Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CHD5	26038	broad.mit.edu	37	1	6194301	6194301	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6194301T>C	uc001amb.1	-	20	3131	c.3031A>G	c.(3031-3033)AAT>GAT	p.N1011D	CHD5_uc001alz.1_5'Flank|CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA|CHD5_uc009vlx.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	1011					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TAGGAGCCATTGGGCAAGACA	0.597													34	111	---	---	---	---	PASS
TAS1R1	80835	broad.mit.edu	37	1	6635260	6635260	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6635260C>T	uc001ant.2	+	3	1068	c.1068C>T	c.(1066-1068)TCC>TCT	p.S356S	TAS1R1_uc001anu.2_Intron|TAS1R1_uc001anv.2_Intron|TAS1R1_uc001anw.2_Silent_p.S356S	NM_138697	NP_619642	Q7RTX1	TS1R1_HUMAN	sweet taste receptor T1r isoform b	356	Extracellular (Potential).				sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		ACAAGGGCTCCTGGTGCAGCA	0.577													9	37	---	---	---	---	PASS
H6PD	9563	broad.mit.edu	37	1	9324427	9324427	+	Silent	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9324427A>T	uc001apt.2	+	5	2148	c.1875A>T	c.(1873-1875)CCA>CCT	p.P625P		NM_004285	NP_004276	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase precursor	625	6-phosphogluconolactonase.					endoplasmic reticulum lumen	6-phosphogluconolactonase activity|glucose 1-dehydrogenase|glucose-6-phosphate dehydrogenase activity|NADP binding				0	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)	NADH(DB00157)	GCTGCGTCCCACTCTCAGACC	0.672													10	23	---	---	---	---	PASS
MASP2	10747	broad.mit.edu	37	1	11087244	11087244	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11087244A>T	uc001aru.2	-	11	1780	c.1759T>A	c.(1759-1761)TAT>AAT	p.Y587N		NM_006610	NP_006601	O00187	MASP2_HUMAN	mannan-binding lectin serine protease 2 isoform	587	Peptidase S1.				complement activation, classical pathway|complement activation, lectin pathway|proteolysis	extracellular region	calcium ion binding|calcium-dependent protein binding|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		ATGTCGACATACATTAGATTT	0.428													22	142	---	---	---	---	PASS
ARHGEF10L	55160	broad.mit.edu	37	1	17953966	17953966	+	Nonsense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17953966A>T	uc001ban.2	+	15	1711	c.1552A>T	c.(1552-1554)AAG>TAG	p.K518*	ARHGEF10L_uc009vpe.1_Nonsense_Mutation_p.K479*|ARHGEF10L_uc001bao.2_Nonsense_Mutation_p.K479*|ARHGEF10L_uc001bap.2_Nonsense_Mutation_p.K479*|ARHGEF10L_uc010ocr.1_Nonsense_Mutation_p.K276*|ARHGEF10L_uc001baq.2_Nonsense_Mutation_p.K284*|ARHGEF10L_uc010ocs.1_Nonsense_Mutation_p.K296*|ARHGEF10L_uc001bar.2_Nonsense_Mutation_p.K226*|ARHGEF10L_uc009vpf.2_RNA	NM_018125	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF)	518					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)|pancreas(1)	3		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		GCAGCTGACCAAGAGCGTCAG	0.657													5	26	---	---	---	---	PASS
KLHDC7A	127707	broad.mit.edu	37	1	18809311	18809311	+	Nonsense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18809311G>A	uc001bax.2	+	1	1888	c.1836G>A	c.(1834-1836)TGG>TGA	p.W612*	KLHDC7A_uc009vpg.2_Nonsense_Mutation_p.W394*	NM_152375	NP_689588	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	612	Kelch 4.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TGGACCGCTGGGACTTTGCCC	0.697													3	19	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22158245	22158245	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22158245G>T	uc001bfj.2	-	82	11292	c.11252C>A	c.(11251-11253)CCA>CAA	p.P3751Q	HSPG2_uc001bfi.2_5'Flank|HSPG2_uc009vqd.2_Missense_Mutation_p.P3752Q	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	3751	Laminin G-like 1.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	CAGGGCCAGTGGTGTGGGATG	0.657													16	59	---	---	---	---	PASS
SLC30A2	7780	broad.mit.edu	37	1	26371674	26371674	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26371674C>A	uc001blh.1	-	2	302	c.85G>T	c.(85-87)GGC>TGC	p.G29C	SLC30A2_uc001blg.1_Missense_Mutation_p.G29C	NM_032513	NP_115902	Q9BRI3	ZNT2_HUMAN	solute carrier family 30, member 2 isoform 2	29	Cytoplasmic (Potential).				positive regulation of sequestering of zinc ion|zinc ion transport	integral to membrane|late endosome|lysosomal membrane	cation transmembrane transporter activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.09e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00614)|READ - Rectum adenocarcinoma(331;0.0649)		GGAATCCAGCCAGCCCCTTCC	0.607													11	40	---	---	---	---	PASS
KPNA6	23633	broad.mit.edu	37	1	32623057	32623057	+	Intron	SNP	T	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32623057T>G	uc001bug.2	+						KPNA6_uc001buh.2_Intron|KPNA6_uc010ogx.1_Intron|KPNA6_uc010ogy.1_Intron|KPNA6_uc009vtz.2_Intron	NM_012316	NP_036448	O60684	IMA7_HUMAN	karyopherin alpha 6						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				GTACAAAGCCTGGCCCTTGTC	0.294													5	38	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34174707	34174707	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34174707G>A	uc001bxn.1	-	22	3467	c.3438C>T	c.(3436-3438)TCC>TCT	p.S1146S	CSMD2_uc001bxm.1_Silent_p.S1186S|CSMD2_uc001bxo.1_Silent_p.S59S	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1146	Extracellular (Potential).|CUB 7.					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CATCTCCTTCGGAGAGTTCGA	0.423													29	113	---	---	---	---	PASS
C1orf212	113444	broad.mit.edu	37	1	35320824	35320824	+	Missense_Mutation	SNP	C	A	A	rs141693729		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35320824C>A	uc001byb.2	-	2	875	c.458G>T	c.(457-459)AGC>ATC	p.S153I		NM_138428	NP_612437			hypothetical protein LOC113444												0		Myeloproliferative disorder(586;0.0393)				CATTCCTGAGCTGACAAGACA	0.473													13	82	---	---	---	---	PASS
DLGAP3	58512	broad.mit.edu	37	1	35334343	35334343	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35334343G>A	uc001byc.2	-	7	2348	c.2348C>T	c.(2347-2349)CCC>CTC	p.P783L		NM_001080418	NP_001073887	O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated	783					cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane				ovary(3)	3		Myeloproliferative disorder(586;0.0393)				GCCTGAGTCGGGGAGGCTACG	0.577													15	27	---	---	---	---	PASS
EPHA10	284656	broad.mit.edu	37	1	38227289	38227289	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38227289G>T	uc009vvi.2	-	3	724	c.638C>A	c.(637-639)GCC>GAC	p.A213D	EPHA10_uc001cbw.3_Missense_Mutation_p.A213D	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	213	Extracellular (Potential).					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCGCACGGTGGCGCGGCACTG	0.692													7	15	---	---	---	---	PASS
CAP1	10487	broad.mit.edu	37	1	40535455	40535455	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40535455C>A	uc001cfa.3	+	9	1131	c.902C>A	c.(901-903)TCT>TAT	p.S301Y	CAP1_uc001cey.3_Missense_Mutation_p.S301Y|CAP1_uc001cez.3_Missense_Mutation_p.S301Y|CAP1_uc009vvz.2_Missense_Mutation_p.S301Y|CAP1_uc010oje.1_Missense_Mutation_p.S218Y	NM_006367	NP_006358	Q01518	CAP1_HUMAN	adenylyl cyclase-associated protein	301					activation of adenylate cyclase activity|axon guidance|establishment or maintenance of cell polarity|platelet activation|platelet degranulation|signal transduction	plasma membrane	actin binding			ovary(1)	1	Lung NSC(20;5.03e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;4.63e-18)|Epithelial(16;1.27e-16)|all cancers(16;2.3e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AAACCATTCTCTGCACCTAAA	0.522													4	116	---	---	---	---	PASS
RAD54L	8438	broad.mit.edu	37	1	46738151	46738151	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46738151A>G	uc009vye.2	+	12	1297	c.1183A>G	c.(1183-1185)AGG>GGG	p.R395G	RAD54L_uc001cpl.2_Missense_Mutation_p.R395G|RAD54L_uc001cpm.1_Missense_Mutation_p.R215G	NM_001142548	NP_001136020	Q92698	RAD54_HUMAN	RAD54-like protein	395					meiosis	nucleus	ATP binding|DNA binding|helicase activity			ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		CCTGATACGGAGGACTTCTGA	0.428								Direct_reversal_of_damage|Homologous_recombination					15	62	---	---	---	---	PASS
USP24	23358	broad.mit.edu	37	1	55620440	55620440	+	Silent	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55620440T>A	uc001cyg.3	-	12	1122	c.1122A>T	c.(1120-1122)TCA>TCT	p.S374S		NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24	486					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						TCACAGTAGATGATTGTCCTG	0.383													8	43	---	---	---	---	PASS
C8B	732	broad.mit.edu	37	1	57395200	57395200	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57395200C>A	uc001cyp.2	-	12	1720	c.1653G>T	c.(1651-1653)TGG>TGT	p.W551C	C8B_uc010oon.1_Missense_Mutation_p.W489C|C8B_uc010ooo.1_Missense_Mutation_p.W499C	NM_000066	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	551	TSP type-1 2.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex				central_nervous_system(2)|large_intestine(1)|ovary(1)	4						ACCAATTTGACCAGCAATTCC	0.463													12	53	---	---	---	---	PASS
IL23R	149233	broad.mit.edu	37	1	67724262	67724262	+	Silent	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67724262T>C	uc001ddo.2	+	11	1426	c.1341T>C	c.(1339-1341)CCT>CCC	p.P447P	IL23R_uc009waz.2_Silent_p.P244P|IL23R_uc010opi.1_RNA|IL23R_uc010opj.1_Silent_p.P45P|IL23R_uc010opk.1_3'UTR|IL23R_uc010opl.1_Silent_p.P29P|IL23R_uc010opm.1_RNA|IL23R_uc001ddq.2_Silent_p.P193P|IL23R_uc010opn.1_Silent_p.P292P|IL23R_uc001ddr.2_RNA|IL23R_uc010ops.1_Silent_p.P244P|IL23R_uc010opt.1_Silent_p.P88P|IL23R_uc010opu.1_Silent_p.P143P|IL23R_uc010opv.1_Silent_p.P205P|IL23R_uc010opw.1_Silent_p.P82P|IL23R_uc010opx.1_Silent_p.P88P|IL23R_uc010opy.1_Silent_p.P214P|IL23R_uc010opz.1_Silent_p.P88P|IL23R_uc010oqa.1_Silent_p.P88P|IL23R_uc010oqb.1_Silent_p.P276P|IL23R_uc010oqc.1_Silent_p.P163P|IL23R_uc010oqd.1_Silent_p.P82P|IL23R_uc010oqe.1_Silent_p.P45P|IL23R_uc010oqf.1_Silent_p.P45P|IL23R_uc010oqg.1_Silent_p.P45P|IL23R_uc010oqh.1_Silent_p.P88P|IL23R_uc001dds.2_Silent_p.P192P|IL23R_uc001ddt.2_Silent_p.P45P	NM_144701	NP_653302	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor precursor	447	Cytoplasmic (Potential).				inflammatory response|negative regulation of interleukin-10 production|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of interleukin-12 production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|response to interferon-gamma|response to lipopolysaccharide	interleukin-23 receptor complex	receptor activity				0						AACACAAGCCTACAGACTACA	0.388													19	155	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70502167	70502167	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70502167G>T	uc001dep.2	+	18	2064	c.2034G>T	c.(2032-2034)CTG>CTT	p.L678L	LRRC7_uc009wbg.2_Intron|LRRC7_uc001deq.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	678						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						CTCACTGTCTGAATAACAGTG	0.428													25	75	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79404920	79404920	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79404920A>T	uc001diq.3	-	4	505	c.349T>A	c.(349-351)TTA>ATA	p.L117I		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	117	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		ACATTATCTAAATGGCAGTTT	0.244													9	29	---	---	---	---	PASS
ABCA4	24	broad.mit.edu	37	1	94543316	94543316	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94543316G>T	uc001dqh.2	-	11	1588	c.1484C>A	c.(1483-1485)GCC>GAC	p.A495D	ABCA4_uc010otn.1_Missense_Mutation_p.A495D	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	495	Extracellular.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GTCGAAGTTGGCCATGTCGTC	0.532													22	149	---	---	---	---	PASS
PTBP2	58155	broad.mit.edu	37	1	97272495	97272495	+	Silent	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97272495T>C	uc001drq.2	+	11	1398	c.1152T>C	c.(1150-1152)GAT>GAC	p.D384D	PTBP2_uc001drn.2_Silent_p.D389D|PTBP2_uc001dro.2_Silent_p.D384D|PTBP2_uc010otz.1_Silent_p.D400D|PTBP2_uc001drp.2_RNA|PTBP2_uc009wdw.2_Silent_p.D332D|PTBP2_uc001drr.2_Silent_p.D389D|PTBP2_uc010oua.1_Silent_p.D392D|PTBP2_uc001dru.2_RNA|PTBP2_uc001drs.1_Silent_p.D3D|PTBP2_uc001drt.2_Silent_p.D3D	NM_021190	NP_067013	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	384	RRM 3.						nucleotide binding				0		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		AGATGGCTGATGGAAACCAAT	0.353													16	80	---	---	---	---	PASS
SLC6A17	388662	broad.mit.edu	37	1	110714798	110714798	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110714798A>G	uc009wfq.2	+	3	864	c.403A>G	c.(403-405)ATA>GTA	p.I135V		NM_001010898	NP_001010898	Q9H1V8	S6A17_HUMAN	solute carrier family 6, member 17	135	Cytoplasmic (Potential).				alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity			ovary(1)|pancreas(1)	2		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		GTGGCACTATATATGTCCCCG	0.632													5	10	---	---	---	---	PASS
CHIA	27159	broad.mit.edu	37	1	111857923	111857923	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111857923C>A	uc001eas.2	+	6	449	c.346C>A	c.(346-348)CGC>AGC	p.R116S	CHIA_uc001ear.2_Missense_Mutation_p.R8S|CHIA_uc001eaq.2_Missense_Mutation_p.R8S|CHIA_uc009wgc.2_Missense_Mutation_p.R8S|CHIA_uc001eat.2_Intron|CHIA_uc001eav.2_5'UTR|CHIA_uc001eau.2_Intron|CHIA_uc009wgd.2_Intron	NM_201653	NP_970615	Q9BZP6	CHIA_HUMAN	acidic chitinase isoform c	116					apoptosis|cell wall chitin metabolic process|chitin catabolic process|digestion|immune response|positive regulation of chemokine secretion|production of molecular mediator involved in inflammatory response|response to acid|response to fungus	cytoplasm|extracellular space	cation binding|chitin binding|chitinase activity|kinase binding|lysozyme activity|sugar binding			ovary(1)	1		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		TCCTGAGAACCGCCAGACTTT	0.537													39	156	---	---	---	---	PASS
HIPK1	204851	broad.mit.edu	37	1	114483113	114483113	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114483113G>T	uc001eem.2	+	2	269	c.108G>T	c.(106-108)CAG>CAT	p.Q36H	HIPK1_uc001eel.2_Missense_Mutation_p.Q36H|HIPK1_uc001een.2_Missense_Mutation_p.Q36H	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN	homeodomain-interacting protein kinase 1 isoform	36					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(4)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTCAGGACAGAGTAGCAACG	0.507													53	316	---	---	---	---	PASS
IGSF3	3321	broad.mit.edu	37	1	117158964	117158964	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117158964C>G	uc001egr.1	-	3	864	c.159G>C	c.(157-159)CAG>CAC	p.Q53H	IGSF3_uc001egq.1_Missense_Mutation_p.Q53H	NM_001007237	NP_001007238	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3 isoform 2	53	Ig-like C2-type 1.|Extracellular (Potential).					integral to membrane				ovary(2)	2	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		ACTGGAAATTCTGCTCAGAAG	0.572													15	45	---	---	---	---	PASS
SEC22B	9554	broad.mit.edu	37	1	145112437	145112437	+	Silent	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145112437C>A	uc001eml.1	+	6	551	c.411C>A	c.(409-411)TCC>TCA	p.S137S	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	NM_004892	NP_004883	O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B	137	v-SNARE coiled-coil homology.|Cytoplasmic (Potential).				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding				0						ACCTAGGCTCCATCAACACTG	0.408													5	115	---	---	---	---	PASS
ITGA10	8515	broad.mit.edu	37	1	145532483	145532483	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145532483G>T	uc001eoa.2	+	9	1012	c.936G>T	c.(934-936)CAG>CAT	p.Q312H	NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Missense_Mutation_p.Q181H|ITGA10_uc009wiw.2_Missense_Mutation_p.Q169H|ITGA10_uc010oyw.1_Missense_Mutation_p.Q257H	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor	312	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCCGGCGGCAGCGAGATCCCA	0.478													20	134	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	154033493	154033493	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154033493A>T	uc001fdw.2	-	19	2745	c.2673T>A	c.(2671-2673)GAT>GAA	p.D891E	NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Missense_Mutation_p.D891E	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	891						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GCAGTTCCACATCTACAGATC	0.333													19	146	---	---	---	---	PASS
HCN3	57657	broad.mit.edu	37	1	155255711	155255711	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155255711G>T	uc001fjz.1	+	6	1441	c.1433G>T	c.(1432-1434)CGC>CTC	p.R478L	RAG1AP1_uc010pey.1_Intron|HCN3_uc010pfz.1_Missense_Mutation_p.R173L	NM_020897	NP_065948	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic	478	Cytoplasmic (Potential).|cAMP.					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)|breast(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTGCTGGCCCGCGGCGCCCGG	0.652													29	124	---	---	---	---	PASS
GPATCH4	54865	broad.mit.edu	37	1	156568034	156568034	+	Silent	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156568034T>A	uc001fpm.2	-	4	285	c.246A>T	c.(244-246)GTA>GTT	p.V82V	GPATCH4_uc001fpl.2_Silent_p.V77V	NM_015590	NP_056405	Q5T3I0	GPTC4_HUMAN	G patch domain containing 4 isoform 1	77						intracellular	nucleic acid binding			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGTTTCCACTACCAAGTTGG	0.517													40	253	---	---	---	---	PASS
CD5L	922	broad.mit.edu	37	1	157804395	157804395	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157804395C>A	uc001frk.3	-	4	663	c.520G>T	c.(520-522)GTG>TTG	p.V174L		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	174	SRCR 2.				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CGGCACACCACCTTTGCGGCC	0.607													5	107	---	---	---	---	PASS
OR6K2	81448	broad.mit.edu	37	1	158669890	158669890	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158669890G>T	uc001fsu.1	-	1	553	c.553C>A	c.(553-555)CGT>AGT	p.R185S		NM_001005279	NP_001005279	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K,	185	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					CAGGCCAGACGCAGCACTGGG	0.478													6	99	---	---	---	---	PASS
MAEL	84944	broad.mit.edu	37	1	166991004	166991004	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166991004A>G	uc001gdy.1	+	12	1288	c.1217A>G	c.(1216-1218)AAT>AGT	p.N406S	MAEL_uc001gdz.1_Missense_Mutation_p.N375S|MAEL_uc009wvf.1_RNA	NM_032858	NP_116247	Q96JY0	MAEL_HUMAN	maelstrom homolog	406					cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|multicellular organismal development|piRNA metabolic process|spermatogenesis	piP-body	DNA binding			skin(1)	1						TCTTCCAGCAATATCCACAAA	0.423													20	81	---	---	---	---	PASS
DCAF6	55827	broad.mit.edu	37	1	168037687	168037687	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168037687A>G	uc001gew.2	+	18	2746	c.2504A>G	c.(2503-2505)AAT>AGT	p.N835S	DCAF6_uc001gev.2_Missense_Mutation_p.N855S|DCAF6_uc001gex.2_Missense_Mutation_p.N926S|DCAF6_uc010plk.1_Missense_Mutation_p.N895S|DCAF6_uc001gey.2_Missense_Mutation_p.N708S|DCAF6_uc001gez.2_Missense_Mutation_p.N138S	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN	IQ motif and WD repeats 1 isoform b	835					positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						GCTTCACTTAATCATATCCGA	0.328													3	45	---	---	---	---	PASS
METTL13	51603	broad.mit.edu	37	1	171765854	171765854	+	Silent	SNP	G	T	T	rs61733151	byFrequency	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171765854G>T	uc001ghz.2	+	8	2405	c.2058G>T	c.(2056-2058)ACG>ACT	p.T686T	METTL13_uc001gia.2_Silent_p.T600T|METTL13_uc001gib.2_Silent_p.T530T|METTL13_uc010pml.1_Silent_p.T685T|METTL13_uc001gic.1_RNA	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN	CGI-01 protein isoform 1	686							methyltransferase activity|protein binding			kidney(1)	1						GGGATGACACGTATGTCTTGT	0.557													32	102	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176563806	176563806	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176563806C>A	uc001gkz.2	+	3	2230	c.1066C>A	c.(1066-1068)CAC>AAC	p.H356N	PAPPA2_uc001gky.1_Missense_Mutation_p.H356N|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	356					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CTTGATTAGCCACAGTCGCTA	0.582													14	47	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	179983508	179983508	+	Silent	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179983508T>C	uc001gnt.2	+	10	2303	c.1920T>C	c.(1918-1920)TTT>TTC	p.F640F	CEP350_uc009wxl.2_Silent_p.F639F|CEP350_uc001gnu.2_Silent_p.F474F	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	640	Potential.					centrosome|nucleus|spindle				ovary(4)	4						AGGAAGCCTTTACTAAAGTAA	0.423													3	8	---	---	---	---	PASS
ZNF648	127665	broad.mit.edu	37	1	182026487	182026487	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182026487G>C	uc001goz.2	-	2	867	c.659C>G	c.(658-660)GCT>GGT	p.A220G		NM_001009992	NP_001009992	Q5T619	ZN648_HUMAN	zinc finger protein 648	220					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GACCGCGGCAGCCAGGCTGGC	0.667													3	26	---	---	---	---	PASS
C1orf25	81627	broad.mit.edu	37	1	185094122	185094122	+	Silent	SNP	A	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185094122A>C	uc001grf.3	-	12	1985	c.1713T>G	c.(1711-1713)CCT>CCG	p.P571P	C1orf25_uc010pon.1_Silent_p.P415P	NM_030934	NP_112196	Q7Z2T5	TRM1L_HUMAN	N2,N2-dimethylguanosine tRNA	571						intracellular	RNA binding|tRNA (guanine-N2-)-methyltransferase activity|zinc ion binding				0						ACTGACTTTGAGGCGTACACT	0.368													10	80	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	185964039	185964039	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185964039C>A	uc001grq.1	+	24	3827	c.3598C>A	c.(3598-3600)CCT>ACT	p.P1200T		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	1200	Ig-like C2-type 9.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GACTCCTCTTCCTGTAATCAC	0.468													19	102	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186287912	186287912	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186287912G>A	uc001grv.2	-	47	6914	c.6617C>T	c.(6616-6618)TCA>TTA	p.S2206L		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	2206					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TCGGCCACCTGACTCTTCTTC	0.388			T	NTRK1	papillary thyroid								24	149	---	---	---	---	PASS
RGS13	6003	broad.mit.edu	37	1	192617069	192617069	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192617069G>A	uc001gsj.2	+	5	360	c.79G>A	c.(79-81)GAA>AAA	p.E27K	RGS13_uc001gsk.2_Missense_Mutation_p.E27K	NM_002927	NP_002918	O14921	RGS13_HUMAN	regulator of G-protein signalling 13	27						plasma membrane	GTPase activator activity|signal transducer activity				0						TACTTTGGAGGAAGTATTACA	0.328													10	127	---	---	---	---	PASS
CD34	947	broad.mit.edu	37	1	208061216	208061216	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208061216C>A	uc001hgw.1	-	8	1283	c.1025G>T	c.(1024-1026)GGA>GTA	p.G342V	CD34_uc001hgv.1_Missense_Mutation_p.G184V|CD34_uc001hgx.1_3'UTR|CD34_uc010psj.1_Missense_Mutation_p.G207V	NM_001025109	NP_001020280	P28906	CD34_HUMAN	CD34 antigen isoform a	342	Cytoplasmic (Potential).				cell-cell adhesion|leukocyte migration|regulation of immune response	integral to membrane	carbohydrate binding			ovary(1)	1						GGTCCCAGGTCCTGAGCTATA	0.562													5	48	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228468290	228468290	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228468290C>T	uc009xez.1	+	30	8034	c.7990C>T	c.(7990-7992)CTG>TTG	p.L2664L	OBSCN_uc001hsn.2_Silent_p.L2664L|OBSCN_uc001hsp.1_Silent_p.L363L|OBSCN_uc001hsq.1_5'UTR	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	2664	Ig-like 26.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GCGCGGCACCCTGGCCCTGCA	0.642													8	58	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237730049	237730049	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237730049C>A	uc001hyl.1	+	28	3517	c.3397C>A	c.(3397-3399)CGT>AGT	p.R1133S		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1133	Cytoplasmic (By similarity).|4 X approximate repeats.|B30.2/SPRY 2.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTCAGATGAACGTGCCTTTGC	0.522													50	194	---	---	---	---	PASS
OR2B11	127623	broad.mit.edu	37	1	247614672	247614672	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247614672C>G	uc010pyx.1	-	1	613	c.613G>C	c.(613-615)GTG>CTG	p.V205L		NM_001004492	NP_001004492	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B,	205	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			GCCACCAGCACAGCCAGTATG	0.577													7	26	---	---	---	---	PASS
OR2C3	81472	broad.mit.edu	37	1	247695546	247695546	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247695546G>T	uc009xgy.2	-	2	630	c.268C>A	c.(268-270)CAG>AAG	p.Q90K	C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	NM_198074	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C,	90	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			ATGGTTTTCTGTGGTCCCCAG	0.547													18	54	---	---	---	---	PASS
OR2W3	343171	broad.mit.edu	37	1	248059679	248059679	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248059679C>A	uc001idp.1	+	3	1060	c.791C>A	c.(790-792)GCC>GAC	p.A264D	OR2W3_uc010pzb.1_Missense_Mutation_p.A264D	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W,	264	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|pancreas(1)	3	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CAGCCAGGAGCCAGTTCTTCC	0.532													11	103	---	---	---	---	PASS
FAM110C	642273	broad.mit.edu	37	2	46014	46014	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46014C>G	uc010yim.1	-	1	372	c.372G>C	c.(370-372)AAG>AAC	p.K124N		NM_001077710	NP_001071178	Q1W6H9	F110C_HUMAN	hypothetical protein LOC642273	124						microtubule|microtubule organizing center|spindle pole					0	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00221)		all cancers(51;0.000815)|Epithelial(75;0.00379)|OV - Ovarian serous cystadenocarcinoma(76;0.0127)|GBM - Glioblastoma multiforme(21;0.232)		GGAAGAGCTTCTTCACCAGGC	0.682													9	17	---	---	---	---	PASS
NBAS	51594	broad.mit.edu	37	2	15307178	15307178	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15307178C>A	uc002rcc.1	-	52	7136	c.7110G>T	c.(7108-7110)TGG>TGT	p.W2370C	NBAS_uc002rcb.1_Missense_Mutation_p.W210C|NBAS_uc010exl.1_Missense_Mutation_p.W1442C|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	2370										ovary(2)|liver(1)|skin(1)	4						GCCCTCACACCCAGTGCTGTG	0.582													23	60	---	---	---	---	PASS
ATAD2B	54454	broad.mit.edu	37	2	24098700	24098700	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24098700T>A	uc002rek.3	-	8	1270	c.976A>T	c.(976-978)AGG>TGG	p.R326W	ATAD2B_uc010yki.1_RNA|ATAD2B_uc010exx.1_Missense_Mutation_p.R340W	NM_017552	NP_060022	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	326							ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAACCTTACCTAATATGGCTT	0.333													3	30	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27802601	27802601	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27802601T>A	uc002rkz.3	+	1	3213	c.3162T>A	c.(3160-3162)AGT>AGA	p.S1054R		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	1054										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					ACTCACAGAGTGATTCCCAGA	0.468													49	150	---	---	---	---	PASS
NLRC4	58484	broad.mit.edu	37	2	32476479	32476479	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32476479G>T	uc002roi.2	-	4	700	c.454C>A	c.(454-456)CTG>ATG	p.L152M	NLRC4_uc002roj.1_Missense_Mutation_p.L152M|NLRC4_uc010ezt.1_Intron	NM_021209	NP_067032	Q9NPP4	NLRC4_HUMAN	caspase recruitment domain protein 12	152					activation of caspase activity|defense response to bacterium|detection of bacterium|interleukin-1 beta secretion|positive regulation of apoptosis	cytoplasm	ATP binding|magnesium ion binding|protein homodimerization activity			ovary(3)|large_intestine(1)|lung(1)|skin(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TTCAGGGTCAGCTGCTCCACG	0.517													13	53	---	---	---	---	PASS
