Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ATAD3C	219293	broad.mit.edu	37	1	1403985	1403985	+	3'UTR	SNP	T	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1403985T>C	uc001aft.2	+	12						NM_001039211	NP_001034300	Q5T2N8	ATD3C_HUMAN	ATPase family, AAA domain containing 3C								ATP binding|nucleoside-triphosphatase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CCCCGCACATTTAGGAAATAC	0.662													7	9	---	---	---	---	PASS
BSDC1	55108	broad.mit.edu	37	1	32842193	32842193	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32842193G>A	uc001bvh.3	-	9	873	c.826C>T	c.(826-828)CCA>TCA	p.P276S	BSDC1_uc010ohg.1_Missense_Mutation_p.P293S|BSDC1_uc010ohh.1_Missense_Mutation_p.P220S|BSDC1_uc010ohi.1_Missense_Mutation_p.P181S|BSDC1_uc001bvg.3_RNA|BSDC1_uc001bvj.2_Missense_Mutation_p.P172S|BSDC1_uc001bvi.2_Missense_Mutation_p.P293S	NM_018045	NP_060515	Q9NW68	BSDC1_HUMAN	BSD domain containing 1 isoform b	276							protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CTCTCTGATGGAGTCACCTCT	0.567													49	101	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39800459	39800459	+	Silent	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39800459C>T	uc010oiu.1	+	1	3650	c.3519C>T	c.(3517-3519)GAC>GAT	p.D1173D	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	2738					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAATTGTTGACATATTTAGTG	0.378													9	39	---	---	---	---	PASS
DMAP1	55929	broad.mit.edu	37	1	44685944	44685944	+	Missense_Mutation	SNP	T	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44685944T>G	uc001clq.1	+	10	1387	c.1307T>G	c.(1306-1308)ATC>AGC	p.I436S	DMAP1_uc001clr.1_Missense_Mutation_p.I436S|DMAP1_uc001cls.1_Missense_Mutation_p.I436S|DMAP1_uc010oku.1_Missense_Mutation_p.I426S	NM_001034024	NP_001029196	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1	436					DNA methylation|histone H2A acetylation|histone H4 acetylation|negative regulation of transcription, DNA-dependent|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex	DNA binding|protein binding				0	Acute lymphoblastic leukemia(166;0.155)					AAGGACACCATCATTGATGTG	0.652											OREG0013438	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	22	---	---	---	---	PASS
PLK3	1263	broad.mit.edu	37	1	45267395	45267395	+	Silent	SNP	C	T	T	rs142337193	byFrequency	TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45267395C>T	uc001cmn.2	+	4	637	c.537C>T	c.(535-537)CGC>CGT	p.R179R	PLK3_uc001cmo.2_RNA	NM_004073	NP_004064	Q9H4B4	PLK3_HUMAN	polo-like kinase 3	179	Protein kinase.					membrane	ATP binding|protein binding|protein serine/threonine kinase activity				0	Acute lymphoblastic leukemia(166;0.155)					TGCACCAGCGCGGCATCTTGC	0.517													21	65	---	---	---	---	PASS
ALG6	29929	broad.mit.edu	37	1	63879795	63879795	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63879795C>T	uc010oow.1	+	10	1185	c.880C>T	c.(880-882)CGT>TGT	p.R294C	ALG6_uc001daz.2_RNA|ALG6_uc009waj.2_Intron|ALG6_uc010oox.1_Missense_Mutation_p.R93C	NM_013339	NP_037471	Q9Y672	ALG6_HUMAN	dolichyl pyrophosphate Man9GlcNAc2	294					dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity				0						TATTTTGCCACGTCACATCCA	0.269													41	68	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86591318	86591318	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86591318T>C	uc001dlj.2	-	3	743	c.701A>G	c.(700-702)TAC>TGC	p.Y234C	COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Missense_Mutation_p.Y234C	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	234					cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		ATATCTGCAGTAGTCTGCAGA	0.378													32	47	---	---	---	---	PASS
CLCA2	9635	broad.mit.edu	37	1	86920831	86920831	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86920831C>A	uc001dlr.3	+	14	2615	c.2453C>A	c.(2452-2454)GCT>GAT	p.A818D		NM_006536	NP_006527	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2 precursor	818	Extracellular (Potential).				cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity			ovary(1)|breast(1)|skin(1)	3		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		TTTAACAATGCTATTTTAGTA	0.338													3	67	---	---	---	---	PASS
KIAA1324	57535	broad.mit.edu	37	1	109740262	109740262	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109740262C>T	uc001dwq.2	+	17	2424	c.2288C>T	c.(2287-2289)GCT>GTT	p.A763V	KIAA1324_uc009wex.1_Missense_Mutation_p.A713V|KIAA1324_uc009wey.2_Missense_Mutation_p.A676V|KIAA1324_uc010ovg.1_Missense_Mutation_p.A661V|KIAA1324_uc001dwr.2_Missense_Mutation_p.A413V|KIAA1324_uc001dws.1_RNA|KIAA1324_uc009wez.1_RNA	NM_020775	NP_065826	Q6UXG2	K1324_HUMAN	hypothetical protein LOC57535 precursor	763	Extracellular (Potential).				macroautophagy|positive regulation of vacuole organization|regulation of apoptosis	integral to plasma membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	5		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		GTCAGCCTTGCTGATCGACTT	0.448													3	14	---	---	---	---	PASS
RHOC	389	broad.mit.edu	37	1	113244258	113244258	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113244258C>G	uc001ecp.1	-	6	786	c.486G>C	c.(484-486)AAG>AAC	p.K162N	RHOC_uc001ecq.1_Missense_Mutation_p.K162N|RHOC_uc001ecr.1_Missense_Mutation_p.K162N|RHOC_uc009wgk.1_Missense_Mutation_p.K162N	NM_001042679	NP_001036144	P08134	RHOC_HUMAN	ras homolog gene family, member C precursor	162					axon guidance|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|signal transducer activity			ovary(1)	1	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCTCCTTGGTCTTGGCTGAGC	0.602													30	38	---	---	---	---	PASS
CD2	914	broad.mit.edu	37	1	117297478	117297478	+	Missense_Mutation	SNP	A	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117297478A>T	uc001egu.3	+	2	316	c.287A>T	c.(286-288)CAT>CTT	p.H96L	CD2_uc010owz.1_Missense_Mutation_p.H96L|CD2_uc010oxa.1_Missense_Mutation_p.H96L	NM_001767	NP_001758	P06729	CD2_HUMAN	CD2 molecule precursor	96	Extracellular (Potential).|Ig-like V-type.				blood coagulation|cell surface receptor linked signaling pathway|cell-cell adhesion|induction of apoptosis|leukocyte migration|membrane raft polarization|natural killer cell activation|positive regulation of myeloid dendritic cell activation|regulation of T cell differentiation|T cell activation	integral to plasma membrane	receptor activity			breast(1)	1	Lung SC(450;0.225)	all_cancers(81;3.15e-06)|Acute lymphoblastic leukemia(138;1.7e-08)|all_epithelial(167;8.38e-07)|all_lung(203;3.37e-06)|Lung NSC(69;2.31e-05)		Epithelial(280;6.71e-26)|OV - Ovarian serous cystadenocarcinoma(397;4.74e-24)|all cancers(265;1.93e-22)|Lung(183;0.0543)|Kidney(133;0.0813)|Colorectal(144;0.174)|KIRC - Kidney renal clear cell carcinoma(1967;0.176)|LUSC - Lung squamous cell carcinoma(189;0.189)|BRCA - Breast invasive adenocarcinoma(282;0.201)	Alefacept(DB00092)	AAAATTAAGCATCTGAAGACC	0.294													8	33	---	---	---	---	PASS
PRKAB2	5565	broad.mit.edu	37	1	146638191	146638191	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146638191C>G	uc001epe.2	-	5	569	c.424G>C	c.(424-426)GTT>CTT	p.V142L	PRKAB2_uc010ozm.1_Missense_Mutation_p.V60L|PRKAB2_uc010ozn.1_Intron|PRKAB2_uc009wjf.1_Missense_Mutation_p.V142L	NM_005399	NP_005390	O43741	AAKB2_HUMAN	AMP-activated protein kinase beta 2	142					carnitine shuttle|cell cycle arrest|energy reserve metabolic process|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleoplasm				lung(2)|skin(1)	3	all_hematologic(923;0.0487)				Adenosine monophosphate(DB00131)	TGACTGGTAACCACAGGCTGA	0.343													15	49	---	---	---	---	PASS
ECM1	1893	broad.mit.edu	37	1	150484888	150484888	+	Missense_Mutation	SNP	T	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150484888T>A	uc001eus.2	+	8	1343	c.1144T>A	c.(1144-1146)TTG>ATG	p.L382M	ECM1_uc001eut.2_Missense_Mutation_p.L257M|ECM1_uc001euu.2_Missense_Mutation_p.L411M|ECM1_uc001euv.2_Missense_Mutation_p.L409M|ECM1_uc009wlu.2_Missense_Mutation_p.L142M	NM_004425	NP_004416	Q16610	ECM1_HUMAN	extracellular matrix protein 1 isoform 1	382	2 X approximate repeats.|2.				angiogenesis|biomineral tissue development|negative regulation of bone mineralization|negative regulation of peptidase activity|ossification|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of I-kappaB kinase/NF-kappaB cascade	proteinaceous extracellular matrix	laminin binding|protease binding|protein C-terminus binding|signal transducer activity			ovary(2)|central_nervous_system(1)	3	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CCACCACCACTTGTGTTGCCG	0.567													44	101	---	---	---	---	PASS
THEM4	117145	broad.mit.edu	37	1	151861685	151861685	+	Intron	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151861685C>G	uc001ezj.1	-						THEM4_uc001ezk.1_Intron	NM_053055	NP_444283	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4						insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|ruffle membrane					0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			GGCTATCATTCTTACCCAGGT	0.413													28	63	---	---	---	---	PASS
S100A11	6282	broad.mit.edu	37	1	152005131	152005131	+	3'UTR	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152005131G>A	uc001ezn.2	-	3					uc001ezm.1_Intron	NM_005620	NP_005611	P31949	S10AB_HUMAN	S100 calcium binding protein A11						negative regulation of cell proliferation|negative regulation of DNA replication|signal transduction	cytoplasm|nucleus|ruffle	calcium ion binding|calcium-dependent protein binding|protein homodimerization activity|S100 beta binding				0	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			CCAGGGCCAAGGGGTCCTCAG	0.547													21	61	---	---	---	---	PASS
DCST2	127579	broad.mit.edu	37	1	155003127	155003127	+	Intron	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155003127G>C	uc001fgm.2	-						DCST2_uc009wpb.2_Intron	NM_144622	NP_653223	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2							integral to membrane				ovary(2)|central_nervous_system(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CACGGCTGGGGCCAGCAGGTT	0.622													6	38	---	---	---	---	PASS
THBS3	7059	broad.mit.edu	37	1	155167970	155167970	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155167970C>G	uc001fix.2	-	18	2139	c.2116G>C	c.(2116-2118)GAT>CAT	p.D706H	RAG1AP1_uc010pey.1_Intron|THBS3_uc009wqi.2_Missense_Mutation_p.D697H|THBS3_uc001fiz.2_Missense_Mutation_p.D669H|THBS3_uc001fiy.2_Missense_Mutation_p.D235H|THBS3_uc010pfu.1_Missense_Mutation_p.D586H|THBS3_uc010pfv.1_RNA	NM_007112	NP_009043	P49746	TSP3_HUMAN	thrombospondin 3 precursor	706	TSP type-3 8.				cell-matrix adhesion	extracellular region|perinuclear region of cytoplasm	calcium ion binding|heparin binding|structural molecule activity			breast(3)|ovary(2)	5	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			ACCACAGCATCATTGTCAAAG	0.557													54	111	---	---	---	---	PASS
DAP3	7818	broad.mit.edu	37	1	155695241	155695241	+	Missense_Mutation	SNP	A	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155695241A>T	uc001flq.2	+	5	508	c.339A>T	c.(337-339)AAA>AAT	p.K113N	DAP3_uc001flr.2_Missense_Mutation_p.K113N|DAP3_uc001fls.2_Missense_Mutation_p.K113N|DAP3_uc010pgl.1_Missense_Mutation_p.K72N|DAP3_uc001flt.2_Missense_Mutation_p.K79N|DAP3_uc001flu.2_Missense_Mutation_p.K113N|DAP3_uc010pgm.1_Missense_Mutation_p.K79N	NM_033657	NP_387506	P51398	RT29_HUMAN	death-associated protein 3	113					induction of apoptosis by extracellular signals	mitochondrial ribosome|nucleolus|small ribosomal subunit	protein binding			ovary(1)	1	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					ATTACCTGAAAAACACCAGTT	0.448													31	144	---	---	---	---	PASS
FCRL4	83417	broad.mit.edu	37	1	157557276	157557276	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157557276C>T	uc001fqw.2	-	5	773	c.637G>A	c.(637-639)GAA>AAA	p.E213K	FCRL4_uc010phy.1_RNA	NM_031282	NP_112572	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4 precursor	213	Ig-like C2-type 3.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(2)|kidney(1)|skin(1)	4	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				AGCTGTGTTTCACAGCTCAGG	0.498													157	147	---	---	---	---	PASS
FCRL3	115352	broad.mit.edu	37	1	157660175	157660175	+	Silent	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157660175G>A	uc001frb.2	-	9	1852	c.1560C>T	c.(1558-1560)ATC>ATT	p.I520I	FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Silent_p.I520I|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_Silent_p.I246I|FCRL3_uc001frc.1_Silent_p.I520I	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor	520	Ig-like C2-type 6.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)					AGTGGGCCGAGATGTTCCCCA	0.567													22	164	---	---	---	---	PASS
FCRL2	79368	broad.mit.edu	37	1	157718392	157718392	+	Silent	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157718392C>T	uc001fre.2	-	10	1469	c.1410G>A	c.(1408-1410)GTG>GTA	p.V470V	FCRL2_uc001frd.2_Silent_p.V217V|FCRL2_uc010phz.1_Intron|FCRL2_uc009wsp.2_Intron	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 precursor	470	Cytoplasmic (Potential).				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			AAACCACATCCACATCTACAG	0.493													84	97	---	---	---	---	PASS
ITLN2	142683	broad.mit.edu	37	1	160917718	160917718	+	Splice_Site	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160917718C>G	uc001fxd.2	-	7	883	c.825_splice	c.e7+1	p.H275_splice	ITLN2_uc009wts.2_Splice_Site_p.H274_splice|ITLN2_uc010pju.1_Splice_Site_p.H192_splice	NM_080878	NP_543154	Q8WWU7	ITLN2_HUMAN	intelectin 2 precursor						signal transduction	extracellular region	receptor binding|sugar binding			ovary(1)	1	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CAAAAACTCACATGCTCAGTG	0.308													15	76	---	---	---	---	PASS
DDR2	4921	broad.mit.edu	37	1	162745548	162745548	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162745548G>A	uc001gcf.2	+	16	2428	c.1963G>A	c.(1963-1965)GAA>AAA	p.E655K	DDR2_uc001gcg.2_Missense_Mutation_p.E655K	NM_001014796	NP_001014796	Q16832	DDR2_HUMAN	discoidin domain receptor family, member 2	655	Cytoplasmic (Potential).|Protein kinase.				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)			TATGATCACTGAATACATGGA	0.453													10	251	---	---	---	---	PASS
C1orf105	92346	broad.mit.edu	37	1	172414239	172414239	+	Silent	SNP	T	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172414239T>C	uc001gik.2	+	2	244	c.48T>C	c.(46-48)ATT>ATC	p.I16I	PIGC_uc001gii.1_5'Flank|PIGC_uc001gij.1_5'Flank|PIGC_uc001gil.2_5'Flank|PIGC_uc001gin.2_5'Flank|PIGC_uc001gio.2_5'Flank	NM_139240	NP_640333	O95561	CA105_HUMAN	hypothetical protein LOC92346	16										skin(1)	1						TTGACAAGATTCCTTGGCTTA	0.418													16	81	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175372327	175372327	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175372327C>T	uc001gkp.1	-	2	1006	c.925G>A	c.(925-927)GAG>AAG	p.E309K	TNR_uc009wwu.1_Missense_Mutation_p.E309K|TNR_uc010pmz.1_Missense_Mutation_p.E309K	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	309	Cys-rich.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					CAGAGCCCCTCCTCACATTGT	0.607													24	37	---	---	---	---	PASS
RFWD2	64326	broad.mit.edu	37	1	175916338	175916338	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175916338G>A	uc001gku.1	-	19	2427	c.2171C>T	c.(2170-2172)ACA>ATA	p.T724I	RFWD2_uc001gkv.1_Missense_Mutation_p.T700I|RFWD2_uc001gkw.1_Missense_Mutation_p.T484I|RFWD2_uc009wwv.2_Missense_Mutation_p.T523I|RFWD2_uc001gkt.1_Missense_Mutation_p.T563I	NM_022457	NP_071902	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2 isoform a	724	WD 7.				DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	centrosome|cytosol|focal adhesion|nuclear speck	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0						TACCTTAATTGTACCCTGACT	0.373													50	179	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200524526	200524526	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200524526G>C	uc010ppk.1	-	28	4849	c.4410C>G	c.(4408-4410)ATC>ATG	p.I1470M	KIF14_uc010ppj.1_Missense_Mutation_p.I979M	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	1470	Required for CIT-binding.|Potential.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						ATTCAGCAAAGATGTTTTCAA	0.239													16	54	---	---	---	---	PASS
TIMM17A	10440	broad.mit.edu	37	1	201926485	201926485	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201926485A>G	uc001gxc.2	+	2	139	c.103A>G	c.(103-105)AAA>GAA	p.K35E		NM_006335	NP_006326	Q99595	TI17A_HUMAN	translocase of inner mitochondrial membrane 17	35	Helical; (Potential).				protein targeting to mitochondrion	integral to membrane|mitochondrial inner membrane presequence translocase complex	P-P-bond-hydrolysis-driven protein transmembrane transporter activity				0						TCAAGCAATCAAAGGTTTTCG	0.448													17	96	---	---	---	---	PASS
PPFIA4	8497	broad.mit.edu	37	1	203030153	203030153	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203030153C>T	uc001gyz.2	+	10	1915	c.1322C>T	c.(1321-1323)ACT>ATT	p.T441I	PPFIA4_uc009xaj.2_Missense_Mutation_p.T1072I|PPFIA4_uc010pqf.1_Missense_Mutation_p.T654I|PPFIA4_uc001gza.2_Missense_Mutation_p.T441I|PPFIA4_uc001gzb.1_Missense_Mutation_p.T136I	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f	441					cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						GAAACATCTACTAAAACAGTG	0.567													61	104	---	---	---	---	PASS
PLEKHA6	22874	broad.mit.edu	37	1	204197299	204197299	+	Silent	SNP	T	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204197299T>G	uc001hau.2	-	21	3260	c.2943A>C	c.(2941-2943)TCA>TCC	p.S981S		NM_014935	NP_055750	Q9Y2H5	PKHA6_HUMAN	phosphoinositol 3-phosphate-binding protein-3	981										ovary(3)|pancreas(1)	4	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GCTGGCTCTCTGAGTCCTGGG	0.632													35	43	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235972415	235972415	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235972415C>A	uc001hxj.2	-	5	1878	c.1703G>T	c.(1702-1704)AGC>ATC	p.S568I	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Missense_Mutation_p.S568I	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	568					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GACACAAGTGCTGCTCAAGGA	0.453									Chediak-Higashi_syndrome				4	141	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1652209	1652209	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1652209C>T	uc002qxa.2	-	17	3407	c.3343G>A	c.(3343-3345)GAT>AAT	p.D1115N		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	1115					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		AGAAGCGGATCGATGCCGCCC	0.592													17	39	---	---	---	---	PASS
