Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	Oncotatorv0393GAF20hg19Feb2011dbSNPbuild132UniProtRelease2011_6	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	context_orig	context65	gene_name	categ	categ_ignoring_null_categ
CPN1	1369	broad.mit.edu	37	10	101841283	101841283	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:101841283T>A	uc001kql.2	-	c.100A>T	c.(100-102)ACG>TCG	p.T34S		NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor	34	Catalytic.				proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)										0.083333	0.383748	8.836319	4	44	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	101841283	101841283	3947	10	T	A	A	A	754	58	CPN1	3	3
SMC3	9126	broad.mit.edu	37	10	112356221	112356221	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:112356221G>A	uc001kze.2	+	c.2029G>A	c.(2029-2031)GAA>AAA	p.E677K		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	677	Potential.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)	2		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)										0.135802	17.092063	27.481097	11	70	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	112356221	112356221	15282	10	G	A	A	A	585	45	SMC3	2	2
AFAP1L2	84632	broad.mit.edu	37	10	116064523	116064523	+	Nonsense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:116064523G>C	uc010qse.1	-	c.1398C>G	c.(1396-1398)TAC>TAG	p.Y466*	AFAP1L2_uc001lbn.2_Nonsense_Mutation_p.Y413*|AFAP1L2_uc001lbo.2_Nonsense_Mutation_p.Y413*|AFAP1L2_uc001lbp.2_Nonsense_Mutation_p.Y441*|AFAP1L2_uc001lbr.1_Nonsense_Mutation_p.Y413*|AFAP1L2_uc010qsd.1_5'UTR|AFAP1L2_uc001lbq.1_5'Flank	NM_001001936	NP_001001936	Q8N4X5	AF1L2_HUMAN	KIAA1914 protein isoform 1	413	PH 2.				inflammatory response|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of transcription, DNA-dependent|regulation of interleukin-6 production|regulation of mitotic cell cycle	cytoplasm	protein tyrosine kinase activator activity|SH2 domain binding|SH3 domain binding			ovary(1)|breast(1)	2		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)										0.269231	18.231179	19.470139	7	19	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	116064523	116064523	356	10	G	C	C	C	464	36	AFAP1L2	5	3
TIAL1	7073	broad.mit.edu	37	10	121335210	121335210	+	Silent	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:121335210G>A	uc001lej.1	-	c.1146C>T	c.(1144-1146)GCC>GCT	p.A382A	TIAL1_uc001leh.1_Silent_p.A343A|TIAL1_uc001lei.1_Silent_p.A365A|TIAL1_uc001lek.1_Silent_p.A242A|TIAL1_uc009xzi.1_Silent_p.A234A	NM_001033925	NP_001029097	Q01085	TIAR_HUMAN	TIA-1 related protein isoform 2	365					apoptosis|defense response|induction of apoptosis|regulation of transcription from RNA polymerase II promoter	lysosome|nucleus|stress granule	nucleotide binding|RNA binding|RNA polymerase II transcription factor activity			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)										0.325	113.823939	117.065086	39	81	KEEP	---	---	---	---	capture		Silent	SNP	121335210	121335210	16417	10	G	A	A	A	496	39	TIAL1	1	1
PHYH	5264	broad.mit.edu	37	10	13325783	13325783	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:13325783C>A	uc001imf.2	-	c.735G>T	c.(733-735)CGG>CGT	p.R245R	PHYH_uc001ime.2_Silent_p.R145R|PHYH_uc001img.2_Silent_p.R228R	NM_006214	NP_006205	O14832	PAHX_HUMAN	phytanoyl-CoA 2-hydroxylase isoform a precursor	245			R -> Q (in RD; partial loss of activity).		fatty acid alpha-oxidation|nervous system development|response to stimulus|visual perception	peroxisomal matrix	electron carrier activity|L-ascorbic acid binding|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|phytanoyl-CoA dioxygenase activity|protein binding				0		Ovarian(717;0.0448)			Antihemophilic Factor(DB00025)|Vitamin C(DB00126)									0.246154	117.103028	128.551577	48	147	KEEP	---	---	---	---	capture		Silent	SNP	13325783	13325783	12288	10	C	A	A	A	275	22	PHYH	2	2
OLAH	55301	broad.mit.edu	37	10	15103770	15103770	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:15103770C>A	uc001int.2	+	c.370C>A	c.(370-372)CTT>ATT	p.L124I	ACBD7_uc010qby.1_Intron|OLAH_uc001inu.2_Missense_Mutation_p.L71I	NM_018324	NP_060794	Q9NV23	SAST_HUMAN	oleoyl-ACP hydrolase isoform 1	71					fatty acid biosynthetic process		myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity				0														0.25	54.988103	60.716685	25	75	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	15103770	15103770	11256	10	C	A	A	A	416	32	OLAH	2	2
ZEB1	6935	broad.mit.edu	37	10	31809063	31809063	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:31809063C>A	uc001ivu.3	+	c.803C>A	c.(802-804)CCA>CAA	p.P268Q	ZEB1_uc001ivr.3_Missense_Mutation_p.P49Q|ZEB1_uc010qee.1_Missense_Mutation_p.P49Q|ZEB1_uc010qef.1_Missense_Mutation_p.P49Q|ZEB1_uc009xlj.1_Missense_Mutation_p.P193Q|ZEB1_uc010qeg.1_Missense_Mutation_p.P126Q|ZEB1_uc009xlk.1_Missense_Mutation_p.P49Q|ZEB1_uc001ivs.3_Missense_Mutation_p.P267Q|ZEB1_uc001ivt.3_Missense_Mutation_p.P49Q|ZEB1_uc001ivv.3_Missense_Mutation_p.P247Q|ZEB1_uc010qeh.1_Missense_Mutation_p.P200Q|ZEB1_uc009xlo.1_Missense_Mutation_p.P250Q|ZEB1_uc009xlp.2_Missense_Mutation_p.P251Q	NM_030751	NP_001121600	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b	267					cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter	cytoplasm	sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|transcription repressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)				Ovarian(40;423 959 14296 36701 49589)								0.3125	27.837303	28.839425	10	22	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	31809063	31809063	18211	10	C	A	A	A	273	21	ZEB1	2	2
C10orf71	118461	broad.mit.edu	37	10	50531444	50531444	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:50531444C>A	uc010qgp.1	+	c.854C>A	c.(853-855)CCA>CAA	p.P285Q		NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2	285											0														0.222222	10.795102	12.069271	4	14	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	50531444	50531444	1651	10	C	A	A	A	273	21	C10orf71	2	2
AIFM2	84883	broad.mit.edu	37	10	71880924	71880924	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:71880924C>A	uc010qjg.1	-	c.338G>T	c.(337-339)GGG>GTG	p.G113V	AIFM2_uc001jqp.1_Missense_Mutation_p.G113V	NM_032797	NP_116186	Q9BRQ8	AIFM2_HUMAN	apoptosis-inducing factor (AIF)-like	113					apoptotic mitochondrial changes|chromosome condensation|induction of apoptosis|oxidation-reduction process	cytosol|integral to membrane|mitochondrial outer membrane	DNA binding|electron-transferring-flavoprotein dehydrogenase activity|flavin adenine dinucleotide binding			central_nervous_system(1)	1														0.216216	17.981968	20.729989	8	29	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	71880924	71880924	430	10	C	A	A	A	286	22	AIFM2	2	2
PLCE1	51196	broad.mit.edu	37	10	95994067	95994067	+	Nonsense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:95994067G>T	uc001kjk.2	+	c.2212G>T	c.(2212-2214)GAG>TAG	p.E738*	PLCE1_uc010qnx.1_Nonsense_Mutation_p.E738*|PLCE1_uc001kjm.2_Nonsense_Mutation_p.E430*	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	738	Ras-GEF.				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|phospholipid metabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)												0.195122	15.579581	19.132917	8	33	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	95994067	95994067	12460	10	G	T	T	T	429	33	PLCE1	5	2