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48809163	48809163	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48809163C>G	uc010yol.1	+	1	1438	c.1391C>G	c.(1390-1392)CCG>CGG	p.P464R	STON1_uc002rwo.3_Missense_Mutation_p.P464R|STON1_uc010fbm.2_Missense_Mutation_p.P464R|STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.P464R|STON1_uc002rwr.2_RNA|STON1_uc002rwq.2_Missense_Mutation_p.P464R	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	464					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CTTGAGTTGCCGAAGCGAGAT	0.368													40	129	---	---	---	---	PASS
MRPL19	9801	broad.mit.edu	37	2	75874342	75874342	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75874342G>A	uc002snl.2	+	2	243	c.218G>A	c.(217-219)CGC>CAC	p.R73H	MRPL19_uc002snm.1_Missense_Mutation_p.R73H	NM_014763	NP_055578	P49406	RM19_HUMAN	mitochondrial ribosomal protein L19 precursor	73					translation	mitochondrion|nuclear membrane|ribosome	structural constituent of ribosome				0						GAACCGGAACGCAGGTGAGGC	0.706													4	6	---	---	---	---	PASS
THNSL2	55258	broad.mit.edu	37	2	88474167	88474167	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88474167A>T	uc002ssz.3	+	3	386	c.233A>T	c.(232-234)GAC>GTC	p.D78V	THNSL2_uc002ssv.2_RNA|THNSL2_uc002ssw.3_Missense_Mutation_p.D78V|THNSL2_uc002ssx.3_Missense_Mutation_p.D46V|THNSL2_uc002sta.3_Intron|THNSL2_uc002ssy.3_Missense_Mutation_p.D78V|THNSL2_uc010fhe.2_5'UTR	NM_018271	NP_060741	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2	78					threonine biosynthetic process		threonine synthase activity			ovary(1)	1						GATCTGATCGACCGAGCCTTC	0.517													22	90	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89277985	89277985	+	Intron	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89277985G>T	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		AATCACTGTGGGAGGTAAGTT	0.448													16	36	---	---	---	---	PASS
KCNIP3	30818	broad.mit.edu	37	2	96040090	96040090	+	Silent	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96040090A>G	uc002sup.2	+	3	343	c.228A>G	c.(226-228)CCA>CCG	p.P76P	KCNIP3_uc002suq.2_Silent_p.P50P	NM_013434	NP_038462	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3 isoform 1	76	EF-hand 1; degenerate.				apoptosis|signal transduction|transcription, DNA-dependent	endoplasmic reticulum|Golgi apparatus|nucleus|plasma membrane	calcium ion binding|DNA binding|potassium channel activity|transcription corepressor activity|voltage-gated ion channel activity			breast(2)|ovary(1)	3				READ - Rectum adenocarcinoma(193;0.13)		GCCACCAGCCAGAGGGGCTGG	0.597													11	55	---	---	---	---	PASS
ADRA2B	151	broad.mit.edu	37	2	96781416	96781416	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96781416G>A	uc002svi.2	-	1	473	c.473C>T	c.(472-474)CCG>CTG	p.P158L		NM_000682	NP_000673	P18089	ADA2B_HUMAN	alpha-2B-adrenergic receptor	158	Extracellular (By similarity).				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation	integral to plasma membrane	alpha2-adrenergic receptor activity|epinephrine binding|protein binding			ovary(2)|lung(1)	3					Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)	GCGCCCGCGCGGCTGGGGGCC	0.637													8	35	---	---	---	---	PASS
ANKRD36B	57730	broad.mit.edu	37	2	98177127	98177127	+	Splice_Site	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98177127C>T	uc010yvc.1	-	8	1145	c.865_splice	c.e8+1	p.V289_splice	ANKRD36B_uc010yve.1_Splice_Site|ANKRD36B_uc010fif.2_Splice_Site	NM_025190	NP_079466	Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B												0						TGCAAAATTACCTGTCCCAGA	0.294													14	105	---	---	---	---	PASS
INPP4A	3631	broad.mit.edu	37	2	99180045	99180045	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99180045C>A	uc002syy.2	+	19	2381	c.1988C>A	c.(1987-1989)ACC>AAC	p.T663N	INPP4A_uc010yvj.1_Missense_Mutation_p.T624N|INPP4A_uc010yvk.1_Missense_Mutation_p.T624N|INPP4A_uc002syx.2_Missense_Mutation_p.T658N|INPP4A_uc010fik.2_Intron	NM_001134224	NP_001127696	Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type 1	663					signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			kidney(1)	1						AGCGCGCCCACCATAGCCACC	0.632													11	48	---	---	---	---	PASS
IL18RAP	8807	broad.mit.edu	37	2	103040368	103040368	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103040368C>A	uc002tbx.2	+	4	652	c.168C>A	c.(166-168)TTC>TTA	p.F56L	IL18RAP_uc010fiz.2_Intron	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	56	Extracellular (Potential).				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						AATCACATTTCTGCCACAGAA	0.428													11	50	---	---	---	---	PASS
SLC5A7	60482	broad.mit.edu	37	2	108609583	108609583	+	Nonsense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108609583G>T	uc002tdv.2	+	4	724	c.448G>T	c.(448-450)GGA>TGA	p.G150*	SLC5A7_uc010ywm.1_5'UTR|SLC5A7_uc010fjj.2_Nonsense_Mutation_p.G150*|SLC5A7_uc010ywn.1_Nonsense_Mutation_p.G37*	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (choline transporter),	150	Cytoplasmic (Potential).				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)	CTCTGCTTTGGGTAAGGACCA	0.443													13	45	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131521817	131521817	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131521817C>A	uc002trw.2	+	2	2362	c.2172C>A	c.(2170-2172)AGC>AGA	p.S724R	FAM123C_uc010fmv.2_Missense_Mutation_p.S724R|FAM123C_uc010fms.1_Missense_Mutation_p.S724R|FAM123C_uc010fmt.1_Missense_Mutation_p.S724R|FAM123C_uc010fmu.1_Missense_Mutation_p.S724R	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	724										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		AGTCCAGCAGCTCCCCCAGCA	0.647													3	29	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141283417	141283417	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141283417G>C	uc002tvj.1	-	49	8994	c.8022C>G	c.(8020-8022)TGC>TGG	p.C2674W		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2674	Extracellular (Potential).|LDL-receptor class A 14.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TATTACCTGGGCACTTTAATT	0.368										TSP Lung(27;0.18)			9	43	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141747209	141747209	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141747209C>G	uc002tvj.1	-	17	3634	c.2662G>C	c.(2662-2664)GAT>CAT	p.D888H	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	888	Extracellular (Potential).|LDL-receptor class A 4.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AACTGATCATCAGGACAGCTA	0.378										TSP Lung(27;0.18)			14	85	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141806619	141806619	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141806619G>A	uc002tvj.1	-	11	2697	c.1725C>T	c.(1723-1725)ACC>ACT	p.T575T	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	575	Extracellular (Potential).|LDL-receptor class B 5.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGAAACTGGTGGTGTCAGCAA	0.428										TSP Lung(27;0.18)			34	136	---	---	---	---	PASS
ITGB6	3694	broad.mit.edu	37	2	160982885	160982885	+	Intron	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160982885A>G	uc002ubh.2	-						ITGB6_uc010fou.2_Intron|ITGB6_uc010zcq.1_Intron|ITGB6_uc010fov.1_Intron	NM_000888	NP_000879	P18564	ITB6_HUMAN	integrin, beta 6 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3						AAGCAGAGACATTACCGTTTA	0.443													16	43	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166848466	166848466	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166848466G>A	uc010zcz.1	-	26	5304	c.5286C>T	c.(5284-5286)TCC>TCT	p.S1762S		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1773	IV.|Helical; Name=S6 of repeat IV; (By similarity).					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	CAACCAGGAAGGATATGATGA	0.443													38	160	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168102055	168102055	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168102055A>T	uc002udx.2	+	8	4171	c.4153A>T	c.(4153-4155)AGT>TGT	p.S1385C	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.S1210C|XIRP2_uc010fpq.2_Missense_Mutation_p.S1163C|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1210	Xin 24.				actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GGGAGATGTTAGTTCTGTCAG	0.353													17	73	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170127585	170127585	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170127585C>G	uc002ues.2	-	16	2362	c.2149G>C	c.(2149-2151)GTT>CTT	p.V717L	LRP2_uc010zdf.1_Intron	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	717	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CGAATAGCAACTTGGGATGAA	0.448													5	41	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179398873	179398873	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179398873A>T	uc010zfg.1	-	307	94989	c.94765T>A	c.(94765-94767)TGC>AGC	p.C31589S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.C25284S|TTN_uc010zfi.1_Missense_Mutation_p.C25217S|TTN_uc010zfj.1_Missense_Mutation_p.C25092S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	32516							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAATTTTGCATACATATTTG	0.423													25	142	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179577633	179577633	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179577633C>G	uc010zfg.1	-	91	23611	c.23387G>C	c.(23386-23388)AGT>ACT	p.S7796T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.S4457T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8723							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTACGATACTTGTGAAAGT	0.408													11	28	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179592014	179592014	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179592014C>A	uc010zfg.1	-	66	16570	c.16346G>T	c.(16345-16347)GGA>GTA	p.G5449V	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.G2110V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6376							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTGGGGATCCAGCTATCTT	0.418													13	72	---	---	---	---	PASS
CERKL	375298	broad.mit.edu	37	2	182423343	182423343	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182423343C>T	uc002unx.2	-	6	949	c.848G>A	c.(847-849)CGA>CAA	p.R283Q	CERKL_uc002uny.2_Missense_Mutation_p.R257Q|CERKL_uc010zfm.1_Missense_Mutation_p.R239Q|CERKL_uc002unz.2_Missense_Mutation_p.R5Q|CERKL_uc002uoa.2_Intron|CERKL_uc002uob.2_Missense_Mutation_p.R5Q|CERKL_uc002uoc.2_Intron|CERKL_uc010frk.2_RNA|CERKL_uc002uod.1_Missense_Mutation_p.R52Q|CERKL_uc002uoe.2_Missense_Mutation_p.R257Q	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	ceramide kinase-like isoform b	283	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)			AGTCAGGATTCGGTCTGTTTC	0.488													24	86	---	---	---	---	PASS
SSFA2	6744	broad.mit.edu	37	2	182780211	182780211	+	Missense_Mutation	SNP	G	A	A	rs141978094		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182780211G>A	uc002uoi.2	+	11	2166	c.1844G>A	c.(1843-1845)GGG>GAG	p.G615E	SSFA2_uc002uoh.2_Missense_Mutation_p.G615E|SSFA2_uc002uoj.2_Missense_Mutation_p.G615E|SSFA2_uc002uok.2_RNA|SSFA2_uc010zfo.1_Missense_Mutation_p.G462E|SSFA2_uc002uol.2_Missense_Mutation_p.G462E|SSFA2_uc002uom.2_Missense_Mutation_p.G83E	NM_001130445	NP_001123917	P28290	SSFA2_HUMAN	sperm specific antigen 2 isoform 1	615						cytoplasm|plasma membrane	actin binding			breast(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			TGTAGTCCAGGGGATCATATC	0.448													9	39	---	---	---	---	PASS
SSFA2	6744	broad.mit.edu	37	2	182780729	182780729	+	Missense_Mutation	SNP	A	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182780729A>C	uc002uoi.2	+	11	2684	c.2362A>C	c.(2362-2364)ATG>CTG	p.M788L	SSFA2_uc002uoh.2_Missense_Mutation_p.M788L|SSFA2_uc002uoj.2_Missense_Mutation_p.M788L|SSFA2_uc002uok.2_RNA|SSFA2_uc010zfo.1_Missense_Mutation_p.M635L|SSFA2_uc002uol.2_Missense_Mutation_p.M635L|SSFA2_uc002uom.2_Missense_Mutation_p.M256L	NM_001130445	NP_001123917	P28290	SSFA2_HUMAN	sperm specific antigen 2 isoform 1	788						cytoplasm|plasma membrane	actin binding			breast(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			AAAGCGGGTGATGGAACATGA	0.483													9	63	---	---	---	---	PASS
COL3A1	1281	broad.mit.edu	37	2	189868835	189868835	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189868835G>A	uc002uqj.1	+	39	2906	c.2789G>A	c.(2788-2790)GGA>GAA	p.G930E		NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	930	Triple-helical region.				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	GGCCAACCAGGAGAGAAGGGA	0.502													16	51	---	---	---	---	PASS
PMS1	5378	broad.mit.edu	37	2	190728639	190728639	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190728639C>T	uc002urh.3	+	10	2556	c.2027C>T	c.(2026-2028)CCA>CTA	p.P676L	PMS1_uc010zga.1_3'UTR|PMS1_uc010zgb.1_Missense_Mutation_p.P615L|PMS1_uc002urk.3_Missense_Mutation_p.P637L|PMS1_uc002uri.3_Intron|PMS1_uc010zgc.1_Missense_Mutation_p.P500L|PMS1_uc010zgd.1_Missense_Mutation_p.P500L|PMS1_uc002urj.2_RNA|PMS1_uc010fry.1_Missense_Mutation_p.P637L|PMS1_uc010frz.2_Intron|PMS1_uc002url.2_Intron|PMS1_uc002urm.2_RNA|PMS1_uc002urn.1_Missense_Mutation_p.P344L	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a	676					mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding	p.P676R(1)		ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TCTAATCAACCAAAACTTGAT	0.333			Mis|N			colorectal|endometrial|ovarian		Direct_reversal_of_damage|MMR					19	89	---	---	---	---	PASS
NBEAL1	65065	broad.mit.edu	37	2	204048123	204048123	+	Intron	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204048123G>T	uc002uzt.3	+						NBEAL1_uc002uzs.3_Intron	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3								binding			ovary(1)|skin(1)	2						TAAGAGTTTTGCATTTAGTTA	0.294													16	97	---	---	---	---	PASS
BARD1	580	broad.mit.edu	37	2	215645566	215645566	+	Missense_Mutation	SNP	A	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215645566A>C	uc002veu.2	-	4	1167	c.1032T>G	c.(1030-1032)AGT>AGG	p.S344R	BARD1_uc010zjm.1_Missense_Mutation_p.S200R	NM_000465	NP_000456	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	344					cell cycle arrest|DNA repair|negative regulation of apoptosis|negative regulation of mRNA 3'-end processing|negative regulation of protein export from nucleus|positive regulation of apoptosis|positive regulation of protein catabolic process|protein K6-linked ubiquitination|regulation of phosphorylation|tissue homeostasis	BRCA1-A complex|BRCA1-BARD1 complex|cytoplasm	kinase binding|protein heterodimerization activity|protein homodimerization activity|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CAAAATCTCCACTGGTGCTCA	0.413									Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				22	77	---	---	---	---	PASS
STK36	27148	broad.mit.edu	37	2	219558038	219558038	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219558038C>T	uc002viu.2	+	17	2385	c.2119C>T	c.(2119-2121)CAT>TAT	p.H707Y	STK36_uc002viv.2_Missense_Mutation_p.H707Y|STK36_uc002viw.2_5'Flank	NM_015690	NP_056505	Q9NRP7	STK36_HUMAN	serine/threonine kinase 36	707					cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding			ovary(4)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	11		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		TGGCCTGCAGCATCCCATCCT	0.448													18	52	---	---	---	---	PASS
CHPF	79586	broad.mit.edu	37	2	220404186	220404186	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220404186G>A	uc002vmc.3	-	4	2474	c.2247C>T	c.(2245-2247)CTC>CTT	p.L749L	CHPF_uc010zlh.1_Silent_p.L587L	NM_024536	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	749	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity|protein binding				0		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		GCACGCTCTGGAGGCAGCGGT	0.682													7	36	---	---	---	---	PASS
ALPPL2	251	broad.mit.edu	37	2	233272586	233272586	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233272586G>A	uc002vss.3	+	5	560	c.507G>A	c.(505-507)CGG>CGA	p.R169R		NM_031313	NP_112603	P10696	PPBN_HUMAN	placental-like alkaline phosphatase	169					phosphorylation	anchored to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			skin(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)|Levamisole(DB00848)	CCACCACACGGGTGCAGCATG	0.662													20	68	---	---	---	---	PASS
ATG16L1	55054	broad.mit.edu	37	2	234198998	234198998	+	Silent	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234198998C>A	uc002vty.2	+	14	1686	c.1429C>A	c.(1429-1431)CGA>AGA	p.R477R	ATG16L1_uc002vtx.1_Silent_p.R314R|ATG16L1_uc002vua.2_Silent_p.R458R|ATG16L1_uc002vub.2_Silent_p.R335R|ATG16L1_uc002vtz.2_Silent_p.R298R|ATG16L1_uc002vud.3_Silent_p.R393R	NM_030803	NP_110430	Q676U5	A16L1_HUMAN	APG16 autophagy 16-like isoform 1	477	WD 4.				autophagic vacuole assembly|protein homooligomerization|protein transport	autophagic vacuole|pre-autophagosomal structure membrane	protein binding				0		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		CTGGGACATTCGGTATGATAC	0.428													4	87	---	---	---	---	PASS
UGT1A8	54576	broad.mit.edu	37	2	234526456	234526456	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234526456G>A	uc002vup.2	+	1	166	c.103G>A	c.(103-105)GGG>AGG	p.G35R	UGT1A8_uc010zmv.1_Missense_Mutation_p.G35R	NM_019076	NP_061949	Q9HAW9	UD18_HUMAN	UDP glycosyltransferase 1 family, polypeptide A8	35					drug metabolic process|fatty acid metabolic process|flavone metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme inhibitor activity|fatty acid binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|steroid binding			ovary(2)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;2.56e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000482)|Lung(119;0.00404)|LUSC - Lung squamous cell carcinoma(224;0.008)		GCCCATGGATGGGAGTCACTG	0.572													16	100	---	---	---	---	PASS
UGT1A5	54579	broad.mit.edu	37	2	234675779	234675779	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234675779A>G	uc002vuw.2	+	2	967	c.967A>G	c.(967-969)ATT>GTT	p.I323V	UGT1A8_uc010zmv.1_Missense_Mutation_p.I319V|UGT1A8_uc002vup.2_Missense_Mutation_p.I319V|UGT1A10_uc002vuq.3_Missense_Mutation_p.I319V|UGT1A10_uc002vur.2_Missense_Mutation_p.I319V|UGT1A9_uc010zmw.1_Missense_Mutation_p.I319V|UGT1A9_uc002vus.2_Missense_Mutation_p.I319V|UGT1A7_uc010zmx.1_Missense_Mutation_p.I319V|UGT1A7_uc002vut.2_Missense_Mutation_p.I319V|UGT1A6_uc002vuu.2_Missense_Mutation_p.I54V|UGT1A6_uc010zmy.1_Missense_Mutation_p.I321V|UGT1A6_uc002vuv.3_Missense_Mutation_p.I321V|UGT1A5_uc010zmz.1_Missense_Mutation_p.I323V|UGT1A4_uc010zna.1_Missense_Mutation_p.I323V|UGT1A4_uc002vux.2_Missense_Mutation_p.I323V|UGT1A3_uc010znb.1_Missense_Mutation_p.I323V|UGT1A3_uc002vuy.2_Missense_Mutation_p.I323V|UGT1A9_uc002vva.2_RNA|UGT1A1_uc010znc.1_Missense_Mutation_p.I322V|UGT1A1_uc002vvb.2_Missense_Mutation_p.I322V	NM_019078	NP_061951	P35504	UD15_HUMAN	UDP glycosyltransferase 1 family, polypeptide A5	323					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		AGCTATGGCAATTGCTGATGC	0.418													30	119	---	---	---	---	PASS
NUP210	23225	broad.mit.edu	37	3	13381467	13381467	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13381467C>A	uc003bxv.1	-	25	3441	c.3358G>T	c.(3358-3360)GCG>TCG	p.A1120S		NM_024923	NP_079199	Q8TEM1	PO210_HUMAN	nucleoporin 210 precursor	1120	Lumenal (Probable).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore				ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11	all_neural(104;0.187)					CTCACCAGCGCAACGCTCTCA	0.612													72	116	---	---	---	---	PASS
KLHL18	23276	broad.mit.edu	37	3	47371567	47371567	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47371567C>T	uc003crd.2	+	4	654	c.528C>T	c.(526-528)TTC>TTT	p.F176F	KLHL18_uc003crc.2_Silent_p.F176F|KLHL18_uc011bav.1_Silent_p.F64F|KLHL18_uc010hjq.1_Silent_p.F27F	NM_025010	NP_079286	O94889	KLH18_HUMAN	kelch-like 18	176	BACK.										0		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		CAGAAGAGTTCCTGGCCCTGC	0.542													19	53	---	---	---	---	PASS
FEZF2	55079	broad.mit.edu	37	3	62357265	62357265	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62357265G>A	uc003dlh.2	-	2	1137	c.930C>T	c.(928-930)TGC>TGT	p.C310C	FEZF2_uc003dli.2_Silent_p.C310C	NM_018008	NP_060478	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	310	C2H2-type 2.				transcription, DNA-dependent	nucleus	zinc ion binding			lung(1)	1		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		AGCCTTTGCCGCAGACTTTGC	0.617													3	58	---	---	---	---	PASS
GCET2	257144	broad.mit.edu	37	3	111844071	111844071	+	Splice_Site	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111844071A>T	uc003dys.1	-	5	369	c.219_splice	c.e5+1	p.Q73_splice	C3orf52_uc011bht.1_Intron|C3orf52_uc003dyr.1_Intron|GCET2_uc003dyt.1_Splice_Site_p.Q7_splice	NM_152785	NP_689998	Q8N6F7	GCET2_HUMAN	germinal center expressed transcript 2 isoform							mitochondrion					0						TGTTCTTATTACCTGGATGGG	0.423													20	75	---	---	---	---	PASS
KIAA2018	205717	broad.mit.edu	37	3	113378936	113378936	+	Silent	SNP	T	C	C	rs34032790		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113378936T>C	uc003eam.2	-	7	2004	c.1593A>G	c.(1591-1593)CAA>CAG	p.Q531Q	KIAA2018_uc003eal.2_Silent_p.Q475Q	NM_001009899	NP_001009899	Q68DE3	K2018_HUMAN	hypothetical protein LOC205717	531					regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3						TCTGAATCACTTGCATTGCTG	0.448													28	108	---	---	---	---	PASS
KIAA1407	57577	broad.mit.edu	37	3	113721326	113721326	+	Nonsense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113721326T>A	uc003eax.2	-	12	2185	c.2038A>T	c.(2038-2040)AAA>TAA	p.K680*	KIAA1407_uc011bin.1_RNA	NM_020817	NP_065868	Q8NCU4	K1407_HUMAN	hypothetical protein LOC57577	680	Potential.									ovary(2)	2						TCTTGTTTTTTCTTCTTCTCT	0.323													9	60	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121414584	121414584	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121414584C>T	uc003eei.3	-	13	4897	c.4771G>A	c.(4771-4773)GAA>AAA	p.E1591K	GOLGB1_uc010hrc.2_Missense_Mutation_p.E1596K|GOLGB1_uc003eej.3_Missense_Mutation_p.E1557K|GOLGB1_uc011bjm.1_Missense_Mutation_p.E1477K|GOLGB1_uc010hrd.1_Missense_Mutation_p.E1555K	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	1591	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		TTCAAAGATTCAATTTCCTTC	0.378													37	156	---	---	---	---	PASS
ABTB1	80325	broad.mit.edu	37	3	127396373	127396373	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127396373C>T	uc003ejt.2	+	9	916	c.828C>T	c.(826-828)TTC>TTT	p.F276F	ABTB1_uc003ejr.2_Silent_p.F134F|ABTB1_uc003ejs.2_Silent_p.F251F|ABTB1_uc003eju.2_Silent_p.F134F|ABTB1_uc010hsm.2_Intron	NM_172027	NP_742024	Q969K4	ABTB1_HUMAN	ankyrin repeat and BTB (POZ) domain containing 1	276	BTB 2.					cytoplasm|nucleolus|plasma membrane	translation elongation factor activity				0						ACATCTGCTTCCGAGTGGCTG	0.632													32	111	---	---	---	---	PASS
COL29A1	256076	broad.mit.edu	37	3	130202885	130202885	+	Nonstop_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130202885A>T	uc010htj.1	+	40	8075	c.7581A>T	c.(7579-7581)TGA>TGT	p.*2527C	COL29A1_uc010hti.1_RNA|COL29A1_uc010htk.1_Missense_Mutation_p.E648V	NM_153264	NP_694996	A8TX70	CO6A5_HUMAN	collagen, type XXIX, alpha 1	2527	Nonhelical region.				axon guidance|cell adhesion	collagen					0						GCAGATGGTGAAGATACAAGG	0.353													10	26	---	---	---	---	PASS
PIK3R4	30849	broad.mit.edu	37	3	130452596	130452596	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130452596C>T	uc003enj.2	-	4	1827	c.1246G>A	c.(1246-1248)GAT>AAT	p.D416N		NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	416	HEAT 1.				fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						GTAATACGATCCAAAAGGATT	0.423													14	72	---	---	---	---	PASS
SLC9A9	285195	broad.mit.edu	37	3	143412060	143412060	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143412060C>A	uc003evn.2	-	5	805	c.623G>T	c.(622-624)GGT>GTT	p.G208V	SLC9A9_uc011bnk.1_Missense_Mutation_p.G82V	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen	208	Helical; (Potential).				regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						CATCAGTGAACCAAAAAATAA	0.338													8	45	---	---	---	---	PASS
SLC9A9	285195	broad.mit.edu	37	3	143412061	143412061	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143412061C>A	uc003evn.2	-	5	804	c.622G>T	c.(622-624)GGT>TGT	p.G208C	SLC9A9_uc011bnk.1_Missense_Mutation_p.G82C	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen	208	Helical; (Potential).				regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						ATCAGTGAACCAAAAAATAAA	0.338													8	45	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128279	147128279	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128279G>T	uc003ewe.2	+	1	1099	c.380G>T	c.(379-381)GGC>GTC	p.G127V		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	127					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						TCGGCCGGGGGCTTCGGGGGC	0.701													5	24	---	---	---	---	PASS
ECE2	9718	broad.mit.edu	37	3	184001719	184001719	+	Missense_Mutation	SNP	C	A	A	rs151261667		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184001719C>A	uc003fni.3	+	8	1355	c.1317C>A	c.(1315-1317)GAC>GAA	p.D439E	ECE2_uc011brh.1_Missense_Mutation_p.D292E|ECE2_uc003fnl.3_Missense_Mutation_p.D367E|ECE2_uc003fnm.3_Missense_Mutation_p.D321E|ECE2_uc003fnk.3_Missense_Mutation_p.D292E|ECE2_uc011bri.1_Missense_Mutation_p.D354E|ECE2_uc010hxv.2_Missense_Mutation_p.D83E	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A	439	Lumenal (Potential).|Endothelin-converting enzyme 2 region.				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AGCGGCGCGACGAGGAGAAGA	0.637													6	46	---	---	---	---	PASS
GAK	2580	broad.mit.edu	37	4	853458	853458	+	Silent	SNP	G	A	A	rs138681664	by1000genomes	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:853458G>A	uc003gbm.3	-	24	3418	c.3219C>T	c.(3217-3219)AGC>AGT	p.S1073S	GAK_uc003gbn.3_Silent_p.S994S|GAK_uc010ibi.2_Silent_p.S254S|GAK_uc010ibj.2_RNA|GAK_uc003gbl.3_Silent_p.S926S	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase	1073					cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		ACTTGGTCCAGCTGGCCTGAG	0.607													16	84	---	---	---	---	PASS
PTTG2	10744	broad.mit.edu	37	4	37962456	37962456	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37962456G>A	uc011bye.1	+	1	401	c.401G>A	c.(400-402)CGC>CAC	p.R134H	TBC1D1_uc003gtb.2_Intron|TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron	NM_006607	NP_006598	Q9NZH5	PTTG2_HUMAN	pituitary tumor-transforming 2	134					chromosome organization|DNA metabolic process	cytoplasm|nucleus	SH3 domain binding				0						CCTGAAGAGCGCCAGATTGCA	0.488													23	131	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47602230	47602230	+	Splice_Site	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47602230C>G	uc003gxm.2	-	21	3039	c.2946_splice	c.e21+1	p.M982_splice	CORIN_uc011bzf.1_Splice_Site_p.M843_splice|CORIN_uc011bzg.1_Splice_Site_p.M915_splice	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin						peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						AAGCAACTTACCATGCATGAA	0.398													11	81	---	---	---	---	PASS
AASDH	132949	broad.mit.edu	37	4	57204949	57204949	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57204949C>G	uc003hbn.2	-	15	3069	c.2916G>C	c.(2914-2916)CAG>CAC	p.Q972H	AASDH_uc010ihb.2_Missense_Mutation_p.Q487H|AASDH_uc011caa.1_Missense_Mutation_p.V765L|AASDH_uc003hbo.2_Missense_Mutation_p.Q872H|AASDH_uc011cab.1_Missense_Mutation_p.Q487H|AASDH_uc010ihc.2_Missense_Mutation_p.V833L	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	972					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TGGTAGAGAACTGCCAAACCT	0.343													10	40	---	---	---	---	PASS
ENAM	10117	broad.mit.edu	37	4	71510196	71510196	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71510196A>T	uc011caw.1	+	9	3334	c.3053A>T	c.(3052-3054)CAG>CTG	p.Q1018L		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	1018					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			ACTCCTGAGCAGCTTGTTATT	0.428													14	73	---	---	---	---	PASS
PPEF2	5470	broad.mit.edu	37	4	76793293	76793293	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76793293A>T	uc003hix.2	-	13	1891	c.1534T>A	c.(1534-1536)TAC>AAC	p.Y512N	PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Missense_Mutation_p.Y512N	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	512	Catalytic.				detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			ACTTCATAGTAGTTGGAGGCA	0.473													16	38	---	---	---	---	PASS
