jia.1	-						ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						tgtgacaggcccaatgcaatgc	0.000										HNSCC(64;0.19)			5	3	---	---	---	---	
PRLR	5618	broad.mit.edu	37	5	35086663	35086664	+	Intron	DEL	GT	-	-	rs73767508	byFrequency	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35086663_35086664delGT	uc003jjm.2	-						PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Intron|PRLR_uc010iuw.1_5'Flank	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor						activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CATTTTGCTGgtgtgtgtgtgt	0.386													8	5	---	---	---	---	
SPEF2	79925	broad.mit.edu	37	5	35664380	35664381	+	Intron	INS	-	AA	AA	rs34622548		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35664380_35664381insAA	uc003jjo.2	+						SPEF2_uc003jjn.1_Intron|SPEF2_uc003jjq.3_Intron	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			aTGAAATAAAGAAAAAAAAAAA	0.015													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	36551321	36551322	+	IGR	INS	-	AAA	AAA	rs75732371		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36551321_36551322insAAA								RANBP3L (249310 upstream) : SLC1A3 (55135 downstream)																							gactctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	38243473	38243473	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38243473delC								GDNF (403691 upstream) : EGFLAM (15060 downstream)																							GGATCTCTGTCCCCTGAAGTA	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	39274748	39274748	+	IGR	DEL	T	-	-	rs138010879		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39274748delT								FYB (3989 upstream) : C9 (9631 downstream)																							ACACTTTTTCTTTTTTTTTTG	0.368													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	39687356	39687357	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39687356_39687357insT								DAB2 (262021 upstream) : PTGER4 (992675 downstream)																							aacttctcttctcttgtcattt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	43874119	43874119	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43874119delT								NNT (168452 upstream) : FGF10 (430978 downstream)																							aactgcagaatttttttttaa	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	46093974	46093974	+	IGR	DEL	T	-	-	rs143907956		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46093974delT								HCN1 (397754 upstream) : None (None downstream)																							ttggaaacagtttttttttgt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	51201468	51201468	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51201468delT								ISL1 (510911 upstream) : ITGA1 (882306 downstream)																							ATTTGAATTATTTTTTTTTCC	0.318													4	2	---	---	---	---	
ARL15	54622	broad.mit.edu	37	5	53339677	53339678	+	Intron	DEL	AA	-	-	rs72031214		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53339677_53339678delAA	uc003jpg.1	-						ARL15_uc010ivs.1_Intron	NM_019087	NP_061960	Q9NXU5	ARL15_HUMAN	ADP-ribosylation factor-like 15								GTP binding			ovary(1)	1		Lung NSC(810;0.000779)				cccatctcttaaaaaaaaaaaa	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	54839463	54839464	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54839463_54839464insA								PPAP2A (8590 upstream) : SLC38A9 (82212 downstream)																							CACATGCAGTTAAAAAAAAAAA	0.371													3	3	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	59186082	59186085	+	Intron	DEL	ACAC	-	-	rs72135540		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59186082_59186085delACAC	uc003jsa.2	-						PDE4D_uc003jsb.2_Intron	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	GTGCGcacgtacacacacacacac	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	73546695	73546696	+	IGR	DEL	CA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73546695_73546696delCA								RGNEF (309282 upstream) : ENC1 (376539 downstream)																							catgagcactcacacacacaca	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	78452143	78452146	+	IGR	DEL	AAAC	-	-	rs113382295		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78452143_78452146delAAAC								BHMT (24031 upstream) : JMY (79808 downstream)																							atctcaaaataaacaaacaaacaa	0.157													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	94691990	94691991	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94691990_94691991insT								MCTP1 (71711 upstream) : FAM81B (35057 downstream)																							tccacatcctcctgttgtttcc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103222307	103222308	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103222307_103222308insA								NUDT12 (323817 upstream) : None (None downstream)																							agaataaagtgaaaaaaaaaat	0.010													3	3	---	---	---	---	
C5orf13	9315	broad.mit.edu	37	5	111014237	111014238	+	Intron	DEL	AC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111014237_111014238delAC	uc003kpk.2	-									Q16612	NP311_HUMAN	Homo sapiens cDNA FLJ55239 complete cds, moderately similar to Neuronal protein 3.1.							cytoplasm				skin(1)	1		all_cancers(142;0.00597)|all_epithelial(76;0.000144)|Prostate(80;0.0115)|Colorectal(10;0.0446)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;5.45e-09)|Epithelial(69;2e-08)|all cancers(49;1.9e-06)|COAD - Colon adenocarcinoma(37;0.0514)|Colorectal(14;0.0629)		TTTCCCTTGTACCTTCCTGCCC	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	122356803	122356804	+	IGR	INS	-	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122356803_122356804insG								SNX24 (11902 upstream) : PPIC (2276 downstream)																							CACAGTTCCCCCCCCGTCCCCA	0.569													4	2	---	---	---	---	
TGFBI	7045	broad.mit.edu	37	5	135369811	135369812	+	Intron	DEL	GT	-	-	rs35570039		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135369811_135369812delGT	uc003lbf.3	+						TGFBI_uc003lbg.3_Intron|TGFBI_uc003lbh.3_Intron	NM_000358	NP_000349	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa						angiogenesis|cell adhesion|cell proliferation|negative regulation of cell adhesion|response to stimulus|visual perception	extracellular space|proteinaceous extracellular matrix	integrin binding			breast(3)|ovary(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GAAACACtgcgtgtgtgtgtgt	0.366													4	2	---	---	---	---	
KLHL3	26249	broad.mit.edu	37	5	137037949	137037949	+	Intron	DEL	C	-	-	rs34922265		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137037949delC	uc010jek.2	-						KLHL3_uc003lbr.3_Intron|KLHL3_uc011cyd.1_Intron|MYOT_uc011cye.1_Intron|KLHL3_uc010jem.1_Intron|KLHL3_uc010jen.1_Intron	NM_017415	NP_059111	Q9UH77	KLHL3_HUMAN	kelch-like 3							cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		cacaagagcaccaggtttgct	0.000													4	3	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	167676459	167676460	+	Intron	DEL	GT	-	-	rs71841419		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167676459_167676460delGT	uc010jjd.2	+						ODZ2_uc003lzr.3_Intron|ODZ2_uc003lzt.3_Intron|ODZ2_uc010jje.2_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		ttctctcaaggtgtgtgtgtgt	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	169547956	169547957	+	IGR	INS	-	GA	GA	rs147107643	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169547956_169547957insGA								FOXI1 (11228 upstream) : C5orf58 (111993 downstream)																							cttacatggctgagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173448020	173448020	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173448020delA								C5orf47 (14878 upstream) : HMP19 (24704 downstream)																							AAACAGGAGGAAAAAAAAAAa	0.100													3	4	---	---	---	---	
UNC5A	90249	broad.mit.edu	37	5	176235839	176235840	+	5'Flank	DEL	AC	-	-	rs72364681		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176235839_176235840delAC	uc003mey.2	+						UNC5A_uc003mex.1_5'Flank	NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	netrin receptor Unc5h1 precursor						apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane				skin(1)	1	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CACTGCTCCTacacacacacac	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	178929383	178929384	+	IGR	DEL	GT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178929383_178929384delGT								ADAMTS2 (157054 upstream) : RUFY1 (48187 downstream)																							agggtgtacagtgtgtgtgtgt	0.000													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	2880206	2880208	+	IGR	DEL	CAA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2880206_2880208delCAA								SERPINB1 (38125 upstream) : SERPINB9 (7298 downstream)																							acatttcatccaacaaccgcaga	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	9086799	9086799	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9086799delT								HULC (432722 upstream) : None (None downstream)																							TCAGGGCTGCTTTTCCCAGCG	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	9221544	9221544	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9221544delT								HULC (567467 upstream) : None (None downstream)																							ttgtttttgcttttttttttC	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	12368046	12368047	+	IGR	INS	-	T	T	rs147041498	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12368046_12368047insT								EDN1 (70620 upstream) : PHACTR1 (348841 downstream)																							attgaagcaggtagaacacatt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	12711402	12711403	+	IGR	INS	-	A	A	rs144787602		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12711402_12711403insA								EDN1 (413976 upstream) : PHACTR1 (5485 downstream)																							GGCCCACCAGGAAAAAAAAAAT	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	16988775	16988775	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16988775delA								ATXN1 (227054 upstream) : RBM24 (293034 downstream)																							catctccatcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
HIST1H4D	8360	broad.mit.edu	37	6	26191332	26191333	+	5'Flank	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26191332_26191333insA	uc003ngu.2	-							NM_003539	NP_003530	P62805	H4_HUMAN	histone cluster 1, H4d						CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding				0		all_hematologic(11;0.196)				gactccatctcaaaaaaaaaac	0.000													5	3	---	---	---	---	
C6orf10	10665	broad.mit.edu	37	6	32295431	32295432	+	Intron	INS	-	T	T	rs145356318		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32295431_32295432insT	uc011dpy.1	-							NM_006781	NP_006772	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10							integral to membrane				skin(1)	1						ttttctttttcttttttttttt	0.149													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32443516	32443516	+	IGR	DEL	A	-	-	rs9279698		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32443516delA								HLA-DRA (30695 upstream) : HLA-DRB1 (41647 downstream)																							acatatttcgaggctccttta	0.000													4	6	---	---	---	---	
GRM4	2914	broad.mit.edu	37	6	34040390	34040394	+	Intron	DEL	CACAC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34040390_34040394delCACAC	uc003oir.3	-						GRM4_uc011dsn.1_Intron|GRM4_uc010jvh.2_Intron|GRM4_uc010jvi.2_Intron|GRM4_uc011dsl.1_Intron|GRM4_uc003oiq.2_Intron|GRM4_uc011dsm.1_Intron	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor						activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	cacacacacacacacatcaccgcat	0.000													3	3	---	---	---	---	
ZNF76	7629	broad.mit.edu	37	6	35229292	35229295	+	Intron	DEL	TTGG	-	-	rs10531520		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35229292_35229295delTTGG	uc003oki.1	+						ZNF76_uc011dsy.1_Intron|ZNF76_uc011dsz.1_Intron|ZNF76_uc003okj.1_Intron|ZNF76_uc011dsx.1_Intron	NM_003427	NP_003418	P36508	ZNF76_HUMAN	zinc finger protein 76 (expressed in testis)						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						atatttttgtttggttggttggtt	0.025													4	3	---	---	---	---	
BTBD9	114781	broad.mit.edu	37	6	38185116	38185119	+	Intron	DEL	AAAG	-	-	rs139157418		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38185116_38185119delAAAG	uc003ooa.3	-						BTBD9_uc003ony.3_Intron|BTBD9_uc010jwv.2_Intron|BTBD9_uc010jww.2_Intron|BTBD9_uc010jwx.2_Intron	NM_052893	NP_443125	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9 isoform a						cell adhesion						0						aaaaaaaaaaaaagaaTCCCCATC	0.206													4	2	---	---	---	---	
C6orf64	55776	broad.mit.edu	37	6	39077192	39077193	+	Intron	INS	-	TCC	TCC	rs138538630	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39077192_39077193insTCC	uc003ook.1	-						C6orf64_uc011dty.1_Intron|C6orf64_uc003oom.1_RNA	NM_018322	NP_060792	Q9NPB0	CF064_HUMAN	hypothetical protein LOC55776							integral to membrane					0						ATGTAGATACTTCCTCATCAAT	0.485													5	5	---	---	---	---	
KIF6	221458	broad.mit.edu	37	6	39334669	39334669	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39334669delT	uc003oot.2	-						KIF6_uc003oos.2_Intron|KIF6_uc010jwz.1_Intron|KIF6_uc010jxa.1_Intron|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						AAGTTGAGCATTTTTTTTTTT	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	40578840	40578840	+	IGR	DEL	T	-	-	rs66598969		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40578840delT								LRFN2 (23714 upstream) : UNC5CL (415932 downstream)																							AATGATACTCttttttttttt	0.229													4	2	---	---	---	---	
CCND3	896	broad.mit.edu	37	6	41932057	41932068	+	Intron	DEL	TGTGTGTGTGAA	-	-	rs70987549		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41932057_41932068delTGTGTGTGTGAA	uc003orp.2	-						CCND3_uc011duk.1_Intron|CCND3_uc011dum.1_Intron	NM_001136017	NP_001129489	P30281	CCND3_HUMAN	cyclin D3 isoform 1						cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding				0	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			tgtgtgagtctgtgtgtgtgaatgtgtgtgtg	0.132			T	IGH@	MM								5	3	---	---	---	---	
CAPN11	11131	broad.mit.edu	37	6	44124033	44124034	+	5'Flank	INS	-	CTT	CTT	rs147637541	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44124033_44124034insCTT	uc003owt.1	+							NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			aaaaaaaTCACCTCGAAAAAAG	0.228													2	5	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57344143	57344144	+	Intron	INS	-	A	A	rs147853435	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57344143_57344144insA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TGTAGACTACTAAAAAAAAGCA	0.302													3	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57386410	57386410	+	Intron	DEL	A	-	-	rs66841422		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57386410delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CCTCTTTCTGAAATTGTTTTT	0.308													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57444301	57444301	+	Intron	DEL	T	-	-	rs113862454		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57444301delT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		tcatgtctccttaatctcttc	0.000													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57517009	57517010	+	IGR	INS	-	ATTTA	ATTTA	rs5876670		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57517009_57517010insATTTA								PRIM2 (3634 upstream) : GUSBL2 (729149 downstream)																							ACAAATACTGCATTTAAGACTG	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57553541	57553542	+	IGR	DEL	AG	-	-	rs113085434		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57553541_57553542delAG								PRIM2 (40166 upstream) : GUSBL2 (692617 downstream)																							agtgacctacagagtcaatgca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57554398	57554399	+	IGR	INS	-	T	T	rs138559963	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57554398_57554399insT								PRIM2 (41023 upstream) : GUSBL2 (691760 downstream)																							agctgcaggcatttcttgtatc	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57603579	57603580	+	IGR	INS	-	T	T	rs142427194	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57603579_57603580insT								PRIM2 (90204 upstream) : GUSBL2 (642579 downstream)																							tcagttggaaatgcagaaatca	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	61913980	61913980	+	IGR	DEL	T	-	-	rs79096875		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:61913980delT								None (None upstream) : KHDRBS2 (475885 downstream)																							ttctgtctactttttatgtga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	76453372	76453373	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76453372_76453373insT								SENP6 (25379 upstream) : MYO6 (5536 downstream)																							TTCTTTTATTATTTTTTTTTAA	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	76874175	76874175	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76874175delA								IMPG1 (91840 upstream) : None (None downstream)																							caagaaggccaatgtggctgg	0.179													4	2	---	---	---	---	
ANKRD6	22881	broad.mit.edu	37	6	90214589	90214589	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90214589delA	uc003pni.3	+						ANKRD6_uc003pne.3_Intron|ANKRD6_uc003pnf.3_Intron	NM_014942	NP_055757	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6								protein binding			ovary(2)|pancreas(1)	3		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		CACAGCCTGGAAATGCTCAAT	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	95040312	95040313	+	IGR	DEL	AC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:95040312_95040313delAC								TSG1 (554113 upstream) : MANEA (985100 downstream)																							aatagtaagtacacacacacac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	95065264	95065267	+	IGR	DEL	ACAC	-	-	rs111300018		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:95065264_95065267delACAC								TSG1 (579065 upstream) : MANEA (960146 downstream)																							GGAACATTTTacacacacacacac	0.206													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	95666729	95666730	+	IGR	DEL	AC	-	-	rs113025786		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:95666729_95666730delAC								None (None upstream) : MANEA (358683 downstream)																							GCGTGCGCAAacacacacacac	0.238													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	96148590	96148591	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96148590_96148591insA								MANEA (91264 upstream) : FUT9 (315254 downstream)																							agaagaggaagaggaagaagaa	0.074													4	2	---	---	---	---	
SFRS18	25957	broad.mit.edu	37	6	99850727	99850728	+	Intron	INS	-	TT	TT	rs146432936	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99850727_99850728insTT	uc003ppo.3	-						SFRS18_uc003ppl.2_5'Flank|SFRS18_uc003ppp.3_Intron|SFRS18_uc011eag.1_Intron	NM_032870	NP_116259	Q8TF01	PNISR_HUMAN	splicing factor, arginine/serine-rich 130							nuclear speck					0		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0631)		GGGGAGAAGTATACATTCAAAC	0.351													4	4	---	---	---	---	
LAMA4	3910	broad.mit.edu	37	6	112450391	112450392	+	Intron	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112450391_112450392delTG	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		tgtgtgtgcatgtgtgtgtgtg	0.252													4	2	---	---	---	---	
KPNA5	3841	broad.mit.edu	37	6	117000623	117000623	+	5'Flank	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117000623delC	uc003pxh.2	+						uc003pxg.1_RNA	NM_002269	NP_002260	O15131	IMA5_HUMAN	karyopherin alpha 5						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding|protein transporter activity			breast(3)|skin(1)	4		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		cccaccagcaccatgacagtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	123302107	123302107	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123302107delT								SMPDL3A (171245 upstream) : CLVS2 (15475 downstream)																							AACATACCACTTTTTTTTTCG	0.343													4	2	---	---	---	---	
NKAIN2	154215	broad.mit.edu	37	6	124499445	124499445	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124499445delT	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010kep.1_Intron	NM_001040214	NP_001035304	Q5VXU1	NKAI2_HUMAN	T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)		GTACATTAACttttttttttt	0.015													6	3	---	---	---	---	
NKAIN2	154215	broad.mit.edu	37	6	124655879	124655880	+	Intron	INS	-	A	A	rs72551965	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124655879_124655880insA	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304	Q5VXU1	NKAI2_HUMAN	T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)		catgactcctcgccagaacttc	0.000													2	8	---	---	---	---	
CENPW	387103	broad.mit.edu	37	6	126660355	126660356	+	5'Flank	INS	-	AGG	AGG	rs140564891	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126660355_126660356insAGG	uc003qao.2	+						CENPW_uc003qap.3_5'Flank	NM_001012507	NP_001012525	Q5EE01	CENPW_HUMAN	hypothetical protein LOC387103							chromosome, centromeric region|nucleus	DNA binding				0						ctcaagggtgtagaagatgact	0.000													8	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	126987213	126987214	+	Intron	INS	-	AAAAT	AAAAT	rs144578168	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126987213_126987214insAAAAT	uc003qaq.1	-											Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																		ATTATTCTTGAAAAATAAACTT	0.302													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	127204615	127204615	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127204615delG	uc003qaq.1	-											Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																		ggtgtaagaaggtatctcatt	0.000													5	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	127737455	127737458	+	IGR	DEL	AAAT	-	-	rs66899493		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127737455_127737458delAAAT								ECHDC1 (72701 upstream) : C6orf174 (22094 downstream)																							ctctgtctcaaaataaataaataa	0.069													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	127755401	127755401	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127755401delT								ECHDC1 (90647 upstream) : C6orf174 (4151 downstream)																							ATTTAGATGCTTATCTTTTTA	0.179													4	2	---	---	---	---	
PTPRK	5796	broad.mit.edu	37	6	128632591	128632591	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128632591delG	uc003qbk.2	-						PTPRK_uc003qbj.2_Intron|PTPRK_uc010kfc.2_Intron|PTPRK_uc011ebu.1_Intron|PTPRK_uc003qbl.1_Intron|PTPRK_uc011ebv.1_Intron	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K						cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CCCTGGATTTGGAAACTTCTC	0.458													4	2	---	---	---	---	
VNN1	8876	broad.mit.edu	37	6	133010410	133010411	+	Intron	DEL	AC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133010410_133010411delAC	uc003qdo.2	-						VNN1_uc003qdn.2_5'Flank	NM_004666	NP_004657	O95497	VNN1_HUMAN	vanin 1 precursor						acute inflammatory response|anti-apoptosis|cell-cell adhesion|cellular component movement|chronic inflammatory response|innate immune response|pantothenate metabolic process|positive regulation of T cell differentiation in thymus|response to oxidative stress	anchored to membrane|integral to membrane|plasma membrane	GPI anchor binding|pantetheine hydrolase activity			ovary(3)	3	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		TTGTTGAGAAacacacacacac	0.317													3	3	---	---	---	---	
MAP3K5	4217	broad.mit.edu	37	6	136977762	136977762	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136977762delT	uc003qhc.2	-						MAP3K5_uc011edj.1_5'Flank|MAP3K5_uc011edk.1_Intron|MAP3K5_uc010kgw.1_Intron	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		GTTTTCACACttttttttttt	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	137792652	137792652	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137792652delT								IFNGR1 (252085 upstream) : OLIG3 (20684 downstream)																							TTCCTTGCTATTTCCCCTCTT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	145192350	145192350	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145192350delA								UTRN (18182 upstream) : EPM2A (754096 downstream)																							AGTGCAGTGGAAAAGCAATGG	0.453													4	2	---	---	---	---	
SLC22A2	6582	broad.mit.edu	37	6	160626918	160626918	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160626918delA	uc003qte.1	-							NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2						body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		CATCTTTTCTAAAGTTGTTGG	0.134													4	2	---	---	---	---	
SMOC2	64094	broad.mit.edu	37	6	169059754	169059755	+	Intron	INS	-	GTG	GTG	rs142614272	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169059754_169059755insGTG	uc003qws.1	+						SMOC2_uc003qwr.1_Intron|SMOC2_uc011egu.1_Intron	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		gtgtgagtggtgtgtatgtatg	0.163													3	3	---	---	---	---	
WDR27	253769	broad.mit.edu	37	6	170040918	170040919	+	Intron	INS	-	GACCCACA	GACCCACA	rs139588331	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170040918_170040919insGACCCACA	uc003qwx.2	-						WDR27_uc003qwv.1_Intron|WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron			A2RRH5	WDR27_HUMAN	RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		CTCCACTGCCTGGCTGCAAGAG	0.554													3	6	---	---	---	---	
WDR27	253769	broad.mit.edu	37	6	170055103	170055103	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170055103delC	uc003qwx.2	-						WDR27_uc003qwv.1_Intron|WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron			A2RRH5	WDR27_HUMAN	RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		ctcgggttttcccgggagaac	0.000													4	2	---	---	---	---	
PRKAR1B	5575	broad.mit.edu	37	7	699910	699910	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:699910delC	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron	NM_002735	NP_002726	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		TTCCCGTCTACCATAGCTCAA	0.637													4	2	---	---	---	---	
GPER	2852	broad.mit.edu	37	7	1130606	1130607	+	Intron	INS	-	CT	CT	rs149305678	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1130606_1130607insCT	uc010ksd.1	+						C7orf50_uc003sju.2_Intron|C7orf50_uc011jvt.1_Intron|C7orf50_uc011jvu.1_Intron|GPER_uc003sjz.1_Intron|GPER_uc003ska.1_Intron|GPER_uc003skb.2_Intron	NM_001098201	NP_001091671	Q99527	GPER_HUMAN	G protein-coupled receptor 30							endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;2.32e-16)		TTCTGGACCCACTCTCTCTCTC	0.455													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1632024	1632024	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1632024delC								KIAA1908 (2765 upstream) : TFAMP1 (22082 downstream)																							GGTGGTGGGGCCGGGCGGGCA	0.682													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	4440103	4440104	+	IGR	INS	-	GT	GT	rs139917354	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4440103_4440104insGT								SDK1 (131474 upstream) : FOXK1 (243284 downstream)																							CTTAGGAAGGAgtgtgtgtgtg	0.223													4	2	---	---	---	---	
DAGLB	221955	broad.mit.edu	37	7	6463079	6463080	+	Intron	DEL	AG	-	-	rs75193740		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6463079_6463080delAG	uc003sqa.2	-						DAGLB_uc003spz.2_5'Flank|DAGLB_uc011jwt.1_Intron|DAGLB_uc011jwu.1_Intron|DAGLB_uc003sqb.2_Intron|DAGLB_uc003sqc.2_Intron|DAGLB_uc011jwv.1_Intron|DAGLB_uc003sqd.3_Intron|DAGLB_uc011jww.1_Intron	NM_139179	NP_631918	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta isoform 1						lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		cttttgagacagagtctcgatc	0.257													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	8999863	8999864	+	IGR	INS	-	T	T	rs142110785	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8999863_8999864insT								NXPH1 (207271 upstream) : PER4 (674036 downstream)																							AATATTCTTTCTTTTTTTTTTG	0.312													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	9113102	9113103	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9113102_9113103insT								NXPH1 (320510 upstream) : PER4 (560797 downstream)																							tgcccagctaatttttttttta	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	15025626	15025626	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15025626delT								DGKB (83076 upstream) : TMEM195 (214317 downstream)																							TGTGGGATTCTTTTTTTTTTT	0.308													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	15173079	15173079	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15173079delG								DGKB (230529 upstream) : TMEM195 (66864 downstream)																							gaagtagggagggaagacaac	0.000													4	2	---	---	---	---	
TMEM195	392636	broad.mit.edu	37	7	15276870	15276870	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15276870delC	uc003stb.1	-							NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195						ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0						ATTGTGTTTACCATGTTATAT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	17693359	17693360	+	IGR	INS	-	C	C	rs144367874	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17693359_17693360insC								AHR (307584 upstream) : SNX13 (137026 downstream)																							tgttcaaatttccccctgttga	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	19408437	19408437	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19408437delG								FERD3L (223393 upstream) : TWISTNB (326648 downstream)																							CTAAAATTCTGGTCTGAATTG	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	19629718	19629718	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19629718delT								FERD3L (444674 upstream) : TWISTNB (105367 downstream)																							cccattagtgttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	22417104	22417104	+	IGR	DEL	T	-	-	rs113868224		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22417104delT								RAPGEF5 (20571 upstream) : MGC87042 (41962 downstream)																							ACTTTGTTAATTTTTTTTTTC	0.398													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	22544810	22544811	+	IGR	INS	-	A	A	rs144911309	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22544810_22544811insA								MGC87042 (5012 upstream) : IL6 (220692 downstream)																							CTTTTGGTTACAAAAAAAAAAG	0.272													4	2	---	---	---	---	
