Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	Oncotatorv0393GAF20hg19Feb2011dbSNPbuild132UniProtRelease2011_6	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	context_orig	context65	gene_name	categ	categ_ignoring_null_categ
FAM178A	55719	broad.mit.edu	37	10	102677018	102677018	+	Silent	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:102677018G>A	uc001krs.2	+	c.876G>A	c.(874-876)CAG>CAA	p.Q292Q	FAM178A_uc001krr.1_Silent_p.Q292Q|FAM178A_uc001krt.3_Silent_p.Q292Q|FAM178A_uc001kru.1_Silent_p.Q228Q	NM_001136123	NP_001129595	Q8IX21	F178A_HUMAN	hypothetical protein LOC55719 isoform 2	292											0														0.122807	20.363094	36.242743	14	100	KEEP	---	---	---	---	capture		Silent	SNP	102677018	102677018	5709	10	G	A	A	A	425	33	FAM178A	2	2
CCDC3	83643	broad.mit.edu	37	10	12940429	12940429	+	Missense_Mutation	SNP	T	C	C			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:12940429T>C	uc001ilq.1	-	c.800A>G	c.(799-801)TAC>TGC	p.Y267C	CCDC3_uc009xjb.1_Non-coding_Transcript|CCDC3_uc001ilr.2_Non-coding_Transcript|CCDC3_uc009xjc.1_Non-coding_Transcript	NM_031455	NP_113643	Q9BQI4	CCDC3_HUMAN	coiled-coil domain containing 3 precursor	267						endoplasmic reticulum|extracellular region				ovary(1)	1		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)											0.5	25.954192	25.954192	8	8	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	12940429	12940429	2926	10	T	C	C	C	741	57	CCDC3	4	4
MYPN	84665	broad.mit.edu	37	10	69959230	69959230	+	Silent	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:69959230C>T	uc001jnm.3	+	c.3391C>T	c.(3391-3393)CTG>TTG	p.L1131L	MYPN_uc001jnn.3_Silent_p.L856L|MYPN_uc001jno.3_Silent_p.L1131L|MYPN_uc009xpt.2_Silent_p.L1131L|MYPN_uc010qit.1_Silent_p.L837L|MYPN_uc010qiu.1_Non-coding_Transcript	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	1131	Ig-like 4.|Interaction with ACTN.					nucleus|sarcomere	actin binding			ovary(3)	3														0.071429	-2.321366	13.580607	6	78	KEEP	---	---	---	---	capture		Silent	SNP	69959230	69959230	10493	10	C	T	T	T	415	32	MYPN	2	2
ZDHHC16	84287	broad.mit.edu	37	10	99211511	99211511	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:99211511C>T	uc001knj.2	+	c.79C>T	c.(79-81)CGC>TGC	p.R27C	ZDHHC16_uc001knp.2_Missense_Mutation_p.R27C|ZDHHC16_uc001knk.2_Missense_Mutation_p.R27C|ZDHHC16_uc001knl.2_Missense_Mutation_p.R27C|ZDHHC16_uc001knm.2_Missense_Mutation_p.R27C|ZDHHC16_uc001knn.2_Missense_Mutation_p.R27C|ZDHHC16_uc010qow.1_Missense_Mutation_p.R27C|ZDHHC16_uc009xvq.2_Non-coding_Transcript|ZDHHC16_uc001kno.2_Missense_Mutation_p.R27C|ZDHHC16_uc009xvr.2_Missense_Mutation_p.R27C	NM_198046	NP_932163	Q969W1	ZDH16_HUMAN	Abl-philin 2 isoform 1	27	Cytoplasmic (Potential).				apoptosis	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)										0.114943	12.094679	24.797912	10	77	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	99211511	99211511	18194	10	C	T	T	T	299	23	ZDHHC16	1	1
OR10G7	390265	broad.mit.edu	37	11	123909325	123909325	+	Silent	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:123909325C>T	uc001pzq.1	-	c.384G>A	c.(382-384)CCG>CCA	p.P128P		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	128	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)										0.033803	-62.174674	21.880448	12	343	KEEP	---	---	---	---	capture		Silent	SNP	123909325	123909325	11308	11	C	T	T	T	340	27	OR10G7	1	1
PTPRJ	5795	broad.mit.edu	37	11	48181542	48181542	+	Missense_Mutation	SNP	G	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:48181542G>T	uc001ngp.3	+	c.3499G>T	c.(3499-3501)GCA>TCA	p.A1167S		NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	1167	Tyrosine-protein phosphatase.|Cytoplasmic (Potential).				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8														0.306667	183.572798	191.082653	69	156	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	48181542	48181542	13261	11	G	T	T	T	546	42	PTPRJ	2	2
ZDHHC5	25921	broad.mit.edu	37	11	57449913	57449913	+	Missense_Mutation	SNP	T	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:57449913T>A	uc001nkx.1	+	c.124T>A	c.(124-126)TAT>AAT	p.Y42N	ZDHHC5_uc001nky.1_5'UTR|ZDHHC5_uc001nkz.1_5'UTR	NM_015457	NP_056272	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC domain containing 5	42	Helical; (Potential).					integral to membrane	acyltransferase activity|zinc ion binding			skin(1)	1														0.147887	35.78917	52.687408	21	121	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	57449913	57449913	18206	11	T	A	A	A	741	57	ZDHHC5	3	3
TPCN1	53373	broad.mit.edu	37	12	113729448	113729448	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:113729448G>A	uc001tux.2	+	c.2210G>A	c.(2209-2211)CGC>CAC	p.R737H	TPCN1_uc001tuw.2_Missense_Mutation_p.R665H|TPCN1_uc010syu.1_5'Flank	NM_001143819	NP_001137291	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 1	665	Extracellular (Potential).					endosome membrane|integral to membrane|lysosomal membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1														0.166667	6.184323	8.714484	4	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	113729448	113729448	16939	12	G	A	A	A	494	38	TPCN1	1	1
