Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIF1B	23095	broad.mit.edu	37	1	10403337	10403337	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10403337C>A	uc001aqx.3	+	34	3882	c.3680C>A	c.(3679-3681)TCC>TAC	p.S1227Y	KIF1B_uc001aqw.3_Missense_Mutation_p.S1181Y|KIF1B_uc001aqy.2_Missense_Mutation_p.S1201Y|KIF1B_uc001aqz.2_Missense_Mutation_p.S1227Y|KIF1B_uc001ara.2_Missense_Mutation_p.S1187Y|KIF1B_uc001arb.2_Missense_Mutation_p.S1213Y	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	1227					anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		ATGCCACTGTCCAAGCCAGGT	0.423													27	6	---	---	---	---	PASS
FBXO44	93611	broad.mit.edu	37	1	11721284	11721284	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11721284C>T	uc001asm.2	+	6	848	c.722C>T	c.(721-723)CCG>CTG	p.P241L	FBXO44_uc001ask.2_Silent_p.P199P|FBXO44_uc001asl.2_Missense_Mutation_p.P241L|FBXO44_uc001asn.2_Silent_p.P199P|FBXO44_uc010oar.1_Silent_p.P231P|FBXO44_uc010oas.1_Missense_Mutation_p.P101L|FBXO6_uc001aso.2_5'Flank	NM_033182	NP_149438	Q9H4M3	FBX44_HUMAN	F-box protein 44 isoform 1	241	FBA.				protein catabolic process	SCF ubiquitin ligase complex	protein binding			ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.41e-06)|COAD - Colon adenocarcinoma(227;0.000255)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000758)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		TGGTACGGCCCGAGGGTCACC	0.632													51	13	---	---	---	---	PASS
PHACTR4	65979	broad.mit.edu	37	1	28815747	28815747	+	Intron	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28815747G>C	uc001bpw.2	+						PHACTR4_uc001bpv.1_Intron|PHACTR4_uc001bpx.2_Intron|PHACTR4_uc001bpy.2_Intron|PHACTR4_uc001bpz.2_5'Flank	NM_001048183	NP_001041648	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4 isoform 1								actin binding|protein phosphatase inhibitor activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		CGTGAGTCCAGTTATGGAAAT	0.333													19	3	---	---	---	---	PASS
JAK1	3716	broad.mit.edu	37	1	65309869	65309869	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65309869G>A	uc001dbu.1	-	17	2530	c.2281C>T	c.(2281-2283)CCT>TCT	p.P761S	JAK1_uc009wam.1_Missense_Mutation_p.P749S|JAK1_uc009wal.1_5'UTR	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1	761	Protein kinase 1.				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)		ACACACTCAGGAGCAATCCAT	0.498			Mis		ALL								13	125	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70504838	70504838	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70504838C>A	uc001dep.2	+	19	3247	c.3217C>A	c.(3217-3219)CCT>ACT	p.P1073T	LRRC7_uc009wbg.2_Missense_Mutation_p.P357T|LRRC7_uc001deq.2_Missense_Mutation_p.P314T	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1073						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						TTTGATTAGTCCTAGAGCTTA	0.478													45	3	---	---	---	---	PASS
SLC44A5	204962	broad.mit.edu	37	1	75805294	75805294	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75805294G>T	uc001dgu.2	-	4	218	c.74C>A	c.(73-75)CCA>CAA	p.P25Q	SLC44A5_uc001dgt.2_Missense_Mutation_p.P25Q|SLC44A5_uc001dgs.2_5'UTR|SLC44A5_uc001dgr.2_5'UTR|SLC44A5_uc010oqz.1_Missense_Mutation_p.P64Q|SLC44A5_uc010ora.1_Missense_Mutation_p.P19Q|SLC44A5_uc010orb.1_5'UTR	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	25	Cytoplasmic (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						CTTGAAATCTGGGTCATATGT	0.348													244	52	---	---	---	---	PASS
C1orf103	55791	broad.mit.edu	37	1	111495194	111495194	+	Silent	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111495194T>C	uc001eaa.2	-	2	568	c.312A>G	c.(310-312)TCA>TCG	p.S104S	C1orf103_uc001dzz.2_5'UTR|C1orf103_uc001eab.2_Intron|C1orf103_uc001eac.1_Intron	NM_018372	NP_060842	Q5T3J3	LRIF1_HUMAN	receptor-interacting factor 1 isoform 1	104					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	protein binding				0		all_cancers(81;1.02e-05)|all_epithelial(167;1.87e-05)|all_lung(203;0.000234)|Lung NSC(277;0.000451)		Lung(183;0.0155)|Colorectal(144;0.0314)|all cancers(265;0.082)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0891)|COAD - Colon adenocarcinoma(174;0.134)		GAAAATAGTTTGAAGAACTGG	0.373													81	9	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118530769	118530769	+	Silent	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118530769T>C	uc001ehk.2	-	39	5648	c.5580A>G	c.(5578-5580)CCA>CCG	p.P1860P		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1860						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ATGTGTCTGGTGGGCATTTTG	0.358													26	10	---	---	---	---	PASS
HDGF	3068	broad.mit.edu	37	1	156714059	156714059	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156714059C>A	uc001fpy.3	-	4	707	c.385G>T	c.(385-387)GCA>TCA	p.A129S	HDGF_uc009wsd.2_Missense_Mutation_p.A97S|HDGF_uc001fpz.3_Missense_Mutation_p.A122S|HDGF_uc009wse.2_Missense_Mutation_p.A145S|HDGF_uc010phr.1_Missense_Mutation_p.A152S|HDGF_uc009wsf.2_Missense_Mutation_p.A97S|HDGF_uc009wsg.2_Missense_Mutation_p.A129S	NM_004494	NP_004485	P51858	HDGF_HUMAN	hepatoma-derived growth factor isoform a	129	Glu-rich.				cell proliferation|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus	DNA binding|growth factor activity|heparin binding|nucleotide binding			lung(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)		CTGCCCTCTGCATTCCCCTTC	0.562													537	352	---	---	---	---	PASS
CD1C	911	broad.mit.edu	37	1	158259909	158259909	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158259909G>T	uc001fru.2	+	1	347	c.55G>T	c.(55-57)GCA>TCA	p.A19S	CD1C_uc001frv.2_5'Flank	NM_001765	NP_001756	P29017	CD1C_HUMAN	CD1C antigen precursor	19	Extracellular (Potential).				antigen processing and presentation|T cell activation involved in immune response	endosome membrane|integral to plasma membrane	endogenous lipid antigen binding|exogenous lipid antigen binding|glycolipid binding|lipopeptide binding			ovary(2)|skin(1)|pancreas(1)	4	all_hematologic(112;0.0378)					TGGTGACAATGCAGACGGTAA	0.468													48	149	---	---	---	---	PASS
CCDC19	25790	broad.mit.edu	37	1	159846478	159846478	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159846478T>C	uc001fui.2	-	10	1238	c.1220A>G	c.(1219-1221)AAG>AGG	p.K407R	CCDC19_uc009wtb.2_RNA|CCDC19_uc001fuj.2_RNA|CCDC19_uc001fuk.2_Missense_Mutation_p.K322R|CCDC19_uc001ful.2_Missense_Mutation_p.K322R|CCDC19_uc009wtc.1_Silent_p.K406K	NM_012337	NP_036469	Q9UL16	CCD19_HUMAN	nasopharyngeal epithelium specific protein 1	407	Potential.					mitochondrion|soluble fraction				ovary(1)	1	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			CGCATTTTCCTTTTCCTTTCT	0.552													3	103	---	---	---	---	PASS
IGSF9	57549	broad.mit.edu	37	1	159904551	159904551	+	Silent	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159904551T>C	uc001fur.2	-	7	933	c.735A>G	c.(733-735)TCA>TCG	p.S245S	IGSF9_uc001fuq.2_Silent_p.S245S|IGSF9_uc001fup.2_5'Flank	NM_001135050	NP_001128522	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9 isoform a	245	Ig-like 3.|Extracellular (Potential).					cell junction|integral to membrane|synapse				ovary(2)|central_nervous_system(2)|large_intestine(1)	5	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GGCAGGCCAATGAAACATCCT	0.567													78	40	---	---	---	---	PASS
BLZF1	8548	broad.mit.edu	37	1	169349804	169349804	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169349804A>T	uc001gfx.1	+	5	1191	c.754A>T	c.(754-756)AGT>TGT	p.S252C	BLZF1_uc001gfy.2_Missense_Mutation_p.S252C|BLZF1_uc009wvp.1_Missense_Mutation_p.S229C	NM_003666	NP_003657	Q9H2G9	GO45_HUMAN	basic leucine zipper nuclear factor 1	252					cell proliferation|Golgi organization|Golgi to plasma membrane protein transport|regulation of cell growth|regulation of transcription from RNA polymerase II promoter	Golgi lumen|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding			skin(1)	1	all_hematologic(923;0.208)					AGATCTCCTAAGTGAACGGGA	0.408													48	134	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169555505	169555505	+	Silent	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169555505G>A	uc001ggg.1	-	1	265	c.120C>T	c.(118-120)GGC>GGT	p.G40G	F5_uc010plr.1_RNA	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	40	F5/8 type A 1.|Plastocyanin-like 1.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	TCCAACTGATGCCCTGAGCAG	0.567													92	58	---	---	---	---	PASS
METTL13	51603	broad.mit.edu	37	1	171753036	171753036	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171753036G>C	uc001ghz.2	+	2	657	c.310G>C	c.(310-312)GAC>CAC	p.D104H	METTL13_uc001gia.2_Missense_Mutation_p.D18H|METTL13_uc001gib.2_Missense_Mutation_p.D104H|METTL13_uc010pml.1_Missense_Mutation_p.D103H	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN	CGI-01 protein isoform 1	104							methyltransferase activity|protein binding			kidney(1)	1						CTTGAAGATGGACATGACGCA	0.502													52	139	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175046735	175046735	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175046735G>T	uc001gkl.1	+	2	294	c.181G>T	c.(181-183)GAC>TAC	p.D61Y	TNN_uc010pmx.1_Missense_Mutation_p.D61Y	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	61					cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GGTTGACGCTGACCCTCAGCC	0.592													40	64	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175299209	175299209	+	Splice_Site	SNP	C	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175299209C>G	uc001gkp.1	-	19	3874	c.3793_splice	c.e19+1	p.G1265_splice	TNR_uc009wwu.1_Splice_Site_p.G1265_splice	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					GCCATAGGTACCCGCAGTGCC	0.587													74	55	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190067447	190067447	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190067447C>A	uc001gse.1	-	8	2234	c.2002G>T	c.(2002-2004)GTG>TTG	p.V668L	FAM5C_uc010pot.1_Missense_Mutation_p.V566L	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	668						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					TAGCCAAACACTTGAATGTTA	0.453													81	205	---	---	---	---	PASS
CFHR5	81494	broad.mit.edu	37	1	196965178	196965178	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196965178C>A	uc001gts.3	+	6	945	c.817C>A	c.(817-819)CCT>ACT	p.P273T		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor	273	Sushi 5.				complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2						TGGATACATACCTGAACTCGA	0.338													85	221	---	---	---	---	PASS
CYB5R1	51706	broad.mit.edu	37	1	202936319	202936319	+	Silent	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202936319C>T	uc001gyt.2	-	1	86	c.15G>A	c.(13-15)ACG>ACA	p.T5T	CYB5R1_uc010pqe.1_RNA	NM_016243	NP_057327	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1	5					sterol biosynthetic process	integral to membrane	cytochrome-b5 reductase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(75;0.141)			AGGGTCTTACCGTCTGGATCC	0.547													11	26	---	---	---	---	PASS
DSTYK	25778	broad.mit.edu	37	1	205116781	205116781	+	Silent	SNP	A	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205116781A>G	uc001hbw.2	-	13	2759	c.2695T>C	c.(2695-2697)TTG>CTG	p.L899L	DSTYK_uc001hbx.2_Silent_p.L854L	NM_015375	NP_056190	Q6XUX3	DUSTY_HUMAN	receptor interacting protein kinase 5 isoform 1	899	Protein kinase.					cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(1)	1						ACAATGCCCAAGAGAGGCCTC	0.532													201	138	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216144034	216144034	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216144034G>A	uc001hku.1	-	36	7277	c.6890C>T	c.(6889-6891)GCT>GTT	p.A2297V		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2297	Fibronectin type-III 9.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACTCCAAGGAGCAAATCCGTA	0.413										HNSCC(13;0.011)			90	185	---	---	---	---	PASS
HIST3H2A	92815	broad.mit.edu	37	1	228645337	228645337	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228645337G>A	uc001hsy.2	-	1	224	c.182C>T	c.(181-183)GCC>GTC	p.A61V	HIST3H2BB_uc001hsz.2_5'Flank	NM_033445	NP_254280	Q7L7L0	H2A3_HUMAN	histone cluster 3, H2a	61					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)	1		Prostate(94;0.183)				CAGGATCTCGGCAGTCAAGTA	0.687													4	103	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237798254	237798254	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237798254G>A	uc001hyl.1	+	44	6874	c.6754G>A	c.(6754-6756)GAA>AAA	p.E2252K		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2252	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGATAATAATGAACTAGCATT	0.428													6	17	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237921021	237921021	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237921021C>T	uc001hyl.1	+	82	11390	c.11270C>T	c.(11269-11271)GCT>GTT	p.A3757V	RYR2_uc010pya.1_Missense_Mutation_p.A172V	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3757					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATGGTAGCAGCTACTCTGAAA	0.368													48	124	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237942003	237942003	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237942003G>A	uc001hyl.1	+	88	11933	c.11813G>A	c.(11812-11814)AGC>AAC	p.S3938N	RYR2_uc010pya.1_Missense_Mutation_p.S353N	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3938					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTGGCACACAGCAGGCTGTGG	0.448													46	130	---	---	---	---	PASS
OR2C3	81472	broad.mit.edu	37	1	247695265	247695265	+	Silent	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247695265G>T	uc009xgy.2	-	2	911	c.549C>A	c.(547-549)CCC>CCA	p.P183P	C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	NM_198074	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C,	183	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			GCATAATGAGGGGCATCTCGC	0.562													39	15	---	---	---	---	PASS
OR13G1	441933	broad.mit.edu	37	1	247835993	247835993	+	Nonsense_Mutation	SNP	A	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247835993A>C	uc001idi.1	-	1	351	c.351T>G	c.(349-351)TAT>TAG	p.Y117*		NM_001005487	NP_001005487	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G,	117	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CATAGCGGTCATAGGCCATGG	0.463													35	82	---	---	---	---	PASS
OR1C1	26188	broad.mit.edu	37	1	247920813	247920813	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247920813C>T	uc010pza.1	-	1	896	c.896G>A	c.(895-897)AGG>AAG	p.R299K		NM_012353	NP_036485	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C,	299	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CTGAAGTCCCCTCTTCATATC	0.418													53	195	---	---	---	---	PASS
OR14A16	284532	broad.mit.edu	37	1	247978629	247978629	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247978629C>A	uc001idm.1	-	1	403	c.403G>T	c.(403-405)GAC>TAC	p.D135Y		NM_001001966	NP_001001966	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A,	135	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GTGCTCCTGTCCATGATGACA	0.517													98	217	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004903	248004903	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004903G>A	uc001idn.1	-	1	296	c.296C>T	c.(295-297)GCA>GTA	p.A99V		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	99	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GTAGAGCTGTGCCATGCAGGC	0.592													18	43	---	---	---	---	PASS
OR2L13	284521	broad.mit.edu	37	1	248263567	248263567	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248263567T>C	uc001ids.2	+	3	1227	c.890T>C	c.(889-891)CTG>CCG	p.L297P		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	297	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			AAGGAAGTCCTGGGGGCTATG	0.473													76	59	---	---	---	---	PASS
OR2M5	127059	broad.mit.edu	37	1	248309138	248309138	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248309138C>A	uc010pze.1	+	1	689	c.689C>A	c.(688-690)TCT>TAT	p.S230Y		NM_001004690	NP_001004690	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M,	230	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|kidney(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			CACATGGGATCTGGAGAGGGT	0.448													422	298	---	---	---	---	PASS
OR2T33	391195	broad.mit.edu	37	1	248437007	248437007	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248437007A>T	uc010pzi.1	-	1	110	c.110T>A	c.(109-111)CTG>CAG	p.L37Q		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	37	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ATTGCCAAACAGGGAGGTCAA	0.488													61	169	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248525905	248525905	+	Silent	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525905T>A	uc001ieh.1	+	1	1023	c.1023T>A	c.(1021-1023)CCT>CCA	p.P341P		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	341	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAGTGGAACCTGCCTTTCAAA	0.388													94	207	---	---	---	---	PASS
KIDINS220	57498	broad.mit.edu	37	2	8952524	8952524	+	Splice_Site	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8952524C>T	uc002qzc.2	-	6	686	c.504_splice	c.e6+1	p.K168_splice	KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Splice_Site_p.K126_splice|KIDINS220_uc010yiw.1_Splice_Site_p.K169_splice	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa						activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TGCTGACCTACCTTATCAGAG	0.398													32	94	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21230036	21230036	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21230036G>T	uc002red.2	-	26	9832	c.9704C>A	c.(9703-9705)GCT>GAT	p.A3235D		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3235	Heparin-binding.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	AGATTTTTCAGCTTTGTACTT	0.363													47	103	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26696918	26696918	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26696918C>A	uc002rhk.2	-	27	3476	c.3349G>T	c.(3349-3351)GGT>TGT	p.G1117C	OTOF_uc010yla.1_5'Flank|OTOF_uc002rhh.2_Missense_Mutation_p.G370C|OTOF_uc002rhi.2_Missense_Mutation_p.G427C|OTOF_uc002rhj.2_Missense_Mutation_p.G370C	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	1117	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGATGGGACCTCGGTCCACG	0.647													113	70	---	---	---	---	PASS
ZNF512	84450	broad.mit.edu	37	2	27826121	27826121	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27826121C>T	uc002rla.2	+	9	970	c.883C>T	c.(883-885)CCA>TCA	p.P295S	ZNF512_uc010ylv.1_Missense_Mutation_p.P216S|ZNF512_uc010ylw.1_Missense_Mutation_p.P266S|ZNF512_uc002rlb.2_Missense_Mutation_p.P216S|ZNF512_uc010ylx.1_Missense_Mutation_p.P216S|ZNF512_uc002rlc.2_Missense_Mutation_p.P216S|ZNF512_uc010yly.1_RNA|ZNF512_uc010ylz.1_Missense_Mutation_p.P188S	NM_032434	NP_115810	Q96ME7	ZN512_HUMAN	zinc finger protein 512	295	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					CTGTGGAAAACCATATAGGTC	0.488													93	245	---	---	---	---	PASS
SRBD1	55133	broad.mit.edu	37	2	45704186	45704186	+	Silent	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45704186T>A	uc002rus.2	-	16	2071	c.1995A>T	c.(1993-1995)CCA>CCT	p.P665P	SRBD1_uc010yoc.1_Silent_p.P184P	NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	665					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			GCTCAGCTAATGGATCTTGTA	0.338													65	53	---	---	---	---	PASS
VRK2	7444	broad.mit.edu	37	2	58350361	58350361	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58350361G>T	uc002rzo.2	+	11	1414	c.669G>T	c.(667-669)AAG>AAT	p.K223N	VRK2_uc010fcb.2_Missense_Mutation_p.K223N|VRK2_uc002rzs.2_Missense_Mutation_p.K223N|VRK2_uc002rzr.2_Missense_Mutation_p.K223N|VRK2_uc010fcc.2_Missense_Mutation_p.K105N|VRK2_uc002rzv.2_Missense_Mutation_p.K223N|VRK2_uc010fcd.2_Missense_Mutation_p.K200N|VRK2_uc002rzp.2_Missense_Mutation_p.K223N|VRK2_uc010ypg.1_Missense_Mutation_p.K223N|VRK2_uc002rzq.2_Missense_Mutation_p.K223N|VRK2_uc002rzu.2_Missense_Mutation_p.K223N|VRK2_uc002rzt.2_Missense_Mutation_p.K105N|VRK2_uc010yph.1_Missense_Mutation_p.K105N	NM_001130482	NP_001123954	Q86Y07	VRK2_HUMAN	vaccinia related kinase 2 isoform 2	223	Protein kinase.					integral to membrane	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						ATGCCCACAAGGGAGTAGGTG	0.393													73	207	---	---	---	---	PASS
WDR92	116143	broad.mit.edu	37	2	68361898	68361898	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68361898G>T	uc002see.1	-	7	883	c.802C>A	c.(802-804)CTG>ATG	p.L268M	WDR92_uc002sed.1_RNA|WDR92_uc002sef.1_Missense_Mutation_p.L268M|WDR92_uc002seg.1_Missense_Mutation_p.L167M	NM_138458	NP_612467	Q96MX6	WDR92_HUMAN	monad	268	WD 5.				apoptosis|histone lysine methylation		methylated histone residue binding				0						TTCTGCGGCAGGTGTCGGACC	0.507													24	40	---	---	---	---	PASS
CD207	50489	broad.mit.edu	37	2	71058916	71058916	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71058916T>C	uc002shg.2	-	5	799	c.752A>G	c.(751-753)TAC>TGC	p.Y251C		NM_015717	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 antigen, langerin	251	C-type lectin.|Extracellular (Potential).				defense response to virus	endocytic vesicle|integral to membrane	mannose binding			ovary(1)|lung(1)	2						GCCAATCCAGTAGATGAGTCC	0.537													59	154	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89987002	89987002	+	Intron	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89987002G>T	uc010fhm.2	+						uc002stn.1_RNA					Parts of antibodies, mostly variable regions.																		GTCAGGGACAGATTTCACACT	0.527													6	163	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100194833	100194833	+	Silent	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100194833G>A	uc002tag.2	-	17	3110	c.2874C>T	c.(2872-2874)AAC>AAT	p.N958N	AFF3_uc002taf.2_Silent_p.N983N	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	958					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						CCCTGTGGCCGTTGGAGCCTG	0.493													103	354	---	---	---	---	PASS
MRPS9	64965	broad.mit.edu	37	2	105654683	105654683	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105654683C>A	uc002tcn.3	+	1	201	c.133C>A	c.(133-135)CAG>AAG	p.Q45K		NM_182640	NP_872578	P82933	RT09_HUMAN	mitochondrial ribosomal protein S9 precursor	45					DNA damage response, detection of DNA damage|translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome				0						TGTCAGATCCCAGGTAAGGCC	0.622													10	24	---	---	---	---	PASS
GTDC1	79712	broad.mit.edu	37	2	144764848	144764848	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144764848T>G	uc002tvp.2	-	7	1055	c.776A>C	c.(775-777)CAT>CCT	p.H259P	GTDC1_uc002tvo.2_Missense_Mutation_p.H259P|GTDC1_uc002tvq.2_Intron|GTDC1_uc002tvr.2_Missense_Mutation_p.H259P|GTDC1_uc010fnn.2_Missense_Mutation_p.H259P|GTDC1_uc002tvs.2_Missense_Mutation_p.H227P|GTDC1_uc010fno.2_Missense_Mutation_p.H130P|GTDC1_uc002tvt.1_Missense_Mutation_p.H259P	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	259					biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)		ATTTTCACCATGATGAGAGCT	0.413													65	117	---	---	---	---	PASS
PRPF40A	55660	broad.mit.edu	37	2	153519149	153519149	+	Nonsense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153519149G>A	uc002tyh.3	-	21	2312	c.2290C>T	c.(2290-2292)CGA>TGA	p.R764*	PRPF40A_uc002tyg.3_Nonsense_Mutation_p.R220*|PRPF40A_uc010zcd.1_Nonsense_Mutation_p.R715*	NM_017892	NP_060362	O75400	PR40A_HUMAN	formin binding protein 3	791	FF 5.				mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0						TTAAATATTCGTTTTCTTTCA	0.264													9	20	---	---	---	---	PASS
SCN7A	6332	broad.mit.edu	37	2	167327160	167327160	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167327160G>C	uc002udu.1	-	6	756	c.629C>G	c.(628-630)ACT>AGT	p.T210S	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	210	Helical; Voltage-sensor; Name=S4 of repeat I; (By similarity).				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						AATTCTCAAAGTTCTTGCAGT	0.299													23	31	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168103567	168103567	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168103567G>T	uc002udx.2	+	8	5683	c.5665G>T	c.(5665-5667)GAT>TAT	p.D1889Y	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.D1714Y|XIRP2_uc010fpq.2_Missense_Mutation_p.D1667Y|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1714					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TAAACAGCCTGATGCCATCCC	0.368													51	68	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168103615	168103615	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168103615G>C	uc002udx.2	+	8	5731	c.5713G>C	c.(5713-5715)GCT>CCT	p.A1905P	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.A1730P|XIRP2_uc010fpq.2_Missense_Mutation_p.A1683P|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1730					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						CCTTGAAAAAGCTACAAATAC	0.368													35	56	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179400408	179400408	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179400408A>G	uc010zfg.1	-	307	93454	c.93230T>C	c.(93229-93231)ATT>ACT	p.I31077T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.I24772T|TTN_uc010zfi.1_Missense_Mutation_p.I24705T|TTN_uc010zfj.1_Missense_Mutation_p.I24580T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	32004							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTGTGACAATAACTTGGTA	0.423													122	156	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179414471	179414471	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179414471G>A	uc010zfg.1	-	287	84498	c.84274C>T	c.(84274-84276)CGG>TGG	p.R28092W	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R21787W|TTN_uc010zfi.1_Missense_Mutation_p.R21720W|TTN_uc010zfj.1_Missense_Mutation_p.R21595W	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29019							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGGTTTCCCGTTTTTCAATG	0.438													57	67	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179500272	179500272	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179500272C>T	uc010zfg.1	-	176	34299	c.34075G>A	c.(34075-34077)GGA>AGA	p.G11359R	TTN_uc010zfh.1_Missense_Mutation_p.G5054R|TTN_uc010zfi.1_Missense_Mutation_p.G4987R|TTN_uc010zfj.1_Missense_Mutation_p.G4862R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12286							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGATGATTTCCATCTCTCAGT	0.378													5	10	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179581922	179581922	+	Silent	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179581922C>A	uc010zfg.1	-	85	22031	c.21807G>T	c.(21805-21807)CTG>CTT	p.L7269L	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.L3930L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8196							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGAGAACTGTCAGAGTGGCAG	0.493													49	59	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179599249	179599249	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179599249G>C	uc010zfg.1	-	49	11794	c.11570C>G	c.(11569-11571)ACT>AGT	p.T3857S	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.T518S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	4784							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAATGGTCCAGTGCCTGAGAC	0.388													94	129	---	---	---	---	PASS
CCDC141	285025	broad.mit.edu	37	2	179733888	179733888	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179733888C>G	uc002unf.1	-	5	682	c.625G>C	c.(625-627)GAT>CAT	p.D209H		NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	209							protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TACAGGATATCCTCGTAATCC	0.403													88	137	---	---	---	---	PASS
ZNF385B	151126	broad.mit.edu	37	2	180383331	180383331	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180383331G>T	uc002unn.3	-	5	1035	c.431C>A	c.(430-432)ACA>AAA	p.T144K	ZNF385B_uc002unj.2_Missense_Mutation_p.T42K|ZNF385B_uc002unk.2_RNA|ZNF385B_uc002unl.2_Missense_Mutation_p.T41K|ZNF385B_uc002unm.2_Missense_Mutation_p.T68K	NM_152520	NP_689733	Q569K4	Z385B_HUMAN	zinc finger protein 385B isoform 1	144						nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			TACTCCAAATGTATGGTTAAT	0.343													71	143	---	---	---	---	PASS
FAM171B	165215	broad.mit.edu	37	2	187627521	187627521	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187627521G>T	uc002ups.2	+	8	2564	c.2452G>T	c.(2452-2454)GAG>TAG	p.E818*	FAM171B_uc002upr.1_Nonsense_Mutation_p.E785*|FAM171B_uc002upt.2_Nonsense_Mutation_p.E287*	NM_177454	NP_803237	Q6P995	F171B_HUMAN	KIAA1946	818	Cytoplasmic (Potential).					integral to membrane	DNA binding			ovary(6)|breast(3)|central_nervous_system(1)	10						GAAGAAGCGAGAGGAACGCCC	0.438													33	40	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189899824	189899824	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189899824G>A	uc002uqk.2	-	53	4446	c.4171C>T	c.(4171-4173)CGC>TGC	p.R1391C	COL5A2_uc010frx.2_Missense_Mutation_p.R967C	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	1391	Fibrillar collagen NC1.				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			GATAAAAGGCGCAAAAAAGTC	0.398													97	76	---	---	---	---	PASS