STK31	56164	broad.mit.edu	37	7	23831252	23831252	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23831252delA	uc003sws.3	+						STK31_uc003swt.3_Intron|STK31_uc011jze.1_Intron|STK31_uc010kuq.2_Intron|STK31_uc003swv.1_Intron	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a								ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						gttggaagacaaaaaaATAAA	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	24367924	24367924	+	IGR	DEL	T	-	-	rs34052008		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24367924delT								NPY (36447 upstream) : MPP6 (245161 downstream)																							GAAATAGCACttttttttttt	0.189													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	24389650	24389650	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24389650delA								NPY (58173 upstream) : MPP6 (223435 downstream)																							CACAATGTGTAACTTAAGATT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	25776111	25776112	+	IGR	INS	-	CACA	CACA	rs148676025	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25776111_25776112insCACA								NPVF (508006 upstream) : MIR148A (213427 downstream)																							acacccacacccacacacacac	0.277													3	4	---	---	---	---	
HOXA3	3200	broad.mit.edu	37	7	27151104	27151105	+	Intron	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs138343021	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27151104_27151105insGTGTGTGTGT	uc011jzl.1	-						HOXA3_uc011jzk.1_Intron|HOXA3_uc003syk.2_Intron	NM_030661	NP_109377	O43365	HXA3_HUMAN	homeobox A3 isoform a						angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(2)	2						GAACACATtgcgtgtgtgtgtg	0.416													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	27412469	27412472	+	IGR	DEL	ACAC	-	-	rs35818083		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27412469_27412472delACAC								EVX1 (126277 upstream) : HIBADH (152591 downstream)																							TTCCTCTTTTacacacacacacac	0.407													3	3	---	---	---	---	
CREB5	9586	broad.mit.edu	37	7	28563935	28563946	+	Intron	DEL	ACACACACACAC	-	-	rs72138692		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28563935_28563946delACACACACACAC	uc003szq.2	+						CREB5_uc003szo.2_Intron|CREB5_uc003szr.2_Intron	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						cctctactaaacacacacacacacacacacac	0.000													4	2	---	---	---	---	
CPVL	54504	broad.mit.edu	37	7	29136009	29136009	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29136009delG	uc003szv.2	-						CPVL_uc003szw.2_Intron|CPVL_uc003szx.2_Intron	NM_031311	NP_112601	Q9H3G5	CPVL_HUMAN	serine carboxypeptidase vitellogenic-like						proteolysis		protein binding|serine-type carboxypeptidase activity			ovary(2)	2						GATCATCTTTGGTTCTTTGAA	0.438													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	35439988	35439989	+	IGR	DEL	TT	-	-	rs34468772		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35439988_35439989delTT								TBX20 (146746 upstream) : HERPUD2 (232283 downstream)																							GATGAAAATATTTttctttctt	0.406													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	35614756	35614756	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35614756delG								TBX20 (321514 upstream) : HERPUD2 (57516 downstream)																							CGCGGTTCTTGGAGGTCCCCC	0.597													4	2	---	---	---	---	
ELMO1	9844	broad.mit.edu	37	7	36898270	36898275	+	Intron	DEL	AGAGTC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36898270_36898275delAGAGTC	uc003tfk.1	-						ELMO1_uc003tfi.1_Intron|ELMO1_uc003tfj.1_Intron|ELMO1_uc011kbb.1_Intron|ELMO1_uc011kbc.1_Intron|ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						aaacagaagaagagtcagagtcagag	0.000													6	3	---	---	---	---	
VPS41	27072	broad.mit.edu	37	7	38943255	38943255	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38943255delA	uc003tgy.2	-						VPS41_uc003tgz.2_Intron|VPS41_uc010kxn.2_Intron	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1						Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						GCATAATGAGAAAGAGAGTTC	0.443													4	2	---	---	---	---	
CCM2	83605	broad.mit.edu	37	7	45079978	45079978	+	Intron	DEL	A	-	-	rs75010881		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45079978delA	uc003tmo.2	+						CCM2_uc003tmn.2_Intron|CCM2_uc003tmp.2_Intron|CCM2_uc003tmq.2_Intron|CCM2_uc003tmr.2_Intron|CCM2_uc011kcb.1_Intron|CCM2_uc011kcc.1_Intron|CCM2_uc003tms.2_Intron	NM_031443	NP_113631	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2 isoform 2						endothelial tube morphogenesis|integrin-mediated signaling pathway|stress-activated MAPK cascade|vasculogenesis	cytoplasm	protein binding				0						actccgtctcaaaaaaaaaag	0.000									Familial_Cerebral_Cavernous_Angioma				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	45283047	45283048	+	IGR	DEL	TG	-	-	rs112050392		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45283047_45283048delTG								RAMP3 (59200 upstream) : ADCY1 (330691 downstream)																							tgtgtgtctttgtgtgtgtgtg	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	47080591	47080591	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47080591delC								None (None upstream) : TNS3 (234162 downstream)																							tgcacatgcgccccctcccaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	49749839	49749840	+	IGR	INS	-	GT	GT	rs28690332		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49749839_49749840insGT								CDC14C (782790 upstream) : VWC2 (63417 downstream)																							tgtgtgtgtgggtgtgtgtgtg	0.069													4	4	---	---	---	---	
GBAS	2631	broad.mit.edu	37	7	56044222	56044223	+	Intron	DEL	GG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56044222_56044223delGG	uc003tre.1	+						GBAS_uc003trf.1_Intron	NM_001483	NP_001474	O75323	NIPS2_HUMAN	nipsnap homolog 2							integral to plasma membrane|membrane fraction|mitochondrion	protein binding			central_nervous_system(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ctgccctcttgggaggtcaaca	0.050													4	2	---	---	---	---	
ZNF716	441234	broad.mit.edu	37	7	57510201	57510201	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57510201delC	uc011kdi.1	+							NM_001159279	NP_001152751			zinc finger protein 716											ovary(2)	2						TAAGATGCTGCCTGGGCCAGC	0.612													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57608582	57608583	+	IGR	DEL	TC	-	-	rs137895384		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57608582_57608583delTC								ZNF716 (75317 upstream) : None (None downstream)																							tttttctcattcttttttctcc	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57723595	57723595	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57723595delA								ZNF716 (190330 upstream) : None (None downstream)																							AGTAtttttgagacagaattt	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61739787	61739788	+	IGR	INS	-	TGGAG	TGGAG	rs143369465		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61739787_61739788insTGGAG								None (None upstream) : None (None downstream)																							atggaaggcaatggagtggagt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61769524	61769524	+	IGR	DEL	A	-	-	rs150670066		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61769524delA								None (None upstream) : LOC643955 (982148 downstream)																							agggaatccgaacccagctac	0.040													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61845987	61845987	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61845987delT								None (None upstream) : LOC643955 (905685 downstream)																							agagttaaacttttttttcat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61903707	61903719	+	IGR	DEL	GTTTGGAAACAAT	-	-	rs112954132		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61903707_61903719delGTTTGGAAACAAT								None (None upstream) : LOC643955 (847953 downstream)																							tgattgagcagtttggaaacaatgttttgtaga	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62190622	62190622	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62190622delC								None (None upstream) : LOC643955 (561050 downstream)																							cccagctacacgggaggctga	0.000													4	2	---	---	---	---	
INTS4L1	285905	broad.mit.edu	37	7	64605204	64605208	+	Intron	DEL	ATGAA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64605204_64605208delATGAA	uc003ttw.2	+							NR_027393				Homo sapiens cDNA FLJ25037 fis, clone CBL03066.												0						aagtgaaatgatgaaatgaaatgat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64970799	64970800	+	IGR	INS	-	TCATT	TCATT	rs145532213		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64970799_64970800insTCATT								ZNF92 (104802 upstream) : INTS4L2 (141977 downstream)																							atttcatttcatcatttcattt	0.020													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65332211	65332213	+	IGR	DEL	AGA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65332211_65332213delAGA								CCT6P1 (103550 upstream) : VKORC1L1 (6044 downstream)																							aaggagtaggagaagaagaagaa	0.000													4	2	---	---	---	---	
GUSB	2990	broad.mit.edu	37	7	65436721	65436722	+	Intron	INS	-	A	A	rs112996996		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65436721_65436722insA	uc003tun.2	-						GUSB_uc011kdt.1_Intron	NM_000181	NP_000172	P08236	BGLR_HUMAN	glucuronidase, beta precursor						glycosaminoglycan catabolic process	lysosome	beta-glucuronidase activity|cation binding				0						ccatcttgcggaaaaaaaaaaa	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	66449405	66449405	+	IGR	DEL	T	-	-	rs113493980		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66449405delT								C7orf42 (25868 upstream) : SBDS (3285 downstream)																							cagttaattcttttttttttt	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67153705	67153705	+	IGR	DEL	G	-	-	rs60560566		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67153705delG								STAG3L4 (367193 upstream) : None (None downstream)																							ctttttttttgtttttgaggc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67511734	67511734	+	IGR	DEL	C	-	-	rs7793908	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67511734delC								STAG3L4 (725222 upstream) : None (None downstream)																							caaaaaaaaaCCTCCTTTTCT	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68197181	68197181	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68197181delT								None (None upstream) : AUTS2 (866724 downstream)																							CTCACGtttcttttttttttt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	70361856	70361857	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70361856_70361857insT								AUTS2 (103972 upstream) : WBSCR17 (235932 downstream)																							GCAGTCttttgttttttttttt	0.025													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	70393725	70393728	+	IGR	DEL	GTTT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70393725_70393728delGTTT								AUTS2 (135841 upstream) : WBSCR17 (204061 downstream)																							gttctatgaggtttgtttgtttgt	0.064													4	2	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	71145868	71145869	+	Intron	INS	-	CTTC	CTTC	rs141566749	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71145868_71145869insCTTC	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				tccttccttttcttccttcctt	0.000													3	3	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71501477	71501477	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71501477delC	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				acttgatggacacgattcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	99608922	99608923	+	IGR	INS	-	CTT	CTT			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99608922_99608923insCTT								AZGP1 (35235 upstream) : ZKSCAN1 (4296 downstream)																							ttccttccttcccttcccttcc	0.020													6	5	---	---	---	---	
FOXP2	93986	broad.mit.edu	37	7	114221130	114221131	+	Intron	INS	-	CACA	CACA	rs150167103	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114221130_114221131insCACA	uc003vhb.2	+						FOXP2_uc003vgu.2_Intron|FOXP2_uc003vgz.2_Intron|FOXP2_uc003vha.2_Intron|FOXP2_uc011kmu.1_Intron|FOXP2_uc011kmv.1_Intron|FOXP2_uc003vgt.1_Intron|FOXP2_uc003vgv.1_Intron|FOXP2_uc003vgw.2_Intron|FOXP2_uc003vgx.2_Intron|FOXP2_uc003vhd.2_Intron|FOXP2_uc003vhc.2_Intron	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						ataaacacatgcacacacacac	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	117550745	117550746	+	IGR	DEL	GT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117550745_117550746delGT								CTTNBP2 (37184 upstream) : NAA38 (273340 downstream)																							TCACCCTTTAGTGTGTGTGTGT	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	129410598	129410598	+	5'Flank	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129410598delG	uc011kpb.1	-						MIR182_hsa-mir-182|MI0000272_5'Flank					DQ595899																		ACCATCCCTAGGGCAGCCACC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	130528283	130528285	+	IGR	DEL	AAA	-	-	rs71739822		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130528283_130528285delAAA								KLF14 (109423 upstream) : MIR29A (33221 downstream)																							acttcatctcaaaaaaaaaaaaa	0.202													7	4	---	---	---	---	
UBN2	254048	broad.mit.edu	37	7	138956330	138956331	+	Intron	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138956330_138956331insA	uc011kqr.1	+						UBN2_uc003vuv.2_Intron	NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2											ovary(1)|skin(1)	2						actctgtctccaaaaaaaaaaa	0.109													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	140202667	140202667	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140202667delA								MKRN1 (23298 upstream) : DENND2A (15560 downstream)																							actttgtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
SSPO	23145	broad.mit.edu	37	7	149478696	149478697	+	Intron	DEL	AC	-	-	rs72129576		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149478696_149478697delAC	uc010lpk.2	+						SSPO_uc010lpl.1_Intron	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor						cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GTGCATGCAAacacacacacac	0.317													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152106492	152106495	+	Intron	DEL	AAGA	-	-	rs76883025		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152106492_152106495delAAGA	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		AGATTTTCAGAAGAAATATGTTAA	0.152			N		medulloblastoma								0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	8772071	8772072	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8772071_8772072insA								MFHAS1 (20940 upstream) : ERI1 (88242 downstream)																							gaccctgtctcaaaaaaaaaaa	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	10578157	10578158	+	IGR	INS	-	AAA	AAA	rs140497440	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10578157_10578158insAAA								C8orf74 (20054 upstream) : SOX7 (3121 downstream)																							aaggaagaaatgaaataaagag	0.010													4	2	---	---	---	---	
MTMR7	9108	broad.mit.edu	37	8	17162256	17162257	+	Intron	DEL	GT	-	-	rs72221681		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17162256_17162257delGT	uc003wxm.2	-						MTMR7_uc003wxn.2_Intron|MTMR7_uc011kya.1_Intron|MTMR7_uc011kyb.1_Intron	NM_004686	NP_004677	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7								protein tyrosine phosphatase activity			skin(1)	1				Colorectal(111;0.112)		TGTTCGATTCgtgtgtgtgtgt	0.282													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	20231160	20231160	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20231160delG								LZTS1 (118357 upstream) : None (None downstream)																							aggaaggggaggagaaggaag	0.000													4	2	---	---	---	---	
ZNF395	55893	broad.mit.edu	37	8	28347232	28347233	+	Intron	INS	-	C	C	rs141884451	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28347232_28347233insC	uc003xgt.2	-						FBXO16_uc003xgu.2_Intron|FBXO16_uc003xgv.2_Intron|FBXO16_uc003xgw.2_Intron	NM_018660	NP_061130	Q9H8N7	ZN395_HUMAN	zinc finger protein 395						transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding				0		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		acaaaaaccaacaaaaaaaaaa	0.163													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	30815190	30815191	+	IGR	DEL	AT	-	-	rs59269063		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30815190_30815191delAT								TEX15 (68968 upstream) : PURG (38130 downstream)																							acacacacacatacacacacac	0.030													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	33445202	33445203	+	IGR	INS	-	TC	TC	rs145861565	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33445202_33445203insTC								RNF122 (20559 upstream) : DUSP26 (3653 downstream)																							ctctttttctttttctctttct	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	36832802	36832803	+	IGR	INS	-	AC	AC	rs143926746	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36832802_36832803insAC								KCNU1 (39161 upstream) : ZNF703 (720498 downstream)																							CCCGcatacatacacacacaca	0.446													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	36847089	36847090	+	IGR	INS	-	GTGCGCGCAC	GTGCGCGCAC	rs146158812	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36847089_36847090insGTGCGCGCAC								KCNU1 (53448 upstream) : ZNF703 (706211 downstream)																							tgtgtgtgtgtgcgcgcgcttc	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37213327	37213328	+	IGR	INS	-	ATGG	ATGG	rs138900066	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37213327_37213328insATGG								KCNU1 (419686 upstream) : ZNF703 (339973 downstream)																							TAGATAGACACatggatggatg	0.243													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37364163	37364166	+	IGR	DEL	GGAA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37364163_37364166delGGAA								KCNU1 (570522 upstream) : ZNF703 (189135 downstream)																							gagggaggagggaaggaaggaagg	0.000													6	14	---	---	---	---	
BRF2	55290	broad.mit.edu	37	8	37710305	37710305	+	5'Flank	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37710305delA	uc003xkk.2	-							NM_018310	NP_060780	Q9HAW0	BRF2_HUMAN	RNA polymerase III transcription initiation						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter|transcription initiation, DNA-dependent	nucleoplasm	protein binding|zinc ion binding				0		Lung NSC(58;0.118)|all_lung(54;0.195)	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;1.81e-10)			accctgactcaaaaaaaaaaa	0.199													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	38080760	38080761	+	IGR	INS	-	CACA	CACA	rs139121543	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38080760_38080761insCACA								BAG4 (12223 upstream) : DDHD2 (8248 downstream)																							CCACCTTGCTGCACAGCTTCAA	0.416													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	38425633	38425634	+	IGR	INS	-	AACAAACA	AACAAACA	rs146698878	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38425633_38425634insAACAAACA								C8orf86 (39453 upstream) : RNF5P1 (32061 downstream)																							ccaaaaaatacaacaaacaaac	0.000													1	5	---	---	---	---	
TACC1	6867	broad.mit.edu	37	8	38587386	38587396	+	Intron	DEL	AAAAAGAAAAG	-	-	rs111859179		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38587386_38587396delAAAAAGAAAAG	uc011lbz.1	+						TACC1_uc011lby.1_Intron|TACC1_uc003xma.2_Intron|TACC1_uc003xlz.2_Intron|TACC1_uc003xmc.3_Intron|TACC1_uc003xmb.3_Intron	NM_006283	NP_006274	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing						cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			gactgtctcaaaaaagaaaagaaaaagaaaa	0.223													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	40266042	40266043	+	IGR	INS	-	CTTT	CTTT	rs142186427	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40266042_40266043insCTTT								C8orf4 (253221 upstream) : ZMAT4 (122073 downstream)																							ctcctttcttcctttctctctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	40978018	40978018	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40978018delA								ZMAT4 (222675 upstream) : SFRP1 (141461 downstream)																							GACTGAATCGAAAAAAAAATG	0.433													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	41494449	41494452	+	IGR	DEL	GTTT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41494449_41494452delGTTT								AGPAT6 (11929 upstream) : NKX6-3 (9377 downstream)																							agaaaaatgagtttgtttgtttgt	0.000													0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	41771522	41771523	+	IGR	INS	-	T	T	rs140975602	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41771522_41771523insT								ANK1 (17242 upstream) : MYST3 (15475 downstream)																							ttgatttcgcctttggccattg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	54179150	54179150	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54179150delA								OPRK1 (14956 upstream) : ATP6V1H (448966 downstream)																							aaattagtggaaaaaaaaaca	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	56957876	56957876	+	IGR	DEL	T	-	-	rs71896827		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56957876delT								LYN (33940 upstream) : RPS20 (22863 downstream)																							CCCAACAGCAttttttttttt	0.254													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	59181862	59181865	+	Intron	DEL	AAAC	-	-	rs34441484		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59181862_59181865delAAAC	uc003xtk.2	-											Homo sapiens cDNA clone IMAGE:4826156.																		ctgcacagcaaaacaaacaaacaa	0.000													3	3	---	---	---	---	
TOX	9760	broad.mit.edu	37	8	59839446	59839447	+	Intron	INS	-	T	T	rs138897888	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59839446_59839447insT	uc003xtw.1	-							NM_014729	NP_055544	O94900	TOX_HUMAN	thymus high mobility group box protein TOX							nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				AAATTACTGGGTTTTGACAAAG	0.401													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	60830057	60830057	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60830057delA								TOX (798290 upstream) : CA8 (271366 downstream)																							GTACATTGACAATCTCTCTAG	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	64809031	64809032	+	IGR	INS	-	ACAC	ACAC	rs149399346	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64809031_64809032insACAC								YTHDF3 (683686 upstream) : MIR124-2 (482674 downstream)																							TCCTTAAAAATacacacacaca	0.252													5	3	---	---	---	---	
C8orf84	157869	broad.mit.edu	37	8	73984520	73984523	+	Intron	DEL	AGAA	-	-	rs112684308		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73984520_73984523delAGAA	uc003xzf.2	-							NM_153225	NP_694957	Q8IVN8	RPESP_HUMAN	RPE-spondin precursor						immune response	extracellular region	polysaccharide binding|scavenger receptor activity				0						ataaaagaatagaaaggaaacaaa	0.083													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	78541908	78541908	+	IGR	DEL	G	-	-	rs111752332		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78541908delG								PEX2 (629384 upstream) : PKIA (886428 downstream)																							TGAGAGTCCAGCTTTCTGGGG	0.313													4	3	---	---	---	---	
PSKH2	85481	broad.mit.edu	37	8	87062062	87062063	+	Intron	DEL	AG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87062062_87062063delAG	uc011lfy.1	-							NM_033126	NP_149117	Q96QS6	KPSH2_HUMAN	protein serine kinase H2								ATP binding|protein serine/threonine kinase activity			stomach(2)|lung(2)|ovary(1)	5			STAD - Stomach adenocarcinoma(118;0.129)			gaagaaaggcagagagagagag	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	91581759	91581760	+	IGR	INS	-	AA	AA	rs71303417		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91581759_91581760insAA								CALB1 (474072 upstream) : TMEM64 (52463 downstream)																							gagagagaaagagagagagaga	0.208													3	3	---	---	---	---	
CCNE2	9134	broad.mit.edu	37	8	95903888	95903890	+	Intron	DEL	AAA	-	-	rs78334619		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95903888_95903890delAAA	uc003yhc.2	-						CCNE2_uc003yhd.2_Intron	NM_057749	NP_477097	O96020	CCNE2_HUMAN	cyclin E2						cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	cytosol|nucleoplasm	protein kinase binding				0	Breast(36;8.75e-07)					ctctgtctccaaaaaaaaaaaaa	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	97184401	97184402	+	IGR	INS	-	GAATG	GAATG			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97184401_97184402insGAATG								GDF6 (11381 upstream) : UQCRB (54908 downstream)																							cagaaagaatagaatggaatgg	0.074													6	3	---	---	---	---	
PTDSS1	9791	broad.mit.edu	37	8	97295844	97295845	+	Intron	DEL	CA	-	-	rs34435346		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97295844_97295845delCA	uc003yht.1	+						PTDSS1_uc003yhu.1_Intron	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1						phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	CTCTCTCTCTcacacacacaca	0.178													1	5	---	---	---	---	
PGCP	10404	broad.mit.edu	37	8	97719921	97719921	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97719921delT	uc003yhw.2	+							NM_016134	NP_057218	Q9Y646	PGCP_HUMAN	plasma glutamate carboxypeptidase precursor						peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity			upper_aerodigestive_tract(1)	1	Breast(36;1.86e-05)					gaatgaatgaTTTTTTTTTTt	0.000													4	2	---	---	---	---	
PGCP	10404	broad.mit.edu	37	8	97727709	97727709	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97727709delT	uc003yhw.2	+							NM_016134	NP_057218	Q9Y646	PGCP_HUMAN	plasma glutamate carboxypeptidase precursor						peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity			upper_aerodigestive_tract(1)	1	Breast(36;1.86e-05)					gaggaaggagttactctgaac	0.000													4	2	---	---	---	---	
VPS13B	157680	broad.mit.edu	37	8	100703476	100703477	+	Intron	DEL	TG	-	-	rs144300139		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100703476_100703477delTG	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			tatgggatactgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	101259983	101259983	+	IGR	DEL	A	-	-	rs11297090		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101259983delA								SPAG1 (5853 upstream) : RNF19A (9305 downstream)																							CTTCATTTGCAAAAAAAACTG	0.358													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	101815689	101815690	+	IGR	DEL	GT	-	-	rs34227463		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101815689_101815690delGT								PABPC1 (81374 upstream) : YWHAZ (115114 downstream)																							AGgtgtgtgagtgtgtgtgtgt	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	102448806	102448806	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102448806delA								NACAP1 (63871 upstream) : GRHL2 (55862 downstream)																							tatttttagtaaagacaggtt	0.000													4	2	---	---	---	---	
GRHL2	79977	broad.mit.edu	37	8	102544983	102544984	+	Intron	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102544983_102544984insA	uc010mbu.2	+						GRHL2_uc010mbt.1_Intron|GRHL2_uc011lhi.1_Intron	NM_024915	NP_079191	Q6ISB3	GRHL2_HUMAN	transcription factor CP2-like 3							cytoplasm|nucleus	DNA binding			ovary(2)|skin(1)	3	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			ctccatctcacaaaaaaaaaaa	0.119													4	2	---	---	---	---	
RIMS2	9699	broad.mit.edu	37	8	104589654	104589655	+	Intron	INS	-	G	G	rs147264400		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104589654_104589655insG	uc003ylp.2	+							NM_001100117	NP_001093587	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			tgagaacacatggacacaggga	0.000										HNSCC(12;0.0054)			4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	105659247	105659247	+	IGR	DEL	C	-	-	rs113454009		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105659247delC								LRP12 (58027 upstream) : ZFPM2 (671900 downstream)																							acccatctctcaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	105942983	105942983	+	IGR	DEL	T	-	-	rs60110104		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105942983delT								LRP12 (341763 upstream) : ZFPM2 (388164 downstream)																							tcccctcccctcccctccccC	0.318													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	110915112	110915112	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110915112delA								SYBU (211092 upstream) : KCNV1 (64123 downstream)																							AGTTTACAATAAAAGCCACAA	0.348													4	2	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	113382960	113382960	+	Intron	DEL	T	-	-	rs76799004		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113382960delT	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						tctccatctatttttttctat	0.000										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			3	4	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	113722539	113722539	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113722539delA	uc003ynu.2	-						CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						acatgtgtctaatgaggttgt	0.000										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	115041729	115041729	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:115041729delT								CSMD3 (592487 upstream) : None (None downstream)																							TAGGGCAATCTTTTTTTTTTT	0.323													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	121828425	121828425	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121828425delA								SNTB1 (4116 upstream) : HAS2 (796846 downstream)																							gacccaaaggaggtcaatgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	123476576	123476577	+	IGR	DEL	CA	-	-	rs34145014	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123476576_123476577delCA								HAS2AS (819643 upstream) : ZHX2 (317324 downstream)																							tgtgtgcacgcacacacacaca	0.000													4	2	---	---	---	---	
ZHX2	22882	broad.mit.edu	37	8	123859744	123859744	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123859744delG	uc003ypk.1	+							NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2							cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GGTGGGTCTTGGCAACAGAGG	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	124679704	124679705	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124679704_124679705insA								KLHL38 (14514 upstream) : ANXA13 (13330 downstream)																							GATAAGAGATGAAAAGGCAGCC	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	127594165	127594165	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127594165delG								FAM84B (23699 upstream) : LOC727677 (707897 downstream)																							gaacctgggaggcagaggttg	0.025													4	2	---	---	---	---	
KCNQ3	3786	broad.mit.edu	37	8	133311869	133311869	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133311869delG	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GAATGCAAAAGGGGGAAGGAA	0.373													4	2	---	---	---	---	