CIT	11113	broad.mit.edu	37	12	120128147	120128147	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:120128147G>A	uc001txj.1	-	c.5995C>T	c.(5995-5997)CAC>TAC	p.H1999Y	CIT_uc001txh.1_Missense_Mutation_p.H1475Y|CIT_uc001txi.1_Missense_Mutation_p.H1957Y	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	1957	SH3-binding (Potential).				intracellular signal transduction|protein phosphorylation		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)						1263				0.3	16.75094	17.460717	6	14	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	120128147	120128147	3573	12	G	A	A	A	611	47	CIT	2	2
USP15	9958	broad.mit.edu	37	12	62783684	62783684	+	Nonsense_Mutation	SNP	C	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:62783684C>A	uc001src.1	+	c.1760C>A	c.(1759-1761)TCA>TAA	p.S587*	USP15_uc001srb.1_Nonsense_Mutation_p.S558*	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	587					protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)	2			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		Melanoma(181;615 2041 39364 49691 50001)								0.089744	2.760366	16.015712	7	71	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	62783684	62783684	17608	12	C	A	A	A	377	29	USP15	5	2
NUPL1	9818	broad.mit.edu	37	13	25905666	25905666	+	Missense_Mutation	SNP	A	G	G			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:25905666A>G	uc001uqi.2	+	c.1405A>G	c.(1405-1407)ACA>GCA	p.T469A	NUPL1_uc001uqg.1_Missense_Mutation_p.T469A|NUPL1_uc001uqj.2_Missense_Mutation_p.T457A	NM_014089	NP_054808	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1 isoform a	469	14 X 2 AA repeats of F-G.				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore					0		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		Pancreas(166;1040 2004 4560 4728 37041)|GBM(109;1045 1520 7614 9308 19618)								0.384615	30.098245	30.415835	10	16	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	25905666	25905666	11179	13	A	G	G	G	26	2	NUPL1	4	4
KL	9365	broad.mit.edu	37	13	33629297	33629297	+	Silent	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:33629297C>T	uc001uus.2	+	c.1444C>T	c.(1444-1446)CTA>TTA	p.L482L	KL_uc001uur.1_Silent_p.L175L	NM_004795	NP_004786	Q9UEF7	KLOT_HUMAN	klotho precursor	482	Glycosyl hydrolase-1 1.|Extracellular (Potential).				aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding			large_intestine(1)|ovary(1)	2	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)										0.051402	-21.960846	23.634498	11	203	KEEP	---	---	---	---	capture		Silent	SNP	33629297	33629297	8643	13	C	T	T	T	415	32	KL	2	2
SCEL	8796	broad.mit.edu	37	13	78176221	78176221	+	Silent	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:78176221G>A	uc001vki.2	+	c.939G>A	c.(937-939)CCG>CCA	p.P313P	SCEL_uc001vkj.2_Silent_p.P293P|SCEL_uc010thx.1_Silent_p.P291P	NM_144777	NP_659001	O95171	SCEL_HUMAN	sciellin isoform 1	313	16 X approximate tandem repeats.|4.				embryo development|keratinocyte differentiation	cornified envelope|cytoplasm|membrane	protein binding|zinc ion binding			ovary(4)|breast(1)	5		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)										0.132353	13.126618	22.056501	9	59	KEEP	---	---	---	---	capture		Silent	SNP	78176221	78176221	14369	13	G	A	A	A	470	37	SCEL	1	1
SPTB	6710	broad.mit.edu	37	14	65239968	65239968	+	Silent	SNP	C	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:65239968C>A	uc001xhr.2	-	c.5148G>T	c.(5146-5148)CCG>CCT	p.P1716P	SPTB_uc001xhs.2_Silent_p.P1716P|SPTB_uc001xht.2_Silent_p.P1716P|SPTB_uc001xhu.2_Silent_p.P1716P|SPTB_uc010aqi.2_Silent_p.P377P	NM_001024858	NP_001020029	P11277	SPTB1_HUMAN	spectrin beta isoform a	1716	Spectrin 14.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|lung(1)|central_nervous_system(1)	9		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)										0.084507	1.094335	13.535957	6	65	KEEP	---	---	---	---	capture		Silent	SNP	65239968	65239968	15632	14	C	A	A	A	288	23	SPTB	1	1
ANGEL1	23357	broad.mit.edu	37	14	77275637	77275637	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:77275637C>A	uc001xsv.2	-	c.414G>T	c.(412-414)GAG>GAT	p.E138D	ANGEL1_uc010tvf.1_Missense_Mutation_p.E138D	NM_015305	NP_056120	Q9UNK9	ANGE1_HUMAN	angel homolog 1	138										ovary(2)|central_nervous_system(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)										0.12	2.805755	6.349961	3	22	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	77275637	77275637	611	14	C	A	A	A	311	24	ANGEL1	2	2
KIAA1409	57578	broad.mit.edu	37	14	94173127	94173127	+	Silent	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:94173127G>A	uc001ybv.1	+	c.7320G>A	c.(7318-7320)CCG>CCA	p.P2440P	KIAA1409_uc001ybs.1_Silent_p.P2418P	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	2595						integral to membrane				ovary(10)|large_intestine(3)	13		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)						1186				0.086957	2.352757	18.220779	8	84	KEEP	---	---	---	---	capture		Silent	SNP	94173127	94173127	8539	14	G	A	A	A	496	39	KIAA1409	1	1
DAPK2	23604	broad.mit.edu	37	15	64263636	64263636	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:64263636G>A	uc002amr.2	-	c.439C>T	c.(439-441)CAC>TAC	p.H147Y	DAPK2_uc010uim.1_Non-coding_Transcript|DAPK2_uc010bgu.1_Missense_Mutation_p.H137Y	NM_014326	NP_055141	Q9UIK4	DAPK2_HUMAN	death-associated kinase 2	147	Protein kinase.				apoptosis|induction of apoptosis|intracellular protein kinase cascade|protein phosphorylation	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding			central_nervous_system(1)	1				LUAD - Lung adenocarcinoma(2;0.215)						295				0.33101	255.21002	262.481796	95	192	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	64263636	64263636	4403	15	G	A	A	A	585	45	DAPK2	2	2