RRP12	23223	broad.mit.edu	37	10	99126615	99126615	+	Silent	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:99126615G>C	uc001knf.2	-	c.3099C>G	c.(3097-3099)GTC>GTG	p.V1033V	RRP12_uc001kne.2_Silent_p.V48V|RRP12_uc009xvl.2_Silent_p.V150V|RRP12_uc009xvm.2_Silent_p.V751V|RRP12_uc010qou.1_Silent_p.V972V|RRP12_uc009xvn.2_Silent_p.V933V	NM_015179	NP_055994	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog isoform 1	1033						integral to membrane|nuclear membrane|nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)										0.069767	-3.985024	20.631713	9	120	KEEP	---	---	---	---	capture		Silent	SNP	99126615	99126615	14166	10	G	C	C	C	574	45	RRP12	3	3
ALG9	79796	broad.mit.edu	37	11	111657158	111657158	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:111657158C>A	uc010rwm.1	-	c.1820G>T	c.(1819-1821)CGG>CTG	p.R607L	ALG9_uc001ply.2_Missense_Mutation_p.R429L|ALG9_uc001plz.2_Missense_Mutation_p.R436L|ALG9_uc001pmb.2_Missense_Mutation_p.R600L|ALG9_uc010rwn.1_3'UTR|ALG9_uc010rwo.1_Missense_Mutation_p.R428L	NM_024740	NP_079016	Q9H6U8	ALG9_HUMAN	asparagine-linked glycosylation 9 protein	600	Lumenal (Potential).				dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			large_intestine(1)|ovary(1)	2		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)										0.327869	122.385146	125.57685	40	82	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	111657158	111657158	527	11	C	A	A	A	299	23	ALG9	1	1
DSCAML1	57453	broad.mit.edu	37	11	117647604	117647604	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:117647604C>A	uc001prh.1	-	c.593G>T	c.(592-594)CGT>CTT	p.R198L	DSCAML1_uc001pri.1_Missense_Mutation_p.R2L	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	138	Extracellular (Potential).|Ig-like C2-type 2.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)	5	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)										0.2	13.163662	15.253759	5	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	117647604	117647604	4953	11	C	A	A	A	247	19	DSCAML1	1	1
TMEM225	338661	broad.mit.edu	37	11	123755300	123755300	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:123755300G>T	uc001pzi.2	-	c.225C>A	c.(223-225)GGC>GGA	p.G75G		NM_001013743	NP_001013765	Q6GV28	TM225_HUMAN	transmembrane protein 225	75	Helical; (Potential).					integral to membrane				pancreas(1)	1														0.27027	51.174783	54.693689	20	54	KEEP	---	---	---	---	capture		Silent	SNP	123755300	123755300	16683	11	G	T	T	T	535	42	TMEM225	2	2
OR10G7	390265	broad.mit.edu	37	11	123909454	123909454	+	Silent	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:123909454G>C	uc001pzq.1	-	c.255C>G	c.(253-255)TCC>TCG	p.S85S		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)										0.213115	82.944168	96.857098	39	144	KEEP	---	---	---	---	capture		Silent	SNP	123909454	123909454	11308	11	G	C	C	C	548	43	OR10G7	3	3
FEZ1	9638	broad.mit.edu	37	11	125325762	125325762	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:125325762C>A	uc001qbx.2	-	c.908G>T	c.(907-909)CGG>CTG	p.R303L	FEZ1_uc001qbw.2_Missense_Mutation_p.R93L|FEZ1_uc010sbc.1_Missense_Mutation_p.R274L	NM_005103	NP_005094	Q99689	FEZ1_HUMAN	zygin 1 isoform 1	303					axon guidance|cell adhesion|transport	microtubule|plasma membrane				central_nervous_system(3)|ovary(1)	4	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		Melanoma(180;509 2033 10762 15939 24711)								0.331288	166.514949	170.615829	54	109	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	125325762	125325762	6060	11	C	A	A	A	299	23	FEZ1	1	1
BARX2	8538	broad.mit.edu	37	11	129246011	129246011	+	Silent	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:129246011C>T	uc001qfc.3	+	c.81C>T	c.(79-81)ATC>ATT	p.I27I		NM_003658	NP_003649	Q9UMQ3	BARX2_HUMAN	BarH-like homeobox 2	27							transcription regulator activity				0	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)								OREG0021508	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.301587	102.183106	106.626525	38	88	KEEP	---	---	---	---	capture		Silent	SNP	129246011	129246011	1337	11	C	T	T	T	395	31	BARX2	1	1
KCNJ11	3767	broad.mit.edu	37	11	17409336	17409336	+	Silent	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:17409336G>A	uc001mna.2	-	c.303C>T	c.(301-303)GCC>GCT	p.A101A	KCNJ11_uc001mnb.3_Silent_p.A14A	NM_000525	NP_000516	E9PNK0	E9PNK0_HUMAN	potassium inwardly-rectifying channel J11	14						membrane	ATP-activated inward rectifier potassium channel activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)										0.103448	2.305443	6.847594	3	26	KEEP	---	---	---	---	capture		Silent	SNP	17409336	17409336	8350	11	G	A	A	A	548	43	KCNJ11	2	2
SAAL1	113174	broad.mit.edu	37	11	18103004	18103004	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:18103004T>A	uc009yhf.2	-	c.1292A>T	c.(1291-1293)AAG>ATG	p.K431M	SAAL1_uc001mnq.2_Missense_Mutation_p.K429M|SAAL1_uc001mnr.2_Missense_Mutation_p.K428M|SAAL1_uc001mns.2_Non-coding_Transcript	NM_138421	NP_612430	Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	429					acute-phase response	extracellular region	binding				0														0.345238	82.180111	83.94261	29	55	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	18103004	18103004	14281	11	T	A	A	A	728	56	SAAL1	3	3
NAV2	89797	broad.mit.edu	37	11	19955296	19955296	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:19955296G>T	uc001mpr.3	+	c.1506G>T	c.(1504-1506)AAG>AAT	p.K502N	NAV2_uc001mpp.2_Missense_Mutation_p.K438N|NAV2_uc010rdm.1_Missense_Mutation_p.K525N	NM_182964	NP_892009	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 1	525	Potential.					nucleus	ATP binding|helicase activity			ovary(1)|pancreas(1)	2														0.298246	44.950332	47.025844	17	40	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	19955296	19955296	10580	11	G	T	T	T	451	35	NAV2	2	2
NAV2	89797	broad.mit.edu	37	11	20067038	20067038	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:20067038C>G	uc001mpr.3	+	c.3724C>G	c.(3724-3726)CTA>GTA	p.L1242V	NAV2_uc001mpp.2_Missense_Mutation_p.L1178V|NAV2_uc010rdm.1_Missense_Mutation_p.L1265V|NAV2_uc001mpt.2_Missense_Mutation_p.L328V|NAV2_uc009yhx.2_Missense_Mutation_p.L328V|NAV2_uc009yhy.1_Missense_Mutation_p.L241V	NM_182964	NP_892009	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 1	1265						nucleus	ATP binding|helicase activity			ovary(1)|pancreas(1)	2														0.285714	29.874448	31.611085	12	30	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20067038	20067038	10580	11	C	G	G	G	415	32	NAV2	3	3
LDLRAD3	143458	broad.mit.edu	37	11	36248704	36248704	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:36248704C>T	uc001mwk.1	+	c.524C>T	c.(523-525)GCC>GTC	p.A175V	LDLRAD3_uc010rey.1_Missense_Mutation_p.A126V|LDLRAD3_uc010rez.1_Missense_Mutation_p.A54V|LDLRAD3_uc010rfa.1_Intron	NM_174902	NP_777562	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain	175	Helical; (Potential).					integral to membrane	receptor activity			central_nervous_system(1)	1	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)												0.2	45.076048	53.823764	21	84	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	36248704	36248704	9031	11	C	T	T	T	338	26	LDLRAD3	2	2
LRRC4C	57689	broad.mit.edu	37	11	40137021	40137021	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:40137021C>A	uc001mxa.1	-	c.822G>T	c.(820-822)CTG>CTT	p.L274L	LRRC4C_uc001mxc.1_Silent_p.L270L|LRRC4C_uc001mxd.1_Silent_p.L270L|LRRC4C_uc001mxb.1_Silent_p.L270L	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	274	LRR 9.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5		all_lung(304;0.0575)|Lung NSC(402;0.138)												0.370787	101.676197	102.972076	33	56	KEEP	---	---	---	---	capture		Silent	SNP	40137021	40137021	9383	11	C	A	A	A	262	21	LRRC4C	2	2