LIN54	132660	broad.mit.edu	37	4	83857199	83857199	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83857199G>A	uc003hnx.3	-	11	2158	c.1780C>T	c.(1780-1782)CGT>TGT	p.R594C	LIN54_uc003hnz.3_Missense_Mutation_p.R373C|LIN54_uc003hny.3_Missense_Mutation_p.R193C|LIN54_uc010ijt.2_Missense_Mutation_p.R505C|LIN54_uc010iju.2_Missense_Mutation_p.R193C|LIN54_uc010ijv.2_Missense_Mutation_p.R373C	NM_194282	NP_919258	Q6MZP7	LIN54_HUMAN	lin-54 homolog isoform a	594	CXC 2.				cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Hepatocellular(203;0.114)				TTGCTATGACGTCGATCAGAT	0.403													30	123	---	---	---	---	PASS
UNC5C	8633	broad.mit.edu	37	4	96140439	96140439	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96140439G>T	uc003htp.1	-	9	1480	c.1326C>A	c.(1324-1326)CTC>CTA	p.L442L	UNC5C_uc010ilc.1_Silent_p.L461L|UNC5C_uc003htq.2_Silent_p.L461L	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor	442	Cytoplasmic (Potential).				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CAGCTGACGTGAGGTCTGGGG	0.507													47	189	---	---	---	---	PASS
NDST4	64579	broad.mit.edu	37	4	115749016	115749016	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115749016G>T	uc003ibu.2	-	14	3254	c.2575C>A	c.(2575-2577)CCT>ACT	p.P859T	NDST4_uc010imw.2_RNA	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	859	Lumenal (Potential).|Heparan sulfate N-sulfotransferase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GATGGCAGAGGCTGTCCCAGT	0.403													16	59	---	---	---	---	PASS
NDST4	64579	broad.mit.edu	37	4	115997560	115997560	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115997560C>G	uc003ibu.2	-	2	1312	c.633G>C	c.(631-633)GAG>GAC	p.E211D	NDST4_uc010imw.2_Intron	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	211	Lumenal (Potential).|Heparan sulfate N-deacetylase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GAGGGCCTTTCTCAACCTTGG	0.408													7	72	---	---	---	---	PASS
PRSS12	8492	broad.mit.edu	37	4	119203396	119203396	+	Nonsense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119203396G>A	uc003ica.1	-	13	2370	c.2323C>T	c.(2323-2325)CGA>TGA	p.R775*		NM_003619	NP_003610	P56730	NETR_HUMAN	neurotrypsin precursor	775	Peptidase S1.					membrane	scavenger receptor activity			skin(1)	1						GAATAGGCTCGTCCTACTCAG	0.393													17	75	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126239746	126239746	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126239746G>A	uc003ifj.3	+	1	2180	c.2180G>A	c.(2179-2181)AGC>AAC	p.S727N		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	727	Cadherin 7.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						GTCAAATATAGCATATCTGCT	0.463													10	49	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155218992	155218992	+	Intron	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155218992G>A	uc003inw.2	-							NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AAAACTTGAAGGGACACTCAC	0.388													7	47	---	---	---	---	PASS
GLRB	2743	broad.mit.edu	37	4	158057978	158057978	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158057978C>A	uc003ipj.2	+	6	752	c.550C>A	c.(550-552)CCT>ACT	p.P184T		NM_000824	NP_000815	P48167	GLRB_HUMAN	glycine receptor, beta isoform A precursor	184	Extracellular (Probable).				nervous system development|neuropeptide signaling pathway|startle response	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|protein binding|receptor activity			skin(2)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Glycine(DB00145)	TCTTTCATGCCCTTTGGACTT	0.333													16	53	---	---	---	---	PASS
TKTL2	84076	broad.mit.edu	37	4	164393795	164393795	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164393795T>C	uc003iqp.3	-	1	1253	c.1092A>G	c.(1090-1092)ATA>ATG	p.I364M		NM_032136	NP_115512	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	364						cytoplasm	metal ion binding|transketolase activity			ovary(2)|skin(2)|pancreas(1)	5	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TAATACACTCTATGAAACGCT	0.373													20	86	---	---	---	---	PASS
TRIM60	166655	broad.mit.edu	37	4	165962132	165962132	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165962132C>A	uc003iqy.1	+	3	1078	c.908C>A	c.(907-909)ACA>AAA	p.T303K	TRIM60_uc010iqx.1_Missense_Mutation_p.T303K	NM_152620	NP_689833	Q495X7	TRI60_HUMAN	ring finger protein 129	303	B30.2/SPRY.					intracellular	zinc ion binding			skin(1)	1	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		GATCTCAACACAGCACATCCT	0.363													15	143	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177032734	177032734	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177032734G>A	uc003iuj.2	+	3	231	c.75G>A	c.(73-75)ATG>ATA	p.M25I	WDR17_uc003iuk.2_Missense_Mutation_p.M1I|WDR17_uc003ium.3_Missense_Mutation_p.M1I|WDR17_uc003iul.1_Missense_Mutation_p.M1I	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	25										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		AGGCAAACATGTCCCAGGTAA	0.438													9	81	---	---	---	---	PASS
TUBB4Q	56604	broad.mit.edu	37	4	190905411	190905411	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190905411G>T	uc011clg.1	-	3	276	c.273C>A	c.(271-273)TCC>TCA	p.S91S		NM_020040	NP_064424	Q99867	TBB4Q_HUMAN	tubulin, beta polypeptide 4, member Q	92					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;4.1e-31)|Epithelial(3;1.44e-30)|OV - Ovarian serous cystadenocarcinoma(60;2.03e-15)|BRCA - Breast invasive adenocarcinoma(30;8.54e-06)|Lung(3;3.23e-05)|STAD - Stomach adenocarcinoma(60;8.24e-05)|LUSC - Lung squamous cell carcinoma(40;0.000184)|GBM - Glioblastoma multiforme(59;0.00839)|READ - Rectum adenocarcinoma(43;0.155)		GCAGCTCACGGGAAATGAAGT	0.652													10	76	---	---	---	---	PASS
KIAA0947	23379	broad.mit.edu	37	5	5464670	5464670	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5464670G>T	uc003jdm.3	+	13	5445	c.5223G>T	c.(5221-5223)GTG>GTT	p.V1741V		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1741										ovary(1)|central_nervous_system(1)	2						ACGCTGCTGTGGGAGGGCCTC	0.582													8	35	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11732237	11732237	+	Intron	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11732237A>G	uc003jfa.1	-						CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						CAAAAATGGGAATGTTTCTAC	0.408													62	113	---	---	---	---	PASS
MARCH11	441061	broad.mit.edu	37	5	16090997	16090997	+	Splice_Site	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16090997C>A	uc003jfo.2	-	3	1099	c.886_splice	c.e3+1	p.G296_splice	MARCH11_uc010itw.1_Intron	NM_001102562	NP_001096032	A6NNE9	MARHB_HUMAN	membrane-associated ring finger (C3HC4) 11							cytoplasmic vesicle membrane|integral to membrane	ligase activity|zinc ion binding				0						CATGGTCTTACCTATGCACAC	0.428													18	55	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24535392	24535392	+	Intron	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24535392G>A	uc003jgr.1	-						CDH10_uc011cnu.1_Intron	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		ATGATACCTTGAGAAAATATA	0.368										HNSCC(23;0.051)			14	92	---	---	---	---	PASS
AGXT2	64902	broad.mit.edu	37	5	35047982	35047982	+	Nonsense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35047982T>A	uc003jjf.2	-	1	95	c.16A>T	c.(16-18)AGA>TGA	p.R6*	AGXT2_uc011com.1_Nonsense_Mutation_p.R6*|AGXT2_uc011con.1_5'UTR	NM_031900	NP_114106	Q9BYV1	AGT2_HUMAN	alanine-glyoxylate aminotransferase 2 precursor	6					glyoxylate metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity|alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(3)|skin(1)	4	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)	AGCAAATGTCTCCAGATTAGA	0.537													8	48	---	---	---	---	PASS
FYB	2533	broad.mit.edu	37	5	39202365	39202365	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39202365G>T	uc003jls.2	-	1	765	c.698C>A	c.(697-699)TCC>TAC	p.S233Y	FYB_uc003jlt.2_Missense_Mutation_p.S233Y|FYB_uc003jlu.2_Missense_Mutation_p.S233Y|FYB_uc011cpl.1_Missense_Mutation_p.S243Y	NM_199335	NP_955367	O15117	FYB_HUMAN	FYN binding protein (FYB-120/130) isoform 2	233					cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding			ovary(2)	2	all_lung(31;0.000343)		Epithelial(62;0.235)			GCCGCTTTTGGACCTGACTCC	0.502													40	198	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40950040	40950040	+	Silent	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40950040C>G	uc003jmh.2	+	9	1131	c.1017C>G	c.(1015-1017)TCC>TCG	p.S339S	C7_uc011cpn.1_RNA	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	339	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				AATGTAAATCCTCAGGTTGGC	0.353													11	31	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41032884	41032884	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41032884G>T	uc003jmj.3	-	24	2891	c.2401C>A	c.(2401-2403)CCT>ACT	p.P801T	HEATR7B2_uc003jmi.3_Missense_Mutation_p.P356T	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	801	HEAT 9.						binding			ovary(6)|central_nervous_system(2)	8						CACCGAATAGGGCTAGCTAAG	0.398													13	39	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262787	45262787	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262787C>A	uc003jok.2	-	8	1934	c.1909G>T	c.(1909-1911)GCT>TCT	p.A637S		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	637	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						TTGATGGGAGCGATTGCCTGC	0.483													8	122	---	---	---	---	PASS
RAD17	5884	broad.mit.edu	37	5	68692239	68692239	+	Missense_Mutation	SNP	A	T	T	rs148563193		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68692239A>T	uc003jwo.2	+	13	1533	c.1471A>T	c.(1471-1473)AGG>TGG	p.R491W	RAD17_uc003jwg.2_Missense_Mutation_p.R480W|RAD17_uc003jwh.2_Missense_Mutation_p.R480W|RAD17_uc003jwi.2_Missense_Mutation_p.R480W|RAD17_uc003jwj.2_Missense_Mutation_p.R480W|RAD17_uc003jwk.2_Missense_Mutation_p.R480W|RAD17_uc003jwl.2_Missense_Mutation_p.R480W|RAD17_uc003jwm.2_Missense_Mutation_p.R315W|RAD17_uc003jwn.2_Missense_Mutation_p.R394W|RAD17_uc003jwp.2_Missense_Mutation_p.R51W	NM_133339	NP_579917	O75943	RAD17_HUMAN	RAD17 homolog isoform 2	491	Interaction with MCM7.				cell cycle|DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint|mitotic cell cycle checkpoint|negative regulation of DNA replication|regulation of phosphorylation	nucleoplasm	ATP binding|nucleoside-triphosphatase activity|protein binding				0		Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		CTCTTTACTCAGGGAATATAG	0.388								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					5	26	---	---	---	---	PASS
RASA1	5921	broad.mit.edu	37	5	86672713	86672713	+	Nonsense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86672713G>T	uc003kiw.2	+	17	2318	c.2200G>T	c.(2200-2202)GAA>TAA	p.E734*	RASA1_uc010jav.2_RNA|RASA1_uc003kix.2_Nonsense_Mutation_p.E557*|RASA1_uc011ctv.1_Nonsense_Mutation_p.E567*|RASA1_uc011ctw.1_Nonsense_Mutation_p.E568*|RASA1_uc010jaw.2_Nonsense_Mutation_p.E556*	NM_002890	NP_002881	P20936	RASA1_HUMAN	RAS p21 protein activator 1 isoform 1	734					cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding			upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		ACTGCAAAAGGAACTTCATGT	0.358													18	48	---	---	---	---	PASS
P4HA2	8974	broad.mit.edu	37	5	131530683	131530683	+	Silent	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131530683C>G	uc003kwh.2	-	14	2037	c.1473G>C	c.(1471-1473)CGG>CGC	p.R491R	P4HA2_uc003kwg.2_Silent_p.R489R|P4HA2_uc003kwi.2_Silent_p.R489R|P4HA2_uc003kwk.2_Silent_p.R489R|P4HA2_uc003kwl.2_Silent_p.R491R|P4HA2_uc003kwj.2_Silent_p.R489R	NM_004199	NP_004190	O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha II subunit isoform 1	491	Fe2OG dioxygenase.					endoplasmic reticulum lumen	electron carrier activity|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity|protein binding				0		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	CTTCCCCGCTCCGCAAGAGGT	0.542													19	54	---	---	---	---	PASS
PCDHB4	56131	broad.mit.edu	37	5	140502062	140502062	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140502062T>A	uc003lip.1	+	1	482	c.482T>A	c.(481-483)GTG>GAG	p.V161E		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	161	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GATTTGGATGTGGGCAGCAAT	0.423													18	34	---	---	---	---	PASS
PCDHB12	56124	broad.mit.edu	37	5	140588483	140588483	+	Nonsense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140588483G>T	uc003liz.2	+	1	193	c.4G>T	c.(4-6)GAA>TAA	p.E2*	PCDHB12_uc011dak.1_5'UTR	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	2					homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGAAGCTATGGAAAACGGAGG	0.488													23	71	---	---	---	---	PASS
PCDHGB3	56102	broad.mit.edu	37	5	140752099	140752099	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140752099T>C	uc003ljw.1	+	1	2138	c.2138T>C	c.(2137-2139)CTG>CCG	p.L713P	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGA6_uc003ljy.1_5'Flank|PCDHGB3_uc011dat.1_Missense_Mutation_p.L713P|PCDHGA6_uc011dau.1_5'Flank	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3 isoform 1	713	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAATCTCCCTGCGCCTGCGA	0.582													11	43	---	---	---	---	PASS
PCDHGA11	56105	broad.mit.edu	37	5	140802039	140802039	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140802039G>T	uc003lkq.1	+	1	1503	c.1245G>T	c.(1243-1245)TTG>TTT	p.L415F	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Missense_Mutation_p.L415F|PCDHGA11_uc003lkp.1_Missense_Mutation_p.L415F	NM_018914	NP_061737	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11 isoform 1	415	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGGGAGTTGGTCCAGAGCT	0.428													36	79	---	---	---	---	PASS
SGCD	6444	broad.mit.edu	37	5	155771565	155771565	+	Missense_Mutation	SNP	A	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155771565A>C	uc003lwd.3	+	2	543	c.67A>C	c.(67-69)AAG>CAG	p.K23Q	SGCD_uc003lwa.1_Missense_Mutation_p.K24Q|SGCD_uc003lwb.2_Missense_Mutation_p.K24Q|SGCD_uc003lwc.3_Missense_Mutation_p.K24Q	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3	23	Cytoplasmic (Potential).				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACAGGTATACAAGGTGGGGAT	0.502													19	59	---	---	---	---	PASS
RREB1	6239	broad.mit.edu	37	6	7229882	7229882	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7229882C>T	uc003mxc.2	+	10	1940	c.1550C>T	c.(1549-1551)ACG>ATG	p.T517M	RREB1_uc003mxb.2_Missense_Mutation_p.T517M|RREB1_uc010jnx.2_Missense_Mutation_p.T517M	NM_001003698	NP_001003698	Q92766	RREB1_HUMAN	ras responsive element binding protein 1 isoform	517	Pro-rich.				multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				ACACCACGGACGGTGGTGGCC	0.677													36	121	---	---	---	---	PASS
DSP	1832	broad.mit.edu	37	6	7583007	7583007	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7583007C>T	uc003mxp.1	+	24	5791	c.5512C>T	c.(5512-5514)CGT>TGT	p.R1838C	DSP_uc003mxq.1_Missense_Mutation_p.R1239C	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1838	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TGAGCTGAATCGTGCAAAATC	0.483													29	134	---	---	---	---	PASS
SNRNP48	154007	broad.mit.edu	37	6	7609057	7609057	+	Splice_Site	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7609057G>T	uc003mxr.2	+	9	1031	c.972_splice	c.e9-1	p.R324_splice	SNRNP48_uc003mxs.2_Splice_Site	NM_152551	NP_689764	Q6IEG0	SNR48_HUMAN	U11/U12 snRNP 48K						mRNA processing	cytoplasm|U12-type spliceosomal complex	metal ion binding				0						TTTTATTTCAGGGATGGGGAA	0.279													8	35	---	---	---	---	PASS
PHACTR1	221692	broad.mit.edu	37	6	12933987	12933987	+	Intron	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12933987A>G	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron|PHACTR1_uc003nai.2_Missense_Mutation_p.T125A	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			GACAGCCCCTACATACACTAC	0.547													11	50	---	---	---	---	PASS
HIST1H3J	8356	broad.mit.edu	37	6	27858534	27858534	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27858534C>A	uc003nka.2	-	1	37	c.37G>T	c.(37-39)GGC>TGC	p.G13C	HIST1H2BO_uc003nkc.1_5'Flank	NM_003535	NP_003526	P68431	H31_HUMAN	histone cluster 1, H3j	13					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1						GCCTTGCCGCCGGTAGACTTG	0.592													13	56	---	---	---	---	PASS
DHX16	8449	broad.mit.edu	37	6	30638192	30638192	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30638192C>A	uc003nqz.2	-	4	873	c.661G>T	c.(661-663)GCC>TCC	p.A221S	DHX16_uc011dmo.1_Missense_Mutation_p.A161S	NM_003587	NP_003578	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	221					mRNA processing|RNA splicing	nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity			ovary(2)|kidney(2)	4						CTCACCATGGCCTTCCGGTCT	0.517													5	21	---	---	---	---	PASS
DHX16	8449	broad.mit.edu	37	6	30638193	30638193	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30638193C>A	uc003nqz.2	-	4	872	c.660G>T	c.(658-660)AAG>AAT	p.K220N	DHX16_uc011dmo.1_Missense_Mutation_p.K160N	NM_003587	NP_003578	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	220					mRNA processing|RNA splicing	nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity			ovary(2)|kidney(2)	4						TCACCATGGCCTTCCGGTCTT	0.517													5	21	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32037618	32037618	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32037618C>T	uc003nzl.2	-	15	5501	c.5299G>A	c.(5299-5301)GAT>AAT	p.D1767N		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	1849					actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						GTTCCAGTATCATCCATAGCA	0.597													4	26	---	---	---	---	PASS
C6orf222	389384	broad.mit.edu	37	6	36294340	36294340	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36294340C>G	uc003oly.2	-	5	1161	c.983G>C	c.(982-984)AGC>ACC	p.S328T		NM_001010903	NP_001010903	P0C671	CF222_HUMAN	hypothetical protein LOC389384	328										skin(2)|ovary(1)|breast(1)	4						GGGCAGAAAGCTGGACTTCTT	0.597													5	130	---	---	---	---	PASS
RUNX2	860	broad.mit.edu	37	6	45514572	45514572	+	Nonsense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45514572G>T	uc011dvx.1	+	9	1306	c.1096G>T	c.(1096-1098)GAA>TAA	p.E366*	RUNX2_uc011dvy.1_Nonsense_Mutation_p.E344*|RUNX2_uc003oxt.2_Nonsense_Mutation_p.E352*	NM_001024630	NP_001019801	Q13950	RUNX2_HUMAN	runt-related transcription factor 2 isoform a	366	Interaction with MYST3 (By similarity).|Pro/Ser/Thr-rich.				negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3						AGGTGCTTCAGAACTGGGCCC	0.393													23	97	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57372301	57372301	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57372301C>A	uc003pdx.2	+	8	794	c.707C>A	c.(706-708)TCC>TAC	p.S236Y		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	236					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ACAGCCAGGTCCTTGCCTGCT	0.428													4	89	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57372302	57372302	+	Silent	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57372302C>A	uc003pdx.2	+	8	795	c.708C>A	c.(706-708)TCC>TCA	p.S236S		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	236					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CAGCCAGGTCCTTGCCTGCTG	0.423													4	90	---	---	---	---	PASS
KHDRBS2	202559	broad.mit.edu	37	6	62604622	62604622	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62604622G>A	uc003peg.2	-	6	975	c.728C>T	c.(727-729)CCT>CTT	p.P243L		NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal	243	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		TCGAGGGGTAGGGACACCTCT	0.577													15	56	---	---	---	---	PASS
B3GAT2	135152	broad.mit.edu	37	6	71603972	71603972	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71603972G>C	uc003pfv.2	-	2	1251	c.595C>G	c.(595-597)CGA>GGA	p.R199G	B3GAT2_uc011dxz.1_RNA|B3GAT2_uc003pfw.2_Missense_Mutation_p.R199G	NM_080742	NP_542780	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	199	Lumenal (Potential).				carbohydrate biosynthetic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						CGGGTGGTTCGCATCTATAAA	0.502													8	48	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90460227	90460227	+	Silent	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90460227T>A	uc003pnn.1	-	24	3368	c.3252A>T	c.(3250-3252)GGA>GGT	p.G1084G		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	1084	ATP (Potential).				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CTGATGTCTCTCCCTGAATCA	0.418													55	278	---	---	---	---	PASS
GJA10	84694	broad.mit.edu	37	6	90604280	90604280	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90604280C>T	uc011eaa.1	+	1	93	c.93C>T	c.(91-93)ATC>ATT	p.I31I		NM_032602	NP_115991	Q969M2	CXA10_HUMAN	gap junction protein, alpha 10	31	Helical; (Potential).				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity				0		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		TCCTCTTCATCTTCCGAATGC	0.507													28	106	---	---	---	---	PASS
KIAA0776	23376	broad.mit.edu	37	6	97001374	97001374	+	Nonsense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97001374G>T	uc003por.2	+	19	2428	c.2380G>T	c.(2380-2382)GAG>TAG	p.E794*	KIAA0776_uc010kck.2_RNA	NM_015323	NP_056138	O94874	UFL1_HUMAN	hypothetical protein LOC23376	794					negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|protein ufmylation	endoplasmic reticulum|nucleus	protein binding|UFM1 conjugating enzyme activity			ovary(1)	1		all_cancers(76;5.83e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0604)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0934)		TGTGACGGAAGAGTAATGATC	0.378													7	34	---	---	---	---	PASS
POU3F2	5454	broad.mit.edu	37	6	99283761	99283761	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99283761T>A	uc003ppe.2	+	1	1182	c.1012T>A	c.(1012-1014)TCC>ACC	p.S338T		NM_005604	NP_005595	P20265	PO3F2_HUMAN	POU domain, class 3, transcription factor 2	338					positive regulation of cell proliferation		identical protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		GGCGGACTCGTCCTCGGGCAG	0.592													18	96	---	---	---	---	PASS
POPDC3	64208	broad.mit.edu	37	6	105609717	105609717	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105609717T>C	uc003prb.2	-	2	470	c.68A>G	c.(67-69)CAA>CGA	p.Q23R	uc003pqz.2_Intron|POPDC3_uc003pra.2_RNA	NM_022361	NP_071756	Q9HBV1	POPD3_HUMAN	popeye protein 3	23						integral to membrane				skin(3)|ovary(2)	5		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				TTCGGCCTCTTGCTTCCAGGT	0.428													25	71	---	---	---	---	PASS
AIM1	202	broad.mit.edu	37	6	106968998	106968998	+	Silent	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106968998C>G	uc003prh.2	+	2	3178	c.2691C>G	c.(2689-2691)CCC>CCG	p.P897P		NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	897							sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		ATCTTCTGCCCGACAACTCCT	0.463													31	121	---	---	---	---	PASS
HS3ST5	222537	broad.mit.edu	37	6	114383955	114383955	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114383955G>T	uc003pwg.3	-	1	87	c.55C>A	c.(55-57)CTT>ATT	p.L19I	uc003pwf.2_Intron|HS3ST5_uc003pwh.3_Missense_Mutation_p.L19I	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine)	19	Helical; Signal-anchor for type II membrane protein; (Potential).				heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		CCAACGGCAAGGCTTCCCAGC	0.532													36	100	---	---	---	---	PASS
KIAA1244	57221	broad.mit.edu	37	6	138657493	138657493	+	Missense_Mutation	SNP	T	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138657493T>G	uc003qhu.2	+	34	6404	c.6404T>G	c.(6403-6405)TTC>TGC	p.F2135C		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine	2135					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GACCAGACCTTCACGGCCCTC	0.542													40	147	---	---	---	---	PASS
AKAP12	9590	broad.mit.edu	37	6	151672155	151672155	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151672155G>A	uc011eep.1	+	4	2869	c.2629G>A	c.(2629-2631)GCC>ACC	p.A877T	AKAP12_uc003qoe.2_Missense_Mutation_p.A877T|AKAP12_uc003qof.2_Missense_Mutation_p.A779T|AKAP12_uc010kim.2_Intron|AKAP12_uc003qog.2_Missense_Mutation_p.A772T	NM_005100	NP_005091	Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12 isoform 1	877					G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding			large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		GCAGAAGGCAGCCACTGAGGT	0.562													17	99	---	---	---	---	PASS
SYNJ2	8871	broad.mit.edu	37	6	158495649	158495649	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158495649G>T	uc003qqx.1	+	16	2246	c.2171G>T	c.(2170-2172)TGT>TTT	p.C724F	SYNJ2_uc003qqw.1_Missense_Mutation_p.C724F|SYNJ2_uc003qqy.1_Missense_Mutation_p.C437F|SYNJ2_uc003qqz.1_Missense_Mutation_p.C341F|SYNJ2_uc003qra.1_Missense_Mutation_p.C67F	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2	724	Catalytic (By similarity).						nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		GTATTTTGGTGTGGCGATTTC	0.373													20	104	---	---	---	---	PASS
LPA	4018	broad.mit.edu	37	6	161027644	161027644	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161027644G>C	uc003qtl.2	-	18	2770	c.2650C>G	c.(2650-2652)CCT>GCT	p.P884A		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3392	Kringle 30.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TAACAATAAGGGGCTGCCACA	0.517													43	206	---	---	---	---	PASS
THBS2	7058	broad.mit.edu	37	6	169650859	169650859	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169650859C>T	uc003qwt.2	-	3	269	c.21G>A	c.(19-21)CTG>CTA	p.L7L		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	7					cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		ACAGAGCCAGCAGGACCAGCC	0.577													5	29	---	---	---	---	PASS
KIAA0415	9907	broad.mit.edu	37	7	4815354	4815354	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4815354C>A	uc003sne.2	+	1	91	c.8C>A	c.(7-9)TCG>TAG	p.S3*	KIAA0415_uc010ksp.2_RNA	NM_014855	NP_055670	O43299	K0415_HUMAN	hypothetical protein LOC9907	3					cell death|double-strand break repair via homologous recombination	cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.091)|OV - Ovarian serous cystadenocarcinoma(56;8.35e-15)		GTGATGTTCTCGGCAGGAGCG	0.697													8	25	---	---	---	---	PASS
RNF216	54476	broad.mit.edu	37	7	5780740	5780740	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5780740T>A	uc003soy.1	-	4	927	c.737A>T	c.(736-738)CAG>CTG	p.Q246L	RNF216_uc010ksz.1_5'UTR|RNF216_uc010kta.1_Intron|RNF216_uc011jwj.1_Intron|RNF216_uc003sox.1_Missense_Mutation_p.Q303L	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b	246					apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		ACTTGCTAACTGCTGGTCTTC	0.537													36	78	---	---	---	---	PASS
MIOS	54468	broad.mit.edu	37	7	7612493	7612493	+	Silent	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7612493A>T	uc003srf.2	+	4	695	c.387A>T	c.(385-387)CTA>CTT	p.L129L	MIOS_uc010ktp.1_Silent_p.L129L	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog	129	WD 2.										0						GTAACTGGCTAGCTGCTGGTT	0.388													32	92	---	---	---	---	PASS
EVX1	2128	broad.mit.edu	37	7	27283072	27283072	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27283072C>A	uc003szd.1	+	1	909	c.423C>A	c.(421-423)AGC>AGA	p.S141R	EVX1_uc011jzn.1_Intron|EVX1_uc010kuy.1_Intron	NM_001989	NP_001980	P49640	EVX1_HUMAN	even-skipped homeobox 1	141						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						ACCAGCACAGCAAAGGTAGCC	0.652													5	27	---	---	---	---	PASS
CRHR2	1395	broad.mit.edu	37	7	30695196	30695196	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30695196C>G	uc003tbn.2	-	10	1297	c.1053G>C	c.(1051-1053)CAG>CAC	p.Q351H	CRHR2_uc010kvw.1_Missense_Mutation_p.Q351H|CRHR2_uc010kvx.1_Missense_Mutation_p.Q350H|CRHR2_uc010kvy.1_Missense_Mutation_p.Q187H|CRHR2_uc003tbo.2_Missense_Mutation_p.Q337H|CRHR2_uc003tbp.2_Missense_Mutation_p.Q378H	NM_001883	NP_001874	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	351	Helical; Name=7; (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(2)|ovary(1)|skin(1)	4						CAGGCCCCACCTGGAACGACT	0.592													17	73	---	---	---	---	PASS
KBTBD2	25948	broad.mit.edu	37	7	32910500	32910500	+	Intron	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32910500G>C	uc003tdb.2	-						AVL9_uc011kai.1_Intron	NM_015483	NP_056298	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2												0			GBM - Glioblastoma multiforme(11;0.0499)			TACCTAGAATGAGAAGGAAAA	0.323													3	12	---	---	---	---	PASS
DPY19L1	23333	broad.mit.edu	37	7	34971194	34971194	+	Silent	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34971194T>A	uc003tem.3	-	22	2164	c.2019A>T	c.(2017-2019)GTA>GTT	p.V673V	DPY19L1_uc003tel.1_RNA	NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1	673						integral to membrane					0						GTCATTCTTTTACAACTTCTA	0.393													13	67	---	---	---	---	PASS