APOB48R	55911	broad.mit.edu	37	16	28509145	28509145	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:28509145G>A	uc002dqb.1	+	c.2756G>A	c.(2755-2757)CGG>CAG	p.R919Q	APOB48R_uc010byg.1_Missense_Mutation_p.R457Q	NM_018690	NP_061160	Q0VD83	APOBR_HUMAN	apolipoprotein B48 receptor	919	Glu-rich.				cholesterol metabolic process|lipid transport	chylomicron|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle					0														0.12	4.008964	7.549089	3	22	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	28509145	28509145	797	16	G	A	A	A	507	39	APOB48R	1	1
MYH3	4621	broad.mit.edu	37	17	10538773	10538773	+	Silent	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:10538773C>T	uc002gmq.1	-	c.4083G>A	c.(4081-4083)GCG>GCA	p.A1361A		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	1361	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(1)|pancreas(1)	6														0.060606	-19.437518	27.170577	14	217	KEEP	---	---	---	---	capture		Silent	SNP	10538773	10538773	10431	17	C	T	T	T	340	27	MYH3	1	1
GH2	2689	broad.mit.edu	37	17	61957888	61957888	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:61957888G>A	uc002jcl.1	-	c.700C>T	c.(700-702)CAC>TAC	p.H234Y	GH2_uc002jcj.2_Intron|CSH2_uc002jck.2_Intron|GH2_uc002jcm.1_Intron|GH2_uc002jcn.1_Intron|GH2_uc002jco.1_Intron	NM_022557	NP_072051	P01242	SOM2_HUMAN	growth hormone 2 isoform 2	Error:Variant_position_missing_in_P01242_after_alignment						extracellular region	hormone activity			pancreas(1)	1														0.054545	-12.850016	10.171047	6	104	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	61957888	61957888	6636	17	G	A	A	A	585	45	GH2	2	2
UNC13D	201294	broad.mit.edu	37	17	73824137	73824137	+	Missense_Mutation	SNP	C	G	G	rs79891552		TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:73824137C>G	uc002jpp.2	-	c.3182G>C	c.(3181-3183)CGG>CCG	p.R1061P		NM_199242	NP_954712	Q70J99	UN13D_HUMAN	unc-13 homolog D	1061					positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding				0			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)											0.2	5.64614	6.481634	2	8	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	73824137	73824137	17545	17	C	G	G	G	299	23	UNC13D	3	3
DPY19L3	147991	broad.mit.edu	37	19	32930060	32930060	+	Silent	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:32930060G>A	uc002ntg.2	+	c.639G>A	c.(637-639)GAG>GAA	p.E213E	DPY19L3_uc002nth.1_Silent_p.E213E|DPY19L3_uc002nti.1_Non-coding_Transcript	NM_207325	NP_997208	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3	213						integral to membrane				ovary(4)	4	Esophageal squamous(110;0.162)													0.065934	-7.829543	27.729812	12	170	KEEP	---	---	---	---	capture		Silent	SNP	32930060	32930060	4926	19	G	A	A	A	425	33	DPY19L3	2	2
DPY19L3	147991	broad.mit.edu	37	19	32930116	32930116	+	Missense_Mutation	SNP	G	C	C			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:32930116G>C	uc002ntg.2	+	c.695G>C	c.(694-696)AGA>ACA	p.R232T	DPY19L3_uc002nth.1_Missense_Mutation_p.R232T|DPY19L3_uc002nti.1_Non-coding_Transcript	NM_207325	NP_997208	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3	232	Helical; (Potential).					integral to membrane				ovary(4)	4	Esophageal squamous(110;0.162)													0.059603	-4.656995	25.98356	9	142	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32930116	32930116	4926	19	G	C	C	C	429	33	DPY19L3	3	3
RASGRP4	115727	broad.mit.edu	37	19	38903681	38903681	+	Silent	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:38903681G>A	uc002oir.2	-	c.1425C>T	c.(1423-1425)TTC>TTT	p.F475F	RASGRP4_uc010efz.1_Non-coding_Transcript|RASGRP4_uc010ega.1_Non-coding_Transcript|RASGRP4_uc010xua.1_Silent_p.F406F|RASGRP4_uc010xub.1_Silent_p.F441F|RASGRP4_uc010xuc.1_Silent_p.F383F|RASGRP4_uc010xud.1_Silent_p.F378F|RASGRP4_uc010xue.1_Silent_p.F286F|RASGRP4_uc010egb.2_Silent_p.F461F	NM_170604	NP_733749	Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4 isoform a	475	EF-hand.				activation of phospholipase C activity|cell growth|cell proliferation|myeloid cell differentiation|positive regulation of Ras protein signal transduction|regulation of G-protein coupled receptor protein signaling pathway|response to extracellular stimulus|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|membrane fraction|plasma membrane|soluble fraction	diacylglycerol binding|GTP-dependent protein binding|metal ion binding|Ras guanyl-nucleotide exchange factor activity			pancreas(1)|skin(1)	2	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)											0.070175	-5.297031	16.446109	8	106	KEEP	---	---	---	---	capture		Silent	SNP	38903681	38903681	13538	19	G	A	A	A	581	45	RASGRP4	2	2
CYP2F1	1572	broad.mit.edu	37	19	41627459	41627459	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:41627459G>A	uc002opu.1	+	c.581G>A	c.(580-582)CGT>CAT	p.R194H	CYP2F1_uc010xvw.1_Intron|CYP2F1_uc010xvv.1_Missense_Mutation_p.R194H|CYP2F1_uc002opv.1_Non-coding_Transcript	NM_000774	NP_000765	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F,	194					naphthalene metabolic process|oxidation-reduction process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0														0.113095	13.025574	37.850838	19	149	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	41627459	41627459	4336	19	G	A	A	A	520	40	CYP2F1	1	1