ARHGAP1	392	broad.mit.edu	37	11	46702216	46702216	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:46702216G>T	uc001ndd.2	-	c.717C>A	c.(715-717)AAC>AAA	p.N239K		NM_004308	NP_004299	Q07960	RHG01_HUMAN	Rho GTPase activating protein 1	239					Rho protein signal transduction	cytosol|intracellular membrane-bounded organelle	SH3 domain binding|SH3/SH2 adaptor activity			skin(1)	1		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)										0.285714	17.98141	19.140861	8	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	46702216	46702216	872	11	G	T	T	T	568	44	ARHGAP1	2	2
ZNF408	79797	broad.mit.edu	37	11	46727238	46727238	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:46727238G>T	uc001nde.1	+	c.1988G>T	c.(1987-1989)AGA>ATA	p.R663I	ZNF408_uc010rgw.1_Missense_Mutation_p.R655I	NM_024741	NP_079017	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	663					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|identical protein binding|zinc ion binding				0						Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)								0.178571	9.160284	11.882127	5	23	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	46727238	46727238	18481	11	G	T	T	T	429	33	ZNF408	2	2
HBB	3043	broad.mit.edu	37	11	5246887	5246887	+	Missense_Mutation	SNP	C	A	A	rs34139813		TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:5246887C>A	uc001mae.1	-	c.385G>T	c.(385-387)GCT>TCT	p.A129S		NM_000518	NP_000509	P68871	HBB_HUMAN	beta globin	129			A -> D (in J-Guantanamo; unstable).		blood coagulation|hydrogen peroxide catabolic process|nitric oxide transport|positive regulation of cell death|positive regulation of nitric oxide biosynthetic process|protein heterooligomerization|regulation of blood pressure|regulation of blood vessel size	haptoglobin-hemoglobin complex|hemoglobin complex	heme binding|hemoglobin binding|oxygen binding|oxygen transporter activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	Iron Dextran(DB00893)									0.368421	61.305379	62.154102	21	36	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	5246887	5246887	7260	11	C	A	A	A	338	26	HBB	2	2
OR8I2	120586	broad.mit.edu	37	11	55860845	55860845	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:55860845C>G	uc010rix.1	+	c.62C>G	c.(61-63)CCT>CGT	p.P21R		NM_001003750	NP_001003750	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I,	21	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1	Esophageal squamous(21;0.00693)													0.221591	85.863504	98.400001	39	137	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55860845	55860845	11651	11	C	G	G	G	312	24	OR8I2	3	3
OR5J2	282775	broad.mit.edu	37	11	55944979	55944979	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:55944979G>C	uc010rjb.1	+	c.886G>C	c.(886-888)GAC>CAC	p.D296H		NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J,	296	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4	Esophageal squamous(21;0.00693)													0.278689	48.349863	51.036998	17	44	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55944979	55944979	11575	11	G	C	C	C	533	41	OR5J2	3	3
OR9G4	283189	broad.mit.edu	37	11	56510579	56510579	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:56510579G>A	uc010rjo.1	-	c.709C>T	c.(709-711)CTC>TTC	p.L237F		NM_001005284	NP_001005284	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G,	237	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2														0.266667	45.729165	48.644105	16	44	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	56510579	56510579	11662	11	G	A	A	A	455	35	OR9G4	2	2
MS4A14	84689	broad.mit.edu	37	11	60182961	60182961	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:60182961C>A	uc001npj.2	+	c.520C>A	c.(520-522)CCA>ACA	p.P174T	MS4A14_uc001npi.2_Missense_Mutation_p.P62T|MS4A14_uc001npn.2_5'UTR|MS4A14_uc001npk.2_Missense_Mutation_p.P157T|MS4A14_uc001npl.2_5'UTR|MS4A14_uc001npm.2_5'UTR	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	174						integral to membrane	receptor activity			breast(1)	1														0.247059	51.78866	56.701785	21	64	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	60182961	60182961	10251	11	C	A	A	A	286	22	MS4A14	2	2
ATG2A	23130	broad.mit.edu	37	11	64662491	64662491	+	Missense_Mutation	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:64662491T>C	uc001obx.2	-	c.5771A>G	c.(5770-5772)CAC>CGC	p.H1924R	ATG2A_uc001obw.2_Missense_Mutation_p.H689R	NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1924							protein binding			ovary(1)|central_nervous_system(1)	2														0.270588	59.588016	63.623369	23	62	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	64662491	64662491	1112	11	T	C	C	C	767	59	ATG2A	4	4
CARNS1	57571	broad.mit.edu	37	11	67191318	67191318	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:67191318G>A	uc001olc.3	+	c.2147G>A	c.(2146-2148)CGG>CAG	p.R716Q	PPP1CA_uc001okx.1_5'Flank|CARNS1_uc009yrp.2_Missense_Mutation_p.R577Q	NM_020811	NP_065862	A5YM72	CRNS1_HUMAN	ATP-grasp domain containing 1	577	ATP-grasp.|ATP (By similarity).				carnosine biosynthetic process		ATP binding|carnosine synthase activity|metal ion binding				0														0.391304	25.076595	25.311856	9	14	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	67191318	67191318	2775	11	G	A	A	A	507	39	CARNS1	1	1
MTL5	9633	broad.mit.edu	37	11	68480780	68480780	+	Nonsense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:68480780G>T	uc001ooc.2	-	c.1116C>A	c.(1114-1116)TGC>TGA	p.C372*		NM_004923	NP_004914	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific isoform	372	CXC 2.				cell differentiation|cellular metal ion homeostasis|multicellular organismal development|response to metal ion|spermatogenesis	cytoplasm|nucleus|soluble fraction	metal ion binding			ovary(2)|breast(1)	3	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)											0.319048	190.583443	196.73334	67	143	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	68480780	68480780	10329	11	G	T	T	T	594	46	MTL5	5	2
ARAP1	116985	broad.mit.edu	37	11	72421536	72421536	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:72421536C>A	uc001osu.2	-	c.1310G>T	c.(1309-1311)GGC>GTC	p.G437V	ARAP1_uc001osv.2_Missense_Mutation_p.G437V|ARAP1_uc001osr.2_Missense_Mutation_p.G197V|ARAP1_uc001oss.2_Missense_Mutation_p.G192V|ARAP1_uc009yth.2_Missense_Mutation_p.G192V|ARAP1_uc010rre.1_Missense_Mutation_p.G192V	NM_001040118	NP_001035207	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	437					actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding				0						Ovarian(102;1198 1520 13195 17913 37529)								0.309091	87.214528	90.784342	34	76	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72421536	72421536	849	11	C	A	A	A	338	26	ARAP1	2	2
KLHL35	283212	broad.mit.edu	37	11	75136592	75136592	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:75136592C>T	uc001owm.1	-	c.560G>A	c.(559-561)CGC>CAC	p.R187H		NM_001039548	NP_001034637	Q6PF15	KLH35_HUMAN	kelch-like 35	187	Kelch 3.										0						Colon(77;683 1691 18820 23811)								0.6	10.226237	10.270096	3	2	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	75136592	75136592	8702	11	C	T	T	T	351	27	KLHL35	1	1
NARS2	79731	broad.mit.edu	37	11	78204204	78204204	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:78204204G>C	uc001ozi.2	-	c.727C>G	c.(727-729)CGA>GGA	p.R243G	NARS2_uc010rsq.1_Missense_Mutation_p.R16G	NM_024678	NP_078954	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial	243					asparaginyl-tRNA aminoacylation|aspartyl-tRNA aminoacylation	mitochondrial matrix	asparagine-tRNA ligase activity|aspartate-tRNA ligase activity|ATP binding|nucleic acid binding			ovary(2)	2	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)									0.097561	3.638969	16.941006	8	74	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	78204204	78204204	10567	11	G	C	C	C	506	39	NARS2	3	3
