Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	Oncotatorv0393GAF20hg19Feb2011dbSNPbuild132UniProtRelease2011_6	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	context_orig	context65	gene_name	categ	categ_ignoring_null_categ
ARHGAP21	57584	broad.mit.edu	37	10	24908654	24908654	+	Nonsense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:24908654C>A	uc001isb.2	-	c.2170G>T	c.(2170-2172)GAG>TAG	p.E724*	ARHGAP21_uc010qdb.1_Non-coding_Transcript|ARHGAP21_uc009xkl.1_Nonsense_Mutation_p.E724*|ARHGAP21_uc010qdc.1_Nonsense_Mutation_p.E559*|ARHGAP21_uc001isc.1_Nonsense_Mutation_p.E714*	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	723					signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8														0.038462	-16.297173	7.652126	4	100	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	24908654	24908654	882	10	C	A	A	A	377	29	ARHGAP21	5	2
C10orf53	282966	broad.mit.edu	37	10	50916423	50916423	+	Missense_Mutation	SNP	T	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:50916423T>A	uc001jid.1	+	c.234T>A	c.(232-234)AGT>AGA	p.S78R		NM_182554	NP_872360	Q8N6V4	CJ053_HUMAN	chromosome 10 open reading frame 53 isoform a	81											0		all_neural(218;0.107)												0.27193	80.574242	85.92193	31	83	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	50916423	50916423	1643	10	T	A	A	A	738	57	C10orf53	3	3
UNC5B	219699	broad.mit.edu	37	10	73056384	73056384	+	Missense_Mutation	SNP	G	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:73056384G>C	uc001jro.2	+	c.2375G>C	c.(2374-2376)TGC>TCC	p.C792S	UNC5B_uc001jrp.2_Missense_Mutation_p.C781S	NM_170744	NP_734465	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B precursor	792	Cytoplasmic (Potential).				apoptosis|axon guidance|regulation of apoptosis	integral to membrane				ovary(2)|lung(1)	3														0.081081	2.116512	8.712203	3	34	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	73056384	73056384	17550	10	G	C	C	C	598	46	UNC5B	3	3
TNKS2	80351	broad.mit.edu	37	10	93576936	93576936	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:93576936G>T	uc001khp.2	+	c.470G>T	c.(469-471)GGA>GTA	p.G157V		NM_025235	NP_079511	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related	157					positive regulation of telomere maintenance via telomerase|protein ADP-ribosylation|protein localization to chromosome, telomeric region	Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity			kidney(3)|skin(2)|ovary(1)|lung(1)	7		Colorectal(252;0.162)								718				0.3	15.741057	16.456491	6	14	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	93576936	93576936	16862	10	G	T	T	T	533	41	TNKS2	2	2
SLIT1	6585	broad.mit.edu	37	10	98797513	98797513	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:98797513C>A	uc001kmw.2	-	c.2308G>T	c.(2308-2310)GGG>TGG	p.G770W	SLIT1_uc009xvh.1_Missense_Mutation_p.G780W	NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor	770	LRR 17.				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)								OREG0020406	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.2	14.634778	17.144269	6	24	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	98797513	98797513	15237	10	C	A	A	A	299	23	SLIT1	1	1
DYNC2H1	79659	broad.mit.edu	37	11	103029646	103029646	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:103029646G>A	uc001phn.1	+	c.4268G>A	c.(4267-4269)CGC>CAC	p.R1423H	DYNC2H1_uc001pho.2_Missense_Mutation_p.R1423H|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1423	Stem (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)										0.157895	5.520611	7.634633	3	16	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	103029646	103029646	5032	11	G	A	A	A	494	38	DYNC2H1	1	1
USH1C	10083	broad.mit.edu	37	11	17527437	17527437	+	Silent	SNP	A	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:17527437A>T	uc001mne.2	-	c.2073T>A	c.(2071-2073)CCT>CCA	p.P691P	USH1C_uc001mnf.2_Intron|USH1C_uc009yhb.2_Intron|USH1C_uc001mng.2_Intron|USH1C_uc001mnd.2_Intron	NM_153676	NP_710142	Q9Y6N9	USH1C_HUMAN	harmonin isoform b3	Error:Variant_position_missing_in_Q9Y6N9_after_alignment					equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1														0.184615	26.965162	33.025738	12	53	KEEP	---	---	---	---	capture		Silent	SNP	17527437	17527437	17596	11	A	T	T	T	80	7	USH1C	3	3
USH1C	10083	broad.mit.edu	37	11	17552759	17552759	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:17552759C>A	uc001mne.2	-	c.329G>T	c.(328-330)TGT>TTT	p.C110F	USH1C_uc001mnf.2_Missense_Mutation_p.C110F|USH1C_uc009yhb.2_Missense_Mutation_p.C110F|USH1C_uc001mng.2_Non-coding_Transcript|USH1C_uc001mnd.2_Missense_Mutation_p.C74F	NM_153676	NP_710142	Q9Y6N9	USH1C_HUMAN	harmonin isoform b3	110	PDZ 1.				equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1														0.181818	38.493255	47.906896	18	81	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	17552759	17552759	17596	11	C	A	A	A	221	17	USH1C	2	2
TSG101	7251	broad.mit.edu	37	11	18503191	18503192	+	Missense_Mutation	DNP	CC	AG	AG			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:18503191_18503192CC>AG	uc001mor.2	-	c.1068_1069GG>CT	c.(1066-1071)CTGGAT>CTCTAT	p.D357Y		NM_006292	NP_006283	Q99816	TS101_HUMAN	tumor susceptibility gene 101	357	SB.				cell division|cellular membrane organization|endosome transport|interspecies interaction between organisms|non-lytic virus budding|protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	early endosome|late endosome membrane|multivesicular body|nucleolus|plasma membrane	calcium-dependent protein binding|DNA binding|transcription corepressor activity|ubiquitin binding|ubiquitin protein ligase binding				0						GBM(99;1348 1396 8611 26475 50572)								0.247525	56.887915	62.785518	25	76	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	18503191	18503192	17167	11	CC	AG	AG	AG	390	30	TSG101	2	2
NAV2	89797	broad.mit.edu	37	11	19890506	19890506	+	Silent	SNP	A	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:19890506A>T	uc001mpr.3	+	c.474A>T	c.(472-474)GCA>GCT	p.A158A	NAV2_uc001mpp.2_Silent_p.A94A|NAV2_uc010rdm.1_Silent_p.A158A	NM_182964	NP_892009	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 1	158	CH.					nucleus	ATP binding|helicase activity			ovary(1)|pancreas(1)	2														0.275862	47.175945	49.798437	16	42	KEEP	---	---	---	---	capture		Silent	SNP	19890506	19890506	10580	11	A	T	T	T	80	7	NAV2	3	3
KCNA4	3739	broad.mit.edu	37	11	30033103	30033104	+	Nonsense_Mutation	DNP	CC	AA	AA			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:30033103_30033104CC>AA	uc001msk.2	-	c.1122_1123GG>TT	c.(1120-1125)GTGGAA>GTTTAA	p.E375*		NM_002233	NP_002224	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related	375	Helical; Name=Segment S2; (Potential).					voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4														0.236486	78.648887	88.046387	35	113	KEEP	---	---	---	---	capture		Nonsense_Mutation	DNP	30033103	30033104	8310	11	CC	AA	AA	AA	390	30	KCNA4	5	2
RAG2	5897	broad.mit.edu	37	11	36614627	36614627	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:36614627G>T	uc001mwv.3	-	c.1092C>A	c.(1090-1092)AAC>AAA	p.N364K	RAG1_uc001mwt.2_Non-coding_Transcript|C11orf74_uc010rfd.1_5'Flank|C11orf74_uc001mww.1_5'Flank|C11orf74_uc001mwx.1_5'Flank|C11orf74_uc001mwy.1_5'Flank|C11orf74_uc001mwz.1_5'Flank|C11orf74_uc010rfe.1_5'Flank	NM_000536	NP_000527	P55895	RAG2_HUMAN	recombination activating gene 2	364					chromatin modification|pre-B cell allelic exclusion|somatic diversification of immunoglobulins|T cell differentiation in thymus|V(D)J recombination	nucleus	chromatin binding|DNA binding|endonuclease activity|methylated histone residue binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)	2	all_lung(20;0.226)	all_hematologic(20;0.00756)												0.222772	109.250984	123.545808	45	157	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	36614627	36614627	13465	11	G	T	T	T	620	48	RAG2	2	2
PTPRJ	5795	broad.mit.edu	37	11	48146645	48146645	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:48146645G>T	uc001ngp.3	+	c.1000G>T	c.(1000-1002)GGG>TGG	p.G334W	PTPRJ_uc001ngo.3_Missense_Mutation_p.G334W	NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	334	Extracellular (Potential).|Fibronectin type-III 3.				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8														0.217391	109.8215	126.775353	50	180	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	48146645	48146645	13261	11	G	T	T	T	507	39	PTPRJ	1	1
OR5D16	390144	broad.mit.edu	37	11	55607017	55607017	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:55607017C>A	uc010rio.1	+	c.790C>A	c.(790-792)CCC>ACC	p.P264T		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	264	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3		all_epithelial(135;0.208)												0.176471	34.884122	44.950255	18	84	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55607017	55607017	11566	11	C	A	A	A	234	18	OR5D16	2	2
OR5B3	441608	broad.mit.edu	37	11	58170034	58170034	+	Silent	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:58170034C>A	uc010rkf.1	-	c.849G>T	c.(847-849)CTG>CTT	p.L283L		NM_001005469	NP_001005469	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B,	283	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)												0.129032	15.428642	27.899472	12	81	KEEP	---	---	---	---	capture		Silent	SNP	58170034	58170034	11562	11	C	A	A	A	366	29	OR5B3	2	2
OR4D6	219983	broad.mit.edu	37	11	59225059	59225059	+	Missense_Mutation	SNP	T	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:59225059T>A	uc010rku.1	+	c.626T>A	c.(625-627)CTC>CAC	p.L209H		NM_001004708	NP_001004708	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D,	209	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1														0.203209	81.042765	96.340243	38	149	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	59225059	59225059	11465	11	T	A	A	A	702	54	OR4D6	3	3
SCGB2A2	4250	broad.mit.edu	37	11	62037700	62037700	+	Silent	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:62037700G>T	uc001ntc.2	+	c.12G>T	c.(10-12)CTG>CTT	p.L4L	SCGB2A2_uc009ynx.2_Silent_p.L4L	NM_002411	NP_002402	Q13296	SG2A2_HUMAN	secretoglobin, family 2A, member 2 precursor	4						extracellular region	steroid binding			ovary(1)	1														0.176923	82.954939	108.594282	46	214	KEEP	---	---	---	---	capture		Silent	SNP	62037700	62037700	14381	11	G	T	T	T	574	45	SCGB2A2	2	2
EML3	256364	broad.mit.edu	37	11	62373360	62373360	+	Silent	SNP	T	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:62373360T>C	uc001ntu.1	-	c.1749A>G	c.(1747-1749)GGA>GGG	p.G583G	EML3_uc001ntr.1_Silent_p.G555G|EML3_uc001nts.1_Silent_p.G555G|EML3_uc001ntt.1_Silent_p.G467G|EML3_uc010rly.1_Silent_p.G583G	NM_153265	NP_694997	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like	583						cytoplasm|microtubule	protein binding				0														0.223684	81.851054	92.563387	34	118	KEEP	---	---	---	---	capture		Silent	SNP	62373360	62373360	5290	11	T	C	C	C	691	54	EML3	4	4
NLRP14	338323	broad.mit.edu	37	11	7059986	7059986	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:7059986G>T	uc001mfb.1	+	c.169G>T	c.(169-171)GAC>TAC	p.D57Y		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	57	DAPIN.				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|lung(1)|pancreas(1)	7				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)										0.142857	17.20783	28.402147	13	78	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	7059986	7059986	10879	11	G	T	T	T	533	41	NLRP14	2	2
NOX4	50507	broad.mit.edu	37	11	89088203	89088203	+	Nonsense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:89088203G>A	uc001pct.2	-	c.1144C>T	c.(1144-1146)CGA>TGA	p.R382*	NOX4_uc009yvr.2_Nonsense_Mutation_p.R357*|NOX4_uc001pcu.2_Nonsense_Mutation_p.R308*|NOX4_uc001pcw.2_Nonsense_Mutation_p.R75*|NOX4_uc001pcx.2_Nonsense_Mutation_p.R75*|NOX4_uc001pcv.2_Nonsense_Mutation_p.R382*|NOX4_uc009yvo.2_Non-coding_Transcript|NOX4_uc010rtu.1_Nonsense_Mutation_p.R216*|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Nonsense_Mutation_p.R358*|NOX4_uc009yvq.2_Nonsense_Mutation_p.R358*	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	382	FAD-binding FR-type.|Extracellular (Potential).|Mediates interaction with TLR4.				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|oxidation-reduction process|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)												0.142857	11.389352	17.414339	7	42	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	89088203	89088203	10962	11	G	A	A	A	480	37	NOX4	5	1
MED13L	23389	broad.mit.edu	37	12	116413011	116413011	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:116413011C>A	uc001tvw.2	-	c.5696G>T	c.(5695-5697)GGG>GTG	p.G1899V		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1899					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		RNA polymerase II transcription mediator activity			skin(3)|ovary(1)|lung(1)	5	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)						497				0.216216	36.15698	41.65733	16	58	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	116413011	116413011	9820	12	C	A	A	A	286	22	MED13L	2	2
TAOK3	51347	broad.mit.edu	37	12	118650764	118650764	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:118650764C>A	uc001twx.2	-	c.774G>T	c.(772-774)TTG>TTT	p.L258F	TAOK3_uc001tww.2_Missense_Mutation_p.L88F|TAOK3_uc001twy.3_Missense_Mutation_p.L258F	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	258	Protein kinase.				MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)									500				0.222222	19.479183	22.035637	8	28	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	118650764	118650764	16070	12	C	A	A	A	324	25	TAOK3	2	2
WNT5B	81029	broad.mit.edu	37	12	1741938	1741938	+	Nonsense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:1741938C>A	uc009zdq.2	+	c.195C>A	c.(193-195)TAC>TAA	p.Y65*	WNT5B_uc001qjj.2_Nonsense_Mutation_p.Y65*|WNT5B_uc001qjk.2_Nonsense_Mutation_p.Y65*|WNT5B_uc001qjl.2_Nonsense_Mutation_p.Y65*	NM_032642	NP_116031	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family,	65					angiogenesis|anterior/posterior pattern formation|cell migration involved in gastrulation|cellular response to retinoic acid|chondrocyte differentiation|convergent extension involved in axis elongation|convergent extension involved in gastrulation|dorsal/ventral axis specification|endocrine pancreas development|fat cell differentiation|lens fiber cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of gene-specific transcription from RNA polymerase II promoter|neuron differentiation|positive regulation of cell migration|positive regulation of fat cell differentiation|respiratory system development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)											0.222222	88.669088	101.492936	40	140	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	1741938	1741938	17966	12	C	A	A	A	233	18	WNT5B	5	2
ABCC9	10060	broad.mit.edu	37	12	22012531	22012531	+	Missense_Mutation	SNP	T	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:22012531T>C	uc001rfh.2	-	c.2494A>G	c.(2494-2496)ATT>GTT	p.I832V	ABCC9_uc001rfi.1_Missense_Mutation_p.I832V|ABCC9_uc001rfj.1_Missense_Mutation_p.I796V	NM_020297	NP_064693	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	832	Cytoplasmic (Potential).|ABC transporter 1.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)	4					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)									0.240506	109.27674	118.980478	38	120	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	22012531	22012531	60	12	T	C	C	C	663	51	ABCC9	4	4
SOX5	6660	broad.mit.edu	37	12	23818455	23818455	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:23818455G>A	uc001rfw.2	-	c.854C>T	c.(853-855)CCT>CTT	p.P285L	SOX5_uc001rfx.2_Missense_Mutation_p.P272L|SOX5_uc001rfy.2_Missense_Mutation_p.P272L|SOX5_uc010siv.1_Missense_Mutation_p.P272L|SOX5_uc010siw.1_Non-coding_Transcript|SOX5_uc001rfz.1_Missense_Mutation_p.P237L	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a	285					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6														0.243478	73.839864	80.739312	28	87	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	23818455	23818455	15454	12	G	A	A	A	455	35	SOX5	2	2
KRT79	338785	broad.mit.edu	37	12	53215788	53215788	+	Silent	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:53215788C>A	uc001sbb.2	-	c.1476G>T	c.(1474-1476)GGG>GGT	p.G492G	KRT79_uc001sba.2_Silent_p.G263G	NM_175834	NP_787028	Q5XKE5	K2C79_HUMAN	keratin 6L	492	Tail.					keratin filament	structural molecule activity			ovary(2)	2														0.226667	33.929946	39.082529	17	58	KEEP	---	---	---	---	capture		Silent	SNP	53215788	53215788	8807	12	C	A	A	A	379	30	KRT79	2	2
RARG	5916	broad.mit.edu	37	12	53607014	53607014	+	Silent	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:53607014C>T	uc001sce.2	-	c.1032G>A	c.(1030-1032)CTG>CTA	p.L344L	RARG_uc001scd.2_Silent_p.L333L|RARG_uc010sob.1_Silent_p.L322L|RARG_uc001scf.2_Silent_p.L344L|RARG_uc001scg.2_Silent_p.L272L|RARG_uc010soc.1_Silent_p.L223L	NM_000966	NP_000957	P13631	RARG_HUMAN	retinoic acid receptor, gamma isoform 1	344	Ligand-binding.				canonical Wnt receptor signaling pathway|embryonic eye morphogenesis|embryonic hindlimb morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|regulation of cell size|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid	integral to membrane|transcription factor complex	retinoic acid receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			breast(2)|ovary(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)					80		OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.151515	14.900675	22.585306	10	56	KEEP	---	---	---	---	capture		Silent	SNP	53607014	53607014	13514	12	C	T	T	T	262	21	RARG	2	2