LOC286094	286094	broad.mit.edu	37	8	136280773	136280774	+	Intron	DEL	TC	-	-	rs10557025		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136280773_136280774delTC	uc011ljm.1	+							NR_026706				Homo sapiens cDNA clone IMAGE:4837396.												0						AAGTGctttttctctctctctc	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	139140100	139140100	+	IGR	DEL	A	-	-	rs67513464		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139140100delA								None (None upstream) : FAM135B (2168 downstream)																							caaaaaaaagaaaaaaaaagt	0.164													4	4	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139897260	139897261	+	Intron	DEL	CA	-	-	rs72323889		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139897260_139897261delCA	uc003yvd.2	-							NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TGTGTGcacgcacacacacaca	0.416										HNSCC(7;0.00092)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140041225	140041225	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140041225delA								COL22A1 (114989 upstream) : KCNK9 (571857 downstream)																							CTTTTGTGGTAAGGGGTGTTC	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	141530799	141530800	+	IGR	INS	-	A	A	rs11383653		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141530799_141530800insA								CHRAC1 (3547 upstream) : EIF2C2 (10465 downstream)																							TGTGTTGGGGGAAAAAAAAAAA	0.411													1	5	---	---	---	---	
PTK2	5747	broad.mit.edu	37	8	141769947	141769948	+	Intron	DEL	CA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141769947_141769948delCA	uc003yvu.2	-						PTK2_uc003yvo.2_Intron|PTK2_uc011ljq.1_Intron|PTK2_uc003yvp.2_Intron|PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			ctctcTcacccacacacacaca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143042021	143042021	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143042021delC								MIR1302-7 (174347 upstream) : NCRNA00051 (237696 downstream)																							agataaatctccatggtgtca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143513747	143513748	+	IGR	INS	-	CCATCA	CCATCA	rs144949638		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143513747_143513748insCCATCA								TSNARE1 (29204 upstream) : BAI1 (31629 downstream)																							caccatcgctcccatcaccacc	0.015													6	3	---	---	---	---	
BAI1	575	broad.mit.edu	37	8	143550983	143550984	+	Intron	INS	-	GTGCATGTGT	GTGCATGTGT	rs144114675	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143550983_143550984insGTGCATGTGT	uc003ywm.2	+							NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1						axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					tgtgtatgcacgtgcatgtgtg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	144499779	144499779	+	IGR	DEL	G	-	-	rs71316887		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144499779delG								RHPN1 (33390 upstream) : MAFA (11736 downstream)																							ggacaggggtgctgggcaggg	0.139													2	4	---	---	---	---	
PYCRL	65263	broad.mit.edu	37	8	144689933	144689936	+	Intron	DEL	ACAT	-	-	rs145356628		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144689933_144689936delACAT	uc003yyy.2	-						PYCRL_uc011lkm.1_Intron|PYCRL_uc011lkn.1_Intron	NM_023078	NP_075566	Q53H96	P5CR3_HUMAN	pyrroline-5-carboxylate reductase-like						proline biosynthetic process		pyrroline-5-carboxylate reductase activity				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			gcacatgagcacatacatacacac	0.034													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	1282677	1282692	+	IGR	DEL	GAAGGAAAGAAAAAAG	-	-	rs149555615		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1282677_1282692delGAAGGAAAGAAAAAAG								DMRT2 (225124 upstream) : SMARCA2 (732650 downstream)																							aggtggaaaagaaggaaagaaaaaaggaaggaaaga	0.269													3	3	---	---	---	---	
RFX3	5991	broad.mit.edu	37	9	3232039	3232042	+	Intron	DEL	CAAG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3232039_3232042delCAAG	uc003zhr.2	-						RFX3_uc010mhd.2_Intron	NM_134428	NP_602304	P48380	RFX3_HUMAN	regulatory factor X3 isoform b						cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		gtctcaaaaacaagcaagcaagca	0.098													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	6035110	6035110	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6035110delC								RANBP6 (19470 upstream) : IL33 (180697 downstream)																							tgtgctaacaccaccaccaat	0.000													4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8319718	8319719	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8319718_8319719insT	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		aaacagtttgATGCTTTCCCCA	0.248										TSP Lung(15;0.13)			7	9	---	---	---	---	
NFIB	4781	broad.mit.edu	37	9	14187005	14187006	+	Intron	DEL	TG	-	-	rs36219499		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14187005_14187006delTG	uc003zle.2	-						NFIB_uc003zlf.2_Intron|NFIB_uc011lmo.1_Intron	NM_005596	NP_005587	O00712	NFIB_HUMAN	nuclear factor I/B						anterior commissure morphogenesis|chondrocyte differentiation|Clara cell differentiation|commissural neuron axon guidance|DNA replication|glial cell differentiation|lung ciliated cell differentiation|negative regulation of DNA binding|negative regulation of epithelial cell proliferation involved in lung morphogenesis|negative regulation of mesenchymal cell proliferation involved in lung development|positive regulation of transcription from RNA polymerase II promoter|principal sensory nucleus of trigeminal nerve development|Type I pneumocyte differentiation|Type II pneumocyte differentiation	cerebellar mossy fiber|nucleolus|nucleus	RNA polymerase II transcription corepressor activity|sequence-specific DNA binding RNA polymerase II transcription factor activity				0				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		tcttcgctcctgtgtgtgtgtg	0.124			T	MYB|HGMA2	adenoid cystic carcinoma|lipoma								1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	18378659	18378659	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18378659delT								SH3GL2 (581539 upstream) : ADAMTSL1 (95445 downstream)																							CTTTCCCTCCTTCTTCCTTCT	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	20324675	20324675	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20324675delC								SLC24A2 (535867 upstream) : MLLT3 (20293 downstream)																							TGTATCAACTCCCCCCAAAGC	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	23384663	23384664	+	IGR	DEL	AC	-	-	rs71919739		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23384663_23384664delAC								DMRTA1 (932191 upstream) : ELAVL2 (305441 downstream)																							aggggtaaatacacacacacac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	23546764	23546764	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23546764delA	uc003zpr.2	-											Homo sapiens mRNA; cDNA DKFZp781D1719 (from clone DKFZp781D1719).																		aaaagaagtgaagaagctacc	0.000													4	2	---	---	---	---	
LINGO2	158038	broad.mit.edu	37	9	28198079	28198079	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28198079delT	uc003zqu.1	-						LINGO2_uc010mjf.1_Intron|LINGO2_uc003zqv.1_Intron	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		ttacattcacttttttttttt	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	29925970	29925971	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29925970_29925971insT								None (None upstream) : None (None downstream)																							tttggttttagtttgtcagtgt	0.089													4	2	---	---	---	---	
SUGT1P1	441394	broad.mit.edu	37	9	33456212	33456213	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33456212_33456213insT	uc010mjq.1	-							NR_003667				Homo sapiens suppressor of G2 allele of SKP1 pseudogene (S. cerevisiae) (SUGT1P), non-coding RNA.												0						CATGAGGGCTCttttttttttt	0.272													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	34058573	34058573	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34058573delA								UBAP2 (9626 upstream) : DCAF12 (27808 downstream)																							acaaaaagtcaaaaaattggc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	34601870	34601872	+	IGR	DEL	GAG	-	-	rs71891438		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34601870_34601872delGAG								CNTFR (12148 upstream) : C9orf23 (8621 downstream)																							agaagagagagaggaggacagcg	0.099													1	6	---	---	---	---	
TMEM8B	51754	broad.mit.edu	37	9	35854650	35854651	+	3'UTR	INS	-	GT	GT	rs144763477	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35854650_35854651insGT	uc003zym.2	+	14					TMEM8B_uc003zyo.2_3'UTR	NM_001042589	NP_001036054	A6NDV4	TMM8B_HUMAN	transmembrane protein 8B isoform a						cell-matrix adhesion|regulation of growth|regulation of mitotic cell cycle	cell surface|endoplasmic reticulum|integral to membrane|mitochondrion|nucleus|plasma membrane	protein binding			ovary(1)	1						GTATCTGAGGGgtgtgtgtgtg	0.376													8	5	---	---	---	---	
DCAF10	79269	broad.mit.edu	37	9	37840896	37840899	+	Intron	DEL	TACT	-	-	rs77552137		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37840896_37840899delTACT	uc004aao.2	+						DCAF10_uc010mlz.2_Intron	NM_024345	NP_077321	Q5QP82	DCA10_HUMAN	WD repeat domain 32							CUL4 RING ubiquitin ligase complex				central_nervous_system(1)	1						aatatacaaatacttacgattgtg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	45378484	45378485	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45378484_45378485insT								FAM27C (386993 upstream) : FAM27A (348544 downstream)																							TCTTTCCACACtttttttatta	0.178													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66458507	66458509	+	5'Flank	DEL	CGC	-	-	rs11262323	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66458507_66458509delCGC	uc010mng.1	-						uc004aeb.2_5'UTR|uc004aec.2_Intron					Homo sapiens cDNA, FLJ98602.																		TGTTGGGGGGCGCCGCCGGAGGC	0.734													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66797667	66797668	+	IGR	DEL	TT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66797667_66797668delTT								LOC442421 (294640 upstream) : AQP7P1 (456599 downstream)																							tgaaacactctttttgtagtat	0.000													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66821222	66821223	+	IGR	DEL	CT	-	-	rs112498295		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66821222_66821223delCT								LOC442421 (318195 upstream) : AQP7P1 (433044 downstream)																							ttttgaaacactcttcttgtag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66977084	66977084	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66977084delA								LOC442421 (474057 upstream) : AQP7P1 (277183 downstream)																							cagattatagaaaaagagaga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67337092	67337092	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67337092delT								AQP7P1 (47600 upstream) : FAM27B (455838 downstream)																							ataaaaatgcttcaacaagca	0.005													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68397606	68397606	+	IGR	DEL	T	-	-	rs146336066		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68397606delT								FAM27B (603417 upstream) : MIR1299 (604633 downstream)																							TCTTTTGTGATTTTTTTTTTT	0.378													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69954700	69954700	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69954700delG								LOC100133920 (289751 upstream) : FOXD4L5 (221009 downstream)																							tcacagagttgaaatttcttt	0.000													4	2	---	---	---	---	
FXN	2395	broad.mit.edu	37	9	71658660	71658660	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71658660delT	uc004aha.2	+						FXN_uc011lrr.1_Intron|FXN_uc004agz.2_Intron	NM_000144	NP_000135	Q16595	FRDA_HUMAN	frataxin isoform 1 preproprotein						cellular iron ion homeostasis|cellular response to hydrogen peroxide|heme biosynthetic process|ion transport|iron incorporation into metallo-sulfur cluster|negative regulation of apoptosis|negative regulation of release of cytochrome c from mitochondria|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity|protein autoprocessing|regulation of ferrochelatase activity|response to iron ion	cytosol|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferric iron binding|ferrous iron binding|ferroxidase activity|iron chaperone activity|protein binding				0						tcatcacgccttgctaatttt	0.000													4	2	---	---	---	---	
TJP2	9414	broad.mit.edu	37	9	71815134	71815134	+	Intron	DEL	C	-	-	rs11315095		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71815134delC	uc004ahe.2	+						TJP2_uc011lrs.1_Intron|TJP2_uc004ahb.1_Intron|TJP2_uc011lrt.1_Intron|TJP2_uc004ahd.2_Intron|TJP2_uc004ahf.2_Intron	NM_004817	NP_004808	Q9UDY2	ZO2_HUMAN	tight junction protein 2 (zona occludens 2)						cellular component disassembly involved in apoptosis	adherens junction|cytoplasm|nucleus|tight junction	guanylate kinase activity|protein binding				0						tctgaacgggctgttccctct	0.189													4	2	---	---	---	---	
TRPM3	80036	broad.mit.edu	37	9	73267429	73267429	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73267429delG	uc004aid.2	-						TRPM3_uc004ahu.2_Intron|TRPM3_uc004ahv.2_Intron|TRPM3_uc004ahw.2_Intron|TRPM3_uc004ahx.2_Intron|TRPM3_uc004ahy.2_Intron|TRPM3_uc004ahz.2_Intron|TRPM3_uc004aia.2_Intron|TRPM3_uc004aib.2_Intron|TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						CAGGAACTTTGACACCAAGGA	0.174													4	2	---	---	---	---	
TRPM3	80036	broad.mit.edu	37	9	73692203	73692203	+	Intron	DEL	A	-	-	rs34046790		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73692203delA	uc004aid.2	-						TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron|TRPM3_uc004aii.2_Intron	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						tcactgGTTTAAAACACCAGA	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	74201547	74201554	+	IGR	DEL	TGTGTGTG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74201547_74201554delTGTGTGTG								TRPM3 (139727 upstream) : TMEM2 (96728 downstream)																							tgtgagtggatgtgtgtgtgtgtgtgtg	0.087													4	2	---	---	---	---	
TMC1	117531	broad.mit.edu	37	9	75175923	75175923	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75175923delT	uc004aiz.1	+							NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1						CAGGAGTATGTTTTTGGACAA	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	82723248	82723249	+	IGR	INS	-	A	A	rs79826015		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82723248_82723249insA								TLE4 (381591 upstream) : None (None downstream)																							tgttgttgttCAAAAAAAAAaa	0.010													4	2	---	---	---	---	
FRMD3	257019	broad.mit.edu	37	9	86066268	86066269	+	Intron	DEL	CA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86066268_86066269delCA	uc004ams.1	-						FRMD3_uc004amr.1_Intron	NM_174938	NP_777598	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2						TGCCCCACTCcacacacacaca	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	88499080	88499080	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88499080delG								AGTPBP1 (142136 upstream) : NAA35 (56977 downstream)																							tgctctccctgccgatcatgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	89308789	89308789	+	IGR	DEL	A	-	-	rs111640601		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89308789delA								ZCCHC6 (339411 upstream) : GAS1 (250490 downstream)																							gggaaaagttaaaaagttaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	92707684	92707684	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92707684delA								LOC100129066 (373010 upstream) : DIRAS2 (664430 downstream)																							GCCTGGTCTCACCTCTTCTCC	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	95922549	95922550	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95922549_95922550insA								NINJ1 (25979 upstream) : WNK2 (24662 downstream)																							agcagccaaagaaaaaaaaata	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	96197742	96197743	+	IGR	DEL	TC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96197742_96197743delTC								C9orf129 (89046 upstream) : FAM120AOS (1153 downstream)																							cacctccttttctctctctctc	0.233													4	2	---	---	---	---	
C9orf3	84909	broad.mit.edu	37	9	97776754	97776754	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97776754delA	uc004ava.2	+						C9orf3_uc004auy.2_Intron|C9orf3_uc004auz.1_Intron|C9orf3_uc004avc.2_Intron|C9orf3_uc011luj.1_Intron|C9orf3_uc011luk.1_Intron|C9orf3_uc004avd.2_Intron|C9orf3_uc004ave.1_Intron	NM_032823	NP_116212	Q8N6M6	AMPO_HUMAN	aminopeptidase O						leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		accctgtttcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
HSD17B3	3293	broad.mit.edu	37	9	99055944	99055945	+	Intron	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99055944_99055945delTG	uc004awa.1	-						HSD17B3_uc010msc.1_Intron	NM_000197	NP_000188	P37058	DHB3_HUMAN	estradiol 17 beta-dehydrogenase 3						androgen biosynthetic process|male genitalia development	endoplasmic reticulum membrane|microsome	binding|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity				0		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)			NADH(DB00157)	tgtgtgtgtatgtgtgtgtgtg	0.074													4	3	---	---	---	---	
SLC35D2	11046	broad.mit.edu	37	9	99093780	99093780	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99093780delT	uc004awc.2	-						SLC35D2_uc010msd.2_Intron|SLC35D2_uc010mse.2_Intron|SLC35D2_uc010msf.2_Intron|SLC35D2_uc004awd.2_Intron	NM_007001	NP_008932	Q76EJ3	S35D2_HUMAN	solute carrier family 35, member D2							Golgi membrane|integral to membrane	nucleotide-sugar transmembrane transporter activity				0		Acute lymphoblastic leukemia(62;0.0167)				cctccctccctttTTTTTTct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	100504458	100504459	+	IGR	INS	-	AAG	AAG	rs138487704	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100504458_100504459insAAG								XPA (44767 upstream) : FOXE1 (111078 downstream)																							agaaggaagaaaagaagaagaa	0.045													8	4	---	---	---	---	
C9orf84	158401	broad.mit.edu	37	9	114486630	114486630	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114486630delT	uc004bfr.2	-						C9orf84_uc011lwt.1_Intron|C9orf84_uc004bfq.2_Intron|C9orf84_uc010mug.2_Intron	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1											ovary(2)	2						ttttcttttcttttttttaag	0.080													4	2	---	---	---	---	
C9orf84	158401	broad.mit.edu	37	9	114546279	114546279	+	5'Flank	DEL	T	-	-	rs35280722		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114546279delT	uc004bfr.2	-						C9orf84_uc011lwt.1_Intron|C9orf84_uc004bfs.1_Intron	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1											ovary(2)	2						ggacatcctgttttgtgggtg	0.000													4	2	---	---	---	---	
DAB2IP	153090	broad.mit.edu	37	9	124350208	124350208	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124350208delG	uc004bln.2	+							NM_032552	NP_115941	Q5VWQ8	DAB2P_HUMAN	disabled homolog 2 interacting protein isoform						activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2						acatttacctggcatcttgta	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132200169	132200172	+	IGR	DEL	AGAG	-	-	rs71798453		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132200169_132200172delAGAG								C9orf106 (115287 upstream) : C9orf50 (174334 downstream)																							gcctggaaacagagaacggtggga	0.240													4	2	---	---	---	---	
EXOSC2	23404	broad.mit.edu	37	9	133572545	133572545	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133572545delA	uc004bzu.2	+						EXOSC2_uc011mbz.1_Intron|EXOSC2_uc011mca.1_Intron	NM_014285	NP_055100	Q13868	EXOS2_HUMAN	exosome component 2						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|positive regulation of cell growth|rRNA processing	cytosol|exosome (RNase complex)|nucleolus	3'-5'-exoribonuclease activity|7S RNA binding|protein binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		aggaactagcaaaggggcttg	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	134218805	134218805	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134218805delT								PPAPDC3 (34156 upstream) : BAT2L1 (50795 downstream)																							gatcctgtcattatgatgtta	0.000													4	2	---	---	---	---	
MED27	9442	broad.mit.edu	37	9	134813217	134813217	+	Intron	DEL	T	-	-	rs71501288		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134813217delT	uc004cbe.1	-						MED27_uc004cbf.1_Intron|MED27_uc011mco.1_Intron	NM_004269	NP_004260	Q6P2C8	MED27_HUMAN	mediator complex subunit 27						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleolus|transcription factor complex	protein binding|transcription coactivator activity			skin(1)	1		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		TGAGGCAGACttttttttttt	0.274													4	4	---	---	---	---	
MED27	9442	broad.mit.edu	37	9	134819918	134819918	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134819918delT	uc004cbe.1	-						MED27_uc004cbf.1_Intron|MED27_uc011mco.1_Intron|MED27_uc004cbg.3_Intron	NM_004269	NP_004260	Q6P2C8	MED27_HUMAN	mediator complex subunit 27						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleolus|transcription factor complex	protein binding|transcription coactivator activity			skin(1)	1		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		Gtttttagtcttttttttttt	0.164													3	3	---	---	---	---	
VAV2	7410	broad.mit.edu	37	9	136657280	136657281	+	Intron	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136657280_136657281delTG	uc004ces.2	-						VAV2_uc004cer.2_Intron|VAV2_uc004cet.1_5'Flank	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		tgtgtgtgactgtgtgtgtgta	0.134													4	2	---	---	---	---	
VAV2	7410	broad.mit.edu	37	9	136798604	136798611	+	Intron	DEL	TGGATGGA	-	-	rs111702861		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136798604_136798611delTGGATGGA	uc004ces.2	-						VAV2_uc004cer.2_Intron	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		aatggatgagtggatggatggatggatg	0.053													3	5	---	---	---	---	
OLFM1	10439	broad.mit.edu	37	9	137976345	137976348	+	Intron	DEL	TCTC	-	-	rs10586568		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137976345_137976348delTCTC	uc004cfl.3	+						OLFM1_uc004cfk.3_Intron	NM_014279	NP_055094	Q99784	NOE1_HUMAN	olfactomedin related ER localized protein						nervous system development	endoplasmic reticulum lumen	protein binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		tctcctctcttctctctcctctct	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	141037337	141037338	+	IGR	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141037337_141037338delTG								CACNA1B (18262 upstream) : TUBBP5 (7227 downstream)																							GACAGCGACTtgtgtgtgtgtg	0.302													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	2266777	2266777	+	IGR	DEL	T	-	-	rs67206855		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2266777delT								ADARB2 (487059 upstream) : PFKP (842975 downstream)																							CACAGttttgttttttttttt	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	2279174	2279175	+	IGR	DEL	AC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2279174_2279175delAC								ADARB2 (499456 upstream) : PFKP (830577 downstream)																							TGAAAGAAATACAAAGACTTGA	0.436													4	2	---	---	---	---	
FBXO18	84893	broad.mit.edu	37	10	5958667	5958668	+	Intron	INS	-	AG	AG	rs137889600	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5958667_5958668insAG	uc001iis.2	+						FBXO18_uc001iir.2_Intron|FBXO18_uc009xig.2_Intron|FBXO18_uc001iit.2_Intron	NM_178150	NP_835363	Q8NFZ0	FBX18_HUMAN	F-box only protein, helicase, 18 isoform 2						DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(2)|skin(1)	3						GATGGGGGAACGGGAAGTGTTA	0.515													4	2	---	---	---	---	
CCDC3	83643	broad.mit.edu	37	10	13126287	13126288	+	Intron	INS	-	A	A	rs71386146		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13126287_13126288insA	uc001ilr.2	-						CCDC3_uc009xjc.1_Intron|uc009xjd.1_Intron			Q9BQI4	CCDC3_HUMAN	Homo sapiens MSTP151 (MST151) mRNA, complete cds.							endoplasmic reticulum|extracellular region				ovary(1)	1		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)			cttttcttttcttttttttttt	0.000													4	2	---	---	---	---	
FRMD4A	55691	broad.mit.edu	37	10	14249685	14249686	+	Intron	INS	-	CA	CA	rs71951238		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14249685_14249686insCA	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imv.2_Intron	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						TCCTAGGTAACcacacacacac	0.064													4	2	---	---	---	---	
NMT2	9397	broad.mit.edu	37	10	15159706	15159707	+	Intron	DEL	AC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15159706_15159707delAC	uc001inz.1	-						NMT2_uc001ioa.1_Intron|NMT2_uc009xjo.1_Intron|NMT2_uc010qbz.1_Intron	NM_004808	NP_004799	O60551	NMT2_HUMAN	N-myristoyltransferase 2						N-terminal protein myristoylation|protein lipoylation	Golgi apparatus|plasma membrane	glycylpeptide N-tetradecanoyltransferase activity			ovary(1)	1						taggatacaaacacacaaaaga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	17591761	17591761	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17591761delA								ST8SIA6 (95507 upstream) : PTPLA (40199 downstream)																							TTCTGAATGGAAAAAAAAAAA	0.368													4	2	---	---	---	---	
MLLT10	8028	broad.mit.edu	37	10	21875206	21875206	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21875206delT	uc001iqs.2	+						MLLT10_uc001iqt.2_Intron|MLLT10_uc001iqv.2_Intron|MLLT10_uc001iqy.2_Intron|MLLT10_uc009xke.1_Intron|MLLT10_uc001iqw.1_Intron|MLLT10_uc001iqx.1_Intron|MLLT10_uc009xkf.1_Intron	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						TACCTGTTTCTTTTTTTTTTT	0.338			T	MLL|PICALM|CDK6	AL								7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	29109983	29109984	+	IGR	DEL	CC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29109983_29109984delCC								BAMBI (138115 upstream) : LYZL1 (468006 downstream)																							atctcttcttcctccctctagt	0.119													4	2	---	---	---	---	
SVIL	6840	broad.mit.edu	37	10	29936567	29936568	+	Intron	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29936567_29936568delTG	uc001iuu.1	-						SVIL_uc009xld.1_Intron	NM_003174	NP_003165	O95425	SVIL_HUMAN	supervillin isoform 1						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				tgtgtgtgtttgtgtgtgtgtg	0.327													3	3	---	---	---	---	
SVIL	6840	broad.mit.edu	37	10	29980600	29980600	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29980600delC	uc001iuu.1	-						SVIL_uc009xld.1_Intron	NM_003174	NP_003165	O95425	SVIL_HUMAN	supervillin isoform 1						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				GCTTATCTCTCAAATGAGTGT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	32039947	32039948	+	IGR	INS	-	A	A	rs146627394	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32039947_32039948insA								ZEB1 (221820 upstream) : ARHGAP12 (55277 downstream)																							aaaaaacacacaaaaaaaacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34222572	34222573	+	IGR	DEL	AC	-	-	rs66543205		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34222572_34222573delAC								NRP1 (598566 upstream) : PARD3 (177525 downstream)																							attgtgagatacacacacacac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38562340	38562341	+	IGR	INS	-	TA	TA	rs146712221	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38562340_38562341insTA								LOC100129055 (59068 upstream) : HSD17B7P2 (82967 downstream)																							ctctctctccctATATATATAT	0.213													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38804244	38804253	+	IGR	DEL	GACTGGAAAG	-	-	rs10827873	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38804244_38804253delGACTGGAAAG								LOC399744 (63164 upstream) : None (None downstream)																							caattgactcgactggaaaggaatggaatg	0.010													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38939264	38939265	+	IGR	INS	-	AG	AG	rs142390219	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38939264_38939265insAG								LOC399744 (198184 upstream) : None (None downstream)																							CTTGGTTTAAAAAAAAAGAGCA	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	39111151	39111152	+	IGR	INS	-	TTCGT	TTCGT			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39111151_39111152insTTCGT								LOC399744 (370071 upstream) : None (None downstream)																							attgcattccattccattccat	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42370636	42370637	+	IGR	INS	-	T	T	rs145059442		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42370636_42370637insT								None (None upstream) : LOC441666 (456678 downstream)																							gttcccttccattggggtgatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42617334	42617334	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42617334delC								None (None upstream) : LOC441666 (209981 downstream)																							ttctttgtttctttgccttcc	0.030													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42653435	42653436	+	IGR	DEL	AT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42653435_42653436delAT								None (None upstream) : LOC441666 (173879 downstream)																							AAACTCTAACATAAACATTTCC	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42659683	42659684	+	IGR	INS	-	AA	AA			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42659683_42659684insAA								None (None upstream) : LOC441666 (167631 downstream)																							GGTATGTTCACAAAAAAAGTAA	0.312													4	2	---	---	---	---	
ZNF37B	100129482	broad.mit.edu	37	10	43012142	43012143	+	RNA	DEL	CT	-	-	rs56062397		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43012142_43012143delCT	uc001jab.3	-	5		c.7057_7058delAG			ZNF37B_uc001jac.3_RNA|ZNF37B_uc001jaa.3_RNA					Homo sapiens cDNA: FLJ23327 fis, clone HEP12630, highly similar to HSZNF37 Homo sapiens ZNF37A mRNA for zinc finger protein.												0						TCTCCTCCCCCTGTCCCTTCCA	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	44820958	44820959	+	IGR	DEL	GT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44820958_44820959delGT								HNRNPA3P1 (535093 upstream) : CXCL12 (44648 downstream)																							GTGTTTTGTGGTGTGTGTGTGT	0.450													4	2	---	---	---	---	