PPP2R1A	5518	broad.mit.edu	37	19	52716329	52716329	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:52716329G>A	uc002pyp.2	+	c.773G>A	c.(772-774)CGC>CAC	p.R258H	PPP2R1A_uc010ydk.1_Missense_Mutation_p.R203H|PPP2R1A_uc010epm.1_Missense_Mutation_p.R298H|PPP2R1A_uc002pyq.2_Missense_Mutation_p.R79H	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein	258	HEAT 7.|PP2A subunit B binding.|Polyoma small and medium T antigens Binding.			R -> A (in Ref. 2; AAA36399).	ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(24)|ovary(17)|breast(2)|lung(1)|skin(1)|kidney(1)|pancreas(1)	47				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)										0.113636	4.04178	10.52609	5	39	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	52716329	52716329	12818	19	G	A	A	A	494	38	PPP2R1A	1	1
MYBPHL	343263	broad.mit.edu	37	1	109838959	109838959	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:109838959C>T	uc001dxk.1	-	c.764G>A	c.(763-765)CGA>CAA	p.R255Q	MYBPHL_uc010ovh.1_Missense_Mutation_p.R232Q|MYBPHL_uc001dxl.2_Intron	NM_001010985	NP_001010985	A2RUH7	MBPHL_HUMAN	myosin binding protein H-like	255										ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(203;0.00519)|all_epithelial(167;0.00575)|Lung NSC(277;0.00822)		Colorectal(144;0.0306)|Lung(183;0.0681)|COAD - Colon adenocarcinoma(174;0.117)|Epithelial(280;0.197)|all cancers(265;0.225)										0.076923	-2.952595	23.222101	11	132	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	109838959	109838959	10410	1	C	T	T	T	403	31	MYBPHL	1	1
SPEN	23013	broad.mit.edu	37	1	16260282	16260282	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:16260282C>T	uc001axk.1	+	c.7547C>T	c.(7546-7548)CCA>CTA	p.P2516L	SPEN_uc010obp.1_Missense_Mutation_p.P2475L	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	2516	RID.|Pro-rich.				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	14		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)						551				0.221198	229.776244	260.832662	96	338	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	16260282	16260282	15550	1	C	T	T	T	273	21	SPEN	2	2
KLHL20	27252	broad.mit.edu	37	1	173703050	173703050	+	Silent	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:173703050G>A	uc001gjc.2	+	c.222G>A	c.(220-222)GTG>GTA	p.V74V	KLHL20_uc010pmr.1_Intron|KLHL20_uc009wwf.2_Silent_p.V56V|KLHL20_uc001gjd.2_Silent_p.V74V	NM_014458	NP_055273	Q9Y2M5	KLH20_HUMAN	kelch-like 20	74	BTB.				cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity			ovary(1)	1						GBM(159;862 2695 6559 23041)								0.044776	-19.783782	10.047434	6	128	KEEP	---	---	---	---	capture		Silent	SNP	173703050	173703050	8687	1	G	A	A	A	600	47	KLHL20	2	2
GRHL3	57822	broad.mit.edu	37	1	24663569	24663569	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:24663569C>T	uc001biy.2	+	c.629C>T	c.(628-630)TCG>TTG	p.S210L	GRHL3_uc001bix.2_Missense_Mutation_p.S205L|GRHL3_uc001biz.2_Missense_Mutation_p.S112L	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform	205					regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)										0.358491	54.007334	54.943124	19	34	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	24663569	24663569	7043	1	C	T	T	T	403	31	GRHL3	1	1
GPBP1L1	60313	broad.mit.edu	37	1	46120493	46120493	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:46120493G>A	uc001coq.2	-	c.199C>T	c.(199-201)CAC>TAC	p.H67Y		NM_021639	NP_067652	Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1	67					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)													0.25	35.163204	38.804455	16	48	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	46120493	46120493	6870	1	G	A	A	A	598	46	GPBP1L1	2	2
C8B	732	broad.mit.edu	37	1	57409395	57409395	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:57409395C>T	uc001cyp.2	-	c.1208G>A	c.(1207-1209)TGC>TAC	p.C403Y	C8B_uc010oon.1_Missense_Mutation_p.C341Y|C8B_uc010ooo.1_Missense_Mutation_p.C351Y	NM_000066	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	403	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex				central_nervous_system(2)|large_intestine(1)|ovary(1)	4														0.046784	-23.855592	13.609817	8	163	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	57409395	57409395	2526	1	C	T	T	T	325	25	C8B	2	2
C1orf173	127254	broad.mit.edu	37	1	75038612	75038612	+	Missense_Mutation	SNP	A	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:75038612A>T	uc001dgg.2	-	c.2782T>A	c.(2782-2784)TCG>ACG	p.S928T		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	928	Glu-rich.									ovary(3)|central_nervous_system(1)	4														0.05641	-18.903793	21.3933	11	184	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	75038612	75038612	2081	1	A	T	T	T	156	12	C1orf173	3	3
KRTAP10-5	386680	broad.mit.edu	37	21	46000423	46000423	+	Silent	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:46000423G>A	uc002zfl.1	-	c.33C>T	c.(31-33)AGC>AGT	p.S11S	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198694	NP_941967	P60370	KR105_HUMAN	keratin associated protein 10-5	11						keratin filament					0														0.094488	4.513818	25.488654	12	115	KEEP	---	---	---	---	capture		Silent	SNP	46000423	46000423	8827	21	G	A	A	A	490	38	KRTAP10-5	1	1