NTS	4922	broad.mit.edu	37	12	86268247	86268247	+	Silent	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:86268247G>T	uc001tag.2	+	c.66G>T	c.(64-66)CTG>CTT	p.L22L		NM_006183	NP_006174	P30990	NEUT_HUMAN	neurotensin/neuromedin N preproprotein	22					regulation of blood vessel size|signal transduction	extracellular region|soluble fraction|transport vesicle	neuropeptide hormone activity				0														0.230769	40.490954	44.808285	15	50	KEEP	---	---	---	---	capture		Silent	SNP	86268247	86268247	11114	12	G	T	T	T	613	48	NTS	2	2
A2ML1	144568	broad.mit.edu	37	12	8976459	8976459	+	Silent	SNP	C	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:8976459C>G	uc001quz.3	+	c.390C>G	c.(388-390)CTC>CTG	p.L130L		NM_144670	NP_653271	B3KVV6	B3KVV6_HUMAN	alpha-2-macroglobulin-like 1 precursor	Error:Variant_position_missing_in_B3KVV6_after_alignment						extracellular space	endopeptidase inhibitor activity			ovary(2)	2														0.146067	25.511816	36.232376	13	76	KEEP	---	---	---	---	capture		Silent	SNP	8976459	8976459	6	12	C	G	G	G	405	32	A2ML1	3	3
FGF14	2259	broad.mit.edu	37	13	102375188	102375188	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:102375188G>T	uc001vpf.2	-	c.752C>A	c.(751-753)ACA>AAA	p.T251K	FGF14_uc001vpe.2_Missense_Mutation_p.T246K|FGF14_uc001vpd.1_5'Flank	NM_175929	NP_787125	Q92915	FGF14_HUMAN	fibroblast growth factor 14 isoform 1B	246					cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			large_intestine(1)|ovary(1)	2	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)													0.276923	48.220017	51.132404	18	47	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	102375188	102375188	6080	13	G	T	T	T	624	48	FGF14	2	2
N4BP2L2	10443	broad.mit.edu	37	13	33092138	33092138	+	Missense_Mutation	SNP	C	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:33092138C>G	uc010abe.1	-	c.266G>C	c.(265-267)AGG>ACG	p.R89T	N4BP2L2_uc001uuj.2_Missense_Mutation_p.R34T|N4BP2L2_uc010tdz.1_Missense_Mutation_p.R74T|N4BP2L2_uc001uuk.3_Missense_Mutation_p.R518T	NM_033111	NP_149102	Q92802	N42L2_HUMAN	phosphonoformate immuno-associated protein 5	518					cell killing		ATP binding				0		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)										0.270833	40.553042	42.826757	13	35	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	33092138	33092138	10507	13	C	G	G	G	312	24	N4BP2L2	3	3
DACH1	1602	broad.mit.edu	37	13	72440283	72440283	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:72440283C>T	uc010thn.1	-	c.619G>A	c.(619-621)GAG>AAG	p.E207K	DACH1_uc010tho.1_Missense_Mutation_p.E207K|DACH1_uc010thp.1_Missense_Mutation_p.E207K	NM_080759	NP_542937	Q9UI36	DACH1_HUMAN	dachshund homolog 1 isoform a	207	Interaction with SIX6 and HDAC3 (By similarity).|DACHbox-N.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)						202				0.263158	49.775676	53.625055	20	56	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72440283	72440283	4386	13	C	T	T	T	403	31	DACH1	1	1
UGGT2	55757	broad.mit.edu	37	13	96515938	96515938	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:96515938C>A	uc001vmt.2	-	c.3589G>T	c.(3589-3591)GAT>TAT	p.D1197Y		NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	1197					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3														0.109756	7.909929	20.277211	9	73	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	96515938	96515938	17500	13	C	A	A	A	416	32	UGGT2	2	2
OR4N2	390429	broad.mit.edu	37	14	20296431	20296431	+	Missense_Mutation	SNP	A	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:20296431A>T	uc010tkv.1	+	c.824A>T	c.(823-825)CAC>CTC	p.H275L		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	275	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)										0.116564	20.715607	44.296293	19	144	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20296431	20296431	11487	14	A	T	T	T	78	6	OR4N2	3	3
OR4K15	81127	broad.mit.edu	37	14	20443788	20443788	+	Silent	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:20443788G>T	uc010tkx.1	+	c.111G>T	c.(109-111)GTG>GTT	p.V37V		NM_001005486	NP_001005486	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K,	37	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)										0.205128	93.681753	109.41595	40	155	KEEP	---	---	---	---	capture		Silent	SNP	20443788	20443788	11480	14	G	T	T	T	613	48	OR4K15	2	2
C14orf28	122525	broad.mit.edu	37	14	45373686	45373686	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:45373686G>A	uc001wvo.2	+	c.703G>A	c.(703-705)GAA>AAA	p.E235K	C14orf28_uc001wvp.1_Missense_Mutation_p.E235K	NM_001017923	NP_001017923	Q4W4Y0	CN028_HUMAN	hypothetical protein LOC122525	235										ovary(1)	1														0.056075	-9.945494	12.231395	6	101	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	45373686	45373686	1819	14	G	A	A	A	585	45	C14orf28	2	2
PTGDR	5729	broad.mit.edu	37	14	52735015	52735015	+	Silent	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:52735015G>T	uc001wzq.2	+	c.483G>T	c.(481-483)CTG>CTT	p.L161L		NM_000953	NP_000944	Q13258	PD2R_HUMAN	prostaglandin D2 receptor	161	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	prostaglandin D receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)									0.220513	97.710474	111.749044	43	152	KEEP	---	---	---	---	capture		Silent	SNP	52735015	52735015	13195	14	G	T	T	T	600	47	PTGDR	2	2
ADAM21	8747	broad.mit.edu	37	14	70925692	70925692	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:70925692C>A	uc001xmd.2	+	c.1476C>A	c.(1474-1476)GAC>GAA	p.D492E		NM_003813	NP_003804	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21 preproprotein	492	Disintegrin.|Extracellular (Potential).				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			pancreas(1)	1				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)										0.035088	-28.403317	11.786403	6	165	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	70925692	70925692	244	14	C	A	A	A	246	19	ADAM21	1	1
CATSPERB	79820	broad.mit.edu	37	14	92074715	92074715	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:92074715C>A	uc001xzs.1	-	c.2632G>T	c.(2632-2634)GCT>TCT	p.A878S	CATSPERB_uc010aub.1_Missense_Mutation_p.A400S	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta	878					cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|ovary(1)	3		all_cancers(154;0.0663)|all_epithelial(191;0.236)								637				0.166667	20.109928	26.432393	10	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	92074715	92074715	2810	14	C	A	A	A	325	25	CATSPERB	2	2
RIN3	79890	broad.mit.edu	37	14	93107608	93107608	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:93107608C>A	uc001yap.2	+	c.466C>A	c.(466-468)CTA>ATA	p.L156I	RIN3_uc010auk.2_5'UTR|RIN3_uc001yaq.2_Missense_Mutation_p.L81I	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	156	SH2.				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding				0		all_cancers(154;0.0701)												0.061224	-3.216884	6.632464	3	46	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	93107608	93107608	13850	14	C	A	A	A	363	28	RIN3	2	2
UBR7	55148	broad.mit.edu	37	14	93686679	93686679	+	Nonsense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:93686679C>T	uc001ybm.3	+	c.1045C>T	c.(1045-1047)CAG>TAG	p.Q349*	UBR7_uc001ybn.3_Nonsense_Mutation_p.Q273*|UBR7_uc010auq.2_Nonsense_Mutation_p.Q198*	NM_175748	NP_786924	Q8N806	UBR7_HUMAN	ubiquitin protein ligase E3 component n-recognin	349							ubiquitin-protein ligase activity|zinc ion binding				0														0.188235	68.003227	83.468174	32	138	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	93686679	93686679	17464	14	C	T	T	T	273	21	UBR7	5	2
LRRK1	79705	broad.mit.edu	37	15	101601410	101601410	+	Missense_Mutation	SNP	A	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:101601410A>T	uc002bwr.2	+	c.4714A>T	c.(4714-4716)ATG>TTG	p.M1572L	LRRK1_uc010usb.1_Non-coding_Transcript|LRRK1_uc010usc.1_Non-coding_Transcript|LRRK1_uc002bws.2_Non-coding_Transcript	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	1572					protein phosphorylation|small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)							1100				0.2	28.973511	33.989738	12	48	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	101601410	101601410	9408	15	A	T	T	T	104	8	LRRK1	3	3
C15orf2	23742	broad.mit.edu	37	15	24921511	24921511	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:24921511C>A	uc001ywo.2	+	c.497C>A	c.(496-498)CCG>CAG	p.P166Q		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	166					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|kidney(1)|central_nervous_system(1)	6		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)						443				0.209302	41.20459	47.936063	18	68	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	24921511	24921511	1834	15	C	A	A	A	299	23	C15orf2	1	1
GABRA5	2558	broad.mit.edu	37	15	27128544	27128544	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:27128544G>T	uc001zbd.1	+	c.337G>T	c.(337-339)GGG>TGG	p.G113W	GABRB3_uc001zbb.2_Intron	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	113	Extracellular (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)									0.3	91.825743	96.134226	36	84	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	27128544	27128544	6415	15	G	T	T	T	559	43	GABRA5	2	2
GABRG3	2567	broad.mit.edu	37	15	27765182	27765182	+	Silent	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:27765182G>A	uc001zbg.1	+	c.777G>A	c.(775-777)CAG>CAA	p.Q259Q		NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma	259	Helical; (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		NSCLC(114;800 1656 7410 37729 45293)								0.272727	8.519861	9.032127	3	8	KEEP	---	---	---	---	capture		Silent	SNP	27765182	27765182	6424	15	G	A	A	A	425	33	GABRG3	2	2
HERC2	8924	broad.mit.edu	37	15	28459224	28459224	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:28459224C>A	uc001zbj.2	-	c.6553G>T	c.(6553-6555)GGG>TGG	p.G2185W		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	2185					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of mitotic metaphase/anaphase transition	anaphase-promoting complex	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(2)|central_nervous_system(1)	11		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)						1580				0.282828	72.255286	76.451542	28	71	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	28459224	28459224	7341	15	C	A	A	A	312	24	HERC2	2	2
MGA	23269	broad.mit.edu	37	15	42042148	42042148	+	Nonsense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:42042148G>T	uc010ucy.1	+	c.6343G>T	c.(6343-6345)GAA>TAA	p.E2115*	MGA_uc010ucz.1_Nonsense_Mutation_p.E1906*|MGA_uc010uda.1_Nonsense_Mutation_p.E731*|MGA_uc001zoi.2_Nonsense_Mutation_p.E329*	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1	2076	Basic motif.				regulation of transcription, DNA-dependent	MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|skin(1)	11		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)						606				0.205128	16.575333	19.723471	8	31	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	42042148	42042148	9930	15	G	T	T	T	533	41	MGA	5	2
ATP8B4	79895	broad.mit.edu	37	15	50264909	50264909	+	Silent	SNP	A	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:50264909A>T	uc001zxu.2	-	c.1113T>A	c.(1111-1113)CCT>CCA	p.P371P	ATP8B4_uc010ber.2_Silent_p.P244P|ATP8B4_uc010ufd.1_Silent_p.P244P|ATP8B4_uc010ufe.1_Non-coding_Transcript	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	371	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|breast(2)|large_intestine(1)	5		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)										0.230769	22.654671	25.245222	9	30	KEEP	---	---	---	---	capture		Silent	SNP	50264909	50264909	1216	15	A	T	T	T	80	7	ATP8B4	3	3
CCDC33	80125	broad.mit.edu	37	15	74559018	74559018	+	Splice_Site_SNP	SNP	G	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:74559018G>C	uc002axo.2	+	c.320_splice	c.e4-1	p.D107_splice	CCDC33_uc002axp.2_5'Flank	NM_025055	NP_079331			coiled-coil domain containing 33 isoform 1								protein binding			ovary(3)	3														0.176744	95.510168	116.683828	38	177	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	74559018	74559018	2928	15	G	C	C	C	429	33	CCDC33	5	3
ZNF592	9640	broad.mit.edu	37	15	85327613	85327613	+	Silent	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:85327613G>A	uc002bld.2	+	c.1707G>A	c.(1705-1707)GCG>GCA	p.A569A	ZNF592_uc010upb.1_Non-coding_Transcript	NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592	569					cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4			BRCA - Breast invasive adenocarcinoma(143;0.0587)											0.176471	50.111435	65.14667	27	126	KEEP	---	---	---	---	capture		Silent	SNP	85327613	85327613	18617	15	G	A	A	A	483	38	ZNF592	1	1
AGBL1	123624	broad.mit.edu	37	15	87217502	87217502	+	Splice_Site_SNP	SNP	A	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:87217502A>G	uc002blz.1	+	c.2920_splice	c.e22-2	p.G974_splice		NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0														0.285714	15.840395	16.706377	6	15	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	87217502	87217502	377	15	A	G	G	G	91	7	AGBL1	5	4
ZP2	7783	broad.mit.edu	37	16	21213575	21213575	+	Silent	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:21213575G>A	uc010bwn.1	-	c.1254C>T	c.(1252-1254)GAC>GAT	p.D418D	ZP2_uc002dii.2_Silent_p.D379D	NM_003460	NP_003451	Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 preproprotein	379	Extracellular (Potential).|ZP.				binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.0573)										0.090909	1.365152	8.790318	4	40	KEEP	---	---	---	---	capture		Silent	SNP	21213575	21213575	18820	16	G	A	A	A	516	40	ZP2	1	1
ZNF423	23090	broad.mit.edu	37	16	49671380	49671380	+	Missense_Mutation	SNP	C	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:49671380C>G	uc002efs.2	-	c.1683G>C	c.(1681-1683)GAG>GAC	p.E561D	ZNF423_uc010vgn.1_Missense_Mutation_p.E444D	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	561					cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	transcription activator activity|transcription repressor activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)								386				0.233871	74.61035	82.648634	29	95	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	49671380	49671380	18491	16	C	G	G	G	311	24	ZNF423	3	3
CDH8	1006	broad.mit.edu	37	16	61761098	61761098	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:61761098C>A	uc002eog.1	-	c.1436G>T	c.(1435-1437)CGA>CTA	p.R479L	CDH8_uc002eoh.2_Missense_Mutation_p.R248L	NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	479	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|breast(1)	7		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)										0.189542	64.077928	77.88037	29	124	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	61761098	61761098	3245	16	C	A	A	A	403	31	CDH8	1	1
HAS3	3038	broad.mit.edu	37	16	69148656	69148656	+	Silent	SNP	A	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:69148656A>T	uc010cfh.2	+	c.1149A>T	c.(1147-1149)TCA>TCT	p.S383S	HAS3_uc002ewk.2_Intron|HAS3_uc002ewl.2_Silent_p.S383S	NM_005329	NP_005320	O00219	HAS3_HUMAN	hyaluronan synthase 3 isoform a	383	Helical; Name=3; (Potential).				carbohydrate metabolic process	integral to plasma membrane	hyaluronan synthase activity				0		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)										0.308511	166.882867	173.024964	58	130	KEEP	---	---	---	---	capture		Silent	SNP	69148656	69148656	7245	16	A	T	T	T	80	7	HAS3	3	3
NFAT5	10725	broad.mit.edu	37	16	69726307	69726307	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:69726307G>T	uc002exl.1	+	c.2579G>T	c.(2578-2580)AGC>ATC	p.S860I	NFAT5_uc002exi.2_Missense_Mutation_p.S766I|NFAT5_uc002exj.1_Missense_Mutation_p.S766I|NFAT5_uc002exk.1_Missense_Mutation_p.S766I|NFAT5_uc002exn.1_Missense_Mutation_p.S859I|NFAT5_uc002exm.1_Missense_Mutation_p.S842I|NFAT5_uc002exo.1_5'Flank	NM_138713	NP_619727	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5 isoform b	842					excretion|regulation of transcription, DNA-dependent|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|RNA polymerase II transcription factor activity|sequence-specific DNA binding transcription factor activity				0														0.282297	153.930298	162.833802	59	150	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	69726307	69726307	10760	16	G	T	T	T	442	34	NFAT5	2	2
NARFL	64428	broad.mit.edu	37	16	781625	781625	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:781625C>A	uc002cjr.2	-	c.974G>T	c.(973-975)CGG>CTG	p.R325L	NARFL_uc002cjp.2_Missense_Mutation_p.R223L|NARFL_uc002cjq.2_Missense_Mutation_p.R223L|NARFL_uc002cjs.2_Missense_Mutation_p.R107L|NARFL_uc010uuq.1_Missense_Mutation_p.G134C	NM_022493	NP_071938	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like	325					iron-sulfur cluster assembly|oxygen homeostasis|regulation of transcription, DNA-dependent|response to hypoxia		4 iron, 4 sulfur cluster binding|metal ion binding				0		Hepatocellular(780;0.0218)												0.5	9.82534	9.82534	3	3	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	781625	781625	10564	16	C	A	A	A	299	23	NARFL	1	1