FRMPD2	143162	broad.mit.edu	37	10	49444112	49444112	+	Intron	DEL	T	-	-	rs112112427		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49444112delT	uc001jgi.2	-						FRMPD2_uc001jgh.2_Intron|FRMPD2_uc001jgj.2_Intron	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3						tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		ttgttttttgttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	50476949	50476949	+	IGR	DEL	T	-	-	rs34518544		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50476949delT								C10orf128 (80542 upstream) : C10orf71 (30238 downstream)																							caaaagaccctgttgggagga	0.000													4	2	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	61881137	61881137	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61881137delA	uc001jky.2	-						ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jla.1_Intron|ANK3_uc001jlb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						aaaatgcaccaaaaaaaaaaa	0.000													5	3	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	62348509	62348509	+	Intron	DEL	A	-	-	rs79386264		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62348509delA	uc001jkz.3	-							NM_001149	NP_001140	Q12955	ANK3_HUMAN	ankyrin 3 isoform 2						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						tacagaaaataaaaaaaaaca	0.000													5	3	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73523520	73523520	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73523520delG	uc001jrx.3	+						C10orf54_uc001jsd.2_Intron|C10orf54_uc001jse.2_Intron|C10orf54_uc009xqm.2_Intron|C10orf54_uc001jsf.1_Intron	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						cttggtacttgggagctAGAC	0.219													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	74044765	74044766	+	IGR	INS	-	T	T	rs146917143		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74044765_74044766insT								DDIT4 (8968 upstream) : DNAJB12 (47822 downstream)																							ctggcTGTGACttttttttttt	0.015													2	4	---	---	---	---	
CCDC109A	90550	broad.mit.edu	37	10	74517175	74517175	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74517175delC	uc001jtc.2	+						CCDC109A_uc009xqp.1_Intron|CCDC109A_uc009xqq.1_Intron|CCDC109A_uc010qjy.1_Intron|CCDC109A_uc009xqr.2_Intron|CCDC109A_uc001jtd.2_Intron	NM_138357	NP_612366	Q8NE86	MCU_HUMAN	coiled-coil domain containing 109A						elevation of mitochondrial calcium ion concentration|mitochondrial calcium ion transport|protein complex oligomerization	integral to membrane|mitochondrial inner membrane	protein binding				0	Prostate(51;0.0198)					CCTTCTTCCTCCTACTTCCCC	0.363													4	2	---	---	---	---	
SAMD8	142891	broad.mit.edu	37	10	76886946	76886946	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76886946delA	uc001jwx.1	+						SAMD8_uc001jwy.1_Intron	NM_144660	NP_653261	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8						sphingomyelin biosynthetic process	integral to membrane					0	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					actctgtctcaaaaaaaaaaa	0.095													3	3	---	---	---	---	
C10orf11	83938	broad.mit.edu	37	10	77800329	77800330	+	Intron	DEL	TC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77800329_77800330delTC	uc001jxi.2	+							NM_032024	NP_114413	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)					TCACActctttctctctctctc	0.450													4	2	---	---	---	---	
ZMIZ1	57178	broad.mit.edu	37	10	80951130	80951131	+	Intron	INS	-	G	G	rs149086627	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80951130_80951131insG	uc001kaf.2	+						ZMIZ1_uc001kae.2_Intron	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			AGCTGGTGGTCGGGGGGGGTCC	0.564													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	83216741	83216744	+	IGR	DEL	TGTG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83216741_83216744delTGTG								SH2D4B (810425 upstream) : NRG3 (418326 downstream)																							tatatttatatgtgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	87150422	87150423	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87150422_87150423insA								FAM190B (872146 upstream) : GRID1 (208889 downstream)																							gaagtagccagaaaaaaaaagg	0.005													4	2	---	---	---	---	
KIF11	3832	broad.mit.edu	37	10	94361934	94361934	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94361934delT	uc001kic.2	+						KIF11_uc010qnq.1_Intron	NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11						blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1						ttgttgaggatttttttttat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	102432122	102432123	+	IGR	INS	-	C	C	rs71888807		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102432122_102432123insC								HIF1AN (118442 upstream) : PAX2 (73345 downstream)																							tcttctttcttctttcttcctt	0.109													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	113885866	113885867	+	IGR	DEL	AG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113885866_113885867delAG								None (None upstream) : GPAM (23755 downstream)																							ggaaacaggcagagagagAGAG	0.267													4	2	---	---	---	---	
KIAA1598	57698	broad.mit.edu	37	10	118828125	118828125	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118828125delA	uc010qsq.1	-							NM_018330	NP_060800	A0MZ66	SHOT1_HUMAN	shootin1 isoform b						axon guidance	axon					0				all cancers(201;0.00494)		actccatctgaaaaaaaaaaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	126032400	126032400	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126032400delG								CHST15 (179194 upstream) : OAT (53472 downstream)																							TCTGGCTCCTGGGGGAGGCAA	0.552													4	2	---	---	---	---	
DHX32	55760	broad.mit.edu	37	10	127578794	127578795	+	Intron	DEL	AT	-	-	rs5788723		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127578794_127578795delAT	uc001ljg.1	-							NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TTTGAAAAACATATTTCTAACA	0.297													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130695561	130695562	+	IGR	INS	-	AGAGAGAG	AGAGAGAG	rs12358287	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130695561_130695562insAGAGAGAG								MKI67 (771093 upstream) : MGMT (569892 downstream)																							gagagagagacagagagagaga	0.381													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134825215	134825216	+	IGR	DEL	AG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134825215_134825216delAG								C10orf93 (69151 upstream) : GPR123 (59217 downstream)																							gatgtgtgttagtgtgtgatgt	0.035													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	4886680	4886680	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4886680delA								OR51S1 (16242 upstream) : OR51T1 (16369 downstream)																							GATATGAACCAAAAAAACTAT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	7185487	7185498	+	IGR	DEL	AAAAGTAGTAAT	-	-	rs139170680		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7185487_7185498delAAAAGTAGTAAT								RBMXL2 (73108 upstream) : MIR302E (70499 downstream)																							cctaatgctgaaaagtagtaataaaagagaaa	0.000													4	2	---	---	---	---	
SYT9	143425	broad.mit.edu	37	11	7426324	7426324	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7426324delA	uc001mfe.2	+						SYT9_uc001mfd.2_Intron|SYT9_uc009yfi.2_Intron	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN	synaptotagmin IX							cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		tgtcaaggttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
MICAL2	9645	broad.mit.edu	37	11	12246525	12246526	+	Intron	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12246525_12246526delTG	uc001mjz.2	+						MICAL2_uc010rch.1_Intron|MICAL2_uc001mka.2_Intron|MICAL2_uc010rci.1_Intron|MICAL2_uc001mkb.2_Intron|MICAL2_uc001mkc.2_Intron|MICAL2_uc001mkd.2_Intron|MICAL2_uc010rcj.1_Intron	NM_014632	NP_055447	O94851	MICA2_HUMAN	microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)		CTGATTACTCTGTCAGCAGTGT	0.406													4	2	---	---	---	---	
TEAD1	7003	broad.mit.edu	37	11	12805031	12805031	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12805031delG	uc001mkj.3	+							NM_021961	NP_068780	P28347	TEAD1_HUMAN	TEA domain family member 1						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		ATTTATTTGTGAACACCTCTC	0.443													4	2	---	---	---	---	
RRAS2	22800	broad.mit.edu	37	11	14365215	14365215	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14365215delA	uc001mlf.3	-						RRAS2_uc009ygq.2_Intron|RRAS2_uc010rco.1_Intron	NM_012250	NP_036382	P62070	RRAS2_HUMAN	related RAS viral (r-ras) oncogene homolog 2							endoplasmic reticulum|plasma membrane	GTP binding|GTPase activity|protein binding			breast(1)	1				Epithelial(150;0.203)		cgtctctaccaaaaaaaatac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	15366453	15366454	+	IGR	DEL	AG	-	-	rs5789878		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15366453_15366454delAG								INSC (97701 upstream) : SOX6 (621542 downstream)																							ggaaagacaaagagagagacag	0.208													2	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	18226406	18226406	+	IGR	DEL	A	-	-	rs149537596	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18226406delA								MRGPRX4 (30579 upstream) : LOC494141 (4279 downstream)																							agattgccccacctagcctac	0.000													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19744935	19744938	+	Intron	DEL	GTGT	-	-	rs141735916		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19744935_19744938delGTGT	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						ggtatagacagtgtgtggcaggat	0.093													3	3	---	---	---	---	
NELL1	4745	broad.mit.edu	37	11	21494415	21494415	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21494415delC	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron|NELL1_uc001mqg.2_Intron|NELL1_uc001mqh.2_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						ttccttctttccttcTATTTA	0.189													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	23213920	23213931	+	IGR	DEL	AAGATGAAGAAG	-	-	rs71037571		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:23213920_23213931delAAGATGAAGAAG								SVIP (362538 upstream) : None (None downstream)																							tggaagaagtaagatgaagaagaagtatggaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	26953369	26953370	+	IGR	DEL	GT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26953369_26953370delGT								SLC5A12 (208395 upstream) : FIBIN (62258 downstream)																							tcaacagatggtgtgtgtgtgt	0.178													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	32346655	32346659	+	IGR	DEL	AAAAC	-	-	rs113268686		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32346655_32346659delAAAAC								RCN1 (219384 upstream) : WT1 (62666 downstream)																							aaaaaagaaaaaaacaaaacaaaac	0.234													4	2	---	---	---	---	
LMO2	4005	broad.mit.edu	37	11	33892748	33892751	+	5'Flank	DEL	TGTG	-	-	rs141132884		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33892748_33892751delTGTG	uc001mve.2	-						LMO2_uc001mvd.2_5'Flank|LMO2_uc010rel.1_5'Flank|LMO2_uc010rem.1_Intron	NM_001142316	NP_001135788	P25791	RBTN2_HUMAN	LIM domain only 2 isoform 2						multicellular organismal development	nucleus	protein binding|zinc ion binding			lung(1)	1						AATCAAAAGCtgtgtgtgtgtgtg	0.333			T	TRD@	T-ALL								4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	38839200	38839200	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38839200delC								None (None upstream) : None (None downstream)																							GAAAACAAAACAAAACCTACA	0.174													4	2	---	---	---	---	
LRRC4C	57689	broad.mit.edu	37	11	40158714	40158715	+	Intron	DEL	GT	-	-	rs71936348		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40158714_40158715delGT	uc001mxa.1	-						LRRC4C_uc001mxc.1_Intron|LRRC4C_uc001mxd.1_Intron|LRRC4C_uc001mxb.1_Intron	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				ACGTGGGCACgtgtgtgtgtgt	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	44718603	44718604	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44718603_44718604insT								CD82 (77290 upstream) : TSPAN18 (163275 downstream)																							taatttttgtattttttttttt	0.000													4	2	---	---	---	---	
TSPAN18	90139	broad.mit.edu	37	11	44879445	44879446	+	5'Flank	DEL	AT	-	-	rs79405632		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44879445_44879446delAT	uc001mye.3	+							NM_130783	NP_570139	Q96SJ8	TSN18_HUMAN	tetraspanin 18 isoform 2							integral to membrane					0						GCCAACAGTCATGTGCACACAT	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48352565	48352566	+	IGR	INS	-	A	A	rs148779169	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48352565_48352566insA								OR4C3 (5085 upstream) : OR4C45 (14336 downstream)																							ttccagtcCTCATCATCTTTTc	0.094													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48765500	48765501	+	IGR	INS	-	G	G	rs61930777		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48765500_48765501insG								OR4A47 (254228 upstream) : FOLH1 (402687 downstream)																							ctgtctagtttcatgggaagat	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	49104012	49104027	+	IGR	DEL	GTGTCTCCAAGAGGAC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49104012_49104027delGTGTCTCCAAGAGGAC								OR4A47 (592740 upstream) : FOLH1 (64161 downstream)																							AAGAAATCTGGTGTCTCCAAGAGGACTCAAAACAAA	0.384													16	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	51580273	51580274	+	IGR	INS	-	A	A	rs148326824		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51580273_51580274insA								OR4C46 (64064 upstream) : None (None downstream)																							ctgctccgtctaaaggaatgtt	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	56071047	56071047	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56071047delT								OR8H1 (12509 upstream) : OR8K3 (14736 downstream)																							atgttgagcgttttttatatg	0.000													4	2	---	---	---	---	
SLC43A1	8501	broad.mit.edu	37	11	57285739	57285739	+	5'Flank	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57285739delT	uc001nkl.2	-							NM_003627	NP_003618	O75387	LAT3_HUMAN	solute carrier family 43, member 1						cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	neutral amino acid transmembrane transporter activity				0						ttttcttttcttttttcctga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	57684080	57684080	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57684080delA								CTNND1 (97429 upstream) : OR9Q1 (107273 downstream)																							acccttttggaaggcctgagg	0.015													4	2	---	---	---	---	
TCN1	6947	broad.mit.edu	37	11	59631246	59631250	+	Intron	DEL	TTACC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59631246_59631250delTTACC	uc001noj.2	-							NM_001062	NP_001053	P20061	TCO1_HUMAN	transcobalamin I precursor						cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding			ovary(2)	2		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CATGTTTCTGTTACCTCAAGTTTGG	0.366													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	59733465	59733466	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59733465_59733466insT	uc001nok.1	+											Homo sapiens mRNA for hypothetical protein, partial sequence, clone:Hsa11-digit01-13-09-F.																		TGTTGTTGTTGTTTTTTAAAAT	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	63539455	63539456	+	IGR	INS	-	AGG	AGG	rs140059095	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63539455_63539456insAGG								C11orf95 (3342 upstream) : C11orf84 (41467 downstream)																							ggaggaggagaaggaggaggag	0.069													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69022955	69022956	+	IGR	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs138479991	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69022955_69022956insGTGTGTGTGT								TPCN2 (93048 upstream) : MYEOV (38666 downstream)																							CATTGGAAATGgtgtgtgtgtg	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69602564	69602564	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69602564delA								FGF4 (12393 upstream) : FGF3 (22173 downstream)																							TTCACCAGGCAGGAGGAAGTG	0.333													4	2	---	---	---	---	
PDE2A	5138	broad.mit.edu	37	11	72314333	72314333	+	Intron	DEL	T	-	-	rs33965768		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72314333delT	uc010rrc.1	-						PDE2A_uc001oso.2_Intron|PDE2A_uc010rra.1_Intron|PDE2A_uc001osn.2_Intron|PDE2A_uc010rrb.1_Intron|PDE2A_uc010rrd.1_Intron	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	TTTTAATTGCTTTTTTTTTTG	0.458													4	3	---	---	---	---	
FAM168A	23201	broad.mit.edu	37	11	73262155	73262156	+	Intron	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73262155_73262156insA	uc001otz.1	-						FAM168A_uc001oty.1_Intron|FAM168A_uc009ytp.1_Intron	NM_015159	NP_055974	Q92567	F168A_HUMAN	hypothetical protein LOC23201												0						gactctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
FAM168A	23201	broad.mit.edu	37	11	73311222	73311225	+	5'Flank	DEL	TTTG	-	-	rs113111322		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73311222_73311225delTTTG	uc001otz.1	-						FAM168A_uc001oty.1_5'Flank|FAM168A_uc009ytp.1_5'Flank	NM_015159	NP_055974	Q92567	F168A_HUMAN	hypothetical protein LOC23201												0						TGAATTCTTTtttgtttgtttgtt	0.172													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	76140991	76140991	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76140991delT								PRKRIR (49111 upstream) : C11orf30 (15078 downstream)																							agaatccttcttttttttttc	0.000													5	3	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76889271	76889274	+	Intron	DEL	TCAC	-	-	rs142729329		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76889271_76889274delTCAC	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_5'Flank|MYO7A_uc009yut.1_5'Flank	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						gcccacctattcacccatccatcc	0.039													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	80292992	80292992	+	IGR	DEL	A	-	-	rs147116191		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80292992delA								None (None upstream) : None (None downstream)																							agttcctcacaaaaactgaac	0.129													5	4	---	---	---	---	
CCDC81	60494	broad.mit.edu	37	11	86091664	86091664	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86091664delT	uc001pbx.1	+						CCDC81_uc001pbw.1_Intron	NM_001156474	NP_001149946	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81 isoform 1											skin(1)	1		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				atattctgggttttttttttc	0.000													4	2	---	---	---	---	
ME3	10873	broad.mit.edu	37	11	86349172	86349173	+	Intron	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86349172_86349173insA	uc001pbz.2	-						ME3_uc001pca.2_Intron|ME3_uc009yvk.2_Intron|ME3_uc010rtr.1_Intron	NM_001014811	NP_001014811	Q16798	MAON_HUMAN	mitochondrial malic enzyme 3 precursor						aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding			ovary(1)	1		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)			NADH(DB00157)	AAATGGTGTACCTCTGACTTTT	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	87203470	87203475	+	IGR	DEL	AAAAAG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87203470_87203475delAAAAAG								TMEM135 (168902 upstream) : RAB38 (642956 downstream)																							gttgctgtgaAAAAAGAAAAAGAAGA	0.165													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	88123200	88123200	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88123200delG								CTSC (52259 upstream) : GRM5 (114545 downstream)																							TGCTGGAGTAGGAAATGGATG	0.537													4	2	---	---	---	---	
PIWIL4	143689	broad.mit.edu	37	11	94316211	94316212	+	Intron	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94316211_94316212delTG	uc001pfa.2	+						PIWIL4_uc010rue.1_Intron|PIWIL4_uc009ywk.1_Intron	NM_152431	NP_689644	Q7Z3Z4	PIWL4_HUMAN	piwi-like 4						cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|meiosis|multicellular organismal development|piRNA metabolic process|regulation of translation|spermatogenesis	nucleus|piP-body	piRNA binding			skin(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				tatatatatatgtgtgtgtgtg	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	95345993	95345993	+	IGR	DEL	T	-	-	rs34975788		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95345993delT								SESN3 (380288 upstream) : FAM76B (156113 downstream)																							ataaaaatcctttttaaaaga	0.000													2	5	---	---	---	---	
CNTN5	53942	broad.mit.edu	37	11	100226729	100226733	+	Intron	DEL	ACTCT	-	-	rs7119036	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100226729_100226733delACTCT	uc001pga.2	+						CNTN5_uc001pgb.2_Intron|CNTN5_uc010ruk.1_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TATAAAGAACACTCTCATCAGAAAC	0.337													5	6	---	---	---	---	
ARHGAP42	143872	broad.mit.edu	37	11	100791409	100791409	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100791409delT	uc001pge.2	+							NM_152432	NP_689645	A6NI28	RHG42_HUMAN	Rho-type GTPase-activating protein FLJ32810						filopodium assembly|signal transduction	intracellular	cytoskeletal adaptor activity|GTPase activator activity|SH3 domain binding				0						GAGAGAGGCATTGTCTAAAAG	0.378													4	2	---	---	---	---	
DSCAML1	57453	broad.mit.edu	37	11	117337839	117337840	+	Intron	INS	-	AC	AC	rs146652266	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117337839_117337840insAC	uc001prh.1	-							NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GGGGCTGGAAAACTCTCATCCC	0.614													3	3	---	---	---	---	
ASAM	79827	broad.mit.edu	37	11	122962586	122962587	+	Intron	INS	-	C	C	rs148574164	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122962586_122962587insC	uc001pyt.2	-							NM_024769	NP_079045	Q9H6B4	CLMP_HUMAN	adipocyte-specific adhesion molecule precursor							integral to membrane|tight junction					0		Breast(109;0.0025)|Lung NSC(97;0.0179)|all_lung(97;0.0182)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.73e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		TGAAGGCTTGGCTTCTGAAGGT	0.490													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	123871148	123871148	+	IGR	DEL	G	-	-	rs146052242		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123871148delG								OR10S1 (22750 upstream) : OR10G4 (15134 downstream)																							GGGGCAATGTGGGGAGGCACG	0.438													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	124722940	124722940	+	IGR	DEL	A	-	-	rs66459655		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124722940delA								C11orf61 (52641 upstream) : ROBO3 (12342 downstream)																							accctgtcttaaaaaaaaaaa	0.085													3	4	---	---	---	---	
ROBO3	64221	broad.mit.edu	37	11	124738179	124738179	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124738179delC	uc001qbc.2	+							NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3						axon midline choice point recognition	integral to membrane	receptor activity			breast(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		TCCCGTCTTGCCTTTCATAAG	0.527											OREG0021466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	128749892	128749893	+	IGR	INS	-	G	G	rs147911201	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128749892_128749893insG								KCNJ1 (12624 upstream) : KCNJ5 (11420 downstream)																							GGCCTAGGCTTGGTACTAGGAT	0.589													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	129232346	129232347	+	IGR	INS	-	CT	CT			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129232346_129232347insCT								ARHGAP32 (170253 upstream) : BARX2 (13534 downstream)																							ttgaatccacactctataacat	0.000													4	2	---	---	---	---	
KDM5A	5927	broad.mit.edu	37	12	498268	498269	+	5'UTR	DEL	GG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:498268_498269delGG	uc001qif.1	-	1					KDM5A_uc001qie.1_5'UTR|CCDC77_uc009zdk.2_5'Flank|CCDC77_uc010sdp.1_5'Flank|KDM5A_uc010sdn.1_5'UTR|KDM5A_uc010sdo.1_5'UTR	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1						chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						TGCAACGGCCGGGGGGGGGGGG	0.688			T 	NUP98	AML								8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	780591	780591	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:780591delA								NINJ2 (7836 upstream) : WNK1 (81634 downstream)																							agactcatctaaaaaaaaaaa	0.000													4	4	---	---	---	---	
WNK1	65125	broad.mit.edu	37	12	936687	936689	+	Intron	DEL	TTG	-	-	rs80189368		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:936687_936689delTTG	uc001qio.3	+						WNK1_uc001qip.3_Intron	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			ATAGCCTTTTttgttgttgttgt	0.143													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	1772962	1772963	+	IGR	INS	-	AGG	AGG	rs112021138		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1772962_1772963insAGG								WNT5B (16585 upstream) : ADIPOR2 (27284 downstream)																							ggaaggagggaaaggagggaag	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	2141160	2141161	+	IGR	DEL	TG	-	-	rs147494447		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2141160_2141161delTG								DCP1B (27483 upstream) : CACNA1C (21255 downstream)																							tgagtgtgtttgtgtgtgtgtg	0.337													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	2870717	2870718	+	IGR	DEL	CA	-	-	rs141525806		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2870717_2870718delCA								CACNA1C (63602 upstream) : FKBP4 (33390 downstream)																							cacacacatgcacacacacaca	0.322													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	3160466	3160483	+	IGR	DEL	TTCTTTCTTTCTTTTTCT	-	-	rs74214852		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3160466_3160483delTTCTTTCTTTCTTTTTCT								TEAD4 (10625 upstream) : TSPAN9 (26074 downstream)																							ccttccttccttctttctttctttttctttctttcttt	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5111235	5111235	+	IGR	DEL	T	-	-	rs72277523		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5111235delT								KCNA1 (83815 upstream) : KCNA5 (41850 downstream)																							TACAGTCTTGTTTTTTTTTTA	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	8128587	8128588	+	IGR	INS	-	AA	AA			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8128587_8128588insAA								SLC2A3 (39695 upstream) : FOXJ2 (56771 downstream)																							CCATTGTTGGTaaaaaaaaaaa	0.228													4	2	---	---	---	---	
LOC389634	389634	broad.mit.edu	37	12	8533659	8533660	+	Intron	INS	-	GGT	GGT			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8533659_8533660insGGT	uc001quk.3	-							NR_024420				Homo sapiens cDNA FLJ90405 fis, clone NT2RP2006099.												0						CTGAGGGATAAGGTGGGGGGCA	0.584													4	2	---	---	---	---	
DDX12	440081	broad.mit.edu	37	12	9578923	9578925	+	Intron	DEL	TCC	-	-	rs78084511		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9578923_9578925delTCC	uc010sgs.1	-							NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						CAACGCAGTGTCCTCCTCAGGGG	0.571													4	2	---	---	---	---	
GRIN2B	2904	broad.mit.edu	37	12	13720620	13720620	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13720620delG	uc001rbt.2	-							NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TGGGCATGCTGGATGGATGAA	0.448													4	2	---	---	---	---	
PLBD1	79887	broad.mit.edu	37	12	14687478	14687478	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14687478delT	uc001rcc.1	-							NM_024829	NP_079105	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1						lipid catabolic process	extracellular region	hydrolase activity				0						ttttcttttcttttttttttt	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	17346152	17346152	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17346152delG								LMO3 (583394 upstream) : RERGL (887652 downstream)																							ctttggaactgggtaatgggc	0.005													4	2	---	---	---	---	
SLCO1A2	6579	broad.mit.edu	37	12	21527754	21527755	+	Intron	DEL	TC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21527754_21527755delTC	uc001res.2	-						SLCO1A2_uc010siq.1_Intron|IAPP_uc001rev.2_Intron	NM_134431	NP_602307	P46721	SO1A2_HUMAN	organic anion transporting polypeptide A						bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						tgagacagggtctctctctctc	0.099													4	2	---	---	---	---	
SOX5	6660	broad.mit.edu	37	12	23900896	23900897	+	Intron	DEL	AA	-	-	rs148875062		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23900896_23900897delAA	uc001rfw.2	-						SOX5_uc001rfx.2_Intron|SOX5_uc001rfy.2_Intron|SOX5_uc010siv.1_Intron|SOX5_uc010siw.1_Intron|SOX5_uc001rfz.1_Intron	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						gaaagagattaaaaaaaaaaaa	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	24876788	24876790	+	IGR	DEL	AGC	-	-	rs141442223		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24876788_24876790delAGC								SOX5 (161408 upstream) : BCAT1 (87491 downstream)																							taagctctagagccagactgcct	0.020													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	29946543	29946546	+	IGR	DEL	ACAC	-	-	rs76768783		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29946543_29946546delACAC								TMTC1 (8851 upstream) : IPO8 (835377 downstream)																							CATGCACAATACACACTGCAACAT	0.436													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	32213773	32213773	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32213773delG								C12orf35 (67742 upstream) : BICD1 (46412 downstream)																							CTTGCTTCTTGGGGCGGGGTA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	32537649	32537651	+	IGR	DEL	TTC	-	-	rs111399032		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32537649_32537651delTTC								BICD1 (6509 upstream) : FGD4 (101255 downstream)																							tcttccttctttcttcttcttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	32601656	32601657	+	IGR	INS	-	G	G	rs150643225	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32601656_32601657insG								BICD1 (70516 upstream) : FGD4 (37249 downstream)																							TGTGTTTAGCAGGGGGAAGGAA	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	32601657	32601658	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32601657_32601658insT								BICD1 (70517 upstream) : FGD4 (37248 downstream)																							GTGTTTAGCAGGGGGAAGGAAA	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34325582	34325582	+	IGR	DEL	A	-	-	rs111444960		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34325582delA								ALG10 (144348 upstream) : None (None downstream)																							CTGGCAGGGGAGAGTTCAGCC	0.299													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34389178	34389178	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34389178delG								ALG10 (207944 upstream) : None (None downstream)																							accatcaccagtcatcaccat	0.000													2	6	---	---	---	---	