ZSWIM2	151112	broad.mit.edu	37	2	187702037	187702037	+	Missense_Mutation	SNP	A	G	G			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:187702037A>G	uc002upu.1	-	c.739T>C	c.(739-741)TAT>CAT	p.Y247H		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	247	ZZ-type.				apoptosis		zinc ion binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)											0.067797	0.421431	23.215995	8	110	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	187702037	187702037	18845	2	A	G	G	G	169	13	ZSWIM2	4	4
TMEM169	92691	broad.mit.edu	37	2	216964796	216964796	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:216964796C>T	uc010zjr.1	+	c.425C>T	c.(424-426)ACG>ATG	p.T142M	TMEM169_uc010zjs.1_Missense_Mutation_p.T142M|TMEM169_uc002vfw.2_Missense_Mutation_p.T142M|TMEM169_uc002vfv.3_Missense_Mutation_p.T142M	NM_001142310	NP_001135782	Q96HH4	TM169_HUMAN	transmembrane protein 169	142	Extracellular (Potential).					integral to membrane				ovary(1)	1		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.15	27.27059	41.368796	18	102	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	216964796	216964796	16618	2	C	T	T	T	247	19	TMEM169	1	1
MXD1	4084	broad.mit.edu	37	2	70164438	70164438	+	Silent	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:70164438G>A	uc002sfy.2	+	c.390G>A	c.(388-390)AAG>AAA	p.K130K	MXD1_uc010yqp.1_Silent_p.K130K|MXD1_uc010yqq.1_Silent_p.K67K|MXD1_uc010yqr.1_Non-coding_Transcript|MXD1_uc010yqs.1_Silent_p.K120K	NM_002357	NP_002348	Q05195	MAD1_HUMAN	MAX dimerization protein 1	130					cell proliferation|multicellular organismal development|regulation of transcription, DNA-dependent	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulator activity				0														0.182482	51.786262	64.763682	25	112	KEEP	---	---	---	---	capture		Silent	SNP	70164438	70164438	10393	2	G	A	A	A	425	33	MXD1	2	2
DCTN1	1639	broad.mit.edu	37	2	74594501	74594501	+	Missense_Mutation	SNP	A	G	G			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:74594501A>G	uc002skx.2	-	c.2231T>C	c.(2230-2232)ATG>ACG	p.M744T	DCTN1_uc002skt.1_5'Flank|DCTN1_uc002skv.2_Missense_Mutation_p.M610T|DCTN1_uc002sku.2_Missense_Mutation_p.M610T|DCTN1_uc002skw.1_Missense_Mutation_p.M720T|DCTN1_uc010ffd.2_Missense_Mutation_p.M724T|DCTN1_uc002sky.2_Missense_Mutation_p.M707T	NM_004082	NP_004073	Q14203	DCTN1_HUMAN	dynactin 1 isoform 1	744					cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding			ovary(3)	3														0.126761	15.026861	24.673896	9	62	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	74594501	74594501	4477	2	A	G	G	G	104	8	DCTN1	4	4
SEMA5B	54437	broad.mit.edu	37	3	122642572	122642572	+	Silent	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:122642572G>A	uc003efz.1	-	c.1164C>T	c.(1162-1164)TGC>TGT	p.C388C	SEMA5B_uc011bju.1_Silent_p.C330C|SEMA5B_uc003ega.1_Non-coding_Transcript|SEMA5B_uc003egb.1_Silent_p.C388C|SEMA5B_uc010hro.1_Silent_p.C330C|SEMA5B_uc010hrp.1_Non-coding_Transcript	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1	388	Extracellular (Potential).|Sema.				cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)						383				0.256579	90.67634	98.83197	39	113	KEEP	---	---	---	---	capture		Silent	SNP	122642572	122642572	14524	3	G	A	A	A	490	38	SEMA5B	1	1
NEK11	79858	broad.mit.edu	37	3	130884337	130884337	+	Nonsense_Mutation	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:130884337C>T	uc003eny.2	+	c.1150C>T	c.(1150-1152)CAG>TAG	p.Q384*	NEK11_uc003enx.2_Nonsense_Mutation_p.Q384*|NEK11_uc003eoa.2_Nonsense_Mutation_p.Q384*|NEK11_uc003enz.2_Nonsense_Mutation_p.Q202*|NEK11_uc010htn.2_Non-coding_Transcript|NEK11_uc011blk.1_Nonsense_Mutation_p.Q236*|NEK11_uc011bll.1_Nonsense_Mutation_p.Q279*|NEK11_uc011blm.1_Nonsense_Mutation_p.Q384*	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1	384	Potential.				cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade|protein phosphorylation	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|central_nervous_system(1)	5										271				0.067797	-3.052047	8.360545	4	55	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	130884337	130884337	10722	3	C	T	T	T	377	29	NEK11	5	2
SLC4A7	9497	broad.mit.edu	37	3	27472895	27472895	+	Silent	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:27472895G>A	uc011aww.1	-	c.1044C>T	c.(1042-1044)GCC>GCT	p.A348A	SLC4A7_uc011awu.1_Non-coding_Transcript|SLC4A7_uc011awv.1_Intron|SLC4A7_uc003cdu.3_Intron|SLC4A7_uc011awx.1_Silent_p.A335A|SLC4A7_uc011awy.1_Silent_p.A331A|SLC4A7_uc011awz.1_Intron|SLC4A7_uc011axa.1_Intron|SLC4A7_uc011axb.1_Silent_p.A335A|SLC4A7_uc010hfm.2_Intron|SLC4A7_uc003cdv.2_Silent_p.A339A|SLC4A7_uc003cdw.2_Intron	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate	339	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|central_nervous_system(1)	4														0.151351	47.273323	68.820026	28	157	KEEP	---	---	---	---	capture		Silent	SNP	27472895	27472895	15155	3	G	A	A	A	600	47	SLC4A7	2	2
DNAH1	25981	broad.mit.edu	37	3	52429597	52429597	+	Missense_Mutation	SNP	T	C	C			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:52429597T>C	uc011bef.1	+	c.11162T>C	c.(11161-11163)ATA>ACA	p.I3721T	DNAH1_uc003ddv.2_Missense_Mutation_p.I579T	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3786	AAA 6 (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)										0.196721	34.468492	39.691974	12	49	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	52429597	52429597	4779	3	T	C	C	C	637	49	DNAH1	4	4