GAN	8139	broad.mit.edu	37	16	81410934	81410934	+	Splice_Site_SNP	SNP	G	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:81410934G>C	uc002fgo.2	+	c.1612_splice	c.e10+1	p.G538_splice		NM_022041	NP_071324			gigaxonin						cell death	cytoplasm|neurofilament	protein binding			ovary(2)	2		Colorectal(91;0.153)				GBM(106;1239 1507 7582 9741 33976)								0.127479	90.936203	138.68468	45	308	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	81410934	81410934	6496	16	G	C	C	C	572	44	GAN	5	3
ZNF778	197320	broad.mit.edu	37	16	89294225	89294225	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:89294225G>T	uc002fmv.2	+	c.1445G>T	c.(1444-1446)TGT>TTT	p.C482F	ZNF778_uc010vpf.1_Intron|ZNF778_uc002fmw.1_Missense_Mutation_p.C440F|ZNF778_uc010vpg.1_Missense_Mutation_p.C245F	NM_182531	NP_872337	Q96MU6	ZN778_HUMAN	zinc finger protein 778	482	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0269)										0.153846	23.35616	32.286173	12	66	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	89294225	89294225	18749	16	G	T	T	T	624	48	ZNF778	2	2
MYH4	4622	broad.mit.edu	37	17	10355258	10355258	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:10355258C>A	uc002gmn.2	-	c.3738G>T	c.(3736-3738)AAG>AAT	p.K1246N		NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1246	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|central_nervous_system(1)	11														0.24026	90.29	99.778164	37	117	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	10355258	10355258	10432	17	C	A	A	A	311	24	MYH4	2	2
DNAH9	1770	broad.mit.edu	37	17	11593391	11593391	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:11593391G>T	uc002gne.2	+	c.4252G>T	c.(4252-4254)GAT>TAT	p.D1418Y	DNAH9_uc010coo.2_Missense_Mutation_p.D712Y	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	1418	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	10		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)										0.174603	19.281627	25.581233	11	52	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	11593391	11593391	4791	17	G	T	T	T	533	41	DNAH9	2	2
RHBDL3	162494	broad.mit.edu	37	17	30611731	30611731	+	Silent	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:30611731G>A	uc002hhe.1	+	c.189G>A	c.(187-189)CTG>CTA	p.L63L	RHBDL3_uc010csw.1_Silent_p.L55L|RHBDL3_uc010csx.1_Silent_p.L63L|RHBDL3_uc010csy.1_Intron|RHBDL3_uc002hhf.1_Intron	NM_138328	NP_612201	P58872	RHBL3_HUMAN	rhomboid protease 3	63	EF-hand 1.					integral to membrane	calcium ion binding|serine-type endopeptidase activity			ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)												0.223684	35.127603	40.469815	17	59	KEEP	---	---	---	---	capture		Silent	SNP	30611731	30611731	13798	17	G	A	A	A	600	47	RHBDL3	2	2
MYO19	80179	broad.mit.edu	37	17	34883509	34883509	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:34883509C>A	uc010wcy.1	-	c.173G>T	c.(172-174)CGG>CTG	p.R58L	MYO19_uc002hmw.2_Missense_Mutation_p.R58L|MYO19_uc010cuu.2_Non-coding_Transcript|MYO19_uc010wcz.1_Non-coding_Transcript|MYO19_uc010wda.1_Intron|MYO19_uc002hmx.2_Missense_Mutation_p.R58L	NM_001163735	NP_001157207	Q96H55	MYO19_HUMAN	myosin XIX isoform 2	58	Myosin head-like.					mitochondrial outer membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)	1		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)										0.229167	28.011297	31.232029	11	37	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	34883509	34883509	10462	17	C	A	A	A	299	23	MYO19	1	1
MRM1	79922	broad.mit.edu	37	17	34964761	34964761	+	Silent	SNP	A	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:34964761A>G	uc002hne.2	+	c.972A>G	c.(970-972)CAA>CAG	p.Q324Q	MRM1_uc002hnf.2_Silent_p.Q129Q	NM_024864	NP_079140	Q6IN84	MRM1_HUMAN	mitochondrial rRNA methyltransferase 1 homolog	324					RNA processing	mitochondrion	RNA binding|RNA methyltransferase activity				0		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)										0.203226	168.655813	194.000323	63	247	KEEP	---	---	---	---	capture		Silent	SNP	34964761	34964761	10164	17	A	G	G	G	37	3	MRM1	4	4
C17orf85	55421	broad.mit.edu	37	17	3721736	3721736	+	Silent	SNP	G	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:3721736G>C	uc010ckl.1	-	c.1131C>G	c.(1129-1131)CTC>CTG	p.L377L	C17orf85_uc002fwr.2_Silent_p.L87L|C17orf85_uc002fwq.2_Silent_p.L97L	NM_001114118	NP_001107590	Q53F19	CQ085_HUMAN	ELG protein isoform a	377							nucleotide binding				0				UCEC - Uterine corpus endometrioid carcinoma (3;0.0725)										0.206107	78.170006	88.644887	27	104	KEEP	---	---	---	---	capture		Silent	SNP	3721736	3721736	1946	17	G	C	C	C	522	41	C17orf85	3	3
MLX	6945	broad.mit.edu	37	17	40720536	40720536	+	Missense_Mutation	SNP	A	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:40720536A>G	uc002iag.2	+	c.290A>G	c.(289-291)AAT>AGT	p.N97S	MLX_uc002iaf.2_Missense_Mutation_p.N43S|MLX_uc002iah.2_Intron	NM_170607	NP_733752	Q9UH92	MLX_HUMAN	transcription factor-like protein 4 isoform	97	Helix-loop-helix motif.				energy reserve metabolic process|negative regulation of transcription, DNA-dependent|positive regulation of cellular metabolic process	cytoplasm|nucleus	DNA binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulator activity				0		all_cancers(22;4.26e-05)|Breast(137;0.000153)|all_epithelial(22;0.00148)		BRCA - Breast invasive adenocarcinoma(366;0.129)		GBM(121;657 1601 4665 24731 34640)								0.21118	189.835628	214.663669	68	254	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	40720536	40720536	10025	17	A	G	G	G	52	4	MLX	4	4
PRKCA	5578	broad.mit.edu	37	17	64785039	64785040	+	Missense_Mutation	DNP	GG	TT	TT			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:64785039_64785040GG>TT	uc002jfp.1	+	c.1796_1797GG>TT	c.(1795-1797)AGG>ATT	p.R599I		NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	599	AGC-kinase C-terminal.				activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|ovary(1)	7			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)					554				0.21374	65.633672	75.546223	28	103	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	64785039	64785040	12950	17	GG	TT	TT	TT	455	35	PRKCA	2	2
C17orf74	201243	broad.mit.edu	37	17	7330250	7330250	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:7330250C>T	uc002ggw.2	+	c.940C>T	c.(940-942)CGG>TGG	p.R314W	FGF11_uc010vtw.1_Intron	NM_175734	NP_783861	Q0P670	CQ074_HUMAN	hypothetical protein LOC201243	314						integral to membrane					0		Prostate(122;0.157)												0.189655	21.792747	27.016833	11	47	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	7330250	7330250	1937	17	C	T	T	T	347	27	C17orf74	1	1
UNC13D	201294	broad.mit.edu	37	17	73836332	73836332	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:73836332G>A	uc002jpp.2	-	c.832C>T	c.(832-834)CTC>TTC	p.L278F	UNC13D_uc010wsk.1_Missense_Mutation_p.L278F|UNC13D_uc002jpq.1_5'UTR|UNC13D_uc010dgq.1_Missense_Mutation_p.L75F	NM_199242	NP_954712	Q70J99	UN13D_HUMAN	unc-13 homolog D	278	Interaction with RAB27A.				positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding				0			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)											0.153846	16.467379	22.42328	8	44	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	73836332	73836332	17545	17	G	A	A	A	455	35	UNC13D	2	2
TRIM65	201292	broad.mit.edu	37	17	73887248	73887248	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:73887248C>A	uc002jpx.2	-	c.1166G>T	c.(1165-1167)CGC>CTC	p.R389L		NM_173547	NP_775818	Q6PJ69	TRI65_HUMAN	tripartite motif-containing 65	389	B30.2/SPRY.					intracellular	zinc ion binding				0			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)											0.154639	26.410148	37.430723	15	82	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	73887248	73887248	17087	17	C	A	A	A	351	27	TRIM65	1	1
RNF165	494470	broad.mit.edu	37	18	44027602	44027602	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:44027602C>A	uc002lcb.1	+	c.562C>A	c.(562-564)CTA>ATA	p.L188I	RNF165_uc002lby.1_Missense_Mutation_p.L121I|RNF165_uc010dnn.1_5'UTR	NM_152470	NP_689683	Q6ZSG1	RN165_HUMAN	ring finger protein 165	188							zinc ion binding				0				READ - Rectum adenocarcinoma(1;0.0873)										0.287671	106.398816	112.298006	42	104	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	44027602	44027602	13933	18	C	A	A	A	311	24	RNF165	2	2
ABCA7	10347	broad.mit.edu	37	19	1046335	1046335	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:1046335C>A	uc002lqw.3	+	c.1552C>A	c.(1552-1554)CTC>ATC	p.L518I	ABCA7_uc010dsb.1_Missense_Mutation_p.L380I	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	518	Extracellular (By similarity).				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.094763	10.793567	76.955655	38	363	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	1046335	1046335	38	19	C	A	A	A	364	28	ABCA7	2	2
EMR2	30817	broad.mit.edu	37	19	14857057	14857057	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:14857057G>A	uc002mzp.1	-	c.2170C>T	c.(2170-2172)CTC>TTC	p.L724F	EMR2_uc010dzs.1_Missense_Mutation_p.L183F|EMR2_uc010xnw.1_Missense_Mutation_p.L666F|EMR2_uc002mzo.1_Missense_Mutation_p.L713F|EMR2_uc002mzq.1_Missense_Mutation_p.L664F|EMR2_uc002mzr.1_Missense_Mutation_p.L675F|EMR2_uc002mzs.1_Missense_Mutation_p.L582F|EMR2_uc002mzt.1_Missense_Mutation_p.L620F|EMR2_uc002mzu.1_Missense_Mutation_p.L631F|EMR2_uc010xnx.1_Non-coding_Transcript	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone	724	Cytoplasmic (Potential).				cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)	1														0.215054	202.904621	230.779506	80	292	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	14857057	14857057	5298	19	G	A	A	A	455	35	EMR2	2	2
OR10H1	26539	broad.mit.edu	37	19	15918047	15918047	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:15918047C>A	uc002nbq.2	-	c.801G>T	c.(799-801)CAG>CAT	p.Q267H		NM_013940	NP_039228	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H,	267	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.293103	94.300339	98.747814	34	82	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	15918047	15918047	11311	19	C	A	A	A	259	20	OR10H1	2	2
SLC5A5	6528	broad.mit.edu	37	19	17994525	17994525	+	Silent	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:17994525C>T	uc002nhr.3	+	c.1278C>T	c.(1276-1278)CCC>CCT	p.P426P		NM_000453	NP_000444	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium iodide	426	Helical; (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process	integral to membrane|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity			ovary(1)|central_nervous_system(1)	2						Melanoma(65;1008 1708 7910 46650)								0.160377	31.903664	43.54625	17	89	KEEP	---	---	---	---	capture		Silent	SNP	17994525	17994525	15165	19	C	T	T	T	275	22	SLC5A5	2	2
CRTC1	23373	broad.mit.edu	37	19	18888001	18888001	+	Missense_Mutation	SNP	A	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:18888001A>T	uc010ebv.2	+	c.1762A>T	c.(1762-1764)AGC>TGC	p.S588C	CRTC1_uc002nkb.3_Missense_Mutation_p.S572C|CRTC1_uc010ebw.2_Missense_Mutation_p.S408C|CRTC1_uc002nkc.3_Missense_Mutation_p.S270C	NM_001098482	NP_001091952	Q6UUV9	CRTC1_HUMAN	mucoepidermoid carcinoma translocated 1 isoform	572					interspecies interaction between organisms|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	cAMP response element binding protein binding|protein binding	p.S572fs*4(1)		ovary(1)|lung(1)|breast(1)	3										173				0.228261	48.600067	54.785752	21	71	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	18888001	18888001	4038	19	A	T	T	T	91	7	CRTC1	3	3
ZNF536	9745	broad.mit.edu	37	19	31025803	31025803	+	Silent	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:31025803G>T	uc002nsu.1	+	c.2220G>T	c.(2218-2220)CTG>CTT	p.L740L	ZNF536_uc010edd.1_Silent_p.L740L	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	740					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)	9	Esophageal squamous(110;0.0834)													0.238806	150.154957	166.86273	64	204	KEEP	---	---	---	---	capture		Silent	SNP	31025803	31025803	18568	19	G	T	T	T	587	46	ZNF536	2	2
CELF5	60680	broad.mit.edu	37	19	3281249	3281249	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:3281249C>T	uc002lxm.2	+	c.656C>T	c.(655-657)ACG>ATG	p.T219M	CELF5_uc002lxl.1_Missense_Mutation_p.T219M|CELF5_uc010dtj.1_Missense_Mutation_p.T219M|CELF5_uc010xhg.1_Missense_Mutation_p.T105M|CELF5_uc002lxn.2_Non-coding_Transcript	NM_021938	NP_068757	Q8N6W0	CELF5_HUMAN	bruno-like 5, RNA binding protein	219					mRNA processing	cytoplasm|nucleus	nucleotide binding|RNA binding			ovary(1)	1														0.096491	7.144477	25.745875	11	103	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	3281249	3281249	3352	19	C	T	T	T	247	19	CELF5	1	1
LSM14A	26065	broad.mit.edu	37	19	34706112	34706112	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:34706112G>T	uc002nvb.3	+	c.622G>T	c.(622-624)GCT>TCT	p.A208S	LSM14A_uc002nva.3_Missense_Mutation_p.A208S|LSM14A_uc010xru.1_Missense_Mutation_p.A167S|LSM14A_uc002nvc.3_Missense_Mutation_p.A14S	NM_001114093	NP_001107565	Q8ND56	LS14A_HUMAN	LSM14 homolog A isoform a	208					cytoplasmic mRNA processing body assembly|multicellular organismal development|regulation of translation	cytoplasmic mRNA processing body|intracellular membrane-bounded organelle|stress granule					0	Esophageal squamous(110;0.162)													0.253165	44.245139	48.632062	20	59	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	34706112	34706112	9430	19	G	T	T	T	598	46	LSM14A	2	2
ZFP14	57677	broad.mit.edu	37	19	36832235	36832235	+	Missense_Mutation	SNP	C	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:36832235C>G	uc010xtd.1	-	c.496G>C	c.(496-498)GTT>CTT	p.V166L	ZFP14_uc002odx.1_Missense_Mutation_p.V165L|ZFP14_uc010eex.1_Missense_Mutation_p.V165L	NM_020917	NP_065968	Q9HCL3	ZFP14_HUMAN	zinc finger protein 14-like	165					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.162)													0.208333	145.016587	163.921958	50	190	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	36832235	36832235	18227	19	C	G	G	G	247	19	ZFP14	3	3
TMIGD2	126259	broad.mit.edu	37	19	4298087	4298087	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:4298087G>T	uc002lzx.1	-	c.302C>A	c.(301-303)CCT>CAT	p.P101H	TMIGD2_uc010dtv.1_Missense_Mutation_p.P101H	NM_144615	NP_653216	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain	101	Extracellular (Potential).|Ig-like.					integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)										0.218391	83.255303	95.977223	38	136	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	4298087	4298087	16771	19	G	T	T	T	455	35	TMIGD2	2	2
PSG3	5671	broad.mit.edu	37	19	43233410	43233410	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:43233410C>T	uc010eil.2	-	c.1174G>A	c.(1174-1176)GGG>AGG	p.G392R	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Missense_Mutation_p.G370R|PSG3_uc002oue.2_Missense_Mutation_p.G370R	NM_021016	NP_066296	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	370	Ig-like C2-type 3.			Missing (in Ref. 9).	defense response|female pregnancy	extracellular region				ovary(1)	1		Prostate(69;0.00682)												0.205656	175.853832	207.134908	80	309	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43233410	43233410	13109	19	C	T	T	T	273	21	PSG3	2	2
ETHE1	23474	broad.mit.edu	37	19	44012091	44012091	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:44012091C>A	uc010eiu.1	-	c.717G>T	c.(715-717)GAG>GAT	p.E239D	ETHE1_uc002owp.2_Intron	NM_014297	NP_055112	O95571	ETHE1_HUMAN	ETHE1 protein precursor	Error:Variant_position_missing_in_O95571_after_alignment						mitochondrial matrix|nucleus	hydrolase activity|metal ion binding				0		Prostate(69;0.0153)												0.111111	2.603545	6.642874	3	24	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	44012091	44012091	5465	19	C	A	A	A	352	28	ETHE1	2	2
RTN2	6253	broad.mit.edu	37	19	45992753	45992753	+	Silent	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:45992753C>T	uc002pcb.2	-	c.1092G>A	c.(1090-1092)CTG>CTA	p.L364L	RTN2_uc002pcc.2_Silent_p.L291L|RTN2_uc002pcd.2_Non-coding_Transcript	NM_005619	NP_005610	O75298	RTN2_HUMAN	reticulon 2 isoform A	364	Reticulon.					integral to endoplasmic reticulum membrane	signal transducer activity			ovary(3)	3		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)										0.375	23.367209	23.697033	9	15	KEEP	---	---	---	---	capture		Silent	SNP	45992753	45992753	14206	19	C	T	T	T	366	29	RTN2	2	2
SIGLEC9	27180	broad.mit.edu	37	19	51628373	51628373	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:51628373C>A	uc010yct.1	+	c.142C>A	c.(142-144)CAT>AAT	p.H48N	SIGLEC9_uc002pvu.2_Missense_Mutation_p.H48N	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9 precursor	48	Extracellular (Potential).|Ig-like V-type.				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding				0		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)										0.233766	42.626372	47.610882	18	59	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	51628373	51628373	14810	19	C	A	A	A	325	25	SIGLEC9	2	2
SIGLEC12	89858	broad.mit.edu	37	19	51994930	51994930	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:51994930C>T	uc002pwx.1	-	c.1753G>A	c.(1753-1755)GGC>AGC	p.G585S	SIGLEC12_uc002pww.1_Missense_Mutation_p.G467S|SIGLEC12_uc010eoy.1_Missense_Mutation_p.G312S	NM_053003	NP_443729	Q96PQ1	SIG12_HUMAN	sialic acid binding immunoglobulin-like	585	Cytoplasmic (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)	3		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)										0.327044	154.546658	158.764569	52	107	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	51994930	51994930	14803	19	C	T	T	T	299	23	SIGLEC12	1	1