DLG2	1740	broad.mit.edu	37	11	83344258	83344258	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:83344258C>T	uc001pak.2	-	c.1936G>A	c.(1936-1938)GTC>ATC	p.V646I	DLG2_uc001pai.2_Missense_Mutation_p.V438I|DLG2_uc010rsy.1_Missense_Mutation_p.V508I|DLG2_uc001paj.2_Missense_Mutation_p.V541I|DLG2_uc010rsz.1_Missense_Mutation_p.V541I|DLG2_uc010rta.1_Missense_Mutation_p.V541I|DLG2_uc010rtb.1_Missense_Mutation_p.V508I|DLG2_uc001pal.1_Missense_Mutation_p.V541I|DLG2_uc010rsw.1_Missense_Mutation_p.V23I|DLG2_uc010rsx.1_Missense_Mutation_p.V22I	NM_001142699	NP_001136171	Q15700	DLG2_HUMAN	chapsyn-110 isoform 1	541	SH3.					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)	5		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)												0.227273	25.129616	28.131517	10	34	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	83344258	83344258	4735	11	C	T	T	T	247	19	DLG2	1	1
TYR	7299	broad.mit.edu	37	11	88911788	88911788	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:88911788C>A	uc001pcs.2	+	c.667C>A	c.(667-669)CAG>AAG	p.Q223K		NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor	223	Lumenal, melanosome (Potential).				eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|oxidation-reduction process|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)									0.402062	116.31555	117.12451	39	58	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	88911788	88911788	17370	11	C	A	A	A	273	21	TYR	2	2
AP2A2	161	broad.mit.edu	37	11	988579	988579	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:988579C>T	uc001lss.2	+	c.1159C>T	c.(1159-1161)CGG>TGG	p.R387W	AP2A2_uc001lst.1_Missense_Mutation_p.R388W|AP2A2_uc009yco.1_Non-coding_Transcript	NM_012305	NP_036437	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2	387					axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|cytosol	lipid binding|protein transporter activity				0		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)										0.295455	103.470682	108.356432	39	93	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	988579	988579	750	11	C	T	T	T	347	27	AP2A2	1	1
SLC5A8	160728	broad.mit.edu	37	12	101603528	101603528	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:101603528G>T	uc001thz.3	-	c.99C>A	c.(97-99)GCC>GCA	p.A33A		NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),	33	Cytoplasmic (Potential).				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						GBM(60;420 1056 13605 22380 47675)								0.30303	26.356271	27.488644	10	23	KEEP	---	---	---	---	capture		Silent	SNP	101603528	101603528	15168	12	G	T	T	T	444	35	SLC5A8	2	2
STAB2	55576	broad.mit.edu	37	12	104084208	104084208	+	Missense_Mutation	SNP	T	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:104084208T>G	uc001tjw.2	+	c.3189T>G	c.(3187-3189)CAT>CAG	p.H1063Q		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1063	Extracellular (Potential).|FAS1 3.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(1)	10														0.245902	42.602622	46.183816	15	46	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	104084208	104084208	15756	12	T	G	G	G	634	49	STAB2	4	4
FOXN4	121643	broad.mit.edu	37	12	109723211	109723211	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:109723211G>C	uc001toe.3	-	c.799C>G	c.(799-801)CTG>GTG	p.L267V	FOXN4_uc009zvg.2_Missense_Mutation_p.L64V|FOXN4_uc001tof.3_Missense_Mutation_p.L87V	NM_213596	NP_998761	Q96NZ1	FOXN4_HUMAN	forkhead box N4	267	Fork-head.				axon extension|embryo development|negative regulation of gene-specific transcription from RNA polymerase II promoter|organ development|pattern specification process|positive regulation of gene-specific transcription|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|lung(1)	2														0.433333	38.537677	38.658786	13	17	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	109723211	109723211	6268	12	G	C	C	C	451	35	FOXN4	3	3
GATC	283459	broad.mit.edu	37	12	120884581	120884582	+	Missense_Mutation	DNP	GC	TT	TT			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:120884581_120884582GC>TT	uc010szi.1	+	c.203_204GC>TT	c.(202-204)CGC>CTT	p.R68L	TRIAP1_uc001tyg.2_5'Flank	NM_176818	NP_789788	O43716	GATCL_HUMAN	glutamyl-tRNA(Gln) amidotransferase, subunit C	68					regulation of translational fidelity						0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)													0.216667	32.04701	36.486613	13	47	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	120884581	120884582	6526	12	GC	TT	TT	TT	494	38	GATC	1	1
SLCO1A2	6579	broad.mit.edu	37	12	21446879	21446879	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:21446879C>A	uc001rer.2	-	c.1437G>T	c.(1435-1437)ATG>ATT	p.M479I	SLCO1A2_uc001res.2_Missense_Mutation_p.M479I|SLCO1A2_uc010siq.1_Missense_Mutation_p.M347I|SLCO1A2_uc010sio.1_Missense_Mutation_p.M347I|SLCO1A2_uc010sip.1_Missense_Mutation_p.M347I|SLCO1A2_uc001ret.2_Missense_Mutation_p.M477I	NM_021094	NP_066580	P46721	SO1A2_HUMAN	organic anion transporting polypeptide A	479	Extracellular (Potential).|Kazal-like.				bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|ovary(1)|pancreas(1)	3														0.194444	16.032841	19.146311	7	29	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	21446879	21446879	15219	12	C	A	A	A	273	21	SLCO1A2	2	2
ST8SIA1	6489	broad.mit.edu	37	12	22487122	22487122	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:22487122G>T	uc001rfo.3	-	c.45C>A	c.(43-45)GCC>GCA	p.A15A	ST8SIA1_uc009zix.2_5'UTR	NM_003034	NP_003025	Q92185	SIA8A_HUMAN	alpha-2,8-sialyltransferase 1	15	Cytoplasmic (Potential).				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(3)	3														0.211538	22.881664	26.903158	11	41	KEEP	---	---	---	---	capture		Silent	SNP	22487122	22487122	15749	12	G	T	T	T	600	47	ST8SIA1	2	2
FAR2	55711	broad.mit.edu	37	12	29450055	29450055	+	Nonsense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:29450055C>G	uc001ris.3	+	c.467C>G	c.(466-468)TCA>TGA	p.S156*	FAR2_uc001rit.2_Nonsense_Mutation_p.S156*|FAR2_uc009zjm.2_Nonsense_Mutation_p.S59*	NM_018099	NP_060569	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	156					ether lipid biosynthetic process|oxidation-reduction process	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor				0														0.128788	24.345048	42.173262	17	115	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	29450055	29450055	5911	12	C	G	G	G	377	29	FAR2	5	3
TMTC1	83857	broad.mit.edu	37	12	29786214	29786214	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:29786214C>G	uc001rjb.2	-	c.670G>C	c.(670-672)GTG>CTG	p.V224L	TMTC1_uc001riz.2_5'UTR|TMTC1_uc001rja.2_Missense_Mutation_p.V68L|TMTC1_uc001rjc.1_Missense_Mutation_p.V286L	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	224	Helical; (Potential).					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)													0.153846	11.828846	16.29384	6	33	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	29786214	29786214	16801	12	C	G	G	G	247	19	TMTC1	3	3
DENND5B	160518	broad.mit.edu	37	12	31632903	31632903	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:31632903C>A	uc001rkh.1	-	c.629G>T	c.(628-630)CGA>CTA	p.R210L	DENND5B_uc001rki.1_Missense_Mutation_p.R175L|DENND5B_uc009zjq.1_Missense_Mutation_p.R94L|DENND5B_uc001rkj.2_Missense_Mutation_p.R197L|DENND5B_uc001rkk.1_Missense_Mutation_p.R97L	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	175						integral to membrane				ovary(1)|central_nervous_system(1)	2														0.285714	76.168694	80.201637	28	70	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	31632903	31632903	4616	12	C	A	A	A	403	31	DENND5B	1	1