ICOS	29851	broad.mit.edu	37	2	204822598	204822598	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204822598G>A	uc002vam.2	+	4	645	c.578G>A	c.(577-579)AGA>AAA	p.R193K	ICOS_uc010zip.1_Missense_Mutation_p.R193K|ICOS_uc010fua.2_Intron	NM_012092	NP_036224	Q9Y6W8	ICOS_HUMAN	inducible T-cell co-stimulator precursor	193	Cytoplasmic (Potential).				immune response|T cell costimulation	extracellular region					0						AAAAAATCTAGACTCACAGGT	0.388													59	71	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211465305	211465305	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211465305C>T	uc002vee.3	+	15	1708	c.1576C>T	c.(1576-1578)CTC>TTC	p.L526F	CPS1_uc010fur.2_Missense_Mutation_p.L532F|CPS1_uc010fus.2_Missense_Mutation_p.L75F	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	526					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		GAGAGGTGTGCTCAAGGAATA	0.363													81	125	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215862486	215862486	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215862486G>C	uc002vew.2	-	23	3447	c.3227C>G	c.(3226-3228)GCC>GGC	p.A1076G	ABCA12_uc002vev.2_Missense_Mutation_p.A758G|ABCA12_uc010zjn.1_Missense_Mutation_p.A3G	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	1076	Helical; (Potential).				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TACAACCCAGGCAACCATAAG	0.363													38	44	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216241299	216241299	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216241299C>A	uc002vfa.2	-	36	6075	c.5809G>T	c.(5809-5811)GTT>TTT	p.V1937F	FN1_uc002vfb.2_Missense_Mutation_p.V1756F|FN1_uc002vfc.2_Missense_Mutation_p.V1756F|FN1_uc002vfd.2_Missense_Mutation_p.V1937F|FN1_uc002vfe.2_Missense_Mutation_p.V1846F|FN1_uc002vff.2_Missense_Mutation_p.V1846F|FN1_uc002vfg.2_Missense_Mutation_p.V1756F|FN1_uc002vfh.2_Missense_Mutation_p.V1756F|FN1_uc002vfi.2_Missense_Mutation_p.V1937F|FN1_uc002vfj.2_Missense_Mutation_p.V1847F|FN1_uc002vez.2_Missense_Mutation_p.V131F|FN1_uc010zjp.1_Missense_Mutation_p.V474F|FN1_uc002vfk.1_RNA|FN1_uc010fva.1_RNA|FN1_uc010fvb.1_RNA|FN1_uc010fvc.1_Missense_Mutation_p.V299F|FN1_uc010fvd.1_Intron	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ACGGCATCAACTTGGAAGCCA	0.512													28	39	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228882652	228882652	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228882652T>A	uc002vpq.2	-	7	2965	c.2918A>T	c.(2917-2919)AAC>ATC	p.N973I	SPHKAP_uc002vpp.2_Missense_Mutation_p.N973I|SPHKAP_uc010zlx.1_Missense_Mutation_p.N973I	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	973						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GCAGGGTACGTTGGGTGTCAT	0.522													48	75	---	---	---	---	PASS
DNER	92737	broad.mit.edu	37	2	230253096	230253096	+	Missense_Mutation	SNP	A	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230253096A>C	uc002vpv.2	-	11	1887	c.1740T>G	c.(1738-1740)ATT>ATG	p.I580M		NM_139072	NP_620711	Q8NFT8	DNER_HUMAN	delta-notch-like EGF repeat-containing	580	Extracellular (Potential).				central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity			lung(5)|ovary(2)|skin(1)	8		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		CATTTATGTCAATGTCGCACT	0.502													109	170	---	---	---	---	PASS
USP40	55230	broad.mit.edu	37	2	234468512	234468512	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234468512T>C	uc010zmu.1	-	4	444	c.326A>G	c.(325-327)CAG>CGG	p.Q109R	USP40_uc010zmr.1_Missense_Mutation_p.Q121R			Q9NVE5	UBP40_HUMAN	SubName: Full=cDNA FLJ56772, highly similar to Ubiquitin carboxyl-terminal hydrolase 40 (EC 3.1.2.15);	109					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)|breast(1)	3		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		TGCAGCTTCCTGGTCTAAGAG	0.438													14	18	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238283145	238283145	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238283145C>T	uc002vwl.2	-	8	3874	c.3589G>A	c.(3589-3591)GTC>ATC	p.V1197I	COL6A3_uc002vwo.2_Missense_Mutation_p.V991I|COL6A3_uc010znj.1_Missense_Mutation_p.V590I|COL6A3_uc002vwq.2_Missense_Mutation_p.V991I|COL6A3_uc002vwr.2_Missense_Mutation_p.V790I	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1197	Nonhelical region.|VWFA 6.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		ACCTGTTGGACGGTCCCCAGC	0.622													49	69	---	---	---	---	PASS
KIF1A	547	broad.mit.edu	37	2	241658532	241658532	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241658532C>G	uc002vzy.2	-	45	4948	c.4802G>C	c.(4801-4803)CGC>CCC	p.R1601P	KIF1A_uc010fzk.2_Missense_Mutation_p.R1702P|KIF1A_uc002vzw.2_Missense_Mutation_p.R262P|KIF1A_uc002vzx.2_Missense_Mutation_p.R328P	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles	1601	PH.				anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GGCATAGGGGCGCCGCACCAC	0.627													75	95	---	---	---	---	PASS
ANKRD28	23243	broad.mit.edu	37	3	15762485	15762485	+	Silent	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15762485T>C	uc003caj.1	-	8	986	c.843A>G	c.(841-843)GCA>GCG	p.A281A	ANKRD28_uc003cai.1_Silent_p.A127A|ANKRD28_uc011avz.1_Silent_p.A127A|ANKRD28_uc003cak.1_RNA|ANKRD28_uc011awa.1_RNA|ANKRD28_uc003cal.1_Silent_p.A311A|ANKRD28_uc003cam.2_Silent_p.A314A	NM_015199	NP_056014	O15084	ANR28_HUMAN	ankyrin repeat domain 28	281	ANK 8.					nucleoplasm	protein binding			breast(1)	1						CATGTGTTGATGCAGCAGCAA	0.363													96	14	---	---	---	---	PASS
SCAP	22937	broad.mit.edu	37	3	47468674	47468674	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47468674G>A	uc003crh.1	-	6	965	c.710C>T	c.(709-711)ACC>ATC	p.T237I	SCAP_uc011baz.1_Intron|SCAP_uc003crg.2_Intron	NM_012235	NP_036367	Q12770	SCAP_HUMAN	SREBF chaperone protein	237	Lumenal (By similarity).				cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		GAAGACCAGGGTGATGGTGTA	0.527													105	15	---	---	---	---	PASS
RNF123	63891	broad.mit.edu	37	3	49742178	49742178	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49742178G>T	uc003cxh.2	+	22	2034	c.1948G>T	c.(1948-1950)GCT>TCT	p.A650S	RNF123_uc010hky.1_Missense_Mutation_p.A312S|RNF123_uc003cxi.2_RNA	NM_022064	NP_071347	Q5XPI4	RN123_HUMAN	ring finger protein 123	650						cytoplasm	ligase activity|protein binding|zinc ion binding			kidney(3)|ovary(1)|lung(1)|breast(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GCCAGCCCCAGCTATGGCCCA	0.592													3	0	---	---	---	---	PASS
UBA3	9039	broad.mit.edu	37	3	69111294	69111294	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69111294T>A	uc003dno.2	-	10	750	c.730A>T	c.(730-732)AGG>TGG	p.R244W	UBA3_uc003dnq.2_Missense_Mutation_p.R230W|UBA3_uc011bfy.1_Missense_Mutation_p.R67W|UBA3_uc011bfz.1_Missense_Mutation_p.R67W	NM_003968	NP_003959	Q8TBC4	UBA3_HUMAN	ubiquitin-activating enzyme 3 isoform 1	244	Interaction with NAE1.				protein neddylation|proteolysis	nucleus	acid-amino acid ligase activity|ATP binding|protein heterodimerization activity			ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.98e-05)|Epithelial(33;0.000363)|LUSC - Lung squamous cell carcinoma(21;0.012)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.206)|Kidney(39;0.241)		TCTGGTAGCCTGGGCATAGAT	0.363													72	24	---	---	---	---	PASS
STX19	415117	broad.mit.edu	37	3	93734029	93734029	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93734029C>T	uc003drh.1	-	2	342	c.85G>A	c.(85-87)GAG>AAG	p.E29K	ARL13B_uc003drc.2_Intron|ARL13B_uc010hop.2_Intron|ARL13B_uc003drd.2_Intron|ARL13B_uc003dre.2_Intron|ARL13B_uc003drf.2_Intron|ARL13B_uc003drg.2_Intron	NM_001001850	NP_001001850	Q8N4C7	STX19_HUMAN	syntaxin 19	29					intracellular protein transport|vesicle-mediated transport	membrane	SNAP receptor activity				0						CCTTGTTCCTCTGTTTCTGTA	0.393													102	116	---	---	---	---	PASS
CPNE4	131034	broad.mit.edu	37	3	131306318	131306318	+	Intron	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131306318G>A	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						AAAAGTGGTTGACCATGTACC	0.448													64	175	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140178441	140178441	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140178441G>T	uc003etn.2	+	7	1242	c.1052G>T	c.(1051-1053)AGC>ATC	p.S351I	CLSTN2_uc003etm.2_Missense_Mutation_p.S351I	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	351	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						CTGGTGGACAGCAGTGAGATG	0.562										HNSCC(16;0.037)			11	296	---	---	---	---	PASS
ACPL2	92370	broad.mit.edu	37	3	141011380	141011380	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141011380G>A	uc003etu.2	+	8	1075	c.776G>A	c.(775-777)CGT>CAT	p.R259H	ACPL2_uc003etv.2_Missense_Mutation_p.R259H|ACPL2_uc011bna.1_Missense_Mutation_p.R221H|ACPL2_uc011bnb.1_Missense_Mutation_p.R242H	NM_152282	NP_689495	Q8TE99	ACPL2_HUMAN	acid phosphatase-like 2 precursor	259						extracellular region	acid phosphatase activity			skin(1)	1						AAGGAGCAGCGTCGTCAGTAC	0.527													7	218	---	---	---	---	PASS
TM4SF4	7104	broad.mit.edu	37	3	149216547	149216547	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149216547G>A	uc003exd.1	+	4	671	c.440G>A	c.(439-441)CGA>CAA	p.R147Q		NM_004617	NP_004608	P48230	T4S4_HUMAN	transmembrane 4 superfamily member 4	147	Extracellular (Potential).					integral to membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			AACAAGTGCCGAGAGCCTCTC	0.483													14	229	---	---	---	---	PASS
SELT	51714	broad.mit.edu	37	3	150321258	150321258	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150321258A>T	uc011bnx.1	+	1	193	c.109A>T	c.(109-111)ACG>TCG	p.T37S	SERP1_uc003exz.2_5'Flank|uc003eye.1_5'Flank	NM_016275	NP_057359	P62341	SELT_HUMAN	selenoprotein T precursor	37					cell redox homeostasis|selenocysteine incorporation		selenium binding				0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GCAGTACGCCACGGGGCCGCT	0.667													27	33	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155282833	155282833	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155282833C>T	uc011bok.1	-	7	1181	c.904G>A	c.(904-906)GAT>AAT	p.D302N	PLCH1_uc011boj.1_Missense_Mutation_p.D302N|PLCH1_uc011bol.1_Missense_Mutation_p.D284N	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	302	PI-PLC X-box.				lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			AGGGGCTGATCCATGTCTTGG	0.463													35	214	---	---	---	---	PASS
ARPM1	84517	broad.mit.edu	37	3	169485535	169485535	+	Silent	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169485535G>T	uc003ffs.1	-	2	1179	c.804C>A	c.(802-804)GCC>GCA	p.A268A	TERC_uc003ffr.1_5'Flank	NM_032487	NP_115876	Q9BYD9	ARPM1_HUMAN	actin related protein M1	268						cytoplasm|cytoskeleton					0	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;5.01e-59)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			CAATGCCAGGGGCCTCAAGGT	0.468													195	251	---	---	---	---	PASS
CCDC39	339829	broad.mit.edu	37	3	180366077	180366077	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180366077G>T	uc010hxe.2	-	10	1353	c.1238C>A	c.(1237-1239)ACA>AAA	p.T413K	CCDC39_uc003fkn.2_RNA	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	413	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TTCTTTCATTGTCTCAGTCTG	0.353													196	207	---	---	---	---	PASS
ZNF518B	85460	broad.mit.edu	37	4	10446229	10446229	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10446229T>C	uc003gmn.2	-	3	2211	c.1724A>G	c.(1723-1725)AAC>AGC	p.N575S		NM_053042	NP_444270	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	575					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4						CTCTGTCTGGTTATCTTCCTG	0.373													101	142	---	---	---	---	PASS
GBA3	57733	broad.mit.edu	37	4	22749453	22749453	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22749453C>A	uc003gqp.3	+	3	912	c.821C>A	c.(820-822)TCC>TAC	p.S274Y	GBA3_uc010iep.2_Intron|GBA3_uc011bxo.1_Missense_Mutation_p.S275Y	NM_020973	NP_066024	Q9H227	GBA3_HUMAN	cytosolic beta-glucosidase isoform a	274					glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity				0						CAGATTGCCTCCATGAGTCAA	0.408													18	31	---	---	---	---	PASS
BEND4	389206	broad.mit.edu	37	4	42145884	42145884	+	Silent	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42145884G>A	uc003gwn.2	-	3	1195	c.615C>T	c.(613-615)GGC>GGT	p.G205G	BEND4_uc003gwm.2_Silent_p.G205G|BEND4_uc011byy.1_Silent_p.G205G	NM_207406	NP_997289	Q6ZU67	BEND4_HUMAN	BEN domain containing 4 isoform a	205											0						TGTAACTTGAGCCTTCCTGCT	0.468													16	32	---	---	---	---	PASS
ATP8A1	10396	broad.mit.edu	37	4	42576678	42576678	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42576678A>T	uc003gwr.2	-	14	1485	c.1253T>A	c.(1252-1254)GTA>GAA	p.V418E	ATP8A1_uc003gws.2_Missense_Mutation_p.V418E|ATP8A1_uc011byz.1_Missense_Mutation_p.V418E	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),	418	Cytoplasmic (Potential).				ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)	AAACTGCATTACATTGCATGT	0.308													44	46	---	---	---	---	PASS
KCTD8	386617	broad.mit.edu	37	4	44177251	44177251	+	Silent	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44177251T>A	uc003gwu.2	-	2	1262	c.978A>T	c.(976-978)ATA>ATT	p.I326I		NM_198353	NP_938167	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerisation domain	326						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(2)|ovary(1)	3						TAGGTGATACTATTTTCTGAG	0.348										HNSCC(17;0.042)			35	53	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46060643	46060643	+	Intron	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46060643T>C	uc003gxb.2	-							NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		TATCCATCTATAGAGAAAAAA	0.333													27	45	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66230755	66230755	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66230755A>G	uc003hcy.2	-	12	2409	c.2216T>C	c.(2215-2217)TTA>TCA	p.L739S	EPHA5_uc003hcx.2_Missense_Mutation_p.L671S|EPHA5_uc003hcz.2_Missense_Mutation_p.L717S|EPHA5_uc011cah.1_Missense_Mutation_p.L740S|EPHA5_uc011cai.1_Missense_Mutation_p.L718S|EPHA5_uc003hda.2_Missense_Mutation_p.L740S	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	739	Cytoplasmic (Potential).|Protein kinase.				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						CACACCTTCTAAATGGATGAT	0.358										TSP Lung(17;0.13)			100	131	---	---	---	---	PASS
UGT2A1	10941	broad.mit.edu	37	4	70504808	70504808	+	Intron	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70504808G>A	uc003hem.3	-						UGT2A1_uc011caq.1_Missense_Mutation_p.P385L|UGT2A1_uc010ihu.2_Intron|UGT2A1_uc010iht.2_Intron|UGT2A1_uc010ihs.2_Missense_Mutation_p.P176L	NM_006798	NP_006789	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family,						detection of chemical stimulus|sensory perception of smell	integral to membrane	glucuronosyltransferase activity|glucuronosyltransferase activity			ovary(1)	1						TGTTGATGCTGGAGAGAACCT	0.463													29	44	---	---	---	---	PASS
CSN3	1448	broad.mit.edu	37	4	71115032	71115032	+	Silent	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71115032T>C	uc003hfe.3	+	4	463	c.405T>C	c.(403-405)AAT>AAC	p.N135N		NM_005212	NP_005203	P07498	CASK_HUMAN	casein kappa precursor	135						extracellular region	protein binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						CTACCATCAATACCATTGCTA	0.483													33	49	---	---	---	---	PASS
AMTN	401138	broad.mit.edu	37	4	71396799	71396799	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71396799G>T	uc003hfk.1	+	8	490	c.401G>T	c.(400-402)GGA>GTA	p.G134V	AMTN_uc010ihy.1_Missense_Mutation_p.G133V	NM_212557	NP_997722	Q6UX39	AMTN_HUMAN	amelotin precursor	134					biomineral tissue development|cell adhesion|odontogenesis of dentine-containing tooth	basal lamina|cell-cell junction				large_intestine(1)|central_nervous_system(1)	2			Lung(101;0.235)			TTGTTCCCGGGAGGCATCCTG	0.512													25	31	---	---	---	---	PASS
GC	2638	broad.mit.edu	37	4	72622592	72622592	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72622592T>C	uc003hge.2	-	8	1024	c.871A>G	c.(871-873)ACA>GCA	p.T291A	GC_uc003hgd.2_Missense_Mutation_p.T169A|GC_uc010iie.2_Missense_Mutation_p.T291A|GC_uc010iif.2_Missense_Mutation_p.T310A	NM_000583	NP_000574	P02774	VTDB_HUMAN	vitamin D-binding protein precursor	291	Albumin 2.				hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		all_hematologic(202;0.107)	Lung(101;0.148)		Cholecalciferol(DB00169)	GAATTCTTTGTGGATAAATTG	0.393													46	61	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79394605	79394605	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79394605G>C	uc003hlb.2	+	53	7976	c.7536G>C	c.(7534-7536)TTG>TTC	p.L2512F		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2511	CSPG 12.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						ATGTGAACTTGGGGTTGATTC	0.418													123	236	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79394606	79394606	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79394606G>T	uc003hlb.2	+	53	7977	c.7537G>T	c.(7537-7539)GGG>TGG	p.G2513W		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2512	CSPG 12.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						TGTGAACTTGGGGTTGATTCG	0.418													126	234	---	---	---	---	PASS
GPRIN3	285513	broad.mit.edu	37	4	90170412	90170412	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90170412C>T	uc003hsm.1	-	2	1369	c.850G>A	c.(850-852)GTG>ATG	p.V284M		NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	284										ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		GGCAGCGGCACCTTCTCTGGA	0.567													108	152	---	---	---	---	PASS
PDLIM5	10611	broad.mit.edu	37	4	95497089	95497089	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95497089G>A	uc003hti.2	+	5	765	c.614G>A	c.(613-615)CGG>CAG	p.R205Q	PDLIM5_uc003htf.2_Intron|PDLIM5_uc003htg.2_Intron|PDLIM5_uc011cdx.1_Intron|PDLIM5_uc003hth.2_Intron|PDLIM5_uc003htj.2_Intron|PDLIM5_uc003htk.2_Intron|PDLIM5_uc011cdy.1_Missense_Mutation_p.R83Q	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a	205					regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		AATGTCCCACGGCAGCCCACA	0.537													41	67	---	---	---	---	PASS
PDHA2	5161	broad.mit.edu	37	4	96762238	96762238	+	Missense_Mutation	SNP	G	T	T	rs28935187		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96762238G>T	uc003htr.3	+	1	1000	c.937G>T	c.(937-939)GAT>TAT	p.D313Y		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	313					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	AAGTAAGAGGGATCCTATAAT	0.418													46	65	---	---	---	---	PASS
NDST4	64579	broad.mit.edu	37	4	115997243	115997243	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115997243C>A	uc003ibu.2	-	2	1629	c.950G>T	c.(949-951)GGA>GTA	p.G317V	NDST4_uc010imw.2_Intron	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	317	Lumenal (Potential).|Heparan sulfate N-deacetylase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	p.G317R(1)		skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		CATCCTTGTTCCCTCTTTCCC	0.363													85	89	---	---	---	---	PASS
SPCS3	60559	broad.mit.edu	37	4	177248312	177248312	+	Splice_Site	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177248312G>T	uc003iur.3	+	4	433	c.295_splice	c.e4-1	p.A99_splice		NM_021928	NP_068747	P61009	SPCS3_HUMAN	signal peptidase complex subunit 3						energy reserve metabolic process|regulation of insulin secretion|signal peptide processing	integral to membrane|microsome|signal peptidase complex	peptidase activity			ovary(1)	1		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.43e-19)|Epithelial(43;1.84e-16)|OV - Ovarian serous cystadenocarcinoma(60;4.51e-09)|GBM - Glioblastoma multiforme(59;0.000142)|STAD - Stomach adenocarcinoma(60;0.00279)|LUSC - Lung squamous cell carcinoma(193;0.0319)		TTTTAATATAGGCTCTGAACC	0.299													11	11	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19612679	19612679	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19612679G>C	uc003jgc.2	-	5	1052	c.675C>G	c.(673-675)GAC>GAG	p.D225E	CDH18_uc003jgd.2_Missense_Mutation_p.D225E|CDH18_uc011cnm.1_Missense_Mutation_p.D225E	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	225	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TGGCTTCTCTGTCCATGTTAT	0.373													43	55	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26890021	26890021	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26890021A>T	uc003jgs.1	-	9	1605	c.1436T>A	c.(1435-1437)CTA>CAA	p.L479Q	CDH9_uc011cnv.1_Missense_Mutation_p.L72Q	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	479	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						ATTTATATCTAGAATTCTGAT	0.358													64	112	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26916006	26916006	+	Silent	SNP	A	G	G	rs149377000		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26916006A>G	uc003jgs.1	-	3	424	c.255T>C	c.(253-255)GAT>GAC	p.D85D	CDH9_uc010iug.2_Silent_p.D85D	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	85	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						TTAAATTTCCATCTCCTTTAT	0.338													81	103	---	---	---	---	PASS
CDH6	1004	broad.mit.edu	37	5	31294255	31294255	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31294255G>C	uc003jhe.1	+	3	741	c.415G>C	c.(415-417)GTG>CTG	p.V139L	CDH6_uc003jhd.1_Missense_Mutation_p.V139L	NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein	139	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7						AGGGAGACCCGTGGAGCCCGA	0.478													122	141	---	---	---	---	PASS
RXFP3	51289	broad.mit.edu	37	5	33937805	33937805	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33937805A>T	uc003jic.1	+	1	1317	c.960A>T	c.(958-960)AGA>AGT	p.R320S		NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	320	Cytoplasmic (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1						GCGCCCGGAGACTGTCGAAGG	0.657													13	19	---	---	---	---	PASS
SLC45A2	51151	broad.mit.edu	37	5	33984499	33984499	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33984499C>A	uc003jid.2	-	1	282	c.190G>T	c.(190-192)GGT>TGT	p.G64C	SLC45A2_uc003jie.2_Missense_Mutation_p.G64C|SLC45A2_uc003jif.3_Missense_Mutation_p.G64C|SLC45A2_uc011coe.1_Missense_Mutation_p.G64C	NM_016180	NP_057264	Q9UMX9	S45A2_HUMAN	membrane-associated transporter protein isoform	64	Helical; Name=1; (Potential).				melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						CTGGGCAGACCTACGCTGAGC	0.617													23	22	---	---	---	---	PASS
IL7R	3575	broad.mit.edu	37	5	35860946	35860946	+	Intron	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35860946C>T	uc003jjs.2	+						IL7R_uc011coo.1_Intron|IL7R_uc011cop.1_Intron	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor						immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			ATGTTTGTTCCTCCCCAGGAG	0.418													93	125	---	---	---	---	PASS
UGT3A1	133688	broad.mit.edu	37	5	35954499	35954499	+	Silent	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35954499G>A	uc003jjv.1	-	7	1534	c.1377C>T	c.(1375-1377)ATC>ATT	p.I459I	UGT3A1_uc003jjw.1_RNA	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	459	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGATGTGGTCGATCCAGCCCA	0.602													21	31	---	---	---	---	PASS
LMBRD2	92255	broad.mit.edu	37	5	36136480	36136480	+	Silent	SNP	C	G	G	rs144023598	byFrequency	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36136480C>G	uc003jkb.1	-	6	1093	c.678G>C	c.(676-678)ACG>ACC	p.T226T		NM_001007527	NP_001007528	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	226	Cytoplasmic (Potential).					integral to membrane					0	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCTTAAAATACGTTTTCATAA	0.413													177	254	---	---	---	---	PASS
NUP155	9631	broad.mit.edu	37	5	37350275	37350275	+	Silent	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37350275C>A	uc003jku.1	-	7	934	c.816G>T	c.(814-816)ACG>ACT	p.T272T	NUP155_uc003jkt.1_Silent_p.T213T|NUP155_uc010iuz.1_Silent_p.T272T	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1	272					carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTTCTGAGAACGTGAATTGTA	0.358													75	92	---	---	---	---	PASS
RICTOR	253260	broad.mit.edu	37	5	38962427	38962427	+	Nonsense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38962427G>A	uc003jlp.2	-	19	1729	c.1705C>T	c.(1705-1707)CAG>TAG	p.Q569*	RICTOR_uc003jlo.2_Nonsense_Mutation_p.Q569*|RICTOR_uc010ivf.2_Nonsense_Mutation_p.Q284*	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR	569					actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					CTGTGTAACTGTTCATCTTTA	0.239													25	39	---	---	---	---	PASS
CARD6	84674	broad.mit.edu	37	5	40854526	40854526	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40854526A>T	uc003jmg.2	+	3	3167	c.3092A>T	c.(3091-3093)CAG>CTG	p.Q1031L		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	1031					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						AAAGCAGGGCAGAAGAGGGGA	0.488													136	193	---	---	---	---	PASS
OXCT1	5019	broad.mit.edu	37	5	41853522	41853522	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41853522T>A	uc003jmn.2	-	4	744	c.413A>T	c.(412-414)CAG>CTG	p.Q138L		NM_000436	NP_000427	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1 precursor	138					cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity			ovary(2)|large_intestine(1)	3					Succinic acid(DB00139)	TTTTCTCACCTGTGGTGTCAG	0.363													59	71	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45303823	45303823	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45303823C>A	uc003jok.2	-	6	1521	c.1496G>T	c.(1495-1497)GGA>GTA	p.G499V		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	499	cAMP.|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						GATATAATCTCCAGGTTGAAA	0.408													91	128	---	---	---	---	PASS
CETN3	1070	broad.mit.edu	37	5	89703555	89703555	+	Silent	SNP	A	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89703555A>G	uc003kjo.2	-	2	239	c.114T>C	c.(112-114)GAT>GAC	p.D38D		NM_004365	NP_004356	O15182	CETN3_HUMAN	centrin 3	38	1 (Potential).|EF-hand 1.				cell division|centrosome cycle|mitosis	centriole	calcium ion binding				0		all_cancers(142;7.93e-09)|all_epithelial(76;2.13e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;1.42e-32)|Epithelial(54;1.45e-26)|all cancers(79;2.87e-23)		CTTTGTCTGTATCAAATAGTT	0.294													45	10	---	---	---	---	PASS
C5orf20	140947	broad.mit.edu	37	5	134782580	134782580	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134782580G>C	uc003lav.2	-	1	459	c.219C>G	c.(217-219)AAC>AAG	p.N73K		NM_130848	NP_570900	Q8TF63	DCNP1_HUMAN	dendritic cell nuclear protein 1	73						nucleus					0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCAAGGTTTTGTTCCTCCCTG	0.602													27	35	---	---	---	---	PASS
WDR55	54853	broad.mit.edu	37	5	140048089	140048089	+	Splice_Site	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140048089T>C	uc003lgr.3	+	3	494	c.380_splice	c.e3+2	p.G127_splice	WDR55_uc011czl.1_5'Flank	NM_017706	NP_060176	Q9H6Y2	WDR55_HUMAN	WD repeat domain 55						rRNA processing	cytoplasm|nucleolus				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCTCATGGGTAAGGAGAGCA	0.512													86	93	---	---	---	---	PASS
PCDH12	51294	broad.mit.edu	37	5	141334818	141334818	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141334818C>T	uc003llx.2	-	1	3810	c.2599G>A	c.(2599-2601)GAG>AAG	p.E867K		NM_016580	NP_057664	Q9NPG4	PCD12_HUMAN	protocadherin 12 precursor	867	Cytoplasmic (Potential).				neuron recognition	integral to plasma membrane	calcium ion binding			ovary(3)	3		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCTGGGGCTCGGGAAGGTTC	0.652													41	44	---	---	---	---	PASS
ANXA6	309	broad.mit.edu	37	5	150502573	150502573	+	Splice_Site	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150502573C>T	uc003ltl.1	-	16	1291	c.1139_splice	c.e16-1	p.G380_splice	ANXA6_uc011dcp.1_Splice_Site_p.G348_splice|ANXA6_uc003ltm.1_Splice_Site_p.G380_splice|ANXA6_uc003ltn.1_Splice_Site_p.G173_splice|ANXA6_uc003lto.1_Intron	NM_001155	NP_001146	P08133	ANXA6_HUMAN	annexin VI isoform 1							melanosome	calcium ion binding|calcium-dependent phospholipid binding|protein binding				0		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCGTCAGTCCCTGAGTCACCA	0.567													82	85	---	---	---	---	PASS
HAVCR2	84868	broad.mit.edu	37	5	156535959	156535959	+	Silent	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156535959C>A	uc003lwk.1	-	1	180	c.36G>T	c.(34-36)CTG>CTT	p.L12L	HAVCR2_uc003lwl.2_Silent_p.L12L	NM_032782	NP_116171	Q8TDQ0	HAVR2_HUMAN	T cell immunoglobulin mucin 3 precursor	12						integral to membrane					0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCAGCAGCAGCAGCAGGACAC	0.313													32	33	---	---	---	---	PASS