PFKM	5213	broad.mit.edu	37	12	48509111	48509111	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48509111delT	uc001rrb.1	+						PFKM_uc001rra.1_Intron	NM_000289	NP_000280	P08237	K6PF_HUMAN	phosphofructokinase, muscle						fructose 6-phosphate metabolic process|glycolysis|muscle cell homeostasis	6-phosphofructokinase complex|apical plasma membrane	6-phosphofructokinase activity|ATP binding|identical protein binding|kinase binding|metal ion binding|protein C-terminus binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4						taggtgcaggtgggctgagtc	0.065													4	2	---	---	---	---	
LMBR1L	55716	broad.mit.edu	37	12	49494516	49494516	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49494516delT	uc001rth.3	-						LMBR1L_uc001rtg.3_Intron|LMBR1L_uc001rti.3_Intron	NM_018113	NP_060583	Q6UX01	LMBRL_HUMAN	lipocalin-interacting membrane receptor						endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1						AGCCCACttcttttttttttt	0.229													4	3	---	---	---	---	
SPATS2	65244	broad.mit.edu	37	12	49893816	49893816	+	Intron	DEL	T	-	-	rs71812288		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49893816delT	uc001rud.2	+						SPATS2_uc001rue.2_Intron|SPATS2_uc009zli.1_Intron|SPATS2_uc001ruf.2_Intron|SPATS2_uc001rug.2_Intron	NM_023071	NP_075559	Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2							cytoplasm				breast(1)	1						ataattattcttttttttttt	0.358													6	3	---	---	---	---	
FAIM2	23017	broad.mit.edu	37	12	50288814	50288814	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50288814delC	uc001rvj.1	-						FAIM2_uc001rvi.1_Intron|FAIM2_uc001rvk.1_Intron	NM_012306	NP_036438	Q9BWQ8	FAIM2_HUMAN	Fas apoptotic inhibitory molecule 2						anti-apoptosis|apoptosis	cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|ovary(1)|skin(1)	3						ACTTAGGGGGCAGGACGGAGA	0.602													4	2	---	---	---	---	
RACGAP1	29127	broad.mit.edu	37	12	50405902	50405902	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50405902delC	uc001rvt.2	-						RACGAP1_uc009zlm.1_Intron|RACGAP1_uc001rvs.2_Intron|RACGAP1_uc001rvu.2_Intron	NM_013277	NP_037409	Q9H0H5	RGAP1_HUMAN	Rac GTPase activating protein 1						blood coagulation|cytokinesis, actomyosin contractile ring assembly|cytokinesis, initiation of separation|embryo development|microtubule-based movement|neuroblast proliferation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|spermatogenesis|sulfate transport	acrosomal vesicle|cytosol|microtubule|midbody|nucleus|spindle	alpha-tubulin binding|beta-tubulin binding|gamma-tubulin binding|GTPase activator activity|metal ion binding			kidney(1)	1						cagagcgagaccttgtctcca	0.005													4	2	---	---	---	---	
RARG	5916	broad.mit.edu	37	12	53620928	53620929	+	Intron	INS	-	G	G	rs149517676	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53620928_53620929insG	uc001sce.2	-						RARG_uc001scf.2_Intron|RARG_uc001scg.2_Intron|RARG_uc010soc.1_Intron	NM_000966	NP_000957	P13631	RARG_HUMAN	retinoic acid receptor, gamma isoform 1						canonical Wnt receptor signaling pathway|embryonic eye morphogenesis|embryonic hindlimb morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|regulation of cell size|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid	integral to membrane|transcription factor complex	retinoic acid receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			breast(2)|ovary(1)|lung(1)	4					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)	ATCCTATTTGACAGGAGAACTC	0.480													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	53638024	53638024	+	IGR	DEL	T	-	-	rs11316313		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53638024delT								RARG (11988 upstream) : MFSD5 (7413 downstream)																							tcctggataatttttttttta	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	63933235	63933238	+	IGR	DEL	ATGG	-	-	rs72204948		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63933235_63933238delATGG								AVPR1A (386645 upstream) : DPY19L2 (19455 downstream)																							ggacagatgaatggatggatggat	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	69551607	69551608	+	IGR	INS	-	T	T	rs149465712	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69551607_69551608insT								CPM (194587 upstream) : CPSF6 (81709 downstream)																							ctcaagtgatcgcctgccctgg	0.000													3	3	---	---	---	---	
TBC1D15	64786	broad.mit.edu	37	12	72312725	72312729	+	Intron	DEL	TTTTA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72312725_72312729delTTTTA	uc001swu.2	+						TBC1D15_uc010stt.1_Intron|TBC1D15_uc001swv.2_Intron|TBC1D15_uc001sww.2_Intron	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0						ttttttcaacttttattttaggttc	0.161													3	3	---	---	---	---	
PHLDA1	22822	broad.mit.edu	37	12	76427104	76427105	+	5'Flank	DEL	AC	-	-	rs3834714		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76427104_76427105delAC	uc001sxu.2	-							NM_007350	NP_031376	Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A,						apoptosis	cytoplasmic vesicle membrane|nucleolus|plasma membrane	protein binding				0		Colorectal(145;0.09)				TAAGAGGATGACATTCTTCAGC	0.396													2	4	---	---	---	---	
PTPRQ	374462	broad.mit.edu	37	12	80970431	80970431	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80970431delT	uc001sze.2	+							NM_001145026	NP_001138498			protein tyrosine phosphatase, receptor type, Q												0						TCTTCTGACCTTTTTTTTTTT	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	91035296	91035297	+	IGR	DEL	GA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91035296_91035297delGA								LOC338758 (929568 upstream) : C12orf12 (310696 downstream)																							agggaagaaggaagggaggcat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	92205601	92205602	+	IGR	INS	-	AC	AC	rs144232695	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92205601_92205602insAC								DCN (628795 upstream) : BTG1 (173264 downstream)																							CTTTCAAAAGTacacacacaca	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	92983352	92983352	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92983352delT								CLLU1 (105896 upstream) : C12orf74 (113488 downstream)																							TAGGAAAGCCTATGTTTAAAG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	95849550	95849551	+	IGR	DEL	AG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95849550_95849551delAG								MIR331 (147261 upstream) : METAP2 (18271 downstream)																							gctttaaatcagagagagagaa	0.000													4	2	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101712610	101712610	+	Intron	DEL	A	-	-	rs35483128		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101712610delA	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						ctccatcttgaaaaaaaaaaa	0.189													4	2	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101760737	101760738	+	Intron	INS	-	CT	CT	rs149954080	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101760737_101760738insCT	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						CCCATGAGTCCCTCTGAACTAC	0.248													4	2	---	---	---	---	
TRPV4	59341	broad.mit.edu	37	12	110240643	110240644	+	Intron	INS	-	CATC	CATC	rs112575595		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110240643_110240644insCATC	uc001tpj.1	-						TRPV4_uc001tpg.1_Intron|TRPV4_uc001tph.1_Intron|TRPV4_uc001tpi.1_Intron|TRPV4_uc001tpk.1_Intron|TRPV4_uc001tpl.1_Intron	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,						actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						atgcatccatgcatccatccat	0.292													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	111149732	111149734	+	IGR	DEL	AAC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111149732_111149734delAAC								HVCN1 (22115 upstream) : PPP1CC (7881 downstream)																							ctctgtctcaaacaacaacaaca	0.010													2	7	---	---	---	---	
CUX2	23316	broad.mit.edu	37	12	111596945	111596947	+	Intron	DEL	TTG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111596945_111596947delTTG	uc001tsa.1	+						CUX2_uc001tsb.1_Intron	NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						TGCCAGGATTttgttgttgttgt	0.271													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114694641	114694641	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114694641delG								RBM19 (290465 upstream) : TBX5 (97095 downstream)																							TACGGGTCTTGGGGACTCTGA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	117083508	117083509	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117083508_117083509insT								MAP1LC3B2 (69083 upstream) : C12orf49 (70087 downstream)																							cgccctgccCATTTTTTTTTTT	0.129													0	7	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	118406110	118406111	+	5'Flank	INS	-	G	G	rs138026123	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118406110_118406111insG	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GAGAGAAAAAAGAGGGGGGGGA	0.530													5	3	---	---	---	---	
RILPL1	353116	broad.mit.edu	37	12	123974219	123974220	+	Intron	DEL	AA	-	-	rs36068810		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123974219_123974220delAA	uc001ufe.2	-						RILPL1_uc001ufd.2_Intron|RILPL1_uc010tas.1_Intron	NM_178314	NP_847884	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1						neuroprotection	cytosol					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		actccatcttaaaaaaaaaaaa	0.188													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	124719639	124719641	+	IGR	DEL	CCT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124719639_124719641delCCT								ZNF664 (219672 upstream) : FAM101A (54069 downstream)																							accaccatcacctccatcatcac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128748821	128748822	+	IGR	INS	-	T	T	rs141536207	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128748821_128748822insT								None (None upstream) : TMEM132C (150469 downstream)																							CTTCTTCCTCATTTTTTAATCG	0.272													2	4	---	---	---	---	
GLT1D1	144423	broad.mit.edu	37	12	129468880	129468881	+	3'UTR	INS	-	T	T	rs138283900	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129468880_129468881insT	uc010tbh.1	+	13					GLT1D1_uc001uhx.1_3'UTR|GLT1D1_uc001uhy.1_RNA	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1						biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		TTCAACCATCATTTTTTTAATG	0.411													4	2	---	---	---	---	
TMEM132D	121256	broad.mit.edu	37	12	130181367	130181367	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130181367delG	uc009zyl.1	-							NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AACATTTTCTGGGATTGAATG	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	130739792	130739792	+	IGR	DEL	T	-	-	rs67883665		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130739792delT								FZD10 (89508 upstream) : PIWIL1 (82822 downstream)																							CCTTGGTTTGTTTTTTTTTTT	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131251497	131251498	+	IGR	INS	-	A	A	rs138311470	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131251497_131251498insA								RIMBP2 (50671 upstream) : STX2 (22651 downstream)																							TGAAAGAATAGGGGGGAGAAGA	0.431													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132964917	132964918	+	IGR	DEL	AG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132964917_132964918delAG								GALNT9 (59012 upstream) : FBRSL1 (102239 downstream)																							atgcgggctcagagagagggga	0.109													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	20371304	20371305	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20371304_20371305insA								PSPC1 (14221 upstream) : ZMYM5 (26319 downstream)																							aataataaaataaaaaaatggt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	21135806	21135806	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21135806delT								CRYL1 (35794 upstream) : IFT88 (5402 downstream)																							cttcttcaccttttttcaacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	22877646	22877646	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22877646delT								FGF9 (599006 upstream) : SGCG (877414 downstream)																							cctcggcctctgggcctgtga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	24930023	24930024	+	IGR	DEL	CA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24930023_24930024delCA								C1QTNF9 (33358 upstream) : PARP4 (65051 downstream)																							Tcacacacaccacacacactca	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	29089243	29089243	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29089243delT								FLT1 (19978 upstream) : POMP (143998 downstream)																							ggtctcagtcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	29327574	29327575	+	IGR	DEL	AG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29327574_29327575delAG								SLC46A3 (34424 upstream) : MTUS2 (271173 downstream)																							ATTGATGGCCAGAGAGAGAGAG	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	45281713	45281713	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45281713delA								TSC22D1 (131012 upstream) : NUFIP1 (231671 downstream)																							tttaggtttcaacaagccctc	0.000													4	2	---	---	---	---	
COG3	83548	broad.mit.edu	37	13	46083178	46083178	+	Intron	DEL	T	-	-	rs35234559		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46083178delT	uc001vak.2	+						COG3_uc001vaj.1_Intron|COG3_uc010tfv.1_Intron|COG3_uc010aci.2_Intron	NM_031431	NP_113619	Q96JB2	COG3_HUMAN	component of golgi transport complex 3						ER to Golgi vesicle-mediated transport|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein glycosylation|protein localization to organelle|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	cis-Golgi network|Golgi cisterna membrane|Golgi transport complex	protein binding|protein transporter activity			breast(1)|skin(1)	2		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		ATCTGCTTCCttttttttttt	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	50386912	50386912	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50386912delA								KPNA3 (19855 upstream) : LOC220429 (77633 downstream)																							ACAAGAGGAGAGGGAAGATAA	0.368													4	2	---	---	---	---	
THSD1P1	374500	broad.mit.edu	37	13	52803642	52803642	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52803642delT	uc001vgm.1	-						uc001vgn.2_Intron					Homo sapiens cDNA FLJ14630 fis, clone NT2RP2000459.												0						CAGTTTTCCCTTTTTTTTTTT	0.328													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	54526360	54526361	+	IGR	DEL	AC	-	-	rs142800575		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54526360_54526361delAC								OLFM4 (900174 upstream) : MIR1297 (359746 downstream)																							atacatgcaaacacacacacac	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	60151781	60151784	+	IGR	DEL	ACAC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60151781_60151784delACAC								None (None upstream) : DIAPH3 (87941 downstream)																							tcaatagcaaacacacacacacac	0.000													3	3	---	---	---	---	
KLHL1	57626	broad.mit.edu	37	13	70293342	70293343	+	Intron	DEL	GA	-	-	rs71816977		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70293342_70293343delGA	uc001vip.2	-						KLHL1_uc010thm.1_Intron	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		gtgtgtgtgtgagagagagaga	0.213													4	2	---	---	---	---	
UCHL3	7347	broad.mit.edu	37	13	76123902	76123916	+	5'Flank	DEL	GGCGGCGGCGGCGAA	-	-	rs67763278		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76123902_76123916delGGCGGCGGCGGCGAA	uc001vjq.2	+							NM_006002	NP_005993	P15374	UCHL3_HUMAN	ubiquitin carboxyl-terminal esterase L3						ubiquitin-dependent protein catabolic process	cytoplasm	cysteine-type peptidase activity|ubiquitin binding|ubiquitin thiolesterase activity				0				GBM - Glioblastoma multiforme(99;0.0125)		GggcggaagcggcggcggcggcgaaggcggcggcT	0.581											OREG0022446	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	78001408	78001408	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78001408delT								MYCBP2 (100231 upstream) : SCEL (108401 downstream)																							tgtgtcctacttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	93522655	93522655	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93522655delG								GPC5 (3170 upstream) : GPC6 (356423 downstream)																							GGAAACATCTGATTTAAGAGA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	95383327	95383328	+	IGR	DEL	AC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95383327_95383328delAC								SOX21 (18938 upstream) : ABCC4 (288756 downstream)																							atacacacagacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	98736768	98736769	+	IGR	INS	-	A	A	rs35006627		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98736768_98736769insA								IPO5 (60219 upstream) : FARP1 (58047 downstream)																							gactctgtctcaaaaaaaaaaa	0.050													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	98768162	98768163	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98768162_98768163insT								IPO5 (91613 upstream) : FARP1 (26653 downstream)																							tgcccagctaatttttgcattt	0.045													4	2	---	---	---	---	
LOC121952	121952	broad.mit.edu	37	13	103539082	103539082	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103539082delC	uc001vpx.1	+							NR_026965				Homo sapiens cDNA FLJ39105 fis, clone NTONG2004806.												0						ttaaatatctcctcttttatg	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	104064668	104064669	+	IGR	DEL	TG	-	-	rs140322845		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104064668_104064669delTG								SLC10A2 (345472 upstream) : None (None downstream)																							TTCTGAGTCATGTGTGTGTATG	0.208													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112220736	112220737	+	IGR	INS	-	AC	AC	rs150891767		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112220736_112220737insAC								C13orf16 (224143 upstream) : SOX1 (501176 downstream)																							AGTATCTTTCAACACATTGGAC	0.525													4	2	---	---	---	---	
FAM70B	348013	broad.mit.edu	37	13	114500363	114500363	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114500363delC	uc001vuh.2	+							NM_182614	NP_872420	Q8WV15	FA70B_HUMAN	family with sequence similarity 70, member B							integral to membrane					0	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.123)|all_epithelial(44;0.133)	all cancers(43;0.181)			GAGATGCGTGCCTTCCAACTG	0.592													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19011738	19011738	+	IGR	DEL	T	-	-	rs111547352		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19011738delT								None (None upstream) : OR11H12 (365856 downstream)																							actctgtgagttgaatgcaag	0.000													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19702973	19702974	+	IGR	INS	-	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19702973_19702974insG								POTEG (118031 upstream) : P704P (280980 downstream)																							GATGAGAAGATGCACGATTGCC	0.416													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	25565229	25565230	+	IGR	DEL	TG	-	-	rs79353081		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25565229_25565230delTG								STXBP6 (46058 upstream) : None (None downstream)																							GCAGTATGCAtgtgtgtgtgtg	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	28677760	28677761	+	IGR	DEL	AG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28677760_28677761delAG								None (None upstream) : FOXG1 (558526 downstream)																							tgggggagaaagagagagagag	0.020													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	40768129	40768130	+	IGR	INS	-	TGTT	TGTT			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40768129_40768130insTGTT								FBXO33 (866425 upstream) : None (None downstream)																							gtgtgtgtgtgtgtgtgtgtat	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	49012464	49012465	+	IGR	INS	-	AAT	AAT	rs144784598	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49012464_49012465insAAT								MDGA2 (868476 upstream) : None (None downstream)																							cccattttctcgatatgtggga	0.000													3	5	---	---	---	---	
CNIH	10175	broad.mit.edu	37	14	54897552	54897554	+	Intron	DEL	TTG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54897552_54897554delTTG	uc001xat.1	-						CNIH_uc001xav.1_Intron	NM_005776	NP_005767	O95406	CNIH_HUMAN	cornichon-like						immune response|intracellular signal transduction|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane|integral to membrane					0				GBM - Glioblastoma multiforme(112;0.00341)		ttttgtttttttgttgttgttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	55262139	55262139	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55262139delT								SAMD4A (2106 upstream) : GCH1 (46585 downstream)																							tactggttggtttttttccaa	0.229													4	2	---	---	---	---	
C14orf101	54916	broad.mit.edu	37	14	57050709	57050712	+	Intron	DEL	TGTG	-	-	rs35393718		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57050709_57050712delTGTG	uc001xcm.2	+						C14orf101_uc001xcj.2_Intron|C14orf101_uc001xck.2_Intron|C14orf101_uc010aot.1_Intron|C14orf101_uc001xcl.1_Intron|C14orf101_uc001xcn.2_Intron|C14orf101_uc010trf.1_Intron	NM_017799	NP_060269	Q9NX78	CN101_HUMAN	hypothetical protein LOC54916							integral to membrane				breast(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(311;0.226)		TCCAGCCTTTtgtgtgtgtgtgtg	0.333													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	57560649	57560650	+	IGR	DEL	GA	-	-	rs10600711		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57560649_57560650delGA								OTX2 (283465 upstream) : EXOC5 (108546 downstream)																							tggaaagaaggagagagccagg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	62944128	62944128	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62944128delA								FLJ43390 (346896 upstream) : KCNH5 (229819 downstream)																							cacattttttattgtgttgtg	0.000													4	2	---	---	---	---	
SPTB	6710	broad.mit.edu	37	14	65336922	65336922	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65336922delG	uc001xhs.2	-						SPTB_uc001xhu.2_Intron	NM_001024858	NP_001020029	P11277	SPTB1_HUMAN	spectrin beta isoform a						actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		tgtcaggcaaggttacaaaga	0.119													4	2	---	---	---	---	
EIF2S1	1965	broad.mit.edu	37	14	67849626	67849627	+	Intron	DEL	GT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67849626_67849627delGT	uc001xjg.2	+							NM_004094	NP_004085	P05198	IF2A_HUMAN	eukaryotic translation initiation factor 2,							cytosol|eukaryotic translation initiation factor 2 complex|polysome|stress granule	protein binding|ribosome binding|translation initiation factor activity			ovary(1)	1				all cancers(60;0.000683)|OV - Ovarian serous cystadenocarcinoma(108;0.00579)|BRCA - Breast invasive adenocarcinoma(234;0.00937)		gcgtgcgtgcgtgtgtgtgtgt	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	70295783	70295783	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70295783delT								SLC10A1 (31777 upstream) : SMOC1 (50360 downstream)																							tgtatgtgtgttgtgtgtatg	0.000													4	3	---	---	---	---	
RGS6	9628	broad.mit.edu	37	14	72769390	72769391	+	Intron	DEL	AC	-	-	rs34627833		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72769390_72769391delAC	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		acatacacatacacacacacac	0.287													4	2	---	---	---	---	
HEATR4	399671	broad.mit.edu	37	14	73968274	73968276	+	Intron	DEL	TTT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73968274_73968276delTTT	uc010tub.1	-						HEATR4_uc010tua.1_Intron	NM_203309	NP_976054			HEAT repeat containing 4											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		TCTCTCTCTCttttttttttttt	0.103													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	75979351	75979353	+	IGR	DEL	TTT	-	-	rs76727327		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75979351_75979353delTTT								JDP2 (39949 upstream) : BATF (9431 downstream)																							TTCCCttttcttttttttttttt	0.084													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	76013546	76013548	+	IGR	DEL	CTC	-	-	rs141338928	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76013546_76013548delCTC								BATF (219 upstream) : FLVCR2 (31392 downstream)																							ccttctccttctcctcctcctcc	0.202													5	4	---	---	---	---	
FOXN3	1112	broad.mit.edu	37	14	89671136	89671137	+	Intron	INS	-	TCCA	TCCA	rs142220885	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89671136_89671137insTCCA	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3						GAGACATAGGCtccatccatcc	0.228													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	90927495	90927495	+	IGR	DEL	T	-	-	rs68016318		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90927495delT								CALM1 (52885 upstream) : TTC7B (79438 downstream)																							AGAGACATGCttttttttttt	0.159													3	3	---	---	---	---	
PPP4R4	57718	broad.mit.edu	37	14	94656386	94656386	+	Intron	DEL	T	-	-	rs34015633		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94656386delT	uc001ycs.1	+						PPP4R4_uc001ycr.2_Intron	NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN	HEAT-like repeat-containing protein isoform 1							cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4						TGCTTTTATCttttttttttt	0.209													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	94837381	94837382	+	IGR	INS	-	AC	AC	rs143753129	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94837381_94837382insAC								SERPINA6 (47693 upstream) : SERPINA1 (5703 downstream)																							Aacacacagagacacacacaca	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95008123	95008123	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95008123delG								SERPINA12 (23942 upstream) : SERPINA4 (19656 downstream)																							GGGACTGGAAGGGGCTCAGCA	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99798610	99798611	+	IGR	DEL	CA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99798610_99798611delCA								BCL11B (60788 upstream) : SETD3 (65473 downstream)																							cacgtgccagcacacacacaca	0.059													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106518132	106518133	+	Intron	INS	-	AA	AA			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106518132_106518133insAA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						ACTCCTGTTGCAAAAAAACAAA	0.406													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	107165353	107165353	+	Intron	DEL	A	-	-	rs112626899		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107165353delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						atcaatgaataaaaaaacata	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20016203	20016203	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20016203delC								None (None upstream) : GOLGA6L6 (720891 downstream)																							gcagatcctacaaaaagagtt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20402418	20402419	+	IGR	INS	-	T	T	rs144809150	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20402418_20402419insT								None (None upstream) : GOLGA6L6 (334675 downstream)																							taatcatgtggtttttttcatt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20437396	20437396	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20437396delA								None (None upstream) : GOLGA6L6 (299698 downstream)																							tctcaaaaagaaaaaaaaaaa	0.224													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20513708	20513712	+	IGR	DEL	CATTT	-	-	rs146275982		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20513708_20513712delCATTT								None (None upstream) : GOLGA6L6 (223382 downstream)																							GCATCCTATCCATTTCATTTCATGA	0.166													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20573875	20573875	+	IGR	DEL	A	-	-	rs150151593		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20573875delA								None (None upstream) : GOLGA6L6 (163219 downstream)																							AGAAAAGTGGAAAAAAAAGTC	0.308													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20579183	20579188	+	IGR	DEL	AAACTT	-	-	rs111482967		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20579183_20579188delAAACTT								None (None upstream) : GOLGA6L6 (157906 downstream)																							agctgtaaaaaaacttaaactctcaa	0.000													11	5	---	---	---	---	
BCL8	606	broad.mit.edu	37	15	20943366	20943367	+	Intron	INS	-	TA	TA			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20943366_20943367insTA	uc010tze.1	-							NR_027992				RecName: Full=Putative protein BCL8;												0						attatacctcttatatataaaa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21202103	21202104	+	IGR	INS	-	TTG	TTG			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21202103_21202104insTTG								NF1P1 (67478 upstream) : LOC646214 (730410 downstream)																							GTCTTTTGTTTTTGTTGTTGTT	0.406													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22539625	22539626	+	IGR	DEL	CA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22539625_22539626delCA								MIR1268 (26345 upstream) : GOLGA8DP (162659 downstream)																							acacacataccacacagataca	0.069													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23737989	23737989	+	IGR	DEL	C	-	-	rs57586128		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23737989delC								GOLGA8E (289566 upstream) : MKRN3 (72465 downstream)																							cttatgcatacacacatgtgc	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	24183774	24183776	+	IGR	DEL	TCC	-	-	rs138176146		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24183774_24183776delTCC								NDN (251324 upstream) : PWRN2 (226150 downstream)																							cattcccccttcctcctcccatt	0.000													6	3	---	---	---	---	
SNRPN	6638	broad.mit.edu	37	15	25214535	25214536	+	Intron	INS	-	A	A	rs147036570	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25214535_25214536insA	uc001ywp.1	+						SNRPN_uc001ywq.1_Intron|SNRPN_uc001ywr.1_Intron|SNRPN_uc001yws.1_Intron|SNRPN_uc001ywt.1_Intron|SNRPN_uc001ywv.1_Intron|SNRPN_uc001yww.1_Intron|SNRPN_uc001ywx.1_Intron|SNRPN_uc001ywz.1_Intron|PAR-SN_uc001yxa.1_Intron|SNRPN_uc001ywy.1_Intron	NM_022807	NP_073718	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N						RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding			ovary(1)	1		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		cttggcctctcaaagtgctggg	0.099									Prader-Willi_syndrome				4	2	---	---	---	---	