ABCD2	225	broad.mit.edu	37	12	39998605	39998605	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:39998605G>T	uc001rmb.2	-	c.1364C>A	c.(1363-1365)GCT>GAT	p.A455D		NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D, member 2	455					fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4														0.312	111.597927	115.521448	39	86	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	39998605	39998605	62	12	G	T	T	T	442	34	ABCD2	2	2
SLC38A2	54407	broad.mit.edu	37	12	46756848	46756848	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:46756848C>A	uc001rpg.2	-	c.1135G>T	c.(1135-1137)GTG>TTG	p.V379L	SLC38A2_uc010sli.1_Missense_Mutation_p.V217L|SLC38A2_uc001rph.2_Missense_Mutation_p.V279L	NM_018976	NP_061849	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	379	Helical; (Potential).				cellular nitrogen compound metabolic process|glutamate secretion|neurotransmitter secretion|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			urinary_tract(1)|skin(1)	2	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		Ovarian(9;448 492 8335 28722 40361)								0.253012	60.036433	64.632326	21	62	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	46756848	46756848	15101	12	C	A	A	A	221	17	SLC38A2	2	2
KRT86	3892	broad.mit.edu	37	12	52695778	52695778	+	Nonsense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:52695778C>A	uc010snq.1	+	c.78C>A	c.(76-78)TGC>TGA	p.C26*	KRT86_uc009zmg.2_Nonsense_Mutation_p.C26*|KRT81_uc001sac.2_Intron|KRT86_uc001sad.2_Nonsense_Mutation_p.C26*	NM_002284	NP_002275	O43790	KRT86_HUMAN	keratin 86	26	Head.				cytoskeleton organization	keratin filament	structural molecule activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(357;0.189)										0.333333	56.766225	58.309985	21	42	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	52695778	52695778	8815	12	C	A	A	A	324	25	KRT86	5	2
KRT6A	3853	broad.mit.edu	37	12	52884697	52884697	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:52884697G>C	uc001sam.2	-	c.857C>G	c.(856-858)GCC>GGC	p.A286G		NM_005554	NP_005545	P02538	K2C6A_HUMAN	keratin 6A	286	Coil 1B.|Rod.				cell differentiation|ectoderm development|positive regulation of cell proliferation	keratin filament	protein binding|structural constituent of cytoskeleton			ovary(4)	4				BRCA - Breast invasive adenocarcinoma(357;0.189)										0.288136	48.86408	51.231218	17	42	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	52884697	52884697	8795	12	G	C	C	C	546	42	KRT6A	3	3
HOXC10	3226	broad.mit.edu	37	12	54379688	54379688	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:54379688G>T	uc001sen.2	+	c.645G>T	c.(643-645)AAG>AAT	p.K215N		NM_017409	NP_059105	Q9NYD6	HXC10_HUMAN	homeobox C10	215					positive regulation of cell proliferation|regulation of transcription, DNA-dependent	nucleus	RNA polymerase II transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1														0.319149	39.807193	41.17401	15	32	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	54379688	54379688	7601	12	G	T	T	T	425	33	HOXC10	2	2
ITGA7	3679	broad.mit.edu	37	12	56081788	56081788	+	Silent	SNP	C	G	G	rs114735704	by1000genomes	TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:56081788C>G	uc001shh.2	-	c.3162G>C	c.(3160-3162)CTG>CTC	p.L1054L	ITGA7_uc001shg.2_Silent_p.L1050L|ITGA7_uc010sps.1_Silent_p.L957L|ITGA7_uc001shf.2_Silent_p.L28L|ITGA7_uc009znw.2_Silent_p.L297L|ITGA7_uc009znx.2_Silent_p.L931L	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor	1094	Helical; (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4									p.L1054L(SJSA1-Tumor)	261				0.224138	53.885441	62.013533	26	90	KEEP	---	---	---	---	capture		Silent	SNP	56081788	56081788	8185	12	C	G	G	G	262	21	ITGA7	3	3
GEFT	115557	broad.mit.edu	37	12	58009719	58009719	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:58009719C>A	uc009zpy.2	+	c.1456C>A	c.(1456-1458)CAG>AAG	p.Q486K	GEFT_uc001spb.2_Missense_Mutation_p.Q447K|GEFT_uc001spa.2_Missense_Mutation_p.Q341K|GEFT_uc001spd.2_Missense_Mutation_p.Q152K	NM_001111270	NP_001104740	Q86VW2	ARHGP_HUMAN	RhoA/RAC/CDC42 exchange factor isoform 3	447	PH.				regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity				0	Melanoma(17;0.122)													0.283333	91.647087	96.678217	34	86	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	58009719	58009719	6596	12	C	A	A	A	325	25	GEFT	2	2
TSPAN31	6302	broad.mit.edu	37	12	58140819	58140819	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:58140819C>T	uc001spt.2	+	c.463C>T	c.(463-465)CCC>TCC	p.P155S	TSPAN31_uc009zqb.2_Missense_Mutation_p.P71S|TSPAN31_uc010ssa.1_Missense_Mutation_p.P77S	NM_005981	NP_005972	Q12999	TSN31_HUMAN	sarcoma amplified sequence	155	Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane|membrane fraction					0	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)											0.11215	14.952578	30.825105	12	95	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	58140819	58140819	17197	12	C	T	T	T	286	22	TSPAN31	2	2
VWF	7450	broad.mit.edu	37	12	6131129	6131129	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:6131129C>A	uc001qnn.1	-	c.3611G>T	c.(3610-3612)CGG>CTG	p.R1204L	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1204					blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			ovary(3)|pancreas(2)|breast(1)|central_nervous_system(1)	7					Antihemophilic Factor(DB00025)									0.213235	70.749477	81.060145	29	107	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	6131129	6131129	17818	12	C	A	A	A	299	23	VWF	1	1
AVPR1A	552	broad.mit.edu	37	12	63541201	63541201	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:63541201C>A	uc001sro.1	-	c.1195G>T	c.(1195-1197)GGT>TGT	p.G399C		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	399	Cytoplasmic (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)									0.294574	103.192638	108.06807	38	91	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	63541201	63541201	1252	12	C	A	A	A	286	22	AVPR1A	2	2
AVPR1A	552	broad.mit.edu	37	12	63544414	63544414	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:63544414C>A	uc001sro.1	-	c.203G>T	c.(202-204)GGC>GTC	p.G68V		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	68	Helical; Name=1; (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)									0.288462	39.096649	41.188409	15	37	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	63544414	63544414	1252	12	C	A	A	A	338	26	AVPR1A	2	2
TPH2	121278	broad.mit.edu	37	12	72366394	72366394	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:72366394C>A	uc009zrw.1	+	c.704C>A	c.(703-705)GCT>GAT	p.A235D	TPH2_uc001swy.2_Missense_Mutation_p.A145D	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	235					aromatic amino acid family metabolic process|hormone biosynthetic process|oxidation-reduction process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity			ovary(2)|central_nervous_system(1)	3					L-Tryptophan(DB00150)									0.290698	269.129044	282.659666	100	244	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72366394	72366394	16946	12	C	A	A	A	364	28	TPH2	2	2