HK3	3101	broad.mit.edu	37	5	176310852	176310852	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176310852C>T	uc003mfa.2	-	15	2064	c.1972G>A	c.(1972-1974)GTT>ATT	p.V658I	HK3_uc003mez.2_Missense_Mutation_p.V214I	NM_002115	NP_002106	P52790	HXK3_HUMAN	hexokinase 3	658	Catalytic.				glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity			ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACAATGGCAACCACATTCAGC	0.587													63	119	---	---	---	---	PASS
TMEM170B	100113407	broad.mit.edu	37	6	11565950	11565950	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11565950A>G	uc010jpa.2	+	2	149	c.149A>G	c.(148-150)CAT>CGT	p.H50R		NM_001100829	NP_001094299	Q5T4T1	T170B_HUMAN	transmembrane protein 170B	50	Helical; (Potential).					integral to membrane					0						CTGTTTGTCCATGGTGCTGCA	0.443													204	281	---	---	---	---	PASS
JARID2	3720	broad.mit.edu	37	6	15511634	15511634	+	Splice_Site	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15511634T>A	uc003nbj.2	+	13	3196	c.2952_splice	c.e13+2	p.M984_splice	JARID2_uc011div.1_Splice_Site_p.M812_splice	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein						central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AACGTCATGGTGCGTCCACTC	0.567													29	33	---	---	---	---	PASS
SLC17A3	10786	broad.mit.edu	37	6	25850844	25850844	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25850844C>A	uc003nfi.3	-	7	712	c.602G>T	c.(601-603)GGG>GTG	p.G201V	SLC17A3_uc003nfk.3_Missense_Mutation_p.G279V|SLC17A3_uc011djz.1_3'UTR|SLC17A3_uc011dka.1_Missense_Mutation_p.G201V	NM_006632	NP_006623	O00476	NPT4_HUMAN	solute carrier family 17 (sodium phosphate),	201					glucose-6-phosphate transport|urate metabolic process	apical plasma membrane|brush border membrane|endoplasmic reticulum membrane|integral to plasma membrane|perinuclear region of cytoplasm	drug transmembrane transporter activity|efflux transmembrane transporter activity|organic anion transmembrane transporter activity|sodium:phosphate symporter activity|toxin transporter activity|urate transmembrane transporter activity|voltage-gated anion channel activity				0						CTTAGAAGACCCGACCTGAAA	0.423													35	54	---	---	---	---	PASS
BTN2A2	10385	broad.mit.edu	37	6	26391044	26391044	+	Silent	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26391044A>T	uc003nhq.2	+	7	1052	c.966A>T	c.(964-966)ACA>ACT	p.T322T	BTN2A2_uc011dkf.1_3'UTR|BTN2A2_uc011dkg.1_Silent_p.T228T|BTN2A2_uc003nhr.2_Silent_p.T206T|BTN2A2_uc011dkh.1_Silent_p.T112T|BTN2A2_uc003nhs.2_Silent_p.T322T|BTN2A2_uc003nht.2_Silent_p.T322T|BTN2A2_uc011dki.1_Silent_p.T71T	NM_006995	NP_008926	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2 isoform a	322	B30.2/SPRY.|Cytoplasmic (Potential).				negative regulation of activated T cell proliferation|negative regulation of cellular metabolic process|negative regulation of cytokine secretion	integral to membrane					0						GGAGAAGAACATTCTTACATG	0.493													120	207	---	---	---	---	PASS
SCAND3	114821	broad.mit.edu	37	6	28540574	28540574	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28540574G>C	uc003nlo.2	-	4	3710	c.3092C>G	c.(3091-3093)TCT>TGT	p.S1031C		NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN	SCAN domain containing 3	1031					DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			ovary(1)	1						caatgaattagattttatata	0.000													39	37	---	---	---	---	PASS
TRIM10	10107	broad.mit.edu	37	6	30122115	30122115	+	Silent	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30122115G>A	uc003npo.3	-	7	1153	c.1077C>T	c.(1075-1077)GGC>GGT	p.G359G	TRIM10_uc003npn.2_Silent_p.G359G	NM_006778	NP_006769	Q9UDY6	TRI10_HUMAN	tripartite motif-containing 10 isoform 1	359	B30.2/SPRY.					cytoplasm	zinc ion binding				0						CCCCTGTGATGCCAGTGTGGG	0.627													30	47	---	---	---	---	PASS
GTPBP2	54676	broad.mit.edu	37	6	43593088	43593088	+	Intron	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43593088G>A	uc003ovs.2	-						GTPBP2_uc010jyv.2_Intron|GTPBP2_uc003ovt.1_Intron	NM_019096	NP_061969	Q9BX10	GTPB2_HUMAN	GTP binding protein 2								GTP binding|GTPase activity			liver(1)|skin(1)	2	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000501)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			GGGTCCCATTGATCCCATGCA	0.507													177	199	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69666042	69666042	+	Nonsense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69666042G>A	uc003pev.3	+	7	1770	c.1322G>A	c.(1321-1323)TGG>TAG	p.W441*	BAI3_uc010kak.2_Nonsense_Mutation_p.W441*	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	441	TSP type-1 3.|Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				AGAGGGCCATGGGCAGAAAGC	0.532													32	44	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	70049400	70049400	+	Intron	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70049400A>T	uc003pev.3	+						BAI3_uc010kak.2_Intron|BAI3_uc011dxx.1_Intron|BAI3_uc003pex.1_Nonsense_Mutation_p.R285*	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				GAGAGAGGTGAGAAGCATTCT	0.363													106	163	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72892798	72892798	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72892798G>T	uc003pga.2	+	6	1701	c.1624G>T	c.(1624-1626)GAG>TAG	p.E542*	RIMS1_uc011dyb.1_Nonsense_Mutation_p.E168*|RIMS1_uc003pgc.2_Nonsense_Mutation_p.E168*|RIMS1_uc003pgb.3_Nonsense_Mutation_p.E168*	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	542					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GTCGACGCCCGAGTACACCAG	0.682													7	4	---	---	---	---	PASS
KCNQ5	56479	broad.mit.edu	37	6	73713722	73713722	+	Splice_Site	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73713722G>C	uc003pgk.2	+	2	836	c.489_splice	c.e2+1	p.L163_splice	KCNQ5_uc003pgj.3_Splice_Site_p.L163_splice|KCNQ5_uc011dyh.1_Splice_Site_p.L163_splice|KCNQ5_uc011dyi.1_Splice_Site_p.L163_splice|KCNQ5_uc010kat.2_Splice_Site_p.L163_splice|KCNQ5_uc011dyj.1_Splice_Site_p.L163_splice|KCNQ5_uc011dyk.1_Splice_Site	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like						protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		CTTGATCCTGGTAAGTGAAAC	0.353													67	74	---	---	---	---	PASS
GABRR1	2569	broad.mit.edu	37	6	89909131	89909131	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89909131C>A	uc003pna.2	-	4	753	c.298G>T	c.(298-300)GGT>TGT	p.G100C	GABRR1_uc011dzv.1_Missense_Mutation_p.G77C	NM_002042	NP_002033	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 1	100	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			pancreas(1)	1		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Picrotoxin(DB00466)	ACATCCACACCAACAGGAATG	0.502													34	56	---	---	---	---	PASS
UBE2J1	51465	broad.mit.edu	37	6	90053462	90053462	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90053462T>A	uc010kcb.2	-	3	218	c.45A>T	c.(43-45)TTA>TTT	p.L15F	UBE2J1_uc003pnc.2_Missense_Mutation_p.L15F	NM_016021	NP_057105	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	15	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane	ATP binding|ubiquitin-protein ligase activity				0		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		CTTCTTTCATTAAACGTTTAA	0.308													27	45	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	101076979	101076979	+	Silent	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101076979C>T	uc003pqk.2	-	27	4616	c.4287G>A	c.(4285-4287)GAG>GAA	p.E1429E		NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	1429	Helicase ATP-binding 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		CATCCCACTTCTCTGGCGTAG	0.438													54	67	---	---	---	---	PASS
CDC40	51362	broad.mit.edu	37	6	110540978	110540978	+	Silent	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110540978C>A	uc003pua.2	+	12	1270	c.1246C>A	c.(1246-1248)CGG>AGG	p.R416R		NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog	416	WD 4.				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		GGAATATGATCGGCATTTGGG	0.403													4	172	---	---	---	---	PASS
HSF2	3298	broad.mit.edu	37	6	122752641	122752641	+	Missense_Mutation	SNP	A	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122752641A>C	uc003pyu.2	+	12	1484	c.1297A>C	c.(1297-1299)AAA>CAA	p.K433Q	HSF2_uc003pyv.2_Missense_Mutation_p.K415Q	NM_004506	NP_004497	Q03933	HSF2_HUMAN	heat shock transcription factor 2 isoform a	433					response to stress|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription coactivator activity				0				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)		AGAGGGAAGAAAATCTAAATC	0.328													25	31	---	---	---	---	PASS
STL	7955	broad.mit.edu	37	6	125233205	125233205	+	RNA	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125233205C>A	uc003pzq.2	-	7		c.1529G>T				NR_026876				Homo sapiens mRNA; cDNA DKFZp451I132 (from clone DKFZp451I132).												0						TTCTTCAAGACTGTATTTCCA	0.338			T	ETV6	B-ALL								6	3	---	---	---	---	PASS
VNN1	8876	broad.mit.edu	37	6	133013653	133013653	+	Silent	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133013653G>C	uc003qdo.2	-	5	917	c.897C>G	c.(895-897)CTC>CTG	p.L299L		NM_004666	NP_004657	O95497	VNN1_HUMAN	vanin 1 precursor	299	CN hydrolase.				acute inflammatory response|anti-apoptosis|cell-cell adhesion|cellular component movement|chronic inflammatory response|innate immune response|pantothenate metabolic process|positive regulation of T cell differentiation in thymus|response to oxidative stress	anchored to membrane|integral to membrane|plasma membrane	GPI anchor binding|pantetheine hydrolase activity			ovary(3)	3	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		GCGAGAGGAGGAGTTTTCCCT	0.438													36	55	---	---	---	---	PASS
TFB1M	51106	broad.mit.edu	37	6	155635423	155635423	+	Intron	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155635423C>A	uc003qqj.3	-						TFB1M_uc003qqk.2_Intron	NM_016020	NP_057104	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	DNA binding|protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity			skin(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		ACTGCTAAGCCATCCACCTGT	0.612													27	34	---	---	---	---	PASS
ARID1B	57492	broad.mit.edu	37	6	157527307	157527307	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157527307G>T	uc003qqn.2	+	20	5130	c.4978G>T	c.(4978-4980)GGA>TGA	p.G1660*	ARID1B_uc003qqo.2_Nonsense_Mutation_p.G1620*|ARID1B_uc003qqp.2_Nonsense_Mutation_p.G1607*	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1665					chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CCAGTTGTCTGGATTTCTCGA	0.428													291	438	---	---	---	---	PASS
ARID1B	57492	broad.mit.edu	37	6	157527593	157527593	+	Missense_Mutation	SNP	A	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157527593A>C	uc003qqn.2	+	20	5416	c.5264A>C	c.(5263-5265)GAC>GCC	p.D1755A	ARID1B_uc003qqo.2_Missense_Mutation_p.D1715A|ARID1B_uc003qqp.2_Missense_Mutation_p.D1702A	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1760					chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GCCGCTGCAGACCCAAAGGAG	0.512													70	82	---	---	---	---	PASS
T	6862	broad.mit.edu	37	6	166571969	166571969	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166571969G>T	uc003quu.1	-	9	1635	c.1142C>A	c.(1141-1143)GCG>GAG	p.A381E	T_uc003qut.1_Missense_Mutation_p.A382E|T_uc003quv.1_Missense_Mutation_p.A323E	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T	381					anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		TGTGTAGTGCGCGGGGGAGCC	0.711									Chordoma_Familial_Clustering_of				44	39	---	---	---	---	PASS
PDGFA	5154	broad.mit.edu	37	7	550620	550620	+	Silent	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:550620G>A	uc003sir.2	-	4	1122	c.279C>T	c.(277-279)CCC>CCT	p.P93P	PDGFA_uc003sis.2_Silent_p.P93P|PDGFA_uc003sit.1_Silent_p.P107P	NM_002607	NP_002598	P04085	PDGFA_HUMAN	platelet-derived growth factor alpha isoform 1	93					actin cytoskeleton organization|angiogenesis|cell projection assembly|embryo development|hair follicle development|lung alveolus development|negative chemotaxis|negative regulation of phosphatidylinositol biosynthetic process|negative regulation of platelet activation|organ morphogenesis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of DNA replication|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|positive regulation of MAP kinase activity|positive regulation of mesenchymal cell proliferation|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein autophosphorylation|positive regulation of protein kinase B signaling cascade|regulation of actin cytoskeleton organization|regulation of branching involved in salivary gland morphogenesis by epithelial-mesenchymal signaling|regulation of peptidyl-tyrosine phosphorylation|regulation of smooth muscle cell migration|skin development	cell surface|endoplasmic reticulum lumen|extracellular space|Golgi membrane|microvillus|platelet alpha granule lumen	collagen binding|eukaryotic cell surface binding|growth factor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein heterodimerization activity|protein homodimerization activity				0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|Epithelial(4;1.1e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.7e-17)|all cancers(6;4.89e-15)		TGCAGACAGCGGGGACAGCTT	0.682													13	19	---	---	---	---	PASS
C7orf70	84792	broad.mit.edu	37	7	6370367	6370367	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6370367C>A	uc003spu.2	-	2	887	c.419G>T	c.(418-420)GGC>GTC	p.G140V		NM_001037163	NP_001032240	Q7Z4H9	SIPAR_HUMAN	hypothetical protein LOC84792	140						nucleus					0						TCCTCTGTGGCCGTCAGTGGC	0.602													34	38	---	---	---	---	PASS
NXPH1	30010	broad.mit.edu	37	7	8790773	8790773	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8790773C>A	uc003srv.2	+	3	1101	c.190C>A	c.(190-192)CGT>AGT	p.R64S	NXPH1_uc011jxh.1_5'UTR	NM_152745	NP_689958	P58417	NXPH1_HUMAN	neurexophilin 1 precursor	64	II.					extracellular region				ovary(1)|central_nervous_system(1)	2		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		ACAGACTTTTCGTGGCAAAGA	0.463													44	52	---	---	---	---	PASS
GPNMB	10457	broad.mit.edu	37	7	23309656	23309656	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23309656C>T	uc003swc.2	+	9	1488	c.1327C>T	c.(1327-1329)CCT>TCT	p.P443S	GPNMB_uc003swb.2_Missense_Mutation_p.P431S|GPNMB_uc011jyy.1_Missense_Mutation_p.P385S|GPNMB_uc011jyz.1_Missense_Mutation_p.P332S	NM_001005340	NP_001005340	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb isoform a	443	Extracellular (Potential).				negative regulation of cell proliferation	melanosome				ovary(3)|breast(2)	5			GBM - Glioblastoma multiforme(13;0.154)			AGTCTGCAGCCCTGTGGATGT	0.582													100	118	---	---	---	---	PASS
ABCB4	5244	broad.mit.edu	37	7	87035607	87035607	+	Silent	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87035607G>T	uc003uiv.1	-	26	3580	c.3504C>A	c.(3502-3504)CCC>CCA	p.P1168P	ABCB4_uc003uiw.1_Silent_p.P1161P|ABCB4_uc003uix.1_Silent_p.P1114P	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	1168	ABC transporter 2.|Cytoplasmic (By similarity).		P -> S (in GBD1).		cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					AACTTACGTGGGGTAACGTCT	0.398													84	132	---	---	---	---	PASS
RUNDC3B	154661	broad.mit.edu	37	7	87370837	87370837	+	Silent	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87370837C>T	uc003ujb.2	+	7	1033	c.622C>T	c.(622-624)CTG>TTG	p.L208L	RUNDC3B_uc011khd.1_Silent_p.L191L|RUNDC3B_uc011khe.1_Silent_p.L191L|RUNDC3B_uc003ujc.2_Silent_p.L191L|RUNDC3B_uc003ujd.2_Silent_p.L113L	NM_138290	NP_612147	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B isoform a	208										skin(1)	1	Esophageal squamous(14;0.00164)					GGGAGAGGGGCTGGATGGCAG	0.264													26	34	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94037644	94037644	+	Intron	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94037644T>A	uc003ung.1	+						COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor						axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TATTTTCTTCTTAGGGTGCCC	0.448										HNSCC(75;0.22)			88	104	---	---	---	---	PASS
SPDYE3	441272	broad.mit.edu	37	7	99917560	99917560	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99917560G>A	uc003uug.1	+	5	706	c.466G>A	c.(466-468)GCT>ACT	p.A156T	uc011kjm.1_5'Flank	NM_001004351	NP_001004351	A6NKU9	SPDE3_HUMAN	speedy homolog E3	533											0						CCAGATCCAGGCTTATGACCC	0.617													76	102	---	---	---	---	PASS
TRIP6	7205	broad.mit.edu	37	7	100466332	100466332	+	Silent	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100466332G>T	uc003uww.2	+	4	749	c.579G>T	c.(577-579)GGG>GGT	p.G193G	TRIP6_uc010lhk.1_RNA	NM_003302	NP_003293	Q15654	TRIP6_HUMAN	thyroid receptor-interacting protein 6	193					focal adhesion assembly|positive regulation of cell migration|regulation of transcription, DNA-dependent|release of cytoplasmic sequestered NF-kappaB|transcription, DNA-dependent	cytoplasm|cytoskeleton|focal adhesion|nucleus	identical protein binding|interleukin-1 receptor binding|kinase binding|thyroid hormone receptor binding|zinc ion binding			central_nervous_system(2)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)					AGGCCTCTGGGCCCCTCCCGG	0.706													8	11	---	---	---	---	PASS
CADPS2	93664	broad.mit.edu	37	7	122130267	122130267	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122130267C>A	uc010lkp.2	-	11	1883	c.1720G>T	c.(1720-1722)GAT>TAT	p.D574Y	CADPS2_uc003vkg.3_Missense_Mutation_p.D274Y|CADPS2_uc010lkq.2_Missense_Mutation_p.D574Y	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2	574	PH.				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						TCCTGTTCATCATCACTGGCA	0.388													13	173	---	---	---	---	PASS
CPA5	93979	broad.mit.edu	37	7	129986318	129986318	+	Translation_Start_Site	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129986318G>T	uc010lmd.1	+	4	612	c.-8G>T	c.(-10--6)GAGGA>GATGA		CPA5_uc003vps.2_Translation_Start_Site|CPA5_uc003vpt.2_Translation_Start_Site|CPA5_uc010lme.1_Translation_Start_Site|CPA5_uc003vpu.1_Translation_Start_Site	NM_001127441	NP_001120913	Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5 isoform 1						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2	Melanoma(18;0.0435)					CTCACCAGGAGGAAGAAGCAT	0.632													63	71	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131908396	131908396	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131908396G>T	uc003vra.3	-	9	2216	c.1987C>A	c.(1987-1989)CTG>ATG	p.L663M		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	663	PSI 2.|Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						ACGCAGGACAGGCACCTGGGC	0.537													9	13	---	---	---	---	PASS
KLRG2	346689	broad.mit.edu	37	7	139168179	139168179	+	Silent	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139168179C>A	uc003vvb.2	-	1	279	c.210G>T	c.(208-210)CCG>CCT	p.P70P	KLRG2_uc010lnc.2_Silent_p.P70P	NM_198508	NP_940910	A4D1S0	KLRG2_HUMAN	killer cell lectin-like receptor subfamily G,	70	Pro-rich.					integral to membrane	sugar binding			central_nervous_system(1)	1	Melanoma(164;0.233)					GAGGCGAAGGCGGCTTTTTCT	0.731													16	10	---	---	---	---	PASS
WEE2	494551	broad.mit.edu	37	7	141408806	141408806	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141408806C>A	uc003vwn.2	+	1	654	c.248C>A	c.(247-249)ACT>AAT	p.T83N	FLJ40852_uc011krh.1_Intron|FLJ40852_uc010lnm.2_Intron|FLJ40852_uc010lnn.2_Intron|FLJ40852_uc003vwm.3_Intron|FLJ40852_uc010lno.2_Intron	NM_001105558	NP_001099028	P0C1S8	WEE2_HUMAN	WEE1 homolog 2	83					egg activation|female meiosis|female pronucleus assembly|meiotic metaphase II|meiotic prophase I|mitosis|negative regulation of oocyte development|regulation of meiosis I	centrosome|nucleus	ATP binding|magnesium ion binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2	Melanoma(164;0.0171)					ATTTTGAGGACTCCAGTGTCA	0.522													146	177	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142379083	142379083	+	Intron	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142379083G>T	uc011krp.1	+						uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc011ksg.1_Intron					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		AATACACAGTGCTACATGGAT	0.502													26	46	---	---	---	---	PASS
OR2A2	442361	broad.mit.edu	37	7	143807527	143807527	+	Silent	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143807527G>T	uc011ktz.1	+	1	852	c.852G>T	c.(850-852)CTG>CTT	p.L284L		NM_001005480	NP_001005480	Q6IF42	OR2A2_HUMAN	olfactory receptor, family 2, subfamily A,	284	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Melanoma(164;0.0783)					ATCCAATGCTGAACCCCCTGA	0.517													127	192	---	---	---	---	PASS
DLC1	10395	broad.mit.edu	37	8	12957052	12957052	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12957052C>T	uc003wwm.2	-	9	3238	c.2794G>A	c.(2794-2796)GAT>AAT	p.D932N	DLC1_uc003wwk.1_Missense_Mutation_p.D495N|DLC1_uc003wwl.1_Missense_Mutation_p.D529N|DLC1_uc011kxx.1_Missense_Mutation_p.D421N	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	932					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						GAGTCCGAATCTCCCTCATCA	0.567													67	21	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55537815	55537815	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55537815G>C	uc003xsd.1	+	4	1521	c.1373G>C	c.(1372-1374)AGA>ACA	p.R458T	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	458					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AGAAGAGTGAGACAAAAGAAA	0.418													55	76	---	---	---	---	PASS
IMPAD1	54928	broad.mit.edu	37	8	57905986	57905986	+	Silent	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57905986C>A	uc003xte.3	-	1	442	c.159G>T	c.(157-159)GCG>GCT	p.A53A		NM_017813	NP_060283	Q9NX62	IMPA3_HUMAN	inositol monophosphatase domain containing 1	53	Poly-Ala.					Golgi apparatus|integral to membrane	inositol-1(or 4)-monophosphatase activity|metal ion binding			ovary(1)	1		all_cancers(86;0.175)|all_lung(136;0.0321)|Lung NSC(129;0.0417)|all_epithelial(80;0.0448)				cggccgcggccgcgggccccg	0.587													3	0	---	---	---	---	PASS
CLVS1	157807	broad.mit.edu	37	8	62371029	62371029	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62371029C>A	uc003xuh.2	+	5	1229	c.905C>A	c.(904-906)TCC>TAC	p.S302Y	CLVS1_uc003xui.2_RNA|CLVS1_uc010lyp.2_Intron	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN	retinaldehyde binding protein 1-like 1	302					lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5						ACTCACACATCCTATAATGCA	0.498													41	54	---	---	---	---	PASS
XKR9	389668	broad.mit.edu	37	8	71646376	71646376	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71646376G>T	uc003xyq.2	+	5	1373	c.839G>T	c.(838-840)GGA>GTA	p.G280V	XKR9_uc010lze.2_Missense_Mutation_p.G280V|XKR9_uc010lzd.2_Missense_Mutation_p.G148V	NM_001011720	NP_001011720	Q5GH70	XKR9_HUMAN	XK, Kell blood group complex subunit-related	280						integral to membrane				ovary(1)|skin(1)	2	Breast(64;0.0716)		Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)			AATATTAAGGGACAGAATACC	0.328													39	61	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87683207	87683207	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87683207C>A	uc003ydx.2	-	4	504	c.458G>T	c.(457-459)GGA>GTA	p.G153V	CNGB3_uc010maj.2_Missense_Mutation_p.G15V	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	153	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						GGAGAGATCTCCCTCTACCAA	0.493													225	237	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104954994	104954994	+	Intron	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104954994T>C	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron|RIMS2_uc003ylt.2_Intron	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GTCTCTTGGGTTTGTAGATTT	0.313										HNSCC(12;0.0054)			51	39	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106814722	106814722	+	Silent	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106814722G>T	uc003ymd.2	+	8	2435	c.2412G>T	c.(2410-2412)ACG>ACT	p.T804T	ZFPM2_uc011lhs.1_Silent_p.T535T	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	804					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CTTCTCTGACGATCAACAAGT	0.443													33	22	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113563053	113563053	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113563053C>A	uc003ynu.2	-	27	4570	c.4411G>T	c.(4411-4413)GTC>TTC	p.V1471F	CSMD3_uc003yns.2_Missense_Mutation_p.V743F|CSMD3_uc003ynt.2_Missense_Mutation_p.V1431F|CSMD3_uc011lhx.1_Missense_Mutation_p.V1367F	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1471	Extracellular (Potential).|CUB 8.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CCGTCCCAGACTCGGAGTATA	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			34	114	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	134108523	134108523	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134108523C>G	uc003ytw.2	+	43	7519	c.7478C>G	c.(7477-7479)GCC>GGC	p.A2493G	TG_uc010mdw.2_Missense_Mutation_p.A1252G|TG_uc011ljb.1_Missense_Mutation_p.A862G|TG_uc011ljc.1_Missense_Mutation_p.A626G|SLA_uc003ytz.2_Intron|SLA_uc011lje.1_Intron|SLA_uc011ljf.1_Intron|SLA_uc011ljg.1_Intron|SLA_uc010mea.2_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2493					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GAGCCTCCAGCCAGAGCACTG	0.542													182	337	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139144962	139144962	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139144962G>T	uc003yuy.2	-	20	4266	c.4095C>A	c.(4093-4095)AAC>AAA	p.N1365K	FAM135B_uc003yux.2_Missense_Mutation_p.N1266K|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	1365										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CGTGGAACACGTTGTGTCGGA	0.532										HNSCC(54;0.14)			176	415	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139164371	139164371	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139164371C>A	uc003yuy.2	-	13	2518	c.2347G>T	c.(2347-2349)GCT>TCT	p.A783S	FAM135B_uc003yux.2_Missense_Mutation_p.A684S|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.A345S|FAM135B_uc003yvb.2_Missense_Mutation_p.A345S	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	783										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GCATCTTCAGCAGCCTCCTCT	0.507										HNSCC(54;0.14)			81	56	---	---	---	---	PASS
CYP11B1	1584	broad.mit.edu	37	8	143960491	143960491	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143960491C>T	uc003yxi.2	-	2	359	c.352G>A	c.(352-354)GCC>ACC	p.A118T	CYP11B1_uc003yxh.2_5'Flank|CYP11B1_uc003yxj.2_Missense_Mutation_p.A118T|CYP11B1_uc010mey.2_Missense_Mutation_p.A163T	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	118					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	TGTCTGTAGGCCACCCAGGGC	0.627									Familial_Hyperaldosteronism_type_I				81	66	---	---	---	---	PASS
RANBP6	26953	broad.mit.edu	37	9	6015055	6015055	+	Silent	SNP	A	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6015055A>G	uc003zjr.2	-	1	564	c.553T>C	c.(553-555)TTG>CTG	p.L185L	RANBP6_uc011lmf.1_Intron|RANBP6_uc003zjs.2_Intron	NM_012416	NP_036548	O60518	RNBP6_HUMAN	RAN binding protein 6	185					protein transport	cytoplasm|nucleus	binding			ovary(3)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		CACTGGTCCAACAACCGTTTG	0.428													64	85	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14857664	14857664	+	Nonsense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14857664C>A	uc003zlm.2	-	5	1305	c.715G>T	c.(715-717)GAG>TAG	p.E239*	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	239					cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		AGCAGGAACTCCTCACAGCTC	0.478													77	90	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21971000	21971000	+	Nonsense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971000C>A	uc003zpk.2	-	2	570	c.358G>T	c.(358-360)GAG>TAG	p.E120*	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_3'UTR	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	120	ANK 4.		E -> A (in non-small cell lung carcinoma).|E -> K (in non-small cell lung carcinoma).		cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.?(13)|p.E120*(8)|p.E120K(4)|p.E120A(1)|p.A118fs*10(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		TGGCCCAGCTCCTCAGCCAGG	0.726		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			31	34	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32632793	32632793	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32632793C>A	uc003zrg.1	-	1	2875	c.2785G>T	c.(2785-2787)GCC>TCC	p.A929S	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	929					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCTTCTGGGGCAAAAAAGGAT	0.458													85	154	---	---	---	---	PASS