ADAMTS9	56999	broad.mit.edu	37	3	64582594	64582594	+	Missense_Mutation	SNP	T	C	C			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:64582594T>C	uc003dmg.2	-	c.4091A>G	c.(4090-4092)AAC>AGC	p.N1364S	ADAMTS9_uc011bfo.1_Missense_Mutation_p.N1336S|ADAMTS9_uc003dmh.1_Missense_Mutation_p.N1193S|ADAMTS9_uc011bfp.1_Missense_Mutation_p.N275S	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1364	TSP type-1 9.				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)	3		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)										0.102273	12.014419	25.883014	9	79	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	64582594	64582594	274	3	T	C	C	C	780	60	ADAMTS9	4	4
CENPE	1062	broad.mit.edu	37	4	104041347	104041347	+	Missense_Mutation	SNP	A	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:104041347A>T	uc003hxb.1	-	c.7287T>A	c.(7285-7287)AAT>AAA	p.N2429K	CENPE_uc003hxc.1_Missense_Mutation_p.N2308K	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	2429	Kinetochore-binding domain.|Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)										0.2	19.378536	22.725455	8	32	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	104041347	104041347	3363	4	A	T	T	T	206	16	CENPE	3	3
SORBS2	8470	broad.mit.edu	37	4	186544955	186544955	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:186544955G>A	uc003iyg.2	-	c.1958C>T	c.(1957-1959)CCG>CTG	p.P653L	SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iyl.2_Missense_Mutation_p.P539L|SORBS2_uc003iym.2_Missense_Mutation_p.P639L|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Missense_Mutation_p.P443L|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2	539						actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		Esophageal Squamous(153;41 2433 9491 36028)								0.047619	-14.349041	13.093395	6	120	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	186544955	186544955	15428	4	G	A	A	A	507	39	SORBS2	1	1
CYP4V2	285440	broad.mit.edu	37	4	187131662	187131662	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:187131662C>T	uc003iyw.3	+	c.1445C>T	c.(1444-1446)TCG>TTG	p.S482L	CYP4V2_uc010ism.2_Non-coding_Transcript	NM_207352	NP_997235	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily v,	482					oxidation-reduction process|response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity				0		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)										0.148148	32.909597	48.955968	20	115	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	187131662	187131662	4357	4	C	T	T	T	403	31	CYP4V2	1	1
PCDHA1	56147	broad.mit.edu	37	5	140167367	140167367	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140167367C>T	uc003lhb.2	+	c.1492C>T	c.(1492-1494)CGG>TGG	p.R498W	PCDHA1_uc003lha.2_Missense_Mutation_p.R498W|PCDHA1_uc003lgz.2_Missense_Mutation_p.R498W	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	498	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.09589	5.994853	29.867104	14	132	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140167367	140167367	11939	5	C	T	T	T	347	27	PCDHA1	1	1
PCDHA10	56139	broad.mit.edu	37	5	140236799	140236799	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140236799C>T	uc003lhx.2	+	c.1166C>T	c.(1165-1167)ACG>ATG	p.T389M	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Missense_Mutation_p.T389M|PCDHA10_uc011dad.1_Missense_Mutation_p.T389M	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	389	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|breast(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.045643	-32.74226	20.361395	11	230	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140236799	140236799	11940	5	C	T	T	T	247	19	PCDHA10	1	1
JAKMIP2	9832	broad.mit.edu	37	5	146991890	146991890	+	Silent	SNP	T	C	C			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:146991890T>C	uc010jgo.1	-	c.2391A>G	c.(2389-2391)CAA>CAG	p.Q797Q	JAKMIP2_uc003loq.1_Silent_p.Q797Q|JAKMIP2_uc011dbx.1_Silent_p.Q755Q|JAKMIP2_uc003lor.1_Silent_p.Q776Q	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein	797	Potential.					Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.142857	6.110209	8.692137	3	18	KEEP	---	---	---	---	capture		Silent	SNP	146991890	146991890	8245	5	T	C	C	C	829	64	JAKMIP2	4	4
FAM71B	153745	broad.mit.edu	37	5	156592963	156592963	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:156592963C>A	uc003lwn.2	-	c.217G>T	c.(217-219)GGC>TGC	p.G73C		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	73						nucleus				ovary(3)|pancreas(1)	4	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)											0.087591	0.942961	24.477955	12	125	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	156592963	156592963	5831	5	C	A	A	A	286	22	FAM71B	2	2
UGT3A1	133688	broad.mit.edu	37	5	35954373	35954373	+	Missense_Mutation	SNP	C	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:35954373C>A	uc003jjv.1	-	c.1503G>T	c.(1501-1503)TGG>TGT	p.W501C	UGT3A1_uc003jjw.1_Non-coding_Transcript	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	501	Helical; (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)											0.109091	5.112484	13.435866	6	49	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	35954373	35954373	17521	5	C	A	A	A	338	26	UGT3A1	2	2
ENPP1	5167	broad.mit.edu	37	6	132203597	132203597	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:132203597G>A	uc011ecf.1	+	c.2213G>A	c.(2212-2214)GGG>GAG	p.G738E		NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	738	Nuclease.|Extracellular (Potential).				3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|regulation of bone mineralization|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			ovary(2)	2	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	Colon(104;336 1535 5856 11019 33782)								0.217822	110.786811	125.616464	44	158	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	132203597	132203597	5322	6	G	A	A	A	559	43	ENPP1	2	2