HS1BP3	64342	broad.mit.edu	37	2	20840876	20840876	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20840876G>C	uc002rdw.1	-	3	304	c.263C>G	c.(262-264)GCC>GGC	p.A88G	HS1BP3_uc002rdx.2_Missense_Mutation_p.A88G|HS1BP3_uc002rdy.2_Missense_Mutation_p.A88G	NM_022460	NP_071905	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	88	PX.				cell communication		phosphatidylinositol binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGGAGGCTGGCTGCTGCATA	0.532													31	260	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21228898	21228898	+	Silent	SNP	A	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21228898A>C	uc002red.2	-	26	10970	c.10842T>G	c.(10840-10842)CCT>CCG	p.P3614P		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3614					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GGCCAAGGTCAGGGAAATCAT	0.493													24	85	---	---	---	---	PASS
WDR43	23160	broad.mit.edu	37	2	29152454	29152454	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29152454G>C	uc002rmo.2	+	11	1347	c.1315G>C	c.(1315-1317)GAA>CAA	p.E439Q		NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43	439						nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					GGTTAGCATTGAAGAACGTCT	0.353													26	38	---	---	---	---	PASS
ZFP36L2	678	broad.mit.edu	37	2	43452225	43452225	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43452225C>T	uc002rsv.3	-	2	1009	c.718G>A	c.(718-720)GAT>AAT	p.D240N	LOC100129726_uc010ynx.1_5'Flank	NM_006887	NP_008818	P47974	TISD_HUMAN	zinc finger protein 36, C3H type-like 2	240					cell proliferation	nucleus	DNA binding|RNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				TGCAACGCATCGCGCGTGCCA	0.612													15	15	---	---	---	---	PASS
ABCG8	64241	broad.mit.edu	37	2	44079798	44079798	+	Missense_Mutation	SNP	T	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44079798T>A	uc002rtq.2	+	6	845	c.755T>A	c.(754-756)GTG>GAG	p.V252E	ABCG8_uc010yoa.1_Missense_Mutation_p.V252E	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN	ATP-binding cassette sub-family G member 8	252	ABC transporter.|Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			skin(3)|ovary(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CACAACCTGGTGAAGACCTTG	0.582													45	75	---	---	---	---	PASS
BMP10	27302	broad.mit.edu	37	2	69093080	69093080	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69093080C>T	uc002sez.1	-	2	1117	c.958G>A	c.(958-960)GGA>AGA	p.G320R		NM_014482	NP_055297	O95393	BMP10_HUMAN	bone morphogenetic protein 10 preproprotein	320					activin receptor signaling pathway|adult heart development|atrial cardiac muscle tissue morphogenesis|BMP signaling pathway|cardiac muscle cell proliferation|heart trabecula formation|negative regulation of cardiac muscle hypertrophy|negative regulation of cell growth|negative regulation of endothelial cell migration|Notch signaling pathway|pathway-restricted SMAD protein phosphorylation|positive regulation of cardiac muscle cell proliferation|positive regulation of cardiac muscle hypertrophy|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent|sarcomere organization|ventricular cardiac muscle cell development|ventricular cardiac muscle tissue morphogenesis	cell surface|extracellular space|Z disc	cytokine activity|growth factor activity|receptor serine/threonine kinase binding			ovary(2)	2						CAGTAGTTTCCTTTGGCGTTC	0.517													32	50	---	---	---	---	PASS
TGFBRAP1	9392	broad.mit.edu	37	2	105886097	105886097	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105886097C>T	uc002tcq.2	-	11	2122	c.2038G>A	c.(2038-2040)GAG>AAG	p.E680K	TGFBRAP1_uc010fjc.2_Missense_Mutation_p.E449K|TGFBRAP1_uc002tcr.3_Missense_Mutation_p.E680K	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor	680					regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2						AGCGCCTTCTCATGCTCGCCC	0.642													16	13	---	---	---	---	PASS
GCC2	9648	broad.mit.edu	37	2	109103003	109103003	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109103003A>G	uc002tec.2	+	16	3983	c.3829A>G	c.(3829-3831)ATC>GTC	p.I1277V	GCC2_uc002ted.2_Missense_Mutation_p.I1176V	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	1277	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						GAAGCACAAAATCCACGAGCA	0.458													9	101	---	---	---	---	PASS
CYP27C1	339761	broad.mit.edu	37	2	127958804	127958804	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127958804C>A	uc002tod.2	-	3	413	c.282G>T	c.(280-282)ATG>ATT	p.M94I		NM_001001665	NP_001001665	Q4G0S4	C27C1_HUMAN	cytochrome P450, family 27, subfamily C,	94						membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.071)		AGGTCTTGAACATGCTAAACA	0.552													67	55	---	---	---	---	PASS
SMPD4	55627	broad.mit.edu	37	2	130914945	130914945	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130914945G>T	uc002tqq.1	-	12	1613	c.1093C>A	c.(1093-1095)CAT>AAT	p.H365N	SMPD4_uc002tqo.1_5'UTR|SMPD4_uc002tqp.1_Missense_Mutation_p.H58N|SMPD4_uc010yzy.1_Missense_Mutation_p.H114N|SMPD4_uc010yzz.1_Missense_Mutation_p.H29N|SMPD4_uc002tqr.1_Missense_Mutation_p.H336N|SMPD4_uc002tqs.1_Missense_Mutation_p.H233N|SMPD4_uc002tqt.1_Missense_Mutation_p.H214N|SMPD4_uc010zaa.1_Missense_Mutation_p.H223N|SMPD4_uc010zab.1_Missense_Mutation_p.H263N|SMPD4_uc010zac.1_Missense_Mutation_p.H106N|SMPD4_uc010zad.1_Intron	NM_017951	NP_060421	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4 isoform 2	326					sphingomyelin catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|trans-Golgi network	metal ion binding|protein binding|sphingomyelin phosphodiesterase activity|sphingomyelin phosphodiesterase D activity				0	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	ACCAACACATGCTCCTCAGTA	0.647													11	12	---	---	---	---	PASS
IMP4	92856	broad.mit.edu	37	2	131103936	131103936	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131103936G>C	uc002tra.1	+	9	788	c.771G>C	c.(769-771)ATG>ATC	p.M257I		NM_033416	NP_219484	Q96G21	IMP4_HUMAN	IMP4, U3 small nucleolar ribonucleoprotein,	257	Brix.				rRNA processing|translation	nucleolus|ribonucleoprotein complex	aminoacyl-tRNA ligase activity|ATP binding|protein binding			central_nervous_system(2)	2	Colorectal(110;0.1)					CAGTGTACATGATCCGTCTGG	0.627													7	3	---	---	---	---	PASS
NR4A2	4929	broad.mit.edu	37	2	157186681	157186681	+	Silent	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157186681C>T	uc002tyz.3	-	3	440	c.18G>A	c.(16-18)GCG>GCA	p.A6A	NR4A2_uc002tyx.3_Intron|NR4A2_uc010zcf.1_Silent_p.A6A|NR4A2_uc010zcg.1_5'Flank	NM_006186	NP_006177	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	6					cellular response to extracellular stimulus|dopaminergic neuron differentiation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus	nucleoplasm	sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						ACCCATACTGCGCCTGAACAC	0.537													4	36	---	---	---	---	PASS
WIPF1	7456	broad.mit.edu	37	2	175440042	175440042	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175440042C>T	uc002uiy.2	-	5	580	c.248G>A	c.(247-249)GGA>GAA	p.G83E	uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Missense_Mutation_p.G83E|WIPF1_uc010fqt.1_Missense_Mutation_p.G83E|WIPF1_uc002ujc.1_Missense_Mutation_p.G83E|WIPF1_uc002uiz.2_Missense_Mutation_p.G83E|WIPF1_uc002ujb.1_Missense_Mutation_p.G83E|WIPF1_uc010zep.1_Missense_Mutation_p.G83E	NM_003387	NP_003378	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	83	Gly-rich.				actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding			ovary(1)|skin(1)	2						gccaccacctcctccgccaaa	0.299													37	93	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179434109	179434109	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179434109C>G	uc010zfg.1	-	275	69270	c.69046G>C	c.(69046-69048)GAA>CAA	p.E23016Q	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E16711Q|TTN_uc010zfi.1_Missense_Mutation_p.E16644Q|TTN_uc010zfj.1_Missense_Mutation_p.E16519Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	23943							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGCTGTTTTCTAATGTAAGC	0.413													71	126	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179468920	179468920	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179468920C>T	uc010zfg.1	-	231	47014	c.46790G>A	c.(46789-46791)CGC>CAC	p.R15597H	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R9292H|TTN_uc010zfi.1_Missense_Mutation_p.R9225H|TTN_uc010zfj.1_Missense_Mutation_p.R9100H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16524							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCAGGAAGGCGATAAGGATC	0.453													30	104	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179550282	179550282	+	Silent	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179550282G>A	uc010zfg.1	-	125	28847	c.28623C>T	c.(28621-28623)CAC>CAT	p.H9541H	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.H6202H|TTN_uc010fre.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	10468							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAGAAATAATGTGCAGCTTTT	0.348													22	40	---	---	---	---	PASS
CCDC141	285025	broad.mit.edu	37	2	179733966	179733966	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179733966C>T	uc002unf.1	-	5	604	c.547G>A	c.(547-549)GTA>ATA	p.V183I		NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	183	Potential.						protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TTTTCTTTTACAGGGGCTCCT	0.378													36	74	---	---	---	---	PASS
ITGAV	3685	broad.mit.edu	37	2	187529339	187529339	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187529339G>A	uc002upq.2	+	20	2320	c.2044G>A	c.(2044-2046)GAT>AAT	p.D682N	ITGAV_uc010frs.2_Missense_Mutation_p.D646N|ITGAV_uc010zfv.1_Missense_Mutation_p.D636N	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor	682	Extracellular (Potential).				angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		ACTGCAGGCTGATTTCATCGG	0.443													48	264	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196722264	196722264	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196722264A>G	uc002utj.3	-	44	8352	c.8251T>C	c.(8251-8253)TCA>CCA	p.S2751P		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2751	Stalk (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TCATGAAGTGACTGCAGAAAC	0.378													3	126	---	---	---	---	PASS
GTF3C3	9330	broad.mit.edu	37	2	197645389	197645389	+	Intron	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197645389G>A	uc002uts.2	-						GTF3C3_uc010zgu.1_Intron|GTF3C3_uc002utu.2_Intron|GTF3C3_uc002utt.3_Intron	NM_012086	NP_036218	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide							transcription factor TFIIIC complex	DNA binding|protein binding			ovary(3)|breast(3)|pancreas(1)	7						CTCAGGAGCTGGAGAATACAC	0.393													17	39	---	---	---	---	PASS
FAM119A	151194	broad.mit.edu	37	2	208478081	208478081	+	Missense_Mutation	SNP	T	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208478081T>G	uc002vcf.2	-	4	506	c.346A>C	c.(346-348)ACT>CCT	p.T116P	FAM119A_uc002vce.2_Intron|FAM119A_uc010fuk.1_Missense_Mutation_p.T116P|FAM119A_uc002vcg.3_Missense_Mutation_p.T116P	NM_145280	NP_660323	Q8WXB1	MT21A_HUMAN	hypothetical protein LOC151194	116						integral to membrane	methyltransferase activity				0				LUSC - Lung squamous cell carcinoma(261;0.0705)|Epithelial(149;0.131)|Lung(261;0.135)		ACAGTTTTAGTTTGGATATGA	0.383													63	51	---	---	---	---	PASS
ABCB6	10058	broad.mit.edu	37	2	220083188	220083188	+	Missense_Mutation	SNP	T	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220083188T>G	uc002vkc.1	-	1	485	c.208A>C	c.(208-210)ATC>CTC	p.I70L	ABCB6_uc010fwe.1_Missense_Mutation_p.I70L|ABCB6_uc010zku.1_RNA|ATG9A_uc002vkd.1_RNA	NM_005689	NP_005680	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B, member 6	70					cadmium ion transmembrane transport|cellular iron ion homeostasis|detoxification of cadmium ion|porphyrin biosynthetic process	ATP-binding cassette (ABC) transporter complex|Golgi apparatus|integral to mitochondrial outer membrane|plasma membrane|vacuolar membrane	ATP binding|efflux transmembrane transporter activity|heme binding|heme-transporting ATPase activity			breast(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TAGGGAGAGATGCGAGGGCCG	0.721													4	20	---	---	---	---	PASS
ATG9A	79065	broad.mit.edu	37	2	220089359	220089359	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220089359C>T	uc002vke.1	-	8	920	c.734G>A	c.(733-735)CGT>CAT	p.R245H	ATG9A_uc002vkd.1_RNA|ATG9A_uc002vkf.1_Missense_Mutation_p.R245H	NM_001077198	NP_001070666	Q7Z3C6	ATG9A_HUMAN	APG9 autophagy 9-like 1	245	Cytoplasmic (By similarity).				autophagic vacuole assembly|protein transport	autophagic vacuole membrane|cytoplasmic vesicle|Golgi apparatus|integral to membrane|late endosome membrane				skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTGAGACCACGGGTGAAGAA	0.552													21	60	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238234216	238234216	+	Missense_Mutation	SNP	C	A	A	rs113992704		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238234216C>A	uc002vwl.2	-	43	9765	c.9480G>T	c.(9478-9480)AAG>AAT	p.K3160N	COL6A3_uc002vwo.2_Missense_Mutation_p.K2954N|COL6A3_uc010znj.1_Missense_Mutation_p.K2553N|COL6A3_uc002vwj.2_Missense_Mutation_p.K541N	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	3160	Nonhelical region.|BPTI/Kunitz inhibitor.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GAGCGCAAACCTTTTCACATT	0.383													20	115	---	---	---	---	PASS
SATB1	6304	broad.mit.edu	37	3	18457567	18457567	+	Silent	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18457567A>G	uc003cbh.2	-	4	2182	c.447T>C	c.(445-447)CCT>CCC	p.P149P	SATB1_uc003cbi.2_Silent_p.P149P|SATB1_uc003cbj.2_Silent_p.P149P	NM_002971	NP_002962	Q01826	SATB1_HUMAN	special AT-rich sequence binding protein 1	149	PDZ-like dimerization domain.				cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter	nuclear matrix|PML body	double-stranded DNA binding|sequence-specific DNA binding			skin(2)|ovary(1)|lung(1)	4						CTGTAGCATCAGGGGCATCTG	0.403													3	137	---	---	---	---	PASS
ITGA9	3680	broad.mit.edu	37	3	37514869	37514869	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37514869G>T	uc003chd.2	+	3	391	c.338G>T	c.(337-339)GGA>GTA	p.G113V	ITGA9_uc003chc.2_Missense_Mutation_p.G113V	NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor	113	Extracellular (Potential).|FG-GAP 2.				axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		ACGTCCTGCGGAAAGACCTGC	0.602													41	16	---	---	---	---	PASS
CCR1	1230	broad.mit.edu	37	3	46245443	46245443	+	Missense_Mutation	SNP	A	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46245443A>T	uc003cph.1	-	2	433	c.362T>A	c.(361-363)ATC>AAC	p.I121N	CCR3_uc003cpg.1_Intron	NM_001295	NP_001286	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	121	Helical; Name=3; (Potential).				cell adhesion|cell-cell signaling|cytokine-mediated signaling pathway|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	integral to plasma membrane	C-C chemokine receptor activity			skin(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		GATGAAAAAGATCTCGCTGTA	0.507													38	34	---	---	---	---	PASS
CCRL2	9034	broad.mit.edu	37	3	46449908	46449908	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46449908G>A	uc003cpp.3	+	2	623	c.338G>A	c.(337-339)GGC>GAC	p.G113D	CCRL2_uc010hjg.2_Missense_Mutation_p.G125D|CCRL2_uc010hjf.2_Missense_Mutation_p.G113D	NM_003965	NP_003956	O00421	CCRL2_HUMAN	chemokine (C-C motif) receptor-like 2 isoform 1	113	Helical; Name=3; (Potential).				chemotaxis|inflammatory response	integral to plasma membrane	CCR chemokine receptor binding|chemokine receptor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)		TACTTCGTGGGCCTGTACAGT	0.483													17	106	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48684274	48684274	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48684274G>C	uc003cul.2	-	21	7498	c.7217C>G	c.(7216-7218)TCC>TGC	p.S2406C	CELSR3_uc003cuf.1_Missense_Mutation_p.S2476C|CELSR3_uc010hkf.2_5'Flank|CELSR3_uc010hkg.2_Missense_Mutation_p.S389C	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	2406	Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AATGATAATGGAGATCCCAGG	0.612													14	16	---	---	---	---	PASS
DALRD3	55152	broad.mit.edu	37	3	49053093	49053093	+	Silent	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49053093A>G	uc003cvk.1	-	12	1580	c.1560T>C	c.(1558-1560)CTT>CTC	p.L520L	WDR6_uc003cvj.2_3'UTR|WDR6_uc011bby.1_3'UTR|WDR6_uc010hkn.2_3'UTR|WDR6_uc011bbz.1_3'UTR|DALRD3_uc003cvl.1_Missense_Mutation_p.S512P|DALRD3_uc003cvm.1_Silent_p.L353L|DALRD3_uc010hko.1_Missense_Mutation_p.S382P	NM_001009996	NP_001009996	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	520					arginyl-tRNA aminoacylation	cytoplasm	arginine-tRNA ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CAGCTCTCAGAAGCTGCAGGC	0.562													26	40	---	---	---	---	PASS
TMPRSS7	344805	broad.mit.edu	37	3	111766781	111766781	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111766781C>A	uc010hqb.2	+	5	718	c.548C>A	c.(547-549)TCC>TAC	p.S183Y	TMPRSS7_uc011bhr.1_Missense_Mutation_p.S38Y	NM_001042575	NP_001036040	Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	309	Extracellular (Potential).|CUB 1.				proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2						ATTTACGACTCCCTTTTGCCC	0.468													17	70	---	---	---	---	PASS
SLC9A10	285335	broad.mit.edu	37	3	111901040	111901040	+	Missense_Mutation	SNP	T	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111901040T>G	uc003dyu.2	-	21	2811	c.2589A>C	c.(2587-2589)GAA>GAC	p.E863D	SLC9A10_uc011bhu.1_Missense_Mutation_p.E126D|SLC9A10_uc010hqc.2_Missense_Mutation_p.E815D	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	863					cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						ATAGAACTTCTTCAACAGTAA	0.254													68	73	---	---	---	---	PASS
CCDC80	151887	broad.mit.edu	37	3	112357363	112357363	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112357363G>A	uc003dzf.2	-	2	1608	c.1390C>T	c.(1390-1392)CGG>TGG	p.R464W	CCDC80_uc011bhv.1_Missense_Mutation_p.R464W|CCDC80_uc003dzg.2_Missense_Mutation_p.R464W|CCDC80_uc003dzh.1_Missense_Mutation_p.R464W	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	464										ovary(2)	2						CGGTTGTCCCGGAAACGGCCT	0.612													40	51	---	---	---	---	PASS
PHC3	80012	broad.mit.edu	37	3	169824720	169824720	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169824720T>C	uc010hws.1	-	12	2396	c.2332A>G	c.(2332-2334)ATG>GTG	p.M778V	PHC3_uc003fgl.2_Missense_Mutation_p.M790V|PHC3_uc011bpq.1_Missense_Mutation_p.M737V	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3	778	FCS-type.				multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			TCACTGTCCATTTCTTCTAAT	0.333													13	142	---	---	---	---	PASS