C7orf63	79846	broad.mit.edu	37	7	89915616	89915616	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89915616G>T	uc010lep.2	+	14	1810	c.1559G>T	c.(1558-1560)AGC>ATC	p.S520I	C7orf63_uc003ukf.2_RNA|C7orf63_uc003ukg.2_Missense_Mutation_p.S195I|C7orf63_uc011khj.1_Missense_Mutation_p.S502I|C7orf63_uc011khk.1_Missense_Mutation_p.S82I	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1	520							binding			ovary(1)	1						AATATAATAAGCAAGCCTAAT	0.308													13	66	---	---	---	---	PASS
DYNC1I1	1780	broad.mit.edu	37	7	95614265	95614265	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95614265G>T	uc003uoc.3	+	8	1047	c.770G>T	c.(769-771)GGC>GTC	p.G257V	DYNC1I1_uc003uod.3_Missense_Mutation_p.G240V|DYNC1I1_uc003uob.2_Missense_Mutation_p.G220V|DYNC1I1_uc003uoe.3_Missense_Mutation_p.G237V|DYNC1I1_uc010lfl.2_Missense_Mutation_p.G246V	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	257					vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			GACTACAGCGGCCGAGAGTTA	0.373													23	112	---	---	---	---	PASS
LMTK2	22853	broad.mit.edu	37	7	97823030	97823030	+	Missense_Mutation	SNP	A	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97823030A>C	uc003upd.1	+	11	3546	c.3253A>C	c.(3253-3255)ACA>CCA	p.T1085P		NM_014916	NP_055731	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2 precursor	1085					early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					TCACAGAGGCACAGAAGTGAC	0.592													8	20	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100549930	100549930	+	5'Flank	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100549930A>T	uc003uxk.1	+						uc003uxl.1_5'Flank					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		GACCACCGTCACCAGTACTTA	0.547													8	33	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100551511	100551511	+	RNA	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100551511A>T	uc003uxk.1	+	1		c.762A>T			uc003uxl.1_5'UTR					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		CATCCAAAGTACAGAAACCTC	0.463													8	212	---	---	---	---	PASS
PMPCB	9512	broad.mit.edu	37	7	102940667	102940667	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102940667G>A	uc003vbl.2	+	4	404	c.370G>A	c.(370-372)GAA>AAA	p.E124K	PMPCB_uc010liu.1_Missense_Mutation_p.E124K|PMPCB_uc003vbk.1_Missense_Mutation_p.E124K|PMPCB_uc003vbm.2_Missense_Mutation_p.E33K|PMPCB_uc010liv.2_Missense_Mutation_p.E30K|PMPCB_uc010liw.2_Missense_Mutation_p.E33K|PMPCB_uc011kll.1_Missense_Mutation_p.E19K|PMPCB_uc011klm.1_5'UTR	NM_004279	NP_004270	O75439	MPPB_HUMAN	mitochondrial processing peptidase beta subunit	124					proteolysis	mitochondrial matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)	4						ACTTGAGATTGAAAATATGGG	0.378													9	115	---	---	---	---	PASS
ARF5	381	broad.mit.edu	37	7	127231325	127231325	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127231325G>T	uc003vmb.1	+	6	551	c.515G>T	c.(514-516)TGG>TTG	p.W172L	FSCN3_uc003vmc.1_5'Flank|FSCN3_uc011kog.1_5'Flank|FSCN3_uc011koh.1_5'Flank|FSCN3_uc003vmd.1_5'Flank|FSCN3_uc010llc.1_5'Flank	NM_001662	NP_001653	P84085	ARF5_HUMAN	ADP-ribosylation factor 5	172					protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	Golgi apparatus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)	1						GGTCTGGACTGGCTGTCCCAC	0.607													7	29	---	---	---	---	PASS
ZC3HC1	51530	broad.mit.edu	37	7	129666074	129666074	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129666074T>A	uc003vpi.2	-	6	727	c.700A>T	c.(700-702)ACT>TCT	p.T234S	ZC3HC1_uc003vph.2_Missense_Mutation_p.T121S|ZC3HC1_uc010lma.2_Missense_Mutation_p.T121S	NM_016478	NP_057562	Q86WB0	NIPA_HUMAN	zinc finger, C3HC type 1	234					cell division|mitosis	nucleus	protein kinase binding|zinc ion binding				0	Melanoma(18;0.0435)					TTGATTGTAGTTTTTCTCTCA	0.453													16	85	---	---	---	---	PASS
AKR1D1	6718	broad.mit.edu	37	7	137792252	137792252	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137792252C>T	uc003vtz.2	+	7	850	c.781C>T	c.(781-783)CGT>TGT	p.R261C	AKR1D1_uc011kqe.1_Missense_Mutation_p.R261C|AKR1D1_uc011kqf.1_Missense_Mutation_p.R220C|AKR1D1_uc010lmy.1_RNA	NM_005989	NP_005980	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1	261			R -> C (in CBAS2).		androgen metabolic process|bile acid biosynthetic process|bile acid catabolic process|C21-steroid hormone metabolic process|cholesterol catabolic process|digestion	cytosol	aldo-keto reductase (NADP) activity|delta4-3-oxosteroid 5beta-reductase activity|steroid binding			skin(1)	1						AATTGTTTTGCGTTTCAACAT	0.373													24	99	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142494098	142494098	+	Intron	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142494098G>A	uc003vzp.2	+						uc011ksh.1_Intron|uc011ksi.1_RNA|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc003wan.1_Intron|uc003wbe.3_RNA|uc003wbf.3_RNA|uc003wbg.3_5'Flank|uc003wbh.3_5'Flank|uc003wbi.3_5'Flank|uc003wbj.3_5'Flank|uc003wbm.3_5'Flank|uc003wbn.3_5'Flank|uc010los.2_5'Flank					SubName: Full=V_segment translation product; Flags: Fragment;																		CACCGTGCTAGGTAAGAAGGG	0.597													3	11	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146829568	146829568	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146829568C>A	uc003weu.1	+	8	1831	c.1315C>A	c.(1315-1317)CAG>AAG	p.Q439K		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	439	Extracellular (Potential).|Laminin G-like 2.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CAACATCACACAGACCAAGAT	0.423										HNSCC(39;0.1)			12	57	---	---	---	---	PASS
ZNF467	168544	broad.mit.edu	37	7	149462587	149462587	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149462587G>T	uc003wgd.2	-	5	1145	c.1004C>A	c.(1003-1005)TCC>TAC	p.S335Y	ZNF467_uc003wgc.2_Intron	NM_207336	NP_997219	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	335					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGAGAAGCGGACGAGTCGGG	0.662													6	10	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149486292	149486292	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149486292G>T	uc010lpk.2	+	30	4268	c.4268G>T	c.(4267-4269)TGC>TTC	p.C1423F		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	1423	LDL-receptor class A 2.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CAGATGACTTGCAGCTCCGGC	0.662													7	34	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149488961	149488961	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149488961G>A	uc010lpk.2	+	36	5302	c.5302G>A	c.(5302-5304)GGC>AGC	p.G1768S		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	1768	TSP type-1 2.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCGTGCAGGGGCACCATGAC	0.677													3	14	---	---	---	---	PASS
GALNTL5	168391	broad.mit.edu	37	7	151704947	151704947	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151704947G>C	uc003wkp.2	+	7	1167	c.944G>C	c.(943-945)CGT>CCT	p.R315P	GALNTL5_uc003wkq.2_Missense_Mutation_p.R66P|GALNTL5_uc003wkr.2_RNA|GALNTL5_uc003wks.2_RNA|GALNTL5_uc010lqf.2_Missense_Mutation_p.R204P	NM_145292	NP_660335	Q7Z4T8	GLTL5_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	315	Catalytic subdomain B.|Lumenal (Potential).					Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		TTTGCTATACGTCGGCATTAT	0.338													24	116	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154172066	154172066	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154172066A>G	uc003wlk.2	+	3	530	c.401A>G	c.(400-402)GAA>GGA	p.E134G	DPP6_uc003wli.2_Missense_Mutation_p.E70G|DPP6_uc003wlj.2_Missense_Mutation_p.E134G|DPP6_uc010lqh.1_Missense_Mutation_p.E72G|DPP6_uc003wlm.2_Missense_Mutation_p.E72G|DPP6_uc011kvq.1_Missense_Mutation_p.E72G	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	134	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GTCACTGTAGAAGATCTCTTC	0.408													19	76	---	---	---	---	PASS
NCAPG2	54892	broad.mit.edu	37	7	158464239	158464239	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158464239C>A	uc003wnv.1	-	13	1591	c.1446G>T	c.(1444-1446)ATG>ATT	p.M482I	NCAPG2_uc010lqu.1_Missense_Mutation_p.M274I|NCAPG2_uc003wnw.1_RNA|NCAPG2_uc003wnx.1_Missense_Mutation_p.M482I|NCAPG2_uc011kwe.1_Missense_Mutation_p.M482I	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5	482	HEAT.				cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		TCTTCAACAGCATGTCCACAA	0.438													50	206	---	---	---	---	PASS
MYOM2	9172	broad.mit.edu	37	8	2040265	2040265	+	Missense_Mutation	SNP	C	A	A	rs149434055		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2040265C>A	uc003wpx.3	+	16	2058	c.1920C>A	c.(1918-1920)GAC>GAA	p.D640E	MYOM2_uc011kwi.1_Missense_Mutation_p.D65E	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	640	Fibronectin type-III 3.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		ATGAGGAGGACCTGCTGGGCT	0.602													9	123	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3063109	3063109	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3063109C>A	uc011kwk.1	-	31	5294	c.4904G>T	c.(4903-4905)GGG>GTG	p.G1635V	CSMD1_uc011kwj.1_Missense_Mutation_p.G1027V|CSMD1_uc003wqe.2_Missense_Mutation_p.G791V	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1635	Extracellular (Potential).|CUB 10.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TAAAACTACCCCTTCTGATCC	0.453													4	18	---	---	---	---	PASS
KIF13B	23303	broad.mit.edu	37	8	28998134	28998134	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28998134C>A	uc003xhh.3	-	20	2394	c.2335G>T	c.(2335-2337)GTA>TTA	p.V779L	uc003xhi.1_RNA	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	779					microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		GATCGTATTACCTGTAAAGAG	0.373													16	39	---	---	---	---	PASS
KIF13B	23303	broad.mit.edu	37	8	28998135	28998135	+	Splice_Site	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28998135C>A	uc003xhh.3	-	20	2394	c.2335_splice	c.e20-1	p.V779_splice	uc003xhi.1_RNA	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B						microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		ATCGTATTACCTGTAAAGAGA	0.373													16	39	---	---	---	---	PASS
GPR124	25960	broad.mit.edu	37	8	37697084	37697084	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37697084T>C	uc003xkj.2	+	16	2818	c.2455T>C	c.(2455-2457)TCT>CCT	p.S819P	GPR124_uc010lvy.2_Missense_Mutation_p.S602P	NM_032777	NP_116166	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124 precursor	819	Helical; Name=2; (Potential).				central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(2)|ovary(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			AGCCATGACCTCTGCTGTCTT	0.582													19	119	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77690543	77690543	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77690543C>A	uc003yav.2	+	4	3502	c.3115C>A	c.(3115-3117)CAT>AAT	p.H1039N	ZFHX4_uc003yau.1_Missense_Mutation_p.H1065N|ZFHX4_uc003yaw.1_Missense_Mutation_p.H1039N	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1039	C2H2-type 7.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCTGGTACAACATGTCCGTTC	0.532										HNSCC(33;0.089)			39	178	---	---	---	---	PASS
LRRCC1	85444	broad.mit.edu	37	8	86044135	86044135	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86044135A>G	uc003ycw.2	+	12	2061	c.1907A>G	c.(1906-1908)TAT>TGT	p.Y636C	LRRCC1_uc010lzz.1_RNA|LRRCC1_uc010maa.1_Missense_Mutation_p.Y337C|LRRCC1_uc003ycx.2_Missense_Mutation_p.Y543C|LRRCC1_uc003ycy.2_Missense_Mutation_p.Y616C	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a	636	Potential.				cell division|mitosis	centriole|nucleus					0						AGCCAGCAGTATATGGATTTA	0.348													14	63	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89128749	89128749	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89128749A>G	uc003yeb.3	-	6	1352	c.1070T>C	c.(1069-1071)ATG>ACG	p.M357T	MMP16_uc003yec.2_Missense_Mutation_p.M357T	NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1	357	Extracellular (Potential).|Hemopexin-like 1.				collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						GAAAACAAACATCTCACGACG	0.418													10	39	---	---	---	---	PASS
SLC26A7	115111	broad.mit.edu	37	8	92378879	92378879	+	Nonsense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92378879T>A	uc003yex.2	+	15	1838	c.1560T>A	c.(1558-1560)TAT>TAA	p.Y520*	SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Nonsense_Mutation_p.Y520*|SLC26A7_uc003yfa.2_Nonsense_Mutation_p.Y520*	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a	520	STAS.|Cytoplasmic (Potential).					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			AAAAATTTTATACTGATTTAA	0.353													34	119	---	---	---	---	PASS
FBXO43	286151	broad.mit.edu	37	8	101149792	101149792	+	Splice_Site	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101149792C>A	uc003yjd.2	-	3	2387	c.1674_splice	c.e3+1	p.E558_splice	FBXO43_uc003yje.2_Splice_Site_p.E524_splice|FBXO43_uc010mbp.1_Missense_Mutation_p.V559L	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b						meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			ACATACATTACCTCAGAATCT	0.308													10	61	---	---	---	---	PASS
LRP12	29967	broad.mit.edu	37	8	105509436	105509436	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105509436G>A	uc003yma.2	-	5	1439	c.1344C>T	c.(1342-1344)TGC>TGT	p.C448C	LRP12_uc003ymb.2_Silent_p.C429C|LRP12_uc003ylz.2_5'Flank	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	low density lipoprotein-related protein 12	448	Extracellular (Potential).|LDL-receptor class A 4.				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GGCAAAAAAAGCAGTTTTTTT	0.418													25	97	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110463361	110463361	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110463361C>T	uc003yne.2	+	41	6437	c.6333C>T	c.(6331-6333)GTC>GTT	p.V2111V		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2111	IPT/TIG 14.|Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GACTGACAGTCGTGGGATCAG	0.517										HNSCC(38;0.096)	OREG0018931	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	22	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113649184	113649184	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113649184G>T	uc003ynu.2	-	22	3736	c.3577C>A	c.(3577-3579)CGA>AGA	p.R1193R	CSMD3_uc003yns.2_Silent_p.R465R|CSMD3_uc003ynt.2_Silent_p.R1153R|CSMD3_uc011lhx.1_Silent_p.R1089R	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1193	Sushi 6.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AACCCGATTCGACTACCATAT	0.453										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			20	80	---	---	---	---	PASS
FER1L6	654463	broad.mit.edu	37	8	125072499	125072499	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125072499A>G	uc003yqw.2	+	23	3159	c.2953A>G	c.(2953-2955)ATT>GTT	p.I985V	uc003yqy.1_RNA	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	985	Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TCCTGCCAACATTCGGCCGGT	0.582													51	96	---	---	---	---	PASS
FAM84B	157638	broad.mit.edu	37	8	127569404	127569404	+	Silent	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127569404C>G	uc003yrz.1	-	2	515	c.231G>C	c.(229-231)CGG>CGC	p.R77R		NM_174911	NP_777571	Q96KN1	FA84B_HUMAN	family with sequence similarity 84, member B	77						cytoplasm|plasma membrane	protein binding				0	Ovarian(5;9.43e-05)|Esophageal squamous(12;0.0012)|Hepatocellular(40;0.128)|Myeloproliferative disorder(2;0.135)		STAD - Stomach adenocarcinoma(47;0.000556)|Colorectal(2;0.0102)|Lung(2;0.0136)|READ - Rectum adenocarcinoma(2;0.0723)			CCTCGTGCAGCCGCGGATCGT	0.716													3	22	---	---	---	---	PASS
ST3GAL1	6482	broad.mit.edu	37	8	134478271	134478271	+	Silent	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134478271C>A	uc003yuk.2	-	6	1198	c.369G>T	c.(367-369)GTG>GTT	p.V123V	ST3GAL1_uc003yum.2_Silent_p.V123V	NM_173344	NP_775479	Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	123	Lumenal (Potential).				protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			TCCCAGGCACCACTCTGAACA	0.587													31	94	---	---	---	---	PASS
FLJ43860	389690	broad.mit.edu	37	8	142476592	142476592	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142476592G>A	uc003ywi.2	-	19	2475	c.2394C>T	c.(2392-2394)ACC>ACT	p.T798T	FLJ43860_uc011ljs.1_RNA|FLJ43860_uc010meu.1_RNA	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	hypothetical protein LOC389690	798							binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			TGGCGTGCAGGGTCTTTTCCT	0.642													13	37	---	---	---	---	PASS
GML	2765	broad.mit.edu	37	8	143927970	143927970	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143927970G>T	uc003yxg.2	+	4	431	c.341G>T	c.(340-342)GGA>GTA	p.G114V		NM_002066	NP_002057	Q99445	GML_HUMAN	glycosylphosphatidylinositol anchored molecule	114	UPAR/Ly6.				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|negative regulation of cell proliferation	anchored to membrane|extrinsic to membrane|plasma membrane				central_nervous_system(2)	2	all_cancers(97;4.26e-11)|all_epithelial(106;1.85e-08)|Lung NSC(106;0.000274)|all_lung(105;0.000755)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					AATGCAGGAGGACCTACTAAT	0.453													26	97	---	---	---	---	PASS
SMARCA2	6595	broad.mit.edu	37	9	2029188	2029188	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2029188C>T	uc003zhc.2	+	2	265	c.166C>T	c.(166-168)CCT>TCT	p.P56S	SMARCA2_uc003zhd.2_Missense_Mutation_p.P56S|SMARCA2_uc010mha.2_Missense_Mutation_p.P47S	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated	56					chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		TGTCTCCCATCCTATGCCGAC	0.537													4	28	---	---	---	---	PASS
PTPRD	5789	broad.mit.edu	37	9	8319963	8319963	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8319963C>T	uc003zkk.2	-	44	6249	c.5538G>A	c.(5536-5538)GCG>GCA	p.A1846A	PTPRD_uc003zkp.2_Silent_p.A1440A|PTPRD_uc003zkq.2_Silent_p.A1439A|PTPRD_uc003zkr.2_Silent_p.A1430A|PTPRD_uc003zks.2_Silent_p.A1439A|PTPRD_uc003zkl.2_Silent_p.A1837A|PTPRD_uc003zkm.2_Silent_p.A1833A|PTPRD_uc003zkn.2_Silent_p.A1435A|PTPRD_uc003zko.2_Silent_p.A1436A	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1846	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTCCAACGCCCGCGCTGCCAC	0.443										TSP Lung(15;0.13)			14	36	---	---	---	---	PASS
ADAMTSL1	92949	broad.mit.edu	37	9	18906818	18906818	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18906818C>T	uc003zne.3	+	28	5217	c.5090C>T	c.(5089-5091)GCC>GTC	p.A1697V	ADAMTSL1_uc003znf.3_Missense_Mutation_p.A398V|ADAMTSL1_uc003zng.1_Missense_Mutation_p.A88V	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	1697	TSP type-1 9.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		TGTGTGCATGCCCGCACCAAC	0.617													18	61	---	---	---	---	PASS
KIAA1797	54914	broad.mit.edu	37	9	20981694	20981694	+	Intron	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20981694C>G	uc003zog.1	+						KIAA1797_uc003zoh.1_Intron	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		GGGTGAGGAACAAAAATATTT	0.443													16	30	---	---	---	---	PASS
TESK1	7016	broad.mit.edu	37	9	35608383	35608383	+	Intron	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35608383A>T	uc003zxa.2	+						TESK1_uc003zwz.1_Intron|TESK1_uc010mks.2_Intron	NM_006285	NP_006276	Q15569	TESK1_HUMAN	testis-specific protein kinase 1						cell junction assembly|spermatogenesis	cytosol	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|breast(2)|lung(1)|ovary(1)|skin(1)	7			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TCCTGTCTCTACCCATCAGCT	0.607													10	27	---	---	---	---	PASS
GDA	9615	broad.mit.edu	37	9	74838034	74838034	+	Splice_Site	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74838034A>T	uc004aiq.2	+	7	790	c.607_splice	c.e7-2	p.Y203_splice	GDA_uc011lse.1_Splice_Site_p.Y129_splice|GDA_uc011lsf.1_Splice_Site_p.Y129_splice|GDA_uc004air.2_Splice_Site_p.Y203_splice|GDA_uc010mow.1_Splice_Site|GDA_uc004ais.2_Intron|GDA_uc004ait.1_Splice_Site_p.Y129_splice	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN	guanine deaminase						nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		AATTATCTCCAGTATTCTAGA	0.259													39	101	---	---	---	---	PASS
CTSL1	1514	broad.mit.edu	37	9	90344506	90344506	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90344506A>T	uc004aph.2	+	6	990	c.640A>T	c.(640-642)AAT>TAT	p.N214Y	CTSL1_uc004api.2_Missense_Mutation_p.N214Y|CTSL1_uc004apj.2_Missense_Mutation_p.N159Y|CTSL1_uc010mqh.2_Missense_Mutation_p.N32Y|CTSL1_uc004apk.2_Missense_Mutation_p.N214Y|CTSL1_uc004apl.2_Missense_Mutation_p.N214Y	NM_001912	NP_001903	P07711	CATL1_HUMAN	cathepsin L1 preproprotein	214					macrophage apoptosis|proteolysis	extracellular region|lysosome|nucleus	cysteine-type endopeptidase activity|histone binding			ovary(3)	3					Glucagon recombinant(DB00040)	CTGTAAGTACAATCCCAAGTA	0.458													33	67	---	---	---	---	PASS
HEMGN	55363	broad.mit.edu	37	9	100692661	100692661	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100692661G>T	uc004axy.2	-	3	1124	c.1016C>A	c.(1015-1017)TCT>TAT	p.S339Y	HEMGN_uc004axz.2_Missense_Mutation_p.S339Y	NM_197978	NP_932095	Q9BXL5	HEMGN_HUMAN	hemogen	339					cell differentiation|multicellular organismal development					ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				TGTTTTATGAGAGGGGGCTTT	0.363													60	162	---	---	---	---	PASS
GABBR2	9568	broad.mit.edu	37	9	101125063	101125063	+	Silent	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101125063C>G	uc004ays.2	-	13	1983	c.1827G>C	c.(1825-1827)CTG>CTC	p.L609L		NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor	609	Helical; Name=4; (Potential).				negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	TCAGGATACACAGGTCGATCA	0.592													10	32	---	---	---	---	PASS
TLR4	7099	broad.mit.edu	37	9	120470891	120470891	+	Silent	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120470891C>A	uc004bjz.2	+	2	435	c.144C>A	c.(142-144)ATC>ATA	p.I48I	TLR4_uc004bka.2_Silent_p.I8I|TLR4_uc004bkb.2_Intron	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	48	Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						TCTACAAAATCCCCGACAACC	0.443													33	101	---	---	---	---	PASS
LCN6	158062	broad.mit.edu	37	9	139642928	139642928	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139642928C>T	uc004ciy.2	-	1	53	c.8G>A	c.(7-9)GGC>GAC	p.G3D	LCN10_uc004ciw.2_RNA|uc004ciz.1_RNA	NM_198946	NP_945184	P62502	LCN6_HUMAN	lipocalin 6 precursor	3					single fertilization	extracellular region	binding				0	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.32e-06)|Epithelial(140;7.83e-05)		CAGCAGCAGGCCGCCCATCCT	0.637													9	15	---	---	---	---	PASS
KIAA1984	84960	broad.mit.edu	37	9	139693672	139693672	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139693672G>C	uc004cjf.2	+	2	237	c.189G>C	c.(187-189)AAG>AAC	p.K63N		NM_001039374	NP_001034463	Q5T5S1	K1984_HUMAN	hypothetical protein LOC84960	63										ovary(1)	1	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		CTTTGGCCAAGAAGGTACACA	0.652													21	30	---	---	---	---	PASS
GTPBP4	23560	broad.mit.edu	37	10	1041879	1041879	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1041879C>T	uc001ift.2	+	3	301	c.230C>T	c.(229-231)CCG>CTG	p.P77L	GTPBP4_uc010qac.1_Intron|GTPBP4_uc001ifu.2_RNA|GTPBP4_uc010qad.1_Intron|GTPBP4_uc010qae.1_Missense_Mutation_p.P30L	NM_012341	NP_036473	Q9BZE4	NOG1_HUMAN	G protein-binding protein CRFG	77					negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of DNA replication|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		GATATTCATCCGTTCTATGCT	0.313													12	35	---	---	---	---	PASS
FAM23A	653567	broad.mit.edu	37	10	18087655	18087655	+	3'UTR	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18087655G>T	uc009xjy.2	+	5					FAM23A_uc010qci.1_3'UTR	NM_001098844	NP_001092314	Q5W0B7	TM236_HUMAN	hypothetical protein LOC653567							integral to membrane					0						ACTCACAGTTGTTAAAAGCTT	0.254													13	35	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37430821	37430821	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37430821G>A	uc001iza.1	+	7	927	c.828G>A	c.(826-828)GTG>GTA	p.V276V		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	332						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						CATCCTTGGTGGAGGGAACAT	0.468													23	52	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37431050	37431050	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37431050G>C	uc001iza.1	+	7	1156	c.1057G>C	c.(1057-1059)GCA>CCA	p.A353P		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	409						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						ATTTACGTGGGCAGCAAAAGG	0.408													3	137	---	---	---	---	PASS
ERCC6	2074	broad.mit.edu	37	10	50741019	50741019	+	5'UTR	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50741019G>A	uc001jhs.3	-	2					PGBD3_uc009xoe.2_5'UTR|PGBD3_uc001jhu.2_5'UTR	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent						base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						ATTCTCTACAGACTACCTAAA	0.338								Direct_reversal_of_damage|NER					16	30	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50870818	50870818	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50870818C>A	uc001jhz.2	+	14	2120	c.1967C>A	c.(1966-1968)TCC>TAC	p.S656Y	CHAT_uc001jhv.1_Missense_Mutation_p.S538Y|CHAT_uc001jhx.1_Missense_Mutation_p.S538Y|CHAT_uc001jhy.1_Missense_Mutation_p.S538Y|CHAT_uc001jia.2_Missense_Mutation_p.S538Y|CHAT_uc010qgs.1_Missense_Mutation_p.S538Y	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	656					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	TTTGTCCTCTCCACTAGCCAG	0.478													41	79	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87373316	87373316	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87373316C>A	uc001kdl.1	-	15	2550	c.2449G>T	c.(2449-2451)GCC>TCC	p.A817S	GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Missense_Mutation_p.A388S	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	817	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	TGGGCGCTGGCATGGCTGGTG	0.642										Multiple Myeloma(13;0.14)			29	72	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89717716	89717716	+	Missense_Mutation	SNP	A	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89717716A>C	uc001kfb.2	+	8	1772	c.741A>C	c.(739-741)TTA>TTC	p.L247F		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	247	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.P248fs*5(11)|p.R55fs*1(4)|p.L247*(3)|p.L247fs*10(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.L247fs*11(1)|p.L247fs*12(1)|p.G165_*404del(1)|p.L247fs*6(1)|p.L247fs*4(1)|p.?(1)|p.L247fs*5(1)|p.G165_K342del(1)|p.L247fs*8(1)|p.P246_L247insGP(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CTCAGCCGTTACCTGTGTGTG	0.403		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			5	49	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89717718	89717718	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89717718C>A	uc001kfb.2	+	8	1774	c.743C>A	c.(742-744)CCT>CAT	p.P248H		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	248	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.P248fs*5(13)|p.P248?(4)|p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.L247fs*4(1)|p.G165_K342del(1)|p.P248fs*4(1)|p.V249fs*4(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CAGCCGTTACCTGTGTGTGGT	0.408		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			6	51	---	---	---	---	PASS
CC2D2B	387707	broad.mit.edu	37	10	97776077	97776077	+	Intron	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97776077T>A	uc001kll.2	+						uc001klg.1_Intron|uc001klj.1_Intron|CC2D2B_uc001klk.2_Intron|CC2D2B_uc010qop.1_Intron	NM_001001732	NP_001001732	Q6DHV5	C2D2B_HUMAN	coiled-coil and C2 domain containing 2B isoform											ovary(1)	1		Colorectal(252;0.158)		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)		TAGAAGTAAGTGCTGGAGTTC	0.393													18	43	---	---	---	---	PASS
CNNM1	26507	broad.mit.edu	37	10	101089820	101089820	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101089820G>T	uc001kpp.3	+	1	965	c.676G>T	c.(676-678)GCG>TCG	p.A226S	CNNM1_uc009xwe.2_Missense_Mutation_p.A226S|CNNM1_uc010qpi.1_Missense_Mutation_p.A226S|CNNM1_uc009xwf.2_Missense_Mutation_p.A226S	NM_020348	NP_065081	Q9NRU3	CNNM1_HUMAN	cyclin M1	226	DUF21.|Helical; (Potential).				ion transport	integral to membrane|plasma membrane					0		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		GTGGCTGCGGGCGCTCGGGGC	0.746													4	0	---	---	---	---	PASS