BBS10	79738	broad.mit.edu	37	12	76740229	76740229	+	Silent	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:76740229T>C	uc001syd.1	-	c.1536A>G	c.(1534-1536)ACA>ACG	p.T512T		NM_024685	NP_078961	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	512					cellular protein metabolic process|photoreceptor cell maintenance|response to stimulus|retina homeostasis|sensory cilium assembly	cilium	ATP binding			ovary(1)	1														0.258993	88.533957	95.851276	36	103	KEEP	---	---	---	---	capture		Silent	SNP	76740229	76740229	1357	12	T	C	C	C	756	59	BBS10	4	4
C3AR1	719	broad.mit.edu	37	12	8212211	8212211	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:8212211G>T	uc001qtv.1	-	c.571C>A	c.(571-573)CCA>ACA	p.P191T		NM_004054	NP_004045	Q16581	C3AR_HUMAN	complement component 3a receptor 1	191	Extracellular (Potential).				blood circulation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response	integral to plasma membrane	C3a anaphylatoxin receptor activity|complement component C3a receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)	1				Kidney(36;0.0893)										0.386364	95.220932	96.219472	34	54	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	8212211	8212211	2297	12	G	T	T	T	533	41	C3AR1	2	2
GALNT4	8693	broad.mit.edu	37	12	89916817	89916817	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:89916817C>T	uc001tbd.2	-	c.1510G>A	c.(1510-1512)GCA>ACA	p.A504T	POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc001tbc.2_Intron|POC1B_uc010sun.1_Intron|GALNT4_uc001tbe.2_Missense_Mutation_p.A501T|GALNT4_uc010suo.1_Missense_Mutation_p.A196T	NM_003774	NP_003765	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	504	Ricin B-type lectin.|Lumenal (Potential).				carbohydrate metabolic process	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0														0.25	21.657911	23.703327	9	27	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	89916817	89916817	6479	12	C	T	T	T	325	25	GALNT4	2	2
PZP	5858	broad.mit.edu	37	12	9303276	9303276	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:9303276G>C	uc001qvl.2	-	c.4348C>G	c.(4348-4350)CCA>GCA	p.P1450A	PZP_uc009zgl.2_Missense_Mutation_p.P1236A	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|large_intestine(1)	4						Melanoma(125;1402 1695 4685 34487 38571)								0.140351	14.203087	21.290041	8	49	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	9303276	9303276	13327	12	G	C	C	C	546	42	PZP	3	3
CLYBL	171425	broad.mit.edu	37	13	100518493	100518493	+	Splice_Site_SNP	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:100518493G>T	uc001vok.2	+	c.635_splice	c.e6-1	p.G212_splice	CLYBL_uc010tix.1_Splice_Site_SNP_p.V213_splice|CLYBL_uc010tiy.1_Splice_Site_SNP_p.G178_splice	NM_206808	NP_996531			citrate lyase beta like precursor						cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)													0.378788	74.261865	75.11156	25	41	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	100518493	100518493	3711	13	G	T	T	T	455	35	CLYBL	5	2
LIG4	3981	broad.mit.edu	37	13	108861556	108861556	+	Silent	SNP	A	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:108861556A>C	uc001vqn.2	-	c.2061T>G	c.(2059-2061)GGT>GGG	p.G687G	LIG4_uc001vqo.2_Silent_p.G687G|LIG4_uc010agg.1_Silent_p.G620G|LIG4_uc010agf.2_Silent_p.G687G|LIG4_uc001vqp.2_Silent_p.G687G	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	687	BRCT 1.				cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)													0.372881	67.229262	68.068068	22	37	KEEP	---	---	---	---	capture		Silent	SNP	108861556	108861556	9109	13	A	C	C	C	15	2	LIG4	4	4
COL4A1	1282	broad.mit.edu	37	13	110807653	110807653	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:110807653A>T	uc001vqw.3	-	c.4732T>A	c.(4732-4734)TGG>AGG	p.W1578R	COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	1578	Collagen IV NC1.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)											0.52	44.285904	44.295415	13	12	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	110807653	110807653	3827	13	A	T	T	T	78	6	COL4A1	3	3
ARHGEF7	8874	broad.mit.edu	37	13	111927998	111927998	+	Silent	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:111927998G>A	uc001vrs.2	+	c.1455G>A	c.(1453-1455)CAG>CAA	p.Q485Q	ARHGEF7_uc001vrr.2_Silent_p.Q464Q|ARHGEF7_uc001vrt.2_Silent_p.Q435Q|ARHGEF7_uc010tjn.1_Non-coding_Transcript|ARHGEF7_uc001vru.1_Silent_p.Q307Q|ARHGEF7_uc001vrv.3_Silent_p.Q307Q|ARHGEF7_uc001vrw.3_Silent_p.Q307Q|ARHGEF7_uc001vrx.3_Silent_p.Q307Q|ARHGEF7_uc010tjo.1_Silent_p.Q382Q|ARHGEF7_uc010tjp.1_Silent_p.Q229Q|ARHGEF7_uc010agn.1_Silent_p.Q229Q	NM_001113511	NP_001106983	Q14155	ARHG7_HUMAN	PAK-interacting exchange factor beta isoform c	485	PH.				apoptosis|epidermal growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)							707				0.454545	99.14364	99.262325	30	36	KEEP	---	---	---	---	capture		Silent	SNP	111927998	111927998	926	13	G	A	A	A	451	35	ARHGEF7	2	2
C13orf15	28984	broad.mit.edu	37	13	42042950	42042950	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:42042950G>T	uc001uyi.2	+	c.382G>T	c.(382-384)GCT>TCT	p.A128S		NM_014059	NP_054778	Q9H4X1	RGC32_HUMAN	response gene to complement 32	128					cell cycle|regulation of cyclin-dependent protein kinase activity	microtubule organizing center|nucleus					0		Lung NSC(96;7.5e-06)|Prostate(109;0.0181)|Breast(139;0.0204)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;8.62e-09)|Epithelial(112;8.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000504)|GBM - Glioblastoma multiforme(144;0.000909)|BRCA - Breast invasive adenocarcinoma(63;0.0679)										0.434783	31.747312	31.832476	10	13	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	42042950	42042950	1765	13	G	T	T	T	598	46	C13orf15	2	2
HTR2A	3356	broad.mit.edu	37	13	47466589	47466589	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:47466589G>T	uc001vbq.2	-	c.549C>A	c.(547-549)CAC>CAA	p.H183Q	HTR2A_uc001vbr.2_Missense_Mutation_p.H83Q|HTR2A_uc010acr.2_Missense_Mutation_p.H183Q	NM_000621	NP_000612	P28223	5HT2A_HUMAN	5-hydroxytryptamine receptor 2A isoform 1	183	Cytoplasmic (By similarity).				ERK1 and ERK2 cascade|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	integral to plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|serotonin binding|serotonin receptor activity			ovary(3)|central_nervous_system(1)	4		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Aripiprazole(DB01238)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Dihydroergotamine(DB00320)|Donepezil(DB00843)|Epinastine(DB00751)|Ergotamine(DB00696)|Fluvoxamine(DB00176)|Mesoridazine(DB00933)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)									0.432836	274.721008	275.50512	87	114	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	47466589	47466589	7741	13	G	T	T	T	620	48	HTR2A	2	2
EDNRB	1910	broad.mit.edu	37	13	78477406	78477406	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:78477406G>T	uc001vkp.1	-	c.935C>A	c.(934-936)TCT>TAT	p.S312Y	EDNRB_uc001vkq.1_Missense_Mutation_p.S229Y|EDNRB_uc001vko.2_Missense_Mutation_p.S229Y|EDNRB_uc010aez.1_Missense_Mutation_p.S229Y	NM_001122659	NP_001116131	P24530	EDNRB_HUMAN	endothelin receptor type B isoform 1 precursor	229	Helical; Name=4; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|enteric nervous system development|macrophage chemotaxis|negative regulation of adenylate cyclase activity|negative regulation of cellular protein metabolic process|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of neuron maturation|vein smooth muscle contraction	integral to plasma membrane	endothelin-B receptor activity|peptide hormone binding				0		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)					117				0.345133	99.178334	101.624845	39	74	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	78477406	78477406	5107	13	G	T	T	T	429	33	EDNRB	2	2