ABCF3	55324	broad.mit.edu	37	3	183904012	183904012	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183904012A>G	uc003fmz.2	+	1	150	c.17A>G	c.(16-18)GAA>GGA	p.E6G	ABCF3_uc003fna.2_Missense_Mutation_p.E6G|ABCF3_uc003fnb.2_5'Flank	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),	6							ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ACTTGCGCCGAAATCCTGCGG	0.647													13	142	---	---	---	---	PASS
VPS8	23355	broad.mit.edu	37	3	184580719	184580719	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184580719G>C	uc003fpb.1	+	15	1424	c.1253G>C	c.(1252-1254)AGC>ACC	p.S418T	VPS8_uc010hyd.1_Missense_Mutation_p.S418T	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b	420							zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			CTCTTAGACAGCGTAGAGAAG	0.433													36	340	---	---	---	---	PASS
LETM1	3954	broad.mit.edu	37	4	1821200	1821200	+	Splice_Site	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1821200C>A	uc003gdv.2	-	11	1906	c.1609_splice	c.e11-1	p.E537_splice		NM_012318	NP_036450	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane						cristae formation	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			central_nervous_system(1)	1			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			TCTCTTCCTCCTGGGATAAAA	0.522													30	77	---	---	---	---	PASS
HTT	3064	broad.mit.edu	37	4	3240265	3240265	+	Missense_Mutation	SNP	A	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3240265A>C	uc011bvq.1	+	66	9134	c.8989A>C	c.(8989-8991)AAC>CAC	p.N2997H		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	2995					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GGACATCATGAACAAAGTCAT	0.547													16	37	---	---	---	---	PASS
GRXCR1	389207	broad.mit.edu	37	4	42895454	42895454	+	Missense_Mutation	SNP	T	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42895454T>A	uc003gwt.2	+	1	171	c.171T>A	c.(169-171)GAT>GAA	p.D57E		NM_001080476	NP_001073945	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	57					cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity			ovary(1)	1						GACTAGGTGATTCCGATGGAC	0.502													124	98	---	---	---	---	PASS
SPARCL1	8404	broad.mit.edu	37	4	88415203	88415203	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88415203G>A	uc010ikm.2	-	5	1321	c.749C>T	c.(748-750)CCA>CTA	p.P250L	SPARCL1_uc011cdc.1_Missense_Mutation_p.P125L|SPARCL1_uc003hqs.3_Missense_Mutation_p.P250L|SPARCL1_uc011cdd.1_Missense_Mutation_p.P125L|SPARCL1_uc003hqt.2_Missense_Mutation_p.P250L	NM_001128310	NP_001121782	Q14515	SPRL1_HUMAN	SPARC-like 1 precursor	250					signal transduction	extracellular space|proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		TACTTGAGTTGGTTGATCAGA	0.418													148	250	---	---	---	---	PASS
ABCG2	9429	broad.mit.edu	37	4	89052230	89052230	+	Missense_Mutation	SNP	T	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89052230T>G	uc003hrg.2	-	5	1007	c.514A>C	c.(514-516)AAA>CAA	p.K172Q	ABCG2_uc003hrh.2_Missense_Mutation_p.K172Q|ABCG2_uc003hrf.2_Missense_Mutation_p.K42Q	NM_004827	NP_004818	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G, member 2	172	ABC transporter.|Cytoplasmic (Potential).				cellular iron ion homeostasis|urate metabolic process	integral to membrane|plasma membrane	ATP binding|heme transporter activity|protein homodimerization activity|xenobiotic-transporting ATPase activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Imatinib(DB00619)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nitrendipine(DB01054)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Topotecan(DB01030)	TCTGCCACTTTATCCAGACCT	0.403													68	171	---	---	---	---	PASS
ARHGAP10	79658	broad.mit.edu	37	4	148653489	148653489	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148653489C>A	uc003ilf.2	+	1	37	c.37C>A	c.(37-39)CTC>ATC	p.L13I	ARHGAP10_uc003ile.1_Missense_Mutation_p.L13I	NM_024605	NP_078881	A1A4S6	RHG10_HUMAN	Rho GTPase activating protein 10	13	BAR.				apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding			skin(2)|pancreas(1)|lung(1)	4	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		CGACTGCTACCTCGACAGCCC	0.657													9	25	---	---	---	---	PASS
ARHGAP10	79658	broad.mit.edu	37	4	148968149	148968149	+	Missense_Mutation	SNP	C	G	G	rs149308358		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148968149C>G	uc003ilf.2	+	20	1974	c.1974C>G	c.(1972-1974)GAC>GAG	p.D658E	ARHGAP10_uc003ilg.2_Missense_Mutation_p.D307E|ARHGAP10_uc003ilh.2_Missense_Mutation_p.D239E|ARHGAP10_uc003ili.2_Missense_Mutation_p.D91E	NM_024605	NP_078881	A1A4S6	RHG10_HUMAN	Rho GTPase activating protein 10	658					apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding			skin(2)|pancreas(1)|lung(1)	4	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		CTGGACCAGACAAAAACCACC	0.567													4	75	---	---	---	---	PASS
RXFP1	59350	broad.mit.edu	37	4	159526275	159526275	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159526275C>G	uc003ipz.2	+	5	530	c.448C>G	c.(448-450)CAT>GAT	p.H150D	RXFP1_uc010iqj.1_Translation_Start_Site|RXFP1_uc011cja.1_Missense_Mutation_p.H69D|RXFP1_uc010iqo.2_Missense_Mutation_p.H150D|RXFP1_uc011cjb.1_Missense_Mutation_p.H96D|RXFP1_uc010iqk.2_Translation_Start_Site|RXFP1_uc011cjc.1_Missense_Mutation_p.H69D|RXFP1_uc011cjd.1_Missense_Mutation_p.H69D|RXFP1_uc010iql.2_Translation_Start_Site|RXFP1_uc011cje.1_Missense_Mutation_p.H177D|RXFP1_uc010iqm.2_Missense_Mutation_p.H117D|RXFP1_uc011cjf.1_Missense_Mutation_p.H20D|RXFP1_uc010iqn.2_Missense_Mutation_p.H96D	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	150	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		CAAGAATTATCATGATCTTCA	0.318													9	28	---	---	---	---	PASS
SLC9A3	6550	broad.mit.edu	37	5	484769	484769	+	Silent	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:484769C>A	uc003jbe.2	-	5	910	c.798G>T	c.(796-798)GTG>GTT	p.V266V	SLC9A3_uc011clx.1_Silent_p.V266V	NM_004174	NP_004165	P48764	SL9A3_HUMAN	solute carrier family 9 (sodium/hydrogen	266	Helical; Name=H/M6; (Potential).					cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			AGGCGAAGACCACCCCCACCA	0.632													45	37	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13867922	13867922	+	Silent	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13867922G>A	uc003jfd.2	-	25	4056	c.4014C>T	c.(4012-4014)TTC>TTT	p.F1338F		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1338	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AATCTTGGAGGAATACCTCCA	0.453									Kartagener_syndrome				35	147	---	---	---	---	PASS
ZNF622	90441	broad.mit.edu	37	5	16453235	16453235	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16453235C>A	uc003jfq.2	-	5	1313	c.1193G>T	c.(1192-1194)AGA>ATA	p.R398I		NM_033414	NP_219482	Q969S3	ZN622_HUMAN	zinc finger protein 622	398						cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1						TTTGTAGTATCTCATCAAGGA	0.478													78	69	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33549326	33549326	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33549326C>T	uc003jia.1	-	21	4451	c.4288G>A	c.(4288-4290)GAG>AAG	p.E1430K	ADAMTS12_uc010iuq.1_Missense_Mutation_p.E1345K	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1430	TSP type-1 7.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CTCCAAGGCTCCACCTGCCAC	0.572										HNSCC(64;0.19)			11	114	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90015976	90015976	+	Silent	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90015976C>T	uc003kju.2	+	44	9655	c.9559C>T	c.(9559-9561)CTG>TTG	p.L3187L	GPR98_uc003kjt.2_Silent_p.L893L|GPR98_uc003kjv.2_Silent_p.L787L	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	3187	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGTTCAAACCCTGATAACAGT	0.398													85	30	---	---	---	---	PASS
SLCO6A1	133482	broad.mit.edu	37	5	101816003	101816003	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101816003T>C	uc003knn.2	-	2	666	c.494A>G	c.(493-495)TAT>TGT	p.Y165C	SLCO6A1_uc003kno.2_Missense_Mutation_p.Y165C|SLCO6A1_uc003knp.2_Missense_Mutation_p.Y165C|SLCO6A1_uc003knq.2_Missense_Mutation_p.Y165C	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	165	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		TCTGTCTCCATAGAATGCTAT	0.328													72	50	---	---	---	---	PASS
PSD2	84249	broad.mit.edu	37	5	139217217	139217217	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139217217A>G	uc003leu.1	+	12	1878	c.1673A>G	c.(1672-1674)TAC>TGC	p.Y558C		NM_032289	NP_115665	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	558	PH.				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGATGAGTACAGGCCTGAC	0.602													19	55	---	---	---	---	PASS
PCDHB12	56124	broad.mit.edu	37	5	140590009	140590009	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140590009C>G	uc003liz.2	+	1	1719	c.1530C>G	c.(1528-1530)AAC>AAG	p.N510K	PCDHB12_uc011dak.1_Missense_Mutation_p.N173K	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	510	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACGCGGACAACGGCCACCTGT	0.677													28	85	---	---	---	---	PASS
JAKMIP2	9832	broad.mit.edu	37	5	146991859	146991859	+	Intron	SNP	T	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146991859T>A	uc003loq.1	-						JAKMIP2_uc011dbx.1_Intron|JAKMIP2_uc003lor.1_Intron|uc003lop.1_Intron|JAKMIP2_uc010jgo.1_Intron	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein							Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTATTGAATTTGACACCTACC	0.308													3	19	---	---	---	---	PASS
CCDC69	26112	broad.mit.edu	37	5	150563006	150563006	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150563006C>G	uc003ltq.2	-	9	1006	c.883G>C	c.(883-885)GCC>CCC	p.A295P	CCDC69_uc010jhu.2_Missense_Mutation_p.A148P|CCDC69_uc011dcq.1_RNA	NM_015621	NP_056436	A6NI79	CCD69_HUMAN	coiled-coil domain containing 69	295										ovary(2)	2		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCTATGTGGCGAGGAAAGAG	0.602													3	11	---	---	---	---	PASS
SGCD	6444	broad.mit.edu	37	5	156184629	156184629	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156184629C>A	uc003lwd.3	+	7	1086	c.610C>A	c.(610-612)CCA>ACA	p.P204T	SGCD_uc003lwb.2_Missense_Mutation_p.P205T|SGCD_uc003lwc.3_Missense_Mutation_p.P205T	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3	204	Extracellular (Potential).				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GATGGAGGCCCCAAAAGGAGT	0.458													4	14	---	---	---	---	PASS
OR2B3	442184	broad.mit.edu	37	6	29054387	29054387	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29054387C>A	uc003nlx.2	-	1	704	c.639G>T	c.(637-639)TTG>TTT	p.L213F		NM_001005226	NP_001005226			olfactory receptor, family 2, subfamily B,											skin(1)	1						AGATGAGGATCAATGTCACTG	0.438													40	35	---	---	---	---	PASS
LTA	4049	broad.mit.edu	37	6	31541077	31541077	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31541077C>G	uc011dnu.1	+	4	438	c.225C>G	c.(223-225)AAC>AAG	p.N75K	LTA_uc003nue.1_Missense_Mutation_p.N75K|LTA_uc003nuf.2_Intron|LTA_uc003nuh.2_Missense_Mutation_p.N22K|LTA_uc003nug.2_Missense_Mutation_p.N22K|LTA_uc010jsr.2_Intron|TNF_uc003nui.2_5'Flank	NM_001159740	NP_001153212	P01374	TNFB_HUMAN	lymphotoxin alpha precursor	75					cell-cell signaling|induction of apoptosis|signal transduction	extracellular space|membrane	cytokine activity|tumor necrosis factor receptor binding				0					Etanercept(DB00005)	GCAAGCAGAACTCACTGCTCT	0.567													8	39	---	---	---	---	PASS
KIAA0240	23506	broad.mit.edu	37	6	42832465	42832465	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42832465C>T	uc003osn.1	+	13	2672	c.2521C>T	c.(2521-2523)CGG>TGG	p.R841W	KIAA0240_uc011duw.1_Missense_Mutation_p.R841W|KIAA0240_uc003osp.1_Missense_Mutation_p.R841W	NM_015349	NP_056164	Q6AI39	K0240_HUMAN	hypothetical protein LOC23506	841										ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)			ACAGTTTGGCCGGAGTGACCA	0.502													32	138	---	---	---	---	PASS
SLC29A1	2030	broad.mit.edu	37	6	44197764	44197764	+	Silent	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44197764C>A	uc003owu.1	+	5	764	c.435C>A	c.(433-435)ATC>ATA	p.I145I	SLC29A1_uc011dvp.1_Silent_p.I164I|SLC29A1_uc003owv.1_Silent_p.I145I|SLC29A1_uc003oww.1_Silent_p.I224I|SLC29A1_uc011dvq.1_Silent_p.I187I|SLC29A1_uc003owx.1_Silent_p.I145I|SLC29A1_uc003owy.1_Silent_p.I145I|SLC29A1_uc003owz.1_Silent_p.I145I	NM_004955	NP_004946	Q99808	S29A1_HUMAN	equilibrative nucleoside transporter 1	145	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|basolateral plasma membrane|integral to plasma membrane|membrane fraction	nucleoside transmembrane transporter activity|protein binding			large_intestine(2)|skin(1)	3	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		Troglitazone(DB00197)	TCACCATGATCAAGATCGTGC	0.557													39	46	---	---	---	---	PASS
PREP	5550	broad.mit.edu	37	6	105821374	105821374	+	Silent	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105821374G>A	uc003prc.2	-	5	668	c.465C>T	c.(463-465)TTC>TTT	p.F155F		NM_002726	NP_002717	P48147	PPCE_HUMAN	prolyl endopeptidase	155					proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	CAACTTTCATGAACTTGATTG	0.468													31	38	---	---	---	---	PASS
SLC22A16	85413	broad.mit.edu	37	6	110746145	110746145	+	Silent	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110746145G>A	uc003puf.2	-	8	1732	c.1665C>T	c.(1663-1665)CTC>CTT	p.L555L	SLC22A16_uc003pue.2_Silent_p.L536L	NM_033125	NP_149116	Q86VW1	S22AG_HUMAN	solute carrier family 22, member 16	555					acid secretion|cell differentiation|multicellular organismal development|single fertilization|sperm motility|spermatogenesis	integral to membrane	carnitine transporter activity			ovary(1)	1		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)		TATTAGTTGTGAGAAGTAATT	0.458													77	61	---	---	---	---	PASS
TAAR6	319100	broad.mit.edu	37	6	132891506	132891506	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132891506G>A	uc011eck.1	+	1	46	c.46G>A	c.(46-48)GCG>ACG	p.A16T		NM_175067	NP_778237	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	16	Extracellular (Potential).					plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(1)	3	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		GCTGTGCTACGCGAACGTGAA	0.483													14	68	---	---	---	---	PASS
IGF2R	3482	broad.mit.edu	37	6	160450647	160450647	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160450647C>T	uc003qta.2	+	7	990	c.842C>T	c.(841-843)GCG>GTG	p.A281V		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	281	2.|Lumenal (Potential).				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		CACAGCCCTGCGGTGACTATT	0.512													15	25	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43436457	43436457	+	Silent	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43436457A>G	uc003tid.1	+	7	1205	c.600A>G	c.(598-600)GGA>GGG	p.G200G	HECW1_uc011kbi.1_Silent_p.G200G|HECW1_uc003tie.1_Silent_p.G232G	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	200	C2.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						AAGGACAAGGAAGTCGGAGGC	0.418													41	61	---	---	---	---	PASS
BAZ1B	9031	broad.mit.edu	37	7	72891722	72891722	+	Missense_Mutation	SNP	T	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72891722T>A	uc003tyc.2	-	7	2414	c.2069A>T	c.(2068-2070)GAG>GTG	p.E690V		NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	690					ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)				CCGCACCAGCTCTGAAACAGA	0.473													62	67	---	---	---	---	PASS
BAZ1B	9031	broad.mit.edu	37	7	72891723	72891723	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72891723C>A	uc003tyc.2	-	7	2413	c.2068G>T	c.(2068-2070)GAG>TAG	p.E690*		NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	690					ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)				CGCACCAGCTCTGAAACAGAA	0.473													63	70	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98608731	98608731	+	Silent	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98608731C>G	uc003upp.2	+	70	11162	c.10953C>G	c.(10951-10953)CTC>CTG	p.L3651L	TRRAP_uc011kis.1_Silent_p.L3622L|TRRAP_uc003upr.2_Silent_p.L3357L|TRRAP_uc003ups.2_5'Flank	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	3651	PI3K/PI4K.				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GCAGCATGCTCAAGGAGTGGG	0.572													18	53	---	---	---	---	PASS
SPDYE3	441272	broad.mit.edu	37	7	99917242	99917242	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99917242C>G	uc003uug.1	+	4	510	c.270C>G	c.(268-270)TTC>TTG	p.F90L	uc011kjm.1_5'Flank	NM_001004351	NP_001004351	A6NKU9	SPDE3_HUMAN	speedy homolog E3	467											0						AAAAGATCTTCTACTTCCTGT	0.552													32	112	---	---	---	---	PASS
LRRC17	10234	broad.mit.edu	37	7	102574465	102574465	+	Silent	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102574465G>C	uc003vau.2	+	2	494	c.105G>C	c.(103-105)GCG>GCC	p.A35A	FBXL13_uc010liq.1_Intron|FBXL13_uc003vaq.2_Intron|FBXL13_uc010lir.1_Intron|FBXL13_uc003var.2_Intron|FBXL13_uc003vas.2_Intron|LRRC17_uc003vat.2_Silent_p.A35A	NM_001031692	NP_001026862	Q8N6Y2	LRC17_HUMAN	leucine rich repeat containing 17 isoform 1	35					bone marrow development|negative regulation of osteoclast differentiation|ossification	extracellular space				ovary(1)	1						ATGGCCGGGCGGGTGGAGGCC	0.552													14	41	---	---	---	---	PASS
MKLN1	4289	broad.mit.edu	37	7	131099445	131099445	+	Nonsense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131099445C>T	uc011kpm.1	+	8	887	c.823C>T	c.(823-825)CAG>TAG	p.Q275*	MKLN1_uc011kpl.1_Nonsense_Mutation_p.Q252*|MKLN1_uc010lmh.2_Nonsense_Mutation_p.Q275*|MKLN1_uc003vqs.2_Nonsense_Mutation_p.Q68*	NM_013255	NP_037387	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing	275					signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)					AGGAGGCCATCAGATGGTTAT	0.418													9	15	---	---	---	---	PASS
KIAA1549	57670	broad.mit.edu	37	7	138546088	138546088	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138546088C>T	uc011kql.1	-	16	5093	c.5044G>A	c.(5044-5046)GAG>AAG	p.E1682K	KIAA1549_uc011kqi.1_Missense_Mutation_p.E466K|KIAA1549_uc003vuk.3_Missense_Mutation_p.E1632K|KIAA1549_uc011kqj.1_Missense_Mutation_p.E1682K|KIAA1549_uc011kqk.1_Missense_Mutation_p.E466K	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	1682						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230						TGGCGTGCCTCCTCGATGGAC	0.682			O	BRAF	pilocytic astrocytoma								36	64	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142162112	142162112	+	Intron	SNP	G	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142162112G>T	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_RNA|uc011krw.1_Silent_p.R55R					SubName: Full=V_segment translation product; Flags: Fragment;																		GGGTCTTGTCGATACCAGTAC	0.478													63	173	---	---	---	---	PASS