FRMPD1	22844	broad.mit.edu	37	9	37740318	37740318	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37740318G>A	uc004aag.1	+	15	1837	c.1793G>A	c.(1792-1794)CGC>CAC	p.R598H	FRMPD1_uc004aah.1_Missense_Mutation_p.R598H|FRMPD1_uc011lqm.1_Missense_Mutation_p.R420H|FRMPD1_uc011lqn.1_Missense_Mutation_p.R467H	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	598						cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		ACTGAGAGCCGCGGCTACAGG	0.632													26	31	---	---	---	---	PASS
GRIN3A	116443	broad.mit.edu	37	9	104385621	104385621	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104385621C>A	uc004bbp.1	-	5	3194	c.2593G>T	c.(2593-2595)GGG>TGG	p.G865W	GRIN3A_uc004bbq.1_Missense_Mutation_p.G865W	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	865	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	AATGGCTTCCCCACAGTGAGA	0.418													34	63	---	---	---	---	PASS
GRIN3A	116443	broad.mit.edu	37	9	104385622	104385622	+	Silent	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104385622C>A	uc004bbp.1	-	5	3193	c.2592G>T	c.(2590-2592)GTG>GTT	p.V864V	GRIN3A_uc004bbq.1_Silent_p.V864V	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	864	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	ATGGCTTCCCCACAGTGAGAA	0.413													32	62	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119738461	119738461	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119738461C>A	uc004bjs.1	-	9	1784	c.1683G>T	c.(1681-1683)TGG>TGT	p.W561C	ASTN2_uc004bjr.1_Missense_Mutation_p.W561C|ASTN2_uc004bjt.1_Missense_Mutation_p.W510C	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	561	Extracellular (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						TCGTGTAGGGCCAAGGTCTAT	0.483													26	27	---	---	---	---	PASS
SH2D3C	10044	broad.mit.edu	37	9	130536590	130536590	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130536590G>C	uc004bsc.2	-	2	336	c.194C>G	c.(193-195)CCA>CGA	p.P65R	SH2D3C_uc004bsa.2_5'Flank|SH2D3C_uc004bsb.2_5'Flank|SH2D3C_uc004bsd.1_Missense_Mutation_p.P9R	NM_170600	NP_733745	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C isoform a	65					JNK cascade|small GTPase mediated signal transduction	cytoplasm|membrane	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			ovary(1)	1						GGCATAGGCTGGGGGACTCTT	0.597													20	45	---	---	---	---	PASS
COQ4	51117	broad.mit.edu	37	9	131094462	131094462	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131094462C>G	uc004bur.3	+	5	780	c.433C>G	c.(433-435)CGC>GGC	p.R145G	COQ4_uc004bus.2_Missense_Mutation_p.R121G|COQ4_uc010mxy.2_Missense_Mutation_p.R121G	NM_016035	NP_057119	Q9Y3A0	COQ4_HUMAN	coenzyme Q4 homolog precursor	145					ubiquinone biosynthetic process	mitochondrial inner membrane					0						AGCACCCACCCGCTTCGTGGA	0.602													9	14	---	---	---	---	PASS
LAMC3	10319	broad.mit.edu	37	9	133914549	133914549	+	Silent	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133914549C>A	uc004caa.1	+	6	1295	c.1197C>A	c.(1195-1197)GGC>GGA	p.G399G		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	399	Laminin EGF-like 3.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		ATGACACAGGCACCTGCGCCT	0.657													22	44	---	---	---	---	PASS
DDX31	64794	broad.mit.edu	37	9	135525610	135525610	+	Intron	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135525610C>T	uc004cbq.1	-						DDX31_uc010mzu.1_Intron|DDX31_uc004cbr.1_Intron	NM_022779	NP_073616	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31							nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		AACCAACAAACCTCTTCCTAC	0.473													28	38	---	---	---	---	PASS
RALGDS	5900	broad.mit.edu	37	9	135983376	135983376	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135983376G>A	uc004cco.2	-	6	1216	c.1196C>T	c.(1195-1197)GCG>GTG	p.A399V	RALGDS_uc004ccp.2_RNA|RALGDS_uc004ccq.2_Missense_Mutation_p.A387V|RALGDS_uc004ccr.2_Missense_Mutation_p.A398V|RALGDS_uc011mcv.1_Missense_Mutation_p.A370V|RALGDS_uc004ccs.2_Missense_Mutation_p.A344V|RALGDS_uc011mcw.1_Missense_Mutation_p.A470V|RALGDS_uc004ccv.1_Missense_Mutation_p.A168V|RALGDS_uc004ccu.1_Missense_Mutation_p.A168V	NM_006266	NP_006257	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	399	Ras-GEF.				nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	Ral guanyl-nucleotide exchange factor activity			large_intestine(1)|lung(1)|ovary(1)	3				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		GCTGCTCACCGCATCCATCAG	0.562			T	CIITA	PMBL|Hodgkin Lymphona|								4	102	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137721880	137721880	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137721880G>A	uc004cfe.2	+	64	5508	c.5126G>A	c.(5125-5127)CGT>CAT	p.R1709H	uc004cff.2_Intron	NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	1709	Fibrillar collagen NC1.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GAATTCAAGCGTGGGAAACTG	0.537													3	50	---	---	---	---	PASS
PMPCA	23203	broad.mit.edu	37	9	139310803	139310803	+	Missense_Mutation	SNP	G	A	A	rs138828077	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139310803G>A	uc004chl.2	+	6	598	c.593G>A	c.(592-594)CGG>CAG	p.R198Q	PMPCA_uc011mdy.1_Missense_Mutation_p.R198Q|PMPCA_uc010nbk.2_RNA|PMPCA_uc010nbl.2_Missense_Mutation_p.R98Q|PMPCA_uc011mdz.1_Missense_Mutation_p.R67Q|PMPCA_uc004chm.1_5'UTR|PMPCA_uc004chn.1_5'Flank	NM_015160	NP_055975	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	198					proteolysis	mitochondrial inner membrane|mitochondrial matrix	metalloendopeptidase activity|zinc ion binding				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		CTGAACCTGCGGCCTGACCCA	0.562													60	89	---	---	---	---	PASS
ABI1	10006	broad.mit.edu	37	10	27059274	27059274	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27059274G>A	uc001isx.2	-	5	645	c.478C>T	c.(478-480)CAT>TAT	p.H160Y	ABI1_uc001ite.2_Missense_Mutation_p.H155Y|ABI1_uc010qdh.1_Missense_Mutation_p.H155Y|ABI1_uc010qdi.1_Missense_Mutation_p.H96Y|ABI1_uc001isy.2_Missense_Mutation_p.H160Y|ABI1_uc001ita.2_Missense_Mutation_p.H160Y|ABI1_uc001isz.2_Missense_Mutation_p.H155Y|ABI1_uc001itb.2_Missense_Mutation_p.H177Y|ABI1_uc001itc.2_Missense_Mutation_p.H160Y|ABI1_uc010qdj.1_Missense_Mutation_p.H160Y|ABI1_uc001itd.2_Missense_Mutation_p.H160Y|ABI1_uc010qdk.1_Missense_Mutation_p.H160Y|ABI1_uc010qdg.1_Missense_Mutation_p.H26Y	NM_005470	NP_005461	Q8IZP0	ABI1_HUMAN	abl-interactor 1 isoform a	160					actin polymerization or depolymerization|cellular component movement|negative regulation of cell proliferation|peptidyl-tyrosine phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	cell junction|cytoskeleton|cytosol|endoplasmic reticulum|filopodium|growth cone|lamellipodium|nucleus|soluble fraction|synapse|synaptosome	cytoskeletal protein binding			central_nervous_system(1)	1						TTATTTCCATGCTAAAATGTA	0.383													50	13	---	---	---	---	PASS
ABI1	10006	broad.mit.edu	37	10	27059275	27059275	+	Splice_Site	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27059275C>A	uc001isx.2	-	5	645	c.478_splice	c.e5-1	p.H160_splice	ABI1_uc001ite.2_Splice_Site_p.H155_splice|ABI1_uc010qdh.1_Splice_Site_p.H155_splice|ABI1_uc010qdi.1_Splice_Site_p.H96_splice|ABI1_uc001isy.2_Splice_Site_p.H160_splice|ABI1_uc001ita.2_Splice_Site_p.H160_splice|ABI1_uc001isz.2_Splice_Site_p.H155_splice|ABI1_uc001itb.2_Splice_Site_p.H177_splice|ABI1_uc001itc.2_Splice_Site_p.H160_splice|ABI1_uc010qdj.1_Splice_Site_p.H160_splice|ABI1_uc001itd.2_Splice_Site_p.H160_splice|ABI1_uc010qdk.1_Splice_Site_p.H160_splice|ABI1_uc010qdg.1_Splice_Site_p.H26_splice	NM_005470	NP_005461	Q8IZP0	ABI1_HUMAN	abl-interactor 1 isoform a						actin polymerization or depolymerization|cellular component movement|negative regulation of cell proliferation|peptidyl-tyrosine phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	cell junction|cytoskeleton|cytosol|endoplasmic reticulum|filopodium|growth cone|lamellipodium|nucleus|soluble fraction|synapse|synaptosome	cytoskeletal protein binding			central_nervous_system(1)	1						TATTTCCATGCTAAAATGTAG	0.383													49	14	---	---	---	---	PASS
MPP7	143098	broad.mit.edu	37	10	28348635	28348635	+	Silent	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28348635A>T	uc001iua.1	-	16	1646	c.1242T>A	c.(1240-1242)GGT>GGA	p.G414G	MPP7_uc009xkz.1_RNA|MPP7_uc001iub.1_Silent_p.G414G|MPP7_uc009xla.2_Silent_p.G414G|MPP7_uc010qdv.1_RNA	NM_173496	NP_775767	Q5T2T1	MPP7_HUMAN	palmitoylated membrane protein 7	414	Guanylate kinase-like.				establishment of cell polarity|positive regulation of protein complex assembly|protein localization to adherens junction|tight junction assembly	MPP7-DLG1-LIN7 complex|tight junction	protein complex scaffold|protein domain specific binding|protein heterodimerization activity|signaling adaptor activity			ovary(1)	1						TGTATTCAACACCATCACTCT	0.338													43	16	---	---	---	---	PASS
LRRTM3	347731	broad.mit.edu	37	10	68686951	68686951	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68686951G>C	uc001jmz.1	+	2	827	c.277G>C	c.(277-279)GAC>CAC	p.D93H	CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Missense_Mutation_p.D93H	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	93	Extracellular (Potential).|LRR 2.					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						GCTATACCTTGACCATAACCA	0.373													108	24	---	---	---	---	PASS
SPOCK2	9806	broad.mit.edu	37	10	73848064	73848064	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73848064C>A	uc001jso.1	-	1	468	c.23G>T	c.(22-24)CGG>CTG	p.R8L	SPOCK2_uc001jsp.2_Missense_Mutation_p.R8L|SPOCK2_uc010qjs.1_Missense_Mutation_p.R8L|SPOCK2_uc010qjt.1_Missense_Mutation_p.R8L	NM_014767	NP_055582	Q92563	TICN2_HUMAN	sparc/osteonectin, cwcv and kazal-like domains	8					extracellular matrix organization|regulation of cell differentiation|signal transduction|synapse assembly	proteinaceous extracellular matrix	calcium ion binding				0						CAGCACCAGCCGCCCGCAGCC	0.682													9	3	---	---	---	---	PASS
ECD	11319	broad.mit.edu	37	10	74914078	74914078	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74914078G>C	uc001jtn.2	-	6	962	c.719C>G	c.(718-720)CCT>CGT	p.P240R	ECD_uc009xqx.2_Missense_Mutation_p.P240R|ECD_uc009xqy.2_Missense_Mutation_p.P240R|ECD_uc001jto.2_Intron	NM_007265	NP_009196	O95905	SGT1_HUMAN	suppressor of S. cerevisiae gcr2 isoform 1	240					regulation of glycolysis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	transcription coactivator activity			pancreas(1)	1	Prostate(51;0.0119)					CAGGTCAATAGGGTCTCGTAG	0.483													21	14	---	---	---	---	PASS
KIF20B	9585	broad.mit.edu	37	10	91533730	91533730	+	Silent	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91533730T>A	uc001kgs.1	+	33	5460	c.5388T>A	c.(5386-5388)ATT>ATA	p.I1796I	KIF20B_uc001kgr.1_Silent_p.I1756I|KIF20B_uc001kgt.1_Silent_p.I1007I|KIF20B_uc009xtw.1_RNA	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	1796	Interaction with PIN1.				cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						AATTTCAGATTTTAATGGACC	0.284													42	15	---	---	---	---	PASS
HTR7	3363	broad.mit.edu	37	10	92508865	92508865	+	Silent	SNP	T	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92508865T>G	uc001kha.2	-	2	1269	c.1026A>C	c.(1024-1026)CCA>CCC	p.P342P	HTR7_uc001kgz.2_Silent_p.P342P|HTR7_uc001khb.2_Silent_p.P342P	NM_019859	NP_062873	P34969	5HT7R_HUMAN	5-hydroxytryptamine receptor 7 isoform d	342	Helical; Name=6; (By similarity).				blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)	GGAGGAAAAATGGCAGCCAGC	0.532													8	53	---	---	---	---	PASS
ENTPD7	57089	broad.mit.edu	37	10	101464369	101464369	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101464369G>A	uc001kqa.3	+	13	1922	c.1744G>A	c.(1744-1746)GCC>ACC	p.A582T	ENTPD7_uc009xwl.2_Missense_Mutation_p.A584T	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase	582	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane	hydrolase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		ACAAACACGAGCCTCAGCTCC	0.547													27	4	---	---	---	---	PASS
C10orf118	55088	broad.mit.edu	37	10	115905426	115905426	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115905426T>C	uc001lbb.1	-	5	1635	c.983A>G	c.(982-984)GAA>GGA	p.E328G	C10orf118_uc009xyd.1_5'Flank|C10orf118_uc001lbc.1_Missense_Mutation_p.E328G|C10orf118_uc009xye.1_RNA	NM_018017	NP_060487	Q7Z3E2	CJ118_HUMAN	CTCL tumor antigen L14-2	328	Potential.									ovary(2)	2		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		TGTCTCTTTTTCCTTTCGAAG	0.373													4	93	---	---	---	---	PASS
TRIM21	6737	broad.mit.edu	37	11	4411401	4411401	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4411401C>A	uc001lyy.1	-	2	352	c.239G>T	c.(238-240)AGC>ATC	p.S80I		NM_003141	NP_003132	P19474	RO52_HUMAN	tripartite motif protein 21	80					cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein deubiquitination|positive regulation of cell cycle|protein autoubiquitination|protein destabilization|protein monoubiquitination|protein polyubiquitination|protein trimerization	cytoplasmic mRNA processing body|nucleus	DNA binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|lung(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		GGCCTCCTGGCTGATTTCTTT	0.567													61	73	---	---	---	---	PASS
OR51D1	390038	broad.mit.edu	37	11	4661500	4661500	+	Silent	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4661500T>A	uc010qyk.1	+	1	480	c.480T>A	c.(478-480)TCT>TCA	p.S160S		NM_001004751	NP_001004751	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D,	160	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTGGACTATCTGCCCTGACCA	0.532													113	127	---	---	---	---	PASS
OR51T1	401665	broad.mit.edu	37	11	4903252	4903252	+	Silent	SNP	C	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4903252C>G	uc010qyp.1	+	1	204	c.204C>G	c.(202-204)CTC>CTG	p.L68L		NM_001004759	NP_001004759	Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T,	41	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCATTGCCCTCTTGGGAAACA	0.473													92	142	---	---	---	---	PASS
OR52E4	390081	broad.mit.edu	37	11	5905792	5905792	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5905792C>A	uc010qzs.1	+	1	270	c.270C>A	c.(268-270)AAC>AAA	p.N90K	TRIM5_uc001mbq.1_Intron	NM_001005165	NP_001005165	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E,	90	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTGGTTCAACCTCCAAGAGA	0.463													112	114	---	---	---	---	PASS
CNGA4	1262	broad.mit.edu	37	11	6265355	6265355	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6265355G>T	uc001mco.2	+	6	1551	c.1444G>T	c.(1444-1446)GCT>TCT	p.A482S	CNGA4_uc010raa.1_3'UTR|CNGA4_uc001mcn.2_3'UTR	NM_001037329	NP_001032406	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	482	Cytoplasmic (Potential).				response to stimulus|sensory perception of smell		cAMP binding			skin(1)	1		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGACGTGAATGCTGAGGCAGC	0.567													63	60	---	---	---	---	PASS
APBB1	322	broad.mit.edu	37	11	6423356	6423356	+	Silent	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6423356G>C	uc001mdb.1	-	8	1438	c.1338C>G	c.(1336-1338)CCC>CCG	p.P446P	APBB1_uc001mcz.1_Silent_p.P67P|APBB1_uc001mdd.3_Silent_p.P226P|APBB1_uc001mda.2_5'UTR|APBB1_uc001mdc.1_Silent_p.P446P|APBB1_uc010rab.1_5'Flank|APBB1_uc010rac.1_5'Flank|APBB1_uc010rad.1_Silent_p.P67P|APBB1_uc010rae.1_Silent_p.P211P|APBB1_uc010raf.1_3'UTR|APBB1_uc009yfa.2_Silent_p.P187P|APBB1_uc009yey.2_Silent_p.P187P|APBB1_uc010rag.1_Silent_p.P187P|APBB1_uc009yfb.2_Silent_p.P187P|APBB1_uc001mde.2_Silent_p.P187P|APBB1_uc010rah.1_Silent_p.P187P	NM_001164	NP_001155	O00213	APBB1_HUMAN	amyloid beta A4 precursor protein-binding,	446	PID 1.				apoptosis|axonogenesis|cell cycle arrest|histone H4 acetylation|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of thymidylate synthase biosynthetic process|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|signal transduction|transcription, DNA-dependent	cytoplasm|growth cone|lamellipodium|nucleus|plasma membrane|synapse	beta-amyloid binding|chromatin binding|histone binding|proline-rich region binding|transcription factor binding			breast(2)	2		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		TGCTGATGATGGGTTGGGCGT	0.597													21	29	---	---	---	---	PASS
SLC17A6	57084	broad.mit.edu	37	11	22398990	22398990	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22398990C>A	uc001mqk.2	+	12	1866	c.1453C>A	c.(1453-1455)CTA>ATA	p.L485I		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	485	Helical; (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						GATCGCTGCCCTAGTCCACTA	0.458													43	57	---	---	---	---	PASS
LRRC4C	57689	broad.mit.edu	37	11	40136857	40136857	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40136857C>A	uc001mxa.1	-	2	2950	c.986G>T	c.(985-987)CGG>CTG	p.R329L	LRRC4C_uc001mxc.1_Missense_Mutation_p.R325L|LRRC4C_uc001mxd.1_Missense_Mutation_p.R325L|LRRC4C_uc001mxb.1_Missense_Mutation_p.R325L	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	329	LRRCT.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				AGTGTTACACCGGGCACAACA	0.502													30	50	---	---	---	---	PASS
OR5D14	219436	broad.mit.edu	37	11	55563899	55563899	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55563899C>A	uc010rim.1	+	1	868	c.868C>A	c.(868-870)CTG>ATG	p.L290M		NM_001004735	NP_001004735	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D,	290	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3		all_epithelial(135;0.196)				GCTGAACCCTCTGATCTACAG	0.413													35	62	---	---	---	---	PASS
OR5T2	219464	broad.mit.edu	37	11	55999874	55999874	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55999874G>A	uc010rjc.1	-	1	788	c.788C>T	c.(787-789)GCC>GTC	p.A263V		NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T,	263	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					CTTCAGAATGGCCAACAGAAT	0.443													108	156	---	---	---	---	PASS
P2RX3	5024	broad.mit.edu	37	11	57106022	57106022	+	5'UTR	SNP	A	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57106022A>C	uc001nju.2	+	1					SSRP1_uc001njt.2_5'Flank	NM_002559	NP_002550	P56373	P2RX3_HUMAN	purinergic receptor P2X3						positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity				0						GCACTCTCTCAGCATGAACTG	0.572													191	218	---	---	---	---	PASS
MS4A8B	83661	broad.mit.edu	37	11	60482867	60482867	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60482867G>T	uc001npv.2	+	7	936	c.733G>T	c.(733-735)GAG>TAG	p.E245*		NM_031457	NP_113645	Q9BY19	M4A8B_HUMAN	membrane-spanning 4-domains, subfamily A, member	245	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						TTATTCCAGTGAGATCCAAGC	0.483													14	39	---	---	---	---	PASS
VWCE	220001	broad.mit.edu	37	11	61042035	61042035	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61042035C>G	uc001nra.2	-	12	1796	c.1517G>C	c.(1516-1518)CGG>CCG	p.R506P	VWCE_uc001nrb.2_RNA	NM_152718	NP_689931	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	506	VWFC 3.					extracellular region	calcium ion binding			ovary(1)	1						TGCGTACCACCGGCCGTGGAA	0.562													35	79	---	---	---	---	PASS
MAP4K2	5871	broad.mit.edu	37	11	64568595	64568595	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64568595C>A	uc001obh.2	-	8	610	c.518G>T	c.(517-519)GGG>GTG	p.G173V	MAP4K2_uc001obi.2_Missense_Mutation_p.G173V	NM_004579	NP_004570	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase	173	Protein kinase.				activation of JUN kinase activity|immune response|positive regulation of JNK cascade|vesicle targeting	basolateral plasma membrane|Golgi membrane|soluble fraction	ATP binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(1)|pancreas(1)	2						GTAGGGAGTCCCAATGAAAGA	0.642													41	68	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65266582	65266582	+	RNA	SNP	A	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65266582A>G	uc010roh.1	+	1		c.1350A>G			MALAT1_uc001odz.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						GAAACCGCAGATAAGTTTTTT	0.438													69	53	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	67372426	67372426	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67372426G>T	uc001omi.1	-	2	271	c.115C>A	c.(115-117)CTG>ATG	p.L39M	NDUFV1_uc001omj.2_5'Flank|NDUFV1_uc010rpv.1_5'Flank|NDUFV1_uc001oml.2_5'Flank|NDUFV1_uc001omk.3_5'Flank					RecName: Full=Uncharacterized protein C11orf72;																		GATGACATCAGAGTGGATCTC	0.473													13	20	---	---	---	---	PASS
PDE2A	5138	broad.mit.edu	37	11	72288475	72288475	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72288475C>T	uc010rrc.1	-	31	3022	c.2779G>A	c.(2779-2781)GGC>AGC	p.G927S	PDE2A_uc001oso.2_Missense_Mutation_p.G906S|PDE2A_uc010rra.1_Missense_Mutation_p.G920S|PDE2A_uc001osn.2_Missense_Mutation_p.G671S|PDE2A_uc010rrb.1_Missense_Mutation_p.G918S|PDE2A_uc010rrd.1_Missense_Mutation_p.G812S	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1	927					platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	GCCCTAGTGCCATCCAGATCA	0.612													50	56	---	---	---	---	PASS
ARRB1	408	broad.mit.edu	37	11	74977313	74977313	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74977313T>A	uc001owe.1	-	16	1373	c.1151A>T	c.(1150-1152)GAC>GTC	p.D384V	ARRB1_uc001owf.1_Missense_Mutation_p.D376V	NM_004041	NP_004032	P49407	ARRB1_HUMAN	arrestin beta 1 isoform A	384	Interaction with TRAF6.				G-protein coupled receptor internalization|histone H4 acetylation|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|positive regulation of histone acetylation|positive regulation of Rho protein signal transduction|positive regulation of transcription from RNA polymerase II promoter|post-Golgi vesicle-mediated transport|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|signal transduction|stress fiber assembly|transcription from RNA polymerase II promoter	chromatin|coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane fraction|nucleus|plasma membrane|pseudopodium|soluble fraction	angiotensin receptor binding|enzyme inhibitor activity|GTPase activator activity|insulin-like growth factor receptor binding|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding			breast(2)	2						TACAATGTCGTCATCACTGGT	0.527													45	44	---	---	---	---	PASS
MYO7A	4647	broad.mit.edu	37	11	76924036	76924036	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76924036G>A	uc001oyb.2	+	47	6666	c.6394G>A	c.(6394-6396)GCC>ACC	p.A2132T	MYO7A_uc001oyc.2_Missense_Mutation_p.A2092T|MYO7A_uc001oye.2_RNA	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1	2132	FERM 2.				actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						CCTCCTAATTGCCATCAACAA	0.517													3	8	---	---	---	---	PASS
FAM76B	143684	broad.mit.edu	37	11	95522558	95522558	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95522558T>G	uc001pfn.2	-	1	397	c.85A>C	c.(85-87)AAG>CAG	p.K29Q	CEP57_uc001pfo.1_5'Flank|CEP57_uc010ruh.1_5'Flank|CEP57_uc010rui.1_5'Flank|CEP57_uc009ywn.1_5'Flank|CEP57_uc001pfp.1_5'Flank|CEP57_uc001pfq.1_5'Flank|CEP57_uc001pfr.1_5'Flank|FAM76B_uc001pfm.2_RNA	NM_144664	NP_653265	Q5HYJ3	FA76B_HUMAN	hypothetical protein LOC143684	29											0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CCACGGACCTTGCAGAGCTGC	0.701													5	13	---	---	---	---	PASS
CNTN5	53942	broad.mit.edu	37	11	99715950	99715950	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99715950C>A	uc001pga.2	+	6	872	c.533C>A	c.(532-534)ACT>AAT	p.T178N	CNTN5_uc009ywv.1_Missense_Mutation_p.T178N|CNTN5_uc001pfz.2_Missense_Mutation_p.T178N|CNTN5_uc001pgb.2_Missense_Mutation_p.T104N	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	178	Ig-like C2-type 1.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GCAACCAACACTGTGGGGAGT	0.348													88	102	---	---	---	---	PASS
CNTN5	53942	broad.mit.edu	37	11	100169925	100169925	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100169925G>T	uc001pga.2	+	20	2756	c.2417G>T	c.(2416-2418)GGC>GTC	p.G806V	CNTN5_uc001pfz.2_Missense_Mutation_p.G806V|CNTN5_uc001pgb.2_Missense_Mutation_p.G732V|CNTN5_uc010ruk.1_Missense_Mutation_p.G77V	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	806	Fibronectin type-III 2.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AATGGGGAAGGCTTCGGCTAT	0.363													24	28	---	---	---	---	PASS
KIAA1826	84437	broad.mit.edu	37	11	105880813	105880813	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105880813T>C	uc001piy.2	-	3	660	c.487A>G	c.(487-489)ATG>GTG	p.M163V	KIAA1826_uc001piz.2_Missense_Mutation_p.M163V	NM_032424	NP_115800	Q8NCY6	K1826_HUMAN	hypothetical protein LOC84437	163						nucleus				breast(1)	1		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.56e-05)|Epithelial(105;0.00432)|all cancers(92;0.0309)		GATGACAACATTTCTTCCTCC	0.368													68	81	---	---	---	---	PASS
NPAT	4863	broad.mit.edu	37	11	108044245	108044245	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108044245G>T	uc001pjz.3	-	13	1568	c.1466C>A	c.(1465-1467)TCT>TAT	p.S489Y	NPAT_uc001pka.2_Missense_Mutation_p.S284Y	NM_002519	NP_002510	Q14207	NPAT_HUMAN	nuclear protein,  ataxia-telangiectasia locus	489					positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			ovary(2)	2		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		TGAAGACAAAGAGTTCTTTTC	0.373													137	187	---	---	---	---	PASS
ERC1	23085	broad.mit.edu	37	12	1137525	1137525	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1137525G>T	uc001qjb.2	+	2	697	c.456G>T	c.(454-456)ATG>ATT	p.M152I	ERC1_uc001qiz.2_RNA|ERC1_uc001qjc.2_Missense_Mutation_p.M152I|ERC1_uc001qja.2_RNA|ERC1_uc001qjd.2_RNA|ERC1_uc001qjf.2_Missense_Mutation_p.M152I	NM_178040	NP_829884	Q8IUD2	RB6I2_HUMAN	RAB6-interacting protein 2 isoform epsilon	152	Potential.				I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			ACACAATCATGGATCTGCAGA	0.453													66	90	---	---	---	---	PASS
ERC1	23085	broad.mit.edu	37	12	1137526	1137526	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1137526G>T	uc001qjb.2	+	2	698	c.457G>T	c.(457-459)GAT>TAT	p.D153Y	ERC1_uc001qiz.2_RNA|ERC1_uc001qjc.2_Missense_Mutation_p.D153Y|ERC1_uc001qja.2_RNA|ERC1_uc001qjd.2_RNA|ERC1_uc001qjf.2_Missense_Mutation_p.D153Y	NM_178040	NP_829884	Q8IUD2	RB6I2_HUMAN	RAB6-interacting protein 2 isoform epsilon	153	Potential.				I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			CACAATCATGGATCTGCAGAC	0.448													66	89	---	---	---	---	PASS
DPPA3	359787	broad.mit.edu	37	12	7868830	7868830	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7868830G>T	uc001qtf.2	+	3	442	c.364G>T	c.(364-366)GTT>TTT	p.V122F		NM_199286	NP_954980	Q6W0C5	DPPA3_HUMAN	stella	122						cytoplasm|nucleus					0				Kidney(36;0.0887)		GCCTAAGGGAGTTAAGGTAAG	0.289													7	18	---	---	---	---	PASS
KLRB1	3820	broad.mit.edu	37	12	9750731	9750731	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9750731G>T	uc010sgt.1	-	5	503	c.441C>A	c.(439-441)GAC>GAA	p.D147E		NM_002258	NP_002249	Q12918	KLRB1_HUMAN	killer cell lectin-like receptor subfamily B,	147	C-type lectin.|Extracellular (Potential).				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	sugar binding|transmembrane receptor activity				0						GAATTGCTTTGTCACGTATCA	0.279													24	33	---	---	---	---	PASS
MGST1	4257	broad.mit.edu	37	12	16507203	16507203	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16507203A>T	uc001rdf.2	+	2	82	c.17A>T	c.(16-18)CAG>CTG	p.Q6L	MGST1_uc001rdg.2_Missense_Mutation_p.Q6L|MGST1_uc009zih.1_Intron|MGST1_uc001rdh.2_Missense_Mutation_p.Q6L|MGST1_uc001rdi.2_Missense_Mutation_p.Q6L	NM_145792	NP_665735	P10620	MGST1_HUMAN	microsomal glutathione S-transferase 1	6	Lumenal (By similarity).				protein homotrimerization|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane	glutathione transferase activity				0		Hepatocellular(102;0.121)			Glutathione(DB00143)	GACCTCACCCAGGTAATGGAT	0.323													35	54	---	---	---	---	PASS
CNTN1	1272	broad.mit.edu	37	12	41316152	41316152	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41316152G>A	uc001rmm.1	+	5	435	c.322G>A	c.(322-324)GAT>AAT	p.D108N	CNTN1_uc009zjy.1_Missense_Mutation_p.D108N|CNTN1_uc001rmn.1_Missense_Mutation_p.D97N|CNTN1_uc001rmo.2_Missense_Mutation_p.D108N	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor	108	Ig-like C2-type 1.				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				CAAACAGAAAGATGCTGGAAT	0.393													66	87	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48368603	48368603	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48368603G>C	uc001rqu.2	-	52	4110	c.3929C>G	c.(3928-3930)GCC>GGC	p.A1310G	COL2A1_uc001rqt.2_Missense_Mutation_p.A91G|COL2A1_uc009zkw.2_RNA|COL2A1_uc001rqv.2_Missense_Mutation_p.A1241G	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	1310	Fibrillar collagen NC1.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	AACCTTCATGGCGTCCAAGGT	0.557													86	99	---	---	---	---	PASS
TENC1	23371	broad.mit.edu	37	12	53454219	53454219	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53454219G>A	uc001sbp.2	+	19	2783	c.2648G>A	c.(2647-2649)GGC>GAC	p.G883D	TENC1_uc001sbl.2_Missense_Mutation_p.G759D|TENC1_uc001sbn.2_Missense_Mutation_p.G893D|TENC1_uc001sbq.2_Missense_Mutation_p.G281D|TENC1_uc001sbr.2_RNA|TENC1_uc009zmr.2_Missense_Mutation_p.G378D|TENC1_uc001sbs.2_5'Flank	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase	883	Pro-rich.				intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding			ovary(1)|pancreas(1)	2						TGGAGGGAGGGCCCCAGTGGG	0.637													42	44	---	---	---	---	PASS