ZNF665	79788	broad.mit.edu	37	19	53678823	53678823	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:53678823C>A	uc010eqm.1	-	c.17G>T	c.(16-18)GGA>GTA	p.G6V		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	Error:Variant_position_missing_in_Q9H7R5_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)										0.176871	46.36881	60.828078	26	121	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	53678823	53678823	18668	19	C	A	A	A	390	30	ZNF665	2	2
CCDC106	29903	broad.mit.edu	37	19	56160839	56160839	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:56160839G>T	uc002qlr.2	+	c.202G>T	c.(202-204)GCT>TCT	p.A68S	CCDC106_uc002qls.2_Missense_Mutation_p.A68S	NM_013301	NP_037433	Q9BWC9	CC106_HUMAN	coiled-coil domain containing 106	68	Potential.					nucleus					0		Colorectal(82;0.00403)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)										0.246377	40.940376	44.981713	17	52	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	56160839	56160839	2861	19	G	T	T	T	546	42	CCDC106	2	2
NLRP4	147945	broad.mit.edu	37	19	56363727	56363727	+	Splice_Site_SNP	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:56363727G>T	uc002qmd.3	+	c.280_splice	c.e2+1	p.G94_splice		NM_134444	NP_604393			NLR family, pyrin domain containing 4								ATP binding			ovary(5)|lung(3)|kidney(1)|pancreas(1)	10		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)										0.161905	31.802185	43.223507	17	88	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	56363727	56363727	10882	19	G	T	T	T	572	44	NLRP4	5	2
ZNF418	147686	broad.mit.edu	37	19	58439201	58439201	+	Silent	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:58439201C>T	uc002qqs.1	-	c.348G>A	c.(346-348)GGG>GGA	p.G116G	ZNF418_uc010yhn.1_Non-coding_Transcript|ZNF418_uc010yho.1_Silent_p.G31G	NM_133460	NP_597717	Q8TF45	ZN418_HUMAN	zinc finger protein 418	116					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)										0.078838	-0.96871	42.700744	19	222	KEEP	---	---	---	---	capture		Silent	SNP	58439201	58439201	18488	19	C	T	T	T	379	30	ZNF418	2	2
MUC16	94025	broad.mit.edu	37	19	9076674	9076674	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:9076674G>T	uc002mkp.2	-	c.10772C>A	c.(10771-10773)TCC>TAC	p.S3591Y		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	3592	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			ovary(15)|large_intestine(1)|pancreas(1)|breast(1)|skin(1)	19														0.140127	26.722892	46.394456	22	135	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	9076674	9076674	10367	19	G	T	T	T	533	41	MUC16	2	2
MUC16	94025	broad.mit.edu	37	19	9077673	9077673	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:9077673C>A	uc002mkp.2	-	c.9773G>T	c.(9772-9774)AGC>ATC	p.S3258I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	3259	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			ovary(15)|large_intestine(1)|pancreas(1)|breast(1)|skin(1)	19														0.243902	84.202652	94.025711	40	124	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	9077673	9077673	10367	19	C	A	A	A	364	28	MUC16	2	2
MUC16	94025	broad.mit.edu	37	19	9083941	9083941	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:9083941G>T	uc002mkp.2	-	c.7874C>A	c.(7873-7875)CCA>CAA	p.P2625Q		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2625	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			ovary(15)|large_intestine(1)|pancreas(1)|breast(1)|skin(1)	19														0.122807	8.583002	16.522365	7	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	9083941	9083941	10367	19	G	T	T	T	611	47	MUC16	2	2
COL11A1	1301	broad.mit.edu	37	1	103352528	103352528	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:103352528C>A	uc001dum.2	-	c.4729G>T	c.(4729-4731)GCA>TCA	p.A1577S	COL11A1_uc001duk.2_Missense_Mutation_p.A761S|COL11A1_uc001dul.2_Missense_Mutation_p.A1565S|COL11A1_uc001dun.2_Missense_Mutation_p.A1526S|COL11A1_uc009weh.2_Missense_Mutation_p.A1449S	NM_080629	NP_542196	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform B	1565					collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|central_nervous_system(1)|pancreas(1)	11		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)										0.148148	27.622439	40.462532	16	92	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	103352528	103352528	3805	1	C	A	A	A	325	25	COL11A1	2	2
NTRK1	4914	broad.mit.edu	37	1	156849038	156849038	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:156849038C>A	uc001fqh.1	+	c.1930C>A	c.(1930-1932)CTG>ATG	p.L644M	NTRK1_uc001fqf.1_Missense_Mutation_p.L608M|NTRK1_uc009wsi.1_Missense_Mutation_p.L343M|NTRK1_uc001fqi.1_Missense_Mutation_p.L638M|NTRK1_uc009wsk.1_Missense_Mutation_p.L641M	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	644	Cytoplasmic (Potential).|Protein kinase.				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|stomach(1)|central_nervous_system(1)	16	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)					290	TSP Lung(10;0.080)			0.254902	27.136079	29.929455	13	38	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	156849038	156849038	11111	1	C	A	A	A	415	32	NTRK1	2	2
CD1A	909	broad.mit.edu	37	1	158226831	158226831	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:158226831G>T	uc001frt.2	+	c.860G>T	c.(859-861)GGC>GTC	p.G287V		NM_001763	NP_001754	P06126	CD1A_HUMAN	CD1A antigen precursor	287	Extracellular (Potential).|Ig-like.				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex				pancreas(2)	2	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)									0.307692	85.767535	89.192719	32	72	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	158226831	158226831	3101	1	G	T	T	T	546	42	CD1A	2	2
SEC16B	89866	broad.mit.edu	37	1	177911130	177911130	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:177911130C>T	uc001glj.1	-	c.1930G>A	c.(1930-1932)GTG>ATG	p.V644M	SEC16B_uc001glk.1_Missense_Mutation_p.V320M|SEC16B_uc009wwy.1_Missense_Mutation_p.V198M|SEC16B_uc001glh.1_Missense_Mutation_p.V302M|SEC16B_uc009wwz.1_Missense_Mutation_p.V302M|SEC16B_uc001gli.1_Missense_Mutation_p.V643M	NM_033127	NP_149118	Q96JE7	SC16B_HUMAN	leucine zipper transcription regulator 2	643					protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane				ovary(3)|central_nervous_system(1)	4														0.343284	60.109347	61.560573	23	44	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	177911130	177911130	14473	1	C	T	T	T	247	19	SEC16B	1	1
TOR1AIP2	163590	broad.mit.edu	37	1	179820234	179820234	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:179820234C>A	uc001gnk.2	-	c.299G>T	c.(298-300)GGG>GTG	p.G100V	TOR1AIP2_uc001gnl.2_Missense_Mutation_p.G100V	NM_145034	NP_659471	Q8NFQ8	TOIP2_HUMAN	torsin A interacting protein 2	100						endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1														0.290541	109.477109	115.288504	43	105	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	179820234	179820234	16915	1	C	A	A	A	286	22	TOR1AIP2	2	2
CACNA1E	777	broad.mit.edu	37	1	181745281	181745281	+	Nonsense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:181745281C>A	uc001gow.2	+	c.5184C>A	c.(5182-5184)TAC>TAA	p.Y1728*	CACNA1E_uc009wxs.2_Nonsense_Mutation_p.Y1616*|CACNA1E_uc001gox.1_Nonsense_Mutation_p.Y954*|CACNA1E_uc009wxt.2_Nonsense_Mutation_p.Y954*	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1728	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6														0.136986	55.731013	92.956047	40	252	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	181745281	181745281	2658	1	C	A	A	A	233	18	CACNA1E	5	2
CRB1	23418	broad.mit.edu	37	1	197390454	197390454	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:197390454G>T	uc001gtz.2	+	c.1496G>T	c.(1495-1497)GGC>GTC	p.G499V	CRB1_uc010poz.1_Missense_Mutation_p.G430V|CRB1_uc010ppa.1_Non-coding_Transcript|CRB1_uc009wza.2_Missense_Mutation_p.G387V|CRB1_uc010ppb.1_Missense_Mutation_p.G499V|CRB1_uc010ppc.1_Non-coding_Transcript|CRB1_uc010ppd.1_5'UTR|CRB1_uc001gub.1_Missense_Mutation_p.G148V	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	499	Extracellular (Potential).|Laminin G-like 1.				cell-cell signaling|establishment or maintenance of cell polarity|response to stimulus|visual perception	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|large_intestine(1)	6														0.372093	89.774938	91.011976	32	54	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	197390454	197390454	3987	1	G	T	T	T	546	42	CRB1	2	2
TMEM9	252839	broad.mit.edu	37	1	201120964	201120964	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:201120964C>T	uc010ppo.1	-	c.158G>A	c.(157-159)CGG>CAG	p.R53Q	TMEM9_uc001gvw.2_Missense_Mutation_p.R28Q|TMEM9_uc001gvx.2_Missense_Mutation_p.R28Q|TMEM9_uc001gvy.2_Missense_Mutation_p.R28Q|TMEM9_uc001gvz.2_Missense_Mutation_p.R31Q|TMEM9_uc001gwa.2_Missense_Mutation_p.R28Q|TMEM9_uc010ppp.1_Missense_Mutation_p.R28Q	NM_016456	NP_057540	Q9P0T7	TMEM9_HUMAN	transmembrane protein 9 precursor	28	Extracellular (Potential).				transport	integral to membrane|late endosome membrane|lysosomal membrane					0		Breast(1374;0.000301)												0.057778	-17.596695	28.53973	13	212	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	201120964	201120964	16757	1	C	T	T	T	299	23	TMEM9	1	1
PLEKHA6	22874	broad.mit.edu	37	1	204237400	204237400	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:204237400C>T	uc001hau.2	-	c.143G>A	c.(142-144)CGC>CAC	p.R48H		NM_014935	NP_055750	Q9Y2H5	PKHA6_HUMAN	phosphoinositol 3-phosphate-binding protein-3	48										ovary(2)|pancreas(1)	3	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)											0.304878	64.747306	67.53135	25	57	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	204237400	204237400	12486	1	C	T	T	T	351	27	PLEKHA6	1	1
USH2A	7399	broad.mit.edu	37	1	216051157	216051157	+	Missense_Mutation	SNP	C	A	A	rs12118814	byFrequency;by1000genomes	TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:216051157C>A	uc001hku.1	-	c.8624G>T	c.(8623-8625)CGG>CTG	p.R2875L		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2875	Extracellular (Potential).|Fibronectin type-III 15.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|kidney(1)|central_nervous_system(1)	22				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)										0.148649	85.10691	120.168909	44	252	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	216051157	216051157	17598	1	C	A	A	A	299	23	USH2A	1	1
USH2A	7399	broad.mit.edu	37	1	216497577	216497577	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:216497577C>A	uc001hku.1	-	c.1261G>T	c.(1261-1263)GCT>TCT	p.A421S	USH2A_uc001hkv.2_Missense_Mutation_p.A421S	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	421	Laminin N-terminal.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|kidney(1)|central_nervous_system(1)	22				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)										0.133333	5.877654	9.793719	4	26	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	216497577	216497577	17598	1	C	A	A	A	325	25	USH2A	2	2
OBSCN	84033	broad.mit.edu	37	1	228565299	228565299	+	Missense_Mutation	SNP	A	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:228565299A>G	uc009xez.1	+	c.23389A>G	c.(23389-23391)ATG>GTG	p.M7797V	OBSCN_uc001hsr.1_Missense_Mutation_p.M2426V	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	7797	Protein kinase 2.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			large_intestine(7)|breast(5)|ovary(4)|skin(2)|stomach(1)|central_nervous_system(1)|pancreas(1)	21		Prostate(94;0.0405)								4006				0.173333	27.030401	34.58608	13	62	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	228565299	228565299	11217	1	A	G	G	G	104	8	OBSCN	4	4
TRIM67	440730	broad.mit.edu	37	1	231349585	231349585	+	Silent	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:231349585G>A	uc009xfn.1	+	c.2148G>A	c.(2146-2148)GGG>GGA	p.G716G		NM_001004342	NP_001004342	Q6ZTA4	TRI67_HUMAN	tripartite motif-containing 67	716	B30.2/SPRY.					cytoplasm|cytoskeleton	zinc ion binding			ovary(2)|breast(1)|kidney(1)	4	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)								1001				0.131868	33.923992	57.8526	24	158	KEEP	---	---	---	---	capture		Silent	SNP	231349585	231349585	17089	1	G	A	A	A	548	43	TRIM67	2	2
PCNXL2	80003	broad.mit.edu	37	1	233344406	233344406	+	Missense_Mutation	SNP	T	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:233344406T>A	uc001hvl.2	-	c.2721A>T	c.(2719-2721)AGA>AGT	p.R907S	PCNXL2_uc009xfu.2_Non-coding_Transcript|PCNXL2_uc001hvp.1_Non-coding_Transcript|PCNXL2_uc009xfv.1_Non-coding_Transcript|PCNXL2_uc001hvq.1_Missense_Mutation_p.R206S	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	907	Helical; (Potential).					integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)												0.155844	21.754499	30.459621	12	65	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	233344406	233344406	12012	1	T	A	A	A	751	58	PCNXL2	3	3
RYR2	6262	broad.mit.edu	37	1	237813354	237813354	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:237813354G>T	uc001hyl.1	+	c.7690G>T	c.(7690-7692)GCT>TCT	p.A2564S		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2564	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)											0.246696	138.547964	151.766954	56	171	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	237813354	237813354	14249	1	G	T	T	T	442	34	RYR2	2	2
FMN2	56776	broad.mit.edu	37	1	240371509	240371509	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:240371509C>A	uc010pye.1	+	c.3409C>A	c.(3409-3411)CCC>ACC	p.P1137T	FMN2_uc010pyd.1_Missense_Mutation_p.P1133T	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1133	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|large_intestine(1)|central_nervous_system(1)	9	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)							1289				0.285714	13.242811	14.107608	6	15	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	240371509	240371509	6192	1	C	A	A	A	390	30	FMN2	2	2
ACTRT2	140625	broad.mit.edu	37	1	2939237	2939237	+	Silent	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:2939237C>A	uc001ajz.2	+	c.987C>A	c.(985-987)ATC>ATA	p.I329I		NM_080431	NP_536356	Q8TDY3	ACTT2_HUMAN	actin-related protein M2	329						cytoplasm|cytoskeleton					0	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)										0.242718	54.610642	60.839349	25	78	KEEP	---	---	---	---	capture		Silent	SNP	2939237	2939237	220	1	C	A	A	A	369	29	ACTRT2	2	2
ELTD1	64123	broad.mit.edu	37	1	79357333	79357333	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:79357333G>A	uc001diq.3	-	c.1886C>T	c.(1885-1887)ACC>ATC	p.T629I		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	629	Helical; Name=6; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)	1				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)										0.175	14.301488	18.285939	7	33	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	79357333	79357333	5276	1	G	A	A	A	572	44	ELTD1	2	2
DNTTIP2	30836	broad.mit.edu	37	1	94342195	94342195	+	Silent	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:94342195G>A	uc001dqf.2	-	c.1296C>T	c.(1294-1296)AAC>AAT	p.N432N	DNTTIP2_uc010otm.1_Non-coding_Transcript|DNTTIP2_uc009wdo.1_Silent_p.N227N	NM_014597	NP_055412	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal,	432					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)										0.198582	114.621993	138.484886	56	226	KEEP	---	---	---	---	capture		Silent	SNP	94342195	94342195	4865	1	G	A	A	A	620	48	DNTTIP2	2	2
RIMS4	140730	broad.mit.edu	37	20	43438829	43438829	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:43438829G>T	uc010ggu.2	-	c.84C>A	c.(82-84)GAC>GAA	p.D28E	RIMS4_uc002xms.2_Missense_Mutation_p.D28E	NM_182970	NP_892015	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	28					exocytosis|neurotransmitter transport	cell junction|synapse				ovary(4)|central_nervous_system(1)	5		Myeloproliferative disorder(115;0.0122)												0.25	8.592325	9.50186	4	12	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43438829	43438829	13847	20	G	T	T	T	516	40	RIMS4	1	1
CYP24A1	1591	broad.mit.edu	37	20	52781004	52781004	+	Silent	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:52781004G>T	uc002xwv.2	-	c.831C>A	c.(829-831)ACC>ACA	p.T277T	CYP24A1_uc002xwu.1_Silent_p.T135T|CYP24A1_uc002xww.2_Silent_p.T277T	NM_000782	NP_000773	Q07973	CP24A_HUMAN	cytochrome P450 family 24 subfamily A	277					hormone biosynthetic process|osteoblast differentiation|oxidation-reduction process|vitamin D catabolic process|vitamin D receptor signaling pathway|xenobiotic metabolic process	mitochondrial inner membrane	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity|electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen			ovary(1)|lung(1)	2	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcitriol(DB00136)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)					1427				0.233918	93.505018	104.590475	40	131	KEEP	---	---	---	---	capture		Silent	SNP	52781004	52781004	4319	20	G	T	T	T	600	47	CYP24A1	2	2