PDIA4	9601	broad.mit.edu	37	7	148716172	148716172	+	Silent	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148716172G>A	uc003wff.2	-	3	669	c.387C>T	c.(385-387)GCC>GCT	p.A129A		NM_004911	NP_004902	P13667	PDIA4_HUMAN	protein disulfide isomerase A4 precursor	129	Thioredoxin 1.				cell redox homeostasis|glycerol ether metabolic process|protein secretion	endoplasmic reticulum lumen|melanosome	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			lung(5)|ovary(1)	6	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			CAAACCTGCTGGCCAGCACAG	0.498													38	26	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3263552	3263552	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3263552C>T	uc011kwk.1	-	15	2656	c.2266G>A	c.(2266-2268)GAA>AAA	p.E756K	CSMD1_uc011kwj.1_Missense_Mutation_p.E148K	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	756	Sushi 4.|Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACTGCACCTTCACAGCGGGGC	0.498													19	21	---	---	---	---	PASS
ZDHHC2	51201	broad.mit.edu	37	8	17053099	17053099	+	Silent	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17053099G>A	uc003wxe.2	+	4	736	c.339G>A	c.(337-339)AAG>AAA	p.K113K		NM_016353	NP_057437	Q9UIJ5	ZDHC2_HUMAN	zinc finger, DHHC-type containing 2	113						integral to membrane	acyltransferase activity|zinc ion binding				0				Colorectal(111;0.0697)|COAD - Colon adenocarcinoma(73;0.244)		GAGCAGCCAAGGATCTTCCCA	0.423													6	58	---	---	---	---	PASS
WRN	7486	broad.mit.edu	37	8	30916059	30916059	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30916059G>T	uc003xio.3	+	2	884	c.96G>T	c.(94-96)AAG>AAT	p.K32N		NM_000553	NP_000544	Q14191	WRN_HUMAN	Werner syndrome protein	32	Interaction with WRNIP1 (By similarity).				base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		AAGAAAGAAAGGTATGTTGTT	0.338			Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				12	9	---	---	---	---	PASS
KCNU1	157855	broad.mit.edu	37	8	36662792	36662792	+	Missense_Mutation	SNP	T	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36662792T>A	uc010lvw.2	+	4	544	c.457T>A	c.(457-459)TTT>ATT	p.F153I	KCNU1_uc003xjw.2_RNA	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	153	Helical; Name=Segment S2; (Potential).					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TAGTTTCTATTTTGGATTGAG	0.393													4	13	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77617287	77617287	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77617287A>G	uc003yav.2	+	2	1351	c.964A>G	c.(964-966)ATA>GTA	p.I322V	ZFHX4_uc003yat.1_Missense_Mutation_p.I322V|ZFHX4_uc003yau.1_Missense_Mutation_p.I322V|ZFHX4_uc003yaw.1_Missense_Mutation_p.I322V	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	322						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTCCGCCATAATACAGGGGAT	0.418										HNSCC(33;0.089)			61	49	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103307198	103307198	+	Intron	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103307198C>G	uc003ykr.1	-						UBR5_uc003yks.1_Intron	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin						cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			AATACACATTCAAAGAACTTA	0.358													31	3	---	---	---	---	PASS
ST3GAL1	6482	broad.mit.edu	37	8	134488234	134488234	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134488234G>C	uc003yuk.2	-	5	863	c.34C>G	c.(34-36)CTC>GTC	p.L12V	ST3GAL1_uc003yum.2_Missense_Mutation_p.L12V	NM_173344	NP_775479	Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	12	Cytoplasmic (Potential).			L -> V (in Ref. 2; AAA36612).	protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			AGGAAGGTGAGCACTTTCAGG	0.562													9	59	---	---	---	---	PASS
TRPM6	140803	broad.mit.edu	37	9	77377803	77377803	+	Silent	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77377803G>A	uc004ajl.1	-	26	4022	c.3784C>T	c.(3784-3786)CTA>TTA	p.L1262L	TRPM6_uc004ajk.1_Silent_p.L1257L|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajj.1_Silent_p.L218L	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	1262	Cytoplasmic (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						ATGCTGCCTAGAACCTCTGCA	0.512													27	144	---	---	---	---	PASS
PSAT1	29968	broad.mit.edu	37	9	80923366	80923366	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80923366G>A	uc004ala.2	+	6	675	c.607G>A	c.(607-609)GGC>AGC	p.G203S	PSAT1_uc004alb.2_Missense_Mutation_p.G203S	NM_058179	NP_478059	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1 isoform 1	203					L-serine biosynthetic process|pyridoxine biosynthetic process		O-phospho-L-serine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)	GAAGAATGTTGGCTCTGCTGG	0.493													18	76	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84606392	84606392	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84606392C>A	uc004amn.2	+	4	1054	c.1007C>A	c.(1006-1008)TCA>TAA	p.S336*		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	336						integral to membrane					0						TCTGGTGGGTCATCCACCTCT	0.478													42	143	---	---	---	---	PASS
OR1N2	138882	broad.mit.edu	37	9	125316421	125316421	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125316421G>T	uc011lyx.1	+	1	973	c.973G>T	c.(973-975)GGA>TGA	p.G325*		NM_001004457	NP_001004457	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N,	325	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4						TTTTGTCAGTGGAAAAACATT	0.388													12	47	---	---	---	---	PASS
MCM10	55388	broad.mit.edu	37	10	13231032	13231032	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13231032A>G	uc001ima.2	+	10	1471	c.1370A>G	c.(1369-1371)GAT>GGT	p.D457G	MCM10_uc001imb.2_Missense_Mutation_p.D456G|MCM10_uc001imc.2_Missense_Mutation_p.D456G	NM_182751	NP_877428	Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	457					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						CTGTGCCAAGATGGCTTTTAC	0.512													32	97	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16967745	16967745	+	Missense_Mutation	SNP	T	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16967745T>G	uc001ioo.2	-	42	6352	c.6300A>C	c.(6298-6300)AGA>AGC	p.R2100S		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	2100	CUB 15.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGATGATCCCTCTGTCTGCAT	0.458													24	58	---	---	---	---	PASS
MASTL	84930	broad.mit.edu	37	10	27444468	27444468	+	Missense_Mutation	SNP	T	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27444468T>A	uc001itm.2	+	1	752	c.113T>A	c.(112-114)GTG>GAG	p.V38E	YME1L1_uc001iti.2_5'Flank|YME1L1_uc001itj.2_5'Flank|YME1L1_uc010qdl.1_5'Flank|YME1L1_uc009xkv.2_5'Flank|YME1L1_uc001itk.1_5'Flank|MASTL_uc001itl.2_Missense_Mutation_p.V38E|MASTL_uc009xkw.1_Missense_Mutation_p.V38E|MASTL_uc009xkx.1_RNA	NM_032844	NP_116233	Q96GX5	GWL_HUMAN	microtubule associated serine/threonine	38	Protein kinase.				cell division|G2/M transition of mitotic cell cycle|mitosis|negative regulation of protein phosphatase type 2A activity|regulation of cell cycle|response to DNA damage stimulus	centrosome|cleavage furrow|nucleus	ATP binding|protein phosphatase 2A binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						TTCAGCATAGTGAAGCCCATT	0.562													14	55	---	---	---	---	PASS
PGBD3	267004	broad.mit.edu	37	10	50723771	50723771	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50723771C>G	uc001jht.2	-	2	1645	c.1390G>C	c.(1390-1392)GAC>CAC	p.D464H	ERCC6_uc001jhs.3_Intron|PGBD3_uc009xoe.2_Missense_Mutation_p.D932H|PGBD3_uc001jhu.2_Missense_Mutation_p.D932H	NM_170753	NP_736609	Q8N328	PGBD3_HUMAN	hypothetical protein LOC267004	464										pancreas(1)|breast(1)|skin(1)	3						TCAGCTCTGTCTACGCCTCCC	0.413													80	82	---	---	---	---	PASS
MAT1A	4143	broad.mit.edu	37	10	82034380	82034380	+	Silent	SNP	C	T	T	rs149163315		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82034380C>T	uc001kbw.2	-	8	1236	c.981G>A	c.(979-981)CCG>CCA	p.P327P		NM_000429	NP_000420	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	327					methylation|S-adenosylmethionine biosynthetic process|xenobiotic metabolic process	cytosol	ATP binding|metal ion binding|methionine adenosyltransferase activity				0			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	AAATGGACAGCGGCTCGGCCA	0.572													21	42	---	---	---	---	PASS
SFXN3	81855	broad.mit.edu	37	10	102795364	102795364	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102795364G>A	uc001ksp.2	+	4	740	c.284G>A	c.(283-285)CGC>CAC	p.R95H	SFXN3_uc001ksq.2_Missense_Mutation_p.R95H|SFXN3_uc010qpx.1_Missense_Mutation_p.R95H	NM_030971	NP_112233	Q9BWM7	SFXN3_HUMAN	sideroflexin 3	95					iron ion homeostasis	integral to membrane|mitochondrial membrane	cation transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CTGATTGGCCGCATGTCAGCC	0.587													3	29	---	---	---	---	PASS
CNNM2	54805	broad.mit.edu	37	10	104679152	104679152	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104679152C>G	uc001kwm.2	+	1	1039	c.915C>G	c.(913-915)ATC>ATG	p.I305M	CNNM2_uc001kwn.2_Missense_Mutation_p.I305M|CNNM2_uc001kwl.2_Missense_Mutation_p.I305M	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1	305	DUF21.				ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CCAAGCGCATCGAGCCGGTGC	0.637													19	17	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129914179	129914179	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129914179C>G	uc001lke.2	-	7	688	c.493G>C	c.(493-495)GAC>CAC	p.D165H	MKI67_uc001lkf.2_Intron|MKI67_uc009yav.1_Intron|MKI67_uc009yaw.1_Intron	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	165					cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GCGGTACTGTCTTCTTTGACA	0.418													36	103	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1078257	1078257	+	Intron	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1078257G>A	uc001lsx.1	+							NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor							inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GAAGGGCCGTGCATCCCCAGG	0.632													12	42	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1101629	1101629	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1101629G>A	uc001lsx.1	+	45	14755	c.14728G>A	c.(14728-14730)GTG>ATG	p.V4910M		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4910						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GAGCAAGATGGTGCCTGGAAG	0.632													8	76	---	---	---	---	PASS
KRTAP5-5	439915	broad.mit.edu	37	11	1651423	1651423	+	Missense_Mutation	SNP	G	C	C	rs76164438		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1651423G>C	uc001lty.2	+	1	391	c.353G>C	c.(352-354)GGC>GCC	p.G118A		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	118	8 X 4 AA repeats of C-C-X-P.			Missing (in Ref. 1; BAD20201 and 2; CAF31639).		keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TCCAAGGGGGGCTGTGGCTCC	0.701													3	65	---	---	---	---	PASS
CD81	975	broad.mit.edu	37	11	2415336	2415336	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2415336C>G	uc001lwf.1	+	3	426	c.193C>G	c.(193-195)CTC>GTC	p.L65V	CD81_uc001lwg.1_Missense_Mutation_p.L58V|CD81_uc001lwh.1_5'Flank	NM_004356	NP_004347	P60033	CD81_HUMAN	CD81 antigen	65	Helical; (Potential).				activation of MAPK activity|cell proliferation|phosphatidylinositol biosynthetic process|positive regulation of 1-phosphatidylinositol 4-kinase activity|positive regulation of cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|protein localization|regulation of immune response|virion attachment, binding of host cell surface receptor	integral to plasma membrane	protein binding				0		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)		CATCTACATCCTCATCGCTGT	0.647													3	58	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	20057595	20057595	+	Silent	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20057595C>T	uc010rdm.1	+	13	3289	c.2928C>T	c.(2926-2928)AGC>AGT	p.S976S	NAV2_uc001mpp.2_Silent_p.S889S|NAV2_uc001mpr.3_Silent_p.S953S|NAV2_uc001mpt.2_Silent_p.S39S|NAV2_uc009yhx.2_Silent_p.S39S|NAV2_uc009yhy.1_5'UTR	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	976						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						CCTCCATCAGCTCTTATGCCA	0.587													11	56	---	---	---	---	PASS
PDHX	8050	broad.mit.edu	37	11	34988250	34988250	+	Silent	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34988250A>G	uc001mvt.2	+	6	1231	c.705A>G	c.(703-705)CCA>CCG	p.P235P	PDHX_uc010rep.1_Silent_p.P220P|PDHX_uc010req.1_Intron	NM_003477	NP_003468	O00330	ODPX_HUMAN	pyruvate dehydrogenase complex, component X	235					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	acyltransferase activity			kidney(1)	1	all_epithelial(35;0.115)|Lung NSC(22;0.218)|all_lung(20;0.242)	all_hematologic(20;0.124)	STAD - Stomach adenocarcinoma(6;0.00113)			GACCAACTCCAGCCCCCACAG	0.522													3	98	---	---	---	---	PASS
AMBRA1	55626	broad.mit.edu	37	11	46455181	46455181	+	Intron	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46455181G>C	uc010rgu.1	-						AMBRA1_uc010rgt.1_Intron|AMBRA1_uc009ylc.1_Intron|AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		ATTGGGACCTGAGGGCCAACA	0.483													13	30	---	---	---	---	PASS
ARHGAP1	392	broad.mit.edu	37	11	46709766	46709766	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46709766G>C	uc001ndd.2	-	4	343	c.274C>G	c.(274-276)CGA>GGA	p.R92G	ARHGAP1_uc009yle.1_Missense_Mutation_p.R92G	NM_004308	NP_004299	Q07960	RHG01_HUMAN	Rho GTPase activating protein 1	92	CRAL-TRIO.				Rho protein signal transduction	cytosol|intracellular membrane-bounded organelle	SH3 domain binding|SH3/SH2 adaptor activity			skin(1)	1		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)		GGGGGCATTCGACAGGCACTA	0.547													6	32	---	---	---	---	PASS
SPRYD5	84767	broad.mit.edu	37	11	55658946	55658946	+	Silent	SNP	G	A	A	rs145711485	byFrequency	TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55658946G>A	uc010rip.1	+	7	1289	c.1197G>A	c.(1195-1197)GTG>GTA	p.V399V	SPRYD5_uc010riq.1_Silent_p.V256V	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	399	B30.2/SPRY.					intracellular	zinc ion binding				0		all_epithelial(135;0.226)				CACTTGTGGTGCAATATGTTC	0.448													33	55	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62300231	62300231	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62300231G>A	uc001ntl.2	-	5	1958	c.1658C>T	c.(1657-1659)ACA>ATA	p.T553I	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	553					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				CCTAGGGCCTGTCAAGGTTCC	0.517													21	195	---	---	---	---	PASS
NCAPD3	23310	broad.mit.edu	37	11	134037950	134037950	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134037950C>G	uc001qhd.1	-	27	4120	c.3514G>C	c.(3514-3516)GAT>CAT	p.D1172H	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA|NCAPD3_uc001qhc.1_Missense_Mutation_p.D122H	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1172					cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GCCATGTCATCTTCTTCCATA	0.453													36	108	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9227264	9227264	+	Silent	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9227264A>G	uc001qvk.1	-	29	3761	c.3648T>C	c.(3646-3648)TAT>TAC	p.Y1216Y	A2M_uc001qvj.1_Silent_p.Y258Y|A2M_uc009zgk.1_Silent_p.Y1066Y	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	1216					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	GGGCCGTGAGATAAGCGAGGA	0.592													7	39	---	---	---	---	PASS
NELL2	4753	broad.mit.edu	37	12	45000994	45000994	+	Missense_Mutation	SNP	A	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45000994A>C	uc001rog.2	-	15	2216	c.1621T>G	c.(1621-1623)TGT>GGT	p.C541G	NELL2_uc001rof.3_Missense_Mutation_p.C540G|NELL2_uc001roh.2_Missense_Mutation_p.C541G|NELL2_uc009zkd.2_Missense_Mutation_p.C540G|NELL2_uc010skz.1_Missense_Mutation_p.C591G|NELL2_uc010sla.1_Missense_Mutation_p.C564G|NELL2_uc001roi.1_Missense_Mutation_p.C541G|NELL2_uc010slb.1_Missense_Mutation_p.C540G	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	541	EGF-like 4.				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		GGGCAGGCACACACATTAGCG	0.383													7	35	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48391460	48391460	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48391460C>G	uc001rqu.2	-	7	641	c.460G>C	c.(460-462)GAA>CAA	p.E154Q	COL2A1_uc001rqv.2_Missense_Mutation_p.E85Q	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	154					axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GTCCCAGGTTCTCCATCTCTG	0.408													19	77	---	---	---	---	PASS
FMNL3	91010	broad.mit.edu	37	12	50043130	50043130	+	Intron	SNP	A	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50043130A>T	uc001ruv.1	-						FMNL3_uc001ruw.1_Intron|FMNL3_uc001rut.1_Intron|FMNL3_uc001ruu.1_Intron	NM_175736	NP_783863	Q8IVF7	FMNL3_HUMAN	formin-like 3 isoform 1						actin cytoskeleton organization		actin binding|Rho GTPase binding			breast(2)|pancreas(2)	4						GATCTGTCCAAAGAATGTGTG	0.557													16	22	---	---	---	---	PASS
SOAT2	8435	broad.mit.edu	37	12	53515077	53515077	+	Intron	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53515077C>T	uc001sbv.2	+						SOAT2_uc009zms.2_Intron	NM_003578	NP_003569	O75908	SOAT2_HUMAN	acyl-CoA:cholesterol acyltransferase 2						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|macrophage derived foam cell differentiation|very-low-density lipoprotein particle assembly	brush border|endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			ovary(1)	1						TCTGACCCCACCTTCTCCAGG	0.577													15	52	---	---	---	---	PASS
CALCOCO1	57658	broad.mit.edu	37	12	54110074	54110074	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54110074C>A	uc001sef.2	-	8	1119	c.975G>T	c.(973-975)AAG>AAT	p.K325N	CALCOCO1_uc001see.2_5'Flank|CALCOCO1_uc010som.1_Intron|CALCOCO1_uc010son.1_Missense_Mutation_p.K202N|CALCOCO1_uc001seh.2_Missense_Mutation_p.K325N|CALCOCO1_uc009znd.2_Missense_Mutation_p.K325N|CALCOCO1_uc001seg.2_Intron|CALCOCO1_uc010soo.1_Missense_Mutation_p.K318N	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN	coiled-coil transcriptional coactivator isoform	325	Potential.				steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding			ovary(1)	1						CTAGGGTGTCCTTCATCTGGG	0.562													26	80	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78593181	78593181	+	Silent	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78593181A>G	uc001syp.2	+	37	6758	c.6585A>G	c.(6583-6585)AAA>AAG	p.K2195K	NAV3_uc001syo.2_Silent_p.K2173K|NAV3_uc010sub.1_Silent_p.K1652K|NAV3_uc009zsf.2_Silent_p.K1004K	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	2195						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						TTCGAAGAAAACTCATAGAGA	0.333										HNSCC(70;0.22)			51	67	---	---	---	---	PASS