PDE1B	5153	broad.mit.edu	37	12	54964082	54964082	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54964082G>A	uc001sgd.1	+	6	701	c.535G>A	c.(535-537)GCC>ACC	p.A179T	PDE1B_uc010soz.1_Missense_Mutation_p.A42T|PDE1B_uc010spa.1_Missense_Mutation_p.A138T|PDE1B_uc001sgf.2_Missense_Mutation_p.A42T|PDE1B_uc001sge.2_Missense_Mutation_p.A159T|PDE1B_uc009znq.2_5'UTR	NM_000924	NP_000915	Q01064	PDE1B_HUMAN	phosphodiesterase 1B isoform 1	179					activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						AGATGACCATGCCCTGAGGAC	0.498													90	102	---	---	---	---	PASS
PPFIA2	8499	broad.mit.edu	37	12	82147808	82147808	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82147808C>A	uc001szo.1	-	3	354	c.193G>T	c.(193-195)GAT>TAT	p.D65Y	PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment										ovary(3)|lung(2)|pancreas(1)	6						TAGATGACATCCTGAAGTCTT	0.488													26	21	---	---	---	---	PASS
UBE3B	89910	broad.mit.edu	37	12	109971309	109971309	+	Silent	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109971309C>T	uc001top.2	+	27	3564	c.2961C>T	c.(2959-2961)TTC>TTT	p.F987F	UBE3B_uc001toq.2_Silent_p.F987F|UBE3B_uc001tos.2_Silent_p.F414F|UBE3B_uc001tot.2_Silent_p.F105F|UBE3B_uc010sxp.1_Silent_p.F105F	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	987	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			ovary(2)|lung(2)	4						TCCTGGGATTCGCCTACCTCA	0.642													16	140	---	---	---	---	PASS
TCTN1	79600	broad.mit.edu	37	12	111052162	111052162	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111052162G>A	uc009zvs.2	+	1	283	c.175G>A	c.(175-177)GCT>ACT	p.A59T	TCTN1_uc010syb.1_Missense_Mutation_p.A59T|TCTN1_uc009zvr.1_RNA|TCTN1_uc001trl.2_RNA|TCTN1_uc001trm.2_5'UTR|TCTN1_uc010syc.1_RNA|TCTN1_uc001tro.2_RNA|TCTN1_uc001trp.3_Missense_Mutation_p.A59T|TCTN1_uc001trn.3_Missense_Mutation_p.A59T|TCTN1_uc001tri.2_5'UTR|TCTN1_uc001trj.1_5'UTR|TCTN1_uc001trk.3_RNA	NM_001082537	NP_001076006	Q2MV58	TECT1_HUMAN	tectonic family member 1 isoform 2	59					multicellular organismal development	extracellular region					0						GACTCCCAGGGCTCCAGGGCC	0.687													12	13	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124330637	124330637	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124330637T>C	uc001uft.3	+	31	5421	c.5396T>C	c.(5395-5397)ATG>ACG	p.M1799T		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1799	AAA 1 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TACGAGTACATGGGCCTGAAC	0.577													32	51	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	129566527	129566527	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129566527C>A	uc009zyl.1	-	7	2028	c.1700G>T	c.(1699-1701)GGC>GTC	p.G567V	TMEM132D_uc001uia.2_Missense_Mutation_p.G105V	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	567	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CAGGGTGCAGCCGCGGCCCCT	0.642													42	65	---	---	---	---	PASS
ATP8A2	51761	broad.mit.edu	37	13	26411317	26411317	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26411317C>G	uc001uqk.2	+	29	2913	c.2771C>G	c.(2770-2772)CCG>CGG	p.P924R	ATP8A2_uc010tdi.1_Missense_Mutation_p.P859R|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Missense_Mutation_p.P474R	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	884	Helical; (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		ACCGCTTTGCCGCCCTTCACT	0.498													61	96	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32914165	32914165	+	Silent	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32914165A>T	uc001uub.1	+	11	5900	c.5673A>T	c.(5671-5673)GCA>GCT	p.A1891A		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	1891					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AAATTATGGCAGGTTGTTACG	0.323			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			14	48	---	---	---	---	PASS
LCP1	3936	broad.mit.edu	37	13	46725120	46725120	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46725120A>T	uc001vaz.3	-	8	959	c.833T>A	c.(832-834)CTG>CAG	p.L278Q	LCP1_uc001vba.3_Missense_Mutation_p.L278Q	NM_002298	NP_002289	P13796	PLSL_HUMAN	L-plastin	278	CH 2.|Actin-binding 1.				regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding			lung(4)|ovary(3)	7		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		TGCATTTTCCAGGTGGTAATT	0.473			T	BCL6	NHL 								79	111	---	---	---	---	PASS
INTS6	26512	broad.mit.edu	37	13	51948489	51948489	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51948489G>C	uc001vfk.2	-	15	2573	c.1959C>G	c.(1957-1959)ATC>ATG	p.I653M	INTS6_uc001vfi.2_Missense_Mutation_p.I337M|INTS6_uc001vfj.2_Missense_Mutation_p.I640M|INTS6_uc001vfl.2_Missense_Mutation_p.I475M	NM_012141	NP_036273	Q9UL03	INT6_HUMAN	integrator complex subunit 6 isoform a	653					snRNA processing	actin cytoskeleton|integrator complex	protein binding|transmembrane receptor activity			ovary(1)|lung(1)	2		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		GTCTTTTAGGGATCCCTTGCA	0.428													164	190	---	---	---	---	PASS
HNRNPA1L2	144983	broad.mit.edu	37	13	53217355	53217355	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53217355G>T	uc001vgx.1	+	7	1801	c.728G>T	c.(727-729)GGC>GTC	p.G243V	HNRNPA1L2_uc001vgy.1_Missense_Mutation_p.G243V|HNRNPA1L2_uc001vgz.1_Missense_Mutation_p.G243V	NM_001011724	NP_001011724	Q32P51	RA1L2_HUMAN	heterogeneous nuclear ribonucleoprotein A1-like	243	Gly-rich.				mRNA processing|mRNA transport|RNA splicing	cytoplasm|spliceosomal complex	nucleotide binding|RNA binding				0						agtggggatggctataatgga	0.095													14	15	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70514254	70514254	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70514254G>T	uc001vip.2	-	4	1726	c.932C>A	c.(931-933)CCA>CAA	p.P311Q	KLHL1_uc010thm.1_Missense_Mutation_p.P250Q	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	311					actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ACAGTTAGATGGATGCAAAAG	0.468													35	28	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77760039	77760039	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77760039G>A	uc001vkf.2	-	32	4388	c.4297C>T	c.(4297-4299)CGT>TGT	p.R1433C	MYCBP2_uc010aev.2_Missense_Mutation_p.R837C	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	1433					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GTATAGACACGCAATAACCTC	0.373													49	59	---	---	---	---	PASS
SLITRK6	84189	broad.mit.edu	37	13	86368471	86368471	+	Nonsense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86368471C>A	uc001vll.1	-	2	2632	c.2173G>T	c.(2173-2175)GAA>TAA	p.E725*	SLITRK6_uc010afe.1_Nonsense_Mutation_p.E178*	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	725	Cytoplasmic (Potential).					integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		GAATGATTTTCCTGTTCCAAA	0.393													232	353	---	---	---	---	PASS
TMTC4	84899	broad.mit.edu	37	13	101287430	101287430	+	Nonsense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101287430C>A	uc001vou.2	-	10	1325	c.1165G>T	c.(1165-1167)GGA>TGA	p.G389*	TMTC4_uc001vot.2_Nonsense_Mutation_p.G408*|TMTC4_uc010tja.1_Nonsense_Mutation_p.G278*|TMTC4_uc001vov.1_Nonsense_Mutation_p.G134*|TMTC4_uc001vow.1_Nonsense_Mutation_p.G172*	NM_001079669	NP_001073137	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat	389	Helical; (Potential).					integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					ACGAGAAATCCCAGGCCCAGA	0.468													12	19	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101759882	101759882	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101759882C>A	uc001vox.1	-	22	2724	c.2535G>T	c.(2533-2535)AGG>AGT	p.R845S		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	845	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AGTTTCTGAACCTGTGTTCTC	0.507													55	100	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101759883	101759883	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101759883C>A	uc001vox.1	-	22	2723	c.2534G>T	c.(2533-2535)AGG>ATG	p.R845M		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	845	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GTTTCTGAACCTGTGTTCTCG	0.507													54	101	---	---	---	---	PASS
COL4A2	1284	broad.mit.edu	37	13	111117753	111117753	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111117753G>A	uc001vqx.2	+	25	2067	c.1778G>A	c.(1777-1779)GGT>GAT	p.G593D		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	593	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TTCACACAGGGTGATGGCATC	0.493													60	99	---	---	---	---	PASS
OR4M1	441670	broad.mit.edu	37	14	20249064	20249064	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20249064G>T	uc010tku.1	+	1	583	c.583G>T	c.(583-585)GAG>TAG	p.E195*		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	195	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CACCTTCCCAGAGGAGTTAGT	0.468													167	213	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22466256	22466256	+	Intron	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22466256C>A	uc001wbw.2	+						uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Silent_p.G62G|uc001wcp.2_Silent_p.G62G|uc001wcr.1_Silent_p.G22G|uc001wcs.1_Silent_p.G22G|uc010ajf.1_Silent_p.G22G|uc001wcq.2_Silent_p.G62G|uc010ajd.1_Silent_p.G62G					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CAGGTAGAGGCCTTGTCCACC	0.398													40	70	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22466395	22466395	+	Intron	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22466395T>C	uc001wbw.2	+						uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Missense_Mutation_p.C109R|uc001wcp.2_Missense_Mutation_p.C109R|uc001wcr.1_Missense_Mutation_p.C69R|uc001wcs.1_Missense_Mutation_p.C69R|uc010ajf.1_Missense_Mutation_p.C69R|uc001wcq.2_Missense_Mutation_p.C109R|uc010ajd.1_Missense_Mutation_p.C109R					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TTCTTACTTCTGTGCTACGGA	0.502													22	23	---	---	---	---	PASS
NYNRIN	57523	broad.mit.edu	37	14	24877620	24877620	+	Silent	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24877620G>T	uc001wpf.3	+	3	1062	c.744G>T	c.(742-744)GGG>GGT	p.G248G		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	248					DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						TGGACATGGGGACCCTCCAGA	0.592													53	74	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42356843	42356843	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42356843A>T	uc001wvm.2	+	3	2213	c.1015A>T	c.(1015-1017)AAC>TAC	p.N339Y	LRFN5_uc010ana.2_Missense_Mutation_p.N339Y	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	339	Extracellular (Potential).|Ig-like.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GGTGTATGATAACGGAACACT	0.448										HNSCC(30;0.082)			86	128	---	---	---	---	PASS
FSCB	84075	broad.mit.edu	37	14	44974473	44974473	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44974473G>T	uc001wvn.2	-	1	2027	c.1718C>A	c.(1717-1719)CCT>CAT	p.P573H		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	573	Ala-rich.					cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		AAGCTCAAGAGGGGCCTCTTC	0.522													24	47	---	---	---	---	PASS
PAPLN	89932	broad.mit.edu	37	14	73719481	73719481	+	Silent	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73719481G>A	uc010ttx.1	+	10	1255	c.1092G>A	c.(1090-1092)AAG>AAA	p.K364K	PAPLN_uc001xnw.3_Silent_p.K337K|PAPLN_uc010arl.2_RNA|PAPLN_uc010ttw.1_RNA|PAPLN_uc010tty.1_Silent_p.K364K	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	364	TSP type-1 3.					proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		CGGAGACCAAGCGGTGAGACC	0.607													19	167	---	---	---	---	PASS
NRXN3	9369	broad.mit.edu	37	14	80158586	80158586	+	Intron	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80158586G>T	uc001xun.2	+						NRXN3_uc001xum.1_RNA|NRXN3_uc001xup.2_RNA|NRXN3_uc001xuq.2_Intron|NRXN3_uc010asw.2_Missense_Mutation_p.E224D|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GGCCTGTAGAGGAGTGGCTGC	0.338													16	19	---	---	---	---	PASS
PRIMA1	145270	broad.mit.edu	37	14	94187904	94187904	+	Intron	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94187904G>A	uc001ybw.1	-						PRIMA1_uc001ybx.1_Intron	NM_178013	NP_821092	Q86XR5	PRIMA_HUMAN	proline rich membrane anchor 1 precursor						neurotransmitter catabolic process	cell junction|integral to membrane|synapse				large_intestine(1)|skin(1)	2		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)		TGGAAGTGGGGGGAGGGGACA	0.542													25	28	---	---	---	---	PASS
TECPR2	9895	broad.mit.edu	37	14	102916037	102916037	+	Silent	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102916037G>C	uc001ylw.1	+	14	3295	c.3147G>C	c.(3145-3147)TCG>TCC	p.S1049S	TECPR2_uc010awl.2_Silent_p.S1049S|TECPR2_uc010txx.1_Silent_p.S212S	NM_014844	NP_055659	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	1049							protein binding			lung(1)|central_nervous_system(1)|skin(1)	3						CCACTCACTCGGTGGCCACAG	0.562													61	71	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25924794	25924794	+	Silent	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25924794T>A	uc010ayu.2	-	21	4300	c.4194A>T	c.(4192-4194)CCA>CCT	p.P1398P		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1398	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CAGCCTCCCCTGGCGCAGAGG	0.677													36	58	---	---	---	---	PASS
CAPN3	825	broad.mit.edu	37	15	42693953	42693953	+	Missense_Mutation	SNP	G	T	T	rs121434548		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42693953G>T	uc001zpn.1	+	11	1775	c.1469G>T	c.(1468-1470)CGG>CTG	p.R490L	CAPN3_uc001zpk.1_Missense_Mutation_p.R263L|CAPN3_uc001zpl.1_Missense_Mutation_p.R403L|CAPN3_uc010udf.1_Missense_Mutation_p.R403L|CAPN3_uc010udg.1_Missense_Mutation_p.R355L|CAPN3_uc001zpo.1_Missense_Mutation_p.R490L|CAPN3_uc001zpp.1_Missense_Mutation_p.R442L|CAPN3_uc001zpq.1_5'Flank	NM_000070	NP_000061	P20807	CAN3_HUMAN	calpain 3 isoform a	490	Domain III.		R -> W (in LGMD2A).|R -> Q (in LGMD2A).		muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity			central_nervous_system(1)	1		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		AAGAACCGGCGGAAGGACCGG	0.572													20	23	---	---	---	---	PASS
SLC12A1	6557	broad.mit.edu	37	15	48539555	48539555	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48539555T>A	uc001zwn.3	+	13	1798	c.1582T>A	c.(1582-1584)TAC>AAC	p.Y528N	SLC12A1_uc010uew.1_Missense_Mutation_p.Y334N|SLC12A1_uc010bem.2_Missense_Mutation_p.Y528N|SLC12A1_uc001zwq.3_Missense_Mutation_p.Y299N|SLC12A1_uc001zwr.3_Missense_Mutation_p.Y255N	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2	528	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	GGACAACATCTACAAAGCCCT	0.363													61	56	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48713001	48713001	+	Missense_Mutation	SNP	C	A	A	rs138558987		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48713001C>A	uc001zwx.1	-	63	8030	c.7702G>T	c.(7702-7704)GTG>TTG	p.V2568L	FBN1_uc010beo.1_RNA	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	2568	EGF-like 45; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CACTCGTCCACGTCTGAAAAA	0.537													30	36	---	---	---	---	PASS
SECISBP2L	9728	broad.mit.edu	37	15	49329817	49329817	+	Silent	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49329817G>A	uc001zxe.1	-	2	308	c.174C>T	c.(172-174)TAC>TAT	p.Y58Y	SECISBP2L_uc001zxd.1_Silent_p.Y58Y|SECISBP2L_uc010bep.1_5'UTR|SECISBP2L_uc010beq.1_Silent_p.Y58Y	NM_014701	NP_055516	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	58										breast(1)|skin(1)	2						GCACAAATGGGTAACAAGTAA	0.383													42	49	---	---	---	---	PASS
PML	5371	broad.mit.edu	37	15	74327786	74327786	+	Intron	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74327786G>T	uc002awv.2	+						PML_uc002awm.2_3'UTR|PML_uc002awl.2_3'UTR|PML_uc002awj.1_3'UTR|PML_uc002awk.2_Missense_Mutation_p.A662S|PML_uc002awn.2_3'UTR|PML_uc002awo.2_Missense_Mutation_p.A614S|PML_uc002awp.2_Intron|PML_uc002awq.2_Intron|PML_uc002awr.2_Intron|PML_uc002aws.2_Intron|PML_uc002awt.2_Intron|PML_uc002awu.2_Intron|PML_uc010ule.1_Intron|PML_uc002awx.2_3'UTR|PML_uc002awy.2_Missense_Mutation_p.A91S	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1						cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5						GTTGTACAGAGCACAGAGAGC	0.637			T	RARA|PAX5	APL|ALL								52	73	---	---	---	---	PASS
SGK269	79834	broad.mit.edu	37	15	77407452	77407452	+	Silent	SNP	C	T	T	rs55736391		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77407452C>T	uc002bcm.2	-	6	4595	c.4287G>A	c.(4285-4287)ACG>ACA	p.T1429T		NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	1429	Protein kinase.				cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		TTTTCCCATCCGTTTCTCCTT	0.507													8	247	---	---	---	---	PASS
ADAMTS7	11173	broad.mit.edu	37	15	79058441	79058441	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79058441G>A	uc002bej.3	-	19	4023	c.3812C>T	c.(3811-3813)GCT>GTT	p.A1271V	ADAMTS7_uc010und.1_3'UTR	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1271					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						ACCCTCCAGAGCTGGCTCCCA	0.642													28	41	---	---	---	---	PASS
ARRDC4	91947	broad.mit.edu	37	15	98513108	98513108	+	Intron	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98513108A>T	uc010bom.2	+						ARRDC4_uc002bui.3_Intron	NM_183376	NP_899232	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4						signal transduction						0	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			TTTTTGGCTTATTAGGTATAC	0.343													9	71	---	---	---	---	PASS
CHTF18	63922	broad.mit.edu	37	16	846977	846977	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:846977C>A	uc002cke.3	+	20	2681	c.2618C>A	c.(2617-2619)CCA>CAA	p.P873Q	CHTF18_uc002ckf.3_Missense_Mutation_p.P901Q|CHTF18_uc010brf.2_Missense_Mutation_p.P455Q|CHTF18_uc002ckg.3_Missense_Mutation_p.P391Q	NM_022092	NP_071375	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor	873					cell cycle|DNA replication	nucleus	ATP binding|DNA binding|nucleoside-triphosphatase activity			kidney(1)	1		Hepatocellular(780;0.00335)				GGGAGCCCCCCAGGGCTCGAG	0.647													87	16	---	---	---	---	PASS
NTHL1	4913	broad.mit.edu	37	16	2094632	2094632	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2094632C>T	uc002col.1	-	3	567	c.548G>A	c.(547-549)AGG>AAG	p.R183K	NTHL1_uc002com.1_Missense_Mutation_p.R184K	NM_002528	NP_002519	P78549	NTHL1_HUMAN	nth endonuclease III-like 1	183					depyrimidination|nucleotide-excision repair, DNA incision, 5'-to lesion	nucleoplasm	4 iron, 4 sulfur cluster binding|double-stranded DNA binding|endonuclease activity|metal ion binding|oxidized pyrimidine base lesion DNA N-glycosylase activity|protein binding			lung(1)	1						AGGGCTCACCCTCCAGAAACC	0.667								BER_DNA_glycosylases					46	8	---	---	---	---	PASS
E4F1	1877	broad.mit.edu	37	16	2279622	2279622	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2279622G>C	uc002cpm.2	+	3	409	c.361G>C	c.(361-363)GTG>CTG	p.V121L	E4F1_uc010bsi.2_Missense_Mutation_p.V121L|E4F1_uc010bsj.2_Missense_Mutation_p.V121L	NM_004424	NP_004415	Q66K89	E4F1_HUMAN	p120E4F	121					cell division|cell proliferation|interspecies interaction between organisms|mitosis|regulation of growth	cytoplasm|nucleoplasm	DNA binding|ligase activity|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						GGCCCACATCGTGGTGGAGGC	0.592													152	21	---	---	---	---	PASS
GLYR1	84656	broad.mit.edu	37	16	4895079	4895079	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4895079C>A	uc002cxx.3	-	3	188	c.151G>T	c.(151-153)GAT>TAT	p.D51Y	GLYR1_uc002cxy.2_RNA|GLYR1_uc002cxz.1_5'UTR|GLYR1_uc002cya.2_Missense_Mutation_p.D51Y|GLYR1_uc010uxv.1_Missense_Mutation_p.D51Y|UBN1_uc010uxw.1_5'Flank|UBN1_uc002cyb.2_5'Flank	NM_032569	NP_115958	Q49A26	GLYR1_HUMAN	cytokine-like nuclear factor n-pac	51	PWWP.				pentose-phosphate shunt	nucleus	coenzyme binding|DNA binding|methylated histone residue binding|phosphogluconate dehydrogenase (decarboxylating) activity				0						ACTCACTGATCTTCTGTTCCA	0.418													115	22	---	---	---	---	PASS
COG7	91949	broad.mit.edu	37	16	23464258	23464258	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23464258C>T	uc002dlo.2	-	1	246	c.58G>A	c.(58-60)GCC>ACC	p.A20T		NM_153603	NP_705831	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	20					intracellular protein transport|protein glycosylation|protein localization in Golgi apparatus|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0				GBM - Glioblastoma multiforme(48;0.0401)		GCCCTGAAGGCCGCATTGATC	0.607													49	54	---	---	---	---	PASS
FUS	2521	broad.mit.edu	37	16	31196347	31196347	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31196347G>T	uc002ebf.2	+	6	694	c.611G>T	c.(610-612)GGC>GTC	p.G204V	FUS_uc002ebe.1_Missense_Mutation_p.G200V|FUS_uc002ebh.2_Missense_Mutation_p.G203V|FUS_uc002ebg.2_Missense_Mutation_p.A11S|FUS_uc002ebi.2_Missense_Mutation_p.G204V|FUS_uc002ebj.2_Missense_Mutation_p.A11S|FUS_uc002ebk.1_5'Flank	NM_004960	NP_004951	P35637	FUS_HUMAN	fusion (involved in t(12;16) in malignant	204	Gly-rich.				cell death|nuclear mRNA splicing, via spliceosome	nucleoplasm	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		FUS/DDIT3(623)|FUS/ERG(163)|FUS/CREB3L2(158)|FUS/CREB3L1(6)|FUS/ATF1(4)|FUS/FEV(2)	soft_tissue(791)|haematopoietic_and_lymphoid_tissue(153)|bone(12)|breast(2)	958		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)		ggtggaggtggcagcggtggC	0.204			T	DDIT3|ERG|FEV|ATF1|CREB3L2|CREB3L1	liposarcoma|AML|Ewing sarcoma|angiomatoid fibrous histiocytoma|fibromyxoid sarcoma								23	23	---	---	---	---	PASS
NUDT21	11051	broad.mit.edu	37	16	56481718	56481718	+	Silent	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56481718T>A	uc002eja.2	-	2	447	c.300A>T	c.(298-300)GGA>GGT	p.G100G	NUDT21_uc002eiz.2_Silent_p.G25G	NM_007006	NP_008937	O43809	CPSF5_HUMAN	cleavage and polyadenylation specific factor 5	100	Nudix hydrolase.|Necessary for interactions with PAPOLA and PABPN1.|Necessary for RNA-binding.				mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|protein tetramerization|termination of RNA polymerase II transcription	centrosome|mRNA cleavage factor complex|paraspeckles	AU-rich element binding|histone deacetylase binding|hydrolase activity|mRNA binding|protein homodimerization activity				0						AGAAAGTTGTTCCCAGCTGCA	0.418													60	70	---	---	---	---	PASS
CDH5	1003	broad.mit.edu	37	16	66432377	66432377	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66432377G>A	uc002eom.3	+	10	1660	c.1504G>A	c.(1504-1506)GCA>ACA	p.A502T		NM_001795	NP_001786	P33151	CADH5_HUMAN	cadherin 5, type 2 preproprotein	502	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)		GCAGATCTCCGCAATAGACAA	0.498													52	69	---	---	---	---	PASS
RLTPR	146206	broad.mit.edu	37	16	67691204	67691204	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67691204C>G	uc002etn.2	+	37	4300	c.4180C>G	c.(4180-4182)CCA>GCA	p.P1394A	RLTPR_uc010vjr.1_Missense_Mutation_p.P1331A	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin	1394	Pro-rich.									breast(1)	1		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		CGAGGCACCTCCATCCCCAAG	0.642													21	26	---	---	---	---	PASS
CDH3	1001	broad.mit.edu	37	16	68732173	68732173	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68732173C>G	uc002ewf.2	+	16	3492	c.2360C>G	c.(2359-2361)TCC>TGC	p.S787C	CDH3_uc010vli.1_Missense_Mutation_p.S732C	NM_001793	NP_001784	P22223	CADH3_HUMAN	cadherin 3, type 1 preproprotein	787	Cytoplasmic (Potential).|Ser-rich.				adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding	p.?(1)		ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		GGCAGCGGCTCCGACGCCGCG	0.612													83	105	---	---	---	---	PASS
ADAMTS18	170692	broad.mit.edu	37	16	77353866	77353866	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77353866C>A	uc002ffc.3	-	16	2831	c.2412G>T	c.(2410-2412)TGG>TGT	p.W804C	ADAMTS18_uc010chc.1_Missense_Mutation_p.W392C|ADAMTS18_uc002ffe.1_Missense_Mutation_p.W500C	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	804	Spacer.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						AGTCGATGCTCCAGCCCCCGG	0.597													39	53	---	---	---	---	PASS
OR3A1	4994	broad.mit.edu	37	17	3195189	3195189	+	Silent	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3195189G>T	uc002fvh.1	-	1	688	c.688C>A	c.(688-690)CGA>AGA	p.R230R		NM_002550	NP_002541	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A,	230	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.R230*(1)		kidney(2)|central_nervous_system(1)	3						GAGCGAATTCGCAGGACTGCA	0.483													11	41	---	---	---	---	PASS
SPATA22	84690	broad.mit.edu	37	17	3346530	3346530	+	Missense_Mutation	SNP	A	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3346530A>C	uc002fvm.2	-	8	1075	c.838T>G	c.(838-840)TAT>GAT	p.Y280D	SPATA22_uc010vrg.1_Missense_Mutation_p.Y264D|SPATA22_uc010vrf.1_Intron|SPATA22_uc002fvn.2_Missense_Mutation_p.Y280D|SPATA22_uc002fvo.2_Missense_Mutation_p.Y280D|SPATA22_uc002fvp.2_Missense_Mutation_p.Y280D|SPATA22_uc010ckf.2_Missense_Mutation_p.Y237D	NM_032598	NP_115987	Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	280											0						GTCTTCGAATAATATGGGCCA	0.348													32	6	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7574017	7574017	+	Missense_Mutation	SNP	C	A	A	rs121912664		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7574017C>A	uc002gim.2	-	10	1204	c.1010G>T	c.(1009-1011)CGC>CTC	p.R337L	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Intron|TP53_uc010cne.1_Intron|TP53_uc010cnf.1_3'UTR|TP53_uc010cng.1_3'UTR|TP53_uc002gii.1_Missense_Mutation_p.R205L|TP53_uc010cnh.1_3'UTR|TP53_uc010cni.1_3'UTR|TP53_uc002gij.2_Missense_Mutation_p.R337L	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	337	Oligomerization.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.|Interaction with HIPK2.		R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R337C(12)|p.0?(7)|p.R337L(5)|p.R337H(2)|p.?(1)|p.I332fs*5(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CATCTCGAAGCGCTCACGCCC	0.453		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			21	3	---	---	---	---	PASS
TMEM107	84314	broad.mit.edu	37	17	8079165	8079165	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8079165C>A	uc002gkg.3	-	3	276	c.166G>T	c.(166-168)GCG>TCG	p.A56S	TMEM107_uc002gkh.3_Missense_Mutation_p.A62S|TMEM107_uc002gki.3_Missense_Mutation_p.A62S|TMEM107_uc002gkj.3_Intron|TMEM107_uc002gkk.2_Missense_Mutation_p.A56S	NM_183065	NP_898888	Q6UX40	TM107_HUMAN	transmembrane protein 107 isoform 2	56	Helical; (Potential).					integral to membrane					0						ACAGAGAGCGCGGCCACCAGC	0.597													60	9	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18054736	18054736	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18054736A>G	uc010vxh.1	+	39	8020	c.7682A>G	c.(7681-7683)TAC>TGC	p.Y2561C	MYO15A_uc010vxi.1_5'Flank|MYO15A_uc010vxj.1_5'Flank|MYO15A_uc010vxk.1_5'Flank	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	2561	Tail.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					CTGGTCCGGTACTCTACGCTC	0.637													61	11	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	19091375	19091375	+	IGR	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19091375G>T								GRAPL (29227 upstream) : EPN2 (49315 downstream)																							tactagagaagtttctctgaa	0.134													18	86	---	---	---	---	PASS
SRCIN1	80725	broad.mit.edu	37	17	36714598	36714598	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36714598G>T	uc002hqd.2	-	11	2291	c.2066C>A	c.(2065-2067)ACG>AAG	p.T689K	SRCIN1_uc002hqf.1_Missense_Mutation_p.T561K|SRCIN1_uc002hqe.2_Missense_Mutation_p.T543K|SRCIN1_uc002hqg.2_5'UTR	NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein	561	Interaction with SNAP25 (By similarity).				exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0						CTCTGCCTCCGTGCGCTTCAG	0.721											OREG0024362	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	42	---	---	---	---	PASS
NPEPPS	9520	broad.mit.edu	37	17	45668111	45668111	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45668111A>T	uc002ilr.3	+	10	1347	c.1124A>T	c.(1123-1125)GAA>GTA	p.E375V	NPEPPS_uc010wkt.1_Missense_Mutation_p.E371V|NPEPPS_uc010wku.1_Missense_Mutation_p.E339V|NPEPPS_uc010wkv.1_5'UTR	NM_006310	NP_006301	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	375		Zinc; catalytic (By similarity).			proteolysis	cytosol|nucleus	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0						TGGTTAAATGAAGGTTTTGCA	0.363													9	189	---	---	---	---	PASS