TAF4	6874	broad.mit.edu	37	20	60575636	60575636	+	Silent	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:60575636C>A	uc002ybs.2	-	c.2628G>T	c.(2626-2628)GCG>GCT	p.A876A		NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4	876					interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|general RNA polymerase II transcription factor activity|protein binding|sequence-specific DNA binding transcription factor activity|transcription activator activity|transcription coactivator activity|transcription initiation factor activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)											0.186364	93.707552	113.935796	41	179	KEEP	---	---	---	---	capture		Silent	SNP	60575636	60575636	16047	20	C	A	A	A	340	27	TAF4	1	1
TMPRSS15	5651	broad.mit.edu	37	21	19713778	19713778	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:19713778G>T	uc002ykw.2	-	c.1516C>A	c.(1516-1518)CTT>ATT	p.L506I		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	506	Extracellular (Potential).				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|breast(1)	6														0.19469	42.572679	52.411382	22	91	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	19713778	19713778	16787	21	G	T	T	T	429	33	TMPRSS15	2	2
GRIK1	2897	broad.mit.edu	37	21	31311771	31311771	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:31311771G>T	uc011acs.1	-	c.48C>A	c.(46-48)GAC>GAA	p.D16E	GRIK1_uc002ynn.2_Missense_Mutation_p.D16E|GRIK1_uc011act.1_Missense_Mutation_p.D16E|GRIK1_uc002yno.1_Missense_Mutation_p.D16E|GRIK1_uc010glq.1_Missense_Mutation_p.D16E|GRIK1_uc002ynr.2_Missense_Mutation_p.D16E	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	16					central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|Topiramate(DB00273)					608				0.384615	29.142856	29.446633	10	16	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	31311771	31311771	7052	21	G	T	T	T	620	48	GRIK1	2	2
KRTAP10-4	386672	broad.mit.edu	37	21	45993646	45993646	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:45993646G>A	uc002zfk.1	+	c.11G>A	c.(10-12)TGC>TAC	p.C4Y	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198687	NP_941960	P60372	KR104_HUMAN	keratin associated protein 10-4	4						keratin filament					0														0.196262	39.203118	48.416342	21	86	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	45993646	45993646	8826	21	G	A	A	A	598	46	KRTAP10-4	2	2
CCT8L2	150160	broad.mit.edu	37	22	17072423	17072423	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:17072423G>T	uc002zlp.1	-	c.1018C>A	c.(1018-1020)CCT>ACT	p.P340T		NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN	T-complex protein 1	340					cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity			ovary(1)	1	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)												0.084577	-3.729204	31.454888	17	184	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	17072423	17072423	3088	22	G	T	T	T	559	43	CCT8L2	2	2
MICAL3	57553	broad.mit.edu	37	22	18301821	18301821	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:18301821C>A	uc002zng.3	-	c.3606G>T	c.(3604-3606)TTG>TTT	p.L1202F	MICAL3_uc011agl.1_Missense_Mutation_p.L1118F	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin	1202	Pro-rich.				oxidation-reduction process	cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)										0.171429	12.056648	15.606234	6	29	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	18301821	18301821	9961	22	C	A	A	A	324	25	MICAL3	2	2
SNRPD3	6634	broad.mit.edu	37	22	24964111	24964111	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:24964111G>T	uc003aam.1	+	c.286G>T	c.(286-288)GGC>TGC	p.G96C	SNRPD3_uc011aju.1_Missense_Mutation_p.G96C	NM_004175	NP_004166	P62318	SMD3_HUMAN	small nuclear ribonucleoprotein polypeptide D3	96	Arg/Lys-rich (basic).				histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	enzyme binding|histone pre-mRNA DCP binding			ovary(1)	1														0.242424	34.958926	38.96248	16	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	24964111	24964111	15366	22	G	T	T	T	611	47	SNRPD3	2	2
HPS4	89781	broad.mit.edu	37	22	26860631	26860631	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:26860631C>A	uc003acl.2	-	c.965G>T	c.(964-966)AGG>ATG	p.R322M	HPS4_uc003aci.2_Missense_Mutation_p.R317M|HPS4_uc003acj.2_Missense_Mutation_p.R186M|HPS4_uc003ack.2_Missense_Mutation_p.R113M|HPS4_uc003acn.2_Missense_Mutation_p.R168M|HPS4_uc010gvd.1_Missense_Mutation_p.R340M|HPS4_uc003ach.2_Missense_Mutation_p.R57M	NM_022081	NP_071364	Q9NQG7	HPS4_HUMAN	light ear protein isoform a	322					lysosome organization|positive regulation of eye pigmentation|protein stabilization|protein targeting	lysosome|melanosome|membrane fraction|platelet dense granule	protein homodimerization activity				0														0.194444	43.510785	52.919303	21	87	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	26860631	26860631	7633	22	C	A	A	A	312	24	HPS4	2	2
SSTR3	6753	broad.mit.edu	37	22	37602771	37602771	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:37602771C>A	uc003ara.2	-	c.1072G>T	c.(1072-1074)GGG>TGG	p.G358W	SSTR3_uc003arb.2_Missense_Mutation_p.G358W	NM_001051	NP_001042	P32745	SSR3_HUMAN	somatostatin receptor 3	358	Cytoplasmic (Potential).|Glu-rich (acidic).				G-protein signaling, coupled to cyclic nucleotide second messenger|induction of apoptosis by hormones|negative regulation of cell proliferation	integral to plasma membrane|nonmotile primary cilium	somatostatin receptor activity				0														0.304348	56.045793	58.404328	21	48	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	37602771	37602771	15715	22	C	A	A	A	273	21	SSTR3	2	2
KCNJ4	3761	broad.mit.edu	37	22	38822911	38822911	+	Silent	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:38822911C>T	uc003avs.1	-	c.1227G>A	c.(1225-1227)GAG>GAA	p.E409E	KCNJ4_uc003avt.1_Silent_p.E409E	NM_004981	NP_004972	P48050	IRK4_HUMAN	potassium inwardly-rectifying channel J4	409	Cytoplasmic (By similarity).				synaptic transmission	basolateral plasma membrane|voltage-gated potassium channel complex	inward rectifier potassium channel activity|PDZ domain binding				0	Melanoma(58;0.0286)													0.144231	25.056125	37.730345	15	89	KEEP	---	---	---	---	capture		Silent	SNP	38822911	38822911	8358	22	C	T	T	T	311	24	KCNJ4	2	2
CPT1B	1375	broad.mit.edu	37	22	51012810	51012810	+	Silent	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:51012810C>T	uc003bmk.3	-	c.924G>A	c.(922-924)CAG>CAA	p.Q308Q	CPT1B_uc003bml.2_Silent_p.Q308Q|CPT1B_uc003bmm.2_Silent_p.Q308Q|CPT1B_uc003bmo.2_Silent_p.Q308Q|CPT1B_uc011asa.1_Silent_p.Q274Q|CPT1B_uc003bmn.2_Silent_p.Q308Q|CPT1B_uc011asb.1_Silent_p.Q308Q|CHKB-CPT1B_uc003bmp.2_Silent_p.Q105Q	NM_001145137	NP_001138609	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B isoform a	308	Cytoplasmic (Potential).				carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)	2		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		Esophageal Squamous(170;988 1933 25577 30295 48163)								0.153846	10.722456	15.192752	6	33	KEEP	---	---	---	---	capture		Silent	SNP	51012810	51012810	3971	22	C	T	T	T	415	32	CPT1B	2	2
FAM123C	205147	broad.mit.edu	37	2	131519874	131519874	+	Missense_Mutation	SNP	G	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:131519874G>C	uc002trw.2	+	c.229G>C	c.(229-231)GGA>CGA	p.G77R	FAM123C_uc010fmv.2_Missense_Mutation_p.G77R|FAM123C_uc010fms.1_Missense_Mutation_p.G77R|FAM123C_uc010fmt.1_Missense_Mutation_p.G77R|FAM123C_uc010fmu.1_Missense_Mutation_p.G77R	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	77										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)										0.142857	4.513662	7.092791	3	18	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	131519874	131519874	5621	2	G	C	C	C	559	43	FAM123C	3	3
LCT	3938	broad.mit.edu	37	2	136566318	136566318	+	Missense_Mutation	SNP	G	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:136566318G>C	uc002tuu.1	-	c.3599C>G	c.(3598-3600)ACG>AGG	p.T1200R		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1200	3.|Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|lung(1)|pancreas(1)	11				BRCA - Breast invasive adenocarcinoma(221;0.169)										0.183099	96.386185	116.48711	39	174	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	136566318	136566318	9017	2	G	C	C	C	520	40	LCT	3	3
LRP1B	53353	broad.mit.edu	37	2	141751656	141751656	+	Missense_Mutation	SNP	C	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:141751656C>G	uc002tvj.1	-	c.2552G>C	c.(2551-2553)CGC>CCC	p.R851P	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	851	Extracellular (Potential).|LDL-receptor class A 3.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|ovary(10)|pancreas(3)|central_nervous_system(2)|liver(1)|kidney(1)	34		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		Colon(99;50 2074 2507 20106)				2546	TSP Lung(27;0.18)			0.174312	46.456678	57.369719	19	90	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	141751656	141751656	9328	2	C	G	G	G	351	27	LRP1B	3	3
ORC4L	5000	broad.mit.edu	37	2	148715893	148715893	+	Nonsense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:148715893C>A	uc002twi.2	-	c.361G>T	c.(361-363)GAA>TAA	p.E121*	ORC4L_uc002twj.2_Nonsense_Mutation_p.E121*|ORC4L_uc010zbo.1_Nonsense_Mutation_p.E47*|ORC4L_uc010zbp.1_5'UTR|ORC4L_uc010fnr.2_Nonsense_Mutation_p.E121*|ORC4L_uc010zbq.1_Nonsense_Mutation_p.E37*|ORC4L_uc002twk.2_Nonsense_Mutation_p.E121*|ORC4L_uc010zbr.1_Nonsense_Mutation_p.E121*	NM_181741	NP_859525	O43929	ORC4_HUMAN	origin recognition complex subunit 4	121					cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|nucleoside-triphosphatase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.0963)|COAD - Colon adenocarcinoma(177;0.203)										0.222222	13.333953	15.2519	6	21	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	148715893	148715893	11675	2	C	A	A	A	390	30	ORC4L	5	2
CHRNA1	1134	broad.mit.edu	37	2	175624091	175624091	+	Nonsense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:175624091G>A	uc002ujd.2	-	c.202C>T	c.(202-204)CAG>TAG	p.Q68*	CHRNA1_uc002uje.2_Nonsense_Mutation_p.Q68*|CHRNA1_uc002ujf.3_Nonsense_Mutation_p.Q68*	NM_001039523	NP_001034612	P02708	ACHA_HUMAN	nicotinic cholinergic receptor alpha 1 isoform a	68	Extracellular.				muscle cell homeostasis|neuromuscular junction development|neuromuscular process|neuromuscular synaptic transmission|neuron homeostasis|regulation of action potential in neuron|skeletal muscle contraction|skeletal muscle tissue growth	cell junction|cell surface|neuromuscular junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(2)|central_nervous_system(1)	3														0.192308	58.741602	72.556662	30	126	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	175624091	175624091	3515	2	G	A	A	A	585	45	CHRNA1	5	2
TTC30B	150737	broad.mit.edu	37	2	178417000	178417000	+	Silent	SNP	G	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:178417000G>C	uc002uln.2	-	c.492C>G	c.(490-492)CTC>CTG	p.L164L	TTC30B_uc010zfc.1_5'UTR	NM_152517	NP_689730	Q8N4P2	TT30B_HUMAN	tetratricopeptide repeat domain 30B	164	TPR 3.				cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)											0.028446	-82.054804	29.853853	13	444	KEEP	---	---	---	---	capture		Silent	SNP	178417000	178417000	17254	2	G	C	C	C	418	33	TTC30B	3	3
TTN	7273	broad.mit.edu	37	2	179650354	179650354	+	Missense_Mutation	SNP	C	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:179650354C>G	uc010zfg.1	-	c.2486G>C	c.(2485-2487)GGA>GCA	p.G829A	TTN_uc010zfh.1_Missense_Mutation_p.G783A|TTN_uc010zfi.1_Missense_Mutation_p.G783A|TTN_uc010zfj.1_Missense_Mutation_p.G783A|TTN_uc002unb.2_Missense_Mutation_p.G829A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	829										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)							8722				0.240506	60.28506	65.138812	19	60	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	179650354	179650354	17290	2	C	G	G	G	390	30	TTN	3	3
ICA1L	130026	broad.mit.edu	37	2	203686132	203686132	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:203686132C>T	uc002uzh.1	-	c.308G>A	c.(307-309)GGC>GAC	p.G103D	ICA1L_uc002uzi.1_Missense_Mutation_p.G103D|ICA1L_uc002uzj.2_Missense_Mutation_p.G103D	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like isoform 1	103	AH.										0														0.219858	74.643701	84.83838	31	110	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	203686132	203686132	7778	2	C	T	T	T	338	26	ICA1L	2	2
CPS1	1373	broad.mit.edu	37	2	211459298	211459298	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:211459298C>T	uc010fur.2	+	c.1249C>T	c.(1249-1251)CCG>TCG	p.P417S	CPS1_uc002vee.3_Missense_Mutation_p.P411S|CPS1_uc010fus.2_5'UTR	NM_001122633	NP_001116105	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform a	411					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)	12				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)										0.179487	14.205448	17.971524	7	32	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	211459298	211459298	3961	2	C	T	T	T	234	18	CPS1	2	2
VIL1	7429	broad.mit.edu	37	2	219296603	219296603	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:219296603G>A	uc002via.2	+	c.1126G>A	c.(1126-1128)GAT>AAT	p.D376N	VIL1_uc010zke.1_Missense_Mutation_p.D65N|VIL1_uc002vib.2_Missense_Mutation_p.D376N	NM_007127	NP_009058	P09327	VILI_HUMAN	villin 1	376	Core.				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.230769	22.056243	24.645749	9	30	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	219296603	219296603	17731	2	G	A	A	A	481	37	VIL1	1	1
NGEF	25791	broad.mit.edu	37	2	233785096	233785096	+	Silent	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:233785096G>A	uc002vts.2	-	c.726C>T	c.(724-726)CTC>CTT	p.L242L	NGEF_uc010fyg.1_Silent_p.L150L|NGEF_uc002vtt.2_Silent_p.L150L	NM_019850	NP_062824	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	242	Regulatory region; modulates activity toward RHOA, RAC1 and CDC42 (By similarity).				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|growth cone|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)|skin(1)	7		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)										0.0625	-8.133404	11.035689	6	90	KEEP	---	---	---	---	capture		Silent	SNP	233785096	233785096	10794	2	G	A	A	A	574	45	NGEF	2	2
LCLAT1	253558	broad.mit.edu	37	2	30863299	30863299	+	Missense_Mutation	SNP	G	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:30863299G>C	uc002rnj.2	+	c.1059G>C	c.(1057-1059)TGG>TGC	p.W353C	LCLAT1_uc010ymp.1_Missense_Mutation_p.W191C|LCLAT1_uc002rnl.2_Missense_Mutation_p.W315C|LCLAT1_uc010ymq.1_Missense_Mutation_p.W315C	NM_182551	NP_872357	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1 isoform 1	353	Helical; (Potential).				multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			ovary(2)	2														0.244019	159.317695	171.798331	51	158	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	30863299	30863299	9001	2	G	C	C	C	533	41	LCLAT1	3	3
THADA	63892	broad.mit.edu	37	2	43801837	43801837	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:43801837G>A	uc002rsw.3	-	c.1367C>T	c.(1366-1368)ACG>ATG	p.T456M	THADA_uc002rsx.3_Missense_Mutation_p.T456M|THADA_uc002rsy.3_Non-coding_Transcript|THADA_uc010fas.1_Non-coding_Transcript|THADA_uc002rsz.2_Missense_Mutation_p.T166M|THADA_uc002rta.2_Missense_Mutation_p.T166M|THADA_uc002rtb.1_Missense_Mutation_p.T456M|THADA_uc002rtc.3_Missense_Mutation_p.T456M|THADA_uc002rtd.2_Missense_Mutation_p.T456M	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	456							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)												0.24031	74.958862	82.90018	31	98	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43801837	43801837	16368	2	G	A	A	A	520	40	THADA	1	1
LRPPRC	10128	broad.mit.edu	37	2	44204416	44204416	+	Splice_Site_SNP	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:44204416C>A	uc002rtr.2	-	c.470_splice	c.e4-1	p.G157_splice	LRPPRC_uc010yob.1_Splice_Site_SNP_p.G57_splice|LRPPRC_uc010faw.1_Splice_Site_SNP_p.G131_splice	NM_133259	NP_573566			leucine-rich PPR motif-containing protein						mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)	2		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)												0.166667	7.883418	10.412901	4	20	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	44204416	44204416	9338	2	C	A	A	A	312	24	LRPPRC	5	2
LRRTM4	80059	broad.mit.edu	37	2	77746912	77746912	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:77746912G>T	uc002snr.2	-	c.83C>A	c.(82-84)ACG>AAG	p.T28K	LRRTM4_uc002snq.2_Missense_Mutation_p.T28K|LRRTM4_uc002sns.2_Missense_Mutation_p.T28K|LRRTM4_uc002snt.2_Missense_Mutation_p.T29K	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	28						integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)										0.27907	34.881348	36.768994	12	31	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	77746912	77746912	9418	2	G	T	T	T	520	40	LRRTM4	1	1
RETSAT	54884	broad.mit.edu	37	2	85571154	85571154	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:85571154C>A	uc002spd.2	-	c.1501G>T	c.(1501-1503)GTC>TTC	p.V501F	RETSAT_uc010fge.2_Intron|RETSAT_uc010ysm.1_Missense_Mutation_p.V440F|RETSAT_uc010fgf.2_Missense_Mutation_p.V292F	NM_017750	NP_060220	Q6NUM9	RETST_HUMAN	all-trans-13,14-dihydroretinol saturase	501					oxidation-reduction process|retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity			ovary(1)	1					Vitamin A(DB00162)									0.201878	97.455037	115.008179	43	170	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	85571154	85571154	13708	2	C	A	A	A	234	18	RETSAT	2	2