MBNL2	10150	broad.mit.edu	37	13	97928509	97928509	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:97928509C>T	uc010aft.2	+	c.20C>T	c.(19-21)CCA>CTA	p.P7L	MBNL2_uc001vmz.2_Missense_Mutation_p.P7L|MBNL2_uc001vna.2_Missense_Mutation_p.P7L|MBNL2_uc001vnb.2_Non-coding_Transcript|MBNL2_uc010tij.1_Missense_Mutation_p.P7L	NM_144778	NP_659002	Q5VZF2	MBNL2_HUMAN	muscleblind-like 2 isoform 1	7					mRNA processing|regulation of RNA splicing|RNA splicing	cytoplasm|nucleus	RNA binding|zinc ion binding				0	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)											0.438596	76.563272	76.751016	25	32	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	97928509	97928509	9742	13	C	T	T	T	273	21	MBNL2	2	2
OR4N2	390429	broad.mit.edu	37	14	20295869	20295869	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:20295869G>C	uc010tkv.1	+	c.262G>C	c.(262-264)GCG>CCG	p.A88P		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	88	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)										0.145119	87.992335	134.010052	55	324	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20295869	20295869	11487	14	G	C	C	C	598	46	OR4N2	3	3
TEP1	7011	broad.mit.edu	37	14	20864835	20864835	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:20864835C>A	uc001vxe.2	-	c.1604G>T	c.(1603-1605)CGG>CTG	p.R535L	TEP1_uc010tlf.1_Non-coding_Transcript|TEP1_uc010tlg.1_Missense_Mutation_p.R427L	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	535	TROVE.				telomere maintenance via recombination|telomere maintenance via telomerase	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)										0.272727	15.944237	16.966056	6	16	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20864835	20864835	16286	14	C	A	A	A	299	23	TEP1	1	1
RPGRIP1	57096	broad.mit.edu	37	14	21771691	21771691	+	Silent	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:21771691T>A	uc001wag.2	+	c.789T>A	c.(787-789)GCT>GCA	p.A263A		NM_020366	NP_065099	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator	263					response to stimulus|visual perception	cilium				ovary(4)|breast(2)|pancreas(1)	7	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)						1408				0.365854	48.415278	49.06368	15	26	KEEP	---	---	---	---	capture		Silent	SNP	21771691	21771691	14028	14	T	A	A	A	704	55	RPGRIP1	3	3
RPGRIP1	57096	broad.mit.edu	37	14	21793123	21793123	+	Silent	SNP	A	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:21793123A>T	uc001wag.2	+	c.2109A>T	c.(2107-2109)ATA>ATT	p.I703I	RPGRIP1_uc001wah.2_Silent_p.I345I|RPGRIP1_uc001wai.2_Intron|RPGRIP1_uc001waj.1_Silent_p.I168I|RPGRIP1_uc001wak.2_Silent_p.I178I|RPGRIP1_uc010aim.2_Silent_p.I86I|RPGRIP1_uc001wal.2_Silent_p.I62I|RPGRIP1_uc001wam.2_Silent_p.I20I	NM_020366	NP_065099	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator	703					response to stimulus|visual perception	cilium				ovary(4)|breast(2)|pancreas(1)	7	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)						1408				0.422414	143.081045	143.701433	49	67	KEEP	---	---	---	---	capture		Silent	SNP	21793123	21793123	14028	14	A	T	T	T	176	14	RPGRIP1	3	3
AKAP6	9472	broad.mit.edu	37	14	32902804	32902804	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:32902804G>T	uc001wrq.2	+	c.105G>T	c.(103-105)GAG>GAT	p.E35D	AKAP6_uc010aml.2_Missense_Mutation_p.E32D	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	35					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|large_intestine(2)|lung(2)|pancreas(1)	16	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		Melanoma(49;821 1200 7288 13647 42351)				483				0.605634	134.955942	135.661028	43	28	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32902804	32902804	458	14	G	T	T	T	438	34	AKAP6	2	2
WDHD1	11169	broad.mit.edu	37	14	55411137	55411137	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:55411137C>A	uc001xbm.1	-	c.3102G>T	c.(3100-3102)TTG>TTT	p.L1034F	WDHD1_uc010aom.1_Missense_Mutation_p.L551F|WDHD1_uc001xbn.1_Missense_Mutation_p.L911F	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	1034	HMG box.					cytoplasm|nucleoplasm	DNA binding				0										606				0.136364	16.630191	25.079217	9	57	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55411137	55411137	17844	14	C	A	A	A	220	17	WDHD1	2	2
SIX6	4990	broad.mit.edu	37	14	60976591	60976591	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:60976591C>A	uc001xfa.3	+	c.475C>A	c.(475-477)CGT>AGT	p.R159S		NM_007374	NP_031400	O95475	SIX6_HUMAN	SIX homeobox 6	159	Homeobox.				organ morphogenesis|regulation of transcription, DNA-dependent|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.088)										0.307692	12.401368	12.826458	4	9	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	60976591	60976591	14846	14	C	A	A	A	247	19	SIX6	1	1
ZFYVE26	23503	broad.mit.edu	37	14	68244368	68244368	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:68244368G>A	uc001xka.2	-	c.4882C>T	c.(4882-4884)CAC>TAC	p.H1628Y	ZFYVE26_uc010tsz.1_Non-coding_Transcript|ZFYVE26_uc001xkc.3_Missense_Mutation_p.H1628Y	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1628					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	phosphatidylinositol-3-phosphate binding|protein binding|zinc ion binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)										0.245283	32.053057	35.182561	13	40	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	68244368	68244368	18258	14	G	A	A	A	585	45	ZFYVE26	2	2
NGB	58157	broad.mit.edu	37	14	77737211	77737211	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:77737211C>A	uc001xtg.1	-	c.70G>T	c.(70-72)GGC>TGC	p.G24C		NM_021257	NP_067080	Q9NPG2	NGB_HUMAN	neuroglobin	24	Globin.					hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)										0.3	9.221405	9.578582	3	7	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	77737211	77737211	10792	14	C	A	A	A	299	23	NGB	1	1
C14orf145	145508	broad.mit.edu	37	14	81244339	81244339	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:81244339C>G	uc001xux.2	-	c.2263G>C	c.(2263-2265)GAG>CAG	p.E755Q	C14orf145_uc010asz.1_Non-coding_Transcript	NM_152446	NP_689659	Q6ZU80	CN145_HUMAN	hypothetical protein LOC145508	755	Potential.									central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0586)						1				0.078947	2.894974	16.648987	6	70	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	81244339	81244339	1797	14	C	G	G	G	390	30	C14orf145	3	3
KIAA1409	57578	broad.mit.edu	37	14	94079385	94079385	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:94079385C>G	uc001ybv.1	+	c.3532C>G	c.(3532-3534)CGC>GGC	p.R1178G	KIAA1409_uc001ybs.1_Missense_Mutation_p.R1156G	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1333						integral to membrane				ovary(10)|large_intestine(3)	13		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)						1186				0.131148	14.211067	22.233546	8	53	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	94079385	94079385	8539	14	C	G	G	G	351	27	KIAA1409	3	3
SERPINA3	12	broad.mit.edu	37	14	95081151	95081151	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:95081151A>T	uc001ydo.3	+	c.448A>T	c.(448-450)ACC>TCC	p.T150S	SERPINA3_uc010avf.1_Non-coding_Transcript|SERPINA3_uc001ydr.2_Non-coding_Transcript|SERPINA3_uc001ydq.2_Missense_Mutation_p.T125S|SERPINA3_uc001ydp.2_Missense_Mutation_p.T125S|SERPINA3_uc001yds.2_Missense_Mutation_p.T125S|SERPINA3_uc010avg.2_Missense_Mutation_p.T125S	NM_001085	NP_001076	P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A, member 3	125					acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)|large_intestine(1)	5		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)										0.135135	8.467006	13.226468	5	32	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	95081151	95081151	14578	14	A	T	T	T	78	6	SERPINA3	3	3