AKAP12	9590	broad.mit.edu	37	6	151672021	151672021	+	Missense_Mutation	SNP	G	C	C			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:151672021G>C	uc011eep.1	+	c.2495G>C	c.(2494-2496)GGG>GCG	p.G832A	AKAP12_uc003qoe.2_Missense_Mutation_p.G832A|AKAP12_uc003qof.2_Missense_Mutation_p.G734A|AKAP12_uc010kim.2_Intron|AKAP12_uc003qog.2_Missense_Mutation_p.G727A	NM_005100	NP_005091	Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12 isoform 1	832					G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding			large_intestine(2)|ovary(2)|pancreas(1)|lung(1)|skin(1)	7		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		Melanoma(141;1616 1805 10049 24534 51979)				196				0.205776	135.914492	158.160571	57	220	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	151672021	151672021	451	6	G	C	C	C	559	43	AKAP12	3	3
PARK2	5071	broad.mit.edu	37	6	161781119	161781119	+	Splice_Site_SNP	SNP	C	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:161781119C>A	uc003qtx.3	-	c.1285_splice	c.e11+1	p.G429_splice	PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Splice_Site_SNP_p.G238_splice|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Splice_Site_SNP_p.G401_splice|PARK2_uc003qtz.3_Splice_Site_SNP_p.G280_splice|PARK2_uc011egf.1_Splice_Site_SNP_p.G103_splice	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)										0.102941	29.572586	82.978227	35	305	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	161781119	161781119	11866	6	C	A	A	A	234	18	PARK2	5	2
CAPN11	11131	broad.mit.edu	37	6	44144683	44144683	+	Silent	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:44144683C>T	uc003owt.1	+	c.1185C>T	c.(1183-1185)TAC>TAT	p.Y395Y	CAPN11_uc011dvn.1_Silent_p.Y49Y	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11	395	Domain III.				proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)											0.110577	17.077777	48.312577	23	185	KEEP	---	---	---	---	capture		Silent	SNP	44144683	44144683	2741	6	C	T	T	T	246	19	CAPN11	1	1
HOXA9	3205	broad.mit.edu	37	7	27203329	27203329	+	Missense_Mutation	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:27203329C>T	uc003syt.2	-	c.712G>A	c.(712-714)GAG>AAG	p.E238K		NM_152739	NP_689952	P31269	HXA9_HUMAN	homeobox A9	238	Homeobox.				regulation of transcription, DNA-dependent		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription activator activity			central_nervous_system(1)	1										22				0.115	23.781077	52.993375	23	177	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	27203329	27203329	7590	7	C	T	T	T	403	31	HOXA9	1	1
CARD11	84433	broad.mit.edu	37	7	2983995	2983995	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:2983995G>A	uc003smv.2	-	c.535C>T	c.(535-537)CGG>TGG	p.R179W		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	179	Potential.				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity	p.R172W(1)		haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|central_nervous_system(1)	48		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)						1492				0.057592	-18.816734	20.40272	11	180	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	2983995	2983995	2764	7	G	A	A	A	493	38	CARD11	1	1
IKBKAP	8518	broad.mit.edu	37	9	111668633	111668633	+	Silent	SNP	C	T	T			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:111668633C>T	uc004bdm.3	-	c.1593G>A	c.(1591-1593)TTG>TTA	p.L531L	IKBKAP_uc004bdl.2_Silent_p.L182L|IKBKAP_uc011lwc.1_Silent_p.L417L|IKBKAP_uc010mtq.2_Silent_p.L182L	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene	531					immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|breast(1)|kidney(1)	6														0.2	45.710115	54.50353	21	84	KEEP	---	---	---	---	capture		Silent	SNP	111668633	111668633	7911	9	C	T	T	T	376	29	IKBKAP	2	2
OR1J2	26740	broad.mit.edu	37	9	125273234	125273234	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:125273234G>A	uc004bmj.1	+	c.154G>A	c.(154-156)GAC>AAC	p.D52N	OR1J2_uc011lyv.1_Missense_Mutation_p.D52N	NM_054107	NP_473448	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J,	52	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|breast(1)|skin(1)	3														0.160377	57.607903	80.922024	34	178	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	125273234	125273234	11366	9	G	A	A	A	533	41	OR1J2	2	2
SCAI	286205	broad.mit.edu	37	9	127765392	127765392	+	Splice_Site_SNP	SNP	C	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:127765392C>A	uc004bpd.2	-	c.1134_splice	c.e12+1	p.K378_splice	SCAI_uc004bpe.2_Splice_Site_SNP_p.K355_splice|SCAI_uc010mwu.2_Splice_Site_SNP	NM_173690	NP_775961			suppressor of cancer cell invasion isoform 1						negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5														0.189831	127.895619	154.480217	56	239	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	127765392	127765392	14350	9	C	A	A	A	234	18	SCAI	5	2