SENP7	57337	broad.mit.edu	37	3	101047372	101047372	+	Silent	SNP	T	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:101047372T>A	uc003dut.2	-	c.2814A>T	c.(2812-2814)CTA>CTT	p.L938L	SENP7_uc003duu.2_Silent_p.L873L|SENP7_uc003duv.2_Silent_p.L905L|SENP7_uc003duw.2_Silent_p.L872L|SENP7_uc003dux.2_Silent_p.L774L|SENP7_uc003dus.2_Silent_p.L126L	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1	938	Protease.				proteolysis	nucleus	cysteine-type peptidase activity			ovary(2)|lung(1)	3														0.149425	23.520379	33.772743	13	74	KEEP	---	---	---	---	capture		Silent	SNP	101047372	101047372	14537	3	T	A	A	A	678	53	SENP7	3	3
CASR	846	broad.mit.edu	37	3	122002643	122002643	+	Silent	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:122002643C>T	uc003eew.3	+	c.1872C>T	c.(1870-1872)ATC>ATT	p.I624I	CASR_uc003eev.3_Silent_p.I614I	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	614	Helical; Name=1; (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)									0.210526	51.639432	60.476886	24	90	KEEP	---	---	---	---	capture		Silent	SNP	122002643	122002643	2801	3	C	T	T	T	395	31	CASR	1	1
PCOLCE2	26577	broad.mit.edu	37	3	142548567	142548567	+	Nonsense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:142548567G>A	uc003evd.2	-	c.832C>T	c.(832-834)CAG>TAG	p.Q278*		NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	278						extracellular region	collagen binding|heparin binding|peptidase activator activity			ovary(2)	2														0.165	52.336944	73.661889	33	167	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	142548567	142548567	12015	3	G	A	A	A	624	48	PCOLCE2	5	2
MED12L	116931	broad.mit.edu	37	3	151127077	151127077	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:151127077C>A	uc003eyp.2	+	c.5762C>A	c.(5761-5763)CCC>CAC	p.P1921H	MED12L_uc011bnz.1_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	1921	Gln-rich.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex	RNA polymerase II transcription mediator activity			ovary(4)|large_intestine(1)	5			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)							59				0.149351	28.350204	46.513436	23	131	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	151127077	151127077	9818	3	C	A	A	A	286	22	MED12L	2	2
MCF2L2	23101	broad.mit.edu	37	3	182897375	182897375	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:182897375C>T	uc003fli.1	-	c.3211G>A	c.(3211-3213)GAG>AAG	p.E1071K		NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor	1071					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(1)|breast(1)	4	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)											0.136364	18.23474	29.506721	12	76	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	182897375	182897375	9769	3	C	T	T	T	377	29	MCF2L2	2	2
LMLN	89782	broad.mit.edu	37	3	197707307	197707307	+	Silent	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:197707307C>T	uc010iar.2	+	c.660C>T	c.(658-660)ACC>ACT	p.T220T	LMLN_uc003fyt.2_Silent_p.T168T|LMLN_uc010ias.2_Silent_p.T168T|LMLN_uc011buo.1_Silent_p.T220T|LMLN_uc003fyu.2_5'UTR	NM_001136049	NP_001129521	Q96KR4	LMLN_HUMAN	leishmanolysin-like isoform 1	220					cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding				0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)										0.178771	69.767758	87.09463	32	147	KEEP	---	---	---	---	capture		Silent	SNP	197707307	197707307	9176	3	C	T	T	T	288	23	LMLN	1	1
CLASP2	23122	broad.mit.edu	37	3	33586292	33586292	+	Silent	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:33586292G>A	uc003cfu.2	-	c.3195C>T	c.(3193-3195)ACC>ACT	p.T1065T	CLASP2_uc003cfs.2_Silent_p.T272T|CLASP2_uc003cft.2_Non-coding_Transcript|CLASP2_uc010hgb.2_Non-coding_Transcript|CLASP2_uc011axt.1_Silent_p.T665T	NM_015097	NP_055912	O75122	CLAP2_HUMAN	CLIP-associating protein 2	853					axon guidance|cell division|establishment or maintenance of cell polarity|microtubule anchoring|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	cell cortex|condensed chromosome kinetochore|cytoplasmic microtubule|cytosol|kinetochore microtubule|microtubule organizing center|trans-Golgi network	galactoside 2-alpha-L-fucosyltransferase activity|microtubule plus-end binding			ovary(3)|central_nervous_system(1)	4														0.222222	15.681377	17.565518	6	21	KEEP	---	---	---	---	capture		Silent	SNP	33586292	33586292	3591	3	G	A	A	A	548	43	CLASP2	2	2
ATRIP	84126	broad.mit.edu	37	3	48501913	48501913	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:48501913G>A	uc003ctf.1	+	c.1460G>A	c.(1459-1461)TGC>TAC	p.C487Y	ATRIP_uc011bbj.1_Missense_Mutation_p.C360Y|ATRIP_uc003ctg.1_Missense_Mutation_p.C487Y|TREX1_uc010hjy.2_Intron	NM_130384	NP_569055	Q8WXE1	ATRIP_HUMAN	ATR interacting protein isoform 1	487					DNA damage checkpoint|DNA repair|DNA replication	nucleoplasm	protein binding|protein serine/threonine kinase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)										0.215278	62.751575	73.527792	31	113	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	48501913	48501913	1224	3	G	A	A	A	598	46	ATRIP	2	2
TLR9	54106	broad.mit.edu	37	3	52257313	52257313	+	Missense_Mutation	SNP	T	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:52257313T>G	uc003ddb.2	-	c.1310A>C	c.(1309-1311)AAC>ACC	p.N437T	TLR9_uc003dda.1_Missense_Mutation_p.N340T	NM_017442	NP_059138	Q9NR96	TLR9_HUMAN	toll-like receptor 9 isoform A precursor	340	LRR 11.|Extracellular (Potential).				defense response to bacterium|fibroblast growth factor receptor signaling pathway|I-kappaB phosphorylation|inflammatory response|innate immune response|insulin receptor signaling pathway|maintenance of gastrointestinal epithelium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of inflammatory response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of JNK cascade|positive regulation of JUN kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of tumor necrosis factor production|response to molecule of bacterial origin	apical plasma membrane|basolateral plasma membrane|early phagosome|endoplasmic reticulum membrane|endosome membrane|extracellular region|integral to membrane|lysosome	interleukin-1 receptor binding|siRNA binding|transmembrane receptor activity			large_intestine(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)					82				0.1875	58.519955	70.234717	24	104	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	52257313	52257313	16488	3	T	G	G	G	780	60	TLR9	4	4
PROS1	5627	broad.mit.edu	37	3	93624636	93624636	+	Missense_Mutation	SNP	T	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:93624636T>A	uc003drb.3	-	c.593A>T	c.(592-594)GAT>GTT	p.D198V	PROS1_uc010hoo.2_Missense_Mutation_p.D67V|PROS1_uc003dqz.3_Missense_Mutation_p.D67V	NM_000313	NP_000304	P07225	PROS_HUMAN	protein S, alpha preproprotein	198	EGF-like 2; calcium-binding (Potential).				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity			large_intestine(1)	1					Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)									0.271605	58.478141	62.318825	22	59	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	93624636	93624636	13001	3	T	A	A	A	650	50	PROS1	3	3
EPHA6	285220	broad.mit.edu	37	3	96706352	96706352	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:96706352G>T	uc010how.1	+	c.629G>T	c.(628-630)TGG>TTG	p.W210L	EPHA6_uc003drp.1_Missense_Mutation_p.W210L	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	115	Ephrin-binding.|Extracellular (Potential).				protein phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(3)|lung(3)|stomach(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	12										480				0.203704	49.183072	57.989331	22	86	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	96706352	96706352	5364	3	G	T	T	T	611	47	EPHA6	2	2
ADH7	131	broad.mit.edu	37	4	100340244	100340244	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:100340244C>A	uc003huv.1	-	c.896G>T	c.(895-897)GGG>GTG	p.G299V		NM_000673	NP_000664	P40394	ADH7_HUMAN	class IV alcohol dehydrogenase, mu or sigma	299					ethanol oxidation|fatty acid omega-oxidation|response to bacterium|response to ethanol|xenobiotic metabolic process	cytosol|soluble fraction	alcohol dehydrogenase activity, zinc-dependent|aldehyde oxidase activity|ethanol binding|receptor antagonist activity|retinol binding|retinol dehydrogenase activity			lung(2)	2				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)	NADH(DB00157)									0.488889	65.547551	65.552389	22	23	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	100340244	100340244	314	4	C	A	A	A	286	22	ADH7	2	2
SH3RF1	57630	broad.mit.edu	37	4	170017740	170017740	+	Missense_Mutation	SNP	C	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:170017740C>G	uc003isa.1	-	c.2597G>C	c.(2596-2598)TGG>TCG	p.W866S		NM_020870	NP_065921	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	866	SH3 4.					Golgi apparatus|lamellipodium|perinuclear region of cytoplasm	ligase activity|zinc ion binding			breast(1)	1		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)										0.072848	-2.866029	25.458084	11	140	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	170017740	170017740	14750	4	C	G	G	G	273	21	SH3RF1	3	3
VEGFC	7424	broad.mit.edu	37	4	177608435	177608435	+	Nonsense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:177608435G>A	uc003ius.1	-	c.1051C>T	c.(1051-1053)CAA>TAA	p.Q351*		NM_005429	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	351	4 X 16 AA repeats of C-X(10)-C-X-C- X(1,3)-C.|4.				angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity			lung(2)	2		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)						148				0.391509	479.348515	483.721072	166	258	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	177608435	177608435	17719	4	G	A	A	A	585	45	VEGFC	5	2
TECRL	253017	broad.mit.edu	37	4	65274940	65274940	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:65274940C>A	uc003hcv.2	-	c.130G>T	c.(130-132)GGC>TGC	p.G44C	TECRL_uc003hcw.2_Missense_Mutation_p.G44C	NM_001010874	NP_001010874	Q5HYJ1	TECRL_HUMAN	steroid 5 alpha-reductase 2-like 2	44					lipid metabolic process|oxidation-reduction process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors				0														0.367347	52.334977	53.09388	18	31	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	65274940	65274940	16273	4	C	A	A	A	286	22	TECRL	2	2
PPIP5K2	23262	broad.mit.edu	37	5	102522089	102522089	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:102522089G>T	uc003kod.3	+	c.3238G>T	c.(3238-3240)GAT>TAT	p.D1080Y	PPIP5K2_uc011cva.1_Non-coding_Transcript|PPIP5K2_uc003koe.2_Missense_Mutation_p.D1080Y|PPIP5K2_uc003kof.2_Intron	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1	1080					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity			ovary(1)	1														0.28169	48.065477	51.109457	20	51	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	102522089	102522089	12768	5	G	T	T	T	533	41	PPIP5K2	2	2
FNIP1	96459	broad.mit.edu	37	5	131008460	131008460	+	Silent	SNP	A	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:131008460A>G	uc003kvs.1	-	c.1677T>C	c.(1675-1677)GAT>GAC	p.D559D	RAPGEF6_uc003kvp.1_Intron|FNIP1_uc003kvt.1_Silent_p.D531D|FNIP1_uc010jdm.1_Silent_p.D514D	NM_133372	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1 isoform 1	559					regulation of protein phosphorylation	cytoplasm	protein binding			pancreas(1)	1		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)										0.07483	-1.281241	25.984082	11	136	KEEP	---	---	---	---	capture		Silent	SNP	131008460	131008460	6217	5	A	G	G	G	102	8	FNIP1	4	4
SLC22A4	6583	broad.mit.edu	37	5	131663013	131663013	+	Missense_Mutation	SNP	T	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:131663013T>C	uc003kwq.2	+	c.868T>C	c.(868-870)TTT>CTT	p.F290L	SLC22A4_uc010jdq.1_Non-coding_Transcript	NM_003059	NP_003050	Q9H015	S22A4_HUMAN	solute carrier family 22 member 4	290	Cytoplasmic (Potential).				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity				0		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)									0.234375	42.594097	46.724242	15	49	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	131663013	131663013	14953	5	T	C	C	C	676	52	SLC22A4	4	4
PCDHA3	56145	broad.mit.edu	37	5	140182645	140182645	+	Silent	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140182645G>A	uc003lhf.2	+	c.1863G>A	c.(1861-1863)CCG>CCA	p.P621P	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Silent_p.P621P	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	621	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(5)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.168421	24.135848	34.083725	16	79	KEEP	---	---	---	---	capture		Silent	SNP	140182645	140182645	11945	5	G	A	A	A	509	40	PCDHA3	1	1
PCDHB4	56131	broad.mit.edu	37	5	140503215	140503215	+	Silent	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140503215G>A	uc003lip.1	+	c.1635G>A	c.(1633-1635)CTG>CTA	p.L545L		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	545	Cadherin 5.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)											0.084211	1.041183	17.705797	8	87	KEEP	---	---	---	---	capture		Silent	SNP	140503215	140503215	11964	5	G	A	A	A	600	47	PCDHB4	2	2
PCDHGA1	56114	broad.mit.edu	37	5	140711965	140711965	+	Missense_Mutation	SNP	T	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140711965T>A	uc003lji.1	+	c.1714T>A	c.(1714-1716)TCT>ACT	p.S572T	PCDHGA1_uc011dan.1_Missense_Mutation_p.S572T	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	572	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.273092	153.815814	165.359166	68	181	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140711965	140711965	11970	5	T	A	A	A	806	62	PCDHGA1	3	3
PCDHGB5	56101	broad.mit.edu	37	5	140778496	140778496	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140778496G>T	uc003lkf.1	+	c.802G>T	c.(802-804)GAC>TAC	p.D268Y	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Missense_Mutation_p.D268Y	NM_018925	NP_061748	Q9Y5G0	PCDGH_HUMAN	protocadherin gamma subfamily B, 5 isoform 1	268	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.238095	92.105822	102.640627	40	128	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140778496	140778496	11986	5	G	T	T	T	585	45	PCDHGB5	2	2
FAM105B	90268	broad.mit.edu	37	5	14693081	14693081	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:14693081C>T	uc003jfk.2	+	c.983C>T	c.(982-984)CCA>CTA	p.P328L		NM_138348	NP_612357	Q96BN8	F105B_HUMAN	hypothetical protein LOC90268	328										ovary(2)	2	Lung NSC(4;0.00696)													0.285714	54.41242	57.589116	22	55	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	14693081	14693081	5585	5	C	T	T	T	273	21	FAM105B	2	2
LARP1	23367	broad.mit.edu	37	5	154181956	154181956	+	Missense_Mutation	SNP	C	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:154181956C>G	uc003lvp.2	+	c.2106C>G	c.(2104-2106)ATC>ATG	p.I702M	LARP1_uc003lvo.2_Missense_Mutation_p.I625M|LARP1_uc010jie.1_Missense_Mutation_p.I497M	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	la related protein isoform 2	702							protein binding|RNA binding			ovary(2)|pancreas(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)											0.053333	-4.759547	11.027912	4	71	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	154181956	154181956	8951	5	C	G	G	G	369	29	LARP1	3	3
ZNF454	285676	broad.mit.edu	37	5	178392687	178392687	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:178392687G>T	uc003mjo.1	+	c.1282G>T	c.(1282-1284)GCC>TCC	p.A428S	ZNF454_uc010jkz.1_Missense_Mutation_p.A428S	NM_182594	NP_872400	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	428	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|lung(1)	2	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)										0.156863	27.326133	38.795798	16	86	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	178392687	178392687	18516	5	G	T	T	T	442	34	ZNF454	2	2
HTR1A	3350	broad.mit.edu	37	5	63256504	63256504	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:63256504C>T	uc011cqt.1	-	c.1043G>A	c.(1042-1044)GGC>GAC	p.G348D		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	348	Helical; Name=6; (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)									0.159204	52.17058	74.4397	32	169	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	63256504	63256504	7736	5	C	T	T	T	338	26	HTR1A	2	2
CWC27	10283	broad.mit.edu	37	5	64081315	64081315	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:64081315G>T	uc003jtn.1	+	c.404G>T	c.(403-405)GGG>GTG	p.G135V	CWC27_uc003jtl.2_Missense_Mutation_p.G135V|CWC27_uc003jtm.2_Missense_Mutation_p.G135V|CWC27_uc010iwt.1_Missense_Mutation_p.G135V	NM_005869	NP_005860	Q6UX04	CWC27_HUMAN	serologically defined colon cancer antigen 10	135	PPIase cyclophilin-type.				nuclear mRNA splicing, via spliceosome|protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity				0														0.121951	11.886453	23.371123	10	72	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	64081315	64081315	4230	5	G	T	T	T	559	43	CWC27	2	2