MIR10A	406902	broad.mit.edu	37	17	46657302	46657302	+	RNA	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46657302G>C	hsa-mir-10a|MI0000266	-			c.8G>C			HOXB3_uc010wlm.1_Intron|HOXB3_uc010dbf.2_Intron|HOXB3_uc010dbg.2_Intron|HOXB3_uc010wll.1_Intron|HOXB4_uc002inp.2_5'Flank|uc002inq.3_RNA																	0						ACAGAAGACAGACAGATCTTC	0.413													26	63	---	---	---	---	PASS
LUC7L3	51747	broad.mit.edu	37	17	48818594	48818594	+	Missense_Mutation	SNP	A	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48818594A>C	uc002isr.2	+	4	455	c.338A>C	c.(337-339)CAG>CCG	p.Q113P	LUC7L3_uc002isp.1_Missense_Mutation_p.Q37P|LUC7L3_uc010wmw.1_Missense_Mutation_p.Q37P|LUC7L3_uc002isq.2_Missense_Mutation_p.Q113P|LUC7L3_uc002iss.2_Missense_Mutation_p.Q113P	NM_006107	NP_006098	O95232	LC7L3_HUMAN	LUC7-like 3	113					apoptosis|mRNA processing|response to stress|RNA splicing	focal adhesion|nuclear speck	DNA binding|mRNA binding|protein binding				0						TCTCAAAACCAGCAGTCTTCT	0.418													45	112	---	---	---	---	PASS
WFIKKN2	124857	broad.mit.edu	37	17	48916920	48916920	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48916920G>T	uc002isv.3	+	2	965	c.271G>T	c.(271-273)GCC>TCC	p.A91S	WFIKKN2_uc010dbu.2_5'UTR	NM_175575	NP_783165	Q8TEU8	WFKN2_HUMAN	WFIKKN2 protein	91	WAP.					extracellular region	metalloendopeptidase inhibitor activity|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			CTGCGTGGCGGCCCGCTACAT	0.582													55	31	---	---	---	---	PASS
ANKFN1	162282	broad.mit.edu	37	17	54558135	54558135	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54558135G>T	uc002iun.1	+	16	2091	c.2056G>T	c.(2056-2058)GCA>TCA	p.A686S		NM_153228	NP_694960	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain	686										large_intestine(1)|ovary(1)	2						GCTCCAGATGGCAGTGAAAGC	0.418													321	232	---	---	---	---	PASS
OR4D2	124538	broad.mit.edu	37	17	56247272	56247272	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56247272C>G	uc010wnp.1	+	1	256	c.256C>G	c.(256-258)CTC>GTC	p.L86V		NM_001004707	NP_001004707	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D,	86	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						AGTGGACCTCCTCTCTGAGAA	0.507													221	122	---	---	---	---	PASS
AXIN2	8313	broad.mit.edu	37	17	63554499	63554499	+	Silent	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63554499C>T	uc002jfi.2	-	2	529	c.240G>A	c.(238-240)AAG>AAA	p.K80K	AXIN2_uc010den.1_Silent_p.K80K|AXIN2_uc002jfh.2_Silent_p.K80K|AXIN2_uc002jfj.1_Silent_p.K80K	NM_004655	NP_004646	Q9Y2T1	AXIN2_HUMAN	axin 2	80					cellular protein localization|cellular response to organic cyclic compound|dorsal/ventral axis specification|intramembranous ossification|maintenance of DNA repeat elements|mRNA stabilization|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of osteoblast differentiation|odontogenesis|positive regulation of cell death|positive regulation of epithelial to mesenchymal transition|positive regulation of protein phosphorylation|regulation of centromeric sister chromatid cohesion|regulation of mismatch repair|Wnt receptor signaling pathway involved in somitogenesis	Axin-APC-beta-catenin-GSK3B complex|cell cortex|centrosome|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|nucleus|plasma membrane|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			central_nervous_system(1)|skin(1)	2						AGTGTAAGGACTTGGTCCACC	0.567									Oligodontia_Ectodermal_Dysplasia_and_Colorectal_Polyp_syndrome				70	183	---	---	---	---	PASS
AXIN2	8313	broad.mit.edu	37	17	63554581	63554581	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63554581G>C	uc002jfi.2	-	2	447	c.158C>G	c.(157-159)TCC>TGC	p.S53C	AXIN2_uc010den.1_Missense_Mutation_p.S53C|AXIN2_uc002jfh.2_Missense_Mutation_p.S53C|AXIN2_uc002jfj.1_Missense_Mutation_p.S53C	NM_004655	NP_004646	Q9Y2T1	AXIN2_HUMAN	axin 2	53				QPGVGKGQVTKPMSVSSNTRRNEDGL -> HHGGQGPGHQT HVCLFQHQAERRWV (in Ref. 2; AAF22799).	cellular protein localization|cellular response to organic cyclic compound|dorsal/ventral axis specification|intramembranous ossification|maintenance of DNA repeat elements|mRNA stabilization|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of osteoblast differentiation|odontogenesis|positive regulation of cell death|positive regulation of epithelial to mesenchymal transition|positive regulation of protein phosphorylation|regulation of centromeric sister chromatid cohesion|regulation of mismatch repair|Wnt receptor signaling pathway involved in somitogenesis	Axin-APC-beta-catenin-GSK3B complex|cell cortex|centrosome|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|nucleus|plasma membrane|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			central_nervous_system(1)|skin(1)	2						CCTGGTGTTGGAAGAGACAGG	0.652									Oligodontia_Ectodermal_Dysplasia_and_Colorectal_Polyp_syndrome				47	159	---	---	---	---	PASS
CCDC46	201134	broad.mit.edu	37	17	63898350	63898350	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63898350C>T	uc002jfl.2	-	20	2302	c.2083G>A	c.(2083-2085)GAA>AAA	p.E695K	CCDC46_uc010deo.2_Missense_Mutation_p.E437K|CCDC46_uc002jfm.2_Missense_Mutation_p.E695K|CCDC46_uc010dep.2_Missense_Mutation_p.E653K	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a	695	Potential.					centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			TCCAGGTTTTCAATTTCCCGT	0.438													139	92	---	---	---	---	PASS
BPTF	2186	broad.mit.edu	37	17	65914834	65914834	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65914834A>G	uc002jgf.2	+	12	5369	c.5308A>G	c.(5308-5310)AGA>GGA	p.R1770G	BPTF_uc002jge.2_Missense_Mutation_p.R1896G	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1896					brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTTCAGGTATAGACTTCAGAC	0.373													62	171	---	---	---	---	PASS
BAIAP2	10458	broad.mit.edu	37	17	79080670	79080670	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79080670A>T	uc002jzg.2	+	12	1571	c.1463A>T	c.(1462-1464)CAG>CTG	p.Q488L	BAIAP2_uc002jyz.3_Missense_Mutation_p.Q488L|BAIAP2_uc002jza.2_Missense_Mutation_p.Q488L|BAIAP2_uc002jzc.2_Missense_Mutation_p.Q489L|BAIAP2_uc002jzb.2_Missense_Mutation_p.Q245L|BAIAP2_uc002jzd.2_Missense_Mutation_p.Q488L|BAIAP2_uc002jzf.2_Missense_Mutation_p.Q488L|BAIAP2_uc002jze.2_Missense_Mutation_p.Q521L|BAIAP2_uc010wuh.1_Missense_Mutation_p.Q410L|BAIAP2_uc002jzh.2_Missense_Mutation_p.Q489L|BAIAP2_uc010wui.1_Missense_Mutation_p.Q351L	NM_017451	NP_059345	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2 isoform 2	488					axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding				0	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GGCTTCAAGCAGAGGCCCTAC	0.721													27	7	---	---	---	---	PASS
C17orf56	146705	broad.mit.edu	37	17	79207258	79207258	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79207258C>A	uc002jzu.1	-	7	522	c.500G>T	c.(499-501)GGC>GTC	p.G167V	C17orf56_uc002jzr.1_5'Flank|C17orf56_uc002jzs.1_Missense_Mutation_p.G15V|C17orf56_uc002jzt.1_Missense_Mutation_p.G15V|C17orf56_uc002jzv.1_Missense_Mutation_p.G15V|uc002jzw.1_RNA	NM_144679	NP_653280	Q96N21	CQ056_HUMAN	hypothetical protein LOC146705	167						integral to membrane					0	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CTTGCTGTAGCCGAAACCCTG	0.697													19	44	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5424262	5424262	+	Nonsense_Mutation	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5424262T>A	uc002kmt.1	-	10	1248	c.1162A>T	c.(1162-1164)AGA>TGA	p.R388*	EPB41L3_uc010wzh.1_Nonsense_Mutation_p.R388*|EPB41L3_uc002kmu.1_Nonsense_Mutation_p.R388*|EPB41L3_uc010dkq.1_Nonsense_Mutation_p.R279*|EPB41L3_uc010dkr.2_5'Flank	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	388	FERM.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						TCTTCCTACCTGAAAAATGTA	0.308													95	148	---	---	---	---	PASS
SLC14A2	8170	broad.mit.edu	37	18	43243838	43243838	+	Silent	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43243838C>T	uc010dnj.2	+	12	1761	c.1440C>T	c.(1438-1440)CAC>CAT	p.H480H	SLC14A2_uc002lbe.2_Silent_p.H480H	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	480						apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						GTGTATTTCACATCGAGTGGT	0.532													23	31	---	---	---	---	PASS
KIAA1632	57724	broad.mit.edu	37	18	43502326	43502326	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43502326T>C	uc002lbm.2	-	16	3179	c.3079A>G	c.(3079-3081)ATG>GTG	p.M1027V	KIAA1632_uc002lbo.1_Missense_Mutation_p.M1027V	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724	1027					autophagy						0						ACAGCTGTCATAGATAAGGCT	0.483													38	33	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74622624	74622624	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74622624G>T	uc002lmi.2	+	16	2854	c.2656G>T	c.(2656-2658)GTG>TTG	p.V886L	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	886					cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		AGGTTTTACAGTGACTGATAC	0.363													47	74	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76752207	76752207	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76752207C>A	uc002lmt.2	+	2	216	c.216C>A	c.(214-216)AGC>AGA	p.S72R	SALL3_uc010dra.2_5'Flank	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	72					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		ACCAGCGGAGCTGCACCAAGC	0.726													11	25	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9089943	9089943	+	Silent	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9089943G>T	uc002mkp.2	-	1	2076	c.1872C>A	c.(1870-1872)ACC>ACA	p.T624T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	624	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGAGTAGGTGGGTTGTGCCCT	0.572													55	73	---	---	---	---	PASS
CYP4F2	8529	broad.mit.edu	37	19	15989695	15989695	+	Silent	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15989695C>T	uc002nbs.1	-	13	1499	c.1449G>A	c.(1447-1449)GCG>GCA	p.A483A	CYP4F2_uc010xot.1_Silent_p.A334A	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	483					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						GCAGCGTGAGCGCCAGGACCA	0.682													33	42	---	---	---	---	PASS
CYP4F2	8529	broad.mit.edu	37	19	15989720	15989720	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15989720A>T	uc002nbs.1	-	13	1474	c.1424T>A	c.(1423-1425)ATG>AAG	p.M475K	CYP4F2_uc010xot.1_Missense_Mutation_p.M326K	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	475					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						CATCTCCGCCATCGCGAACGT	0.677													33	59	---	---	---	---	PASS
JAK3	3718	broad.mit.edu	37	19	17937686	17937686	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17937686T>A	uc002nhn.3	-	24	3341	c.3241A>T	c.(3241-3243)AGC>TGC	p.S1081C	JAK3_uc010ebh.2_Intron	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3	1081	Protein kinase 2.				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						TCCTGTGGGCTAGGGGCCCAG	0.632		2	Mis		acute megakaryocytic leukemia|								48	82	---	---	---	---	PASS
ZNF682	91120	broad.mit.edu	37	19	20117559	20117559	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20117559T>A	uc002noq.2	-	4	875	c.752A>T	c.(751-753)CAT>CTT	p.H251L	ZNF682_uc002noo.2_Missense_Mutation_p.H219L|ZNF682_uc002nop.2_Missense_Mutation_p.H219L|ZNF682_uc010eck.2_Missense_Mutation_p.H175L	NM_033196	NP_149973	O95780	ZN682_HUMAN	zinc finger protein 682 isoform 1	251	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2						CTCACCAGTATGGATTCTCTT	0.378													62	86	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22941562	22941562	+	Silent	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22941562G>T	uc010xrh.1	-	5	876	c.876C>A	c.(874-876)GCC>GCA	p.A292A		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GTTTTCTAAGGGCTGACAAAT	0.368													44	65	---	---	---	---	PASS
LGI4	163175	broad.mit.edu	37	19	35617547	35617547	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35617547A>G	uc002nxx.2	-	8	1520	c.926T>C	c.(925-927)CTG>CCG	p.L309P	LGI4_uc002nxy.1_Missense_Mutation_p.L137P|LGI4_uc002nxz.1_Missense_Mutation_p.L137P	NM_139284	NP_644813	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	309						extracellular region				pancreas(1)	1	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CCGCGGGGCCAGGGTCTGCGT	0.746													2	2	---	---	---	---	PASS
GAPDHS	26330	broad.mit.edu	37	19	36024502	36024502	+	Intron	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36024502G>A	uc002oaf.1	+							NM_014364	NP_055179	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase,						gluconeogenesis|glycolysis|positive regulation of glycolysis|sperm motility	cytosol	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|protein binding				0	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		NADH(DB00157)	CCCGGGTGAGGGAGGCAGCGG	0.632													19	32	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40354256	40354256	+	Intron	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40354256C>T	uc002omp.3	-							NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor							extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TACTACATCCCTCACCATGGG	0.557													7	81	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40433441	40433441	+	Silent	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40433441C>A	uc002omp.3	-	2	836	c.828G>T	c.(826-828)CTG>CTT	p.L276L		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	276	IgGFc-binding.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGTTGTAGGTCAGCTTTGTGG	0.592													40	47	---	---	---	---	PASS
SHANK1	50944	broad.mit.edu	37	19	51219713	51219713	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51219713T>C	uc002psx.1	-	2	297	c.278A>G	c.(277-279)GAT>GGT	p.D93G		NM_016148	NP_057232	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	93					cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GATGGTGGCATCGGGGTTGAA	0.632													42	55	---	---	---	---	PASS
CD33	945	broad.mit.edu	37	19	51738444	51738444	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51738444G>A	uc002pwa.2	+	5	818	c.778G>A	c.(778-780)GGG>AGG	p.G260R	CD33_uc010eos.1_Missense_Mutation_p.G260R|CD33_uc010eot.1_Missense_Mutation_p.G133R|CD33_uc010eou.1_RNA	NM_001772	NP_001763	P20138	CD33_HUMAN	CD33 antigen isoform 1 precursor	260	Helical; (Potential).				cell adhesion|cell-cell signaling|negative regulation of cell proliferation	external side of plasma membrane|integral to plasma membrane	receptor activity|sugar binding				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	AGTGGTTCATGGGGCCATTGG	0.498													61	56	---	---	---	---	PASS
SIGLEC10	89790	broad.mit.edu	37	19	51919427	51919427	+	Intron	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51919427G>C	uc002pwo.2	-						SIGLEC10_uc002pwp.2_Intron|SIGLEC10_uc002pwq.2_Intron|SIGLEC10_uc002pwr.2_Intron|SIGLEC10_uc010ycy.1_Intron|SIGLEC10_uc010ycz.1_Intron|SIGLEC10_uc010eow.2_Missense_Mutation_p.T62S|SIGLEC10_uc002pws.1_Intron	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor						cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		CAGGGCTggagtgggaggaaa	0.398													29	16	---	---	---	---	PASS
ZNF615	284370	broad.mit.edu	37	19	52497080	52497080	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52497080C>A	uc002pye.1	-	6	1541	c.1249G>T	c.(1249-1251)GTA>TTA	p.V417L	ZNF615_uc002pyf.1_Missense_Mutation_p.V428L|ZNF615_uc002pyg.1_Missense_Mutation_p.V309L|ZNF615_uc002pyh.1_Missense_Mutation_p.V428L|ZNF615_uc010epi.1_Missense_Mutation_p.V424L|ZNF615_uc010ydg.1_Missense_Mutation_p.V422L	NM_198480	NP_940882	Q8N8J6	ZN615_HUMAN	zinc finger protein 615	417	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		CGTTGATGTACCATGAGACAG	0.408													62	77	---	---	---	---	PASS
VN1R4	317703	broad.mit.edu	37	19	53770896	53770896	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53770896A>G	uc010ydu.1	-	1	23	c.23T>C	c.(22-24)GTG>GCG	p.V8A		NM_173857	NP_776256	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	8	Helical; Name=1; (Potential).				response to pheromone	actin cytoskeleton|cytoplasm|integral to membrane|plasma membrane	pheromone receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.00294)		GATCATTCCCACTGCCACATA	0.527										HNSCC(26;0.072)			25	46	---	---	---	---	PASS
ZNF765	91661	broad.mit.edu	37	19	53905317	53905317	+	Splice_Site	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53905317G>C	uc010ydx.1	+	5	343	c.16_splice	c.e5-1	p.G6_splice	ZNF765_uc002qbm.2_Splice_Site_p.G6_splice|ZNF765_uc002qbn.2_Splice_Site	NM_001040185	NP_001035275	Q7L2R6	ZN765_HUMAN	zinc finger protein 765						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)		TTTCATTTCAGGGTCTATTGA	0.438													15	225	---	---	---	---	PASS
ZNF761	388561	broad.mit.edu	37	19	53952764	53952764	+	Splice_Site	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53952764G>C	uc010eqp.2	+	5	474	c.16_splice	c.e5-1	p.G6_splice	ZNF761_uc002qbr.2_Splice_Site|ZNF761_uc010ydy.1_Splice_Site|ZNF761_uc002qbs.2_Splice_Site|ZNF761_uc002qbt.1_5'Flank	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)		TTTCATTTCAGGGTCTATTGA	0.433													35	43	---	---	---	---	PASS
ZNF813	126017	broad.mit.edu	37	19	53989885	53989885	+	Splice_Site	SNP	G	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53989885G>C	uc002qbu.2	+	3	144	c.16_splice	c.e3-1	p.G6_splice	ZNF813_uc010eqq.1_Splice_Site	NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN	zinc finger protein 813						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		TTTCATTTCAGGGTCTATTGA	0.443													12	199	---	---	---	---	PASS
LILRA2	11027	broad.mit.edu	37	19	55086941	55086941	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55086941C>A	uc002qgg.3	+	5	963	c.874C>A	c.(874-876)CAG>AAG	p.Q292K	LILRA2_uc010ern.2_Missense_Mutation_p.Q292K|LILRA2_uc002qgf.2_Missense_Mutation_p.Q292K|LILRA2_uc010yfe.1_Missense_Mutation_p.Q292K|LILRA2_uc010yff.1_Missense_Mutation_p.Q280K|LILRA2_uc010ero.2_Missense_Mutation_p.Q280K|LILRA2_uc010yfg.1_Intron	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	292	Ig-like C2-type 3.|Extracellular (Potential).				defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		CCACGGGGGCCAGTACAGATG	0.662													73	73	---	---	---	---	PASS
TNNI3	7137	broad.mit.edu	37	19	55665559	55665559	+	Nonsense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55665559G>A	uc002qjg.3	-	7	388	c.388C>T	c.(388-390)CAG>TAG	p.Q130*	TNNI3_uc010yft.1_Nonsense_Mutation_p.Q122*	NM_000363	NP_000354	P19429	TNNI3_HUMAN	troponin I, cardiac	130	Involved in binding TNC and actin.				cardiac muscle contraction|cellular calcium ion homeostasis|muscle filament sliding|negative regulation of ATPase activity|regulation of systemic arterial blood pressure by ischemic conditions|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|calcium channel inhibitor activity|calcium-dependent protein binding|protein domain specific binding|protein kinase binding|troponin C binding|troponin T binding			lung(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		AAGATCTTCTGAGTCAGATCT	0.567													20	47	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56419147	56419147	+	Intron	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56419147C>A	uc010ygg.1	-							NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing								ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TCTAGGGAGCCAAAGACTTAC	0.502													49	66	---	---	---	---	PASS
ZSCAN1	284312	broad.mit.edu	37	19	58564960	58564960	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58564960C>A	uc002qrc.1	+	6	1015	c.768C>A	c.(766-768)GAC>GAA	p.D256E		NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	256					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GGAACACTGACCAGAGCGGCC	0.632													26	38	---	---	---	---	PASS
ZSCAN18	65982	broad.mit.edu	37	19	58596178	58596178	+	Silent	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58596178G>A	uc002qri.2	-	7	1716	c.1407C>T	c.(1405-1407)TAC>TAT	p.Y469Y	ZSCAN18_uc002qrj.3_Silent_p.Y468Y|ZSCAN18_uc010yhs.1_Silent_p.Y333Y|ZSCAN18_uc002qrh.2_Silent_p.Y469Y|ZSCAN18_uc010yht.1_Silent_p.Y525Y|ZSCAN18_uc002qrk.1_3'UTR|ZSCAN18_uc002qrl.2_3'UTR	NM_001145543	NP_001139015	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	469					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CCCCCAGCGCGTAGCTTTTCT	0.721													4	7	---	---	---	---	PASS
ZNF324B	388569	broad.mit.edu	37	19	58965063	58965063	+	5'UTR	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58965063G>T	uc002qsv.1	+	2					ZNF324B_uc002qsu.1_5'UTR|ZNF324B_uc010euq.1_5'UTR	NM_207395	NP_997278	Q6AW86	Z324B_HUMAN	zinc finger protein 324B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		GCTGTTTTAGGACCTGATGAC	0.612													62	62	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16359631	16359631	+	Nonsense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16359631C>A	uc002wpg.1	-	19	3174	c.3016G>T	c.(3016-3018)GAG>TAG	p.E1006*	KIF16B_uc002wpe.1_Nonsense_Mutation_p.E388*|KIF16B_uc002wpf.1_Nonsense_Mutation_p.E388*|KIF16B_uc010gch.1_Nonsense_Mutation_p.E1006*|KIF16B_uc010gci.1_Nonsense_Mutation_p.E1006*|KIF16B_uc010gcj.1_Nonsense_Mutation_p.E1017*	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	1006	Glu-rich.|Potential.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						AGGGCCCGCTCCAGCGCCTCT	0.542													84	110	---	---	---	---	PASS
CTNNBL1	56259	broad.mit.edu	37	20	36361276	36361276	+	Intron	SNP	C	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36361276C>G	uc010zvw.1	+						CTNNBL1_uc010zvv.1_Intron	NM_030877	NP_110517	Q8WYA6	CTBL1_HUMAN	beta catenin-like 1						apoptosis|positive regulation of apoptosis|somatic diversification of immunoglobulins	nucleus	enzyme binding			ovary(2)	2		Myeloproliferative disorder(115;0.00878)				TTTCTTTTCTCTCAGCCCAAT	0.348													26	26	---	---	---	---	PASS
EMILIN3	90187	broad.mit.edu	37	20	39990279	39990279	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39990279G>T	uc002xjy.1	-	4	2154	c.1930C>A	c.(1930-1932)CTT>ATT	p.L644I		NM_052846	NP_443078	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	644	Potential.					proteinaceous extracellular matrix				ovary(1)	1		Myeloproliferative disorder(115;0.00425)				CCAGCCTGAAGCCTGGAGCCT	0.647													13	22	---	---	---	---	PASS
TP53RK	112858	broad.mit.edu	37	20	45315471	45315471	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45315471G>A	uc002xsk.2	-	2	906	c.683C>T	c.(682-684)TCC>TTC	p.S228F	SLC13A3_uc002xsg.1_5'Flank|SLC13A3_uc010gho.1_5'Flank|TP53RK_uc002xsj.2_3'UTR	NM_033550	NP_291028	Q96S44	PRPK_HUMAN	p53-related protein kinase	228	Protein kinase.				lipopolysaccharide biosynthetic process	membrane|nucleus	ATP binding|p53 binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0		Myeloproliferative disorder(115;0.0122)				CTTTTTGGAGGAGGTGGAGTA	0.478													114	140	---	---	---	---	PASS
COL20A1	57642	broad.mit.edu	37	20	61943356	61943356	+	Silent	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61943356G>T	uc011aau.1	+	14	1852	c.1752G>T	c.(1750-1752)GTG>GTT	p.V584V	COL20A1_uc011aav.1_Silent_p.V405V	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	584	Fibronectin type-III 4.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					CGAGGCCTGTGCGCCTGGTCA	0.682													17	9	---	---	---	---	PASS
COL20A1	57642	broad.mit.edu	37	20	61943357	61943357	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61943357C>A	uc011aau.1	+	14	1853	c.1753C>A	c.(1753-1755)CGC>AGC	p.R585S	COL20A1_uc011aav.1_Missense_Mutation_p.R406S	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	585	Fibronectin type-III 4.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					GAGGCCTGTGCGCCTGGTCAG	0.687													17	9	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10906938	10906938	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10906938C>T	uc002yip.1	-	24	1991	c.1623G>A	c.(1621-1623)ATG>ATA	p.M541I	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.M523I|TPTE_uc002yir.1_Missense_Mutation_p.M503I|TPTE_uc010gkv.1_Missense_Mutation_p.M403I	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	541					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CACTGGAAGTCATTTTCTCGC	0.383													14	93	---	---	---	---	PASS
GABPA	2551	broad.mit.edu	37	21	27117513	27117513	+	Intron	SNP	A	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27117513A>T	uc002ylx.3	+						GABPA_uc002yly.3_Intron	NM_002040	NP_002031	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha						positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)|central_nervous_system(1)	2						TACATCTTTAACATTTAGCAT	0.373													31	55	---	---	---	---	PASS
ITSN1	6453	broad.mit.edu	37	21	35144463	35144463	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35144463G>T	uc002yta.1	+	12	1409	c.1141G>T	c.(1141-1143)GAG>TAG	p.E381*	DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Nonsense_Mutation_p.E381*|ITSN1_uc010gmg.2_Nonsense_Mutation_p.E344*|ITSN1_uc010gmh.2_RNA|ITSN1_uc002ysw.2_Nonsense_Mutation_p.E381*|ITSN1_uc010gmi.2_Nonsense_Mutation_p.E344*|ITSN1_uc010gmj.2_Nonsense_Mutation_p.E265*|ITSN1_uc002ysy.2_Nonsense_Mutation_p.E381*|ITSN1_uc002ysx.2_Nonsense_Mutation_p.E344*|ITSN1_uc002ytb.1_Nonsense_Mutation_p.E381*|ITSN1_uc002ytc.1_Nonsense_Mutation_p.E381*|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Nonsense_Mutation_p.E344*|ITSN1_uc010gml.2_RNA|ITSN1_uc002ytj.2_Nonsense_Mutation_p.E381*|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Nonsense_Mutation_p.E315*	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	381	Potential.|KLERQ.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						CAAGGAGCAGGAGCGCCTGGC	0.532													21	23	---	---	---	---	PASS
SIM2	6493	broad.mit.edu	37	21	38084824	38084824	+	Intron	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38084824C>A	uc002yvr.2	+						SIM2_uc002yvq.2_Intron	NM_005069	NP_005060	Q14190	SIM2_HUMAN	single-minded homolog 2 long isoform						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(1)	1						GACACTTTATCTTTTACAGAC	0.383													48	53	---	---	---	---	PASS
PDE9A	5152	broad.mit.edu	37	21	44185586	44185586	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44185586C>A	uc002zbm.2	+	15	1401	c.1338C>A	c.(1336-1338)AAC>AAA	p.N446K	PDE9A_uc002zbn.2_Missense_Mutation_p.N319K|PDE9A_uc002zbo.2_Missense_Mutation_p.N393K|PDE9A_uc002zbp.2_Missense_Mutation_p.N239K|PDE9A_uc002zbq.2_Missense_Mutation_p.N344K|PDE9A_uc002zbs.2_Missense_Mutation_p.N239K|PDE9A_uc002zbr.2_Missense_Mutation_p.N239K|PDE9A_uc002zbt.2_Missense_Mutation_p.N318K|PDE9A_uc002zbu.2_Missense_Mutation_p.N312K|PDE9A_uc002zbv.2_Missense_Mutation_p.N286K|PDE9A_uc002zbw.2_Missense_Mutation_p.N229K|PDE9A_uc002zbx.2_Missense_Mutation_p.N386K|PDE9A_uc002zby.2_Missense_Mutation_p.N229K|PDE9A_uc002zbz.2_Missense_Mutation_p.N338K|PDE9A_uc002zca.2_Missense_Mutation_p.N405K|PDE9A_uc002zcb.2_Missense_Mutation_p.N420K|PDE9A_uc002zcc.2_Missense_Mutation_p.N345K|PDE9A_uc002zcd.2_Missense_Mutation_p.N360K|PDE9A_uc002zce.2_Missense_Mutation_p.N379K|PDE9A_uc002zcf.2_Missense_Mutation_p.N239K|PDE9A_uc002zcg.2_Missense_Mutation_p.N239K|PDE9A_uc002zch.2_Missense_Mutation_p.N229K|PDE9A_uc010gpf.1_Missense_Mutation_p.N239K	NM_002606	NP_002597	O76083	PDE9A_HUMAN	phosphodiesterase 9A isoform a	446	Catalytic (By similarity).				platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|skin(1)	2						ACTACAGCAACGAGGAGCACA	0.498													10	21	---	---	---	---	PASS
PKNOX1	5316	broad.mit.edu	37	21	44430176	44430176	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44430176C>A	uc002zcq.1	+	4	381	c.193C>A	c.(193-195)CCA>ACA	p.P65T	PKNOX1_uc002zcp.1_Missense_Mutation_p.P65T|PKNOX1_uc011aex.1_Intron|PKNOX1_uc002zcr.2_Missense_Mutation_p.P65T	NM_004571	NP_004562	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1	65							sequence-specific DNA binding			large_intestine(2)	2						TCCACTATTTCCATTATTAGC	0.378													30	69	---	---	---	---	PASS
TXNRD2	10587	broad.mit.edu	37	22	19864684	19864684	+	Silent	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19864684G>A	uc011ahc.1	-	17	1552	c.1519C>T	c.(1519-1521)CTG>TTG	p.L507L	TXNRD2_uc002zql.1_Silent_p.L261L|TXNRD2_uc002zqm.1_RNA|TXNRD2_uc002zqn.1_RNA|TXNRD2_uc002zqo.1_RNA|TXNRD2_uc002zqp.1_RNA|TXNRD2_uc002zqr.1_Silent_p.L506L|TXNRD2_uc002zqj.1_RNA|TXNRD2_uc002zqq.1_Silent_p.L157L	NM_006440	NP_006431	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2 precursor	507					cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)					GAGATGCGCAGCTTGACTACC	0.667													32	25	---	---	---	---	PASS
HIC2	23119	broad.mit.edu	37	22	21799774	21799774	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21799774C>T	uc002zur.3	+	3	820	c.590C>T	c.(589-591)TCA>TTA	p.S197L	HIC2_uc002zus.3_Missense_Mutation_p.S197L	NM_015094	NP_055909	Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	197					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	focal adhesion|nucleus	DNA binding|protein C-terminus binding|zinc ion binding			skin(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				GCCAAAGGCTCAGACGATGAA	0.672													13	23	---	---	---	---	PASS