GAS2L3	283431	broad.mit.edu	37	12	101018492	101018492	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101018492A>G	uc001thu.2	+	10	2135	c.1909A>G	c.(1909-1911)AAG>GAG	p.K637E	GAS2L3_uc009zty.2_Missense_Mutation_p.K637E|GAS2L3_uc001thv.2_Missense_Mutation_p.K533E	NM_174942	NP_777602	Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	637					cell cycle arrest					skin(1)	1						GACTGTCGCTAAGAGCCAGCA	0.512													6	88	---	---	---	---	PASS
UTP20	27340	broad.mit.edu	37	12	101768637	101768637	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101768637G>C	uc001tia.1	+	55	7339	c.7183G>C	c.(7183-7185)GAA>CAA	p.E2395Q		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	2395					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						TGTGGAAAGTGAAGGAGTTGA	0.388													30	171	---	---	---	---	PASS
PTPN11	5781	broad.mit.edu	37	12	112893784	112893784	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112893784G>T	uc001ttx.2	+	6	1053	c.673G>T	c.(673-675)GAA>TAA	p.E225*	PTPN11_uc001ttw.1_Nonsense_Mutation_p.E225*	NM_002834	NP_002825	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type	225					axon guidance|cell junction assembly|ephrin receptor signaling pathway|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|platelet activation|regulation of cell adhesion mediated by integrin|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol	non-membrane spanning protein tyrosine phosphatase activity|protein binding			haematopoietic_and_lymphoid_tissue(375)|lung(6)|autonomic_ganglia(2)|soft_tissue(2)|central_nervous_system(2)|large_intestine(1)|skin(1)|ovary(1)|NS(1)|kidney(1)	392						AAATGCTGCTGAAATAGAAAG	0.343			Mis		JMML|AML|MDS		Noonan Syndrome		Noonan_syndrome				21	58	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124326030	124326030	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124326030G>A	uc001uft.3	+	29	4969	c.4944G>A	c.(4942-4944)ATG>ATA	p.M1648I		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1648	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGAATGAGATGAGAAGAACTA	0.463													74	38	---	---	---	---	PASS
DHX37	57647	broad.mit.edu	37	12	125465138	125465138	+	Silent	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125465138A>G	uc001ugy.2	-	4	735	c.636T>C	c.(634-636)GCT>GCC	p.A212A		NM_032656	NP_116045	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	212							ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		CAGTCATCCCAGCCGGCACGG	0.692													3	46	---	---	---	---	PASS
SLC7A1	6541	broad.mit.edu	37	13	30096564	30096564	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30096564C>T	uc001uso.2	-	8	1466	c.1079G>A	c.(1078-1080)CGG>CAG	p.R360Q		NM_003045	NP_003036	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid	360	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	receptor activity				0		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	ATAGATAACCCGAGGCATGGG	0.488													38	28	---	---	---	---	PASS
UBL3	5412	broad.mit.edu	37	13	30423650	30423650	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30423650A>G	uc001usp.2	-	1	1171	c.26T>C	c.(25-27)ATG>ACG	p.M9T		NM_007106	NP_009037	O95164	UBL3_HUMAN	ubiquitin-like 3 precursor	9						intracellular|plasma membrane					0		Lung SC(185;0.0281)		all cancers(112;0.0598)|GBM - Glioblastoma multiforme(144;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.147)		GTCACTTACCATATCCGCCGG	0.423													12	36	---	---	---	---	PASS
COG6	57511	broad.mit.edu	37	13	40233518	40233518	+	Silent	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40233518C>G	uc001uxh.2	+	2	271	c.171C>G	c.(169-171)CTC>CTG	p.L57L	COG6_uc001uxi.2_Silent_p.L5L|COG6_uc010acb.2_Silent_p.L57L	NM_020751	NP_065802	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6 isoform	57					protein transport	Golgi membrane|Golgi transport complex				kidney(1)|skin(1)	2		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		TAGAAGCTCTCAAGGCACTTT	0.328													26	19	---	---	---	---	PASS
TEP1	7011	broad.mit.edu	37	14	20848129	20848129	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20848129G>T	uc001vxe.2	-	35	5127	c.5087C>A	c.(5086-5088)GCC>GAC	p.A1696D	TEP1_uc010ahk.2_Missense_Mutation_p.A1039D|TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Missense_Mutation_p.A1588D|TEP1_uc010tlh.1_Missense_Mutation_p.A34D	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1696	WD 2.				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		TGTCCCATTGGCAGTGCCCAC	0.522													14	43	---	---	---	---	PASS
TEP1	7011	broad.mit.edu	37	14	20848130	20848130	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20848130C>A	uc001vxe.2	-	35	5126	c.5086G>T	c.(5086-5088)GCC>TCC	p.A1696S	TEP1_uc010ahk.2_Missense_Mutation_p.A1039S|TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Missense_Mutation_p.A1588S|TEP1_uc010tlh.1_Missense_Mutation_p.A34S	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1696	WD 2.				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GTCCCATTGGCAGTGCCCACA	0.522													14	42	---	---	---	---	PASS
EDDM3B	64184	broad.mit.edu	37	14	21238568	21238568	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21238568G>C	uc001vyd.2	+	2	357	c.259G>C	c.(259-261)GAT>CAT	p.D87H		NM_022360	NP_071755	P56851	EP3B_HUMAN	human epididymis-specific 3 beta precursor	87					spermatid development	extracellular region				ovary(1)	1						CAACTGGATGGATCGCTTCCG	0.413													31	25	---	---	---	---	PASS
FLJ10357	55701	broad.mit.edu	37	14	21542304	21542304	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21542304G>A	uc001vzp.2	+	3	444	c.415G>A	c.(415-417)GAG>AAG	p.E139K	FLJ10357_uc001vzn.1_Missense_Mutation_p.E139K|FLJ10357_uc001vzo.1_Intron|FLJ10357_uc010aij.2_RNA|FLJ10357_uc010tln.1_5'UTR	NM_018071	NP_060541	Q8TER5	ARH40_HUMAN	hypothetical protein LOC55701	139					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;5.79e-11)|Epithelial(56;8.35e-09)|all cancers(55;4.23e-08)	GBM - Glioblastoma multiforme(265;0.0197)		TGTGCCCAATGAGGCTTGTGC	0.617													26	53	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22749414	22749414	+	Intron	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22749414A>G	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc010tmr.1_Silent_p.T44T					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TGAGCTGCACATATGACACCA	0.478													12	38	---	---	---	---	PASS
PTGER2	5732	broad.mit.edu	37	14	52794042	52794042	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52794042C>T	uc001wzr.2	+	2	1198	c.947C>T	c.(946-948)GCC>GTC	p.A316V		NM_000956	NP_000947	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	316	Helical; Name=7; (Potential).					integral to plasma membrane	prostaglandin E receptor activity			lung(1)|breast(1)	2	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Iloprost(DB01088)	TGGGTCTTTGCCATCCTTAGG	0.403													4	99	---	---	---	---	PASS
C14orf181	400223	broad.mit.edu	37	14	69262518	69262518	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69262518G>C	uc001xkj.1	-	1	673	c.494C>G	c.(493-495)CCG>CGG	p.P165R	ZFP36L1_uc001xkh.1_5'Flank|ZFP36L1_uc001xki.1_5'Flank	NM_207442	NP_997325			hypothetical protein LOC400223												0				all cancers(60;0.002)|BRCA - Breast invasive adenocarcinoma(234;0.00204)|OV - Ovarian serous cystadenocarcinoma(108;0.0399)		ACGTCATTTCGGGGACTTTCC	0.592													4	135	---	---	---	---	PASS
ZFYVE1	53349	broad.mit.edu	37	14	73459962	73459962	+	Silent	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73459962A>G	uc001xnm.2	-	4	1732	c.1092T>C	c.(1090-1092)ACT>ACC	p.T364T	ZFYVE1_uc010arj.2_Silent_p.T364T	NM_021260	NP_067083	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1 isoform 1	364						endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding			skin(1)	1		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		GAGGGTTGTAAGTCCTCGTTC	0.562													26	70	---	---	---	---	PASS
IFI27	3429	broad.mit.edu	37	14	94582193	94582193	+	Silent	SNP	T	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94582193T>C	uc010tws.1	+	4	376	c.255T>C	c.(253-255)CAT>CAC	p.H85H	IFI27_uc001ycn.1_RNA|IFI27_uc001yco.2_Missense_Mutation_p.I66T	NM_005532	NP_005523	P40305	IFI27_HUMAN	interferon, alpha-inducible protein 27 isoform	Error:Variant_position_missing_in_P40305_after_alignment					activation of caspase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|type I interferon-mediated signaling pathway	integral to membrane|mitochondrion					0				Epithelial(152;0.112)|all cancers(159;0.187)|COAD - Colon adenocarcinoma(157;0.206)		TCGTCCTCCATAGCAGCCAAG	0.632													5	4	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106321137	106321137	+	RNA	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106321137G>A	uc010tyt.1	-	3600		c.56014C>T			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysj.2_Intron|uc001ysk.1_Intron|uc001ysl.1_Intron|uc001ysm.1_Intron|uc001ysn.1_Intron|uc001yso.1_Intron					Parts of antibodies, mostly variable regions.												0						CCTCACCCACGGCGCTGAAAG	0.602													8	51	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106346882	106346882	+	Intron	SNP	T	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106346882T>A	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						ACATAGCTTTTCTCACAGTGG	0.627													3	19	---	---	---	---	PASS
OCA2	4948	broad.mit.edu	37	15	28231737	28231737	+	Missense_Mutation	SNP	A	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28231737A>T	uc001zbh.3	-	12	1345	c.1235T>A	c.(1234-1236)GTA>GAA	p.V412E	OCA2_uc010ayv.2_Missense_Mutation_p.V388E	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	412	Cytoplasmic (Potential).				eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		ACCTACCTTTACAGCACAATA	0.289									Oculocutaneous_Albinism				35	164	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31325029	31325029	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31325029G>A	uc001zfm.2	-	21	2877	c.2749C>T	c.(2749-2751)CGC>TGC	p.R917C	TRPM1_uc010azy.2_Missense_Mutation_p.R824C|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	917	Helical; (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TTCTGTAGGCGAAGAATTGCT	0.478													45	116	---	---	---	---	PASS
MAP1A	4130	broad.mit.edu	37	15	43818818	43818818	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43818818G>A	uc001zrt.2	+	4	5614	c.5147G>A	c.(5146-5148)GGG>GAG	p.G1716E		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1716						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GATGGCCAGGGGGCCCGCCCA	0.602													36	34	---	---	---	---	PASS
TMOD3	29766	broad.mit.edu	37	15	52161438	52161438	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52161438C>G	uc002abm.2	+	3	370	c.151C>G	c.(151-153)CGG>GGG	p.R51G		NM_014547	NP_055362	Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)	51						cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(1)	1				all cancers(107;0.00194)		TGCAGGGTTCCGGCAGAAGAA	0.448													25	100	---	---	---	---	PASS
ONECUT1	3175	broad.mit.edu	37	15	53081638	53081638	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53081638G>T	uc002aci.1	-	1	572	c.444C>A	c.(442-444)AGC>AGA	p.S148R		NM_004498	NP_004489	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	148					endocrine pancreas development	nucleus	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding				0				all cancers(107;0.0708)		TGAGCGTGAAGCTACCGCTCA	0.493													9	84	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63111814	63111814	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63111814A>G	uc002alb.3	+	50	6871	c.6871A>G	c.(6871-6873)ATG>GTG	p.M2291V	TLN2_uc002alc.3_Missense_Mutation_p.M684V|TLN2_uc010uic.1_5'Flank	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	2291					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						GGCGGAAGCCATGAAAGGTAG	0.572													37	20	---	---	---	---	PASS
TLE3	7090	broad.mit.edu	37	15	70351076	70351076	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70351076C>G	uc002asm.2	-	11	1963	c.844G>C	c.(844-846)GAT>CAT	p.D282H	TLE3_uc002ask.2_Missense_Mutation_p.D226H|TLE3_uc002asl.2_Missense_Mutation_p.D287H|TLE3_uc010ukd.1_Missense_Mutation_p.D275H|TLE3_uc010bik.1_Intron|TLE3_uc010bil.1_Missense_Mutation_p.D282H|TLE3_uc002asn.2_Missense_Mutation_p.D282H|TLE3_uc002asp.2_Missense_Mutation_p.D282H|TLE3_uc002aso.2_Missense_Mutation_p.D282H	NM_005078	NP_005069	Q04726	TLE3_HUMAN	transducin-like enhancer protein 3 isoform a	282	Pro/Ser-rich.				organ morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|protein binding			lung(2)	2						GTGGGGGCATCTTTTTTCAGG	0.597													7	17	---	---	---	---	PASS
ZNF774	342132	broad.mit.edu	37	15	90897929	90897929	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90897929G>A	uc002bpk.3	+	2	223	c.37G>A	c.(37-39)GGA>AGA	p.G13R		NM_001004309	NP_001004309	Q6NX45	ZN774_HUMAN	zinc finger protein 774	13	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(11;0.00551)|Lung NSC(78;0.0158)|all_lung(78;0.0331)		BRCA - Breast invasive adenocarcinoma(143;0.0224)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TGGGTTACCTGGACACTGCTT	0.448													8	27	---	---	---	---	PASS
MAPK8IP3	23162	broad.mit.edu	37	16	1816271	1816271	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1816271G>A	uc002cmk.2	+	22	2797	c.2677G>A	c.(2677-2679)GAG>AAG	p.E893K	MAPK8IP3_uc002cml.2_Missense_Mutation_p.E887K|MAPK8IP3_uc010uvl.1_Missense_Mutation_p.E894K	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	893					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3						CCAGTCCACAGAGGAGGCCAC	0.647													11	37	---	---	---	---	PASS
TSC2	7249	broad.mit.edu	37	16	2126131	2126131	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2126131G>A	uc002con.2	+	24	2808	c.2702G>A	c.(2701-2703)CGC>CAC	p.R901H	TSC2_uc010bsd.2_Missense_Mutation_p.R901H|TSC2_uc002coo.2_Missense_Mutation_p.R901H|TSC2_uc010uvv.1_Missense_Mutation_p.R864H|TSC2_uc010uvw.1_Missense_Mutation_p.R852H|TSC2_uc002cop.2_Missense_Mutation_p.R701H	NM_000548	NP_000539	P49815	TSC2_HUMAN	tuberous sclerosis 2 isoform 1	901					cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)				ATCAGGTGCCGCCTGCCCTTC	0.572			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				20	59	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2158510	2158510	+	Missense_Mutation	SNP	G	A	A	rs145357945		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2158510G>A	uc002cos.1	-	15	6867	c.6658C>T	c.(6658-6660)CGG>TGG	p.R2220W	PKD1_uc002cot.1_Missense_Mutation_p.R2220W	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	2220	Extracellular (Potential).|REJ.		Missing (in ADPKD1).		calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						AGCGCCAGCCGCGGCAGCACC	0.697													14	8	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3823774	3823774	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3823774G>A	uc002cvv.2	-	13	2645	c.2441C>T	c.(2440-2442)CCA>CTA	p.P814L	CREBBP_uc002cvw.2_Missense_Mutation_p.P776L	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	814					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TGTTTGGGCTGGCGGCTGCCC	0.547			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				57	25	---	---	---	---	PASS
ERN2	10595	broad.mit.edu	37	16	23702239	23702239	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23702239C>G	uc002dma.3	-	22	3007	c.2838G>C	c.(2836-2838)AGG>AGC	p.R946S	ERN2_uc010bxp.2_Missense_Mutation_p.R894S	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2	898	KEN.|Cytoplasmic (Potential).				apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		AGGCGCAGCTCCTCATGGCTC	0.642													10	37	---	---	---	---	PASS
MYLK3	91807	broad.mit.edu	37	16	46766205	46766205	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46766205C>G	uc002eei.3	-	4	1493	c.1377G>C	c.(1375-1377)GAG>GAC	p.E459D	MYLK3_uc010vge.1_Missense_Mutation_p.E118D|MYLK3_uc002eej.1_Missense_Mutation_p.E118D	NM_182493	NP_872299	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	459					cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			stomach(2)|skin(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	7		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				CACAGTCCTGCTCAGGCTCAG	0.652													16	49	---	---	---	---	PASS
MMP2	4313	broad.mit.edu	37	16	55519555	55519555	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55519555G>T	uc002ehz.3	+	5	1009	c.698G>T	c.(697-699)TGC>TTC	p.C233F	MMP2_uc010vhd.1_Missense_Mutation_p.C157F|MMP2_uc010ccc.2_Missense_Mutation_p.C183F	NM_004530	NP_004521	P08253	MMP2_HUMAN	matrix metalloproteinase 2 isoform a	233	Fibronectin type-II 1.|Collagen-binding.				angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Marimastat(DB00786)|Sulindac(DB00605)	GGGGAGTACTGCAAGTTCCCC	0.537													43	100	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76461469	76461469	+	Nonsense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76461469C>T	uc002feu.1	+	6	896	c.511C>T	c.(511-513)CGA>TGA	p.R171*	CNTNAP4_uc002fev.1_Nonsense_Mutation_p.R83*|CNTNAP4_uc010chb.1_Nonsense_Mutation_p.R146*|CNTNAP4_uc002fex.1_Nonsense_Mutation_p.R174*|CNTNAP4_uc002few.2_Nonsense_Mutation_p.R146*	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	171	Extracellular (Potential).|F5/8 type C.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						AATTGGAATGCGAATCGAAGT	0.408													14	39	---	---	---	---	PASS
ITGAE	3682	broad.mit.edu	37	17	3680912	3680912	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3680912G>T	uc002fwo.3	-	2	176	c.77C>A	c.(76-78)CCC>CAC	p.P26H		NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor	26	FG-GAP 1.|Extracellular (Potential).				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		CGTGAGCCAGGGCCGGGCCAC	0.602													18	65	---	---	---	---	PASS
GPR172B	55065	broad.mit.edu	37	17	4936615	4936615	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4936615G>T	uc002gap.3	-	4	1788	c.1075C>A	c.(1075-1077)CTG>ATG	p.L359M	GPR172B_uc002gao.3_Missense_Mutation_p.L359M|GPR172B_uc010ckw.2_Missense_Mutation_p.L237M|GPR172B_uc010ckx.2_Intron	NM_001104577	NP_001098047	Q9NWF4	RFT_HUMAN	G protein-coupled receptor 172B precursor	359	Helical; (Potential).					integral to plasma membrane	receptor activity|riboflavin transporter activity				0						AGGATTGCCAGTGCCATCAGG	0.627													37	74	---	---	---	---	PASS