F2R	2149	broad.mit.edu	37	5	76028404	76028404	+	Silent	SNP	A	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:76028404A>T	uc003ken.3	+	c.354A>T	c.(352-354)CCA>CCT	p.P118P		NM_001992	NP_001983	P25116	PAR1_HUMAN	coagulation factor II receptor precursor	118	Helical; Name=1; (Potential).				activation of caspase activity|anatomical structure morphogenesis|connective tissue replacement involved in inflammatory response wound healing|negative regulation of cell proliferation|platelet activation|platelet dense granule organization|positive regulation of blood coagulation|positive regulation of cell migration|positive regulation of collagen biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of JAK-STAT cascade|positive regulation of MAPKKK cascade|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of transcription, DNA-dependent|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	caveola|extracellular region|Golgi apparatus|integral to plasma membrane|platelet dense tubular network	receptor binding|thrombin receptor activity			ovary(3)	3		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)									0.2	119.755921	141.918313	53	212	KEEP	---	---	---	---	capture		Silent	SNP	76028404	76028404	5537	5	A	T	T	T	67	6	F2R	3	3
PHACTR1	221692	broad.mit.edu	37	6	13283719	13283719	+	Silent	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:13283719C>T	uc010jpc.2	+	c.1575C>T	c.(1573-1575)TAC>TAT	p.Y525Y	PHACTR1_uc003nah.1_Silent_p.Y525Y|TBC1D7_uc003naj.2_Intron|TBC1D7_uc011dis.1_Intron	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	525						cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)											0.158824	46.559226	65.38432	27	143	KEEP	---	---	---	---	capture		Silent	SNP	13283719	13283719	12232	6	C	T	T	T	246	19	PHACTR1	1	1
LPA	4018	broad.mit.edu	37	6	161071502	161071502	+	Missense_Mutation	SNP	T	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:161071502T>G	uc003qtl.2	-	c.77A>C	c.(76-78)CAG>CCG	p.Q26P		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	2534	Kringle 23.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|pancreas(1)	4		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)									0.309735	106.855481	110.517397	35	78	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	161071502	161071502	9276	6	T	G	G	G	715	55	LPA	4	4
KIF13A	63971	broad.mit.edu	37	6	17849677	17849677	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:17849677G>T	uc003ncg.3	-	c.761C>A	c.(760-762)GCG>GAG	p.A254E	KIF13A_uc003ncf.2_Missense_Mutation_p.A254E|KIF13A_uc003nch.3_Missense_Mutation_p.A254E|KIF13A_uc003nci.3_Missense_Mutation_p.A254E	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	254	Kinesin-motor.				cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)											0.173077	18.142023	23.391235	9	43	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	17849677	17849677	8585	6	G	T	T	T	494	38	KIF13A	1	1
SLC17A2	10246	broad.mit.edu	37	6	25921560	25921560	+	Silent	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:25921560G>T	uc003nfl.2	-	c.321C>A	c.(319-321)ATC>ATA	p.I107I	SLC17A2_uc011dkb.1_Silent_p.I107I|SLC17A2_uc011dkc.1_Silent_p.I107I	NM_005835	NP_005826	O00624	NPT3_HUMAN	solute carrier family 17 (sodium phosphate),	107	Helical; (Potential).				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			ovary(1)	1														0.372727	109.354104	110.915902	41	69	KEEP	---	---	---	---	capture		Silent	SNP	25921560	25921560	14913	6	G	T	T	T	525	41	SLC17A2	2	2
TRIM27	5987	broad.mit.edu	37	6	28872311	28872311	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:28872311C>A	uc003nlr.2	-	c.1078G>T	c.(1078-1080)GTC>TTC	p.V360F	TRIM27_uc003nls.2_Intron|TRIM27_uc003nlt.1_3'UTR	NM_006510	NP_006501	P14373	TRI27_HUMAN	ret finger protein	360	B30.2/SPRY.				cell proliferation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|protein trimerization|spermatogenesis|transcription, DNA-dependent	cytoplasm|integral to plasma membrane|membrane fraction|nuclear membrane|PML body	DNA binding|protein binding|transmembrane receptor protein tyrosine kinase activity|zinc ion binding			ovary(1)	1														0.320988	75.520309	77.826566	26	55	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	28872311	28872311	17045	6	C	A	A	A	221	17	TRIM27	2	2
BTNL2	56244	broad.mit.edu	37	6	32370728	32370728	+	Silent	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:32370728C>A	uc003obg.1	-	c.693G>T	c.(691-693)TCG>TCT	p.S231S	BTNL2_uc010jty.1_Intron|BTNL2_uc010jtz.1_Intron|BTNL2_uc010jua.1_Intron	NM_019602	NP_062548	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2	231	Ig-like V-type 2.|Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1														0.371429	36.263367	36.772563	13	22	KEEP	---	---	---	---	capture		Silent	SNP	32370728	32370728	1599	6	C	A	A	A	288	23	BTNL2	1	1
C7orf51	222950	broad.mit.edu	37	7	100086913	100086913	+	Silent	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:100086913G>T	uc003uvd.1	+	c.1569G>T	c.(1567-1569)GGG>GGT	p.G523G	C7orf51_uc003uve.1_Silent_p.G305G	NM_173564	NP_775835	Q6ZVC0	CG051_HUMAN	hypothetical protein FLJ37538	523											0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)													0.392857	26.909351	27.193408	11	17	KEEP	---	---	---	---	capture		Silent	SNP	100086913	100086913	2507	7	G	T	T	T	548	43	C7orf51	2	2
MUC17	140453	broad.mit.edu	37	7	100675478	100675478	+	Missense_Mutation	SNP	G	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:100675478G>C	uc003uxp.1	+	c.781G>C	c.(781-783)GAA>CAA	p.E261Q	MUC17_uc010lho.1_Non-coding_Transcript	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	261	Extracellular (Potential).|59 X approximate tandem repeats.|2.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|breast(3)|lung(2)	19	Lung NSC(181;0.136)|all_lung(186;0.182)													0.034722	-43.813215	24.018347	10	278	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	100675478	100675478	10368	7	G	C	C	C	585	45	MUC17	3	3
MUC17	140453	broad.mit.edu	37	7	100677522	100677522	+	Missense_Mutation	SNP	G	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:100677522G>C	uc003uxp.1	+	c.2825G>C	c.(2824-2826)AGA>ACA	p.R942T	MUC17_uc010lho.1_Non-coding_Transcript	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	942	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|13.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|breast(3)|lung(2)	19	Lung NSC(181;0.136)|all_lung(186;0.182)													0.050459	-64.658291	75.334307	33	621	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	100677522	100677522	10368	7	G	C	C	C	429	33	MUC17	3	3
RELN	5649	broad.mit.edu	37	7	103159823	103159823	+	Silent	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:103159823G>T	uc003vca.2	-	c.7809C>A	c.(7807-7809)GGC>GGA	p.G2603G	RELN_uc010liz.2_Silent_p.G2603G	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2603	BNR 12.				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|large_intestine(2)|central_nervous_system(2)|pancreas(1)|skin(1)	14				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		NSCLC(146;835 1944 15585 22231 52158)								0.441379	195.27812	195.712788	64	81	KEEP	---	---	---	---	capture		Silent	SNP	103159823	103159823	13689	7	G	T	T	T	587	46	RELN	2	2
RELN	5649	broad.mit.edu	37	7	103205942	103205942	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:103205942G>T	uc003vca.2	-	c.4993C>A	c.(4993-4995)CAG>AAG	p.Q1665K	RELN_uc010liz.2_Missense_Mutation_p.Q1665K	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	1665					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|large_intestine(2)|central_nervous_system(2)|pancreas(1)|skin(1)	14				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		NSCLC(146;835 1944 15585 22231 52158)								0.15625	17.20307	24.42917	10	54	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	103205942	103205942	13689	7	G	T	T	T	598	46	RELN	2	2
ORC5L	5001	broad.mit.edu	37	7	103844634	103844634	+	Missense_Mutation	SNP	T	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:103844634T>C	uc003vcb.2	-	c.121A>G	c.(121-123)AGT>GGT	p.S41G	ORC5L_uc011klp.1_5'UTR|ORC5L_uc003vcc.2_Missense_Mutation_p.S41G|ORC5L_uc003vcd.2_Missense_Mutation_p.S41G	NM_002553	NP_002544	O43913	ORC5_HUMAN	origin recognition complex subunit 5 isoform 1	41	ATP (Potential).				cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	cytoplasm|nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|identical protein binding				0														0.605263	87.433736	87.802583	23	15	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	103844634	103844634	11676	7	T	C	C	C	689	53	ORC5L	4	4
CPA2	1358	broad.mit.edu	37	7	129909536	129909536	+	Missense_Mutation	SNP	C	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:129909536C>G	uc003vpq.2	+	c.181C>G	c.(181-183)CCA>GCA	p.P61A	CPA2_uc011kpc.1_Missense_Mutation_p.P61A	NM_001869	NP_001860	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic) precursor	61					proteolysis|vacuolar protein catabolic process	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)	1	Melanoma(18;0.0435)													0.452703	216.106612	216.395194	67	81	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	129909536	129909536	3928	7	C	G	G	G	286	22	CPA2	3	3
GIMAP8	155038	broad.mit.edu	37	7	150164352	150164352	+	Missense_Mutation	SNP	T	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:150164352T>C	uc003whj.2	+	c.566T>C	c.(565-567)GTT>GCT	p.V189A		NM_175571	NP_783161	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	189						endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)										0.116279	54.66962	92.044889	30	228	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	150164352	150164352	6653	7	T	C	C	C	780	60	GIMAP8	4	4
PRKAG2	51422	broad.mit.edu	37	7	151372540	151372540	+	Missense_Mutation	SNP	A	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:151372540A>T	uc003wkk.2	-	c.650T>A	c.(649-651)CTG>CAG	p.L217Q	PRKAG2_uc011kvl.1_Missense_Mutation_p.L93Q|PRKAG2_uc003wkj.2_Missense_Mutation_p.L173Q|PRKAG2_uc010lqe.1_Non-coding_Transcript|PRKAG2_uc003wkm.1_Missense_Mutation_p.L217Q	NM_016203	NP_057287	Q9UGJ0	AAKG2_HUMAN	AMP-activated protein kinase gamma2 subunit	217					ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			kidney(1)	1	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)										0.404762	101.849198	102.510056	34	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	151372540	151372540	12944	7	A	T	T	T	91	7	PRKAG2	3	3
ABCB5	340273	broad.mit.edu	37	7	20778656	20778656	+	Missense_Mutation	SNP	T	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:20778656T>A	uc010kuh.2	+	c.2918T>A	c.(2917-2919)GTT>GAT	p.V973D	ABCB5_uc003suw.3_Missense_Mutation_p.V528D	NM_001163941	NP_001157413	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	528	Helical; (Potential).|ABC transmembrane type-1.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			large_intestine(1)|ovary(1)|pancreas(1)	3														0.421053	46.894189	47.100654	16	22	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20778656	20778656	45	7	T	A	A	A	780	60	ABCB5	3	3
BMPER	168667	broad.mit.edu	37	7	34118587	34118587	+	Silent	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:34118587G>A	uc011kap.1	+	c.1197G>A	c.(1195-1197)TCG>TCA	p.S399S		NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor	399	VWFD.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3														0.141176	64.313903	106.577298	48	292	KEEP	---	---	---	---	capture		Silent	SNP	34118587	34118587	1493	7	G	A	A	A	483	38	BMPER	1	1
ANLN	54443	broad.mit.edu	37	7	36478826	36478826	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:36478826C>A	uc003tff.2	+	c.2897C>A	c.(2896-2898)TCT>TAT	p.S966Y	ANLN_uc011kaz.1_Missense_Mutation_p.S878Y|ANLN_uc003tfg.2_Missense_Mutation_p.S929Y|ANLN_uc010kxe.2_Missense_Mutation_p.S928Y	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	966	Localization to the cleavage furrow.				cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3														0.037383	-17.098865	7.701706	4	103	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	36478826	36478826	702	7	C	A	A	A	416	32	ANLN	2	2
URGCP	55665	broad.mit.edu	37	7	43917045	43917045	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:43917045G>A	uc003tiw.2	-	c.2017C>T	c.(2017-2019)CGC>TGC	p.R673C	URGCP_uc003tiu.2_Missense_Mutation_p.R630C|URGCP_uc003tiv.2_Missense_Mutation_p.R598C|URGCP_uc003tix.2_Missense_Mutation_p.R664C|URGCP_uc003tiy.2_Missense_Mutation_p.R630C|URGCP_uc003tiz.2_Missense_Mutation_p.R630C|URGCP_uc011kbj.1_Missense_Mutation_p.R630C	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3	673					cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)	3														0.34375	92.569462	94.62853	33	63	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43917045	43917045	17588	7	G	A	A	A	507	39	URGCP	1	1
EGFR	1956	broad.mit.edu	37	7	55249071	55249071	+	Missense_Mutation	SNP	C	T	T	rs121434569		TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:55249071C>T	uc003tqk.2	+	c.2369C>T	c.(2368-2370)ACG>ATG	p.T790M	EGFR_uc010kzg.1_Missense_Mutation_p.T745M|EGFR_uc011kco.1_Missense_Mutation_p.T737M	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	790	Cytoplasmic (Potential).|Protein kinase.		T -> M (found in a lung cancer sample).		activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.T790M(291)|p.K745_E749del(8)|p.K745_A750del(4)|p.I789_L792del(1)|p.K745_L747del(1)		lung(8200)|central_nervous_system(103)|upper_aerodigestive_tract(37)|prostate(32)|ovary(31)|thyroid(23)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|stomach(6)|urinary_tract(6)|skin(5)|adrenal_gland(5)|kidney(4)|soft_tissue(4)|bone(3)|NS(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)|pancreas(1)	8515	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)		T790M(NCIH1975_LUNG)	8	p.T790M(NCIH1975-Tumor)	608	TCGA GBM(3;<1E-8)|TSP Lung(4;<1E-8)			0.521531	333.280095	333.364942	109	100	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55249071	55249071	5156	7	C	T	T	T	247	19	EGFR	1	1
EGFR	1956	broad.mit.edu	37	7	55259515	55259515	+	Missense_Mutation	SNP	T	G	G	rs121434568		TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:55259515T>G	uc003tqk.2	+	c.2573T>G	c.(2572-2574)CTG>CGG	p.L858R	EGFR_uc010kzg.1_Missense_Mutation_p.L813R|EGFR_uc011kco.1_Missense_Mutation_p.L805R	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	858	Cytoplasmic (Potential).|Protein kinase.		L -> R (found in a lung cancer sample; somatic mutation).|L -> M (found in a lung cancer sample).		activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.L858R(3084)|p.L858Q(3)|p.L858A(2)|p.L858W(1)|p.L858P(1)|p.L858L(1)|p.L858K(1)|p.L858G(1)|p.H805I(1)		lung(8200)|central_nervous_system(103)|upper_aerodigestive_tract(37)|prostate(32)|ovary(31)|thyroid(23)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|stomach(6)|urinary_tract(6)|skin(5)|adrenal_gland(5)|kidney(4)|soft_tissue(4)|bone(3)|NS(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)|pancreas(1)	8515	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)		L858R(NCIH1975_LUNG)	8		608	TCGA GBM(3;<1E-8)|TSP Lung(4;<1E-8)			0.417021	314.125045	315.5551	98	137	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55259515	55259515	5156	7	T	G	G	G	715	55	EGFR	4	4
ZNF680	340252	broad.mit.edu	37	7	63982254	63982254	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:63982254G>A	uc003tta.2	-	c.878C>T	c.(877-879)CCT>CTT	p.P293L	ZNF680_uc010kzr.2_Missense_Mutation_p.P220L	NM_178558	NP_848653	Q8NEM1	ZN680_HUMAN	zinc finger protein 680 isoform 1	293					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.118)|all_lung(88;0.243)												0.093023	2.965169	10.130529	4	39	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	63982254	63982254	18682	7	G	A	A	A	455	35	ZNF680	2	2
FKBP6	8468	broad.mit.edu	37	7	72744332	72744332	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:72744332G>T	uc003tya.2	+	c.445G>T	c.(445-447)GAC>TAC	p.D149Y	FKBP6_uc003twz.2_Intron|FKBP6_uc011kew.1_Missense_Mutation_p.D144Y|FKBP6_uc010lbe.1_Non-coding_Transcript|TRIM50_uc003txy.1_5'Flank|TRIM50_uc003txz.1_5'Flank	NM_003602	NP_003593	O75344	FKBP6_HUMAN	FK506 binding protein 6 isoform a	149					protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)												0.494624	128.809671	128.812454	46	47	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72744332	72744332	6150	7	G	T	T	T	429	33	FKBP6	2	2
COL28A1	340267	broad.mit.edu	37	7	7477083	7477083	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:7477083C>T	uc003src.1	-	c.1733G>A	c.(1732-1734)GGC>GAC	p.G578D	COL28A1_uc011jxe.1_Missense_Mutation_p.G261D|COL28A1_uc003srd.2_Missense_Mutation_p.G133D|COL28A1_uc003sre.1_5'UTR	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor	578	Collagen-like 5.				cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity				0		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)										0.452381	57.318757	57.401918	19	23	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	7477083	7477083	3824	7	C	T	T	T	338	26	COL28A1	2	2
COL28A1	340267	broad.mit.edu	37	7	7477086	7477086	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:7477086G>A	uc003src.1	-	c.1730C>T	c.(1729-1731)CCG>CTG	p.P577L	COL28A1_uc011jxe.1_Missense_Mutation_p.P260L|COL28A1_uc003srd.2_Missense_Mutation_p.P132L|COL28A1_uc003sre.1_5'UTR	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor	577	Collagen-like 5.				cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity				0		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)										0.439024	61.145726	61.2784	18	23	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	7477086	7477086	3824	7	G	A	A	A	507	39	COL28A1	1	1