GALR3	8484	broad.mit.edu	37	22	38219752	38219752	+	Silent	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38219752G>A	uc003aub.1	+	1	364	c.339G>A	c.(337-339)CTG>CTA	p.L113L		NM_003614	NP_003605	O60755	GALR3_HUMAN	galanin receptor 3	113	Helical; Name=3; (Potential).				feeding behavior|learning or memory|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity				0	Melanoma(58;0.045)					GCTTTACGCTGGCTGCTGTCT	0.652													26	30	---	---	---	---	PASS
POLR3H	171568	broad.mit.edu	37	22	41928669	41928669	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41928669C>G	uc003baf.2	-	4	349	c.289G>C	c.(289-291)GTG>CTG	p.V97L	POLR3H_uc003bae.2_RNA|POLR3H_uc003bag.2_Missense_Mutation_p.V97L|POLR3H_uc003bai.2_Intron	NM_138338	NP_612211	Q9Y535	RPC8_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	97					innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity			skin(1)	1						TTACCGTGCACTCCTTCTGGG	0.552											OREG0026590	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	72	112	---	---	---	---	PASS
NR0B1	190	broad.mit.edu	37	X	30326572	30326572	+	Silent	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30326572G>A	uc004dcf.3	-	1	924	c.909C>T	c.(907-909)CGC>CGT	p.R303R		NM_000475	NP_000466	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	303	Ligand-binding (By similarity).				adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding			ovary(1)|lung(1)	2					Dexamethasone(DB01234)|Tretinoin(DB00755)	CGAACTGCAAGCGGTCCTGGG	0.657											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	2	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37028554	37028554	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37028554C>T	uc004ddl.1	+	1	2085	c.2071C>T	c.(2071-2073)CGC>TGC	p.R691C		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	691										ovary(3)	3						ATCTCATCTCCGCCCAGAGCC	0.657													49	9	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37029564	37029564	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37029564C>A	uc004ddl.1	+	1	3095	c.3081C>A	c.(3079-3081)GAC>GAA	p.D1027E		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	1027										ovary(3)	3						ACAAAGAAGACGTCACAGATG	0.383													96	14	---	---	---	---	PASS
ZNF630	57232	broad.mit.edu	37	X	47920198	47920198	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47920198C>T	uc004div.3	-	3	394	c.142G>A	c.(142-144)GGG>AGG	p.G48R	ZNF630_uc010nhz.1_RNA|ZNF630_uc004diw.2_5'UTR	NM_001037735	NP_001032824	Q2M218	ZN630_HUMAN	zinc finger protein 630	48	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|lung(1)	2						CTGCCCTTACCCACGGAGACC	0.468													23	2	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	51150238	51150238	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51150238G>A	uc004dpj.2	+	1	472	c.370G>A	c.(370-372)GGG>AGG	p.G124R		NM_203407	NP_981952			hypothetical protein LOC340602																		GGCCGCTGTGGGGCCCCAGAA	0.682													5	0	---	---	---	---	PASS
GSPT2	23708	broad.mit.edu	37	X	51488591	51488591	+	Silent	SNP	G	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51488591G>A	uc004dpl.2	+	1	2095	c.1869G>A	c.(1867-1869)TTG>TTA	p.L623L		NM_018094	NP_060564	Q8IYD1	ERF3B_HUMAN	peptide chain release factor 3	623					cell cycle|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|translational termination	cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)	1	Ovarian(276;0.236)					TTCTGAAATTGGTCCCAGAGA	0.418													35	6	---	---	---	---	PASS
SMC1A	8243	broad.mit.edu	37	X	53440302	53440302	+	Silent	SNP	C	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53440302C>T	uc004dsg.2	-	4	564	c.495G>A	c.(493-495)GCG>GCA	p.A165A	SMC1A_uc011moe.1_Silent_p.A143A|SMC1A_uc011mof.1_Intron|SMC1A_uc004dsi.1_Silent_p.A31A	NM_006306	NP_006297	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	165	Potential.				cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity			ovary(5)|central_nervous_system(1)	6						CATACTCCTGCGCCAGCTCCC	0.463													4	106	---	---	---	---	PASS
KLHL4	56062	broad.mit.edu	37	X	86869560	86869560	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86869560G>T	uc004efb.2	+	3	896	c.714G>T	c.(712-714)CAG>CAT	p.Q238H	KLHL4_uc004efa.2_Missense_Mutation_p.Q238H	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 1	238	BTB.					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						CCTTGGTGCAGTATGCTTACA	0.348													39	6	---	---	---	---	PASS
MAGEA12	4111	broad.mit.edu	37	X	151900150	151900150	+	Silent	SNP	A	G	G			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151900150A>G	uc010ntp.2	-	3	1005	c.651T>C	c.(649-651)CCT>CCC	p.P217P	MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Silent_p.P217P	NM_005367	NP_005358	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	217	MAGE.									skin(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					TTTTCTCCTCAGGGGCACAGT	0.562													118	15	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27056326	27056326	+	Frame_Shift_Del	DEL	C	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27056326delC	uc001bmv.1	+	2	1695	c.1322delC	c.(1321-1323)GCCfs	p.A441fs	ARID1A_uc001bmt.1_Frame_Shift_Del_p.A441fs|ARID1A_uc001bmu.1_Frame_Shift_Del_p.A441fs|ARID1A_uc001bmw.1_Frame_Shift_Del_p.A58fs	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	441					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCGCAGAGTGCCATGGGCGGC	0.572			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								10	51	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	68708301	68708306	+	IGR	DEL	GACGCG	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68708301_68708306delGACGCG								WLS (10048 upstream) : RPE65 (186201 downstream)																							CATCTAGTTTGACGCGGATTTTCTTG	0.461													13	28	---	---	---	---	
CDC7	8317	broad.mit.edu	37	1	91978467	91978468	+	Intron	INS	-	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91978467_91978468insT	uc001doe.2	+						CDC7_uc001dof.2_Intron|CDC7_uc010osw.1_Intron|CDC7_uc009wdc.2_Intron|CDC7_uc009wdd.2_5'Flank	NM_003503	NP_003494	O00311	CDC7_HUMAN	cell division cycle 7						cell cycle checkpoint|cell division|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|positive regulation of cell proliferation|regulation of S phase	cytoplasm|nucleoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	5		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		TGGAAAACTTATTTTTTTTTCT	0.287													5	3	---	---	---	---	
ARHGAP29	9411	broad.mit.edu	37	1	94669701	94669701	+	Intron	DEL	T	-	-	rs77020055		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94669701delT	uc001dqj.3	-						ARHGAP29_uc009wdq.1_Intron|ARHGAP29_uc001dql.2_Intron	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1						Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TCTTTCTTCCttttttttttt	0.149													3	3	---	---	---	---	
LCE1A	353131	broad.mit.edu	37	1	152799752	152799752	+	5'Flank	DEL	C	-	-	rs56820724		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152799752delC	uc010pdw.1	+							NM_178348	NP_848125	Q5T7P2	LCE1A_HUMAN	late cornified envelope 1A						keratinization					ovary(1)|skin(1)	2	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTTATAAAAACATCCTGATGA	0.289													5	7	---	---	---	---	
C1orf204	284677	broad.mit.edu	37	1	159821951	159821954	+	Intron	DEL	AGAC	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159821951_159821954delAGAC	uc001fug.1	-						C1orf204_uc001fuf.1_Intron	NM_001134233	NP_001127705	Q5VU13	VSIG8_HUMAN	hypothetical protein LOC284677							integral to membrane					0						AAAAAATCAAagacagacagacag	0.260													4	2	---	---	---	---	
GREB1	9687	broad.mit.edu	37	2	11725179	11725180	+	Intron	INS	-	A	A	rs78338846		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11725179_11725180insA	uc002rbk.1	+						GREB1_uc002rbl.2_Intron|GREB1_uc002rbn.1_Intron	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TCTGTGATTAGAAAAAAAAAAA	0.302													6	7	---	---	---	---	
NCOA1	8648	broad.mit.edu	37	2	24933593	24933593	+	Intron	DEL	T	-	-	rs67091471		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24933593delT	uc002rfk.2	+						NCOA1_uc010eye.2_Intron|NCOA1_uc002rfi.2_Intron|NCOA1_uc002rfj.2_Intron|NCOA1_uc002rfl.2_Intron	NM_003743	NP_003734	Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1 isoform 1										PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGAATACTATTATCAGAAGC	0.289			T	PAX3	alveolar rhadomyosarcoma								2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	41010336	41010337	+	IGR	DEL	TG	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41010336_41010337delTG								SLC8A1 (270761 upstream) : None (None downstream)																							TTCTCGTGCATGTGTGTGTGTG	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	45371536	45371539	+	IGR	DEL	GTGG	-	-	rs112416419	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45371536_45371539delGTGG								SIX2 (134993 upstream) : SRBD1 (244281 downstream)																							gtgtgtgtgtgtgGGTATAACAAT	0.363													6	3	---	---	---	---	
APLF	200558	broad.mit.edu	37	2	68696146	68696146	+	Intron	DEL	G	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68696146delG	uc002sep.2	+						FBXO48_uc002seo.2_5'Flank|APLF_uc010fdf.2_Intron	NM_173545	NP_775816	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor						double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2						gtgtgtgtgtgtgtgtgttgt	0.308													4	3	---	---	---	---	
REG1B	5968	broad.mit.edu	37	2	79312434	79312435	+	Intron	DEL	AC	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79312434_79312435delAC	uc002sny.2	-							NM_006507	NP_006498	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta precursor						cell proliferation	extracellular region	sugar binding			central_nervous_system(1)|skin(1)	2						GAAGTGTCAGACATAGAGGATC	0.391													31	62	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	86650913	86650913	+	IGR	DEL	T	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86650913delT								REEP1 (86136 upstream) : KDM3A (17358 downstream)																							tttctttttattttttttccc	0.000													4	2	---	---	---	---	
FAM178B	51252	broad.mit.edu	37	2	97627049	97627050	+	Intron	INS	-	GT	GT	rs145389535	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97627049_97627050insGT	uc002sxl.3	-							NM_001122646	NP_001116118	Q8IXR5	F178B_HUMAN	hypothetical protein LOC51252 isoform A												0						AGCAGCAGAGGgtgtgtgtgtg	0.450													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	98090956	98090957	+	RNA	DEL	TT	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98090956_98090957delTT	uc002sxv.3	-	1		c.93_94delAA								Homo sapiens cDNA clone IMAGE:5217021, with apparent retained intron.																		ggcctgaagattgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113103935	113103935	+	IGR	DEL	C	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113103935delC								ZC3H6 (6295 upstream) : RGPD8 (22031 downstream)																							tcaccaccatcaccactgcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122067667	122067668	+	IGR	INS	-	TGTT	TGTT	rs141956564	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122067667_122067668insTGTT								TFCP2L1 (24889 upstream) : CLASP1 (27686 downstream)																							ACATGAACgtgtgtgtgtgtgt	0.401													5	3	---	---	---	---	
LIMS2	55679	broad.mit.edu	37	2	128439816	128439817	+	5'Flank	INS	-	T	T	rs11415515		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128439816_128439817insT	uc002tpb.2	-							NM_001161404	NP_001154876	Q7Z4I7	LIMS2_HUMAN	LIM and senescent cell antigen-like domains 2						cell junction assembly	cytosol|focal adhesion|nucleus	zinc ion binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0681)		ttctttctttcttttttttttt	0.000													4	2	---	---	---	---	
PSMD14	10213	broad.mit.edu	37	2	162251500	162251500	+	Intron	DEL	T	-	-	rs112832377		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162251500delT	uc002ubu.2	+							NM_005805	NP_005796	O00487	PSDE_HUMAN	proteasome 26S subunit, non-ATPase 14						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K63-linked deubiquitination|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of proteasomal protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	endopeptidase activator activity|metal ion binding|metallopeptidase activity|proteasome binding|ubiquitin thiolesterase activity			breast(1)	1						AGTCGAAATGTTTTTTTTTTT	0.224													5	3	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179554142	179554143	+	Intron	INS	-	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179554142_179554143insA	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAAAAAGGCCAAATAAATGAG	0.356													45	25	---	---	---	---	
ATIC	471	broad.mit.edu	37	2	216191333	216191333	+	Intron	DEL	A	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216191333delA	uc002vex.3	+						ATIC_uc010zjo.1_Intron|ATIC_uc002vey.3_Intron	NM_004044	NP_004035	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide						IMP biosynthetic process|purine base metabolic process	cytosol	IMP cyclohydrolase activity|phosphoribosylaminoimidazolecarboxamide formyltransferase activity|protein homodimerization activity		ATIC/ALK(24)	haematopoietic_and_lymphoid_tissue(22)|ovary(2)|lung(2)|soft_tissue(2)|skin(1)	29		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Tetrahydrofolic acid(DB00116)	actttgtctcaaaaaaaaaaa	0.174			T	ALK	ALCL								6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	220223957	220223970	+	IGR	DEL	CACACACACACACC	-	-	rs112179751		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220223957_220223970delCACACACACACACC								RESP18 (26058 upstream) : DNPEP (9103 downstream)																							cacacacacacacacacacacacccccacacacC	0.402													4	2	---	---	---	---	
MAGI1	9223	broad.mit.edu	37	3	65415803	65415821	+	Splice_Site	DEL	ACAATCACATCCCCTGTAG	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65415803_65415821delACAATCACATCCCCTGTAG	uc003dmn.2	-	12	2073	c.1547_splice	c.e12-1	p.G516_splice	MAGI1_uc003dmm.2_Splice_Site_p.G516_splice|MAGI1_uc003dmo.2_Splice_Site_p.G516_splice|MAGI1_uc003dmp.2_Splice_Site_p.G516_splice|MAGI1_uc010hny.2_Splice_Site_p.G401_splice	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		ATTCACACTTACAATCACATCCCCTGTAGAAGGCAAGAG	0.452													17	15	---	---	---	---	
NSUN3	63899	broad.mit.edu	37	3	93844904	93844904	+	Intron	DEL	A	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93844904delA	uc003drl.1	+							NM_022072	NP_071355	Q9H649	NSUN3_HUMAN	NOL1/NOP2/Sun domain family, member 3								methyltransferase activity			skin(1)	1						actctgtctcaaaaaaaaaaa	0.169													5	3	---	---	---	---	
ADCY5	111	broad.mit.edu	37	3	123077002	123077003	+	Intron	INS	-	GT	GT	rs142349557	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123077002_123077003insGT	uc003egh.1	-						ADCY5_uc003egg.1_Intron|ADCY5_uc003egi.1_Intron	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5						activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		ACATGGAACACgtgtgtgtgtg	0.401													5	5	---	---	---	---	
ITGB5	3693	broad.mit.edu	37	3	124523964	124523965	+	Intron	DEL	CC	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124523964_124523965delCC	uc003eho.2	-						ITGB5_uc010hrx.2_Intron	NM_002213	NP_002204	P18084	ITB5_HUMAN	integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)		tccttcctttcccttcctttct	0.015													4	2	---	---	---	---	
DNAJC13	23317	broad.mit.edu	37	3	132166862	132166862	+	Intron	DEL	G	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132166862delG	uc003eor.2	+						DNAJC13_uc010htq.1_Intron	NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13								heat shock protein binding			ovary(1)|breast(1)	2						CATAATCTGTGTGTTCCATTT	0.289													12	52	---	---	---	---	
GRK7	131890	broad.mit.edu	37	3	141521209	141521210	+	Intron	DEL	CA	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141521209_141521210delCA	uc011bnd.1	+							NM_139209	NP_631948	Q8WTQ7	GRK7_HUMAN	G-protein-coupled receptor kinase 7 precursor						visual perception	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						ctttctctgtcacacacacaca	0.000													4	2	---	---	---	---	
PLSCR4	57088	broad.mit.edu	37	3	145914219	145914220	+	Intron	INS	-	A	A	rs142671902	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145914219_145914220insA	uc010huy.2	-						PLSCR4_uc010huz.2_Intron|PLSCR4_uc003evt.3_Intron|PLSCR4_uc010hva.2_Intron|PLSCR4_uc003evu.3_Intron	NM_001128305	NP_001121777	Q9NRQ2	PLS4_HUMAN	phospholipid scramblase 4 isoform a						blood coagulation|phospholipid scrambling	integral to membrane	calcium ion binding|phospholipid scramblase activity|SH3 domain binding				0						ACTGAAGTCATAAAAAAAGCTT	0.257													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	150361094	150361097	+	IGR	DEL	ACAC	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150361094_150361097delACAC								SELT (12862 upstream) : FAM194A (16580 downstream)																							tgcaatagctacacacacacacac	0.000													4	2	---	---	---	---	
SCHIP1	29970	broad.mit.edu	37	3	158868404	158868405	+	Intron	INS	-	AT	AT	rs2047676	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158868404_158868405insAT	uc003fcq.1	+						IQCJ_uc003fco.2_Intron|IQCJ_uc010hvy.1_Intron|IQCJ_uc003fcp.1_Intron	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			cacacacacacaTATTCTGGGG	0.243													4	2	---	---	---	---	
GPR160	26996	broad.mit.edu	37	3	169776819	169776820	+	Intron	DEL	AC	-	-	rs10542909		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169776819_169776820delAC	uc003fgi.2	+						GPR160_uc010hwq.2_Intron	NM_014373	NP_055188	Q9UJ42	GP160_HUMAN	G protein-coupled receptor 160							integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_cancers(22;3.26e-22)|all_epithelial(15;5.71e-27)|all_lung(20;8.41e-17)|Lung NSC(18;3.49e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			acatgcacaaacacacacacac	0.000													5	5	---	---	---	---	
ST6GAL1	6480	broad.mit.edu	37	3	186704969	186704972	+	Intron	DEL	AGGG	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186704969_186704972delAGGG	uc003frb.2	+						ST6GAL1_uc003frc.2_Intron	NM_173216	NP_775323	P15907	SIAT1_HUMAN	ST6 beta-galactosamide						humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			central_nervous_system(1)	1	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		aaagagagacagggagggagggag	0.083													2	4	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194791015	194791015	+	Intron	DEL	C	-	-	rs74504494		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194791015delC	uc003fum.3	-						C3orf21_uc003ful.2_Intron|C3orf21_uc003fuk.2_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		gggctctggaccccaagcctc	0.184													2	6	---	---	---	---	
CHRNA9	55584	broad.mit.edu	37	4	40339043	40339044	+	Intron	INS	-	A	A	rs55853173	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40339043_40339044insA	uc003gva.1	+							NM_017581	NP_060051	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9						elevation of cytosolic calcium ion concentration|synaptic transmission	cell junction|postsynaptic membrane	calcium channel activity|receptor activity			breast(3)|skin(3)|central_nervous_system(1)	7					Nicotine(DB00184)	AATCTAGGAGGAAAAAAAATAT	0.297													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	40682595	40682602	+	IGR	DEL	GTGTGTGT	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40682595_40682602delGTGTGTGT								RBM47 (49955 upstream) : NSUN7 (69312 downstream)																							gggattacaggtgtgtgtgtgtgtgtgt	0.135													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49145315	49145319	+	IGR	DEL	ATTCC	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49145315_49145319delATTCC								CWH43 (81222 upstream) : None (None downstream)																							attgcatgttattccattccattcc	0.000													4	3	---	---	---	---	
CHIC2	26511	broad.mit.edu	37	4	54876132	54876132	+	3'UTR	DEL	C	-	-	rs68107873		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54876132delC	uc003haj.1	-	6					PDGFRA_uc003haa.2_Intron	NM_012110	NP_036242	Q9UKJ5	CHIC2_HUMAN	cysteine-rich hydrophobic domain 2							plasma membrane	protein binding			central_nervous_system(1)	1	all_cancers(7;0.0193)|all_neural(26;0.0209)|Lung NSC(11;0.0281)|Glioma(25;0.08)		LUSC - Lung squamous cell carcinoma(32;0.00216)			aaaaaaaaaacaaaaacaaaa	0.323			T	ETV6	AML								11	5	---	---	---	---	
LIN54	132660	broad.mit.edu	37	4	83858213	83858215	+	Intron	DEL	AAT	-	-	rs5859843		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83858213_83858215delAAT	uc003hnx.3	-						LIN54_uc003hnz.3_Intron|LIN54_uc003hny.3_Intron|LIN54_uc010ijt.2_Intron|LIN54_uc010iju.2_Intron|LIN54_uc010ijv.2_Intron	NM_194282	NP_919258	Q6MZP7	LIN54_HUMAN	lin-54 homolog isoform a						cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Hepatocellular(203;0.114)				agatgaatgaaATAATATTTTTA	0.118													3	5	---	---	---	---	
MTTP	4547	broad.mit.edu	37	4	100542573	100542573	+	Intron	DEL	A	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100542573delA	uc003hvc.3	+						MTTP_uc011cej.1_Intron	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large						lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	CTGGGATACCAAAAAAAAATC	0.299													4	2	---	---	---	---	
NEK1	4750	broad.mit.edu	37	4	170522989	170522990	+	Intron	INS	-	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170522989_170522990insA	uc003isb.1	-						NEK1_uc003isc.1_Intron|NEK1_uc003isd.1_Intron|NEK1_uc003ise.1_Intron|NEK1_uc003isf.1_Intron|NEK1_uc003isg.1_5'Flank	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1						cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		tgtctcaatttaaaaaaaaaaa	0.139													4	2	---	---	---	---	
NKD2	85409	broad.mit.edu	37	5	1036608	1036608	+	Intron	DEL	C	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1036608delC	uc003jbt.1	+						NKD2_uc010itf.1_Intron	NM_033120	NP_149111	Q969F2	NKD2_HUMAN	naked cuticle homolog 2						exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding				0	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			ccctgccccgcccccccccaa	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3897673	3897674	+	IGR	DEL	AC	-	-	rs149013977		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3897673_3897674delAC								IRX1 (296157 upstream) : None (None downstream)																							tttaaaagttacacacacacac	0.000													5	3	---	---	---	---	
SPEF2	79925	broad.mit.edu	37	5	35740020	35740020	+	Splice_Site	DEL	G	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35740020delG	uc003jjo.2	+	22	3175	c.3064_splice	c.e22-1	p.E1022_splice	SPEF2_uc003jjp.1_Splice_Site_p.E508_splice	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCATTTAACAGGAAATGCCTT	0.353													90	58	---	---	---	---	
ZFYVE16	9765	broad.mit.edu	37	5	79768393	79768393	+	Intron	DEL	A	-	-	rs33928816		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79768393delA	uc003kgr.3	+						ZFYVE16_uc003kgq.3_Intron|ZFYVE16_uc003kgs.3_Intron|ZFYVE16_uc003kgt.3_Intron|ZFYVE16_uc003kgu.3_Intron	NM_001105251	NP_001098721	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16						BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity				0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		ttttaaCCTTAAAAAAAAAAT	0.134													2	4	---	---	---	---	
SNCAIP	9627	broad.mit.edu	37	5	121787400	121787400	+	Intron	DEL	A	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121787400delA	uc003ksw.1	+						SNCAIP_uc011cwl.1_Intron|SNCAIP_uc003ksx.1_Intron|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|uc003ktb.1_Intron|SNCAIP_uc003ktc.1_Intron	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein						cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		AATCCCCAGGAAAAAAAAAAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	135431917	135431918	+	IGR	DEL	TG	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135431917_135431918delTG								MIR886 (15620 upstream) : SMAD5OS (33287 downstream)																							tgtgtgtgtctgtgtgtgtgtg	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	161266901	161266902	+	IGR	INS	-	TCTTTCTT	TCTTTCTT	rs10626981		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161266901_161266902insTCTTTCTT								GABRA6 (137303 upstream) : GABRA1 (7295 downstream)																							ttctttctttctctttctttct	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180708698	180708699	+	IGR	INS	-	G	G	rs1815381		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180708698_180708699insG								TRIM52 (20579 upstream) : None (None downstream)																							gggcggtaggcgggggctggag	0.213													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	16063922	16063923	+	IGR	INS	-	AAGG	AAGG	rs115761726	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16063922_16063923insAAGG								DTNBP1 (400651 upstream) : MYLIP (65394 downstream)																							aggaaggaagaaaggaaggaag	0.069													4	2	---	---	---	---	
TRERF1	55809	broad.mit.edu	37	6	42206573	42206574	+	Intron	INS	-	CACACACACACA	CACACACACACA	rs28587516	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42206573_42206574insCACACACACACA	uc003osd.2	-						TRERF1_uc011duq.1_Intron|TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ATCATGCATTTcacacacacac	0.178													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	87836748	87836749	+	IGR	INS	-	CG	CG	rs72200980		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87836748_87836749insCG								CGA (31924 upstream) : ZNF292 (25802 downstream)																							ATacacacacacacacacacac	0.193													4	2	---	---	---	---	
SNX3	8724	broad.mit.edu	37	6	108533548	108533549	+	Intron	INS	-	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108533548_108533549insT	uc003psh.2	-						SNX3_uc003psi.2_Intron|SNX3_uc010kdi.2_Intron	NM_003795	NP_003786	O60493	SNX3_HUMAN	sorting nexin 3 isoform a						cell communication|endocytosis|protein transport	early endosome|endosome membrane	phosphatidylinositol-3-phosphate binding|protein phosphatase binding				0		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0136)|Epithelial(106;0.0564)|OV - Ovarian serous cystadenocarcinoma(136;0.0717)|all cancers(137;0.0743)		AGCATGTATAAttttttttttt	0.158													4	2	---	---	---	---	
DLL1	28514	broad.mit.edu	37	6	170595891	170595892	+	Intron	DEL	AC	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170595891_170595892delAC	uc003qxm.2	-							NM_005618	NP_005609	O00548	DLL1_HUMAN	delta-like 1 precursor						cell communication|cell fate determination|hemopoiesis|Notch receptor processing|Notch signaling pathway|regulation of cell adhesion	extracellular region|integral to plasma membrane	calcium ion binding|Notch binding			lung(4)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		CCTCGCGTGTacacacacacac	0.569													4	3	---	---	---	---	
EIF2AK1	27102	broad.mit.edu	37	7	6077163	6077164	+	Intron	INS	-	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6077163_6077164insA	uc003spp.2	-						EIF2AK1_uc003spq.2_Intron|EIF2AK1_uc011jwm.1_Intron	NM_014413	NP_055228	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha						negative regulation of hemoglobin biosynthetic process|negative regulation of translational initiation by iron|protein autophosphorylation|response to external stimulus|response to stress	cytoplasm	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|heme binding|protein homodimerization activity			upper_aerodigestive_tract(1)|stomach(1)|lung(1)|central_nervous_system(1)	4		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		GACCTTGAAGTAAAAAAAAATA	0.292													103	53	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	10491345	10491345	+	IGR	DEL	G	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10491345delG								PER4 (815898 upstream) : NDUFA4 (481470 downstream)																							AGCCTACCTTGGGAAGACTGT	0.443													13	20	---	---	---	---	
JAZF1	221895	broad.mit.edu	37	7	28054651	28054652	+	Intron	DEL	TA	-	-	rs3073764	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28054651_28054652delTA	uc003szn.2	-							NM_175061	NP_778231	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131						agaaagtgtgtatgtgtgtgtg	0.005			T	SUZ12	endometrial stromal tumours								2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	53082471	53082474	+	IGR	DEL	GCTT	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53082471_53082474delGCTT								None (None upstream) : POM121L12 (20875 downstream)																							GATACTTGCAGCTTGCTTGCTTGC	0.235													8	5	---	---	---	---	