SEC23IP	11196	broad.mit.edu	37	10	121691695	121691695	+	Missense_Mutation	SNP	A	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121691695A>C	uc001leu.1	+	16	2695	c.2623A>C	c.(2623-2625)ATT>CTT	p.I875L	SEC23IP_uc010qtc.1_Missense_Mutation_p.I664L|SEC23IP_uc009xzk.1_RNA	NM_007190	NP_009121	Q9Y6Y8	S23IP_HUMAN	Sec23-interacting protein p125	875	DDHD.				Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding			ovary(3)	3		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		GCAGGGTTTTATTAGCTCTCT	0.403													39	55	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1261412	1261412	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1261412C>A	uc009ycr.1	+	46	5982	c.5856C>A	c.(5854-5856)TGC>TGA	p.C1952*	MUC5B_uc001ltb.2_Nonsense_Mutation_p.C1262*|MUC5B_uc001lta.2_Nonsense_Mutation_p.C927*	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	1259	Cys-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCCCAGCCTGCACCTGCACCT	0.647													3	21	---	---	---	---	PASS
OSBPL5	114879	broad.mit.edu	37	11	3125526	3125526	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3125526C>A	uc001lxk.2	-	10	1299	c.1141G>T	c.(1141-1143)GGC>TGC	p.G381C	OSBPL5_uc010qxq.1_Missense_Mutation_p.G292C|OSBPL5_uc009ydw.2_Missense_Mutation_p.G313C|OSBPL5_uc001lxl.2_Missense_Mutation_p.G313C|OSBPL5_uc009ydx.2_Missense_Mutation_p.G405C	NM_020896	NP_065947	Q9H0X9	OSBL5_HUMAN	oxysterol-binding protein-like protein 5 isoform	381					cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		AGGTCCATGCCTGGCCGTAGC	0.612													8	47	---	---	---	---	PASS
OR51L1	119682	broad.mit.edu	37	11	5020628	5020628	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5020628C>G	uc010qyu.1	+	1	416	c.416C>G	c.(415-417)ACC>AGC	p.T139S		NM_001004755	NP_001004755	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L,	139	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACCATCCTCACCAACAGTGTA	0.488													39	166	---	---	---	---	PASS
HBD	3045	broad.mit.edu	37	11	5255560	5255560	+	Intron	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5255560C>T	uc001maf.1	-							NM_000519	NP_000510	P02042	HBD_HUMAN	delta globin						blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCTTATAACCTTGATACCAA	0.527													7	62	---	---	---	---	PASS
TRIM6-TRIM34	445372	broad.mit.edu	37	11	5663637	5663637	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5663637A>G	uc001mbf.2	+	12	2081	c.1837A>G	c.(1837-1839)AGT>GGT	p.S613G	HBG2_uc001mak.1_Intron|TRIM34_uc001mbh.2_Missense_Mutation_p.S259G|TRIM34_uc009yeq.2_Missense_Mutation_p.S14G|TRIM34_uc001mbi.2_Missense_Mutation_p.S259G|TRIM78P_uc009yer.2_5'Flank	NM_001003819	NP_001003819	B2RNG4	B2RNG4_HUMAN	tripartite motif-containing 6 and tripartite	613						intracellular	zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;1.01e-08)|BRCA - Breast invasive adenocarcinoma(625;0.145)		CATCCCTAGGAGTGAGATCTG	0.443													10	71	---	---	---	---	PASS
OR52E8	390079	broad.mit.edu	37	11	5878630	5878630	+	Silent	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5878630T>A	uc010qzr.1	-	1	303	c.303A>T	c.(301-303)GGA>GGT	p.G101G	TRIM5_uc001mbq.1_Intron	NM_001005168	NP_001005168	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E,	101	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAAGGCAGCCTCCAAAAGATA	0.468													37	187	---	---	---	---	PASS
OR52B2	255725	broad.mit.edu	37	11	6191058	6191058	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6191058G>T	uc010qzy.1	-	1	499	c.499C>A	c.(499-501)CGG>AGG	p.R167R		NM_001004052	NP_001004052	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B,	167	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAGGGCAGCCGCTTCAGCAAG	0.488													8	43	---	---	---	---	PASS
SYT9	143425	broad.mit.edu	37	11	7334699	7334699	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7334699C>A	uc001mfe.2	+	3	808	c.571C>A	c.(571-573)CAG>AAG	p.Q191K	SYT9_uc001mfd.2_RNA|SYT9_uc009yfi.2_Intron	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN	synaptotagmin IX	191	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		AAAACAGGAACAGTTGACTGG	0.413													10	50	---	---	---	---	PASS
USP47	55031	broad.mit.edu	37	11	11964541	11964541	+	Missense_Mutation	SNP	A	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11964541A>C	uc001mjq.1	+	21	3796	c.3033A>C	c.(3031-3033)GAA>GAC	p.E1011D	USP47_uc001mjr.2_Missense_Mutation_p.E923D|USP47_uc001mjs.2_Missense_Mutation_p.E991D|USP47_uc001mjt.1_Missense_Mutation_p.E297D	NM_017944	NP_060414	Q96K76	UBP47_HUMAN	ubiquitin specific protease 47	1011					base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding			ovary(1)|skin(1)	2				Epithelial(150;0.000339)		CAGCAGAAGAAGACTCTGGAA	0.408													22	67	---	---	---	---	PASS
SOX6	55553	broad.mit.edu	37	11	16007843	16007843	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16007843G>A	uc001mme.2	-	15	2162	c.2129C>T	c.(2128-2130)ACC>ATC	p.T710I	SOX6_uc001mmd.2_Missense_Mutation_p.T673I|SOX6_uc001mmf.2_Missense_Mutation_p.T670I|SOX6_uc001mmg.2_Missense_Mutation_p.T677I	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	697					muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						AACAATGCAGGTGCGTTTCGG	0.468													23	229	---	---	---	---	PASS
MRGPRX4	117196	broad.mit.edu	37	11	18195179	18195179	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18195179T>A	uc001mnv.1	+	1	796	c.376T>A	c.(376-378)TGG>AGG	p.W126R		NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	126	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						GTCTGTTCTGTGGCCCATCTG	0.587													24	161	---	---	---	---	PASS
SLC1A2	6506	broad.mit.edu	37	11	35287091	35287091	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35287091T>A	uc001mwd.2	-	10	2228	c.1636A>T	c.(1636-1638)ATA>TTA	p.I546L	SLC1A2_uc001mwe.2_Missense_Mutation_p.I537L|SLC1A2_uc010rev.1_Missense_Mutation_p.I546L	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2	546					D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	TCATCTACTATGACAGAGTTG	0.358													27	128	---	---	---	---	PASS
SYT13	57586	broad.mit.edu	37	11	45265746	45265746	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45265746C>A	uc001myq.2	-	6	1264	c.1138G>T	c.(1138-1140)GGC>TGC	p.G380C	SYT13_uc009yku.1_Missense_Mutation_p.G236C	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	380	C2 2.|Cytoplasmic (Potential).					transport vesicle				ovary(1)	1						TCGTCCTGGCCCAGCACTTCC	0.602													11	35	---	---	---	---	PASS
ZNF408	79797	broad.mit.edu	37	11	46726892	46726892	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46726892G>C	uc001nde.1	+	5	1872	c.1642G>C	c.(1642-1644)GGG>CGG	p.G548R	ZNF408_uc010rgw.1_Missense_Mutation_p.G540R	NM_024741	NP_079017	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	548					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|identical protein binding|zinc ion binding				0						CTCACACACCGGGGAGGCCCA	0.672													5	30	---	---	---	---	PASS
MYBPC3	4607	broad.mit.edu	37	11	47365127	47365127	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47365127T>A	uc001nfa.3	-	13	1194	c.1139A>T	c.(1138-1140)AAG>ATG	p.K380M	MYBPC3_uc010rhl.1_5'Flank	NM_000256	NP_000247	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	380	Ig-like C2-type 2.				cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding			ovary(2)|central_nervous_system(1)	3				Lung(87;0.176)		CAGCCGGATCTTGTGGCCTTT	0.647													6	17	---	---	---	---	PASS
OR4X2	119764	broad.mit.edu	37	11	48267133	48267133	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48267133T>C	uc001ngs.1	+	1	478	c.478T>C	c.(478-480)TTC>CTC	p.F160L		NM_001004727	NP_001004727	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X,	160	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CCACCTGCTCTTCTGTGGCCC	0.483													32	262	---	---	---	---	PASS
OR4C12	283093	broad.mit.edu	37	11	50003572	50003572	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50003572T>C	uc010ria.1	-	1	466	c.466A>G	c.(466-468)ATT>GTT	p.I156V		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	156	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						AGAATCTGAATAGTTGCATGA	0.478													37	165	---	---	---	---	PASS
OR8H3	390152	broad.mit.edu	37	11	55890376	55890376	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55890376C>T	uc001nii.1	+	1	528	c.528C>T	c.(526-528)CAC>CAT	p.H176H		NM_001005201	NP_001005201	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H,	176	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00693)					TAATTCATCACTTTTTCTGTG	0.428													5	142	---	---	---	---	PASS
OR5M10	390167	broad.mit.edu	37	11	56344762	56344762	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56344762T>C	uc001niz.1	-	1	436	c.436A>G	c.(436-438)ACT>GCT	p.T146A		NM_001004741	NP_001004741	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M,	146	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TAAGGCACAGTGACCAGAGAG	0.443													26	87	---	---	---	---	PASS
OR5AP2	338675	broad.mit.edu	37	11	56409758	56409758	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56409758A>T	uc001njb.1	-	1	158	c.158T>A	c.(157-159)GTA>GAA	p.V53E		NM_001002925	NP_001002925	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP,	53	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						CTTAATCAATACAATCATCCC	0.428													15	51	---	---	---	---	PASS
OR5AR1	219493	broad.mit.edu	37	11	56431618	56431618	+	Missense_Mutation	SNP	C	A	A	rs77272836	byFrequency	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56431618C>A	uc010rjm.1	+	1	457	c.457C>A	c.(457-459)CTA>ATA	p.L153I		NM_001004730	NP_001004730	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR,	153	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CCTGGCTGGTCTAGTGAGTTT	0.502													33	153	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62298001	62298001	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62298001A>T	uc001ntl.2	-	5	4188	c.3888T>A	c.(3886-3888)GAT>GAA	p.D1296E	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	1296					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				CAAGGCTCACATCTGGGACTT	0.557													51	252	---	---	---	---	PASS
RBM14	10432	broad.mit.edu	37	11	66391822	66391822	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66391822G>C	uc001oit.2	+	2	614	c.475G>C	c.(475-477)GTC>CTC	p.V159L	RBM14_uc009yrh.2_Intron|RBM14_uc009yri.2_Intron|RBM4_uc009yrj.2_Intron|RBM4_uc009yrk.2_Intron	NM_006328	NP_006319	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	159					DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|histone deacetylation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus	mediator complex|ribonucleoprotein complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|protein binding, bridging|RNA binding|RNA polymerase II transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						TGGCCTGGCTGTCCAGTCTGG	0.592													7	58	---	---	---	---	PASS
NADSYN1	55191	broad.mit.edu	37	11	71208566	71208566	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71208566A>G	uc001oqn.2	+	19	1928	c.1802A>G	c.(1801-1803)TAT>TGT	p.Y601C	NADSYN1_uc001oqo.2_Missense_Mutation_p.Y341C|NADSYN1_uc001oqp.2_Missense_Mutation_p.Y230C	NM_018161	NP_060631	Q6IA69	NADE_HUMAN	NAD synthetase 1	601	Ligase (By similarity).				NAD biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds|NAD+ synthase (glutamine-hydrolyzing) activity|protein binding			ovary(2)	2					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	CTCTCGGTCTATGGGAAACTC	0.532													15	50	---	---	---	---	PASS
ACER3	55331	broad.mit.edu	37	11	76726167	76726167	+	Intron	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76726167A>T	uc009yum.1	+						ACER3_uc010rsg.1_3'UTR|ACER3_uc009yul.1_Intron|ACER3_uc001oxu.2_Intron|ACER3_uc009yun.1_Intron|ACER3_uc009yuo.1_Intron|ACER3_uc010rsh.1_Intron|ACER3_uc010rsi.1_Intron|ACER3_uc010rsj.1_Intron	NM_018367	NP_060837	Q9NUN7	ACER3_HUMAN	phytoceramidase, alkaline						ceramide metabolic process|phytosphingosine biosynthetic process|positive regulation of cell proliferation|sphingosine biosynthetic process	integral to endoplasmic reticulum membrane|integral to Golgi membrane	phytoceramidase activity				0						CTGAGGTAAGATATATTTTCA	0.279													7	43	---	---	---	---	PASS
FOLH1B	219595	broad.mit.edu	37	11	89431764	89431764	+	Silent	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89431764C>A	uc001pda.2	+	14	1852	c.1326C>A	c.(1324-1326)GCC>GCA	p.A442A		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	442					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						GTGAAGTAGCCTAAGAGGATT	0.398													10	76	---	---	---	---	PASS
GRIK4	2900	broad.mit.edu	37	11	120673443	120673443	+	Silent	SNP	C	A	A	rs139978243		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120673443C>A	uc001pxn.2	+	4	411	c.124C>A	c.(124-126)CGG>AGG	p.R42R	GRIK4_uc009zav.1_Silent_p.R42R|GRIK4_uc009zaw.1_Silent_p.R42R|GRIK4_uc009zax.1_Silent_p.R42R	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor	42	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	CAGAGGGGAGCGGCTCTCCAT	0.587											OREG0021427	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	70	---	---	---	---	PASS
GRIK4	2900	broad.mit.edu	37	11	120827614	120827614	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120827614C>G	uc001pxn.2	+	16	2113	c.1826C>G	c.(1825-1827)TCC>TGC	p.S609C	GRIK4_uc009zav.1_Missense_Mutation_p.S609C|GRIK4_uc009zaw.1_Missense_Mutation_p.S609C|GRIK4_uc009zax.1_Missense_Mutation_p.S609C	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor	609	Cytoplasmic (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	CAGCAAGGCTCCACCATCGCC	0.647													12	35	---	---	---	---	PASS
ROBO3	64221	broad.mit.edu	37	11	124740079	124740079	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124740079G>T	uc001qbc.2	+	5	977	c.785G>T	c.(784-786)CGC>CTC	p.R262L		NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3	262	Ig-like C2-type 3.|Extracellular (Potential).				axon midline choice point recognition	integral to membrane	receptor activity			breast(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		TCATTCCTGCGCAGACCAGTG	0.552													15	107	---	---	---	---	PASS
CCDC15	80071	broad.mit.edu	37	11	124857197	124857197	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124857197G>T	uc001qbm.3	+	8	1334	c.1075G>T	c.(1075-1077)GAT>TAT	p.D359Y		NM_025004	NP_079280	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	359						centrosome				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		TGTTAAGCCAGATACCCAGGC	0.473													22	130	---	---	---	---	PASS
ACAD8	27034	broad.mit.edu	37	11	134127012	134127012	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134127012G>A	uc001qhk.2	+	3	302	c.241G>A	c.(241-243)GCA>ACA	p.A81T	ACAD8_uc009zdc.2_Intron|ACAD8_uc010sco.1_Intron|ACAD8_uc010scp.1_Intron|ACAD8_uc010scq.1_Missense_Mutation_p.A4T|ACAD8_uc001qhl.2_Intron|ACAD8_uc010scr.1_Missense_Mutation_p.A43T|ACAD8_uc009zde.1_5'Flank	NM_014384	NP_055199	Q9UKU7	ACAD8_HUMAN	acyl-Coenzyme A dehydrogenase family, member 8	81					branched chain family amino acid catabolic process|lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding				0	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)		GATGCGGAAGGCAGCCCAGCT	0.532													14	83	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2676868	2676868	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2676868G>T	uc009zdu.1	+	13	2116	c.1803G>T	c.(1801-1803)CTG>CTT	p.L601L	CACNA1C_uc009zdv.1_Silent_p.L598L|CACNA1C_uc001qkb.2_Silent_p.L601L|CACNA1C_uc001qkc.2_Silent_p.L601L|CACNA1C_uc001qke.2_Silent_p.L601L|CACNA1C_uc001qkf.2_Silent_p.L601L|CACNA1C_uc001qjz.2_Silent_p.L601L|CACNA1C_uc001qkd.2_Silent_p.L601L|CACNA1C_uc001qkg.2_Silent_p.L601L|CACNA1C_uc009zdw.1_Silent_p.L601L|CACNA1C_uc001qkh.2_Silent_p.L601L|CACNA1C_uc001qkl.2_Silent_p.L601L|CACNA1C_uc001qkn.2_Silent_p.L601L|CACNA1C_uc001qko.2_Silent_p.L601L|CACNA1C_uc001qkp.2_Silent_p.L601L|CACNA1C_uc001qkr.2_Silent_p.L601L|CACNA1C_uc001qku.2_Silent_p.L601L|CACNA1C_uc001qkq.2_Silent_p.L601L|CACNA1C_uc001qks.2_Silent_p.L601L|CACNA1C_uc001qkt.2_Silent_p.L601L|CACNA1C_uc001qka.1_Silent_p.L136L|CACNA1C_uc001qki.1_Silent_p.L337L|CACNA1C_uc001qkj.1_Silent_p.L337L|CACNA1C_uc001qkk.1_Silent_p.L337L|CACNA1C_uc001qkm.1_Silent_p.L337L	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	601	Helical; Name=S3 of repeat II; (Potential).|II.				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	GCGGCATCCTGGAGACCATCC	0.582													5	27	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2800348	2800348	+	Missense_Mutation	SNP	T	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2800348T>G	uc009zdu.1	+	50	6962	c.6649T>G	c.(6649-6651)TAC>GAC	p.Y2217D	CACNA1C_uc009zdv.1_Missense_Mutation_p.Y2131D|CACNA1C_uc001qkb.2_Missense_Mutation_p.Y2134D|CACNA1C_uc001qkc.2_Missense_Mutation_p.Y2153D|CACNA1C_uc001qke.2_Missense_Mutation_p.Y2123D|CACNA1C_uc001qkf.2_Missense_Mutation_p.Y2142D|CACNA1C_uc001qjz.2_Missense_Mutation_p.Y2134D|CACNA1C_uc001qkd.2_Missense_Mutation_p.Y2153D|CACNA1C_uc001qkg.2_Missense_Mutation_p.Y2140D|CACNA1C_uc009zdw.1_Missense_Mutation_p.Y2175D|CACNA1C_uc001qkh.2_Missense_Mutation_p.Y2142D|CACNA1C_uc001qkl.2_Missense_Mutation_p.Y2182D|CACNA1C_uc001qkn.2_Missense_Mutation_p.Y2134D|CACNA1C_uc001qko.2_Missense_Mutation_p.Y2154D|CACNA1C_uc001qkp.2_Missense_Mutation_p.Y2134D|CACNA1C_uc001qkr.2_Missense_Mutation_p.Y2151D|CACNA1C_uc001qku.2_Missense_Mutation_p.Y2169D|CACNA1C_uc001qkq.2_Missense_Mutation_p.Y2162D|CACNA1C_uc001qks.2_Missense_Mutation_p.Y2134D|CACNA1C_uc001qkt.2_Missense_Mutation_p.Y2153D|CACNA1C_uc001qki.1_Missense_Mutation_p.Y1941D|CACNA1C_uc001qkj.1_Missense_Mutation_p.Y1905D|CACNA1C_uc001qkk.1_Missense_Mutation_p.Y1870D|CACNA1C_uc001qkm.1_Missense_Mutation_p.Y1930D|CACNA1C_uc010sea.1_Missense_Mutation_p.Y825D|uc001qkx.1_5'Flank|CACNA1C_uc001qky.1_Missense_Mutation_p.Y452D	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	2217	Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	CAGCAGGGTCTACGTCAGCAG	0.612													9	35	---	---	---	---	PASS
CD163L1	283316	broad.mit.edu	37	12	7528442	7528442	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7528442C>A	uc001qsy.2	-	10	2566	c.2540G>T	c.(2539-2541)GGA>GTA	p.G847V	CD163L1_uc010sge.1_Missense_Mutation_p.G857V	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	847	SRCR 8.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						AAAGTGATCTCCCACAGAAAG	0.463													30	104	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7633838	7633838	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7633838C>A	uc001qsz.3	-	15	3390	c.3262G>T	c.(3262-3264)GAG>TAG	p.E1088*	CD163_uc001qta.3_Nonsense_Mutation_p.E1088*|CD163_uc009zfw.2_Nonsense_Mutation_p.E1121*	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	1088	Cytoplasmic (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						ACTAAGTTCTCTCCTCTTGAG	0.428													26	115	---	---	---	---	PASS
KLRF1	51348	broad.mit.edu	37	12	9985926	9985926	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9985926A>G	uc010sgw.1	+	3	276	c.212A>G	c.(211-213)CAA>CGA	p.Q71R	KLRF1_uc009zgw.2_Intron|KLRF1_uc009zgx.2_RNA|KLRF1_uc001qwm.2_RNA|KLRF1_uc009zgy.2_Intron|KLRF1_uc009zgz.2_Missense_Mutation_p.Q71R|KLRF1_uc009zha.2_Intron	NM_016523	NP_057607	Q9NZS2	KLRF1_HUMAN	killer cell lectin-like receptor subfamily F,	71	Extracellular (Potential).				cell surface receptor linked signaling pathway	integral to plasma membrane	MHC class I receptor activity|sugar binding			large_intestine(1)	1						CTAAAATGCCAAAAAGGAAGT	0.358													10	36	---	---	---	---	PASS
KLRC1	3821	broad.mit.edu	37	12	10602569	10602569	+	Intron	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10602569A>T	uc001qyl.2	-						KLRC1_uc009zhm.1_Intron|KLRC1_uc001qym.2_Intron|KLRC1_uc001qyn.2_Intron|KLRC1_uc001qyo.2_Intron	NM_002259	NP_002250	P26715	NKG2A_HUMAN	killer cell lectin-like receptor subfamily C,						cell surface receptor linked signaling pathway|regulation of immune response	integral to plasma membrane	sugar binding|transmembrane receptor activity				0						TAATGTAGCTAGAAAAATTAA	0.204													3	20	---	---	---	---	PASS
PRH1	5554	broad.mit.edu	37	12	11034868	11034868	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11034868G>A	uc001qzc.2	-	8	1055	c.467C>T	c.(466-468)CCA>CTA	p.P156L	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_RNA|PRB4_uc001qzf.1_Intron	NM_006250	NP_006241	P02810	PRPC_HUMAN	proline-rich protein HaeIII subfamily 1	156						extracellular space	protein binding				0				BRCA - Breast invasive adenocarcinoma(232;0.245)		AGGTCCTTGTGGGCGGCCCCC	0.577													23	143	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13716470	13716470	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13716470C>T	uc001rbt.2	-	13	3881	c.3702G>A	c.(3700-3702)TCG>TCA	p.S1234S		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	1234	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	CCTGCCTGCCCGAGTTCTGAC	0.617													14	63	---	---	---	---	PASS
PDE3A	5139	broad.mit.edu	37	12	20806910	20806910	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20806910C>T	uc001reh.1	+	15	2977	c.2955C>T	c.(2953-2955)CCC>CCT	p.P985P		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	985	Catalytic (By similarity).				lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	TTGGATTACCCATAAGCCCCT	0.458													21	95	---	---	---	---	PASS
SLCO1B1	10599	broad.mit.edu	37	12	21392004	21392004	+	Nonsense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21392004G>T	uc001req.3	+	15	2061	c.1957G>T	c.(1957-1959)GAG>TAG	p.E653*		NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family,	653	Cytoplasmic (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)	AAAATATCAAGAGAAAGATAT	0.323													5	43	---	---	---	---	PASS
DDX11	1663	broad.mit.edu	37	12	31237922	31237922	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31237922G>C	uc001rjt.1	+	5	751	c.500G>C	c.(499-501)AGA>ACA	p.R167T	DDX11_uc010sjw.1_Missense_Mutation_p.R167T|DDX11_uc010sjx.1_RNA|DDX11_uc001rjr.1_Missense_Mutation_p.R167T|DDX11_uc001rjs.1_Missense_Mutation_p.R167T|DDX11_uc001rju.1_5'UTR|DDX11_uc001rjv.1_Missense_Mutation_p.R167T|DDX11_uc001rjw.1_Missense_Mutation_p.R141T|DDX11_uc001rjx.1_5'Flank	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11	167	Glu-rich.|Helicase ATP-binding.				G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GAAGAAGAAAGAGAGAATCTC	0.612										Multiple Myeloma(12;0.14)			3	16	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	33021918	33021918	+	Silent	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33021918A>G	uc001rlj.3	-	4	1228	c.1113T>C	c.(1111-1113)TCT>TCC	p.S371S	PKP2_uc001rlk.3_Silent_p.S371S|PKP2_uc010skj.1_Silent_p.S371S	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	371	ARM 1.				cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					TAGCTGCAGCAGAAATCCTGG	0.502													28	106	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40681156	40681156	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40681156T>C	uc001rmg.3	+	20	2625	c.2504T>C	c.(2503-2505)ATA>ACA	p.I835T	LRRK2_uc001rmh.1_Missense_Mutation_p.I457T	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	835					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTTTCAGATATAGCATCTACA	0.373													6	29	---	---	---	---	PASS
PDZRN4	29951	broad.mit.edu	37	12	41967358	41967358	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41967358C>G	uc010skn.1	+	10	2248	c.2180C>G	c.(2179-2181)ACC>AGC	p.T727S	PDZRN4_uc001rmq.3_Missense_Mutation_p.T668S|PDZRN4_uc009zjz.2_Missense_Mutation_p.T666S|PDZRN4_uc001rmr.2_Missense_Mutation_p.T553S	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2	926							ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				AGTGGCATGACCACAGACGAT	0.552													17	43	---	---	---	---	PASS
ARID2	196528	broad.mit.edu	37	12	46244007	46244007	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46244007A>T	uc001ros.1	+	15	2101	c.2101A>T	c.(2101-2103)ACT>TCT	p.T701S	ARID2_uc001ror.2_Missense_Mutation_p.T701S|ARID2_uc009zkg.1_Missense_Mutation_p.T157S|ARID2_uc009zkh.1_Missense_Mutation_p.T328S|ARID2_uc001rou.1_Missense_Mutation_p.T35S	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	701					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TGCTCCAGTGACTGTCATTCA	0.418													32	124	---	---	---	---	PASS
TROAP	10024	broad.mit.edu	37	12	49723709	49723709	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49723709C>A	uc001rtx.3	+	12	1401	c.1234C>A	c.(1234-1236)CCG>ACG	p.P412T	TROAP_uc009zlh.2_Missense_Mutation_p.P412T|TROAP_uc001rty.2_Missense_Mutation_p.P120T	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1	412					cell adhesion	cytoplasm				ovary(1)	1						TGGGAAACCACCGGTGGCCAC	0.537													28	119	---	---	---	---	PASS
HOXC10	3226	broad.mit.edu	37	12	54379715	54379715	+	Silent	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54379715A>G	uc001sen.2	+	1	770	c.672A>G	c.(670-672)AAA>AAG	p.K224K		NM_017409	NP_059105	Q9NYD6	HXC10_HUMAN	homeobox C10	224					positive regulation of cell proliferation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1						CGGGCCCTAAAGGGAGCCCCT	0.637													8	28	---	---	---	---	PASS
ERBB3	2065	broad.mit.edu	37	12	56489049	56489049	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56489049G>A	uc001sjh.2	+	16	2061	c.1868G>A	c.(1867-1869)GGA>GAA	p.G623E	ERBB3_uc009zoj.2_Intron|ERBB3_uc010sqb.1_5'UTR|ERBB3_uc010sqc.1_Missense_Mutation_p.G564E|ERBB3_uc009zok.2_Missense_Mutation_p.G65E|ERBB3_uc001sjk.2_5'Flank	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor	623	Extracellular (Potential).				cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			AGGTGTAAAGGACCAGAGCTT	0.448													18	81	---	---	---	---	PASS
MARS	4141	broad.mit.edu	37	12	57883198	57883198	+	Intron	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57883198G>T	uc001sog.2	+						ARHGAP9_uc001sod.2_5'Flank|ARHGAP9_uc001soe.1_5'Flank|MARS_uc001sof.1_Intron|MARS_uc010srp.1_Intron|MARS_uc010srq.1_Intron	NM_004990	NP_004981	P56192	SYMC_HUMAN	methionyl-tRNA synthetase						methionyl-tRNA aminoacylation	cytosol	ATP binding|methionine-tRNA ligase activity|protein binding|tRNA binding			ovary(3)|central_nervous_system(1)|pancreas(1)	5			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	CATGTCCCCTGCATTTTAGCC	0.547													22	107	---	---	---	---	PASS
MARS	4141	broad.mit.edu	37	12	57884426	57884426	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57884426G>A	uc001sog.2	+	7	792	c.769G>A	c.(769-771)GTG>ATG	p.V257M	ARHGAP9_uc001sod.2_5'Flank|ARHGAP9_uc001soe.1_5'Flank|MARS_uc001sof.1_RNA|MARS_uc010srp.1_Missense_Mutation_p.V130M|MARS_uc010srq.1_Missense_Mutation_p.V23M	NM_004990	NP_004981	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	257					methionyl-tRNA aminoacylation	cytosol	ATP binding|methionine-tRNA ligase activity|protein binding|tRNA binding			ovary(3)|central_nervous_system(1)|pancreas(1)	5			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	GCAGAATCCAGTGTGAGTAGA	0.532													17	71	---	---	---	---	PASS
SLC16A7	9194	broad.mit.edu	37	12	60168512	60168512	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60168512G>T	uc001sqs.2	+	5	735	c.436G>T	c.(436-438)GCA>TCA	p.A146S	SLC16A7_uc001sqt.2_Missense_Mutation_p.A146S|SLC16A7_uc001squ.2_Missense_Mutation_p.A146S|SLC16A7_uc009zqi.2_Missense_Mutation_p.A47S|SLC16A7_uc010ssi.1_Missense_Mutation_p.A47S	NM_004731	NP_004722	O60669	MOT2_HUMAN	solute carrier family 16, member 7	146	Cytoplasmic (Potential).					integral to plasma membrane|membrane fraction	pyruvate secondary active transmembrane transporter activity|secondary active monocarboxylate transmembrane transporter activity|symporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(3;0.0303)	Pyruvic acid(DB00119)	GCGACCCATGGCAAATGGATT	0.418													18	77	---	---	---	---	PASS