TJP1	7082	broad.mit.edu	37	15	30102050	30102051	+	Intron	INS	-	A	A	rs111981690		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30102050_30102051insA	uc001zcr.2	-						TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a						cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		aactccgtcttaaaaaaaaaaa	0.109													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	32195096	32195097	+	IGR	INS	-	TTG	TTG	rs150775336	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32195096_32195097insTTG								OTUD7A (32104 upstream) : CHRNA7 (127629 downstream)																							gtttgtttgttttgttgttgtt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	32269746	32269754	+	IGR	DEL	GATCCCATC	-	-	rs79548132		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32269746_32269754delGATCCCATC								OTUD7A (106754 upstream) : CHRNA7 (52972 downstream)																							CAGAGCTGAGGATCCCATCGTGGCCTCTG	0.632													4	2	---	---	---	---	
MEIS2	4212	broad.mit.edu	37	15	37291956	37291956	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37291956delG	uc001zjr.2	-						MEIS2_uc001zjl.2_Intron|MEIS2_uc010ucj.1_Intron|MEIS2_uc001zjm.2_Intron|MEIS2_uc001zjn.2_Intron|MEIS2_uc001zjo.2_Intron|MEIS2_uc001zjp.2_Intron|MEIS2_uc001zjs.2_Intron|MEIS2_uc001zju.2_Intron|MEIS2_uc001zjt.2_Intron	NM_170675	NP_733775	O14770	MEIS2_HUMAN	Meis homeobox 2 isoform c						negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)	2		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		AGATAACTGTGGAAaataatt	0.189													4	2	---	---	---	---	
NUSAP1	51203	broad.mit.edu	37	15	41637666	41637667	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41637666_41637667insT	uc001zns.3	+						NUSAP1_uc001znq.3_Intron|NUSAP1_uc001znr.3_Intron|NUSAP1_uc010bce.2_Intron|NUSAP1_uc001znt.3_Intron|NUSAP1_uc001znv.3_Intron|NUSAP1_uc001znu.3_Intron|NUSAP1_uc010ucw.1_Intron|NUSAP1_uc001znw.3_Intron	NM_016359	NP_057443	Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1						cytokinesis after mitosis|establishment of mitotic spindle localization|mitotic chromosome condensation|positive regulation of mitosis	chromosome|cytoplasm|nucleolus	DNA binding				0		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		ttttttctttcttttttttttt	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	42889280	42889281	+	Intron	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42889280_42889281delTG	uc001zqg.2	+											Homo sapiens cDNA FLJ16106 fis, clone THYMU1000496, moderately similar to KINESIN-LIKE PROTEIN KIF1C.																		TGTTTACGATTGTGTGTGTGTG	0.168													4	2	---	---	---	---	
SORD	6652	broad.mit.edu	37	15	45365904	45365904	+	3'UTR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45365904delG	uc001zul.3	+	9					SORD_uc001zum.3_3'UTR|SORD_uc010bdz.2_3'UTR	NM_003104	NP_003095	Q00796	DHSO_HUMAN	sorbitol dehydrogenase						fructose biosynthetic process|glucose metabolic process|L-xylitol catabolic process|sorbitol catabolic process|sperm motility	cilium|extracellular space|flagellum|membrane fraction|mitochondrial membrane|soluble fraction	L-iditol 2-dehydrogenase activity|NAD binding|sugar binding|zinc ion binding				0		all_cancers(109;3.43e-12)|all_epithelial(112;2.33e-10)|Lung NSC(122;6.01e-07)|all_lung(180;4.38e-06)|Melanoma(134;0.0122)		all cancers(107;1.6e-18)|GBM - Glioblastoma multiforme(94;4.95e-07)|COAD - Colon adenocarcinoma(120;0.0704)|Colorectal(133;0.0706)	NADH(DB00157)	GATACAATCTGGGATAGTTTG	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	51196058	51196058	+	IGR	DEL	T	-	-	rs113917955		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51196058delT								SPPL2A (138148 upstream) : AP4E1 (4888 downstream)																							tttctttttcttttttttttt	0.000													4	2	---	---	---	---	
SCG3	29106	broad.mit.edu	37	15	51985077	51985078	+	Intron	DEL	TC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51985077_51985078delTC	uc002abh.2	+						SCG3_uc010ufz.1_Intron	NM_013243	NP_037375	Q8WXD2	SCG3_HUMAN	secretogranin III isoform 1 precursor						platelet activation|platelet degranulation	extracellular region|stored secretory granule				ovary(1)	1				all cancers(107;0.00488)		tttcttttattctttttgtgtg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	60085738	60085739	+	IGR	DEL	CA	-	-	rs10566064		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60085738_60085739delCA								BNIP2 (104096 upstream) : FOXB1 (210682 downstream)																							TTTCTAATACcacacacacaca	0.252													4	2	---	---	---	---	
RAB8B	51762	broad.mit.edu	37	15	63480030	63480032	+	5'Flank	DEL	AGC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63480030_63480032delAGC	uc002alz.2	+						RAB8B_uc010uih.1_5'Flank	NM_016530	NP_057614	Q92930	RAB8B_HUMAN	RAB8B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(1)|kidney(1)	2						ACATTCCGTAagcagcagcagca	0.365													4	3	---	---	---	---	
FAM96A	84191	broad.mit.edu	37	15	64379284	64379284	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64379284delT	uc002amt.1	-						FAM96A_uc002amu.1_Intron|FAM96A_uc010uin.1_Intron	NM_032231	NP_115607	Q9H5X1	FA96A_HUMAN	family with sequence similarity 96, member A						chromosome segregation						0						ctaattttgcttttttttttt	0.000													4	2	---	---	---	---	
ANKDD1A	348094	broad.mit.edu	37	15	65246524	65246525	+	Intron	DEL	TC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65246524_65246525delTC	uc002aoa.2	+						ANKDD1A_uc002aoc.2_Intron|ANKDD1A_uc010bha.2_Intron	NM_182703	NP_874362	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A						signal transduction					ovary(1)	1						tccttattattctttcttcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	65611588	65611589	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65611588_65611589insT								PARP16 (32570 upstream) : IGDCC3 (7876 downstream)																							cctcctccttctttttttttga	0.000													4	2	---	---	---	---	
ITGA11	22801	broad.mit.edu	37	15	68655261	68655275	+	Intron	DEL	ATGGATGATGGATGA	-	-	rs67625689		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68655261_68655275delATGGATGATGGATGA	uc002ari.2	-						ITGA11_uc010bib.2_Intron	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	gaatgggtggatggatgatggatgaatggatgatg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	69957228	69957229	+	IGR	INS	-	G	G	rs138632740	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69957228_69957229insG								LOC145837 (93449 upstream) : C15orf50 (170344 downstream)																							CATGGCAAAAAGGGGTGGTAGG	0.564													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	73310419	73310419	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73310419delT								ADPGK (233752 upstream) : NEO1 (34456 downstream)																							TCCCTTTTCCTTTTAGTCCTG	0.418													4	2	---	---	---	---	
CYP11A1	1583	broad.mit.edu	37	15	74659538	74659538	+	Intron	DEL	G	-	-	rs74267111		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74659538delG	uc002axt.2	-						CYP11A1_uc002axs.2_5'Flank|CYP11A1_uc010bjm.1_5'Flank|CYP11A1_uc010bjn.1_Intron|CYP11A1_uc010bjo.1_Intron|CYP11A1_uc010ulj.1_Intron|CYP11A1_uc010bjq.2_Intron	NM_000781	NP_000772	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A,						C21-steroid hormone biosynthetic process|cholesterol metabolic process|vitamin D metabolic process|xenobiotic metabolic process	mitochondrial matrix	cholesterol monooxygenase (side-chain-cleaving) activity|electron carrier activity|heme binding			ovary(2)	2					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Clotrimazole(DB00257)|Digitoxin(DB01396)|Digoxin(DB00390)|Medroxyprogesterone(DB00603)|Ouabain(DB01092)|Progesterone(DB00396)|Testosterone(DB00624)|Trilostane(DB01108)	AAAAAAAAAAGAAGTTAGACA	0.428													4	2	---	---	---	---	
PPCDC	60490	broad.mit.edu	37	15	75315289	75315289	+	5'Flank	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75315289delA	uc002azo.2	+							NM_021823	NP_068595	Q96CD2	COAC_HUMAN	phosphopantothenoylcysteine decarboxylase						coenzyme A biosynthetic process|pantothenate metabolic process	cytosol	phosphopantothenoylcysteine decarboxylase activity				0						accctgtctcaaaaaaaaaaa	0.169													4	4	---	---	---	---	
ARNT2	9915	broad.mit.edu	37	15	80797126	80797126	+	Intron	DEL	T	-	-	rs113534629		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80797126delT	uc002bfr.2	+						ARNT2_uc010unm.1_Intron|ARNT2_uc002bfs.2_Intron	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	aryl hydrocarbon receptor nuclear translocator						central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)			aaaaaaaaaaTGGAAATCAGG	0.303													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	82009627	82009627	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82009627delT								TMC3 (343209 upstream) : MEX3B (324501 downstream)																							ctgttgatagttttttttttg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	82352861	82352861	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82352861delT								MEX3B (14500 upstream) : EFTUD1 (69700 downstream)																							AACACTCTCATTACACCTTCC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	86484137	86484137	+	IGR	DEL	A	-	-	rs66812186		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86484137delA								KLHL25 (145948 upstream) : AGBL1 (201105 downstream)																							aatctgtctcaaaaaaaaaaa	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	86492259	86492261	+	IGR	DEL	GGT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86492259_86492261delGGT								KLHL25 (154070 upstream) : AGBL1 (192981 downstream)																							aagttaaccaggtggagtggtgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	88075429	88075430	+	IGR	DEL	AA	-	-	rs35975088		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88075429_88075430delAA								AGBL1 (503146 upstream) : NCRNA00052 (44730 downstream)																							acagtcccctaaagtcttaact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	89993535	89993535	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89993535delA								LOC254559 (51817 upstream) : RHCG (21103 downstream)																							TTTGCCAATTAAAAAACACTG	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	95443960	95443961	+	IGR	DEL	CT	-	-	rs141210563	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95443960_95443961delCT								MCTP2 (416780 upstream) : LOC145820 (532361 downstream)																							atgtaccttgctctctctctct	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	96726982	96726982	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96726982delT								LOC145820 (675908 upstream) : NR2F2 (142175 downstream)																							TTGCCAATTGTTTTTTTTTTT	0.453													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98955137	98955138	+	IGR	DEL	AG	-	-	rs72017957		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98955137_98955138delAG								ARRDC4 (438070 upstream) : FAM169B (25253 downstream)																							tgagctggaaagagagagagag	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	99607012	99607013	+	IGR	DEL	TT	-	-	rs3051316		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99607012_99607013delTT								PGPEP1L (55988 upstream) : SYNM (38273 downstream)																							AAGTCACATCtttttttttttt	0.104													4	2	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	6609113	6609114	+	Intron	DEL	TG	-	-	rs34909448		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6609113_6609114delTG	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		tatatacatatgtgtgtgtgtg	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9598666	9598667	+	IGR	INS	-	T	T	rs150251199		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9598666_9598667insT								C16orf72 (385121 upstream) : GRIN2A (248600 downstream)																							AAATAGtttccttttttttttt	0.213													3	3	---	---	---	---	
ABCC6	368	broad.mit.edu	37	16	16249269	16249272	+	Intron	DEL	CCAT	-	-	rs34148011		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16249269_16249272delCCAT	uc002den.3	-						ABCC6_uc010bvo.2_Intron|ABCC6_uc002dem.2_5'UTR	NM_001171	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C, member 6						response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		ccccatcctgccatccatccatcc	0.108													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	20607404	20607404	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20607404delG								ACSM2B (19709 upstream) : ACSM1 (27155 downstream)																							atactgccaaggtgatgaata	0.000													4	2	---	---	---	---	
IL21R	50615	broad.mit.edu	37	16	27461903	27461904	+	3'UTR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27461903_27461904insT	uc002doq.1	+	9					IL21R_uc002dor.1_3'UTR|IL21R_uc002dos.1_3'UTR|uc002dot.2_Intron	NM_181078	NP_851564	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor precursor						natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)|lung(1)|breast(1)	4						ttttctttttcttttttttttt	0.149			T	BCL6	NHL								4	2	---	---	---	---	
XPO6	23214	broad.mit.edu	37	16	28208411	28208411	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28208411delA	uc002dpa.1	-						XPO6_uc002dpb.1_Intron|XPO6_uc010vcp.1_Intron	NM_015171	NP_055986	Q96QU8	XPO6_HUMAN	exportin 6						protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2						cgtctctactaaaaatacaaa	0.010													4	2	---	---	---	---	
STX1B	112755	broad.mit.edu	37	16	31021670	31021671	+	Intron	DEL	CC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31021670_31021671delCC	uc010cad.2	-						STX1B_uc010vfd.1_Intron	NM_052874	NP_443106	P61266	STX1B_HUMAN	syntaxin 1B						intracellular protein transport|neurotransmitter transport|synaptic transmission	integral to plasma membrane	extracellular-glutamate-gated ion channel activity|SNAP receptor activity				0						CCCCCATTCTCCCCACCCCCAA	0.515													4	2	---	---	---	---	
STX1B	112755	broad.mit.edu	37	16	31024654	31024656	+	5'Flank	DEL	TCC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31024654_31024656delTCC	uc010cad.2	-						STX1B_uc010vfd.1_5'Flank	NM_052874	NP_443106	P61266	STX1B_HUMAN	syntaxin 1B						intracellular protein transport|neurotransmitter transport|synaptic transmission	integral to plasma membrane	extracellular-glutamate-gated ion channel activity|SNAP receptor activity				0						ctcttcctcttcctcttcctctt	0.000													4	2	---	---	---	---	
ITGAX	3687	broad.mit.edu	37	16	31384236	31384237	+	Intron	INS	-	AAC	AAC	rs139045178	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31384236_31384237insAAC	uc002ebu.1	+						ITGAX_uc002ebt.2_Intron	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						cacaaaaacaaaacaacaacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32520111	32520111	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32520111delT								HERC2P4 (356237 upstream) : TP53TG3B (164730 downstream)																							taaaaaagagtgtttcaacac	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32531665	32531666	+	IGR	DEL	TA	-	-	rs112134576		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32531665_32531666delTA								HERC2P4 (367791 upstream) : TP53TG3B (153175 downstream)																							aagaaaattttatcactgcgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33521180	33521180	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33521180delC								SLC6A10P (624717 upstream) : MIR1826 (444328 downstream)																							cattcaaaatcctcctagagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33909570	33909570	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33909570delC								None (None upstream) : MIR1826 (55938 downstream)																							ttttgaaactctctttttgta	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33916169	33916169	+	IGR	DEL	T	-	-	rs111918414		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33916169delT								None (None upstream) : MIR1826 (49339 downstream)																							ataaagaaggtttctgagaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33987177	33987179	+	IGR	DEL	CTT	-	-	rs113791407		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33987177_33987179delCTT								MIR1826 (21585 upstream) : UBE2MP1 (416623 downstream)																							tctcagaaagcttctgtctagtt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33994150	33994151	+	IGR	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33994150_33994151delTG								MIR1826 (28558 upstream) : UBE2MP1 (409651 downstream)																							ggttcaactctgtgagatgaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	49017480	49017481	+	IGR	INS	-	GAA	GAA	rs144012511	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49017480_49017481insGAA								N4BP1 (373360 upstream) : CBLN1 (294730 downstream)																							AGGAAGACCATGTCAGCTGAAC	0.495													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	53057876	53057877	+	IGR	INS	-	A	A	rs35620986		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53057876_53057877insA								TOX3 (476162 upstream) : CHD9 (31068 downstream)																							ttgcttCCCTTAAAAAAAAAAA	0.094													5	3	---	---	---	---	
GPR97	222487	broad.mit.edu	37	16	57708924	57708925	+	Intron	INS	-	GC	GC	rs35561154		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57708924_57708925insGC	uc002emh.2	+						GPR97_uc010cdc.2_Intron|GPR97_uc010vhv.1_Intron|GPR97_uc010cdd.2_Intron	NM_170776	NP_740746	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1						aaaaaaaaaaaagcagcagcag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	59547997	59547997	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59547997delC								GOT2 (779751 upstream) : None (None downstream)																							tgctttttttcccatgctaat	0.000													4	2	---	---	---	---	
CDH8	1006	broad.mit.edu	37	16	61927320	61927321	+	Intron	DEL	GT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61927320_61927321delGT	uc002eog.1	-							NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		gtgtgtgtgagtgtgtgtgtgt	0.074													4	2	---	---	---	---	
LOC283867	283867	broad.mit.edu	37	16	65578105	65578105	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65578105delG	uc010cdp.1	-						LOC283867_uc002eol.1_Intron					Homo sapiens cDNA clone IMAGE:5276218.												0				OV - Ovarian serous cystadenocarcinoma(108;0.17)		gagggaggaaggaaggaaggg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	67589470	67589470	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67589470delA								FAM65A (8782 upstream) : CTCF (6994 downstream)																							gcgtgtctgtaatcccagcaa	0.000													4	2	---	---	---	---	
DUS2L	54920	broad.mit.edu	37	16	68099539	68099540	+	Intron	INS	-	AAAC	AAAC			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68099539_68099540insAAAC	uc002evi.2	+						DUS2L_uc002evj.2_Intron|DUS2L_uc010vkk.1_Intron|DUS2L_uc010cez.2_Intron	NM_017803	NP_060273	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2-like, SMM1 homolog						tRNA processing	endoplasmic reticulum	double-stranded RNA binding|flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0131)|Epithelial(162;0.0564)		gtctcaaaacaaaacaaacaaa	0.005													4	2	---	---	---	---	
WWOX	51741	broad.mit.edu	37	16	78686132	78686133	+	Intron	INS	-	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78686132_78686133insG	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		tatggtgaaacctgtcactact	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	79945228	79945228	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79945228delG								MAF (310606 upstream) : DYNLRB2 (629626 downstream)																							TGATTTATGTGGTGTCTTTCC	0.443													4	2	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81619704	81619704	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81619704delT	uc002fgp.2	+						CMIP_uc002fgq.1_Intron	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						TGCTCCTATCTTTTTTTTTTC	0.517													4	2	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	82850776	82850776	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82850776delC	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		TCACTCTTCGCCCCCCACTGC	0.463													4	4	---	---	---	---	
CPNE7	27132	broad.mit.edu	37	16	89640098	89640098	+	5'Flank	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89640098delA	uc002fnp.2	+						CPNE7_uc002fnq.2_5'Flank	NM_014427	NP_055242	Q9UBL6	CPNE7_HUMAN	copine 7 isoform b						lipid metabolic process		transporter activity				0		all_hematologic(23;0.0748)		all cancers(4;3.63e-08)|OV - Ovarian serous cystadenocarcinoma(4;1.7e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0147)		ATTTGCACATAAAAAAAAAAA	0.408													4	2	---	---	---	---	
PLD2	5338	broad.mit.edu	37	17	4719678	4719678	+	Intron	DEL	A	-	-	rs113078659		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4719678delA	uc002fzc.2	+						PLD2_uc010vsj.1_Intron|PLD2_uc002fzd.2_Intron	NM_002663	NP_002654	O14939	PLD2_HUMAN	phospholipase D2						cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5					Choline(DB00122)	actctgtctcaaaaaaaaaaa	0.224													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6653555	6653556	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6653555_6653556insA								SLC13A5 (36815 upstream) : XAF1 (5238 downstream)																							CTTTTCACCATAAAAAAAATAT	0.371													9	7	---	---	---	---	
STX8	9482	broad.mit.edu	37	17	9271049	9271051	+	Intron	DEL	TTG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9271049_9271051delTTG	uc002glx.2	-							NM_004853	NP_004844	Q9UNK0	STX8_HUMAN	syntaxin 8						transport	endoplasmic reticulum|integral to plasma membrane				central_nervous_system(1)	1						AACAGAAGGtttgttgttgttgt	0.158													4	2	---	---	---	---	
DHRS7C	201140	broad.mit.edu	37	17	9683469	9683469	+	Intron	DEL	A	-	-	rs111824797		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9683469delA	uc010vvb.1	-						DHRS7C_uc010cof.2_Intron	NM_001105571	NP_001099041	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C							extracellular region	binding|oxidoreductase activity				0						GAAATGACTGAAAAAAAAAAA	0.413													3	3	---	---	---	---	
NCOR1	9611	broad.mit.edu	37	17	16067232	16067233	+	Intron	INS	-	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16067232_16067233insC	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron|NCOR1_uc002gps.1_Intron|NCOR1_uc010coz.1_Intron|NCOR1_uc010cpb.1_Intron|NCOR1_uc010cpa.1_Intron	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		atgattctgttttttctgatat	0.000													3	4	---	---	---	---	
TRPV2	51393	broad.mit.edu	37	17	16339010	16339010	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16339010delG	uc002gpy.2	+						TRPV2_uc002gpz.2_Intron	NM_016113	NP_057197	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel,						sensory perception	integral to plasma membrane|melanosome	calcium channel activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		TCTCTTTCCTGACAAATTTCA	0.537													4	2	---	---	---	---	
ALDH3A2	224	broad.mit.edu	37	17	19559254	19559255	+	Intron	DEL	CA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19559254_19559255delCA	uc002gwb.1	+						ALDH3A2_uc002gwa.1_Intron|ALDH3A2_uc010cqr.1_Intron|ALDH3A2_uc002gwc.1_Intron|ALDH3A2_uc002gwd.1_5'Flank	NM_000382	NP_000373	P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3A2 isoform 2						cellular aldehyde metabolic process|central nervous system development|epidermis development|lipid metabolic process|peripheral nervous system development	endoplasmic reticulum membrane|integral to membrane	3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase			ovary(2)	2	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)				NADH(DB00157)	accatTCATTCAGAATAGCGTG	0.267													4	2	---	---	---	---	
CCDC144C	348254	broad.mit.edu	37	17	20279655	20279655	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20279655delT	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						tctgtctctcttttttttttt	0.119													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21340048	21340048	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21340048delG								KCNJ12 (16869 upstream) : C17orf51 (91524 downstream)																							TGGGAGAAGTGGGCTTTCAGG	0.597													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21518492	21518492	+	IGR	DEL	G	-	-	rs11870274	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21518492delG								C17orf51 (40761 upstream) : FAM27L (306878 downstream)																							TGAGGAAAAAGAAATCAGTTG	0.219													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21524370	21524371	+	IGR	INS	-	T	T	rs138882004	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21524370_21524371insT								C17orf51 (46639 upstream) : FAM27L (300999 downstream)																							attttgtgtacttgtacaaaca	0.114													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21540910	21540911	+	IGR	DEL	TT	-	-	rs150163000		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21540910_21540911delTT								C17orf51 (63179 upstream) : FAM27L (284459 downstream)																							atttaggttgttttttttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21561699	21561700	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21561699_21561700insA								C17orf51 (83968 upstream) : FAM27L (263670 downstream)																							CCCGGGGCCTCAGCTGGCCCAG	0.703													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25285310	25285311	+	IGR	INS	-	A	A	rs35229286		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25285310_25285311insA								None (None upstream) : WSB1 (335795 downstream)																							agtgtgtttgtggggggggtct	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25285867	25285868	+	IGR	INS	-	CCT	CCT	rs111946477		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25285867_25285868insCCT								None (None upstream) : WSB1 (335238 downstream)																							tcctccctccccctcctcttta	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25296773	25296776	+	IGR	DEL	ACTC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25296773_25296776delACTC								None (None upstream) : WSB1 (324330 downstream)																							ttaaatatatactcagttgcttta	0.000													4	2	---	---	---	---	
SLC13A2	9058	broad.mit.edu	37	17	26798491	26798492	+	5'Flank	DEL	AG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26798491_26798492delAG	uc002hbh.2	+						SLC13A2_uc010wal.1_5'Flank|SLC13A2_uc010wam.1_5'Flank|SLC13A2_uc010wan.1_5'Flank|SLC13A2_uc010wao.1_5'Flank|SLC13A2_uc002hbi.2_5'Flank	NM_003984	NP_003975	Q13183	S13A2_HUMAN	solute carrier family 13, member 2 isoform b							integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity				0	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	AAAGGAGACCAGAGAATGGAGG	0.307													4	2	---	---	---	---	
EFCAB5	374786	broad.mit.edu	37	17	28410416	28410416	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28410416delT	uc002het.2	+						EFCAB5_uc010cse.2_Intron|EFCAB5_uc010csf.2_Intron	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5 isoform a								calcium ion binding			ovary(1)|skin(1)	2						AAAGATGGGCTTTTTCTGCAG	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	32704545	32704545	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32704545delC								CCL1 (14293 upstream) : C17orf102 (196597 downstream)																							atttctctagcccctataata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	34211529	34211530	+	IGR	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34211529_34211530delTG								CCL5 (4152 upstream) : RDM1 (33557 downstream)																							ACCTTTCCACTGTGTGTGTGTG	0.515													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	36806967	36806967	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36806967delT								SRCIN1 (44784 upstream) : C17orf96 (20994 downstream)																							tgtctggcacttttttttttt	0.000													5	3	---	---	---	---	
KRT16	3868	broad.mit.edu	37	17	39768931	39768932	+	Frame_Shift_Ins	INS	-	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39768931_39768932insG	uc002hxg.3	-	1	148_149	c.9_10insC	c.(7-12)ACCTGCfs	p.T3fs	JUP_uc010wfs.1_Intron	NM_005557	NP_005548	P08779	K1C16_HUMAN	keratin 16	3_4	Head.				cell proliferation|epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton			skin(1)	1		Breast(137;0.000307)				TGGCGGCTGCAGGTGGTCATGG	0.653													4	2	---	---	---	---	
ACLY	47	broad.mit.edu	37	17	40071960	40071960	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40071960delC	uc002hyg.2	-						ACLY_uc002hyh.2_Intron|ACLY_uc002hyi.2_Intron|ACLY_uc010wfx.1_Intron|ACLY_uc010wfy.1_Intron	NM_001096	NP_001087	P53396	ACLY_HUMAN	ATP citrate lyase isoform 1						ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)				CACCTCACTGCCCCACGGTCC	0.537													4	2	---	---	---	---	
NBR1	4077	broad.mit.edu	37	17	41358195	41358195	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41358195delA	uc010czd.2	+						NBR1_uc010diz.2_Intron|NBR1_uc010whu.1_Intron|NBR1_uc010whv.1_Intron|NBR1_uc010whw.1_Intron	NM_031862	NP_114068	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1						macroautophagy|protein oligomerization	autophagic vacuole|cytoplasmic vesicle|cytosol|late endosome|lysosome|sarcomere	ubiquitin binding|zinc ion binding			skin(1)	1		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		actctgtctcaaaaaaaaaaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43289465	43289466	+	IGR	DEL	GA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43289465_43289466delGA								HEXIM2 (42059 upstream) : FMNL1 (9826 downstream)																							agaaagagaggaagagagaaag	0.000													4	3	---	---	---	---	
MAPT	4137	broad.mit.edu	37	17	44065869	44065870	+	Intron	INS	-	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44065869_44065870insC	uc002ijr.3	+						MAPT_uc010dau.2_Intron|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519	P10636	TAU_HUMAN	microtubule-associated protein tau isoform 1						cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)				TGGTTCCAGGGCCCCCCCCAGC	0.609													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	44925334	44925335	+	IGR	DEL	GT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44925334_44925335delGT								WNT3 (29252 upstream) : WNT9B (3633 downstream)																							GATTTCCAAAgtgtgtgtgtgt	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	47472852	47472853	+	IGR	INS	-	TTC	TTC	rs10625032		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47472852_47472853insTTC								ZNF652 (33017 upstream) : PHB (8567 downstream)																							GGAACCCTTCTTTCTTCttctt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	54041162	54041163	+	IGR	DEL	CA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54041162_54041163delCA								PCTP (186415 upstream) : ANKFN1 (189673 downstream)																							TTATCTTCTTCACTAAAACTTA	0.163													4	2	---	---	---	---	