NEURL4	84461	broad.mit.edu	37	17	7227500	7227500	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7227500G>C	uc002gga.1	-	11	1996	c.1989C>G	c.(1987-1989)AAC>AAG	p.N663K	NEURL4_uc002ggb.1_Missense_Mutation_p.N663K|NEURL4_uc002ggc.1_Missense_Mutation_p.N9K	NM_032442	NP_115818	Q96JN8	NEUL4_HUMAN	neuralized homolog 4 isoform 1	663	NHR 3.						protein binding			upper_aerodigestive_tract(1)|ovary(1)	2						CCGGGGGCACGTTCCAGGCAG	0.667											OREG0024134	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	123	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578416	7578416	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578416C>A	uc002gim.2	-	5	708	c.514G>T	c.(514-516)GTT>TTT	p.V172F	TP53_uc002gig.1_Missense_Mutation_p.V172F|TP53_uc002gih.2_Missense_Mutation_p.V172F|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.V40F|TP53_uc010cng.1_Missense_Mutation_p.V40F|TP53_uc002gii.1_Missense_Mutation_p.V40F|TP53_uc010cnh.1_Missense_Mutation_p.V172F|TP53_uc010cni.1_Missense_Mutation_p.V172F|TP53_uc002gij.2_Missense_Mutation_p.V172F|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.V79F|TP53_uc002gio.2_Missense_Mutation_p.V40F|TP53_uc010vug.1_Missense_Mutation_p.V133F	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	172	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		V -> A (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation).|V -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.V172F(10)|p.V172D(8)|p.V172I(7)|p.0?(7)|p.V172V(4)|p.V172A(4)|p.V172fs*2(3)|p.V172G(3)|p.V173fs*59(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.V172_R174delVVR(1)|p.P151_V173del23(1)|p.S149fs*72(1)|p.E171fs*61(1)|p.V172_E180delVVRRCPHHE(1)|p.T170fs*2(1)|p.E171fs*1(1)|p.T170fs*8(1)|p.V172fs*9(1)|p.H168fs*69(1)|p.E171_H179delEVVRRCPHH(1)|p.E171_V172delEV(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CGCCTCACAACCTCCGTCATG	0.662		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			33	36	---	---	---	---	PASS
TMEM107	84314	broad.mit.edu	37	17	8076865	8076865	+	3'UTR	SNP	C	G	G	rs148909909	by1000genomes	TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8076865C>G	uc002gkg.3	-	5					TMEM107_uc002gkh.3_3'UTR|TMEM107_uc002gki.3_3'UTR|TMEM107_uc002gkj.3_RNA	NM_183065	NP_898888	Q6UX40	TM107_HUMAN	transmembrane protein 107 isoform 2							integral to membrane					0						tctaatctgccctccggagga	0.144													21	35	---	---	---	---	PASS
TRIM16L	147166	broad.mit.edu	37	17	18638551	18638551	+	Silent	SNP	T	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18638551T>C	uc002gug.1	+	10	1512	c.825T>C	c.(823-825)CCT>CCC	p.P275P	TRIM16L_uc010vyf.1_Silent_p.P329P|TRIM16L_uc002guh.1_Silent_p.P275P|TRIM16L_uc010cqg.1_Silent_p.P377P|TRIM16L_uc002gui.1_Silent_p.P275P|TRIM16L_uc010vyg.1_Silent_p.P275P|TRIM16L_uc010vyh.1_3'UTR	NM_001037330	NP_001032407	Q309B1	TR16L_HUMAN	tripartite motif-containing 16-like	275	B30.2/SPRY.					cytoplasm					0						AAGCTGGCCCTTTCTGGAGGC	0.522													17	84	---	---	---	---	PASS
SSH2	85464	broad.mit.edu	37	17	27958769	27958769	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27958769G>T	uc002heo.1	-	15	3362	c.3362C>A	c.(3361-3363)ACA>AAA	p.T1121K	SSH2_uc010wbh.1_Missense_Mutation_p.T1148K	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	1121					actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						TAAATGGGTTGTATGACTGAC	0.542													25	72	---	---	---	---	PASS
CPD	1362	broad.mit.edu	37	17	28750565	28750565	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28750565G>C	uc002hfb.1	+	6	1714	c.1699G>C	c.(1699-1701)GAA>CAA	p.E567Q	CPD_uc010wbo.1_Missense_Mutation_p.E320Q|CPD_uc010wbp.1_RNA	NM_001304	NP_001295	O75976	CBPD_HUMAN	carboxypeptidase D precursor	567	Extracellular (Potential).|Carboxypeptidase-like 2.	Zinc 2 (By similarity).			proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2						GCATGGAAATGAAGTGGTTGG	0.358													35	26	---	---	---	---	PASS
PLXDC1	57125	broad.mit.edu	37	17	37228713	37228713	+	Silent	SNP	T	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37228713T>G	uc002hrg.2	-	12	1424	c.1212A>C	c.(1210-1212)GCA>GCC	p.A404A	uc002hre.1_Intron|uc002hrf.1_Intron|PLXDC1_uc010cvr.1_Intron|PLXDC1_uc002hrh.2_RNA|PLXDC1_uc002hri.2_RNA|PLXDC1_uc002hrj.1_RNA|PLXDC1_uc002hrk.1_RNA	NM_020405	NP_065138	Q8IUK5	PXDC1_HUMAN	plexin domain containing 1 precursor	404	Extracellular (Potential).				angiogenesis	cytoplasm|extracellular region|integral to membrane|tight junction				ovary(1)|kidney(1)|skin(1)	3						CGTCTCCTCCTGCATAGGGAT	0.527													5	8	---	---	---	---	PASS
PGAP3	93210	broad.mit.edu	37	17	37842247	37842247	+	Silent	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37842247C>T	uc002hsj.2	-	2	250	c.207G>A	c.(205-207)AAG>AAA	p.K69K	ERBB2_uc002hsm.2_5'Flank|ERBB2_uc010cwa.2_5'Flank|PGAP3_uc010cvy.2_5'Flank|PGAP3_uc010wej.1_Silent_p.K69K|PGAP3_uc002hsk.2_Silent_p.K69K|PGAP3_uc010cvz.2_Silent_p.K69K|ERBB2_uc002hsl.2_5'Flank	NM_033419	NP_219487	Q96FM1	PGAP3_HUMAN	per1-like domain containing 1 precursor	69	Lumenal (Potential).				GPI anchor biosynthetic process	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	hydrolase activity, acting on ester bonds			upper_aerodigestive_tract(1)	1						TACACTCATACTTACAGTCGT	0.542													13	63	---	---	---	---	PASS
KRT32	3882	broad.mit.edu	37	17	39619203	39619203	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39619203C>T	uc002hwr.2	-	6	1157	c.1096G>A	c.(1096-1098)GCT>ACT	p.A366T		NM_002278	NP_002269	Q14532	K1H2_HUMAN	keratin 32	366	Coil 2.|Rod.				epidermis development	intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000812)				CGGATCTCAGCCAGCTGGGCC	0.647													15	163	---	---	---	---	PASS
GFAP	2670	broad.mit.edu	37	17	42992539	42992539	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42992539C>A	uc002ihq.2	-	1	376	c.316G>T	c.(316-318)GCC>TCC	p.A106S	GFAP_uc002ihr.2_Missense_Mutation_p.A106S|GFAP_uc010wjg.1_RNA	NM_002055	NP_002046	P14136	GFAP_HUMAN	glial fibrillary acidic protein isoform 1	106	Linker 1.|Rod.					cytoplasm|intermediate filament	structural constituent of cytoskeleton			ovary(1)|pancreas(1)	2		Prostate(33;0.0959)				GGCTCCTTGGCCCGCAGCTGG	0.617													20	134	---	---	---	---	PASS
GFAP	2670	broad.mit.edu	37	17	42992540	42992540	+	Silent	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42992540C>G	uc002ihq.2	-	1	375	c.315G>C	c.(313-315)CGG>CGC	p.R105R	GFAP_uc002ihr.2_Silent_p.R105R|GFAP_uc010wjg.1_RNA	NM_002055	NP_002046	P14136	GFAP_HUMAN	glial fibrillary acidic protein isoform 1	105	Linker 1.|Rod.					cytoplasm|intermediate filament	structural constituent of cytoskeleton			ovary(1)|pancreas(1)	2		Prostate(33;0.0959)				GCTCCTTGGCCCGCAGCTGGT	0.617													20	136	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51902198	51902198	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51902198C>T	uc002iua.2	+	1	1960	c.1804C>T	c.(1804-1806)CCC>TCC	p.P602S	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	602					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						TGAAACATTACCCACTCTGTT	0.423													62	134	---	---	---	---	PASS
LPO	4025	broad.mit.edu	37	17	56329601	56329601	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56329601C>G	uc002ivt.2	+	8	1155	c.839C>G	c.(838-840)GCT>GGT	p.A280G	LPO_uc010wns.1_Missense_Mutation_p.A221G|LPO_uc010dcp.2_Missense_Mutation_p.A197G|LPO_uc010dcq.2_Intron|LPO_uc010dcr.2_5'UTR	NM_006151	NP_006142	P22079	PERL_HUMAN	lactoperoxidase isoform 1 preproprotein	280					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|breast(1)	2						TTCTTCCGAGCTGGGTTCGTC	0.592													17	81	---	---	---	---	PASS
MRC2	9902	broad.mit.edu	37	17	60759627	60759627	+	Silent	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60759627C>A	uc002jad.2	+	20	3237	c.2835C>A	c.(2833-2835)GCC>GCA	p.A945A	MRC2_uc002jae.2_Silent_p.A16A|MRC2_uc002jaf.2_5'UTR	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	945	Extracellular (Potential).|C-type lectin 5.				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3						GCCTGACAGCCTTGCCCTACA	0.562													19	8	---	---	---	---	PASS
GH2	2689	broad.mit.edu	37	17	61958797	61958797	+	Silent	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61958797G>A	uc002jco.1	-	2	155	c.93C>T	c.(91-93)CCC>CCT	p.P31P	GH2_uc002jcj.2_Silent_p.P31P|CSH2_uc002jck.2_Intron|GH2_uc002jcl.1_Silent_p.P31P|GH2_uc002jcm.1_Silent_p.P31P|GH2_uc002jcn.1_Silent_p.P31P	NM_002059	NP_002050	P01242	SOM2_HUMAN	growth hormone 2 isoform 1	31						extracellular region	hormone activity			upper_aerodigestive_tract(2)|pancreas(1)	3						GCCTGGATAAGGGAATGGTTG	0.582													39	290	---	---	---	---	PASS
BPTF	2186	broad.mit.edu	37	17	65850532	65850532	+	Silent	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65850532C>T	uc002jgf.2	+	2	1151	c.1090C>T	c.(1090-1092)CTA>TTA	p.L364L	BPTF_uc002jge.2_Silent_p.L364L|BPTF_uc010wqm.1_Silent_p.L364L	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	364					brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			GATCAAAGTTCTACAGTTTCT	0.433													31	157	---	---	---	---	PASS
CD300C	10871	broad.mit.edu	37	17	72539080	72539080	+	Silent	SNP	T	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72539080T>A	uc002jky.1	-	3	808	c.447A>T	c.(445-447)TCA>TCT	p.S149S		NM_006678	NP_006669	Q08708	CLM6_HUMAN	CD300C antigen precursor	149	Pro-rich.|Extracellular (Potential).				cellular defense response	integral to plasma membrane	transmembrane receptor activity				0						TGGGAGGACCTGAGGTGCCCA	0.632													21	138	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78317711	78317711	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78317711A>G	uc002jyh.1	+	3	680	c.457A>G	c.(457-459)ATG>GTG	p.M153V		NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ACAATACTTAATGGATATAAA	0.458													35	204	---	---	---	---	PASS
SMCHD1	23347	broad.mit.edu	37	18	2656159	2656159	+	Missense_Mutation	SNP	T	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2656159T>A	uc002klm.3	+	1	274	c.85T>A	c.(85-87)TAC>AAC	p.Y29N		NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible	29					chromosome organization		ATP binding				0						CAGGACGGTGTACTTGTTTGA	0.667													11	6	---	---	---	---	PASS
C18orf34	374864	broad.mit.edu	37	18	30926220	30926220	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30926220A>G	uc002kxn.2	-	8	755	c.613T>C	c.(613-615)TGG>CGG	p.W205R	C18orf34_uc010xbr.1_Missense_Mutation_p.W205R|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Missense_Mutation_p.W205R|C18orf34_uc002kxp.2_Missense_Mutation_p.W205R	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	205										ovary(1)	1						CAGACTGACCAAGAGTCAATT	0.368													40	35	---	---	---	---	PASS
SLC14A2	8170	broad.mit.edu	37	18	43204660	43204660	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43204660C>A	uc010dnj.2	+	3	352	c.31C>A	c.(31-33)CCA>ACA	p.P11T	SLC14A2_uc002lbb.2_Missense_Mutation_p.P11T|SLC14A2_uc002lbe.2_Missense_Mutation_p.P11T	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	11						apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						TCCTCTCCTGCCAGAGCCACT	0.567													31	37	---	---	---	---	PASS
SLC14A2	8170	broad.mit.edu	37	18	43206911	43206911	+	Intron	SNP	T	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43206911T>G	uc010dnj.2	+						SLC14A2_uc002lbb.2_Intron|SLC14A2_uc002lbe.2_Intron	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),							apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						GCTCGCTCTCTGTCTCTTTCA	0.562													9	53	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10610487	10610487	+	Nonsense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10610487G>A	uc002moq.1	-	2	379	c.223C>T	c.(223-225)CAG>TAG	p.Q75*	KEAP1_uc002mor.1_Nonsense_Mutation_p.Q75*	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	75					regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			TCACACAGCTGCTGGCTGAGC	0.607													38	33	---	---	---	---	PASS
RAB3D	9545	broad.mit.edu	37	19	11446165	11446165	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11446165C>A	uc002mqy.2	-	4	668	c.430G>T	c.(430-432)GTT>TTT	p.V144F		NM_004283	NP_004274	O95716	RAB3D_HUMAN	RAB3D, member RAS oncogene family	144					exocytosis|protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(2)	2						GCAGGCACAACACGTTCGTCC	0.617													13	24	---	---	---	---	PASS
AP1M1	8907	broad.mit.edu	37	19	16318920	16318920	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16318920T>C	uc002ndu.2	+	4	531	c.358T>C	c.(358-360)TTC>CTC	p.F120L	AP1M1_uc002ndv.2_Missense_Mutation_p.F120L|AP1M1_uc010xpd.1_Missense_Mutation_p.F120L	NM_032493	NP_115882	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	120					cellular membrane organization|endosome to melanosome transport|interspecies interaction between organisms|intracellular protein transport|melanosome organization|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding			ovary(3)|breast(1)	4						GCTCATGGACTTCGGCTACCC	0.602													44	43	---	---	---	---	PASS
GTPBP3	84705	broad.mit.edu	37	19	17449876	17449876	+	Intron	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17449876C>T	uc010eas.2	+						GTPBP3_uc010xpo.1_Intron|GTPBP3_uc010ear.1_Intron|GTPBP3_uc002ngh.3_Intron|GTPBP3_uc002ngg.3_Silent_p.I235I|GTPBP3_uc002ngi.3_Intron	NM_032620	NP_116009	Q969Y2	GTPB3_HUMAN	GTP binding protein 3 (mitochondrial) isoform V						tRNA modification	mitochondrion	GTP binding|GTPase activity			skin(1)	1						CACCTCATATCAGCCCTCAAA	0.602													24	72	---	---	---	---	PASS
ZNF254	9534	broad.mit.edu	37	19	24288805	24288805	+	Missense_Mutation	SNP	A	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24288805A>T	uc002nru.2	+	2	228	c.94A>T	c.(94-96)ATT>TTT	p.I32F	ZNF254_uc010xrk.1_Intron|ZNF254_uc002nrt.1_RNA	NM_203282	NP_975011	O75437	ZN254_HUMAN	zinc finger protein 254	32	KRAB.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				ACACCTGGACATTGCACAGCA	0.403													39	144	---	---	---	---	PASS
ZNF585B	92285	broad.mit.edu	37	19	37678108	37678108	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37678108T>C	uc002ofq.2	-	5	585	c.331A>G	c.(331-333)ATC>GTC	p.I111V	ZNF585B_uc002ofr.1_5'UTR	NM_152279	NP_689492	Q52M93	Z585B_HUMAN	zinc finger protein 585B	111					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTATAACCGATGATTTTTCTA	0.353													22	86	---	---	---	---	PASS
HIPK4	147746	broad.mit.edu	37	19	40885636	40885636	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40885636C>A	uc002onp.2	-	4	1994	c.1709G>T	c.(1708-1710)GGA>GTA	p.G570V		NM_144685	NP_653286	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	570						cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			CAGCCATTCTCCAGGACAGCT	0.647													7	39	---	---	---	---	PASS
ZNF285	26974	broad.mit.edu	37	19	44891507	44891507	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44891507G>C	uc002ozd.3	-	4	987	c.900C>G	c.(898-900)AGC>AGG	p.S300R	ZFP112_uc010xwz.1_Intron|ZNF285_uc010xxa.1_Missense_Mutation_p.S307R	NM_152354	NP_689567	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	300					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(2)	4						GAAGGTCTGAGCTCTGTTTGC	0.468													74	151	---	---	---	---	PASS
PRKD2	25865	broad.mit.edu	37	19	47200993	47200993	+	Silent	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47200993C>G	uc002pfh.2	-	9	1578	c.1236G>C	c.(1234-1236)ACG>ACC	p.T412T	PRKD2_uc002pfe.2_5'Flank|PRKD2_uc002pff.2_5'Flank|PRKD2_uc002pfg.2_Silent_p.T255T|PRKD2_uc002pfi.2_Silent_p.T412T|PRKD2_uc002pfj.2_Silent_p.T412T|PRKD2_uc010xye.1_Silent_p.T412T|PRKD2_uc002pfk.2_Silent_p.T255T	NM_001079881	NP_001073350	Q9BZL6	KPCD2_HUMAN	protein kinase D2 isoform A	412	PH.				cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity			ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		cACTCACCAGCGTGTCCTTGT	0.323													27	78	---	---	---	---	PASS
PNKP	11284	broad.mit.edu	37	19	50370414	50370414	+	Silent	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50370414A>G	uc002pqh.2	-	1	100	c.48T>C	c.(46-48)CCT>CCC	p.P16P	PNKP_uc002pqg.2_5'Flank|PNKP_uc002pqi.2_5'UTR|PNKP_uc002pqj.2_Silent_p.P16P|PNKP_uc010enm.2_Silent_p.P16P|PNKP_uc002pqk.2_Silent_p.P16P	NM_007254	NP_009185	Q96T60	PNKP_HUMAN	polynucleotide kinase 3' phosphatase	16					DNA damage response, detection of DNA damage|DNA-dependent DNA replication|nucleotide-excision repair, DNA damage removal|response to oxidative stress|response to radiation	nucleolus	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|damaged DNA binding|double-stranded DNA binding|endonuclease activity|nucleotide kinase activity|polynucleotide 3'-phosphatase activity|protein binding			ovary(1)|kidney(1)	2		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		GCGCTCCCCCAGGGGGGCTCT	0.721								Other_BER_factors					7	29	---	---	---	---	PASS
NUP62	23636	broad.mit.edu	37	19	50412728	50412728	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50412728C>G	uc002pqx.2	-	2	441	c.337G>C	c.(337-339)GGC>CGC	p.G113R	IL4I1_uc002pqv.1_Intron|IL4I1_uc010eno.1_Intron|IL4I1_uc002pqw.1_Intron|IL4I1_uc002pqu.1_Intron|NUP62_uc002pqy.2_Missense_Mutation_p.G113R|NUP62_uc002pqz.2_Missense_Mutation_p.G113R|NUP62_uc002pra.2_Missense_Mutation_p.G113R|NUP62_uc002prb.2_Missense_Mutation_p.G113R|NUP62_uc002prc.2_Missense_Mutation_p.G113R	NM_153719	NP_714941	P37198	NUP62_HUMAN	nucleoporin 62kDa	113	15 X 9 AA approximate repeats.|Thr-rich.|8.				carbohydrate metabolic process|cell death|cell surface receptor linked signaling pathway|glucose transport|hormone-mediated signaling pathway|mRNA transport|negative regulation of apoptosis|negative regulation of cell proliferation|nucleocytoplasmic transport|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription, DNA-dependent|protein transport|regulation of glucose transport|transcription, DNA-dependent|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleocytoplasmic shuttling complex|ribonucleoprotein complex|spindle pole	chromatin binding|protein serine/threonine kinase activity|receptor signaling complex scaffold activity|SH2 domain binding|structural constituent of nuclear pore|thyroid hormone receptor binding|ubiquitin binding				0		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		AGCCCAAAGCCGCTGGGGTTT	0.592													108	40	---	---	---	---	PASS
DEFB127	140850	broad.mit.edu	37	20	139433	139433	+	Missense_Mutation	SNP	A	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:139433A>T	uc002wcy.1	+	2	68	c.68A>T	c.(67-69)AAG>ATG	p.K23M		NM_139074	NP_620713	Q9H1M4	DB127_HUMAN	defensin, beta 127 preproprotein	23					defense response to bacterium|innate immune response	extracellular region					0		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			CAACTTAAGAAGTGCTGGAAT	0.418													3	29	---	---	---	---	PASS
HCK	3055	broad.mit.edu	37	20	30674582	30674582	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30674582C>G	uc002wxh.2	+	9	1158	c.987C>G	c.(985-987)ATC>ATG	p.I329M	HCK_uc010gdy.2_Missense_Mutation_p.I308M|HCK_uc002wxi.2_Missense_Mutation_p.I307M	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK	329	Protein kinase.				interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			AGGAGCCCATCTACATCATCA	0.587													17	56	---	---	---	---	PASS