POR	5447	broad.mit.edu	37	7	75612659	75612659	+	Intron	DEL	A	-	-	rs41299532		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75612659delA	uc003udy.2	+						POR_uc011kgc.1_Intron|POR_uc011kgd.1_Intron|POR_uc011kge.1_Intron|POR_uc003uea.2_5'Flank	NM_000941	NP_000932	P16435	NCPR_HUMAN	cytochrome P450 reductase						cellular organofluorine metabolic process|positive regulation of monooxygenase activity	endoplasmic reticulum membrane	iron ion binding|NADPH-hemoprotein reductase activity			central_nervous_system(1)	1					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Lipoic Acid(DB00166)|Menadione(DB00170)|Methoxyflurane(DB01028)|Mitomycin(DB00305)|Nilutamide(DB00665)	actctgtctcaaaaaaaaaaa	0.219													5	3	---	---	---	---	
TCEA1	6917	broad.mit.edu	37	8	54886753	54886753	+	Intron	DEL	A	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54886753delA	uc003xru.2	-						TCEA1_uc003xrv.2_Intron|TCEA1_uc011ldw.1_Intron|TCEA1_uc010lyg.2_Intron	NM_006756	NP_006747	P23193	TCEA1_HUMAN	transcription elongation factor A 1 isoform 1						positive regulation of viral transcription|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	nucleoplasm	DNA binding|translation elongation factor activity|zinc ion binding				0		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)			TTCAAGCAAGAAAAAAAAAGT	0.259			T	PLAG1	salivary adenoma								4	2	---	---	---	---	
RUNX1T1	862	broad.mit.edu	37	8	93088475	93088475	+	5'Flank	DEL	A	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93088475delA	uc003yfd.2	-						RUNX1T1_uc003yfe.1_Intron|RUNX1T1_uc010mao.2_Intron|RUNX1T1_uc011lgi.1_Intron|RUNX1T1_uc003yfh.1_Intron	NM_175634	NP_783552	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1						generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TGTTTTGTTTAAAAAAAAAAC	0.313													4	2	---	---	---	---	
ESRP1	54845	broad.mit.edu	37	8	95669701	95669702	+	Intron	DEL	GT	-	-	rs67458854		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95669701_95669702delGT	uc003ygq.3	+						ESRP1_uc003ygr.3_Intron|ESRP1_uc003ygs.3_Intron|ESRP1_uc003ygt.3_Intron|ESRP1_uc003ygu.3_Intron|ESRP1_uc003ygv.2_Intron|ESRP1_uc003ygw.2_Intron	NM_017697	NP_060167	Q6NXG1	ESRP1_HUMAN	RNA binding motif protein 35A isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	nucleus|plasma membrane	mRNA binding|nucleotide binding		ESRP1/RAF1(4)	prostate(4)	4						GGCtgtgtgcgtgtgtgtgtgt	0.337													4	2	---	---	---	---	
ZFPM2	23414	broad.mit.edu	37	8	106495223	106495224	+	Intron	INS	-	TTCCTTCC	TTCCTTCC			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106495223_106495224insTTCCTTCC	uc003ymd.2	+							NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			ccccccatcctttccttccttc	0.000													5	4	---	---	---	---	
TAF2	6873	broad.mit.edu	37	8	120773190	120773194	+	Intron	DEL	TTAAT	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120773190_120773194delTTAAT	uc003you.2	-							NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2						G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			taagctaaaattaatttatcactaa	0.034													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	142551040	142551041	+	IGR	INS	-	ACAG	ACAG			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142551040_142551041insACAG								FLJ43860 (33710 upstream) : MIR1302-7 (316562 downstream)																							acacacaccacacacacaccac	0.144													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143702580	143702581	+	IGR	DEL	TG	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143702580_143702581delTG								ARC (6747 upstream) : JRK (36294 downstream)																							tgcatgtctctgtgtgtgtgtg	0.074													4	2	---	---	---	---	
C9orf84	158401	broad.mit.edu	37	9	114518404	114518406	+	Intron	DEL	ACA	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114518404_114518406delACA	uc004bfr.2	-						C9orf84_uc011lwt.1_Intron|C9orf84_uc004bfs.1_Intron|C9orf84_uc004bfq.2_Intron|C9orf84_uc010mug.2_Intron	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1											ovary(2)	2						ttttgtctcGacaacaacaacaa	0.113													4	2	---	---	---	---	
FKBP15	23307	broad.mit.edu	37	9	115934078	115934079	+	Intron	INS	-	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115934078_115934079insT	uc004bgs.2	-						FKBP15_uc004bgr.2_Intron|FKBP15_uc011lxc.1_Intron|FKBP15_uc011lxd.1_Intron	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa						endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						CATCAAGTCTCTTTTTTTTTTT	0.287													4	2	---	---	---	---	
LHX2	9355	broad.mit.edu	37	9	126776069	126776070	+	Intron	INS	-	T	T	rs148072302	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126776069_126776070insT	uc004boe.1	+						LHX2_uc010mwi.1_Intron	NM_004789	NP_004780	P50458	LHX2_HUMAN	LIM homeobox protein 2							nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CCGCCCAGAAATGGAAATGGGC	0.668													3	6	---	---	---	---	
FAM69B	138311	broad.mit.edu	37	9	139616693	139616694	+	Frame_Shift_Ins	INS	-	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139616693_139616694insA	uc004cik.2	+	4	517_518	c.423_424insA	c.(421-426)GACAAGfs	p.D141fs	FAM69B_uc004cil.2_Frame_Shift_Ins_p.D54fs|SNHG7_uc004cim.2_RNA	NM_152421	NP_689634	Q5VUD6	FA69B_HUMAN	hypothetical protein LOC138311	141_142	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane					0	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		TACTGTTTGACAAGCCCACCCG	0.634													66	40	---	---	---	---	
HPX	3263	broad.mit.edu	37	11	6459775	6459775	+	Intron	DEL	C	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6459775delC	uc001mdg.2	-						HPX_uc001mdf.2_5'Flank|HPX_uc009yfc.2_Intron	NM_000613	NP_000604	P02790	HEMO_HUMAN	hemopexin precursor						cellular iron ion homeostasis|interspecies interaction between organisms	extracellular space	heme transporter activity|metal ion binding|protein binding				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		GACTGTGCATCCCCAGATACT	0.443													49	34	---	---	---	---	
NRXN2	9379	broad.mit.edu	37	11	64421250	64421250	+	Intron	DEL	T	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64421250delT	uc001oar.2	-						NRXN2_uc001oas.2_Intron|NRXN2_uc001oaq.2_Intron	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor						cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						GTAAAACAAGTTTTTTTTTTT	0.617													4	3	---	---	---	---	
MALAT1	378938	broad.mit.edu	37	11	65265274	65265275	+	RNA	INS	-	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65265274_65265275insA	uc010roh.1	+	1		c.42_43insA				NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						CCTGCCCTCTTAAGCGCAGCGC	0.683													74	64	---	---	---	---	
CPT1A	1374	broad.mit.edu	37	11	68567053	68567054	+	Intron	INS	-	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68567053_68567054insA	uc001oog.3	-						CPT1A_uc001oof.3_Intron|CPT1A_uc009ysj.2_Intron	NM_001876	NP_001867	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A liver isoform						carnitine shuttle|fatty acid beta-oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			skin(2)	2	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		L-Carnitine(DB00583)|Perhexiline(DB01074)	cccatctctacaaaaaaaaaca	0.000													4	2	---	---	---	---	
ELMOD1	55531	broad.mit.edu	37	11	107502374	107502375	+	Frame_Shift_Ins	INS	-	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107502374_107502375insA	uc010rvs.1	+	5	665_666	c.261_262insA	c.(259-264)CTGAAAfs	p.L87fs	ELMOD1_uc001pjm.2_Frame_Shift_Ins_p.L87fs|ELMOD1_uc010rvt.1_Frame_Shift_Ins_p.L81fs	NM_018712	NP_061182	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1 isoform 1	87_88					phagocytosis	cytoskeleton	GTPase activator activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		TCATGGAACTGAAAAAAATTAA	0.356													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	119842420	119842420	+	IGR	DEL	A	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119842420delA								PVRL1 (242985 upstream) : TRIM29 (139575 downstream)																							CTCCTACCCTAAAAAGAACTA	0.318													4	2	---	---	---	---	
USP5	8078	broad.mit.edu	37	12	6974302	6974308	+	Intron	DEL	CTCTGAC	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6974302_6974308delCTCTGAC	uc001qri.3	+						USP5_uc001qrh.3_Intron|TPI1_uc001qrk.2_5'Flank|TPI1_uc010sfo.1_5'Flank	NM_001098536	NP_001092006	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 isoform 1						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			lung(2)|breast(1)|skin(1)	4						CTGTTTCCTTCTCTGACCCCCTCTCTC	0.502													48	24	---	---	---	---	
LMO3	55885	broad.mit.edu	37	12	16713597	16713597	+	Intron	DEL	G	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16713597delG	uc001rdk.1	-						LMO3_uc001rdj.1_Intron|LMO3_uc010shy.1_Intron|LMO3_uc001rdl.1_Intron|LMO3_uc009zii.1_Intron|LMO3_uc010shz.1_Intron|LMO3_uc001rdm.1_Intron|LMO3_uc001rdo.1_Intron|LMO3_uc001rdp.1_Intron|LMO3_uc001rdn.1_Intron|LMO3_uc009zij.1_Intron|LMO3_uc009zik.1_Intron	NM_018640	NP_061110	Q8TAP4	LMO3_HUMAN	LIM domain only 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent		zinc ion binding				0		Hepatocellular(102;0.244)				GTACACAAGTGGATTTTATCC	0.328													9	10	---	---	---	---	
TMPRSS12	283471	broad.mit.edu	37	12	51281029	51281029	+	Intron	DEL	G	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51281029delG	uc001rwx.3	+						TMPRSS12_uc001rwy.2_3'UTR	NM_182559	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane protease, serine 12 precursor						proteolysis	integral to membrane	serine-type endopeptidase activity				0						ACACTATTTTGGGACTTTTTT	0.318													32	21	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	64217784	64217786	+	IGR	DEL	AAA	-	-	rs78922460		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64217784_64217786delAAA								TMEM5 (14897 upstream) : SRGAP1 (20755 downstream)																							tgcaaaatataaaataaatttaa	0.246													4	2	---	---	---	---	
SLC17A8	246213	broad.mit.edu	37	12	100796198	100796200	+	In_Frame_Del	DEL	GAG	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100796198_100796200delGAG	uc010svi.1	+	7	1157_1159	c.844_846delGAG	c.(844-846)GAGdel	p.E283del	SLC17A8_uc009ztx.2_In_Frame_Del_p.E283del	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent	283	Cytoplasmic (Potential).				neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						AATATCCAATGAGGAGAAGACCT	0.409													52	35	---	---	---	---	
P2RX4	5025	broad.mit.edu	37	12	121660167	121660168	+	Intron	INS	-	T	T	rs74419719		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121660167_121660168insT	uc001tzr.2	+						P2RX4_uc010szr.1_Intron|P2RX4_uc010szs.1_Intron|P2RX4_uc009zxc.2_Intron|P2RX4_uc001tzs.2_Intron|P2RX4_uc009zxb.2_Intron|P2RX4_uc010szt.1_Intron	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4						endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|perinuclear region of cytoplasm	cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TTGCCCTACtgttttttttttt	0.312													6	4	---	---	---	---	
AACS	65985	broad.mit.edu	37	12	125591546	125591546	+	Intron	DEL	C	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125591546delC	uc001uhc.2	+						AACS_uc009zyg.2_Intron|AACS_uc001uhd.2_Intron|AACS_uc009zyh.2_Intron|AACS_uc009zyi.2_Intron	NM_023928	NP_076417	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase						fatty acid metabolic process	cytosol	acetoacetate-CoA ligase activity|ATP binding			ovary(1)|liver(1)|central_nervous_system(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		TGGCCACCGTCCCCCTGGAAT	0.522													21	13	---	---	---	---	
SOS2	6655	broad.mit.edu	37	14	50670809	50670810	+	Intron	INS	-	T	T			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50670809_50670810insT	uc001wxs.3	-						SOS2_uc010tql.1_Intron	NM_006939	NP_008870	Q07890	SOS2_HUMAN	son of sevenless homolog 2						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)					gttgttctaagttttttttttt	0.030													6	3	---	---	---	---	
ZFP36L1	677	broad.mit.edu	37	14	69256600	69256613	+	Frame_Shift_Del	DEL	GGCTGTCCAGCAGC	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69256600_69256613delGGCTGTCCAGCAGC	uc001xkh.1	-	2	784_797	c.654_667delGCTGCTGGACAGCC	c.(652-669)GGGCTGCTGGACAGCCCCfs	p.G218fs	ZFP36L1_uc001xki.1_Frame_Shift_Del_p.G218fs	NM_004926	NP_004917	Q07352	TISB_HUMAN	butyrate response factor 1	218_223					regulation of mRNA stability	cytosol|nucleus	DNA binding|mRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		ATGGACGTGGGGCTGTCCAGCAGCCcggtggcag	0.565											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	122	58	---	---	---	---	
CDC42BPB	9578	broad.mit.edu	37	14	103434431	103434432	+	Intron	INS	-	A	A			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103434431_103434432insA	uc001ymi.1	-							NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta						actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		gactccatctcaaaaaaaaaaa	0.079													5	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106720127	106720128	+	Intron	INS	-	C	C	rs72527133		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106720127_106720128insC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						TCCCCGGGGGGTGACGGATCCA	0.594													1	7	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106746231	106746231	+	Intron	DEL	G	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106746231delG	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						AGCAAGCTCAGGGGTGGGACG	0.532													6	4	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106774086	106774087	+	Splice_Site	INS	-	AGTAATACACGGCA	AGTAATACACGGCA			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106774086_106774087insAGTAATACACGGCA	uc010tyt.1	-	430		c.15674_splice	c.e430+1							Parts of antibodies, mostly variable regions.												0						GCCTCTTGCACGTGTCCTCAGC	0.550													11	5	---	---	---	---	
DUOX1	53905	broad.mit.edu	37	15	45441123	45441123	+	Intron	DEL	T	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45441123delT	uc001zus.1	+						DUOX1_uc001zut.1_Intron|DUOX1_uc010bee.1_Intron|DUOX1_uc001zuu.2_Intron	NM_017434	NP_059130	Q9NRD9	DUOX1_HUMAN	dual oxidase 1 precursor						cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		TCTCTTGGGGTTTTTTTTTGC	0.473													4	2	---	---	---	---	
CCPG1	9236	broad.mit.edu	37	15	55758877	55758877	+	Intron	DEL	A	-	-	rs11286206		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55758877delA	uc002acy.2	-						DYX1C1_uc010ugh.1_Intron|DYX1C1_uc010ugi.1_Intron|DYX1C1_uc002adb.2_Intron|DYX1C1_uc002adc.2_Intron|DYX1C1_uc002add.2_Intron	NM_020739	NP_065790	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1 isoform 2						cell cycle	integral to membrane				ovary(1)	1				all cancers(107;0.0354)		TGTAAATTTCAAAAGAAAGCA	0.348													4	5	---	---	---	---	
WDR61	80349	broad.mit.edu	37	15	78585309	78585309	+	Intron	DEL	T	-	-	rs71947790		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78585309delT	uc002bdn.2	-						WDR61_uc002bdo.2_Intron|WDR61_uc010umz.1_Intron|WDR61_uc010una.1_Intron	NM_025234	NP_079510	Q9GZS3	WDR61_HUMAN	WD repeat domain 61								protein binding			ovary(1)|skin(1)	2						GACTTTAAGATTTTTTTTTTT	0.333													4	3	---	---	---	---	
POLG	5428	broad.mit.edu	37	15	89860990	89860991	+	Intron	INS	-	T	T	rs34171931		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89860990_89860991insT	uc002bns.3	-						POLG_uc002bnr.3_Intron	NM_002693	NP_002684	P54098	DPOG1_HUMAN	DNA-directed DNA polymerase gamma						base-excision repair, gap-filling|cell death|DNA-dependent DNA replication	mitochondrial nucleoid	DNA binding|DNA-directed DNA polymerase activity|protease binding			ovary(1)|lung(1)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			ACTCAACATACTTTTTTTTTTT	0.376								DNA_polymerases_(catalytic_subunits)					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	16696737	16696738	+	IGR	INS	-	CTTC	CTTC			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16696737_16696738insCTTC								LOC339047 (252300 upstream) : XYLT1 (499445 downstream)																							tccctccctttcttccttcctt	0.000													5	3	---	---	---	---	
IQCK	124152	broad.mit.edu	37	16	19746515	19746542	+	Intron	DEL	AGTTATACAGCCCAGCTCTGTAGTCTGG	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19746515_19746542delAGTTATACAGCCCAGCTCTGTAGTCTGG	uc002dgr.2	+						IQCK_uc002dgs.2_Intron|IQCK_uc010vat.1_Intron|IQCK_uc010bwc.2_Intron|IQCK_uc010vau.1_Intron	NM_153208	NP_694940	Q8N0W5	IQCK_HUMAN	IQ motif containing K											skin(1)	1						AAGTTACTTTAGTTATACAGCCCAGCTCTGTAGTCTGGAGCAAAATAT	0.439													5	3	---	---	---	---	
PRKCB	5579	broad.mit.edu	37	16	24106131	24106134	+	Intron	DEL	AGGA	-	-	rs143705177		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24106131_24106134delAGGA	uc002dmd.2	+						PRKCB_uc002dme.2_Intron	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	gaagggagggaggaaggaaggaag	0.034													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32833097	32833097	+	IGR	DEL	A	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32833097delA								TP53TG3B (144219 upstream) : SLC6A10P (55700 downstream)																							ttagaaatggaaagactaggc	0.055													4	3	---	---	---	---	
ZFP90	146198	broad.mit.edu	37	16	68598744	68598745	+	3'UTR	INS	-	TTT	TTT	rs34979386		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68598744_68598745insTTT	uc010cff.2	+	5					ZFP90_uc002ewb.2_3'UTR|ZFP90_uc002ewc.2_3'UTR|ZFP90_uc002ewd.2_3'UTR|ZFP90_uc002ewe.2_3'UTR	NM_133458	NP_597715	Q8TF47	ZFP90_HUMAN	zinc finger protein 90						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		CAGTAGACAGATTTTTTTTTTT	0.371													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	75226282	75226283	+	IGR	INS	-	T	T	rs11408927		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75226282_75226283insT								ZFP1 (20151 upstream) : CTRB2 (11712 downstream)																							CAAATCAGAACTTTTTTTTTTT	0.178													5	7	---	---	---	---	
CNTNAP4	85445	broad.mit.edu	37	16	76482606	76482606	+	Intron	DEL	T	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76482606delT	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						GAAGGGAACCTTTTTTTTTTT	0.393													4	2	---	---	---	---	
OSGIN1	29948	broad.mit.edu	37	16	83984152	83984153	+	Intron	DEL	AT	-	-	rs59466230		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83984152_83984153delAT	uc002fha.2	+						OSGIN1_uc002fhb.2_Intron|OSGIN1_uc002fhc.2_5'Flank	NM_013370	NP_037502	Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1						cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0						gtacacacacatgcacacatga	0.000													4	2	---	---	---	---	
USP6	9098	broad.mit.edu	37	17	5036584	5036585	+	Intron	DEL	TT	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5036584_5036585delTT	uc002gau.1	+						USP6_uc002gav.1_Intron|USP6_uc010ckz.1_Intron|USP6_uc002gaw.2_Intron|uc002gay.1_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6						protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						CCATCCACTCTTTCAGTCCTGG	0.554			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								4	2	---	---	---	---	
MRC2	9902	broad.mit.edu	37	17	60738939	60738950	+	Intron	DEL	TTCCTTCCTTCC	-	-	rs66648705	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60738939_60738950delTTCCTTCCTTCC	uc002jad.2	+						MRC2_uc002jac.2_Intron	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2						endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3						ccttccttcattccttccttccttccttcctt	0.000													3	3	---	---	---	---	
DDX42	11325	broad.mit.edu	37	17	61857100	61857100	+	Intron	DEL	T	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61857100delT	uc002jbu.2	+						DDX42_uc002jbv.2_Intron	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN	DEAD box polypeptide 42 protein						protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)|large_intestine(1)	5						taggtatctcTTTTTTTTTTC	0.005													4	2	---	---	---	---	
HGS	9146	broad.mit.edu	37	17	79663194	79663203	+	Intron	DEL	TGCCCTGCCC	-	-	rs145540708		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79663194_79663203delTGCCCTGCCC	uc002kbg.2	+							NM_004712	NP_004703	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine						cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of JAK-STAT cascade|regulation of protein catabolic process	cytosol|early endosome membrane|multivesicular body membrane	metal ion binding|protein domain specific binding			ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			GTGATGACCAtgccctgccctgccctgccc	0.510													4	2	---	---	---	---	
KIAA0427	9811	broad.mit.edu	37	18	46184592	46184593	+	Intron	DEL	TG	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46184592_46184593delTG	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						ggtgtggatatgtgtgtgtgtg	0.030													4	2	---	---	---	---	
CD226	10666	broad.mit.edu	37	18	67563417	67563418	+	Intron	INS	-	T	T	rs33943534		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67563417_67563418insT	uc010dqo.2	-						CD226_uc002lkm.3_Intron	NM_006566	NP_006557	Q15762	CD226_HUMAN	CD226 molecule precursor						cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity				0		Esophageal squamous(42;0.129)				CTTTATACTACttttttttttt	0.173													4	2	---	---	---	---	
ZNF557	79230	broad.mit.edu	37	19	7068901	7068902	+	5'Flank	DEL	CA	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7068901_7068902delCA	uc002mgb.2	+						ZNF557_uc002mga.2_5'Flank|ZNF557_uc002mgc.2_5'Flank	NM_001044388	NP_001037853	Q8N988	ZN557_HUMAN	zinc finger protein 557 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2				Lung(535;0.179)		aacgaaaaGCcacacacacaca	0.153													2	4	---	---	---	---	
MUC16	94025	broad.mit.edu	37	19	9006152	9006153	+	Intron	INS	-	AA	AA			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9006152_9006153insAA	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GATGGACTCTGGAATCTCTCAG	0.505													2	6	---	---	---	---	
AP1M2	10053	broad.mit.edu	37	19	10689691	10689691	+	Intron	DEL	C	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10689691delC	uc002mpc.2	-						AP1M2_uc002mpd.2_Intron	NM_005498	NP_005489	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit						cellular membrane organization|post-Golgi vesicle-mediated transport|protein targeting|regulation of defense response to virus by virus|vesicle targeting|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding			ovary(2)	2			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			TGACTCTCttctttttttttt	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	15578651	15578653	+	IGR	DEL	TCC	-	-	rs140423177	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15578651_15578653delTCC								RASAL3 (3269 upstream) : PGLYRP2 (806 downstream)																							tttttttttttccttccttcctt	0.074													4	6	---	---	---	---	
MEGF8	1954	broad.mit.edu	37	19	42856450	42856450	+	Frame_Shift_Del	DEL	T	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42856450delT	uc002otl.3	+	18	3626	c.2991delT	c.(2989-2991)CCTfs	p.P997fs	MEGF8_uc002otm.3_Frame_Shift_Del_p.P605fs	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1064	Extracellular (Potential).					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				TGGCCCTCCCTGCCCGCTGGG	0.721													9	8	---	---	---	---	
KCNN4	3783	broad.mit.edu	37	19	44284568	44284569	+	Intron	INS	-	A	A	rs35437486		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44284568_44284569insA	uc002oxl.2	-						KCNN4_uc010eja.1_Intron	NM_002250	NP_002241	O15554	KCNN4_HUMAN	intermediate conductance calcium-activated						defense response	voltage-gated potassium channel complex	calcium-activated potassium channel activity|calmodulin binding			ovary(2)	2		Prostate(69;0.0352)			Clotrimazole(DB00257)|Halothane(DB01159)|Quinine(DB00468)	cccaggagtccagaccccagcc	0.000													4	2	---	---	---	---	
ZIM3	114026	broad.mit.edu	37	19	57649079	57649080	+	Intron	INS	-	A	A	rs77764788		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57649079_57649080insA	uc002qnz.1	-							NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		agactgtctccaaaaaaaaaaa	0.015													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29636421	29636421	+	Intron	DEL	A	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29636421delA	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						aaattttgataattttttgtt	0.095													3	3	---	---	---	---	
C20orf70	140683	broad.mit.edu	37	20	31767237	31767238	+	Intron	INS	-	A	A	rs79509615		TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31767237_31767238insA	uc002wyo.1	+							NM_080574	NP_542141	Q96DR5	SPLC2_HUMAN	chromosome 20 open reading frame 70 precursor							extracellular region	lipid binding			ovary(1)|central_nervous_system(1)	2						ttctgtctcagaaaaaaaaaaa	0.134													3	3	---	---	---	---	
GGT7	2686	broad.mit.edu	37	20	33444584	33444584	+	Intron	DEL	C	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33444584delC	uc002xay.2	-						GGT7_uc002xaz.1_Intron	NM_178026	NP_821158	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7						glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(1)	1						TGAGGGGGGACCCTGGGAGCC	0.577													18	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	44366727	44366727	+	IGR	DEL	A	-	-	rs144993638	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44366727delA								SPINT4 (12392 upstream) : WFDC3 (36120 downstream)																							CACTCCAGAGAAAAAAAaaaa	0.234													4	2	---	---	---	---	
RTEL1	51750	broad.mit.edu	37	20	62296462	62296463	+	Intron	INS	-	GT	GT	rs141421268	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62296462_62296463insGT	uc002yfu.1	+						RTEL1_uc011abc.1_Intron|RTEL1_uc002yft.1_Intron|RTEL1_uc011abd.1_Intron|RTEL1_uc002yfv.2_Intron|RTEL1_uc011abe.1_Intron|RTEL1_uc002yfw.2_Intron	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1						DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			Ggtgtgtgtgagtgtgtgtgtg	0.495													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17766436	17766437	+	IGR	INS	-	GT	GT	rs139195911	by1000genomes	TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17766436_17766437insGT								CECR1 (63698 upstream) : CECR2 (74402 downstream)																							TCTACCATTTCgtgtgtgtgtg	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	21052399	21052399	+	IGR	DEL	G	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21052399delG								POM121L4P (6390 upstream) : TMEM191A (3003 downstream)																							AGCTGCTGGTGGGGAGGTCTT	0.647													4	2	---	---	---	---	
CABIN1	23523	broad.mit.edu	37	22	24426005	24426005	+	Intron	DEL	A	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24426005delA	uc002zzi.1	+						CABIN1_uc002zzj.1_Intron|CABIN1_uc002zzl.1_Intron|CABIN1_uc010guk.1_Intron|CABIN1_uc002zzk.1_Intron	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1						cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						accctgtcttaaaaaaaaaaa	0.184													4	2	---	---	---	---	
POLDIP3	84271	broad.mit.edu	37	22	42992483	42992488	+	Intron	DEL	TCTAAT	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42992483_42992488delTCTAAT	uc003bcu.2	-						POLDIP3_uc011app.1_Intron|POLDIP3_uc003bcv.2_Intron|POLDIP3_uc011apq.1_Intron|POLDIP3_uc010gza.2_Intron|POLDIP3_uc011apr.1_Intron|POLDIP3_uc010gzb.1_Intron	NM_032311	NP_115687	Q9BY77	PDIP3_HUMAN	DNA polymerase delta interacting protein 3						positive regulation of translation	cytoplasm|nuclear speck	nucleotide binding|protein binding|RNA binding				0						CTCCCAGCTCTCTAATTCTATTAGAG	0.529													4	2	---	---	---	---	
ALG13	79868	broad.mit.edu	37	X	110970594	110970594	+	Frame_Shift_Del	DEL	C	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110970594delC	uc011msy.1	+	17	2045	c.2011delC	c.(2011-2013)CCGfs	p.P671fs	ALG13_uc011msx.1_Frame_Shift_Del_p.P567fs|ALG13_uc011msz.1_Frame_Shift_Del_p.P593fs|ALG13_uc011mta.1_Frame_Shift_Del_p.P567fs|ALG13_uc011mtb.1_Frame_Shift_Del_p.P567fs			Q9NP73	ALG13_HUMAN	SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);	671					dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity			lung(1)	1						GCACAACATGCCGGGCCCTAA	0.398													2	31	---	---	---	---	
TMLHE	55217	broad.mit.edu	37	X	154774662	154774662	+	Intron	DEL	C	-	-			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154774662delC	uc004fnn.2	-						TMLHE_uc004fno.2_Intron|TMLHE_uc004fnp.3_Intron	NM_018196	NP_060666	Q9NVH6	TMLH_HUMAN	trimethyllysine hydroxylase, epsilon						carnitine biosynthetic process	mitochondrial matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|trimethyllysine dioxygenase activity			ovary(1)	1	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Succinic acid(DB00139)|Vitamin C(DB00126)	tttcttaccacgattTtatca	0.109													5	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13486802	13486803	+	IGR	INS	-	C	C			TCGA-51-4080-01	TCGA-51-4080-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13486802_13486803insC								None (None upstream) : None (None downstream)																							gcctagacaaagtcccatcacc	0.000													4	2	---	---	---	---	