RNF126P1	376412	broad.mit.edu	37	17	55123867	55123868	+	RNA	INS	-	GACT	GACT	rs147162599	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55123867_55123868insGACT	uc002iuw.2	+	1		c.1029_1030insGACT				NR_002818				Homo sapiens ring finger protein 126 pseudogene 1, mRNA (cDNA clone IMAGE:5166840), with apparent retained intron.												0						GAAACCGCGGGGACTTTCCCAA	0.688													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	59491889	59491889	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59491889delA								C17orf82 (1248 upstream) : TBX4 (37890 downstream)																							TTGCAGCAGGAAAAGGGCAAA	0.547													4	2	---	---	---	---	
TANC2	26115	broad.mit.edu	37	17	61114206	61114206	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61114206delG	uc002jal.3	+							NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2						ttacatgtaagtttttttttt	0.015													4	2	---	---	---	---	
ICAM2	3384	broad.mit.edu	37	17	62086664	62086664	+	5'Flank	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62086664delT	uc002jdu.3	-						ICAM2_uc002jdw.3_Intron|ICAM2_uc010ded.2_Intron|ICAM2_uc002jdx.3_Intron|ICAM2_uc002jdv.3_Intron|ICAM2_uc010wpx.1_Intron	NM_000873	NP_000864	P13598	ICAM2_HUMAN	intercellular adhesion molecule 2 precursor						cell-cell adhesion|regulation of immune response	integral to plasma membrane	integrin binding			ovary(1)	1						GCATTTACTGTTTTTTTTTTT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62932555	62932556	+	IGR	DEL	GT	-	-	rs35142297		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62932555_62932556delGT								LRRC37A3 (16969 upstream) : AMZ2P1 (30112 downstream)																							gtgtgtgttcgtgtgtgtgtgt	0.238													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	66221168	66221168	+	IGR	DEL	C	-	-	rs71142154		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66221168delC								LOC440461 (24732 upstream) : AMZ2 (22977 downstream)																							aaaaaaaaaacacacacacac	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	67943521	67943521	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67943521delC								MAP2K6 (405059 upstream) : KCNJ16 (127905 downstream)																							gtatttttttcaatggagact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	69193534	69193535	+	Intron	INS	-	ACA	ACA	rs138113708	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69193534_69193535insACA	uc002jis.3	-											Homo sapiens cDNA clone IMAGE:5267277.																		ctggcaaagacacaacaacaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72974990	72974991	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72974990_72974991insA								C17orf28 (6090 upstream) : CDR2L (8736 downstream)																							cctgtctcaagaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	74820125	74820126	+	IGR	INS	-	GCT	GCT	rs111870266		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74820125_74820126insGCT								MFSD11 (44789 upstream) : MGAT5B (44672 downstream)																							CCCCGACCCCAGCCCTTCCTGG	0.594													6	3	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77240845	77240848	+	Intron	DEL	CTTC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77240845_77240848delCTTC	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			ccttccttttcttccttccttcct	0.093													4	2	---	---	---	---	
C17orf70	80233	broad.mit.edu	37	17	79513882	79513882	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79513882delA	uc002kaq.2	-						C17orf70_uc002kao.1_Intron|C17orf70_uc010wuq.1_Intron|C17orf70_uc002kap.2_Intron	NM_001109760	NP_001103230	Q0VG06	FP100_HUMAN	Fanconi anemia core complex 100 kDa subunit						DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding			ovary(1)|skin(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			cctgtctcttaaaaaaaaaaa	0.264													5	3	---	---	---	---	
THOC4	10189	broad.mit.edu	37	17	79845850	79845851	+	3'UTR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79845850_79845851insA	uc002kbu.2	-	6						NM_005782	NP_005773	Q86V81	THOC4_HUMAN	THO complex 4						intronless viral mRNA export from host nucleus|mRNA 3'-end processing|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear speck|transcription export complex	nucleotide binding|protein binding|RNA binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			aaaaaaaaaagaaaaaaaaaaa	0.361													5	3	---	---	---	---	
USP14	9097	broad.mit.edu	37	18	162802	162803	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:162802_162803insT	uc002kkf.1	+						USP14_uc002kkg.1_Intron|USP14_uc010wyr.1_Intron	NM_005151	NP_005142	P54578	UBP14_HUMAN	ubiquitin specific protease 14 isoform a						regulation of chemotaxis|regulation of proteasomal protein catabolic process|ubiquitin-dependent protein catabolic process	cell surface|cytoplasmic membrane-bounded vesicle|plasma membrane|proteasome complex	cysteine-type endopeptidase activity|endopeptidase inhibitor activity|proteasome binding|tRNA guanylyltransferase activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)	2		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				gtctcagtttcttttttttttt	0.015													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	5890004	5890005	+	IGR	INS	-	A	A	rs142173071		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5890004_5890005insA								EPB41L3 (259362 upstream) : TMEM200C (179 downstream)																							CTAGTTTGCTTAAAAAAAAAAA	0.337													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	5941080	5941087	+	IGR	DEL	CACACACA	-	-	rs112874577		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5941080_5941087delCACACACA								TMEM200C (48977 upstream) : L3MBTL4 (13619 downstream)																							gagaccttgtcacacacacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	6418924	6418924	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6418924delA								L3MBTL4 (4014 upstream) : ARHGAP28 (369569 downstream)																							TCTTGTCAATAAAAAAAAAAA	0.318													4	2	---	---	---	---	
KIAA0802	23255	broad.mit.edu	37	18	8820407	8820407	+	Intron	DEL	A	-	-	rs80015232		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8820407delA	uc002knr.2	+						KIAA0802_uc002knq.2_Intron|KIAA0802_uc002kns.2_Intron	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255												0						gactccatccaaaaaaaaaaa	0.184													5	3	---	---	---	---	
RALBP1	10928	broad.mit.edu	37	18	9477898	9477898	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9477898delA	uc002kob.2	+						RALBP1_uc002koc.2_Intron	NM_006788	NP_006779	Q15311	RBP1_HUMAN	ralA binding protein 1						chemotaxis|positive regulation of Cdc42 GTPase activity|small GTPase mediated signal transduction|transport	cytosol|membrane	ATPase activity, coupled to movement of substances|Rac GTPase activator activity|Rac GTPase binding|Ral GTPase binding			central_nervous_system(1)	1						TAGCATCTGCAAAAATAGCAA	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	14267809	14267809	+	IGR	DEL	A	-	-	rs150927059		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14267809delA								ZNF519 (135380 upstream) : LOC284233 (69613 downstream)																							atacttacccaatgcctgtac	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15182215	15182215	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15182215delT								ANKRD30B (329478 upstream) : LOC644669 (131340 downstream)																							GAAATTTGTGTTTTATCAAAA	0.244													3	3	---	---	---	---	
GREB1L	80000	broad.mit.edu	37	18	19101333	19101333	+	Intron	DEL	A	-	-	rs35132178		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19101333delA	uc010xam.1	+							NM_001142966	NP_001136438	Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast							integral to membrane					0						actccatctcaaaaaaaaaaa	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22443494	22443494	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22443494delT								HRH4 (383574 upstream) : ZNF521 (198394 downstream)																							TAAGAAGCCATTTTGAGGGCA	0.194													4	2	---	---	---	---	
AQP4	361	broad.mit.edu	37	18	24445003	24445003	+	Intron	DEL	T	-	-	rs72021963		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24445003delT	uc002kwa.2	-						C18orf16_uc002kwb.2_5'Flank|C18orf16_uc010xbm.1_5'Flank|AQP4_uc002kvz.2_5'Flank	NM_001650	NP_001641	P55087	AQP4_HUMAN	aquaporin 4 isoform a						cellular response to interferon-gamma|excretion|nervous system development	cytoplasm|external side of plasma membrane|integral to plasma membrane	water channel activity				0	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)					TGTTTTTAGCTTTTTTTTTTT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	27885735	27885735	+	IGR	DEL	A	-	-	rs35573648		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27885735delA								MIR302F (6809 upstream) : DSC3 (684318 downstream)																							CAACAACAACAAAAAAAAAAA	0.318													4	4	---	---	---	---	
DSC1	1823	broad.mit.edu	37	18	28730458	28730460	+	Intron	DEL	CAC	-	-	rs141461651		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28730458_28730460delCAC	uc002kwn.2	-						DSC1_uc002kwm.2_Intron	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein						homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			gcaccatcatcaccacactacca	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	36061482	36061485	+	IGR	DEL	TGTG	-	-	rs72372187		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36061482_36061485delTGTG								CELF4 (915482 upstream) : LOC647946 (725403 downstream)																							TGGGGCTCACtgtgtgtgtgtgtg	0.353													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	36145740	36145741	+	IGR	INS	-	C	C	rs143579645	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36145740_36145741insC								CELF4 (999740 upstream) : LOC647946 (641147 downstream)																							tctccccctctccccctctttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	45079158	45079158	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45079158delG	uc002lcx.2	+											Homo sapiens, clone IMAGE:5538207, mRNA.																		ATCCAATTATGGGTCTGCTAG	0.139													4	3	---	---	---	---	
KIAA0427	9811	broad.mit.edu	37	18	46267649	46267651	+	Intron	DEL	CCG	-	-	rs146844162	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46267649_46267651delCCG	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						tactctgcccccgccccccctcC	0.256													4	3	---	---	---	---	
DYM	54808	broad.mit.edu	37	18	46981115	46981115	+	Intron	DEL	A	-	-	rs79064145		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46981115delA	uc002ldi.1	-						DYM_uc010xdf.1_Intron	NM_017653	NP_060123	Q7RTS9	DYM_HUMAN	dymeclin							Golgi apparatus					0						taaaaataccaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	51963762	51963763	+	IGR	INS	-	G	G	rs144818939	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51963762_51963763insG								C18orf54 (55359 upstream) : C18orf26 (291225 downstream)																							TCCATAGAGTTGGGCTTGGAGA	0.465													3	3	---	---	---	---	
WDR7	23335	broad.mit.edu	37	18	54600106	54600107	+	Intron	DEL	GT	-	-	rs79184767		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54600106_54600107delGT	uc002lgk.1	+						WDR7_uc002lgl.1_Intron	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1											ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		TTCATTCTGGgtgtgtgtgtgt	0.386													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	56744476	56744476	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56744476delC								LOC390858 (24030 upstream) : SEC11C (62649 downstream)																							acactattatcctcatctaca	0.000													4	2	---	---	---	---	
CDH7	1005	broad.mit.edu	37	18	63518501	63518502	+	Intron	DEL	AC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63518501_63518502delAC	uc002ljz.2	+						CDH7_uc002lka.2_Intron|CDH7_uc002lkb.2_Intron	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				TTACAGCAATACACACACACAC	0.327													3	3	---	---	---	---	
CNDP1	84735	broad.mit.edu	37	18	72250676	72250676	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72250676delA	uc002llq.2	+						CNDP1_uc002lls.2_Intron	NM_032649	NP_116038	Q96KN2	CNDP1_HUMAN	carnosinase 1 precursor						proteolysis	extracellular region	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity|tripeptidase activity				0		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		ATCTAATGGTAAAAAAAGAAA	0.393													7	4	---	---	---	---	
GALR1	2587	broad.mit.edu	37	18	74970790	74970801	+	Intron	DEL	TGGTGGTGATGG	-	-	rs145793008	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74970790_74970801delTGGTGGTGATGG	uc002lms.3	+							NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1						digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		gtgctggtgatggtggtgatggtggtggtgat	0.000													4	3	---	---	---	---	
TCF3	6929	broad.mit.edu	37	19	1619749	1619750	+	Intron	INS	-	GGGTG	GGGTG	rs141859965	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1619749_1619750insGGGTG	uc002ltr.2	-						TCF3_uc002lto.2_Intron|TCF3_uc002ltt.3_Intron|TCF3_uc002ltq.2_Intron|TCF3_uc002lts.1_Intron|TCF3_uc010dso.1_Intron	NM_003200	NP_003191	P15923	TFE2_HUMAN	transcription factor 3 isoform E12						B cell lineage commitment|B cell lineage commitment|G1 phase of mitotic cell cycle|immunoglobulin V(D)J recombination|muscle cell differentiation|positive regulation of B cell proliferation|positive regulation of cell cycle|positive regulation of muscle cell differentiation|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus|protein complex|transcription factor complex	bHLH transcription factor binding|DNA binding|E-box binding|identical protein binding|mitogen-activated protein kinase kinase kinase binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|vitamin D response element binding			lung(2)|breast(2)|ovary(1)|large_intestine(1)|skin(1)	7		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGTCGGGGAAGGGTGGGGTGG	0.594			T	PBX1|HLF|TFPT	pre B-ALL								3	3	---	---	---	---	
ANKRD24	170961	broad.mit.edu	37	19	4199809	4199810	+	Intron	INS	-	A	A	rs140961038	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4199809_4199810insA	uc010dtt.1	+						ANKRD24_uc002lzs.2_Intron|ANKRD24_uc002lzt.2_Intron	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GAGCCCCTGTCGGGGGCGTGGG	0.708													4	3	---	---	---	---	
KDM4B	23030	broad.mit.edu	37	19	5097512	5097512	+	Intron	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5097512delC	uc002mbq.3	+						KDM4B_uc010xil.1_Intron|KDM4B_uc010xim.1_Intron|KDM4B_uc002mbr.3_Intron	NM_015015	NP_055830	O94953	KDM4B_HUMAN	jumonji domain containing 2B						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1						gatcctcctgccttggcctcc	0.144													4	2	---	---	---	---	
TNFSF9	8744	broad.mit.edu	37	19	6534068	6534071	+	Intron	DEL	TTCC	-	-	rs72356419		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6534068_6534071delTTCC	uc002mfh.2	+							NM_003811	NP_003802	P41273	TNFL9_HUMAN	tumor necrosis factor (ligand) superfamily,						apoptosis|cell proliferation|cell-cell signaling|immune response|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding			central_nervous_system(1)	1						cctctcccctttccttccttctct	0.132													2	4	---	---	---	---	
C3	718	broad.mit.edu	37	19	6717759	6717760	+	Intron	INS	-	GTG	GTG	rs147904211	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6717759_6717760insGTG	uc002mfm.2	-							NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor						complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		gtgtgttgtgtgtgtggtcatg	0.000													4	2	---	---	---	---	
VAV1	7409	broad.mit.edu	37	19	6856887	6856888	+	Intron	DEL	GT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6856887_6856888delGT	uc002mfu.1	+						VAV1_uc010xjh.1_Intron|VAV1_uc010dva.1_Intron|VAV1_uc002mfv.1_Intron	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						gaggtaatgggtgtgtgtgtgt	0.000													4	2	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7131997	7131997	+	Intron	DEL	A	-	-	rs78501993		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7131997delA	uc002mgd.1	-						INSR_uc002mge.1_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	cctccatctcaaaaaaaaaaa	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	10055775	10055775	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10055775delA								OLFM2 (8705 upstream) : COL5A3 (14462 downstream)																							agaaagaaagaaagaaagaaa	0.000													4	3	---	---	---	---	
COL5A3	50509	broad.mit.edu	37	19	10089452	10089452	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10089452delT	uc002mmq.1	-							NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein						collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			CCCTCCACCATTTTTTTTGCT	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	12411164	12411164	+	IGR	DEL	A	-	-	rs112142990		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12411164delA								ZNF44 (5450 upstream) : ZNF563 (17142 downstream)																							actctgtctcaaaaaaaaaaa	0.154													5	3	---	---	---	---	
DNASE2	1777	broad.mit.edu	37	19	12987273	12987274	+	Intron	INS	-	TT	TT	rs142745533		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12987273_12987274insTT	uc002mvn.1	-						DNASE2_uc010xmr.1_Intron	NM_001375	NP_001366	O00115	DNS2A_HUMAN	deoxyribonuclease II, lysosomal precursor						apoptosis	lysosome	deoxyribonuclease II activity|DNA binding|protein binding				0						TCCATAtttccttttttttttt	0.277								Direct_reversal_of_damage					6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	16827523	16827524	+	IGR	INS	-	T	T	rs36007910		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16827523_16827524insT								TMEM38A (27709 upstream) : NWD1 (3263 downstream)																							catacacactcttttttttttt	0.000													4	3	---	---	---	---	
PLVAP	83483	broad.mit.edu	37	19	17471724	17471724	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17471724delT	uc002ngk.1	-							NM_031310	NP_112600	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein							caveola|integral to membrane|perinuclear region of cytoplasm					0						tttctttttcttttttttttt	0.234													7	4	---	---	---	---	
SLC27A1	376497	broad.mit.edu	37	19	17609669	17609670	+	Intron	DEL	GA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17609669_17609670delGA	uc002ngu.1	+						SLC27A1_uc002ngt.1_3'UTR|SLC27A1_uc010xpp.1_Intron|SLC27A1_uc002ngv.1_Intron	NM_198580	NP_940982	Q6PCB7	S27A1_HUMAN	solute carrier family 27, member 1						cardiolipin biosynthetic process|fatty acid metabolic process|long-chain fatty acid transport|negative regulation of phospholipid biosynthetic process|phosphatidic acid biosynthetic process|phosphatidylcholine biosynthetic process|phosphatidylethanolamine biosynthetic process|phosphatidylinositol biosynthetic process|phosphatidylserine biosynthetic process|transmembrane transport	endomembrane system|integral to membrane	fatty acid transporter activity|nucleotide binding				0						cagagagagggagagagagaga	0.000													4	2	---	---	---	---	
ELL	8178	broad.mit.edu	37	19	18575301	18575303	+	Intron	DEL	ACA	-	-	rs146602179		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18575301_18575303delACA	uc002njh.2	-						ELL_uc010ebq.2_Intron|ELL_uc002njg.2_Intron	NM_006532	NP_006523	P55199	ELL_HUMAN	elongation factor RNA polymerase II						positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding			lung(1)	1				GBM - Glioblastoma multiforme(1328;7.81e-07)		CCCTGGCCATACAACATGTCCAC	0.576			T	MLL	AL								3	3	---	---	---	---	
ZNF826	664701	broad.mit.edu	37	19	20498165	20498165	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20498165delT	uc002now.1	-						ZNF826_uc010ecl.1_Intron					Homo sapiens cDNA FLJ44894 fis, clone BRAMY3000692, moderately similar to Zinc finger protein 91.												0						TTTTTTTGCCTTTTttttttt	0.040													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	21782445	21782445	+	IGR	DEL	T	-	-	rs74174023		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21782445delT								ZNF429 (43377 upstream) : ZNF100 (124399 downstream)																							atgtatagagttttaacagca	0.189													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	23651989	23651991	+	IGR	DEL	TCT	-	-	rs7251433		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23651989_23651991delTCT								ZNF91 (73720 upstream) : ZNF675 (183718 downstream)																							cttctcctcctcttctaattctc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27739692	27739693	+	IGR	INS	-	A	A	rs143242816		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27739692_27739693insA								None (None upstream) : LOC148189 (541709 downstream)																							tatcttcatataaaactagaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27792619	27792620	+	IGR	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27792619_27792620insA								None (None upstream) : LOC148189 (488782 downstream)																							attcaacacacagagttgaaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29114056	29114057	+	Intron	DEL	AC	-	-	rs72151192		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29114056_29114057delAC	uc002nsa.1	-											Homo sapiens cDNA clone IMAGE:5297319, with apparent retained intron.																		cttgtggtaaacacacacacac	0.000													4	2	---	---	---	---	
ANKRD27	84079	broad.mit.edu	37	19	33148529	33148529	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33148529delA	uc002ntn.1	-						ANKRD27_uc002nto.1_Intron	NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)						early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					actctgtctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
GPATCH1	55094	broad.mit.edu	37	19	33589832	33589833	+	Intron	INS	-	T	T	rs58057473		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33589832_33589833insT	uc002nug.1	+							NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1							catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					CAATGTTTTTCTTTTTTTTTCC	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	35083273	35083273	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35083273delG								LOC643719 (14677 upstream) : SCGBL (1074 downstream)																							GATCCAGGCTGGTATTCCCAT	0.592													4	2	---	---	---	---	
SIPA1L3	23094	broad.mit.edu	37	19	38601665	38601665	+	Intron	DEL	T	-	-	rs72273680		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38601665delT	uc002ohk.2	+							NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ttgttttgggttttttttttt	0.249													3	3	---	---	---	---	
ACTN4	81	broad.mit.edu	37	19	39207499	39207500	+	Intron	DEL	AA	-	-	rs146598322		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39207499_39207500delAA	uc002oja.1	+						ACTN4_uc010egc.1_Intron	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4						platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGGAAGTAACAAGAGAACAGTA	0.361													3	4	---	---	---	---	
AKT2	208	broad.mit.edu	37	19	40763494	40763495	+	Intron	DEL	AC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40763494_40763495delAC	uc002onf.2	-						AKT2_uc010egs.2_Intron|AKT2_uc010egt.2_Intron|AKT2_uc010xvj.1_Intron|AKT2_uc010egu.1_Intron|AKT2_uc010xvk.1_Intron	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase						insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)			atgcacacaaacacacacacac	0.218			A		ovarian|pancreatic 								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42239444	42239445	+	IGR	INS	-	TCTC	TCTC	rs145923609	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42239444_42239445insTCTC								CEACAM5 (5008 upstream) : CEACAM6 (19953 downstream)																							TGACCTGCTATtctctctctct	0.054													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	43157017	43157017	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43157017delC								CEACAM8 (57935 upstream) : PSG3 (68778 downstream)																							GCACATGTGACGGTCACACAC	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	45195056	45195056	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45195056delA								CEACAM19 (7431 upstream) : CEACAM16 (7302 downstream)																							actctgtctcaaaaaaaaaaa	0.025													6	3	---	---	---	---	
EXOC3L2	90332	broad.mit.edu	37	19	45720288	45720289	+	Intron	INS	-	TT	TT			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45720288_45720289insTT	uc002pay.1	-							NM_138568	NP_612635	Q2M3D2	EX3L2_HUMAN	exocyst complex component 3-like 2											ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)		tcttttttttcttttttttttg	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	45749854	45749854	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45749854delA								EXOC3L2 (12385 upstream) : MARK4 (4988 downstream)																							AGTCAGGGTTACTTTAAAAGG	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47337675	47337675	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47337675delT								SNAR-E (3714 upstream) : AP2S1 (3748 downstream)																							gttAGGCACAttttttttttc	0.020													4	2	---	---	---	---	
NPAS1	4861	broad.mit.edu	37	19	47521291	47521291	+	5'Flank	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47521291delT	uc002pfw.2	+						NPAS1_uc002pfx.2_5'Flank|NPAS1_uc002pfy.2_5'Flank	NM_002517	NP_002508	Q99742	NPAS1_HUMAN	neuronal PAS domain protein 1						central nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity				0		all_cancers(25;4.31e-08)|all_epithelial(76;2.96e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.102)		all cancers(93;6.02e-05)|OV - Ovarian serous cystadenocarcinoma(262;7.35e-05)|Epithelial(262;0.00389)|GBM - Glioblastoma multiforme(486;0.0252)		tccacccgcctcagcctccca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	48449301	48449302	+	IGR	INS	-	TT	TT	rs142936065		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48449301_48449302insTT								SNAR-C4 (6384 upstream) : SNAR-C3 (4251 downstream)																							gaattgttttgttttgttttgt	0.035													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	51478787	51478788	+	IGR	DEL	CT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51478787_51478788delCT								KLK6 (5858 upstream) : KLK7 (942 downstream)																							ggggctggggctggtctggact	0.000													4	2	---	---	---	---	
HAS1	3036	broad.mit.edu	37	19	52217398	52217398	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52217398delG	uc002pxo.1	-						HAS1_uc010epc.1_Intron|HAS1_uc010epd.1_Intron|HAS1_uc002pxn.1_Intron|HAS1_uc002pxp.1_Intron	NM_001523	NP_001514	Q92839	HAS1_HUMAN	hyaluronan synthase 1						cell adhesion	integral to plasma membrane	hyaluronan synthase activity|protein binding			ovary(1)|pancreas(1)	2		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CGTGCTCCCTGGGGCCTGGGC	0.498													4	3	---	---	---	---	
ZNF766	90321	broad.mit.edu	37	19	52773785	52773785	+	Intron	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52773785delG	uc002pyr.1	+						ZNF766_uc002pys.1_Intron	NM_001010851	NP_001010851	Q5HY98	ZN766_HUMAN	zinc finger protein 766						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		TTTGGAGCCAGGGCAGACCGA	0.602													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	55413836	55413836	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55413836delT								FCAR (11998 upstream) : NCR1 (3672 downstream)																							aatttttgcatttttttttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	58567241	58567244	+	IGR	DEL	AGTT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58567241_58567244delAGTT								ZSCAN1 (1242 upstream) : ZNF135 (3368 downstream)																							GGTGTCCCTCAGTTCTCCAATTGA	0.500													4	2	---	---	---	---	
C20orf94	128710	broad.mit.edu	37	20	10520809	10520810	+	Intron	INS	-	TCCT	TCCT			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10520809_10520810insTCCT	uc010zre.1	+							NM_001009608	NP_001009608	Q5VYV7	CT094_HUMAN	hypothetical protein LOC128710								protein binding				0						ccttccttctctccttccttcc	0.059													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	12873349	12873349	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12873349delG								BTBD3 (966107 upstream) : SPTLC3 (116278 downstream)																							agaaaaccatggtcccttcct	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	12896586	12896586	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12896586delA								BTBD3 (989344 upstream) : SPTLC3 (93041 downstream)																							GCAGAGTGACAAAAGAAAGGG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	16706707	16706707	+	IGR	DEL	T	-	-	rs139149827		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16706707delT								KIF16B (152629 upstream) : SNRPB2 (3922 downstream)																							ttttttcttcttttttttttt	0.020													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	17911667	17911668	+	IGR	INS	-	GT	GT	rs147771946	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17911667_17911668insGT								BANF2 (195150 upstream) : SNX5 (10578 downstream)																							AAAGTATTTGAgtgtgtgtgtg	0.297													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19843238	19843241	+	IGR	DEL	AAAC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19843238_19843241delAAAC								SLC24A3 (139698 upstream) : RIN2 (26969 downstream)																							ctccgtctcaaaacaaacaaacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23169414	23169417	+	RNA	DEL	TGTG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23169414_23169417delTGTG	uc002wsw.1	+	1		c.817_820delTGTG								Homo sapiens cDNA FLJ34446 fis, clone HLUNG2002050.																		tgtgcatttatgtgtgtgtggtgt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26206599	26206600	+	IGR	INS	-	AG	AG			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26206599_26206600insAG								MIR663 (17685 upstream) : None (None downstream)																							TATAATACAGCAGAGTTCAATT	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26252699	26252700	+	IGR	INS	-	T	T	rs143639929		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26252699_26252700insT								MIR663 (63785 upstream) : None (None downstream)																							AGAAAGTGTCATCGATTTTTAC	0.441													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29428225	29428225	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29428225delC								None (None upstream) : FRG1B (183654 downstream)																							accttctctacaaaaaataaa	0.000													9	4	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29634402	29634402	+	Intron	DEL	T	-	-	rs67656346		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29634402delT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						GAACTAGGGGTCTGGGCAGAG	0.443													1	6	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29645792	29645792	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29645792delA	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						cataaaaaggaatgagatcat	0.000													10	5	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29648450	29648450	+	Intron	DEL	T	-	-	rs143554592		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29648450delT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						cagaactccctctcctgtttt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31275505	31275505	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31275505delA								C20orf203 (13762 upstream) : COMMD7 (14989 downstream)																							caggaggctgaggcacgagaa	0.000													4	2	---	---	---	---	