RAB3IP	117177	broad.mit.edu	37	12	70194074	70194074	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70194074A>T	uc001svp.2	+	7	1469	c.1022A>T	c.(1021-1023)TAC>TTC	p.Y341F	RAB3IP_uc001svm.2_Missense_Mutation_p.Y325F|RAB3IP_uc001svn.2_Missense_Mutation_p.Y325F|RAB3IP_uc001svo.2_Intron|RAB3IP_uc001svq.2_Missense_Mutation_p.Y341F|RAB3IP_uc001svr.2_RNA|RAB3IP_uc001svs.2_Intron|RAB3IP_uc001svt.2_Missense_Mutation_p.Y119F	NM_175623	NP_783322	Q96QF0	RAB3I_HUMAN	RAB3A interacting protein isoform alpha 2	341					cilium assembly|Golgi to plasma membrane transport|protein localization to organelle|protein transport	actin cortical patch|centrosome|cytosol|lamellipodium|microtubule basal body|nucleus	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)			GACAAAATCTACCAGGAAGAT	0.343													8	44	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78444913	78444913	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78444913T>A	uc001syp.2	+	11	2675	c.2502T>A	c.(2500-2502)GAT>GAA	p.D834E	NAV3_uc001syo.2_Missense_Mutation_p.D834E|NAV3_uc010sub.1_Missense_Mutation_p.D334E	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	834						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						TCAGGACTGATGACATCAACA	0.443										HNSCC(70;0.22)			27	111	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78582517	78582517	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78582517C>A	uc001syp.2	+	33	6188	c.6015C>A	c.(6013-6015)TAC>TAA	p.Y2005*	NAV3_uc001syo.2_Nonsense_Mutation_p.Y1983*|NAV3_uc010sub.1_Nonsense_Mutation_p.Y1462*|NAV3_uc009zsf.2_Nonsense_Mutation_p.Y814*	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	2005						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CTTGTGGATACCTTGTTGGAG	0.388										HNSCC(70;0.22)			19	103	---	---	---	---	PASS
VEZT	55591	broad.mit.edu	37	12	95668562	95668562	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95668562G>A	uc001tdz.2	+	7	998	c.893G>A	c.(892-894)TGT>TAT	p.C298Y	VEZT_uc009ztb.1_RNA|VEZT_uc009ztc.1_Translation_Start_Site|VEZT_uc001tdy.2_RNA	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane	298						acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						AACTACATCTGTGTGGTGCCT	0.423													38	146	---	---	---	---	PASS
CDK17	5128	broad.mit.edu	37	12	96728577	96728577	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96728577C>A	uc001tep.1	-	2	527	c.38G>T	c.(37-39)CGA>CTA	p.R13L	CDK17_uc009ztk.2_Missense_Mutation_p.R13L|CDK17_uc010svb.1_Intron	NM_002595	NP_002586	Q00537	CDK17_HUMAN	PCTAIRE protein kinase 2	13							ATP binding|cyclin-dependent protein kinase activity			ovary(3)|lung(2)|kidney(1)|central_nervous_system(1)	7						CTGACTTCCTCGGAGTGTGAG	0.353													7	35	---	---	---	---	PASS
NT5DC3	51559	broad.mit.edu	37	12	104171830	104171830	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104171830T>C	uc010swe.1	-	14	1465	c.1424A>G	c.(1423-1425)CAG>CGG	p.Q475R	NT5DC3_uc010swd.1_5'Flank	NM_001031701	NP_001026871	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	475							hydrolase activity|metal ion binding			ovary(2)|skin(1)	3						GCTTCCAAACTGGGCATTGAA	0.458													14	68	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	29005411	29005411	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29005411G>T	uc001usb.3	-	7	1135	c.850C>A	c.(850-852)CAA>AAA	p.Q284K	FLT1_uc010aar.1_Missense_Mutation_p.Q284K|FLT1_uc001usc.3_Missense_Mutation_p.Q284K|FLT1_uc010tdp.1_Missense_Mutation_p.Q284K	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	284	Extracellular (Potential).|Ig-like C2-type 3.				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	GAATTGCTTTGGTCAATTCGT	0.363													23	51	---	---	---	---	PASS
FARP1	10160	broad.mit.edu	37	13	99092415	99092415	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99092415A>G	uc001vnj.2	+	23	2891	c.2555A>G	c.(2554-2556)CAG>CGG	p.Q852R	FARP1_uc001vnh.2_Missense_Mutation_p.Q883R	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1	852	PH 1.				regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GAGGACATCCAGATGGCCATT	0.612													38	120	---	---	---	---	PASS
OR11H12	440153	broad.mit.edu	37	14	19377657	19377657	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19377657G>T	uc010tkp.1	+	1	64	c.64G>T	c.(64-66)GCT>TCT	p.A22S		NM_001013354	NP_001013372	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTCCAGCTTTGCTTTTGTAAA	0.383													22	100	---	---	---	---	PASS
OR4K5	79317	broad.mit.edu	37	14	20389730	20389730	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20389730T>A	uc010tkw.1	+	1	965	c.965T>A	c.(964-966)TTT>TAT	p.F322Y		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	322	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AGAACTTCCTTTCATTAAGAC	0.368													18	107	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22315210	22315210	+	Intron	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22315210C>G	uc010tmf.1	+						uc001wbw.2_Intron|uc010tmg.1_Intron|uc001wby.2_Intron|uc010ait.1_Missense_Mutation_p.P31A|uc001wbz.1_Missense_Mutation_p.P50A					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		TTCTTATTCACCATCTCTCTT	0.527											OREG0022570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	40	136	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23887604	23887604	+	Silent	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23887604G>C	uc001wjx.2	-	30	4090	c.3984C>G	c.(3982-3984)GCC>GCG	p.A1328A	MIR208B_hsa-mir-208b|MI0005570_5'Flank	NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1328	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CGTGGGCCAGGGCGTTCTTCG	0.642													7	45	---	---	---	---	PASS
CLEC14A	161198	broad.mit.edu	37	14	38724724	38724724	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38724724G>A	uc001wum.1	-	1	851	c.504C>T	c.(502-504)GGC>GGT	p.G168G		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	168	Extracellular (Potential).|C-type lectin.					integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		TGCACAGGTAGCCGTTGGCGC	0.577													10	67	---	---	---	---	PASS
PELI2	57161	broad.mit.edu	37	14	56757046	56757046	+	Missense_Mutation	SNP	G	A	A	rs137897340	byFrequency	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56757046G>A	uc001xch.2	+	5	854	c.568G>A	c.(568-570)GTC>ATC	p.V190I		NM_021255	NP_067078	Q9HAT8	PELI2_HUMAN	pellino 2	190					innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of protein phosphorylation|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	protein binding			ovary(1)	1						TACTAATGGCGTCCTGGTGAT	0.547													25	131	---	---	---	---	PASS
MUDENG	55745	broad.mit.edu	37	14	57746974	57746974	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57746974C>G	uc001xcv.2	+	3	1209	c.782C>G	c.(781-783)TCT>TGT	p.S261C	MUDENG_uc010tri.1_Missense_Mutation_p.S15C|MUDENG_uc010trj.1_Missense_Mutation_p.S158C	NM_018229	NP_060699	Q9H0R1	MUDEN_HUMAN	Mu-2 related death-inducing protein	261	MHD.				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex				ovary(1)	1						ACCAATGGATCTCCACTTCAG	0.398													38	244	---	---	---	---	PASS
C14orf37	145407	broad.mit.edu	37	14	58606016	58606016	+	Missense_Mutation	SNP	C	A	A	rs147297953	byFrequency	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58606016C>A	uc001xdc.2	-	2	172	c.61G>T	c.(61-63)GTT>TTT	p.V21F	C14orf37_uc010tro.1_Missense_Mutation_p.V59F|C14orf37_uc001xdd.2_Missense_Mutation_p.V21F|C14orf37_uc001xde.2_Missense_Mutation_p.V21F	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor	21						integral to membrane	binding				0						TGTGTGGCAACGCTGAAAAGC	0.473													28	127	---	---	---	---	PASS
EIF2S1	1965	broad.mit.edu	37	14	67831577	67831577	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67831577G>A	uc001xjg.2	+	2	234	c.93G>A	c.(91-93)GGG>GGA	p.G31G		NM_004094	NP_004085	P05198	IF2A_HUMAN	eukaryotic translation initiation factor 2,	31	S1 motif.					cytosol|eukaryotic translation initiation factor 2 complex|polysome|stress granule	protein binding|ribosome binding|translation initiation factor activity			ovary(1)	1				all cancers(60;0.000683)|OV - Ovarian serous cystadenocarcinoma(108;0.00579)|BRCA - Breast invasive adenocarcinoma(234;0.00937)		CTGAAATGGGGGCTTATGTCA	0.284													31	132	---	---	---	---	PASS
COX16	51241	broad.mit.edu	37	14	70826258	70826258	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70826258A>T	uc001xmb.2	-	1	187	c.47T>A	c.(46-48)CTC>CAC	p.L16H		NM_016468	NP_057552	Q9P0S2	COX16_HUMAN	COX16 cytochrome c oxidase assembly homolog	16	Helical; (Potential).					integral to membrane|mitochondrial membrane					0						TCCATAGCCGAGAGTCTTGTT	0.577													10	43	---	---	---	---	PASS
DCAF4	26094	broad.mit.edu	37	14	73406560	73406560	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73406560A>G	uc001xng.2	+	3	363	c.143A>G	c.(142-144)GAC>GGC	p.D48G	DCAF4_uc001xnj.2_Missense_Mutation_p.D48G|DCAF4_uc010ttr.1_Missense_Mutation_p.T37A|DCAF4_uc001xnh.2_5'UTR|DCAF4_uc010tts.1_Missense_Mutation_p.D48G|DCAF4_uc010ttt.1_5'UTR|DCAF4_uc001xni.2_Missense_Mutation_p.D48G|DCAF4_uc001xnk.2_Missense_Mutation_p.D48G	NM_015604	NP_056419	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4 isoform 1	48						CUL4 RING ubiquitin ligase complex				ovary(1)|central_nervous_system(1)|skin(1)	3						CACGGTGATGACGAGTCTCCG	0.617													6	16	---	---	---	---	PASS
ZFYVE1	53349	broad.mit.edu	37	14	73464512	73464512	+	Intron	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73464512C>T	uc001xnm.2	-						ZFYVE1_uc010arj.2_Intron	NM_021260	NP_067083	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1 isoform 1							endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding			skin(1)	1		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		TGTACCCCATCTCTCACCAGA	0.517													16	50	---	---	---	---	PASS
UBR7	55148	broad.mit.edu	37	14	93685054	93685054	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93685054C>T	uc001ybm.3	+	7	1019	c.783C>T	c.(781-783)GCC>GCT	p.A261A	UBR7_uc001ybn.3_Silent_p.A185A|UBR7_uc010auq.2_Silent_p.A110A	NM_175748	NP_786924	Q8N806	UBR7_HUMAN	ubiquitin protein ligase E3 component n-recognin	261							ubiquitin-protein ligase activity|zinc ion binding				0						AACCATGTGCCGGCTCTAGTT	0.378													18	66	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94100987	94100987	+	Intron	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94100987G>T	uc001ybv.1	+						KIAA1409_uc001ybs.1_Intron	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		GACACTGGTGGGTCAAGCTTT	0.478													17	90	---	---	---	---	PASS
C14orf177	283598	broad.mit.edu	37	14	99182725	99182725	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99182725G>C	uc001yfz.1	+	3	616	c.197G>C	c.(196-198)TGT>TCT	p.C66S		NM_182560	NP_872366	Q52M58	CN177_HUMAN	hypothetical protein LOC283598	66											0		Melanoma(154;0.128)				GCCAGGTGCTGTGGTAAGTAT	0.473													7	30	---	---	---	---	PASS
NDN	4692	broad.mit.edu	37	15	23931755	23931755	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23931755C>A	uc001ywk.2	-	1	696	c.610G>T	c.(610-612)GGC>TGC	p.G204C		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	204	MAGE.				negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		TCTCTGGCGCCGCGGCCCTTC	0.657									Prader-Willi_syndrome				7	29	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25307535	25307535	+	Intron	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25307535G>T	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-5_uc001yxo.2_RNA|SNORD116-2_uc001yxp.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						AACAAAATGAGTGAGAACTCA	0.507													15	99	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25940176	25940176	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25940176G>T	uc010ayu.2	-	14	2984	c.2878C>A	c.(2878-2880)CCC>ACC	p.P960T		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	960	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GACGTGGAGGGTGGGCAGAGA	0.587													16	95	---	---	---	---	PASS
GABRG3	2567	broad.mit.edu	37	15	27572065	27572065	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27572065G>C	uc001zbg.1	+	4	546	c.380G>C	c.(379-381)TGG>TCG	p.W127S	GABRG3_uc001zbf.2_Missense_Mutation_p.W127S	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma	127	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		GGGTTAATCTGGATCCCAGAC	0.458													16	128	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33990158	33990158	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33990158G>T	uc001zhi.2	+	40	6280	c.6210G>T	c.(6208-6210)ATG>ATT	p.M2070I	RYR3_uc010bar.2_Missense_Mutation_p.M2070I	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2070	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGACGGTGATGGAGGTGATGG	0.488													17	140	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34015032	34015032	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34015032G>T	uc001zhi.2	+	44	6806	c.6736G>T	c.(6736-6738)GGT>TGT	p.G2246C	RYR3_uc010bar.2_Missense_Mutation_p.G2246C	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2246	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGCCATGCAGGGTGCCATTAA	0.582													28	104	---	---	---	---	PASS
MGA	23269	broad.mit.edu	37	15	42057152	42057152	+	Missense_Mutation	SNP	C	T	T	rs143075460	by1000genomes	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42057152C>T	uc010ucy.1	+	23	7994	c.7813C>T	c.(7813-7815)CTC>TTC	p.L2605F	MGA_uc010ucz.1_Missense_Mutation_p.L2396F	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1	2566						MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		AGGGCAATTGCTCACCCTAAA	0.458													30	108	---	---	---	---	PASS
UBR1	197131	broad.mit.edu	37	15	43281054	43281054	+	Silent	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43281054C>A	uc001zqq.2	-	35	4026	c.3960G>T	c.(3958-3960)CTG>CTT	p.L1320L		NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	1320					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		TGCTCCAGGTCAGCATGGGGA	0.413													41	112	---	---	---	---	PASS
PRTG	283659	broad.mit.edu	37	15	55972345	55972345	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55972345C>T	uc002adg.2	-	6	928	c.880G>A	c.(880-882)GTC>ATC	p.V294I		NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor	294	Ig-like 3.				multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		TGTAGCCTGACATCAGATATC	0.383													14	35	---	---	---	---	PASS
ZNF609	23060	broad.mit.edu	37	15	64791618	64791618	+	5'Flank	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64791618G>T	uc002ann.2	+						ZNF609_uc010bgy.2_5'UTR	NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609							nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						TTGACTCTAAGATGTCCTTGA	0.517													11	65	---	---	---	---	PASS
PLEKHO2	80301	broad.mit.edu	37	15	65153739	65153739	+	Nonsense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65153739C>T	uc002anv.2	+	5	582	c.448C>T	c.(448-450)CGA>TGA	p.R150*	PLEKHO2_uc010bgz.2_Intron|PLEKHO2_uc002anw.2_Nonsense_Mutation_p.R100*	NM_025201	NP_079477	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O	150										ovary(1)|lung(1)	2						AGGGGGCCAGCGACGCCGGCC	0.647													5	38	---	---	---	---	PASS
LINGO1	84894	broad.mit.edu	37	15	77908027	77908027	+	Silent	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77908027G>C	uc002bct.1	-	2	274	c.222C>G	c.(220-222)CGC>CGG	p.R74R	LINGO1_uc002bcu.1_Silent_p.R68R	NM_032808	NP_116197	Q96FE5	LIGO1_HUMAN	leucine-rich repeat neuronal 6A	74	Extracellular (Potential).|LRR 1.				negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane				ovary(1)|lung(1)	2						GGTCCAGCAGGCGCGTCTCGG	0.662													4	12	---	---	---	---	PASS
MEFV	4210	broad.mit.edu	37	16	3293469	3293469	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3293469G>T	uc002cun.1	-	10	2058	c.2018C>A	c.(2017-2019)TCC>TAC	p.S673Y		NM_000243	NP_000234	O15553	MEFV_HUMAN	Mediterranean fever protein	673	B30.2/SPRY.				inflammatory response	cytoplasm|microtubule|microtubule associated complex|nucleus	actin binding|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|lung(1)	6					Colchicine(DB01394)	CCTGCTTATGGATGTCTTGCA	0.542													28	105	---	---	---	---	PASS
TMC5	79838	broad.mit.edu	37	16	19451423	19451423	+	Silent	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19451423G>C	uc002dgc.3	+	3	812	c.63G>C	c.(61-63)GGG>GGC	p.G21G	TMC5_uc010vaq.1_Silent_p.G21G|TMC5_uc002dgb.3_Silent_p.G21G|TMC5_uc010var.1_Silent_p.G21G	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a	21	Extracellular (Potential).					integral to membrane				skin(1)	1						ACTATTCAGGGTCTCAGAACC	0.493													17	112	---	---	---	---	PASS
ZP2	7783	broad.mit.edu	37	16	21215489	21215489	+	Silent	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21215489T>C	uc002dii.2	-	9	834	c.834A>G	c.(832-834)CCA>CCG	p.P278P	ZP2_uc010bwn.1_Silent_p.P317P|ZP2_uc010bwo.2_Silent_p.P317P	NM_003460	NP_003451	Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 preproprotein	278	Extracellular (Potential).				binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(48;0.0573)		CAGGAAACTCTGGTATGGTGA	0.443													22	70	---	---	---	---	PASS
XPO6	23214	broad.mit.edu	37	16	28181118	28181118	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28181118C>A	uc002dpa.1	-	5	1019	c.518G>T	c.(517-519)CGG>CTG	p.R173L	XPO6_uc002dpb.1_Missense_Mutation_p.R159L|XPO6_uc010vcp.1_Missense_Mutation_p.R173L	NM_015171	NP_055986	Q96QU8	XPO6_HUMAN	exportin 6	173					protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2						TAGCAGCTTCCGCAACTCCTC	0.587													14	57	---	---	---	---	PASS
SEZ6L2	26470	broad.mit.edu	37	16	29888632	29888632	+	Silent	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29888632T>A	uc002duq.3	-	11	2109	c.1869A>T	c.(1867-1869)CCA>CCT	p.P623P	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Silent_p.P553P|SEZ6L2_uc002dur.3_Silent_p.P553P|SEZ6L2_uc002dus.3_Silent_p.P509P|SEZ6L2_uc010vec.1_Silent_p.P623P|SEZ6L2_uc010ved.1_Silent_p.P579P	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform	623	CUB 3.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						GGCCTGGATTTGGGGGCCCGG	0.682													4	37	---	---	---	---	PASS
TAOK2	9344	broad.mit.edu	37	16	29997089	29997089	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29997089G>T	uc002dva.1	+	15	2682	c.1899G>T	c.(1897-1899)CGG>CGT	p.R633R	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TAOK2_uc002dvb.1_Silent_p.R633R|TAOK2_uc002dvc.1_Silent_p.R633R|TAOK2_uc010bzm.1_Silent_p.R640R|TAOK2_uc002dvd.1_Silent_p.R460R	NM_016151	NP_057235	Q9UL54	TAOK2_HUMAN	TAO kinase 2 isoform 2	633					actin cytoskeleton organization|activation of MAPKK activity|apoptosis|cell migration|focal adhesion assembly|positive regulation of JNK cascade|protein targeting to membrane|regulation of cell growth|regulation of cell shape|response to stress	cytoplasmic vesicle membrane|cytoskeleton|dendrite|integral to membrane|nucleolus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1						GGCTGCTGCGGCGGCAGCGCC	0.657													3	14	---	---	---	---	PASS
BCL7C	9274	broad.mit.edu	37	16	30899246	30899246	+	Silent	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30899246T>A	uc002dzv.2	-	6	728	c.594A>T	c.(592-594)ACA>ACT	p.T198T	BCL7C_uc002dzt.1_Intron|uc002dzu.2_Intron	NM_004765	NP_004756	Q8WUZ0	BCL7C_HUMAN	B-cell CLL/lymphoma 7C	198	Pro-rich.				apoptosis						0			Colorectal(24;0.198)			CCGAGTCCTCTGTGTCACCCT	0.657													30	178	---	---	---	---	PASS
TRIM72	493829	broad.mit.edu	37	16	31230814	31230814	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31230814G>C	uc002ebn.1	+	4	920	c.691G>C	c.(691-693)GAC>CAC	p.D231H	PYDC1_uc002ebo.2_5'Flank	NM_001008274	NP_001008275	Q6ZMU5	TRI72_HUMAN	tripartite motif-containing 72	231					exocytosis|muscle organ development|muscle system process|plasma membrane repair|protein homooligomerization	cytoplasmic vesicle membrane|sarcolemma	phosphatidylserine binding|zinc ion binding				0						GGAGGTGGCGGACAAGCCGCA	0.652													8	27	---	---	---	---	PASS
SLC6A2	6530	broad.mit.edu	37	16	55734196	55734196	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55734196G>T	uc002eif.2	+	13	1847	c.1736G>T	c.(1735-1737)AGC>ATC	p.S579I	SLC6A2_uc010ccd.2_Intron|SLC6A2_uc002eig.2_Missense_Mutation_p.S579I|SLC6A2_uc002eih.2_Missense_Mutation_p.S579I|SLC6A2_uc002eii.2_Missense_Mutation_p.S474I|SLC6A2_uc002eij.2_Missense_Mutation_p.S293I	NM_001043	NP_001034	P23975	SC6A2_HUMAN	solute carrier family 6 member 2	579	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity			lung(4)|ovary(2)|pancreas(2)	8				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)	AAGTTCCTCAGCACGCAGGGC	0.627													15	61	---	---	---	---	PASS
CDH16	1014	broad.mit.edu	37	16	66944196	66944196	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66944196C>A	uc002eql.2	-	15	2207	c.2134G>T	c.(2134-2136)GTG>TTG	p.V712L	CDH16_uc010cdy.2_Missense_Mutation_p.V690L|CDH16_uc002eqm.2_Missense_Mutation_p.V615L	NM_004062	NP_004053	O75309	CAD16_HUMAN	cadherin 16 precursor	712	Extracellular (Potential).|Ectodomain G.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|upper_aerodigestive_tract(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		TCCCGTTGCACCGTGGGGTTG	0.627													24	54	---	---	---	---	PASS
DUS2L	54920	broad.mit.edu	37	16	68087518	68087518	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68087518G>A	uc002evi.2	+	5	373	c.224G>A	c.(223-225)CGC>CAC	p.R75H	DUS2L_uc002evj.2_Missense_Mutation_p.R75H|DUS2L_uc010vkk.1_Missense_Mutation_p.R75H|DUS2L_uc010cez.2_5'UTR	NM_017803	NP_060273	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2-like, SMM1 homolog	75					tRNA processing	endoplasmic reticulum	double-stranded RNA binding|flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0131)|Epithelial(162;0.0564)		GTTGTCTTCCGCACCTGTGAA	0.527													13	71	---	---	---	---	PASS
COG4	25839	broad.mit.edu	37	16	70531872	70531872	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70531872C>A	uc002ezc.2	-	10	1293	c.1282G>T	c.(1282-1284)GAG>TAG	p.E428*	COG4_uc002ezb.2_5'UTR|COG4_uc010cfu.2_RNA|COG4_uc002ezd.2_Nonsense_Mutation_p.E428*|COG4_uc002eze.2_Nonsense_Mutation_p.E122*	NM_015386	NP_056201	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	424					Golgi organization|Golgi vesicle prefusion complex stabilization|protein transport|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0		Ovarian(137;0.0694)				AAGTACTCCTCCATGGTAACA	0.498													25	177	---	---	---	---	PASS
COG4	25839	broad.mit.edu	37	16	70531873	70531873	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70531873C>A	uc002ezc.2	-	10	1292	c.1281G>T	c.(1279-1281)ATG>ATT	p.M427I	COG4_uc002ezb.2_5'UTR|COG4_uc010cfu.2_RNA|COG4_uc002ezd.2_Missense_Mutation_p.M427I|COG4_uc002eze.2_Missense_Mutation_p.M121I	NM_015386	NP_056201	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	423					Golgi organization|Golgi vesicle prefusion complex stabilization|protein transport|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0		Ovarian(137;0.0694)				AGTACTCCTCCATGGTAACAT	0.493													24	176	---	---	---	---	PASS
SLC38A8	146167	broad.mit.edu	37	16	84050258	84050258	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84050258C>A	uc002fhg.1	-	8	1028	c.1028G>T	c.(1027-1029)GGG>GTG	p.G343V		NM_001080442	NP_001073911	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	343					amino acid transport|sodium ion transport	integral to membrane					0						GACCCACAGCCCTGAGGGGTC	0.647													13	58	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578395	7578395	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578395G>A	uc002gim.2	-	5	729	c.535C>T	c.(535-537)CAT>TAT	p.H179Y	TP53_uc002gig.1_Missense_Mutation_p.H179Y|TP53_uc002gih.2_Missense_Mutation_p.H179Y|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H47Y|TP53_uc010cng.1_Missense_Mutation_p.H47Y|TP53_uc002gii.1_Missense_Mutation_p.H47Y|TP53_uc010cnh.1_Missense_Mutation_p.H179Y|TP53_uc010cni.1_Missense_Mutation_p.H179Y|TP53_uc002gij.2_Missense_Mutation_p.H179Y|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.H86Y|TP53_uc002gio.2_Missense_Mutation_p.H47Y|TP53_uc010vug.1_Missense_Mutation_p.H140Y	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	179	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).	Zinc.	H -> Q (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> D (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H179R(99)|p.H179Y(74)|p.H179L(31)|p.H179Q(17)|p.H179N(13)|p.H179D(10)|p.P177_C182delPHHERC(8)|p.0?(7)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H179P(3)|p.R175_E180delRCPHHE(3)|p.H179fs*68(2)|p.H179H(2)|p.P177fs*3(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.K164_P219del(1)|p.C176fs*65(1)|p.C176fs*68(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.H179del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.R174fs*3(1)|p.H178_H179>QY(1)|p.E171fs*61(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAGCGCTCATGGTGGGGGCAG	0.642		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			24	39	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10428931	10428931	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10428931G>T	uc010coi.2	-	32	4502	c.4374C>A	c.(4372-4374)ATC>ATA	p.I1458I	uc002gml.1_Intron|MYH2_uc002gmp.3_Silent_p.I1458I|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1458	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						ATTCTGCCAGGATCTGAAAAA	0.463													21	38	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10438500	10438500	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10438500C>A	uc010coi.2	-	19	2198	c.2070G>T	c.(2068-2070)ATG>ATT	p.M690I	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.M690I|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	690	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						GCTCATGCTCCATGGCACCTA	0.458													19	42	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10438501	10438501	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10438501A>T	uc010coi.2	-	19	2197	c.2069T>A	c.(2068-2070)ATG>AAG	p.M690K	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.M690K|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	690	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						CTCATGCTCCATGGCACCTAA	0.458													18	41	---	---	---	---	PASS
KCNJ12	3768	broad.mit.edu	37	17	21318931	21318931	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21318931G>T	uc002gyv.1	+	3	982	c.277G>T	c.(277-279)GCC>TCC	p.A93S		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	93	Helical; Name=M1; (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	GGCCTTCCTTGCCTCCTGGCT	0.622										Prostate(3;0.18)			4	62	---	---	---	---	PASS
UTP6	55813	broad.mit.edu	37	17	30214305	30214305	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30214305C>A	uc002hgr.2	-	8	654	c.571G>T	c.(571-573)GAA>TAA	p.E191*	UTP6_uc002hgq.2_Nonsense_Mutation_p.E7*|UTP6_uc010cst.2_Nonsense_Mutation_p.E40*|UTP6_uc010wbw.1_Nonsense_Mutation_p.E191*	NM_018428	NP_060898	Q9NYH9	UTP6_HUMAN	hepatocellular carcinoma-associated antigen 66	191					rRNA processing	nucleolus	binding			ovary(1)	1		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				CTCAGTTTTTCAGCATGCATC	0.289													3	47	---	---	---	---	PASS
AMAC1	146861	broad.mit.edu	37	17	33520925	33520925	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33520925G>A	uc002hjd.2	-	1	488	c.402C>T	c.(400-402)CGC>CGT	p.R134R		NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1	134	DUF6 1.					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)		AAGAACCTTTGCGAACAGTGG	0.602													64	131	---	---	---	---	PASS
SYNRG	11276	broad.mit.edu	37	17	35921351	35921351	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35921351C>A	uc002hoa.2	-	13	1692	c.1609G>T	c.(1609-1611)GAT>TAT	p.D537Y	SYNRG_uc010wde.1_Missense_Mutation_p.D459Y|SYNRG_uc010wdf.1_Missense_Mutation_p.D459Y|SYNRG_uc002hoc.2_Missense_Mutation_p.D458Y|SYNRG_uc002hoe.2_Missense_Mutation_p.D459Y|SYNRG_uc002hod.2_Missense_Mutation_p.D459Y|SYNRG_uc010wdg.1_Missense_Mutation_p.D376Y|SYNRG_uc002hob.2_Missense_Mutation_p.D537Y|SYNRG_uc002hof.2_Missense_Mutation_p.D249Y|SYNRG_uc010cvd.1_Missense_Mutation_p.D337Y	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1	537	Interaction with A1P1G1 and A1P1G2.				endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						CTATATTTATCACCAGGATCT	0.353													21	53	---	---	---	---	PASS
KRT17	3872	broad.mit.edu	37	17	39775851	39775851	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39775851G>A	uc002hxh.2	-	8	1415	c.1294C>T	c.(1294-1296)CGC>TGC	p.R432C	JUP_uc010wfs.1_Intron	NM_000422	NP_000413	Q04695	K1C17_HUMAN	keratin 17	432	Tail.				epidermis development	cytoplasm|intermediate filament	protein binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2		Breast(137;0.000307)				AGTCCTCAGCGGGTGGTCTGG	0.677									Steatocystoma_Multiplex				16	139	---	---	---	---	PASS