LPIN3	64900	broad.mit.edu	37	20	39978997	39978997	+	Silent	SNP	A	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39978997A>T	uc002xjx.2	+	7	1153	c.1062A>T	c.(1060-1062)CCA>CCT	p.P354P	LPIN3_uc010ggh.2_Silent_p.P355P|LPIN3_uc010zwf.1_RNA	NM_022896	NP_075047	Q9BQK8	LPIN3_HUMAN	lipin 3	354					fatty acid metabolic process	nucleus	phosphatidate phosphatase activity			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(115;0.000739)				TGGAGGTTCCAGTTCCCACCG	0.642													9	23	---	---	---	---	PASS
CHD6	84181	broad.mit.edu	37	20	40043905	40043905	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40043905C>A	uc002xka.1	-	34	7038	c.6860G>T	c.(6859-6861)CGG>CTG	p.R2287L	CHD6_uc002xjz.1_5'Flank	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2287	Poly-Arg.				chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				CCTCCCTCTCCGCCTCCTCGT	0.517													54	106	---	---	---	---	PASS
CSE1L	1434	broad.mit.edu	37	20	47683023	47683023	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47683023G>A	uc002xty.2	+	5	586	c.452G>A	c.(451-453)CGT>CAT	p.R151H	CSE1L_uc010zyg.1_Intron|CSE1L_uc010ghx.2_Missense_Mutation_p.R151H	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein	151					apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			GGAGTCCTCCGTACAGCACAT	0.343													3	58	---	---	---	---	PASS
ZNF512B	57473	broad.mit.edu	37	20	62598349	62598349	+	Silent	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62598349C>A	uc002yhl.1	-	4	327	c.273G>T	c.(271-273)CTG>CTT	p.L91L		NM_020713	NP_065764	Q96KM6	Z512B_HUMAN	zinc finger protein 512B	91					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					AGTCGTTCATCAGGGAGAGCT	0.637													13	96	---	---	---	---	PASS
DOPEY2	9980	broad.mit.edu	37	21	37618877	37618877	+	Silent	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37618877C>G	uc002yvg.2	+	19	4678	c.4599C>G	c.(4597-4599)TCC>TCG	p.S1533S	DOPEY2_uc011aeb.1_Silent_p.S1482S|DOPEY2_uc002yvh.2_Silent_p.S384S	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like	1533					endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						TCGGAAAGTCCCTGGGCTGGA	0.552													39	57	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23264868	23264868	+	RNA	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23264868C>A	uc011aim.1	+	379		c.16689C>A								Parts of antibodies, mostly variable regions.												0						GACTTCTACCCGGGAGCCGTG	0.597													6	37	---	---	---	---	PASS
MTMR3	8897	broad.mit.edu	37	22	30415746	30415746	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30415746G>T	uc003agv.3	+	17	2426	c.2098G>T	c.(2098-2100)GAG>TAG	p.E700*	MTMR3_uc003agu.3_Nonsense_Mutation_p.E700*|MTMR3_uc003agw.3_Nonsense_Mutation_p.E700*	NM_021090	NP_066576	Q13615	MTMR3_HUMAN	myotubularin-related protein 3 isoform c	700					phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CACCAAAGAGGAGAGTGGAGT	0.577													38	81	---	---	---	---	PASS
PES1	23481	broad.mit.edu	37	22	30977576	30977576	+	Missense_Mutation	SNP	G	C	C	rs142214789	by1000genomes	TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30977576G>C	uc003aij.1	-	7	760	c.686C>G	c.(685-687)ACG>AGG	p.T229R	PES1_uc003aik.1_Missense_Mutation_p.T229R|PES1_uc003ail.1_Missense_Mutation_p.T212R|PES1_uc003aim.1_Missense_Mutation_p.T229R|PES1_uc003ain.1_Missense_Mutation_p.T90R|PES1_uc003aio.1_Missense_Mutation_p.T90R	NM_014303	NP_055118	O00541	PESC_HUMAN	pescadillo homolog 1, containing BRCT domain	229	Sufficient for nucleolar localization.				cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	chromosome|nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						GCCCAGCAGCGTGGTGTAGAA	0.597													4	39	---	---	---	---	PASS
SFI1	9814	broad.mit.edu	37	22	32009832	32009832	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32009832C>G	uc003ale.2	+	27	3380	c.2987C>G	c.(2986-2988)GCC>GGC	p.A996G	SFI1_uc003alf.2_Missense_Mutation_p.A965G|SFI1_uc003alg.2_Missense_Mutation_p.A914G|SFI1_uc011alp.1_Missense_Mutation_p.A902G|SFI1_uc011alq.1_Missense_Mutation_p.A941G|SFI1_uc003alh.2_RNA|SFI1_uc010gwi.2_RNA|SFI1_uc003ali.2_5'Flank|SFI1_uc003alj.2_5'Flank	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform	996					G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						GAGCCCCACGCCCTGGAGCTG	0.637											OREG0003527	type=REGULATORY REGION|Gene=SFI1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	12	32	---	---	---	---	PASS
RASD2	23551	broad.mit.edu	37	22	35942906	35942906	+	Missense_Mutation	SNP	A	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35942906A>C	uc003anx.2	+	2	255	c.50A>C	c.(49-51)AAA>ACA	p.K17T	RASD2_uc003any.2_Missense_Mutation_p.K17T	NM_014310	NP_055125	Q96D21	RHES_HUMAN	RASD family, member 2 precursor	17					locomotory behavior|positive regulation of protein kinase B signaling cascade|positive regulation of protein sumoylation|regulation of cAMP-mediated signaling	intracellular|plasma membrane	G-protein beta-subunit binding|GTP binding|GTPase activity			lung(2)|skin(1)	3						GTGCCCGCCAAAAACTCATAC	0.607													6	16	---	---	---	---	PASS
MGAT3	4248	broad.mit.edu	37	22	39883552	39883552	+	Missense_Mutation	SNP	C	T	T	rs62230587		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39883552C>T	uc003axv.3	+	2	439	c.200C>T	c.(199-201)CCT>CTT	p.P67L	MGAT3_uc010gxy.2_Missense_Mutation_p.P67L	NM_002409	NP_002400	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein	67	Lumenal (Potential).|Pro-rich.				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity				0	Melanoma(58;0.04)					CCAGGAGGCCCTGACCTGCTG	0.682													20	88	---	---	---	---	PASS
NAGA	4668	broad.mit.edu	37	22	42463813	42463813	+	Missense_Mutation	SNP	C	T	T	rs73167107	byFrequency	TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42463813C>T	uc003bbx.2	-	4	417	c.280G>A	c.(280-282)GAT>AAT	p.D94N	NAGA_uc003bby.2_Missense_Mutation_p.D94N|NAGA_uc003bbw.3_Missense_Mutation_p.D94N	NM_000262	NP_000253	P17050	NAGAB_HUMAN	alpha-N-acetylgalactosaminidase precursor	94					glycoside catabolic process|glycosylceramide catabolic process|oligosaccharide metabolic process	lysosome	alpha-galactosidase activity|alpha-N-acetylgalactosaminidase activity|cation binding|protein homodimerization activity			central_nervous_system(1)	1						CGCTTGGGATCCGGCATCAGG	0.617													27	137	---	---	---	---	PASS
SMC1B	27127	broad.mit.edu	37	22	45795100	45795100	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45795100C>G	uc003bgc.2	-	6	1040	c.988G>C	c.(988-990)GAA>CAA	p.E330Q	SMC1B_uc003bgd.2_Missense_Mutation_p.E330Q|SMC1B_uc003bge.1_Missense_Mutation_p.E113Q	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN	SMC1 structural maintenance of chromosomes	330	Potential.				chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		ATATCATCTTCCTGTTTAGAA	0.363													30	132	---	---	---	---	PASS
CERK	64781	broad.mit.edu	37	22	47089354	47089354	+	Nonsense_Mutation	SNP	T	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47089354T>A	uc003bia.2	-	10	1203	c.1096A>T	c.(1096-1098)AAG>TAG	p.K366*	CERK_uc010hae.2_Nonsense_Mutation_p.K168*	NM_022766	NP_073603	Q8TCT0	CERK1_HUMAN	ceramide kinase	366					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|ceramide metabolic process	integral to membrane of membrane fraction|membrane|nucleus	ATP binding|ceramide kinase activity|diacylglycerol kinase activity|magnesium ion binding			skin(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		AGTGCTTTCTTCTGCTCCTCC	0.488													22	104	---	---	---	---	PASS
CXorf23	256643	broad.mit.edu	37	X	19968911	19968911	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19968911C>T	uc004czp.2	-	7	1705	c.1705G>A	c.(1705-1707)GAA>AAA	p.E569K	CXorf23_uc010nfn.2_RNA|CXorf23_uc011mjg.1_Missense_Mutation_p.E134K|CXorf23_uc004czo.2_Missense_Mutation_p.E519K	NM_198279	NP_938020	A2AJT9	CX023_HUMAN	hypothetical protein LOC256643	569						mitochondrion				lung(1)|skin(1)	2						TGCTCATCTTCATTCTGTAAC	0.373													27	54	---	---	---	---	PASS
SLC38A5	92745	broad.mit.edu	37	X	48318223	48318223	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48318223C>G	uc010nid.2	-	15	1286	c.1108G>C	c.(1108-1110)GCC>CCC	p.A370P	SLC38A5_uc004djk.3_Missense_Mutation_p.A319P	NM_033518	NP_277053	Q8WUX1	S38A5_HUMAN	solute carrier family 38, member 5	370	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|ion transport	integral to membrane|plasma membrane				ovary(3)	3						CAGCTGAAGGCCTTGCCTGGG	0.577													16	12	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50051612	50051612	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50051612C>G	uc004dox.3	+	6	741	c.443C>G	c.(442-444)ACT>AGT	p.T148S	CCNB3_uc004doy.2_Missense_Mutation_p.T148S|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	148					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					ACACCCAACACTGAGGAGGCA	0.418													22	15	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53578078	53578078	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53578078C>A	uc004dsp.2	-	65	9571	c.9169G>T	c.(9169-9171)GAC>TAC	p.D3057Y	HUWE1_uc004dsn.2_Missense_Mutation_p.D1865Y	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	3057					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						GTCACAGGGTCCATAGGGGTG	0.547													18	13	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65420453	65420453	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65420453C>A	uc011moz.1	+	12	2005	c.1945C>A	c.(1945-1947)CTG>ATG	p.L649M	HEPH_uc004dwn.2_Missense_Mutation_p.L649M|HEPH_uc004dwo.2_Missense_Mutation_p.L379M|HEPH_uc010nkr.2_Intron|HEPH_uc011mpa.1_Missense_Mutation_p.L649M|HEPH_uc010nks.2_5'Flank	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	646	Plastocyanin-like 4.|Extracellular (Potential).				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						GGCCTGGCACCTGCTCGGCCT	0.542													6	15	---	---	---	---	PASS
KIAA1210	57481	broad.mit.edu	37	X	118230627	118230627	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118230627C>G	uc004era.3	-	8	1096	c.1096G>C	c.(1096-1098)GAT>CAT	p.D366H		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	366										ovary(4)|skin(1)	5						TGTGAGCAATCAGGTCCAGAT	0.512													16	8	---	---	---	---	PASS
THOC2	57187	broad.mit.edu	37	X	122846737	122846737	+	Silent	SNP	G	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122846737G>A	uc004etu.2	-	2	125	c.93C>T	c.(91-93)CTC>CTT	p.L31L	THOC2_uc011mui.1_5'UTR	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	31					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						TATTTTCACTGAGGATCCGAC	0.269													13	28	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123657279	123657279	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123657279G>C	uc004euj.2	-	17	3032	c.2968C>G	c.(2968-2970)CCT>GCT	p.P990A	ODZ1_uc011muj.1_Missense_Mutation_p.P989A|ODZ1_uc010nqy.2_Missense_Mutation_p.P990A	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	990	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						AGCGGTGAAGGAAGCACAATA	0.448													37	59	---	---	---	---	PASS
ELF4	2000	broad.mit.edu	37	X	129205107	129205107	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129205107G>C	uc004evd.3	-	7	1102	c.717C>G	c.(715-717)TTC>TTG	p.F239L	ELF4_uc004eve.3_Missense_Mutation_p.F239L	NM_001421	NP_001412	Q99607	ELF4_HUMAN	E74-like factor 4	239	ETS.				natural killer cell proliferation|NK T cell proliferation|positive regulation of transcription from RNA polymerase II promoter	PML body	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CCACCAGTTTGAAGATGCCTT	0.522			T	ERG	AML								55	97	---	---	---	---	PASS
UTY	7404	broad.mit.edu	37	Y	15448075	15448075	+	Silent	SNP	A	G	G			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:15448075A>G	uc004fsx.1	-	16	2916	c.1911T>C	c.(1909-1911)AAT>AAC	p.N637N	UTY_uc004fsw.1_Silent_p.N300N|UTY_uc010nwx.1_Intron|UTY_uc004fsy.2_Silent_p.N637N|UTY_uc004fsz.2_Silent_p.N637N	NM_007125	NP_009056	O14607	UTY_HUMAN	tetratricopeptide repeat protein isoform 3	637					chromatin modification	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GTGGTACTGAATTACTAGGCA	0.473													58	79	---	---	---	---	PASS
EPB41	2035	broad.mit.edu	37	1	29320169	29320170	+	Intron	INS	-	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29320169_29320170insT	uc001brm.1	+						EPB41_uc001brg.1_Intron|EPB41_uc001brh.1_Intron|EPB41_uc001bri.1_Intron|EPB41_uc001brj.1_Intron|EPB41_uc009vtk.1_Intron|EPB41_uc001brk.2_Intron|EPB41_uc001brl.1_Intron|EPB41_uc009vtl.1_Intron|EPB41_uc009vtm.1_Intron	NM_203342	NP_976217	P11171	41_HUMAN	erythrocyte membrane protein band 4.1						blood circulation|cortical actin cytoskeleton organization|positive regulation of protein binding	extrinsic to membrane|Golgi apparatus|nucleus|plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	1-phosphatidylinositol binding|actin binding|spectrin binding|structural constituent of cytoskeleton			ovary(1)	1		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		tttcttttttcttttttttttt	0.178													4	2	---	---	---	---	
MEAF6	64769	broad.mit.edu	37	1	37961305	37961306	+	Intron	INS	-	A	A	rs28684519		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37961305_37961306insA	uc001cbg.1	-						MEAF6_uc001cbd.1_Intron|MEAF6_uc001cbe.1_Intron|MEAF6_uc009vvd.1_Intron|MEAF6_uc001cbf.1_Intron	NM_022756	NP_073593	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6						histone H2A acetylation|histone H3-K14 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|NuA4 histone acetyltransferase complex|nucleolus	protein binding				0						aaacaaaaaacaaaaaaaaaaa	0.158													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	102251812	102251813	+	IGR	INS	-	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102251812_102251813insT								S1PR1 (544736 upstream) : OLFM3 (16314 downstream)																							TTGCCAGTAACTTTTTTTTTTT	0.262													4	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145209324	145209332	+	5'UTR	DEL	GGCGGCGGC	-	-	rs72083240	by1000genomes	TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145209324_145209332delGGCGGCGGC	uc001emp.3	+	1					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_5'UTR|NOTCH2NL_uc001emm.3_5'UTR|NOTCH2NL_uc001emo.2_5'UTR|NOTCH2NL_uc010oyh.1_RNA	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GATCTGCCCAggcggcggcggcggcggcg	0.589													6	3	---	---	---	---	
CASQ1	844	broad.mit.edu	37	1	160168299	160168300	+	Intron	INS	-	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160168299_160168300insA	uc010pja.1	+							NM_001231	NP_001222	P31415	CASQ1_HUMAN	calsequestrin 1							mitochondrial matrix|sarcoplasmic reticulum lumen|smooth endoplasmic reticulum	calcium ion binding			central_nervous_system(1)	1	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			gtctcaaaaacaaaaaaaaaca	0.178													5	7	---	---	---	---	
LGTN	1939	broad.mit.edu	37	1	206766824	206766827	+	Intron	DEL	GCGA	-	-	rs72244512		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766824_206766827delGCGA	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			gagagagagcgcgagagagagaga	0.216													4	2	---	---	---	---	
TARBP1	6894	broad.mit.edu	37	1	234608725	234608726	+	Intron	INS	-	T	T	rs141043621	by1000genomes	TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234608725_234608726insT	uc001hwd.2	-							NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1						regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TCAGAGGGAGATTTTTTTTTGC	0.257													7	8	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237850666	237850666	+	Intron	DEL	C	-	-	rs41267515		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237850666delC	uc001hyl.1	+						RYR2_uc010pxz.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ttttcttcttctttttttttt	0.328													4	7	---	---	---	---	
CMPK2	129607	broad.mit.edu	37	2	7001234	7001235	+	Intron	DEL	CG	-	-	rs3085147		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7001234_7001235delCG	uc002qyo.2	-						CMPK2_uc010yis.1_Intron|CMPK2_uc010ewv.2_Intron	NM_207315	NP_997198	Q5EBM0	CMPK2_HUMAN	UMP-CMP kinase 2 precursor						dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					Tacacacacacgcacacacaca	0.198													11	5	---	---	---	---	
PRKCE	5581	broad.mit.edu	37	2	46237534	46237534	+	Frame_Shift_Del	DEL	T	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46237534delT	uc002rut.2	+	10	1512	c.1315delT	c.(1315-1317)TTAfs	p.L439fs		NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon	439	Protein kinase.				activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			TGTGAAGGTCTTAAAGAAGGA	0.443													106	58	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179563644	179563644	+	Intron	DEL	A	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179563644delA	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGGTAACTaaaaaaaaaaa	0.269													4	3	---	---	---	---	
RFTN2	130132	broad.mit.edu	37	2	198540354	198540354	+	5'UTR	DEL	C	-	-	rs56400552		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198540354delC	uc002uuo.3	-	1						NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2							plasma membrane					0						aaaaaaaaaacccaaaaaaaa	0.249													5	3	---	---	---	---	
FRMD4B	23150	broad.mit.edu	37	3	69299441	69299442	+	Intron	INS	-	GTGT	GTGT	rs150662802	by1000genomes	TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69299441_69299442insGTGT	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dnx.1_Intron|FRMD4B_uc011bga.1_5'Flank	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		ACtgtgtgtgcgtgtgtgtgtg	0.376													6	3	---	---	---	---	
CLDND1	56650	broad.mit.edu	37	3	98235420	98235445	+	3'UTR	DEL	TAAAAACAATTGAGAGGTGGGGAAAA	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98235420_98235445delTAAAAACAATTGAGAGGTGGGGAAAA	uc003dsp.2	-	5					CLDND1_uc003dso.2_Intron|CLDND1_uc003dsq.2_3'UTR|CLDND1_uc003dss.2_3'UTR|CLDND1_uc003dsr.2_3'UTR|CLDND1_uc003dst.2_3'UTR|CLDND1_uc003dsu.2_3'UTR|CLDND1_uc003dsv.2_3'UTR	NM_019895	NP_063948	Q9NY35	CLDN1_HUMAN	claudin domain containing 1 protein isoform a							integral to membrane				ovary(1)	1						AAATAAAAATTAAAAACAATTGAGAGGTGGGGAAAATATCAGtatt	0.292													8	4	---	---	---	---	
NMD3	51068	broad.mit.edu	37	3	160953120	160953121	+	Intron	INS	-	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160953120_160953121insA	uc003feb.1	+						NMD3_uc003fec.2_Intron|NMD3_uc003fed.1_Intron|NMD3_uc010hwh.2_Intron	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			tttctgttaggaaaaaaaaaaa	0.079													6	5	---	---	---	---	