PXMP4	11264	broad.mit.edu	37	20	32300254	32300255	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32300254_32300255insT	uc002wzv.2	-						PXMP4_uc002wzw.2_Intron|PXMP4_uc010zuh.1_Intron	NM_007238	NP_009169	Q9Y6I8	PXMP4_HUMAN	peroxisomal membrane protein 4 isoform a							integral to membrane|membrane fraction|mitochondrial inner membrane|peroxisomal membrane	protein transporter activity				0						cctggcagcaattttttttttt	0.000													4	2	---	---	---	---	
TGIF2	60436	broad.mit.edu	37	20	35207584	35207584	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35207584delT	uc002xfn.2	+						C20orf24_uc002xfo.2_Intron	NM_021809	NP_068581	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)|skin(1)	2	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				TAGATAGTCCtttttttttga	0.100													3	3	---	---	---	---	
C20orf132	140699	broad.mit.edu	37	20	35801933	35801934	+	Intron	INS	-	CTGT	CTGT	rs143367151	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35801933_35801934insCTGT	uc010zvu.1	-						C20orf132_uc002xgm.2_Intron|C20orf132_uc002xgn.2_Intron	NM_152503	NP_689716	Q9H579	CT132_HUMAN	hypothetical protein LOC140699 isoform 1												0		Myeloproliferative disorder(115;0.00878)				tacttcagtgactgtttactct	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36740455	36740457	+	IGR	DEL	TTT	-	-	rs149380856	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36740455_36740457delTTT								RPRD1B (19691 upstream) : TGM2 (16409 downstream)																							tccttccttctttccttctttcc	0.099													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	38210492	38210492	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38210492delA								LOC339568 (357101 upstream) : None (None downstream)																							tgtggagtacaaatcaatcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	38658245	38658245	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38658245delG								LOC339568 (804854 upstream) : MAFB (656274 downstream)																							gaggaagaaagggaaggaagg	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	39185902	39185902	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39185902delA								None (None upstream) : MAFB (128617 downstream)																							gagcatcaggaaaaataccta	0.000													4	2	---	---	---	---	
CHD6	84181	broad.mit.edu	37	20	40100181	40100182	+	Intron	DEL	TT	-	-	rs11476741		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40100181_40100182delTT	uc002xka.1	-						CHD6_uc002xkd.2_Intron	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				ATATTTTCAGtttttttttttt	0.153													4	2	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41110418	41110419	+	Intron	DEL	AC	-	-	rs147342759		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41110418_41110419delAC	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				acacacacaaacacacacacac	0.213													3	3	---	---	---	---	
C20orf199	441951	broad.mit.edu	37	20	47897440	47897441	+	RNA	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47897440_47897441insT	uc002xuj.2	+	4		c.412_413insT			ZNFX1_uc002xui.2_5'Flank|C20orf199_uc002xul.3_RNA|C20orf199_uc002xun.3_Intron|C20orf199_uc002xum.3_Intron|C20orf199_uc002xuo.2_Intron	NR_003605				Homo sapiens cDNA FLJ42181 fis, clone THYMU2031368.												0						CTTTCTATAGGTTGGGAGCCAC	0.436													4	4	---	---	---	---	
PTGIS	5740	broad.mit.edu	37	20	48154961	48154962	+	Intron	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48154961_48154962insA	uc002xut.2	-						PTGIS_uc010zyi.1_Intron	NM_000961	NP_000952	Q16647	PTGIS_HUMAN	prostaglandin I2 synthase						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|prostaglandin-I synthase activity			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Phenylbutazone(DB00812)	agacaaaaaacaaaaaataaat	0.000													4	2	---	---	---	---	
DOK5	55816	broad.mit.edu	37	20	53220842	53220842	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53220842delT	uc002xwy.2	+						DOK5_uc010gin.2_Intron|DOK5_uc002xwz.2_Intron	NM_018431	NP_060901	Q9P104	DOK5_HUMAN	docking protein 5								insulin receptor binding			ovary(1)	1			Colorectal(105;0.202)			CATTCTGTGCttttttttttt	0.259													4	2	---	---	---	---	
CASS4	57091	broad.mit.edu	37	20	54991584	54991585	+	Intron	INS	-	GT	GT	rs144647552	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54991584_54991585insGT	uc002xxp.2	+						CASS4_uc002xxq.3_Intron|CASS4_uc002xxr.2_Intron|CASS4_uc010zze.1_Intron|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a						cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						TGTTTACTTCCgtgtgtgtgtg	0.292													5	3	---	---	---	---	
PPP4R1L	55370	broad.mit.edu	37	20	56871134	56871134	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56871134delA	uc002xyy.1	-						PPP4R1L_uc010gjn.1_Intron					SubName: Full=cDNA FLJ50842, moderately similar to Serine/threonine-protein phosphatase 4regulatory subunit 1;												0						TCTACAAGGCAGTATTACAAA	0.358													4	2	---	---	---	---	
YTHDF1	54915	broad.mit.edu	37	20	61830870	61830871	+	Intron	INS	-	A	A			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61830870_61830871insA	uc002yeh.2	-						YTHDF1_uc011aaq.1_Intron	NM_017798	NP_060268	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1											ovary(2)	2						gattctgtcttaaaaaaaaaaa	0.193													2	6	---	---	---	---	
ZBTB46	140685	broad.mit.edu	37	20	62379990	62379990	+	Intron	DEL	G	-	-	rs1887406	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62379990delG	uc002ygv.1	-						ZBTB46_uc002ygu.2_Intron	NM_025224	NP_079500	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)|ovary(1)	2	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					AAGTCCACACGAGGGGCTTCT	0.667													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	62945366	62945367	+	IGR	DEL	TT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62945366_62945367delTT								PCMTD2 (37788 upstream) : None (None downstream)																							attcGAAATGTTTTATTATTAA	0.099													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9831913	9831913	+	IGR	DEL	C	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9831913delC								None (None upstream) : None (None downstream)																							GCTAGCATGACCCTCCTACCT	0.512													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10833982	10833983	+	IGR	INS	-	AATAC	AATAC			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10833982_10833983insAATAC								None (None upstream) : TPTE (72760 downstream)																							gaatggaatggaatggaatgga	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10841779	10841779	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10841779delT								None (None upstream) : TPTE (64964 downstream)																							tggaatggactcgaatggaat	0.000													5	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11058759	11058759	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11058759delA	uc002yit.1	-						BAGE_uc002yiw.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAATAAATACAAAATAAACTC	0.239													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11060029	11060030	+	Intron	INS	-	AAAAT	AAAAT	rs112803135		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11060029_11060030insAAAAT	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAACACAGAAAAAATATTTGTC	0.257													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11086246	11086248	+	Intron	DEL	ATA	-	-	rs112021058		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11086246_11086248delATA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		agtattccagataataaaatgaa	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11094127	11094128	+	Intron	INS	-	T	T	rs145014238		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11094127_11094128insT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GGCACAGTGTGTTTTTTTCCAC	0.287													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14383986	14383987	+	IGR	DEL	AA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14383986_14383987delAA								None (None upstream) : C21orf99 (26500 downstream)																							actccatctcaaaaaaaaaaaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	25476736	25476737	+	IGR	INS	-	A	A	rs149503935	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25476736_25476737insA								None (None upstream) : None (None downstream)																							TCATTAACAGGAAAAAAAAAAC	0.332													4	2	---	---	---	---	
N6AMT1	29104	broad.mit.edu	37	21	30249858	30249859	+	Intron	INS	-	G	G			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30249858_30249859insG	uc002ymo.1	-						N6AMT1_uc002ymp.1_Intron|N6AMT1_uc002ymq.1_Intron	NM_013240	NP_037372	Q9Y5N5	HEMK2_HUMAN	N-6 adenine-specific DNA methyltransferase 1						positive regulation of cell growth	protein complex	nucleic acid binding|protein binding|protein methyltransferase activity				0						aagagaagagaagagagagaga	0.015													4	2	---	---	---	---	
RUNX1	861	broad.mit.edu	37	21	36389179	36389180	+	Intron	DEL	TG	-	-	rs112291224		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36389179_36389180delTG	uc010gmu.2	-						RUNX1_uc002yut.1_Intron|RUNX1_uc010gmv.2_Intron|RUNX1_uc002yuj.3_Intron|RUNX1_uc002yuk.3_Intron|RUNX1_uc002yum.1_Intron|RUNX1_uc010gmw.1_Intron	NM_001754	NP_001745	Q01196	RUNX1_HUMAN	runt-related transcription factor 1 isoform						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387						GTGTGCACATtgtgtgtgtgtg	0.446			T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				4	2	---	---	---	---	
ERG	2078	broad.mit.edu	37	21	39906476	39906477	+	Intron	INS	-	A	A	rs140345128	by1000genomes	TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39906476_39906477insA	uc010gnw.2	-						ERG_uc010gnv.2_Intron|ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron|ERG_uc002yxc.3_Intron|ERG_uc010gnz.2_Intron	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				ctatgaaatataaaaaaaatta	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	42781164	42781165	+	IGR	DEL	AC	-	-	rs150210122		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42781164_42781165delAC								MX2 (295 upstream) : MX1 (11355 downstream)																							GTCTCTGAATacacacacacac	0.178													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44229870	44229871	+	IGR	DEL	CT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44229870_44229871delCT								PDE9A (34254 upstream) : WDR4 (33335 downstream)																							tgcacaggcactcacacacatg	0.069													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44254877	44254880	+	IGR	DEL	GTGT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44254877_44254880delGTGT								PDE9A (59261 upstream) : WDR4 (8326 downstream)																							TCAGCAGTGCGTGTGTATGTGTGT	0.103													2	4	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45813548	45813548	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45813548delT	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						acccagtgcctttttttttta	0.000													4	2	---	---	---	---	
CECR2	27443	broad.mit.edu	37	22	17978664	17978664	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17978664delT	uc010gqw.1	+						CECR2_uc010gqv.1_Intron|CECR2_uc002zml.2_Intron|CECR2_uc002zmm.1_Intron	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2						chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)		TACAGCACAATTTTTTTTTCC	0.348													4	2	---	---	---	---	
CECR2	27443	broad.mit.edu	37	22	18017682	18017682	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18017682delA	uc010gqw.1	+						CECR2_uc010gqv.1_Intron|CECR2_uc002zml.2_Intron|CECR2_uc002zmn.2_Intron	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2						chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)		gactccgtccaaaaaaaaaaa	0.020													4	2	---	---	---	---	
PI4KA	5297	broad.mit.edu	37	22	21186405	21186405	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21186405delT	uc002zsz.3	-						PI4KA_uc010gsq.1_Intron	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha						phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			tttgaaattcttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	22103454	22103456	+	IGR	DEL	TTT	-	-	rs34041692		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22103454_22103456delTTT								YPEL1 (13383 upstream) : MAPK1 (10493 downstream)																							tctcaagaagttttttttttttt	0.030													4	2	---	---	---	---	
PPM1F	9647	broad.mit.edu	37	22	22288587	22288587	+	Frame_Shift_Del	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22288587delG	uc002zvp.1	-	4	481	c.367delC	c.(367-369)CAAfs	p.Q123fs	PPM1F_uc011aik.1_Frame_Shift_Del_p.Q19fs|PPM1F_uc002zvq.2_Frame_Shift_Del_p.Q123fs	NM_014634	NP_055449	P49593	PPM1F_HUMAN	protein phosphatase 1F	123					apoptosis|protein dephosphorylation	protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			ovary(2)|large_intestine(1)|breast(1)|kidney(1)	5	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		GCCAGGCTTTGGGCATCCAGC	0.627													4	8	---	---	---	---	
SMARCB1	6598	broad.mit.edu	37	22	24161509	24161512	+	Intron	DEL	ATTC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24161509_24161512delATTC	uc002zyb.2	+						SMARCB1_uc002zya.2_Intron|SMARCB1_uc002zyc.2_Intron|SMARCB1_uc002zyd.2_Intron	NM_003073	NP_003064	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin						cell cycle|chromatin remodeling|DNA integration|interspecies interaction between organisms|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|retroviral genome replication|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleolus|nucleoplasm|SWI/SNF complex	p53 binding	p.?(3)		soft_tissue(193)|central_nervous_system(172)|haematopoietic_and_lymphoid_tissue(23)|meninges(5)|skin(5)|bone(4)|ovary(2)|endometrium(1)|lung(1)|pancreas(1)	407		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				gttttcatttattcattcattcat	0.000			D|N|F|S		malignant rhabdoid 	malignant rhabdoid			Rhabdoid_Predisposition_syndrome|Schwannomatosis				4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27691663	27691666	+	IGR	DEL	ATGG	-	-	rs149092911		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27691663_27691666delATGG								MIAT (576714 upstream) : MN1 (452600 downstream)																							CTGCCTTACCatggatggatggat	0.098													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	29080900	29080900	+	IGR	DEL	G	-	-	rs113324191		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29080900delG								TTC28 (5047 upstream) : CHEK2 (2831 downstream)																							tctgcacagtgctgtggtttg	0.000													4	5	---	---	---	---	
OSBP2	23762	broad.mit.edu	37	22	31298097	31298098	+	Intron	INS	-	A	A	rs140582816		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31298097_31298098insA	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron|OSBP2_uc003aja.1_Intron|OSBP2_uc011alc.1_Intron|OSBP2_uc003ajb.2_Intron|OSBP2_uc011ald.1_Intron|OSBP2_uc010gwd.1_Intron	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						agcaatataagaaaaaaaaaaA	0.203													4	2	---	---	---	---	
PISD	23761	broad.mit.edu	37	22	32025333	32025333	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32025333delA	uc003alm.3	-						PISD_uc003alk.2_Intron|PISD_uc003all.2_Intron|PISD_uc011alr.1_Intron|PISD_uc003aln.3_Intron	NM_014338	NP_055153	Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase						phospholipid biosynthetic process	mitochondrion	phosphatidylserine decarboxylase activity			central_nervous_system(2)|ovary(1)	3					Phosphatidylserine(DB00144)	tggggtgtgtaggtgtgaggg	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34975791	34975792	+	IGR	INS	-	AC	AC			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34975791_34975792insAC								LARGE (657207 upstream) : ISX (486337 downstream)																							TTTCTGCCATGacacacacaca	0.050													2	4	---	---	---	---	
HMOX1	3162	broad.mit.edu	37	22	35787286	35787286	+	Intron	DEL	T	-	-	rs72337618		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35787286delT	uc003ant.1	+							NM_002133	NP_002124	P09601	HMOX1_HUMAN	heme oxygenase (decyclizing) 1						angiogenesis|anti-apoptosis|cell death|cellular iron ion homeostasis|endothelial cell proliferation|erythrocyte homeostasis|heme catabolic process|heme oxidation|intracellular protein kinase cascade|low-density lipoprotein particle clearance|negative regulation of leukocyte migration|negative regulation of smooth muscle cell proliferation|positive regulation of chemokine biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of smooth muscle cell proliferation|protein homooligomerization|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hydrogen peroxide|response to nicotine|smooth muscle hyperplasia|transmembrane transport|wound healing involved in inflammatory response	endoplasmic reticulum membrane|extracellular space|microsome	enzyme binding|heme binding|heme oxygenase (decyclizing) activity|protein homodimerization activity|signal transducer activity			ovary(1)	1					NADH(DB00157)	Atttttttggttttttttttt	0.005													4	2	---	---	---	---	
FOXRED2	80020	broad.mit.edu	37	22	36905722	36905722	+	5'Flank	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36905722delT	uc003apo.3	-						FOXRED2_uc003app.3_5'Flank	NM_024955	NP_079231	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2						ER-associated protein catabolic process	endoplasmic reticulum lumen	flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			lung(1)|kidney(1)	2						gcacctggccttttttttttt	0.000													4	2	---	---	---	---	
NPTXR	23467	broad.mit.edu	37	22	39219990	39219990	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39219990delT	uc003awk.2	-							NM_014293	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor							integral to membrane	metal ion binding			central_nervous_system(2)|skin(1)	3	Melanoma(58;0.04)					TGAGGTCACAttttttttttt	0.139													4	2	---	---	---	---	
APOBEC3D	140564	broad.mit.edu	37	22	39425926	39425926	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39425926delT	uc011aoe.1	+						APOBEC3D_uc011aof.1_Intron|APOBEC3D_uc003awu.3_Intron|APOBEC3D_uc003awt.3_Intron|APOBEC3D_uc010gxu.2_Intron	NM_152426	NP_689639	Q96AK3	ABC3D_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic						negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding				0	Melanoma(58;0.04)					TCCTCCCACATTTTTTAAGTC	0.284													4	2	---	---	---	---	
CACNA1I	8911	broad.mit.edu	37	22	40016768	40016771	+	Intron	DEL	TTTT	-	-	rs71751650		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40016768_40016771delTTTT	uc003ayc.2	+						CACNA1I_uc003ayd.2_Intron|CACNA1I_uc003aye.2_Intron|CACNA1I_uc003ayf.2_Intron	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,						axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	tgtttgtttgttttttttgagaca	0.167													2	4	---	---	---	---	
MKL1	57591	broad.mit.edu	37	22	40904708	40904708	+	Intron	DEL	T	-	-	rs113864356		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40904708delT	uc003ayw.1	-						MKL1_uc010gye.1_Intron|MKL1_uc010gyf.1_Intron|MKL1_uc003ayy.1_Intron	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein						positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						TTGAGGGTACTTTTTTTTTTG	0.244			T	RBM15	acute megakaryocytic leukemia								3	6	---	---	---	---	
MEI1	150365	broad.mit.edu	37	22	42101711	42101712	+	Intron	DEL	AC	-	-	rs112463174		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42101711_42101712delAC	uc003baz.1	+						MEI1_uc003bay.3_Intron|MEI1_uc011apd.1_Intron	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2						tttgttttttactttttttttt	0.158													4	3	---	---	---	---	
WBP2NL	164684	broad.mit.edu	37	22	42396997	42396997	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42396997delA	uc011ape.1	+						WBP2NL_uc003bbt.2_Intron|WBP2NL_uc011apk.1_Intron|WBP2NL_uc003bbu.2_Intron	NM_152613	NP_689826	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like						egg activation|male pronucleus assembly|meiosis	perinuclear theca	WW domain binding			ovary(2)	2						actccgtctcaaaaaaaaaga	0.149													4	2	---	---	---	---	
C22orf32	91689	broad.mit.edu	37	22	42477173	42477174	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42477173_42477174insT	uc003bca.2	+							NM_033318	NP_201575	Q9H4I9	CV032_HUMAN	hypothetical protein LOC91689 precursor							integral to membrane|mitochondrion				ovary(1)	1						ACCTTATCTCCttttttttttt	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	50432139	50432139	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50432139delA								PIM3 (74420 upstream) : IL17REL (803 downstream)																							GGAAGGCTTGAGGGAGCCCAC	0.587													4	2	---	---	---	---	
MLC1	23209	broad.mit.edu	37	22	50506019	50506020	+	Intron	INS	-	C	C			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50506019_50506020insC	uc003bjg.1	-						MLC1_uc011arl.1_Intron|MLC1_uc003bjh.1_Intron|MLC1_uc011arm.1_Intron|MLC1_uc011arn.1_Intron|MLC1_uc011aro.1_Intron	NM_139202	NP_631941	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with							basolateral plasma membrane|endosome|integral to membrane|integral to membrane of membrane fraction	ion channel activity			pancreas(1)	1		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		AGTGACTCCATCCCCCGTCAGG	0.609													5	3	---	---	---	---	
SHANK3	85358	broad.mit.edu	37	22	51141996	51141996	+	Intron	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51141996delA	uc003bne.1	+						SHANK3_uc003bnf.1_Intron	NM_001080420	NP_001073889	F2Z3L0	F2Z3L0_HUMAN	SH3 and multiple ankyrin repeat domains 3											central_nervous_system(1)	1		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		CGCTCTGTGGACGGCTCTGGC	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	734278	734278	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:734278delG								SHOX (114133 upstream) : CRLF2 (580609 downstream)																							aaagaaggaagggagagagga	0.149													10	5	---	---	---	---	
GYG2	8908	broad.mit.edu	37	X	2774786	2774793	+	Intron	DEL	TATCTATG	-	-	rs80318590		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2774786_2774793delTATCTATG	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				atcatctatctatctatgtatctatcta	0.231													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	6534726	6534726	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6534726delT								VCX3A (81567 upstream) : HDHD1A (432235 downstream)																							ACTTTAAGGGTAATGGGAGGA	0.388													4	2	---	---	---	---	
FAM9B	171483	broad.mit.edu	37	X	9004279	9004280	+	Intron	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9004279_9004280delTG	uc011mhv.1	-						FAM9B_uc004csh.2_5'Flank			Q8IZU0	FAM9B_HUMAN	Homo sapiens family with sequence similarity 9, member B (FAM9B) mRNA, complete cds.							nucleus					0		Hepatocellular(5;0.219)				TGCATGTAAAtgtgtgtgtgtg	0.129													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	21106147	21106148	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21106147_21106148insT								RPS6KA3 (820624 upstream) : CNKSR2 (286832 downstream)																							gttgttattagttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	25727800	25727800	+	IGR	DEL	T	-	-	rs72259072		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:25727800delT								ARX (693735 upstream) : MAGEB18 (428663 downstream)																							CAGAATGATATTTTTTTTTTA	0.343													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	30817674	30817674	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30817674delG								GK (68950 upstream) : TAB3 (27886 downstream)																							ccttgtgtctggtgccttgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	34887852	34887855	+	IGR	DEL	ACAC	-	-	rs147523047		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34887852_34887855delACAC								TMEM47 (212447 upstream) : FAM47B (73076 downstream)																							agaaattgagacacacacacacac	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	37074113	37074113	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37074113delT								FAM47C (44374 upstream) : PRRG1 (134415 downstream)																							TTTGTGCATATTAGAACACAC	0.189													4	2	---	---	---	---	
RBM10	8241	broad.mit.edu	37	X	47036114	47036115	+	Intron	DEL	TC	-	-	rs71692336		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47036114_47036115delTC	uc004dhf.2	+						RBM10_uc004dhe.1_Intron|RBM10_uc004dhg.2_Intron|RBM10_uc004dhh.2_Intron|RBM10_uc010nhq.2_Intron|RBM10_uc004dhi.2_Intron	NM_005676	NP_005667	P98175	RBM10_HUMAN	RNA binding motif protein 10 isoform 1						mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding			ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						tctccctctgtctctctctctc	0.243													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48066110	48066110	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48066110delT								SSX5 (9911 upstream) : SSX1 (48687 downstream)																							ACTGCATTTATTAGGtttttg	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48104441	48104442	+	IGR	INS	-	TG	TG	rs111600216		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48104441_48104442insTG								SSX5 (48242 upstream) : SSX1 (10355 downstream)																							GGCTGATACTCTGTCTGCGATG	0.520													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61754767	61754767	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61754767delG								None (None upstream) : SPIN4 (812341 downstream)																							tcaactcacagagttgaacat	0.000													4	2	---	---	---	---	
LOC92249	92249	broad.mit.edu	37	X	62648043	62648043	+	RNA	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62648043delA	uc004dvg.2	-	4		c.1282delT			LOC92249_uc004dvh.2_RNA|LOC92249_uc004dvi.2_Intron	NR_015353				Homo sapiens cDNA FLJ10894 fis, clone NT2RP4002888, highly similar to Homo sapiens mRNA; cDNA DKFZp434F172.												0						ATGATTTTGTAATTAGGGTGT	0.498													4	2	---	---	---	---	
YIPF6	286451	broad.mit.edu	37	X	67749292	67749292	+	Intron	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67749292delT	uc004dwy.2	+						YIPF6_uc011mph.1_Intron	NM_173834	NP_776195	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6							endoplasmic reticulum|integral to membrane					0						gagtttgttattacccacctt	0.000													4	2	---	---	---	---	
ZDHHC15	158866	broad.mit.edu	37	X	74634766	74634767	+	Intron	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74634766_74634767insT	uc004ecg.2	-						ZDHHC15_uc004ech.2_Intron|ZDHHC15_uc011mqo.1_Intron	NM_144969	NP_659406	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15 isoform 1							integral to membrane	zinc ion binding			ovary(2)	2						atacctggctattttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	109071311	109071312	+	IGR	DEL	TG	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109071311_109071312delTG								ACSL4 (94690 upstream) : TMEM164 (174551 downstream)																							ttgttgttgttgttgttTGttt	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	118076226	118076226	+	IGR	DEL	G	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118076226delG								ZCCHC12 (115296 upstream) : LONRF3 (32487 downstream)																							agggggagaagggagagaatg	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	122924296	122924296	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122924296delT								THOC2 (57392 upstream) : XIAP (69366 downstream)																							acccggccaattttttttttt	0.000													4	2	---	---	---	---	
ENOX2	10495	broad.mit.edu	37	X	130018698	130018701	+	Intron	DEL	GAGA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130018698_130018701delGAGA	uc004evw.2	-						ENOX2_uc004evx.2_Intron|ENOX2_uc004evy.2_Intron	NM_182314	NP_872114	Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2 isoform b						cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity			ovary(1)	1						GCTGATCTATgagagagagagaga	0.201													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	140233410	140233411	+	IGR	INS	-	AAAAT	AAAAT			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140233410_140233411insAAAAT								SPANXB2 (147540 upstream) : LDOC1 (36529 downstream)																							GTTTATGTTAAaaaataaaata	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	140805655	140805656	+	IGR	DEL	GT	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140805655_140805656delGT								SPANXE (19000 upstream) : MAGEC3 (120446 downstream)																							gtatgtgtgcgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
IL9R	3581	broad.mit.edu	37	X	155238775	155238776	+	Intron	DEL	TA	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155238775_155238776delTA	uc004fnv.1	+						IL9R_uc004fnu.1_Intron	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor						cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					tgtgtgtgtttatgtgtctgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9920079	9920080	+	IGR	INS	-	T	T			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9920079_9920080insT								TTTY22 (269225 upstream) : None (None downstream)																							cttctgtgtagtttttatgtga	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9957929	9957929	+	IGR	DEL	T	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9957929delT								TTTY22 (307075 upstream) : None (None downstream)																							aatcaggaggtggacgttgca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10054312	10054312	+	IGR	DEL	A	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10054312delA								TTTY22 (403458 upstream) : None (None downstream)																							cacagagtagaaagctttctt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13651933	13651937	+	IGR	DEL	TAATC	-	-			TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13651933_13651937delTAATC								None (None upstream) : None (None downstream)																							gaatggaaagtaatcaaatggaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59021805	59021806	+	IGR	DEL	TA	-	-	rs150313998		TCGA-46-3765-01	TCGA-46-3765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59021805_59021806delTA								None (None upstream) : None (None downstream)																							gactgaaaactatgagcaaaat	0.104													3	3	---	---	---	---	