VLDLR	7436	broad.mit.edu	37	9	2635511	2635511	+	Silent	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:2635511G>A	uc003zhk.1	+	c.141G>A	c.(139-141)ACG>ACA	p.T47T	VLDLR_uc003zhl.1_Silent_p.T47T|VLDLR_uc003zhm.1_Non-coding_Transcript|VLDLR_uc003zhn.1_Silent_p.T47T	NM_003383	NP_003374	P98155	VLDLR_HUMAN	very low density lipoprotein receptor isoform a	47	Extracellular (Potential).|LDL-receptor class A 1.				cholesterol metabolic process|endocytosis|lipid transport|memory|very-low-density lipoprotein particle clearance	coated pit|integral to membrane|membrane fraction|plasma membrane|very-low-density lipoprotein particle	apolipoprotein binding|calcium ion binding|low-density lipoprotein receptor activity|very-low-density lipoprotein particle receptor activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)										0.039855	-43.615247	19.430831	11	265	KEEP	---	---	---	---	capture		Silent	SNP	2635511	2635511	17741	9	G	A	A	A	483	38	VLDLR	1	1
NUDT2	318	broad.mit.edu	37	9	34343338	34343338	+	Missense_Mutation	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:34343338G>A	uc003zub.2	+	c.344G>A	c.(343-345)CGC>CAC	p.R115H	NUDT2_uc003zuc.2_Missense_Mutation_p.R115H|NUDT2_uc003zud.2_Missense_Mutation_p.R115H	NM_001161	NP_001152	P50583	AP4A_HUMAN	nudix-type motif 2	115	Nudix hydrolase.				induction of apoptosis|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity|bis(5'-nucleosyl)-tetraphosphatase (symmetrical) activity|GTP binding				0			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		Melanoma(95;1683 1957 4276 39813)								0.093023	1.066156	8.233935	4	39	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	34343338	34343338	11142	9	G	A	A	A	494	38	NUDT2	1	1
VAMP7	6845	broad.mit.edu	37	X	155127856	155127856	+	Silent	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:155127856G>A	uc004fnr.2	+	c.285G>A	c.(283-285)CAG>CAA	p.Q95Q	VAMP7_uc004fnt.2_Silent_p.Q54Q|VAMP7_uc011naa.1_Silent_p.Q56Q|VAMP7_uc011nab.1_5'UTR|VAMP7_uc004fns.2_Silent_p.Q95Q|VAMP7_uc011nac.1_Silent_p.Q28Q	NM_005638	NP_005629	P51809	VAMP7_HUMAN	vesicle-associated membrane protein 7 isoform 1	95	Longin.|Cytoplasmic (Potential).				calcium ion-dependent exocytosis|endosome to lysosome transport|eosinophil degranulation|ER to Golgi vesicle-mediated transport|neutrophil degranulation|phagocytosis, engulfment|post-Golgi vesicle-mediated transport|protein transport|vesicle fusion	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|phagocytic vesicle membrane|plasma membrane|SNARE complex|transport vesicle membrane	protein binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)													0.066327	-8.99898	29.262026	13	183	KEEP	---	---	---	---	capture		Silent	SNP	155127856	155127856	17682	23	G	A	A	A	425	33	VAMP7	2	2
MAP7D2	256714	broad.mit.edu	37	X	20031731	20031731	+	Missense_Mutation	SNP	T	G	G			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:20031731T>G	uc010nfo.1	-	c.1762A>C	c.(1762-1764)ATC>CTC	p.I588L	MAP7D2_uc004czq.1_Missense_Mutation_p.I432L|MAP7D2_uc011mji.1_Missense_Mutation_p.I495L|MAP7D2_uc004czr.1_Missense_Mutation_p.I547L|MAP7D2_uc011mjj.1_Missense_Mutation_p.I502L	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	547										ovary(2)|breast(1)	3														0.068376	-0.997443	21.545909	8	109	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20031731	20031731	9651	23	T	G	G	G	676	52	MAP7D2	4	4
MAGED1	9500	broad.mit.edu	37	X	51645010	51645010	+	Missense_Mutation	SNP	T	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:51645010T>A	uc004dpn.2	+	c.2489T>A	c.(2488-2490)TTC>TAC	p.F830Y	MAGED1_uc004dpm.2_Missense_Mutation_p.F774Y|MAGED1_uc004dpo.2_Missense_Mutation_p.F774Y	NM_001005333	NP_001005333	Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1 isoform a	774					apoptosis|induction of apoptosis by extracellular signals|negative regulation of epithelial cell proliferation|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|plasma membrane|protein complex	protein binding			ovary(3)	3	Ovarian(276;0.236)										Multiple Myeloma(10;0.10)			0.268293	26.006937	27.994211	11	30	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	51645010	51645010	9564	23	T	A	A	A	806	62	MAGED1	3	3
ATRX	546	broad.mit.edu	37	X	76939965	76939965	+	Silent	SNP	G	A	A			TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:76939965G>A	uc004ecp.3	-	c.783C>T	c.(781-783)AAC>AAT	p.N261N	ATRX_uc004ecq.3_Silent_p.N223N|ATRX_uc004eco.3_Silent_p.N46N|ATRX_uc004ecr.2_Silent_p.N222N|ATRX_uc010nlx.1_Silent_p.N261N|ATRX_uc010nly.1_Silent_p.N206N	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	261	ADD.|PHD-type; atypical.				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)					2				0.094595	11.963484	60.841318	28	268	KEEP	---	---	---	---	capture		Silent	SNP	76939965	76939965	1227	23	G	A	A	A	568	44	ATRX	2	2
KRTAP5-5	439915	broad.mit.edu	37	11	1651199	1651228	+	In_Frame_Del	DEL	AGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	-	-	rs35089393;rs71025763;rs71454096	by1000genomes	TCGA-49-4501-01	TCGA-49-4501-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:1651199_1651228delAGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	uc001lty.2	+	c.129_158delAGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	c.(127-159)GGAGGCTGTGGGGGCTGTGGCTCCGGCTGTGCG>GGG	p.GCGGCGSGCA44del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	44_53				A -> G (in Ref. 1; BAD20201 and 2; CAF31639).		keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)										0.53			71	62		---	---	---	---	capture_indel		In_Frame_Del	DEL	1651199	1651228	8886	11	AGGCTGTGGGGGCTGTGGCTCCGGCTGTGC	-	-	-	132	11	KRTAP5-5	5	5