SKAP1	8631	broad.mit.edu	37	17	46474159	46474159	+	Intron	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46474159G>C	uc002ini.1	-						SKAP1_uc002inj.1_Intron|SKAP1_uc010dbd.1_Intron|SKAP1_uc010dbe.1_Intron	NM_003726	NP_003717	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1 isoform						positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0						TAAAAGAAAAGGAAAGTTGAT	0.328													39	203	---	---	---	---	PASS
WFIKKN2	124857	broad.mit.edu	37	17	48917355	48917355	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48917355C>T	uc002isv.3	+	2	1400	c.706C>T	c.(706-708)CGG>TGG	p.R236W	WFIKKN2_uc010dbu.2_Missense_Mutation_p.R143W	NM_175575	NP_783165	Q8TEU8	WFKN2_HUMAN	WFIKKN2 protein	236	Ig-like C2-type.					extracellular region	metalloendopeptidase inhibitor activity|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			TGTGGTGGGCCGGCCCCGGCC	0.622													11	63	---	---	---	---	PASS
MRC2	9902	broad.mit.edu	37	17	60743550	60743550	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60743550C>T	uc002jad.2	+	3	1018	c.616C>T	c.(616-618)CGC>TGC	p.R206C	MRC2_uc002jac.2_Missense_Mutation_p.R206C	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	206	Extracellular (Potential).|Fibronectin type-II.				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3						CAGCACGGGCCGCGAGGATGG	0.607													7	9	---	---	---	---	PASS
KIF19	124602	broad.mit.edu	37	17	72346634	72346634	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72346634G>T	uc002jkm.3	+	11	1446	c.1308G>T	c.(1306-1308)GTG>GTT	p.V436V	KIF19_uc002jkj.2_Silent_p.V436V|KIF19_uc002jkk.2_Silent_p.V394V|KIF19_uc002jkl.2_Silent_p.V394V	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19	436	Potential.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						AGATGGATGTGCGGAGGCGCC	0.672													13	15	---	---	---	---	PASS
BTBD17	388419	broad.mit.edu	37	17	72356212	72356212	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72356212C>T	uc002jkn.2	-	2	258	c.258G>A	c.(256-258)CTG>CTA	p.L86L		NM_001080466	NP_001073935	A6NE02	BTBDH_HUMAN	BTB (POZ) domain containing 17 precursor	86	BTB.					extracellular region					0						GCAGTCCCAGCAGCAGGCGGT	0.647													11	51	---	---	---	---	PASS
UBE2O	63893	broad.mit.edu	37	17	74448907	74448907	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74448907C>A	uc002jrm.3	-	1	382	c.317G>T	c.(316-318)GGC>GTC	p.G106V	UBE2O_uc002jrn.3_Missense_Mutation_p.G106V	NM_022066	NP_071349	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	106							ATP binding|ubiquitin-protein ligase activity			breast(2)|skin(2)|lung(1)	5						GTGGCCCGCGCCCCCGGCCTC	0.741													3	4	---	---	---	---	PASS
CYTH1	9267	broad.mit.edu	37	17	76694409	76694409	+	Silent	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76694409C>A	uc002jvw.2	-	9	824	c.753G>T	c.(751-753)GGG>GGT	p.G251G	CYTH1_uc010wtw.1_Silent_p.G192G|CYTH1_uc010wtx.1_Silent_p.G192G	NM_017456	NP_059430	Q15438	CYH1_HUMAN	cytohesin 1 isoform 2	251					regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						TGAGGTCATTCCCGTCGTCTT	0.413													56	116	---	---	---	---	PASS
FASN	2194	broad.mit.edu	37	17	80037473	80037473	+	Silent	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80037473C>T	uc002kdu.2	-	42	7275	c.7158G>A	c.(7156-7158)GCG>GCA	p.A2386A	FASN_uc002kdv.1_RNA	NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase	2386	Thioesterase (By similarity).				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	GCGGCAGCAGCGCCTCCAGCA	0.647													13	25	---	---	---	---	PASS
DSG1	1828	broad.mit.edu	37	18	28934436	28934436	+	Silent	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28934436A>T	uc002kwp.2	+	15	2489	c.2277A>T	c.(2275-2277)GCA>GCT	p.A759A	DSG1_uc010xbp.1_Silent_p.A118A	NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	759	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			AGAAGTTGGCAGACATCAGCC	0.488													29	165	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28980857	28980857	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28980857C>T	uc002kwq.2	+	10	1426	c.1291C>T	c.(1291-1293)CAT>TAT	p.H431Y	DSG4_uc002kwr.2_Missense_Mutation_p.H431Y	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	431	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TATCATAGGGCATGATGCAGG	0.289													13	84	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31226214	31226214	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31226214G>A	uc010dmg.1	+	4	307	c.252G>A	c.(250-252)GAG>GAA	p.E84E	ASXL3_uc002kxq.2_5'UTR	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	84					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						TACAGAAAGAGGAGTCGTCAT	0.383													24	76	---	---	---	---	PASS
DTNA	1837	broad.mit.edu	37	18	32395987	32395987	+	Intron	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32395987T>C	uc010dmn.1	+						DTNA_uc002kxu.2_Intron|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Intron|DTNA_uc002kxw.2_Intron|DTNA_uc002kxx.2_Intron|DTNA_uc010dmj.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010dmk.1_Intron|DTNA_uc010dml.2_Intron|DTNA_uc002kyb.3_Intron|DTNA_uc010dmm.2_Intron|DTNA_uc010xby.1_5'Flank|DTNA_uc010dmo.2_5'Flank|DTNA_uc002kyd.3_5'Flank|DTNA_uc010xbz.1_5'Flank|DTNA_uc010xca.1_5'Flank|DTNA_uc002kye.2_5'Flank	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 1						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0						TGGTGAGTAGTTACTAAGGAG	0.423													39	173	---	---	---	---	PASS
KATNAL2	83473	broad.mit.edu	37	18	44580782	44580782	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44580782C>T	uc002lco.2	+	3	283	c.89C>T	c.(88-90)CCG>CTG	p.P30L	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lcp.3_Intron	NM_031303	NP_112593	Q8IYT4	KATL2_HUMAN	katanin p60 subunit A-like 2	102						cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4						AATAATTTACCGCAAAGAAGT	0.388													56	213	---	---	---	---	PASS
HMSD	284293	broad.mit.edu	37	18	61627505	61627505	+	Silent	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61627505T>C	uc010dqj.2	+	4	485	c.336T>C	c.(334-336)ACT>ACC	p.T112T	SERPINB8_uc002ljs.1_5'UTR	NM_001123366	NP_001116838	A8MTL9	HMSD_HUMAN	histocompatibility (minor) serpin domain	112						extracellular region	serine-type endopeptidase inhibitor activity				0						CTGATAAAACTAAAGGTGAAA	0.318													8	31	---	---	---	---	PASS
CBLN2	147381	broad.mit.edu	37	18	70205524	70205524	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70205524C>A	uc002lku.2	-	4	797	c.562G>T	c.(562-564)GTG>TTG	p.V188L	CBLN2_uc002lkv.2_Missense_Mutation_p.V188L	NM_182511	NP_872317	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	188	C1q.					integral to membrane					0		Esophageal squamous(42;0.131)				AGCAGCAGCACGCCATTGCTA	0.507													37	119	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76754091	76754091	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76754091G>T	uc002lmt.2	+	2	2100	c.2100G>T	c.(2098-2100)ACG>ACT	p.T700T	SALL3_uc010dra.2_Silent_p.T307T	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	700	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		ACTACCGGACGCACACGGGGG	0.632													5	38	---	---	---	---	PASS
REXO1	57455	broad.mit.edu	37	19	1820350	1820350	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1820350G>A	uc002lua.3	-	6	2534	c.2439C>T	c.(2437-2439)GTC>GTT	p.V813V	REXO1_uc010dsq.2_Silent_p.V122V|REXO1_uc010xgs.1_5'UTR|REXO1_uc010dsp.1_5'Flank|uc002lub.1_5'Flank	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3	813						nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGACGGTGGGGACTTTGCCCC	0.552													34	82	---	---	---	---	PASS
MATK	4145	broad.mit.edu	37	19	3778348	3778348	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3778348C>G	uc002lyt.2	-	14	1757	c.1357G>C	c.(1357-1359)GTG>CTG	p.V453L	MATK_uc002lyv.2_Missense_Mutation_p.V454L|MATK_uc002lyu.2_Missense_Mutation_p.V412L|MATK_uc010dtq.2_Missense_Mutation_p.V452L	NM_139355	NP_647612	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase isoform	453	Protein kinase.				cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGACGTGCACGGGGCCTGGA	0.697													9	47	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9065628	9065628	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9065628C>G	uc002mkp.2	-	3	22022	c.21818G>C	c.(21817-21819)GGT>GCT	p.G7273A		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	7275	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGTAGTAGCACCAATGGACAC	0.488													36	102	---	---	---	---	PASS
SMARCA4	6597	broad.mit.edu	37	19	11118702	11118702	+	Intron	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11118702A>G	uc002mqf.3	+						SMARCA4_uc010dxp.2_Intron|SMARCA4_uc010dxo.2_Intron|SMARCA4_uc002mqg.1_Intron|SMARCA4_uc010dxq.2_Intron|SMARCA4_uc010dxr.2_Intron|SMARCA4_uc002mqj.3_Intron|SMARCA4_uc010dxs.2_Intron	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				ATCATTGAGTAAGGGGTCCCG	0.587			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				5	13	---	---	---	---	PASS
ZNF563	147837	broad.mit.edu	37	19	12433494	12433494	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12433494T>C	uc002mtp.2	-	2	273	c.35A>G	c.(34-36)AAC>AGC	p.N12S	ZNF563_uc002mtq.2_Missense_Mutation_p.N12S	NM_145276	NP_660319	Q8TA94	ZN563_HUMAN	zinc finger protein 563	12	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CTGGGTGAAGTTCACAGCCAC	0.438													4	103	---	---	---	---	PASS
SYCE2	256126	broad.mit.edu	37	19	13029085	13029085	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13029085G>T	uc002mvr.2	-	2	97	c.82C>A	c.(82-84)CCG>ACG	p.P28T		NM_001105578	NP_001099048	Q6PIF2	SYCE2_HUMAN	synaptonemal complex central element protein 2	28					cell division	central element					0						TCCCACCGCGGATGCTCCTTG	0.627													25	58	---	---	---	---	PASS
ARMC6	93436	broad.mit.edu	37	19	19162527	19162527	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19162527G>T	uc002nld.2	+	5	724	c.376G>T	c.(376-378)GCC>TCC	p.A126S	ARMC6_uc002nlc.2_Missense_Mutation_p.A101S|ARMC6_uc010xql.1_Missense_Mutation_p.A33S|ARMC6_uc002nle.2_Missense_Mutation_p.A101S|ARMC6_uc010xqm.1_Missense_Mutation_p.A126S	NM_033415	NP_219483	Q6NXE6	ARMC6_HUMAN	armadillo repeat containing 6	126							protein binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.66e-06)|Epithelial(12;0.000391)			ACAGGACAAGGCCTGCCGCTT	0.637													26	69	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22155968	22155968	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22155968G>T	uc002nqp.2	-	5	1717	c.1568C>A	c.(1567-1569)ACC>AAC	p.T523N	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGTAGTAAGGGTTGAGACCTT	0.363													15	87	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22364110	22364110	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22364110C>G	uc002nqs.1	-	3	727	c.409G>C	c.(409-411)GGA>CGA	p.G137R		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	137					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CCTTTCTCTCCAGTATGCCTT	0.323													21	134	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22939855	22939855	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22939855T>C	uc010xrh.1	-	6	2476	c.2476A>G	c.(2476-2478)AGG>GGG	p.R826G		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GATTTCTCCCTAGTATGAATT	0.373													33	144	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	31039105	31039105	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31039105C>T	uc002nsu.1	+	4	2717	c.2579C>T	c.(2578-2580)ACA>ATA	p.T860I	ZNF536_uc010edd.1_Missense_Mutation_p.T860I	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	860					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					CAGCAGTGGACATCAGGGGTT	0.577													25	104	---	---	---	---	PASS
USF2	7392	broad.mit.edu	37	19	35761435	35761435	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35761435C>A	uc002nyq.1	+	5	624	c.515C>A	c.(514-516)GCG>GAG	p.A172E	USF2_uc010xss.1_Missense_Mutation_p.A172E|USF2_uc002nyr.1_Missense_Mutation_p.A105E|USF2_uc002nys.1_5'UTR|USF2_uc002nyt.1_Intron|USF2_uc002nyu.1_5'UTR|USF2_uc002nyv.1_5'UTR	NM_003367	NP_003358	Q15853	USF2_HUMAN	upstream stimulatory factor 2 isoform 1	172					lipid homeostasis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter by glucose	nucleus	bHLH transcription factor binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity				0	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TATTTCCCAGCGTCCAGTGTG	0.597													28	63	---	---	---	---	PASS
USF2	7392	broad.mit.edu	37	19	35761436	35761436	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35761436G>T	uc002nyq.1	+	5	625	c.516G>T	c.(514-516)GCG>GCT	p.A172A	USF2_uc010xss.1_Silent_p.A172A|USF2_uc002nyr.1_Silent_p.A105A|USF2_uc002nys.1_5'UTR|USF2_uc002nyt.1_Intron|USF2_uc002nyu.1_5'UTR|USF2_uc002nyv.1_5'UTR	NM_003367	NP_003358	Q15853	USF2_HUMAN	upstream stimulatory factor 2 isoform 1	172					lipid homeostasis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter by glucose	nucleus	bHLH transcription factor binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity				0	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			ATTTCCCAGCGTCCAGTGTGG	0.597													27	62	---	---	---	---	PASS
APLP1	333	broad.mit.edu	37	19	36367439	36367439	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36367439G>T	uc002oce.2	+	11	1503	c.1365G>T	c.(1363-1365)GTG>GTT	p.V455V	APLP1_uc010xsz.1_Silent_p.V416V|APLP1_uc002ocf.2_Silent_p.V455V|APLP1_uc002ocg.2_Silent_p.V358V|APLP1_uc010xta.1_Silent_p.V449V	NM_005166	NP_005157	P51693	APLP1_HUMAN	amyloid precursor-like protein 1 isoform 2	455	Extracellular (Potential).|Collagen-binding (By similarity).				apoptosis|cell adhesion|cellular response to norepinephrine stimulus|endocytosis|negative regulation of cAMP biosynthetic process|nervous system development|organ morphogenesis	basement membrane|integral to membrane|perinuclear region of cytoplasm|plasma membrane	alpha-2A adrenergic receptor binding|alpha-2B adrenergic receptor binding|alpha-2C adrenergic receptor binding|heparin binding|identical protein binding|metal ion binding			ovary(2)	2	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ACCTTCAAGTGATTGAGGAGA	0.552													18	62	---	---	---	---	PASS
SIPA1L3	23094	broad.mit.edu	37	19	38610204	38610204	+	Silent	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38610204C>G	uc002ohk.2	+	9	3059	c.2550C>G	c.(2548-2550)ACC>ACG	p.T850T		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	850					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TCTCCCTGACCTCCAAGAAGA	0.612													11	39	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38996044	38996044	+	Intron	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38996044C>A	uc002oit.2	+						RYR1_uc002oiu.2_Intron|RYR1_uc002oiv.1_Intron	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	AGAAGGTGACCAGGCCTTGGG	0.507													3	24	---	---	---	---	PASS
ITPKC	80271	broad.mit.edu	37	19	41235273	41235273	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41235273G>T	uc002oot.2	+	3	1455	c.1422G>T	c.(1420-1422)CTG>CTT	p.L474L		NM_025194	NP_079470	Q96DU7	IP3KC_HUMAN	inositol 1,4,5-trisphosphate 3-kinase C	474						cytoplasm|nucleus	ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity				0			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			AAGACCTCCTGGCTGACTTTG	0.612													8	33	---	---	---	---	PASS
B3GNT8	374907	broad.mit.edu	37	19	41932672	41932672	+	Silent	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41932672G>A	uc002oqs.2	-	3	466	c.12C>T	c.(10-12)CCC>CCT	p.P4P	CYP2F1_uc010xvw.1_Intron|B3GNT8_uc002oqt.1_Intron	NM_198540	NP_940942	Q7Z7M8	B3GN8_HUMAN	UDP-GlcNAc:betaGal	4	Cytoplasmic (Potential).				poly-N-acetyllactosamine biosynthetic process|protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity|protein N-acetylglucosaminyltransferase activity				0						GAAGGCACTTGGGGCAGCGCA	0.672													8	59	---	---	---	---	PASS
CEACAM4	1089	broad.mit.edu	37	19	42132287	42132287	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42132287T>C	uc002orh.1	-	2	223	c.112A>G	c.(112-114)ATT>GTT	p.I38V	CEACAM4_uc010xwd.1_Missense_Mutation_p.I38V	NM_001817	NP_001808	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion	38	Extracellular (Potential).|Ig-like V-type.					integral to plasma membrane|membrane fraction					0						AGGGCTTCAATAGTGAACTGG	0.498													39	105	---	---	---	---	PASS
ZNF574	64763	broad.mit.edu	37	19	42583419	42583419	+	Nonsense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42583419C>T	uc002osm.3	+	2	830	c.661C>T	c.(661-663)CAG>TAG	p.Q221*	ZNF574_uc002osk.3_Nonsense_Mutation_p.Q311*	NM_022752	NP_073589	Q6ZN55	ZN574_HUMAN	zinc finger protein 574	221	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.059)				TGAGTGCTCCCAGCTCTTCCA	0.622													34	100	---	---	---	---	PASS
LIPE	3991	broad.mit.edu	37	19	42910529	42910529	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42910529C>G	uc002otr.2	-	7	2426	c.2149G>C	c.(2149-2151)GAA>CAA	p.E717Q	uc010eif.1_Intron	NM_005357	NP_005348	Q05469	LIPS_HUMAN	hormone-sensitive lipase	717					cholesterol metabolic process|protein phosphorylation|triglyceride catabolic process	caveola|cytosol	hormone-sensitive lipase activity|protein binding			ovary(1)|breast(1)	2		Prostate(69;0.00682)				CAGATTCGTTCCCCTGTTGAG	0.642													13	36	---	---	---	---	PASS
EML2	24139	broad.mit.edu	37	19	46136217	46136217	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46136217G>A	uc002pcn.2	-	6	447	c.412C>T	c.(412-414)CAC>TAC	p.H138Y	EML2_uc002pco.2_RNA|EML2_uc002pcp.2_Missense_Mutation_p.H22Y|EML2_uc010xxl.1_Missense_Mutation_p.H285Y|EML2_uc010xxm.1_Missense_Mutation_p.H339Y|EML2_uc010xxn.1_RNA|EML2_uc010xxo.1_Missense_Mutation_p.H138Y|EML2_uc010ekj.2_Missense_Mutation_p.H138Y|EML2_uc010ekk.1_5'Flank	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like	138	WD 1.				sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		ATGCGCACGTGGGGCGGCAGC	0.567													14	50	---	---	---	---	PASS
PRR12	57479	broad.mit.edu	37	19	50099655	50099655	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50099655A>G	uc002poo.3	+	4	2063	c.2063A>G	c.(2062-2064)TAC>TGC	p.Y688C		NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		GGTACACCCTACGAGTTGGCC	0.682													6	19	---	---	---	---	PASS
SIGLEC7	27036	broad.mit.edu	37	19	51647760	51647760	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51647760G>T	uc002pvv.1	+	2	600	c.531G>T	c.(529-531)GGG>GGT	p.G177G	SIGLEC7_uc002pvw.1_Intron|SIGLEC7_uc010eoq.1_Intron|SIGLEC7_uc010eor.1_Intron	NM_014385	NP_055200	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7 isoform 1	177	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion	integral to plasma membrane	receptor activity|sugar binding			large_intestine(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		GTGAGCAGGGGACGCCCCCTA	0.647													33	142	---	---	---	---	PASS
CD33	945	broad.mit.edu	37	19	51728798	51728798	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51728798A>G	uc002pwa.2	+	2	402	c.362A>G	c.(361-363)GAG>GGG	p.E121G	CD33_uc010eos.1_Missense_Mutation_p.E121G|CD33_uc010eot.1_Intron|CD33_uc010eou.1_5'Flank	NM_001772	NP_001763	P20138	CD33_HUMAN	CD33 antigen isoform 1 precursor	121	Extracellular (Potential).|Ig-like V-type.				cell adhesion|cell-cell signaling|negative regulation of cell proliferation	external side of plasma membrane|integral to plasma membrane	receptor activity|sugar binding				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	TTTCGGATGGAGAGAGGAAGT	0.532													23	89	---	---	---	---	PASS
SIGLEC14	100049587	broad.mit.edu	37	19	52147020	52147020	+	Intron	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52147020C>A	uc002pxf.3	-							NM_001098612	NP_001092082	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14 precursor						cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding			ovary(1)	1		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		CAGCACCTGTCCTGCAACTCA	0.577													20	85	---	---	---	---	PASS
ZNF766	90321	broad.mit.edu	37	19	52793634	52793634	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52793634G>T	uc002pyr.1	+	4	633	c.590G>T	c.(589-591)AGA>ATA	p.R197I	ZNF766_uc002pys.1_3'UTR|ZNF766_uc002pyt.1_Missense_Mutation_p.R212I	NM_001010851	NP_001010851	Q5HY98	ZN766_HUMAN	zinc finger protein 766	197	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		AAAGTCTTCAGAGTGTCTTCA	0.413													20	152	---	---	---	---	PASS
NLRP12	91662	broad.mit.edu	37	19	54313082	54313082	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54313082A>T	uc002qch.3	-	3	2051	c.1831T>A	c.(1831-1833)TTG>ATG	p.L611M	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.L611M|NLRP12_uc002qcj.3_Missense_Mutation_p.L611M|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.L611M	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	611					negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		AAGAACTCCAAGGAGCCCTGC	0.567													35	82	---	---	---	---	PASS
NLRP12	91662	broad.mit.edu	37	19	54313593	54313593	+	Silent	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54313593C>A	uc002qch.3	-	3	1540	c.1320G>T	c.(1318-1320)CTG>CTT	p.L440L	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Silent_p.L440L|NLRP12_uc002qcj.3_Silent_p.L440L|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Silent_p.L440L	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	440	NACHT.				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GCATCAGACTCAGCAGGTAGA	0.632													26	145	---	---	---	---	PASS
LILRB3	11025	broad.mit.edu	37	19	54722671	54722671	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54722671G>T	uc002qef.1	-	9	1574	c.1463C>A	c.(1462-1464)GCT>GAT	p.A488D	LILRB3_uc002qee.1_Missense_Mutation_p.A488D|LILRB3_uc002qeh.1_Missense_Mutation_p.A488D|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Missense_Mutation_p.A488D|LILRA6_uc002qek.1_Missense_Mutation_p.A488D|LILRB3_uc010erh.1_Missense_Mutation_p.A505D|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Missense_Mutation_p.A488D|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Missense_Mutation_p.A488D|LILRB3_uc002qep.1_Missense_Mutation_p.A488D|LILRB3_uc002qeq.1_Missense_Mutation_p.A488D|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Missense_Mutation_p.A488D	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,	488	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGTCTCCGCAGCCCCTGCAGG	0.567													29	83	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54758731	54758731	+	Silent	SNP	A	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54758731A>G	uc002qex.2	-	6	1233	c.1122T>C	c.(1120-1122)TAT>TAC	p.Y374Y	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Silent_p.Y365Y|LILRB5_uc002qey.2_Silent_p.Y374Y|LILRB5_uc002qez.2_Silent_p.Y274Y|LILRB5_uc002qfa.1_Silent_p.Y264Y|LILRB5_uc010yes.1_RNA	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	374	Ig-like C2-type 4.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCTGGTGTCTATAAGACTGGT	0.537													22	72	---	---	---	---	PASS
GP6	51206	broad.mit.edu	37	19	55530042	55530042	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55530042G>C	uc002qik.2	-	6	730	c.702C>G	c.(700-702)TTC>TTG	p.F234L	GP6_uc002qil.2_Missense_Mutation_p.F234L|GP6_uc010esq.2_Missense_Mutation_p.F216L	NM_016363	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet) isoform 2	234	Extracellular (Potential).				enzyme linked receptor protein signaling pathway|leukocyte migration|platelet activation	integral to plasma membrane	collagen binding|transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		CTTCGTTTGTGAATGAGACGG	0.458													58	128	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56419214	56419214	+	Silent	SNP	A	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56419214A>T	uc010ygg.1	-	7	2416	c.2391T>A	c.(2389-2391)ACT>ACA	p.T797T		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	797	LRR 2.						ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TCAGGGGGACAGTCATTCCCA	0.498													58	133	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56424444	56424444	+	Nonsense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56424444G>A	uc010ygg.1	-	5	764	c.739C>T	c.(739-741)CAG>TAG	p.Q247*		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	247	NACHT.						ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		AGCATAGCCTGCATTGCCAAG	0.507													45	141	---	---	---	---	PASS
ZNF71	58491	broad.mit.edu	37	19	57133934	57133934	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57133934G>A	uc002qnm.3	+	3	1517	c.1279G>A	c.(1279-1281)GAG>AAG	p.E427K		NM_021216	NP_067039	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	427	C2H2-type 11.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		CTACCTCATCGAGCACCAGCG	0.642													26	43	---	---	---	---	PASS
NKX2-2	4821	broad.mit.edu	37	20	21492742	21492742	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21492742G>T	uc002wsi.2	-	2	998	c.641C>A	c.(640-642)CCA>CAA	p.P214Q		NM_002509	NP_002500	O95096	NKX22_HUMAN	NK2 transcription factor related, locus 2	214					brain development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	chromatin binding|core promoter proximal region DNA binding|transcription coactivator activity			pancreas(1)|skin(1)	2						CGCGTGACATGGTTTGCCGTC	0.662													10	57	---	---	---	---	PASS
CST1	1469	broad.mit.edu	37	20	23728519	23728519	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23728519G>C	uc002wtp.2	-	3	431	c.360C>G	c.(358-360)TTC>TTG	p.F120L		NM_001898	NP_001889	P01037	CYTN_HUMAN	cystatin SN precursor	120						extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1	Lung NSC(19;0.0676)|all_lung(19;0.148)					CGTAGATCTCGAAAGAGCACA	0.527													14	47	---	---	---	---	PASS
CST1	1469	broad.mit.edu	37	20	23731327	23731327	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23731327G>T	uc002wtp.2	-	1	248	c.177C>A	c.(175-177)ACC>ACA	p.T59T		NM_001898	NP_001889	P01037	CYTN_HUMAN	cystatin SN precursor	59						extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1	Lung NSC(19;0.0676)|all_lung(19;0.148)					AGTCATCTTTGGTGGCCTTGT	0.557													26	119	---	---	---	---	PASS
CST7	8530	broad.mit.edu	37	20	24939554	24939554	+	Intron	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24939554C>T	uc002wtx.1	+							NM_003650	NP_003641	O76096	CYTF_HUMAN	cystatin F						immune response	cytoplasm|extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1						AGTCCCTTTGCTCCCTCCAGA	0.557													28	67	---	---	---	---	PASS
C20orf186	149954	broad.mit.edu	37	20	31671440	31671440	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31671440G>T	uc010zue.1	+	3	452	c.437G>T	c.(436-438)AGG>ATG	p.R146M		NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor	146	Gly-rich.					cytoplasm|extracellular region	lipid binding				0						CCTGTGGGCAGGCTTCACCGG	0.642													45	79	---	---	---	---	PASS
SEMG1	6406	broad.mit.edu	37	20	43836508	43836508	+	Silent	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43836508C>A	uc002xni.2	+	2	627	c.570C>A	c.(568-570)TCC>TCA	p.S190S	SEMG1_uc002xnj.2_Silent_p.S190S|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Silent_p.S190S	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	190	42 AA repeat 1.				insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)				AAGGCGGATCCCAAAGCAGTT	0.393													35	52	---	---	---	---	PASS
SLC12A5	57468	broad.mit.edu	37	20	44664042	44664042	+	Splice_Site	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44664042G>A	uc010zxl.1	+	3	293	c.217_splice	c.e3-1	p.E73_splice	SLC12A5_uc002xra.2_Splice_Site_p.E50_splice|SLC12A5_uc010zxm.1_Splice_Site|SLC12A5_uc002xrb.2_Splice_Site_p.E50_splice	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride						potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	TCCCTCCATAGGAGGAGATGG	0.592													93	191	---	---	---	---	PASS
NFATC2	4773	broad.mit.edu	37	20	50140386	50140386	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50140386C>T	uc002xwd.2	-	2	614	c.394G>A	c.(394-396)GAC>AAC	p.D132N	NFATC2_uc002xwc.2_Missense_Mutation_p.D132N|NFATC2_uc010zyv.1_Intron|NFATC2_uc010zyw.1_Intron|NFATC2_uc010zyx.1_Missense_Mutation_p.D112N|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Missense_Mutation_p.D112N	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,	132	Trans-activation domain A (TAD-A).				B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)					AGGCCCGCGTCTCTCATGCGG	0.736													15	50	---	---	---	---	PASS