RUNDC3B	154661	broad.mit.edu	37	7	87436744	87436744	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:87436744C>T	uc003ujb.2	+	c.1064C>T	c.(1063-1065)ACC>ATC	p.T355I	RUNDC3B_uc011khd.1_Missense_Mutation_p.T338I|RUNDC3B_uc011khe.1_Missense_Mutation_p.T338I|RUNDC3B_uc003ujc.2_Intron|RUNDC3B_uc003ujd.2_Intron	NM_138290	NP_612147	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B isoform a	355											0	Esophageal squamous(14;0.00164)													0.115385	17.93674	40.671064	18	138	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	87436744	87436744	14225	7	C	T	T	T	234	18	RUNDC3B	2	2
ADAM22	53616	broad.mit.edu	37	7	87780637	87780637	+	Splice_Site_SNP	SNP	T	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:87780637T>G	uc003ujp.1	+	c.1837_splice	c.e19+2	p.K613_splice	ADAM22_uc003ujk.1_Splice_Site_SNP_p.K561_splice|ADAM22_uc003ujl.1_Splice_Site_SNP_p.K561_splice|ADAM22_uc003ujn.2_Splice_Site_SNP_p.K561_splice|ADAM22_uc003ujm.2_Splice_Site_SNP_p.K561_splice|ADAM22_uc003ujo.2_Splice_Site_SNP_p.K561_splice	NM_004194	NP_004185			ADAM metallopeptidase domain 22 isoform 4						cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)							704				0.132867	40.537827	59.237261	19	124	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	87780637	87780637	245	7	T	G	G	G	741	57	ADAM22	5	4
ZNF804B	219578	broad.mit.edu	37	7	88965549	88965549	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:88965549G>T	uc011khi.1	+	c.3253G>T	c.(3253-3255)GTG>TTG	p.V1085L		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1085						intracellular	zinc ion binding			ovary(5)|pancreas(2)	7	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)											0.424779	151.283446	151.84083	48	65	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	88965549	88965549	18769	7	G	T	T	T	624	48	ZNF804B	2	2
CCDC132	55610	broad.mit.edu	37	7	92979331	92979331	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:92979331G>T	uc003umo.2	+	c.2449G>T	c.(2449-2451)GAT>TAT	p.D817Y	CCDC132_uc003umq.2_Non-coding_Transcript|CCDC132_uc003ump.2_Missense_Mutation_p.D787Y|CCDC132_uc003umr.2_Non-coding_Transcript|CCDC132_uc011khz.1_Missense_Mutation_p.D537Y	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	817											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)											0.104167	5.771949	20.749482	10	86	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	92979331	92979331	2887	7	G	T	T	T	429	33	CCDC132	2	2
EIF2C2	27161	broad.mit.edu	37	8	141595310	141595310	+	Missense_Mutation	SNP	C	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:141595310C>G	uc003yvn.2	-	c.123G>C	c.(121-123)CAG>CAC	p.Q41H	EIF2C2_uc010men.2_Intron|EIF2C2_uc010meo.2_Missense_Mutation_p.Q41H	NM_012154	NP_036286	Q9UKV8	AGO2_HUMAN	argonaute 2 isoform 1	41					mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-microRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)											0.234783	64.362229	71.766014	27	88	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	141595310	141595310	5195	8	C	G	G	G	311	24	EIF2C2	3	3
EXTL3	2137	broad.mit.edu	37	8	28600642	28600642	+	Missense_Mutation	SNP	A	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:28600642A>G	uc003xgz.1	+	c.2461A>G	c.(2461-2463)ATC>GTC	p.I821V		NM_001440	NP_001431	O43909	EXTL3_HUMAN	exostoses-like 3	821	Lumenal (Potential).					integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|metal ion binding|protein binding				0		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)										0.234463	221.25619	244.083567	83	271	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	28600642	28600642	5521	8	A	G	G	G	104	8	EXTL3	4	4
CSMD1	64478	broad.mit.edu	37	8	2944669	2944669	+	Missense_Mutation	SNP	C	G	G			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:2944669C>G	uc011kwk.1	-	c.7427G>C	c.(7426-7428)CGA>CCA	p.R2476P	CSMD1_uc011kwj.1_Missense_Mutation_p.R1805P|CSMD1_uc010lrg.2_Missense_Mutation_p.R544P	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2476	Sushi 14.|Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)										0.229508	43.519258	47.609987	14	47	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	2944669	2944669	4085	8	C	G	G	G	403	31	CSMD1	3	3
TEX15	56154	broad.mit.edu	37	8	30703484	30703484	+	Missense_Mutation	SNP	A	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:30703484A>T	uc003xil.2	-	c.3050T>A	c.(3049-3051)CTT>CAT	p.L1017H		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1017										ovary(3)	3				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)										0.171598	55.976994	73.200503	29	140	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	30703484	30703484	16306	8	A	T	T	T	39	3	TEX15	3	3
CSMD1	64478	broad.mit.edu	37	8	3265422	3265422	+	Silent	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:3265422G>T	uc011kwk.1	-	c.2073C>A	c.(2071-2073)ACC>ACA	p.T691T	CSMD1_uc011kwj.1_Silent_p.T83T	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	691	Extracellular (Potential).|CUB 4.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)										0.222222	8.889454	10.168033	4	14	KEEP	---	---	---	---	capture		Silent	SNP	3265422	3265422	4085	8	G	T	T	T	600	47	CSMD1	2	2
MYST3	7994	broad.mit.edu	37	8	41791382	41791382	+	Silent	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:41791382C>A	uc010lxb.2	-	c.4356G>T	c.(4354-4356)GCG>GCT	p.A1452A	MYST3_uc010lxc.2_Silent_p.A1452A|MYST3_uc003xon.3_Silent_p.A1452A	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	1452					histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription activator activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(3)|central_nervous_system(1)|pancreas(1)	5	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)							476				0.144509	41.49744	62.521087	25	148	KEEP	---	---	---	---	capture		Silent	SNP	41791382	41791382	10499	8	C	A	A	A	236	19	MYST3	1	1
KCNB2	9312	broad.mit.edu	37	8	73480430	73480430	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:73480430G>T	uc003xzb.2	+	c.461G>T	c.(460-462)CGA>CTA	p.R154L		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	154	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4	Breast(64;0.137)		Epithelial(68;0.105)											0.162896	70.664082	94.52981	36	185	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	73480430	73480430	8318	8	G	T	T	T	481	37	KCNB2	1	1
DCAF4L2	138009	broad.mit.edu	37	8	88885425	88885425	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:88885425C>A	uc003ydz.2	-	c.775G>T	c.(775-777)GGC>TGC	p.G259C		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	259										ovary(1)	1														0.230769	54.439497	61.353922	24	80	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	88885425	88885425	4443	8	C	A	A	A	312	24	DCAF4L2	2	2
MTERFD1	51001	broad.mit.edu	37	8	97270732	97270732	+	Missense_Mutation	SNP	T	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:97270732T>A	uc003yhs.1	-	c.187A>T	c.(187-189)ACT>TCT	p.T63S	MTERFD1_uc003yhr.1_5'Flank|MTERFD1_uc010mbd.1_Missense_Mutation_p.T63S	NM_015942	NP_057026	Q96E29	MTER1_HUMAN	MTERF domain containing 1 precursor	63					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion	promoter binding			ovary(1)	1	Breast(36;5.16e-05)													0.18254	46.051625	57.975397	23	103	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	97270732	97270732	10312	8	T	A	A	A	754	58	MTERFD1	3	3
C9orf72	203228	broad.mit.edu	37	9	27561628	27561628	+	Missense_Mutation	SNP	T	A	A	rs17769294	byFrequency;by1000genomes	TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:27561628T>A	uc003zqq.2	-	c.620A>T	c.(619-621)AAT>ATT	p.N207I	C9orf72_uc003zqr.1_Missense_Mutation_p.N207I	NM_018325	NP_060795	Q96LT7	CI072_HUMAN	hypothetical protein LOC203228 isoform a	207										ovary(3)|central_nervous_system(1)	4		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)										0.272727	16.240131	17.264476	6	16	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	27561628	27561628	2611	9	T	A	A	A	676	52	C9orf72	3	3
KIAA1045	23349	broad.mit.edu	37	9	34977191	34977191	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:34977191C>A	uc003zvq.2	+	c.961C>A	c.(961-963)CAC>AAC	p.H321N	KIAA1045_uc003zvr.2_Missense_Mutation_p.H321N	NM_015297	NP_056112	Q9UPV7	K1045_HUMAN	hypothetical protein LOC23349	321							calcium ion binding|zinc ion binding				0			LUSC - Lung squamous cell carcinoma(32;0.00575)											0.327103	94.982026	97.822224	35	72	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	34977191	34977191	8514	9	C	A	A	A	325	25	KIAA1045	2	2
INSL6	11172	broad.mit.edu	37	9	5185531	5185531	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:5185531G>T	uc003zix.2	-	c.72C>A	c.(70-72)AGC>AGA	p.S24R		NM_007179	NP_009110	Q9Y581	INSL6_HUMAN	insulin-like 6 precursor	24						extracellular region	hormone activity				0	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)										0.479167	73.730041	73.74756	23	25	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	5185531	5185531	8071	9	G	T	T	T	490	38	INSL6	1	1
TCEAL2	140597	broad.mit.edu	37	X	101382384	101382384	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:101382384G>T	uc004eip.2	+	c.582G>T	c.(580-582)ATG>ATT	p.M194I		NM_080390	NP_525129	Q9H3H9	TCAL2_HUMAN	transcription elongation factor A (SII)-like 2	194					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0														0.357895	197.740747	201.122702	68	122	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	101382384	101382384	16197	23	G	T	T	T	598	46	TCEAL2	2	2
GLRA4	441509	broad.mit.edu	37	X	102979534	102979534	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:102979534G>T	uc011mse.1	-	c.205C>A	c.(205-207)CCA>ACA	p.P69T	GLRA4_uc010nou.2_Missense_Mutation_p.P69T	NM_001024452	NP_001019623	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4 precursor	69	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity				0														0.28	18.517702	19.603572	7	18	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	102979534	102979534	6725	23	G	T	T	T	559	43	GLRA4	2	2
DCAF12L2	340578	broad.mit.edu	37	X	125299021	125299021	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:125299021G>T	uc004euk.1	-	c.887C>A	c.(886-888)TCC>TAC	p.S296Y		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	296	WD 3.									lung(2)|large_intestine(1)|ovary(1)|pancreas(1)	5														0.359375	121.504142	123.737101	46	82	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	125299021	125299021	4436	23	G	T	T	T	533	41	DCAF12L2	2	2
DCAF12L2	340578	broad.mit.edu	37	X	125299047	125299047	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:125299047G>T	uc004euk.1	-	c.861C>A	c.(859-861)CAC>CAA	p.H287Q		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	287	WD 3.									lung(2)|large_intestine(1)|ovary(1)|pancreas(1)	5														0.344	127.337458	130.000817	43	82	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	125299047	125299047	4436	23	G	T	T	T	568	44	DCAF12L2	2	2
PPEF1	5475	broad.mit.edu	37	X	18748374	18748374	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:18748374C>A	uc004cyq.2	+	c.122C>A	c.(121-123)GCC>GAC	p.A41D	PPEF1_uc004cyp.2_Missense_Mutation_p.A41D|PPEF1_uc004cyr.2_Missense_Mutation_p.A41D|PPEF1_uc004cys.2_Missense_Mutation_p.A41D|PPEF1_uc011mja.1_Intron|PPEF1_uc011mjb.1_5'UTR	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding	41	IQ.				detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)													0.04375	-23.826753	11.982248	7	153	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	18748374	18748374	12737	23	C	A	A	A	338	26	PPEF1	2	2
CXorf22	170063	broad.mit.edu	37	X	35993959	35993959	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:35993959G>T	uc004ddj.2	+	c.2642G>T	c.(2641-2643)TGT>TTT	p.C881F	CXorf22_uc010ngv.2_Non-coding_Transcript	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	881										large_intestine(1)|lung(1)|ovary(1)	3														0.451852	196.853235	197.126613	61	74	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	35993959	35993959	4262	23	G	T	T	T	624	48	CXorf22	2	2
RBM10	8241	broad.mit.edu	37	X	47034492	47034492	+	Splice_Site_SNP	SNP	G	T	T			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:47034492G>T	uc004dhi.2	+	c.771_splice	c.e6+1	p.Q257_splice	RBM10_uc004dhe.1_Intron|RBM10_uc004dhf.2_Splice_Site_SNP_p.Q192_splice|RBM10_uc004dhg.2_Splice_Site_SNP_p.Q115_splice|RBM10_uc004dhh.2_Splice_Site_SNP_p.Q192_splice|RBM10_uc010nhq.2_Splice_Site_SNP_p.Q115_splice	NM_005676	NP_005667			RNA binding motif protein 10 isoform 1						mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding			large_intestine(1)|ovary(1)|pancreas(1)	3						Melanoma(171;120 2705 19495 39241)								0.545455	77.499212	77.577861	24	20	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	47034492	47034492	13572	23	G	T	T	T	572	44	RBM10	5	2
TSPYL2	64061	broad.mit.edu	37	X	53114870	53114870	+	Silent	SNP	A	C	C			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:53114870A>C	uc004drw.2	+	c.1296A>C	c.(1294-1296)GCA>GCC	p.A432A	TSPYL2_uc004drv.2_3'UTR|TSPYL2_uc004drx.1_Silent_p.A37A	NM_022117	NP_071400	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	432					cell cycle|chromatin modification|negative regulation of cell cycle|negative regulation of cell growth|negative regulation of DNA replication|nucleosome assembly|regulation of protein kinase activity|regulation of signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|rDNA binding				0														0.418919	104.515263	104.939237	31	43	KEEP	---	---	---	---	capture		Silent	SNP	53114870	53114870	17213	23	A	C	C	C	80	7	TSPYL2	4	4
KRTAP5-5	439915	broad.mit.edu	37	11	1651199	1651228	+	In_Frame_Del	DEL	AGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	-	-	rs35089393;rs71025763;rs71454096	by1000genomes	TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:1651199_1651228delAGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	uc001lty.2	+	c.129_158delAGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	c.(127-159)GGAGGCTGTGGGGGCTGTGGCTCCGGCTGTGCG>GGG	p.GCGGCGSGCA44del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	44_53				A -> G (in Ref. 1; BAD20201 and 2; CAF31639).		keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)										0.36			43	78		---	---	---	---	capture_indel		In_Frame_Del	DEL	1651199	1651228	8886	11	AGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	-	-	-	132	11	KRTAP5-5	5	5
KRT1	3848	broad.mit.edu	37	12	53069236	53069256	+	In_Frame_Del	DEL	TAGCTGCTACCTCCGGAGCCA	-	-	rs77846840;rs61226348		TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:53069236_53069256delTAGCTGCTACCTCCGGAGCCA	uc001sau.1	-	c.1656_1676delTGGCTCCGGAGGTAGCAGCTA	c.(1654-1677)TATGGCTCCGGAGGTAGCAGCTAC>TAC	p.552_559YGSGGSSY>Y	KRT1_uc001sav.1_Splice_Site_Del_p.G556_splice	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	552_559	Gly/Ser-rich.|Tail.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)	1														0.36			5	9		---	---	---	---	capture_indel		In_Frame_Del	DEL	53069236	53069256	8762	12	TAGCTGCTACCTCCGGAGCCA	-	-	-	741	57	KRT1	5	5
PODXL	5420	broad.mit.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	-	-			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:131241030_131241035delGGCGAC	uc003vqw.3	-	c.84_89delGTCGCC	c.(82-90)CCGTCGCCC>CCC	p.28_30PSP>P	PODXL_uc003vqx.3_In_Frame_Del_p.28_30PSP>P	NM_001018111	NP_001018121	O00592	PODXL_HUMAN	podocalyxin-like isoform 1 precursor	28_30	Extracellular (Potential).				cell adhesion|epithelial tube formation|negative regulation of cell-cell adhesion|positive regulation of cell migration|positive regulation of cell-cell adhesion mediated by integrin|regulation of microvillus assembly	actin cytoskeleton|apical plasma membrane|centrosome|filopodium|integral to plasma membrane|lamellipodium|membrane raft|microvillus membrane|nucleolus|ruffle				breast(2)|pancreas(1)	3	Melanoma(18;0.162)													0.33			4	8		---	---	---	---	capture_indel		In_Frame_Del	DEL	131241030	131241035	12608	7	GGCGAC	-	-	-	559	43	PODXL	5	5
OR2A5	393046	broad.mit.edu	37	7	143748258	143748258	+	Frame_Shift_Del	DEL	C	-	-			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:143748258_143748258delC	uc011ktw.1	+	c.764_764delC	c.(763-765)GCCfs	p.A255fs		NM_012365	NP_036497	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A,	255	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Melanoma(164;0.0783)													0.48			138	152		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	143748258	143748258	11387	7	C	-	-	-	338	26	OR2A5	5	5
SSPO	23145	broad.mit.edu	37	7	149503917	149503920	+	Splice_Site_Del	DEL	GATA	-	-			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:149503917_149503920delGATA	uc010lpk.2	+	c.8745_splice	c.e60+1	p.G2915_splice		NM_198455	NP_940857			SCO-spondin precursor						cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)											0.45			5	6		---	---	---	---	capture_indel		Splice_Site_Del	DEL	149503917	149503920	15705	7	GATA	-	-	-	522	41	SSPO	5	5
MAGEA3	4102	broad.mit.edu	37	X	151935379	151935379	+	Frame_Shift_Del	DEL	C	-	-			TCGA-49-4494-01	TCGA-49-4494-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:151935379_151935379delC	uc004fgp.2	-	c.788_788delG	c.(787-789)GGCfs	p.G263fs		NM_005362	NP_005353	P43357	MAGA3_HUMAN	melanoma antigen family A, 3	263	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)													0.34			44	87		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	151935379	151935379	9546	23	C	-	-	-	338	26	MAGEA3	5	5