PEX5L	51555	broad.mit.edu	37	3	179533561	179533561	+	Intron	DEL	A	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179533561delA	uc003fki.1	-						PEX5L_uc011bqd.1_Intron|PEX5L_uc011bqe.1_Intron|PEX5L_uc011bqf.1_Intron|PEX5L_uc003fkj.1_Intron|PEX5L_uc010hxd.1_Intron|PEX5L_uc011bqg.1_Intron|PEX5L_uc011bqh.1_Intron	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like						protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TTACTTGATGAAAAGCTGACC	0.418													17	72	---	---	---	---	
UGDH	7358	broad.mit.edu	37	4	39505927	39505928	+	Intron	INS	-	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39505927_39505928insA	uc003guk.1	-						UGDH_uc011byp.1_Intron|UGDH_uc003gul.1_Intron	NM_003359	NP_003350	O60701	UGDH_HUMAN	UDP-glucose dehydrogenase						glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4					NADH(DB00157)	gactccatctcaaaaaaaaaaa	0.139													4	2	---	---	---	---	
LARP7	51574	broad.mit.edu	37	4	113574479	113574479	+	Intron	DEL	T	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113574479delT	uc003iay.2	+						LARP7_uc003iaz.2_Intron|LARP7_uc003iba.2_Intron|LARP7_uc003ibb.2_Intron	NM_016648	NP_057732	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7						RNA processing	nucleoplasm|ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(3)	3		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		ATGAAACTAGttttttttttt	0.154													4	2	---	---	---	---	
DDX60L	91351	broad.mit.edu	37	4	169317284	169317285	+	Intron	INS	-	A	A	rs5863929		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169317284_169317285insA	uc003irq.3	-						DDX60L_uc003irr.1_Intron|DDX60L_uc003irs.1_Intron	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TGCTACTATTTAAAAAAAAAAA	0.178													5	4	---	---	---	---	
MSH3	4437	broad.mit.edu	37	5	79950724	79950725	+	In_Frame_Ins	INS	-	CCGCAGCGC	CCGCAGCGC	rs2001675		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79950724_79950725insCCGCAGCGC	uc003kgz.2	+	1	431_432	c.178_179insCCGCAGCGC	c.(178-180)GCC>GCCGCAGCGCCC	p.63_64insAAP	DHFR_uc011ctl.1_5'Flank|DHFR_uc011ctm.1_5'Flank|DHFR_uc010jap.1_5'Flank|DHFR_uc003kgx.1_Intron|DHFR_uc003kgy.1_5'UTR	NM_002439	NP_002430	P20585	MSH3_HUMAN	mutS homolog 3	63_64			Missing.		maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ggccgcagcggccgcagcgCCC	0.569								MMR					5	6	---	---	---	---	
NOP16	51491	broad.mit.edu	37	5	175814066	175814069	+	Intron	DEL	TCTC	-	-	rs145796794		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175814066_175814069delTCTC	uc011dfl.1	-						NOP16_uc003med.2_Intron|NOP16_uc003mee.2_Intron|NOP16_uc011dfm.1_Intron|HIGD2A_uc003meg.2_5'Flank	NM_016391	NP_057475	Q9Y3C1	NOP16_HUMAN	NOP16 nucleolar protein homolog							nucleolus				ovary(1)|central_nervous_system(1)	2						GGAGGCTTTTTCTCTCTCtctctc	0.245													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	82053452	82053452	+	IGR	DEL	C	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82053452delC								BCKDHB (997465 upstream) : FAM46A (401996 downstream)																							atcgaagtcacccctcccaag	0.000													4	2	---	---	---	---	
TPD52L1	7164	broad.mit.edu	37	6	125493336	125493336	+	Intron	DEL	T	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125493336delT	uc003pzu.1	+						TPD52L1_uc003pzv.1_Intron|TPD52L1_uc003pzw.1_Intron|TPD52L1_uc003pzx.1_Intron|TPD52L1_uc003pzy.1_Intron	NM_003287	NP_003278	Q16890	TPD53_HUMAN	tumor protein D52-like 1 isoform 1						DNA fragmentation involved in apoptotic nuclear change|G2/M transition of mitotic cell cycle|induction of apoptosis|positive regulation of JNK cascade|positive regulation of MAP kinase activity	perinuclear region of cytoplasm	caspase activator activity|protein heterodimerization activity|protein homodimerization activity				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		tctttctttctttctttcttt	0.000													6	3	---	---	---	---	
ALDH8A1	64577	broad.mit.edu	37	6	135265198	135265199	+	Intron	INS	-	TTTTG	TTTTG	rs146661388	by1000genomes	TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135265198_135265199insTTTTG	uc003qew.2	-						ALDH8A1_uc003qex.2_Intron|ALDH8A1_uc010kgh.2_Intron|ALDH8A1_uc011ecx.1_Intron	NM_022568	NP_072090	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8A1 isoform 1						retinal metabolic process	cytoplasm	retinal dehydrogenase activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		ACACACCTCATttttgttttgt	0.243													4	2	---	---	---	---	
NKAIN3	286183	broad.mit.edu	37	8	63502435	63502448	+	Intron	DEL	TGTGTGTGTGTGTG	-	-	rs72423486		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63502435_63502448delTGTGTGTGTGTGTG	uc010lyq.1	+							NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				ATAGGTATATtgtgtgtgtgtgtgtgtgtgtgtg	0.248													5	3	---	---	---	---	
MTAP	4507	broad.mit.edu	37	9	22028213	22028214	+	Intron	DEL	AT	-	-	rs142048183		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22028213_22028214delAT	uc003zpi.1	+						CDKN2BAS_uc010miw.1_Intron|CDKN2BAS_uc010mix.1_Intron|CDKN2BAS_uc003zpm.2_Intron	NM_002451	NP_002442	Q13126	MTAP_HUMAN	5'-methylthioadenosine phosphorylase						nucleoside metabolic process	cytoplasm	phosphorylase activity|S-methyl-5-thioadenosine phosphorylase activity			central_nervous_system(1)	1		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)	Adenine(DB00173)	catataaaacatataaaaatat	0.248													0	7	---	---	---	---	
TMEFF1	8577	broad.mit.edu	37	9	103271154	103271154	+	Intron	DEL	A	-	-	rs72170452		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103271154delA	uc004baz.1	+						TMEFF1_uc004bay.1_Intron	NM_003692	NP_003683	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two						multicellular organismal development	integral to membrane|plasma membrane					0		Acute lymphoblastic leukemia(62;0.0452)				TTTTTAAGCCAAAAAAAAAAA	0.284													6	4	---	---	---	---	
RC3H2	54542	broad.mit.edu	37	9	125617396	125617396	+	Intron	DEL	A	-	-	rs5900548		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125617396delA	uc010mwc.1	-						RC3H2_uc004bnc.2_Intron|RC3H2_uc004bnd.1_Intron|RC3H2_uc004bne.3_Intron	NM_001100588	NP_001094058	Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type zinc finger domains 2							cell surface|endomembrane system|membrane|membrane fraction|perinuclear region of cytoplasm	DNA binding|zinc ion binding			ovary(2)|lung(2)	4						tgtctcaattaaaaaaaaaaa	0.114													4	3	---	---	---	---	
ARHGAP12	94134	broad.mit.edu	37	10	32141656	32141657	+	Intron	DEL	TC	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32141656_32141657delTC	uc001ivz.1	-						ARHGAP12_uc001ivy.1_Intron|ARHGAP12_uc009xls.2_Intron|ARHGAP12_uc001iwb.1_Intron|ARHGAP12_uc001iwc.1_Intron|ARHGAP12_uc009xlq.1_Intron|ARHGAP12_uc001iwd.1_Intron|ARHGAP12_uc009xlr.1_Intron	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)				AACAAAAAAttctttttttttt	0.114													6	4	---	---	---	---	
IFITM2	10581	broad.mit.edu	37	11	308885	308886	+	Intron	INS	-	C	C	rs5789178		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:308885_308886insC	uc001lox.3	+							NM_006435	NP_006426	Q01629	IFM2_HUMAN	interferon induced transmembrane protein 2						response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane	protein binding				0		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;5.73e-28)|Epithelial(43;3.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.14e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0328)|LUSC - Lung squamous cell carcinoma(625;0.122)		GAGAGTCTGAGCCGGGTGAGGA	0.639													2	4	---	---	---	---	
HEPHL1	341208	broad.mit.edu	37	11	93839460	93839460	+	Intron	DEL	T	-	-	rs144455207		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93839460delT	uc001pep.2	+						uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor						copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				Atttcttttcttttttttttt	0.179													5	3	---	---	---	---	
ARHGAP20	57569	broad.mit.edu	37	11	110501197	110501197	+	Intron	DEL	T	-	-	rs35229947		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110501197delT	uc001pkz.1	-						ARHGAP20_uc001pky.1_Intron|ARHGAP20_uc009yyb.1_Intron|ARHGAP20_uc001pla.1_Intron	NM_020809	NP_065860	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)|kidney(2)	5		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		gaaCAATCGATTTTTTTTTGC	0.169													5	4	---	---	---	---	
CDCA3	83461	broad.mit.edu	37	12	6959169	6959169	+	Intron	DEL	T	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6959169delT	uc001qrg.2	-						CDCA3_uc001qre.2_Intron|uc001qrf.1_5'Flank|USP5_uc001qri.3_5'Flank|USP5_uc001qrh.3_5'Flank	NM_031299	NP_112589	Q99618	CDCA3_HUMAN	cell division cycle associated 3						cell division|mitosis	cytosol					0						AAGGGAGCAAttttttttttt	0.239													7	4	---	---	---	---	
SLCO1B3	28234	broad.mit.edu	37	12	21242745	21242746	+	Intron	INS	-	T	T			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21242745_21242746insT	uc010sil.1	+						LST-3TM12_uc010sim.1_Intron|LST-3TM12_uc010sin.1_Intron			Q9NPD5	SO1B3_HUMAN	SubName: Full=Liver-specific organic anion transporter 3TM13; SubName: Full=Organic anion transporter LST-3c;						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					TATAACTTCTGTTTTTTTTTTC	0.233													1	7	---	---	---	---	
RPAP3	79657	broad.mit.edu	37	12	48096335	48096336	+	Intron	INS	-	A	A			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48096335_48096336insA	uc001rpr.2	-						RPAP3_uc010slk.1_Intron|RPAP3_uc001rps.2_Intron	NM_024604	NP_078880	Q9H6T3	RPAP3_HUMAN	RNA polymerase II associated protein 3 isoform								binding			ovary(1)	1	Lung SC(27;0.192)					gactccatcacaaaaaaaaaga	0.094													4	2	---	---	---	---	
ITGA5	3678	broad.mit.edu	37	12	54796908	54796908	+	Intron	DEL	C	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54796908delC	uc001sga.2	-							NM_002205	NP_002196	P08648	ITA5_HUMAN	integrin alpha 5 precursor						angiogenesis|axon guidance|blood coagulation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|wound healing, spreading of epidermal cells	alphav-beta3 integrin-vitronectin complex|integrin complex|ruffle	platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			ovary(2)	2						CTTTCCATGGCCCTGCCCCCC	0.582													70	58	---	---	---	---	
MYL2	4633	broad.mit.edu	37	12	111349074	111349074	+	Intron	DEL	T	-	-	rs147632472	by1000genomes	TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111349074delT	uc001try.3	-						MYL2_uc001trx.3_Intron	NM_000432	NP_000423	P10916	MLRV_HUMAN	slow cardiac myosin regulatory light chain 2						cardiac myofibril assembly|heart contraction|muscle filament sliding|negative regulation of cell growth|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	cytosol|myosin complex|sarcomere	actin monomer binding|calcium ion binding|myosin heavy chain binding|structural constituent of muscle			ovary(1)	1						GACGGATAGCTGGGGGGTGGG	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19532389	19532389	+	IGR	DEL	T	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19532389delT								LOC284232 (86280 upstream) : LOC348021 (50010 downstream)																							TTTGGGAGCCTTTTTTTTTTG	0.542													4	2	---	---	---	---	
METT11D1	64745	broad.mit.edu	37	14	21461941	21461941	+	Intron	DEL	T	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21461941delT	uc001vyn.2	+						METT11D1_uc001vym.2_Intron|METT11D1_uc001vyo.2_Intron|METT11D1_uc001vyp.2_Intron|METT11D1_uc001vyq.2_Intron	NM_022734	NP_073571	Q9H7H0	MET17_HUMAN	methyltransferase 11 domain containing 1 isoform						translation	mitochondrion|ribosome	copper ion binding|methyltransferase activity				0	all_cancers(95;0.00267)		OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0191)		TGAGTCTACCTTTTTTTTTTT	0.139													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106934205	106934206	+	Intron	DEL	AA	-	-	rs35485687		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106934205_106934206delAA	uc010tyt.1	-						uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						ctaaaaagtgaaaaaaaaaaaa	0.203													6	3	---	---	---	---	
NRG4	145957	broad.mit.edu	37	15	76248134	76248134	+	Intron	DEL	A	-	-	rs146303179		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76248134delA	uc002bbo.2	-						NRG4_uc010bkm.1_Intron|NRG4_uc002bbn.2_Intron|NRG4_uc010bkn.2_Intron|NRG4_uc010bko.2_Intron	NM_138573	NP_612640	Q8WWG1	NRG4_HUMAN	neuregulin 4							extracellular region|integral to membrane|plasma membrane	growth factor activity				0						GTACCTGGCCAAAAAAAAAAA	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	82626584	82626584	+	IGR	DEL	C	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82626584delC								FAM154B (49319 upstream) : GOLGA6L10 (6540 downstream)																							TGCCTCTCTGCCCCCCCACTC	0.662													4	2	---	---	---	---	
VWA3A	146177	broad.mit.edu	37	16	22128412	22128412	+	Intron	DEL	C	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22128412delC	uc010vbq.1	+						VWA3A_uc010bxc.2_Intron	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A							extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		TGAGGCCTGACCCTGGCCTCA	0.522													4	2	---	---	---	---	
LOC283922	283922	broad.mit.edu	37	16	74372915	74372915	+	Intron	DEL	T	-	-	rs67181940		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74372915delT	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						ACGTAGtttgttttttttttt	0.204													4	3	---	---	---	---	
SPAG9	9043	broad.mit.edu	37	17	49084472	49084473	+	Intron	DEL	GT	-	-	rs35415974		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49084472_49084473delGT	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron|SPAG9_uc002ita.2_Intron|SPAG9_uc002ite.2_Intron	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CAACATTAGGgtgtgtgtgtgt	0.356													5	4	---	---	---	---	
INO80C	125476	broad.mit.edu	37	18	33077602	33077631	+	Intron	DEL	CGCACGCGCCCTGGCTCGGCTCCGCCCCGC	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33077602_33077631delCGCACGCGCCCTGGCTCGGCTCCGCCCCGC	uc002kyy.3	-						INO80C_uc002kyw.1_Intron|INO80C_uc002kyx.3_5'Flank|INO80C_uc010dmt.2_Intron	NM_194281	NP_919257	Q6PI98	IN80C_HUMAN	Ies6-similar protein isoform 2						DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex|MLL1 complex					0						CCCCACATTACGCACGCGCCCTGGCTCGGCTCCGCCCCGCCAAGTCCCGT	0.635													4	3	---	---	---	---	
SF4	57794	broad.mit.edu	37	19	19389509	19389509	+	Frame_Shift_Del	DEL	T	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19389509delT	uc002nmh.2	-	11	1627	c.1625delA	c.(1624-1626)AAGfs	p.K542fs	SF4_uc002nmf.2_Frame_Shift_Del_p.K92fs|SF4_uc002nmg.2_Frame_Shift_Del_p.K92fs|SF4_uc002nmi.2_Frame_Shift_Del_p.K332fs|SF4_uc002nmj.2_Frame_Shift_Del_p.K332fs|SF4_uc002nme.2_Frame_Shift_Del_p.K92fs	NM_172231	NP_757386	Q8IWZ8	SUGP1_HUMAN	splicing factor 4	542					nuclear mRNA splicing, via spliceosome	nucleoplasm|spliceosomal complex	RNA binding				0						CTTCAGGGCCTTGAAGGTCTC	0.612													14	8	---	---	---	---	
ALDH16A1	126133	broad.mit.edu	37	19	49963971	49963972	+	Intron	INS	-	T	T	rs35639941		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49963971_49963972insT	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		acacccggccattttttttttt	0.005													4	4	---	---	---	---	
HM13	81502	broad.mit.edu	37	20	30156903	30156904	+	Intron	INS	-	T	T	rs11376444		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30156903_30156904insT	uc002wwe.2	+						HM13_uc002wwc.2_Intron|HM13_uc002wwd.2_Intron|HM13_uc002wwf.2_Intron|HM13_uc010gdu.2_Intron	NM_030789	NP_110416	Q8TCT9	HM13_HUMAN	minor histocompatibility antigen 13 isoform 1						membrane protein proteolysis	cell surface|endoplasmic reticulum membrane|integral to membrane|plasma membrane	aspartic-type endopeptidase activity|protein binding			breast(1)	1	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			TTTTATTGTTGTTTTTTTTTTT	0.490											OREG0025852	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	5	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32340714	32340715	+	Intron	DEL	AA	-	-	rs11469458		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32340714_32340715delAA	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						ctcagctcccaaagtgttggga	0.134													4	2	---	---	---	---	
PRIC285	85441	broad.mit.edu	37	20	62190971	62190974	+	Intron	DEL	AGTC	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62190971_62190974delAGTC	uc002yfm.2	-						PRIC285_uc002yfl.1_Intron	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285						cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			gtcagatgggagtcagtcagagtc	0.000													9	4	---	---	---	---	
BACE2	25825	broad.mit.edu	37	21	42598306	42598317	+	Intron	DEL	GTGCTGGGCCGG	-	-	rs138335729	by1000genomes	TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42598306_42598317delGTGCTGGGCCGG	uc002yyw.2	+						BACE2_uc002yyx.2_Intron|BACE2_uc002yyy.2_Intron	NM_012105	NP_036237	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2 isoform A						membrane protein ectodomain proteolysis|negative regulation of amyloid precursor protein biosynthetic process|peptide hormone processing	cell surface|endoplasmic reticulum|endosome|Golgi apparatus|integral to membrane	aspartic-type endopeptidase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				CTTGGCTGGTGTGCTGGGCCGGGGCACTGCAT	0.476													21	26	---	---	---	---	
ZNRF3	84133	broad.mit.edu	37	22	29445798	29445820	+	Frame_Shift_Del	DEL	GGCCGACTGCCCAGGCAGCGACA	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29445798_29445820delGGCCGACTGCCCAGGCAGCGACA	uc003aeg.2	+	8	1494_1516	c.1329_1351delGGCCGACTGCCCAGGCAGCGACA	c.(1327-1353)CTGGCCGACTGCCCAGGCAGCGACAGCfs	p.L443fs	ZNRF3_uc003aeh.1_Frame_Shift_Del_p.L443fs	NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	543_551	Cytoplasmic (Potential).					integral to membrane	zinc ion binding			ovary(1)	1						GTGGCTACCTGGCCGACTGCCCAGgcagcgacagcagcagcag	0.587													33	19	---	---	---	---	
C22orf30	253143	broad.mit.edu	37	22	32099784	32099785	+	Intron	DEL	TT	-	-	rs35530740		TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32099784_32099785delTT	uc003alp.3	-						C22orf30_uc003alo.1_Intron|C22orf30_uc010gwj.1_Intron	NM_173566	NP_775837	Q5THK1	PR14L_HUMAN	hypothetical protein LOC253143												0						ttcttcttcatttttttttttt	0.213											OREG0003534	type=REGULATORY REGION|Gene=AK123082|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	5	3	---	---	---	---	
SAGE1	55511	broad.mit.edu	37	X	134988930	134988930	+	Intron	DEL	T	-	-			TCGA-46-6025-01	TCGA-46-6025-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134988930delT	uc004ezh.2	+						SAGE1_uc010nry.1_Intron|SAGE1_uc011mvv.1_Intron	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1											ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(192;0.000127)					TTGTATTGTCTTTCCTGGCCT	0.398													2	14	---	---	---	---	