VAPB	9217	broad.mit.edu	37	20	57019265	57019265	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57019265G>T	uc002xza.2	+	6	977	c.706G>T	c.(706-708)GTA>TTA	p.V236L	VAPB_uc002xzb.2_RNA|VAPB_uc010zzo.1_Missense_Mutation_p.V113L|VAPB_uc002xzc.2_3'UTR	NM_004738	NP_004729	O95292	VAPB_HUMAN	VAMP-associated protein B/C	236	Helical; Anchor for type IV membrane protein; (Potential).				cell death|endoplasmic reticulum unfolded protein response|positive regulation of viral genome replication|sphingolipid metabolic process|virus-host interaction	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	beta-tubulin binding|enzyme binding|protein heterodimerization activity|protein homodimerization activity|structural molecule activity			kidney(1)	1	Lung NSC(12;0.000615)|all_lung(29;0.00186)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;3.7e-08)|all cancers(14;3.88e-07)			TATCGTTGGTGTAATTATTGG	0.453													70	277	---	---	---	---	PASS
PHACTR3	116154	broad.mit.edu	37	20	58415482	58415482	+	Missense_Mutation	SNP	A	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58415482A>C	uc002yau.2	+	10	1910	c.1443A>C	c.(1441-1443)AGA>AGC	p.R481S	PHACTR3_uc002yat.2_Missense_Mutation_p.R478S|PHACTR3_uc010zzw.1_Missense_Mutation_p.R440S|PHACTR3_uc002yav.2_Missense_Mutation_p.R440S|PHACTR3_uc002yaw.2_Missense_Mutation_p.R440S|PHACTR3_uc002yax.2_Missense_Mutation_p.R370S|PHACTR3_uc002yay.2_Missense_Mutation_p.R50S	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1	481	Required for PP1CA binding and inhibition of PP1 activity.|Potential.|RPEL 4.					nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			GATTGACAAGAAAGGTAGTAT	0.363													5	77	---	---	---	---	PASS
HRH3	11255	broad.mit.edu	37	20	60791306	60791306	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60791306C>T	uc002ycf.2	-	3	1391	c.1094G>A	c.(1093-1095)AGC>AAC	p.S365N	HRH3_uc002ycg.2_Missense_Mutation_p.S285N|HRH3_uc002ych.2_Intron|HRH3_uc002yci.2_Missense_Mutation_p.S365N	NM_007232	NP_009163	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	365	Helical; Name=6; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|neurotransmitter secretion	integral to plasma membrane	histamine receptor activity				0	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Histamine Phosphate(DB00667)	CCCAAAGATGCTCACGATGAC	0.607													26	46	---	---	---	---	PASS
STMN3	50861	broad.mit.edu	37	20	62275622	62275622	+	Silent	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62275622G>T	uc002yfr.1	-	2	142	c.60C>A	c.(58-60)CTC>CTA	p.L20L	STMN3_uc011abb.1_Silent_p.L20L	NM_015894	NP_056978	Q9NZ72	STMN3_HUMAN	SCG10-like-protein	20					cytoplasmic microtubule organization|intracellular signal transduction|negative regulation of Rac protein signal transduction|neuron projection development|regulation of cytoskeleton organization|regulation of Rac GTPase activity	cytoplasm	protein domain specific binding				0	all_cancers(38;2.31e-11)|all_epithelial(29;7.76e-13)		Epithelial(9;1.9e-09)|all cancers(9;1.22e-08)|BRCA - Breast invasive adenocarcinoma(10;8.86e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.00559)			AGGAGCAGATGAGCGACAGCA	0.652													13	35	---	---	---	---	PASS
CCT8L2	150160	broad.mit.edu	37	22	17072690	17072690	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17072690C>A	uc002zlp.1	-	1	1011	c.751G>T	c.(751-753)GCC>TCC	p.A251S		NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN	T-complex protein 1	251					cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity			ovary(1)	1	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				TTTGGATGGGCAGGACCAAAG	0.517													19	101	---	---	---	---	PASS
RTDR1	27156	broad.mit.edu	37	22	23482493	23482493	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23482493C>A	uc002zwt.2	-	2	273	c.115G>T	c.(115-117)GAC>TAC	p.D39Y	RTDR1_uc010gtv.1_Missense_Mutation_p.D39Y	NM_014433	NP_055248	Q9UHP6	RTDR1_HUMAN	rhabdoid tumor deletion region protein 1	39							binding			ovary(1)	1	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		GTCTGGAGGTCCTCTGACTGC	0.557													4	55	---	---	---	---	PASS
ADRBK2	157	broad.mit.edu	37	22	26118334	26118334	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26118334C>G	uc003abx.3	+	21	2131	c.1984C>G	c.(1984-1986)CCG>GCG	p.P662A	ADRBK2_uc003aby.3_RNA	NM_005160	NP_005151	P35626	ARBK2_HUMAN	beta-adrenergic receptor kinase 2	662							ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity			lung(3)|ovary(2)|stomach(1)|central_nervous_system(1)	7					Adenosine triphosphate(DB00171)	GCGTCGTGCCCCGAAGTTCCT	0.542													26	71	---	---	---	---	PASS
SLC25A17	10478	broad.mit.edu	37	22	41195076	41195076	+	Silent	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41195076T>A	uc003azc.2	-	2	206	c.66A>T	c.(64-66)ACA>ACT	p.T22T	SLC25A17_uc010gyg.2_RNA|SLC25A17_uc011aou.1_5'UTR|SLC25A17_uc003azd.2_RNA|SLC25A17_uc011aov.1_Silent_p.T22T	NM_006358	NP_006349	O43808	PM34_HUMAN	solute carrier family 25 (mitochondrial carrier;	22	Solcar 1.|Helical; Name=1; (Potential).				fatty acid alpha-oxidation	integral to plasma membrane|mitochondrial inner membrane|peroxisomal membrane	adenine nucleotide transmembrane transporter activity|protein binding				0						CTGTCATTGCTGTCACGCTTC	0.328													16	27	---	---	---	---	PASS
PPEF1	5475	broad.mit.edu	37	X	18797254	18797254	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18797254T>A	uc004cyq.2	+	10	1166	c.685T>A	c.(685-687)TTG>ATG	p.L229M	PPEF1_uc004cyp.2_Missense_Mutation_p.L229M|PPEF1_uc004cyr.2_Missense_Mutation_p.L229M|PPEF1_uc004cys.2_Missense_Mutation_p.L229M|PPEF1_uc011mja.1_Missense_Mutation_p.L164M|PPEF1_uc011mjb.1_Missense_Mutation_p.L173M	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding	229	Catalytic.				detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					TGACCTGCACTTGAACAGAGG	0.398													46	50	---	---	---	---	PASS
RPS6KA3	6197	broad.mit.edu	37	X	20195156	20195156	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20195156G>A	uc004czu.2	-	11	892	c.892C>T	c.(892-894)CTT>TTT	p.L298F	RPS6KA3_uc011mjk.1_Missense_Mutation_p.L269F|RPS6KA3_uc004czv.2_Missense_Mutation_p.L286F|RPS6KA3_uc011mjl.1_Missense_Mutation_p.L270F|RPS6KA3_uc011mjm.1_Missense_Mutation_p.L270F	NM_004586	NP_004577	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	298	Protein kinase 1.				axon guidance|central nervous system development|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|skeletal system development|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(4)|stomach(1)|ovary(1)|lung(1)|breast(1)	8						ATTCGTAAAAGACTCTGCGCT	0.318													32	49	---	---	---	---	PASS
PTCHD1	139411	broad.mit.edu	37	X	23411778	23411778	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23411778G>A	uc004dal.3	+	3	2151	c.2143G>A	c.(2143-2145)GCA>ACA	p.A715T		NM_173495	NP_775766	Q96NR3	PTHD1_HUMAN	patched domain containing 1	715	Helical; (Potential).				cognition|smoothened signaling pathway	integral to membrane|plasma membrane	hedgehog receptor activity			ovary(4)|kidney(1)|skin(1)	6						CTTCTTCTCGGCATTCCTGGT	0.483													4	72	---	---	---	---	PASS
SLC35A2	7355	broad.mit.edu	37	X	48762630	48762630	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48762630G>C	uc004dlo.1	-	4	560	c.556C>G	c.(556-558)CAA>GAA	p.Q186E	SLC35A2_uc011mml.1_Missense_Mutation_p.Q199E|SLC35A2_uc004dlp.1_Missense_Mutation_p.Q186E|SLC35A2_uc011mmm.1_Missense_Mutation_p.Q214E|SLC35A2_uc011mmn.1_Missense_Mutation_p.Q125E|SLC35A2_uc004dlr.1_Intron|SLC35A2_uc004dlq.2_Intron	NM_005660	NP_005651	P78381	S35A2_HUMAN	solute carrier family 35, member A2 isoform a	186	Helical; (Potential).				galactose metabolic process	Golgi membrane|integral to membrane|nucleus	sugar:hydrogen symporter activity|UDP-galactose transmembrane transporter activity			breast(1)	1						CCACCGGCTTGCTGTGCCTGG	0.662													6	4	---	---	---	---	PASS
ITIH5L	347365	broad.mit.edu	37	X	54783662	54783662	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54783662C>A	uc004dtj.2	-	8	2875	c.2845G>T	c.(2845-2847)GGT>TGT	p.G949C		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	949	Pro-rich.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						CTCTGGGGACCCGGGAGGAGG	0.592													9	18	---	---	---	---	PASS
ACRC	93953	broad.mit.edu	37	X	70823780	70823780	+	Missense_Mutation	SNP	A	G	G	rs138572604	byFrequency	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70823780A>G	uc004eae.2	+	8	1154	c.653A>G	c.(652-654)AAG>AGG	p.K218R	BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	218	Asp/Ser-rich.					nucleus				ovary(3)	3	Renal(35;0.156)					CCCGACGACAAGAGTGATGAT	0.507													34	170	---	---	---	---	PASS
ACRC	93953	broad.mit.edu	37	X	70823781	70823781	+	Missense_Mutation	SNP	G	C	C	rs141229655	byFrequency	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70823781G>C	uc004eae.2	+	8	1155	c.654G>C	c.(652-654)AAG>AAC	p.K218N	BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	218	Asp/Ser-rich.					nucleus				ovary(3)	3	Renal(35;0.156)					CCGACGACAAGAGTGATGATT	0.502													42	160	---	---	---	---	PASS
P2RY10	27334	broad.mit.edu	37	X	78216168	78216168	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78216168G>T	uc004ede.2	+	4	520	c.151G>T	c.(151-153)GCT>TCT	p.A51S	P2RY10_uc004edf.2_Missense_Mutation_p.A51S	NM_014499	NP_055314	O00398	P2Y10_HUMAN	G-protein coupled purinergic receptor P2Y10	51	Helical; Name=1; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(2)|breast(1)	5						TGGTCTTCTGGCTAACAGTGC	0.428													30	57	---	---	---	---	PASS
DACH2	117154	broad.mit.edu	37	X	85631865	85631865	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85631865G>A	uc004eew.2	+	2	697	c.527G>A	c.(526-528)AGT>AAT	p.S176N	DACH2_uc004eex.2_Intron|DACH2_uc010nmq.2_Intron|DACH2_uc011mra.1_Missense_Mutation_p.S9N|DACH2_uc010nmr.2_Intron	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a	176					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						gctgttaacaggtatttatgt	0.109													4	4	---	---	---	---	PASS
MAGEC3	139081	broad.mit.edu	37	X	140926178	140926178	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140926178G>A	uc011mwp.1	+	1	77	c.77G>A	c.(76-78)TGT>TAT	p.C26Y		NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	26										skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					AAAAACACATGTGCCACATAT	0.557													29	36	---	---	---	---	PASS
SLITRK2	84631	broad.mit.edu	37	X	144904178	144904178	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144904178C>A	uc004fcd.2	+	5	1225	c.235C>A	c.(235-237)CCA>ACA	p.P79T	SLITRK2_uc010nsp.2_Missense_Mutation_p.P79T|SLITRK2_uc010nso.2_Missense_Mutation_p.P79T|SLITRK2_uc011mwq.1_Missense_Mutation_p.P79T|SLITRK2_uc011mwr.1_Missense_Mutation_p.P79T|SLITRK2_uc011mws.1_Missense_Mutation_p.P79T|SLITRK2_uc004fcg.2_Missense_Mutation_p.P79T|SLITRK2_uc011mwt.1_Missense_Mutation_p.P79T	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	79	Extracellular (Potential).|LRR 1.					integral to membrane				ovary(5)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					AAGACTGTATCCAAACGAATT	0.468													18	51	---	---	---	---	PASS
GRHL3	57822	broad.mit.edu	37	1	24671564	24671564	+	Intron	DEL	C	-	-	rs11352138		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24671564delC	uc001biy.2	+						GRHL3_uc001bix.2_Intron|GRHL3_uc001biz.2_Intron	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform						regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		CACACCTGTGCCCCCTCTACA	0.672													2	4	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62267609	62267609	+	Intron	DEL	T	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62267609delT	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						tttttttttcttttttttttt	0.114													4	2	---	---	---	---	
LOC728855	728855	broad.mit.edu	37	1	149649078	149649079	+	Intron	INS	-	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149649078_149649079insA	uc009wlc.2	+						LOC728855_uc009wld.2_Intron|uc001eso.1_RNA					Homo sapiens mRNA, chromosome 1 specific transcript KIAA0493.												0						AGAGAGCCTTCAAAACCTCTTA	0.426													13	6	---	---	---	---	
C1orf31	388753	broad.mit.edu	37	1	234519319	234519320	+	Intron	INS	-	ACAC	ACAC	rs141657444	by1000genomes	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234519319_234519320insACAC	uc001hwc.2	+						C1orf31_uc001hwb.2_Intron	NM_001012985	NP_001013003	Q5JTJ3	CA031_HUMAN	hypothetical protein LOC388753							mitochondrion	cytochrome-c oxidase activity				0	Ovarian(103;0.0339)	all_cancers(173;0.241)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			AGTTACAGCTGacacacacaca	0.124													4	2	---	---	---	---	
PASK	23178	broad.mit.edu	37	2	242075147	242075148	+	Intron	INS	-	C	C	rs140491962	by1000genomes	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242075147_242075148insC	uc002wao.1	-						PASK_uc010zol.1_Intron|PASK_uc010zom.1_Intron|PASK_uc010fzl.1_Intron|PASK_uc010zon.1_Intron|PASK_uc002wap.2_5'Flank|PASK_uc002waq.2_Intron	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase						regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GAAAACAGTCACCCCCTACTCC	0.550													5	3	---	---	---	---	
MST1	4485	broad.mit.edu	37	3	49724049	49724049	+	Intron	DEL	C	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49724049delC	uc003cxg.2	-						MST1_uc011bcs.1_Intron|MST1_uc010hkx.2_Intron|MST1_uc011bct.1_Intron|MST1_uc011bcu.1_Intron|RNF123_uc003cxh.2_5'Flank	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth						proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCTCTTACCTCCCCGGCCAAG	0.672													6	4	---	---	---	---	
COL6A6	131873	broad.mit.edu	37	3	130367860	130367861	+	Intron	INS	-	T	T	rs10695462		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130367860_130367861insT	uc010htl.2	+						COL6A6_uc003eni.3_Intron	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor						axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						TTCTATGTATCTTTTTTTTTTT	0.302													3	4	---	---	---	---	
WDR19	57728	broad.mit.edu	37	4	39230425	39230425	+	Intron	DEL	T	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39230425delT	uc003gtv.2	+						WDR19_uc011byi.1_Intron|WDR19_uc003gtw.1_Intron	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						CTTGCAAGAATtttttttttt	0.129													5	3	---	---	---	---	
BTF3	689	broad.mit.edu	37	5	72800092	72800093	+	Intron	INS	-	TTT	TTT	rs34051700		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72800092_72800093insTTT	uc003kcr.1	+						BTF3_uc003kcq.1_Intron|BTF3_uc003kcs.1_Intron|BTF3_uc003kct.1_Intron	NM_001037637	NP_001032726	P20290	BTF3_HUMAN	basic transcription factor 3 isoform A						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding				0		Lung NSC(167;0.00405)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;2.73e-54)		TTCATCTGttcttttttttttt	0.267													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180165983	180165984	+	IGR	INS	-	C	C	rs2054696	by1000genomes	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180165983_180165984insC								FLT4 (89359 upstream) : OR2Y1 (139 downstream)																							tgttccccccgccaccaaaaaa	0.188													3	5	---	---	---	---	
TRIM26	7726	broad.mit.edu	37	6	30156018	30156020	+	Intron	DEL	AAG	-	-	rs58681097		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30156018_30156020delAAG	uc003npr.2	-						TRIM26_uc003nps.2_Intron|TRIM26_uc010jry.2_Intron|TRIM26_uc003npt.2_Intron	NM_003449	NP_003440	Q12899	TRI26_HUMAN	tripartite motif-containing 26								DNA binding|zinc ion binding			ovary(2)|lung(1)	3						aaaaaaaaaaaagaaaTTTGGGA	0.202													4	2	---	---	---	---	
PLEKHA8	84725	broad.mit.edu	37	7	30113604	30113605	+	Intron	INS	-	A	A			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30113604_30113605insA	uc003tam.1	+						PLEKHA8_uc003tao.2_Intron|PLEKHA8_uc003tap.1_Intron|PLEKHA8_uc003tan.2_Intron	NM_032639	NP_116028	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A						protein transport	cytoplasm	glycolipid binding|glycolipid transporter activity			breast(3)|ovary(1)	4						cctgtctctttaaaaaaaaaaa	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	76598571	76598573	+	IGR	DEL	TCT	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76598571_76598573delTCT								POMZP3 (341951 upstream) : PMS2L11 (11566 downstream)																							TTCCATTCGGTCttttttttttt	0.232													4	2	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105459892	105459892	+	Intron	DEL	A	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105459892delA	uc003vde.2	-						ATXN7L1_uc003vdi.2_Intron	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						TTTGGGatttaaaaaaaaaaa	0.398													5	3	---	---	---	---	
SNAI2	6591	broad.mit.edu	37	8	49831218	49831219	+	3'UTR	DEL	GT	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49831218_49831219delGT	uc003xqp.2	-	3						NM_003068	NP_003059	O43623	SNAI2_HUMAN	snail 2						canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				CTCTCtgtgggtgtgtgtgtgt	0.282													7	4	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33386780	33386781	+	Intron	INS	-	A	A	rs144468472	by1000genomes	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33386780_33386781insA	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_Intron|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		aatggtaggtcggggggcccag	0.257													4	3	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33395300	33395300	+	Intron	DEL	C	-	-	rs77570582		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33395300delC	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_5'Flank|AQP7_uc010mjt.2_5'UTR|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_5'UTR|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		AGCAGCCTCGCCCACACACGC	0.602													7	4	---	---	---	---	
KCNT1	57582	broad.mit.edu	37	9	138606581	138606582	+	Intron	INS	-	GG	GG	rs141291153	by1000genomes	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138606581_138606582insGG	uc011mdq.1	+						KCNT1_uc011mdr.1_Intron|KCNT1_uc010nbf.2_Intron	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1							membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GGACCGGGCGCGGGGTGGGGGC	0.614													4	4	---	---	---	---	
RUFY2	55680	broad.mit.edu	37	10	70136913	70136913	+	Intron	DEL	T	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70136913delT	uc001job.2	-						RUFY2_uc001jnz.1_Intron|RUFY2_uc001joa.2_5'UTR	NM_017987	NP_060457	Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain-containing 2 isoform a							nucleus	metal ion binding			ovary(1)	1						TGTTTTGTGATTTTTTTTTTT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	85841851	85841851	+	IGR	DEL	T	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85841851delT								None (None upstream) : GHITM (57334 downstream)																							TTTGTTTTACTTTTTTTTTAA	0.313													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	109793901	109793901	+	IGR	DEL	C	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109793901delC								C11orf87 (494063 upstream) : ZC3H12C (170025 downstream)																							ccccgcctaaccccaggcaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	43072603	43072603	+	IGR	DEL	T	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43072603delT								PRICKLE1 (89031 upstream) : ADAMTS20 (675410 downstream)																							AGAACTCTGCttttttttttt	0.413													9	5	---	---	---	---	
CCDC92	80212	broad.mit.edu	37	12	124427761	124427762	+	Intron	INS	-	A	A	rs148378755	by1000genomes	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124427761_124427762insA	uc001ufw.1	-						CCDC92_uc001ufv.1_Intron|CCDC92_uc001ufx.1_Intron|CCDC92_uc001ufy.1_Intron	NM_025140	NP_079416	Q53HC0	CCD92_HUMAN	coiled-coil domain containing 92												0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.0002)|OV - Ovarian serous cystadenocarcinoma(86;0.000222)|all cancers(50;0.00129)|BRCA - Breast invasive adenocarcinoma(302;0.242)		ATGAGGATGATATAAGGCATTC	0.490													4	4	---	---	---	---	
MBNL2	10150	broad.mit.edu	37	13	98009687	98009688	+	Intron	DEL	GT	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98009687_98009688delGT	uc010aft.2	+						MBNL2_uc001vmz.2_Intron|MBNL2_uc001vna.2_Intron|MBNL2_uc001vnb.2_Intron|MBNL2_uc010tij.1_Intron|MBNL2_uc001vnc.2_Intron	NM_144778	NP_659002	Q5VZF2	MBNL2_HUMAN	muscleblind-like 2 isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	cytoplasm|nucleus	RNA binding|zinc ion binding				0	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)			AACATGGAAGGTGTGTTTGCTT	0.391													30	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20086237	20086237	+	IGR	DEL	T	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20086237delT								P704P (65965 upstream) : OR4Q3 (129350 downstream)																							GGTGTGTGTGTGGGGGGGTAT	0.388													12	6	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106773997	106774002	+	Intron	DEL	CTGTCA	-	-	rs144451395		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106773997_106774002delCTGTCA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						CACGTTGTCCCTGTCACTGCCTCAGC	0.388													5	6	---	---	---	---	
GABRG3	2567	broad.mit.edu	37	15	27772540	27772540	+	Intron	DEL	T	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27772540delT	uc001zbg.1	+							NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		CTGTTGCGTGTTGCACCCTTT	0.562													25	11	---	---	---	---	
DPP8	54878	broad.mit.edu	37	15	65746475	65746475	+	Intron	DEL	A	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65746475delA	uc002aov.2	-						DPP8_uc002aow.2_Intron|DPP8_uc010uiv.1_Intron|DPP8_uc002aox.2_Intron|DPP8_uc002aoy.2_Intron|DPP8_uc002aoz.2_Intron|DPP8_uc010bhj.2_Intron|DPP8_uc002apa.2_Intron|DPP8_uc010bhi.2_Intron|DPP8_uc010bhk.1_Intron	NM_130434	NP_569118	Q6V1X1	DPP8_HUMAN	dipeptidyl peptidase 8 isoform 1						immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1						acttcgtctcaaaaaaaaaaa	0.124													5	3	---	---	---	---	
DIS3L	115752	broad.mit.edu	37	15	66624011	66624011	+	Intron	DEL	A	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66624011delA	uc010ujm.1	+						DIS3L_uc002app.2_Intron|DIS3L_uc010bho.2_Intron	NM_001143688	NP_001137160	Q8TF46	DI3L1_HUMAN	DIS3 mitotic control homolog (S.						rRNA catabolic process	cytoplasm|exosome (RNase complex)	exonuclease activity|protein binding|ribonuclease activity|RNA binding			ovary(2)	2						TTCATTTTATAAAATAATTCA	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	75544855	75544855	+	IGR	DEL	T	-	-	rs138336820		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75544855delT								C15orf39 (40347 upstream) : GOLGA6C (6044 downstream)																							tttttttttcttttttttttt	0.214													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102306788	102306790	+	5'Flank	DEL	GTA	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102306788_102306790delGTA	uc002cbx.1	-						uc002ccc.1_5'Flank|uc002ccm.1_5'Flank					DQ582460																		TTAGTCTGTTGTAGTGGTGAGCT	0.498													4	2	---	---	---	---	
CCNF	899	broad.mit.edu	37	16	2495730	2495731	+	Intron	INS	-	TT	TT	rs28663296		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2495730_2495731insTT	uc002cqd.1	+						CCNF_uc002cqe.1_Intron	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F						cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				gttttgtgttgttttttttttt	0.277													6	3	---	---	---	---	
STX1B	112755	broad.mit.edu	37	16	31004014	31004015	+	3'UTR	INS	-	GGGGTGGAGGA	GGGGTGGAGGA	rs143292802	by1000genomes	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31004014_31004015insGGGGTGGAGGA	uc010cad.2	-	10						NM_052874	NP_443106	P61266	STX1B_HUMAN	syntaxin 1B						intracellular protein transport|neurotransmitter transport|synaptic transmission	integral to plasma membrane	extracellular-glutamate-gated ion channel activity|SNAP receptor activity				0						GGTCTGCCGTGGGGGTGGGGCT	0.653													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43675430	43675431	+	IGR	INS	-	A	A	rs1724389		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43675430_43675431insA								LRRC37A4 (79914 upstream) : LOC644172 (2060 downstream)																							TACACTGTTTTTTTTTTTTTTT	0.277													4	2	---	---	---	---	
SLC25A19	60386	broad.mit.edu	37	17	73269841	73269842	+	Intron	INS	-	TTATT	TTATT	rs150528573	by1000genomes	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73269841_73269842insTTATT	uc002jns.3	-						SLC25A19_uc010dge.2_Intron|SLC25A19_uc002jnv.3_Intron|SLC25A19_uc002jnu.3_Intron|SLC25A19_uc002jnw.3_Intron|SLC25A19_uc002jnt.3_Intron	NM_021734	NP_068380	Q9HC21	TPC_HUMAN	solute carrier family 25, member 19							integral to membrane|mitochondrial inner membrane	binding|deoxynucleotide transmembrane transporter activity			ovary(1)	1	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)			AAAATAGCAAAttattttattt	0.045													5	5	---	---	---	---	
KIAA0195	9772	broad.mit.edu	37	17	73486174	73486174	+	Intron	DEL	G	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73486174delG	uc002jnz.3	+						KIAA0195_uc010wsa.1_Intron|KIAA0195_uc010wsb.1_5'Flank	NM_014738	NP_055553	Q12767	K0195_HUMAN	hypothetical protein LOC9772						ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism			ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			aaaaaaaaaagaaCACCTCTT	0.338													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	18517152	18517152	+	IGR	DEL	G	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18517152delG								None (None upstream) : ROCK1 (12553 downstream)																							tctttttgtagtatctggaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	41332291	41332291	+	IGR	DEL	C	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41332291delC								EGLN2 (17955 upstream) : CYP2A6 (17153 downstream)																							GCAGCCAGGTCCGGGGTGGGG	0.632													3	3	---	---	---	---	
NUCB1	4924	broad.mit.edu	37	19	49409198	49409202	+	Intron	DEL	CACTC	-	-	rs71903082		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49409198_49409202delCACTC	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		AGGGTGGCCTCACTCCCGGCCTCCA	0.659													9	4	---	---	---	---	
MCM8	84515	broad.mit.edu	37	20	5975125	5975126	+	3'UTR	DEL	AC	-	-	rs145346371		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5975125_5975126delAC	uc002wmi.2	+	19					MCM8_uc002wmj.2_3'UTR|MCM8_uc002wmk.2_3'UTR|MCM8_uc002wml.2_3'UTR|MCM8_uc010gbp.2_3'UTR|MCM8_uc002wmm.2_3'UTR	NM_032485	NP_115874	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8						cell cycle checkpoint|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|nucleoside-triphosphatase activity			skin(1)	1						agacagacagacacacacacac	0.257													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26113543	26113543	+	IGR	DEL	A	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26113543delA								C20orf191 (18866 upstream) : MIR663 (75279 downstream)																							TCTTTGCCTTAACAACATTAT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	21112409	21112410	+	IGR	INS	-	A	A	rs144954828	by1000genomes	TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21112409_21112410insA								None (None upstream) : None (None downstream)																							agaacaaggagagaaaaaaaaa	0.158													4	2	---	---	---	---	
PCNT	5116	broad.mit.edu	37	21	47777244	47777250	+	Intron	DEL	AGTCCCG	-	-			TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47777244_47777250delAGTCCCG	uc002zji.3	+						PCNT_uc002zjj.2_Intron	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin						cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					TAAGGGCGACAGTCCCGTAAATTCTTG	0.527													7	4	---	---	---	---	
C22orf28	51493	broad.mit.edu	37	22	32790101	32790102	+	Intron	INS	-	TT	TT	rs11396073		TCGA-56-6546-01	TCGA-56-6546-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32790101_32790102insTT	uc003amm.2	-							NM_014306	NP_055121	Q9Y3I0	RTCB_HUMAN	hypothetical protein LOC51493						cell-matrix adhesion|substrate adhesion-dependent cell spreading|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|tRNA-splicing ligase complex	ATP binding|metal ion binding|RNA ligase (ATP) activity|vinculin binding				0						ACCCAGACttcttttttttttt	0.144													5	6	---	---	---	---	