DICER1	23405	broad.mit.edu	37	14	95582053	95582053	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:95582053C>A	uc001ydw.2	-	c.1858G>T	c.(1858-1860)GAT>TAT	p.D620Y	DICER1_uc001ydv.2_Missense_Mutation_p.D610Y|DICER1_uc001ydx.2_Missense_Mutation_p.D620Y	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	620					negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-microRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			ovary(1)|pancreas(1)|lung(1)|skin(1)	4		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)						741				0.21875	49.140353	56.137226	21	75	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	95582053	95582053	4700	14	C	A	A	A	403	31	DICER1	1	1
GABRB3	2562	broad.mit.edu	37	15	26793272	26793272	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:26793272G>T	uc001zbb.2	-	c.1258C>A	c.(1258-1260)CAT>AAT	p.H420N	GABRB3_uc010uae.1_Missense_Mutation_p.H279N|GABRB3_uc001zaz.2_Missense_Mutation_p.H364N|GABRB3_uc001zba.2_Missense_Mutation_p.H364N	NM_021912	NP_068712	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	364	Cytoplasmic (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	4		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)									0.458333	97.856506	97.966249	33	39	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	26793272	26793272	6419	15	G	T	T	T	585	45	GABRB3	2	2
HERC2	8924	broad.mit.edu	37	15	28467327	28467327	+	Missense_Mutation	SNP	A	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:28467327A>C	uc001zbj.2	-	c.5499T>G	c.(5497-5499)AAT>AAG	p.N1833K		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	1833					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of mitotic metaphase/anaphase transition	anaphase-promoting complex	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(2)|central_nervous_system(1)	11		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)						1580				0.259259	18.05943	19.446975	7	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	28467327	28467327	7341	15	A	C	C	C	102	8	HERC2	4	4
CHRM5	1133	broad.mit.edu	37	15	34355202	34355202	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:34355202G>A	uc001zhk.1	+	c.284G>A	c.(283-285)CGC>CAC	p.R95H	CHRM5_uc001zhl.1_Missense_Mutation_p.R95H	NM_012125	NP_036257	P08912	ACM5_HUMAN	cholinergic receptor, muscarinic 5	95	Extracellular (By similarity).				cell proliferation|inhibition of adenylate cyclase activity by muscarinic acetylcholine receptor signaling pathway	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;1.76e-08)		all cancers(64;4.82e-17)|GBM - Glioblastoma multiforme(113;2.58e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	Atropine(DB00572)|Benzquinamide(DB00767)|Cryptenamine(DB00785)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Thiethylperazine(DB00372)									0.214286	12.830753	14.947825	6	22	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	34355202	34355202	3514	15	G	A	A	A	494	38	CHRM5	1	1
TMCO5A	145942	broad.mit.edu	37	15	38243304	38243304	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:38243304G>T	uc001zjw.2	+	c.736G>T	c.(736-738)GTA>TTA	p.V246L	TMCO5A_uc001zjv.1_Intron	NM_152453	NP_689666	Q8N6Q1	TMC5A_HUMAN	transmembrane and coiled-coil domains 5A	246						integral to membrane				central_nervous_system(1)	1														0.45098	151.973158	152.180397	46	56	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	38243304	38243304	16529	15	G	T	T	T	624	48	TMCO5A	2	2
MGA	23269	broad.mit.edu	37	15	42028381	42028381	+	Nonsense_Mutation	SNP	A	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:42028381A>T	uc010ucy.1	+	c.3919A>T	c.(3919-3921)AAG>TAG	p.K1307*	MGA_uc010ucz.1_Nonsense_Mutation_p.K1307*|MGA_uc010uda.1_5'UTR	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1	1307					regulation of transcription, DNA-dependent	MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|skin(1)	11		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)						606				0.481481	40.272453	40.280566	13	14	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	42028381	42028381	9930	15	A	T	T	T	13	1	MGA	5	3
GALK2	2585	broad.mit.edu	37	15	49531528	49531528	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:49531528G>C	uc001zxj.1	+	c.468G>C	c.(466-468)TTG>TTC	p.L156F	GALK2_uc001zxi.1_Missense_Mutation_p.L145F|GALK2_uc010ufb.1_Missense_Mutation_p.L132F|GALK2_uc001zxk.2_Non-coding_Transcript|GALK2_uc010ufc.1_Missense_Mutation_p.L132F	NM_002044	NP_002035	Q01415	GALK2_HUMAN	galactokinase 2 isoform 1	156					galactose metabolic process	cytoplasm	ATP binding|galactokinase activity|N-acetylgalactosamine kinase activity			breast(1)	1		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)										0.548387	50.576721	50.640267	17	14	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	49531528	49531528	6468	15	G	C	C	C	607	47	GALK2	3	3
SPPL2A	84888	broad.mit.edu	37	15	51041888	51041888	+	Missense_Mutation	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:51041888T>C	uc001zyv.2	-	c.122A>G	c.(121-123)TAC>TGC	p.Y41C		NM_032802	NP_116191	Q8TCT8	PSL2_HUMAN	signal peptide peptidase-like 2A	41	Cytoplasmic (Potential).					integral to membrane	aspartic-type endopeptidase activity				0				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		Melanoma(50;790 1209 4069 22965 33125)								0.414894	129.317048	129.908641	39	55	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	51041888	51041888	15601	15	T	C	C	C	741	57	SPPL2A	4	4
TLN2	83660	broad.mit.edu	37	15	63058593	63058593	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:63058593G>T	uc002alb.3	+	c.5168G>T	c.(5167-5169)CGG>CTG	p.R1723L	TLN2_uc002alc.3_Missense_Mutation_p.R116L|TLN2_uc002ald.2_Missense_Mutation_p.R116L	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1723					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cell-cell junction|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(4)|breast(2)	6														0.545455	40.06993	40.122128	12	10	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	63058593	63058593	16478	15	G	T	T	T	507	39	TLN2	1	1
MORF4L1	10933	broad.mit.edu	37	15	79187165	79187165	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:79187165G>A	uc002bel.2	+	c.923G>A	c.(922-924)CGA>CAA	p.R308Q	MORF4L1_uc002bem.2_Missense_Mutation_p.R269Q|MORF4L1_uc010une.1_Missense_Mutation_p.R181Q	NM_206839	NP_996670	Q9UBU8	MO4L1_HUMAN	MORF-related gene 15 isoform 2	308	Sufficient for interaction with PHF12.				double-strand break repair via homologous recombination|histone deacetylation|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|Sin3 complex	protein N-terminus binding				0														0.2	22.052081	25.816351	9	36	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	79187165	79187165	10097	15	G	A	A	A	481	37	MORF4L1	1	1
ADAMTSL3	57188	broad.mit.edu	37	15	84651629	84651629	+	Silent	SNP	A	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:84651629A>T	uc002bjz.3	+	c.3249A>T	c.(3247-3249)GCA>GCT	p.A1083A	ADAMTSL3_uc010bmt.1_Silent_p.A1083A|ADAMTSL3_uc010bmu.1_Silent_p.A1083A	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	1083						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			central_nervous_system(5)|ovary(5)|large_intestine(4)|lung(1)|breast(1)|kidney(1)|pancreas(1)	18			BRCA - Breast invasive adenocarcinoma(143;0.211)							580				0.089552	2.093417	13.505926	6	61	KEEP	---	---	---	---	capture		Silent	SNP	84651629	84651629	277	15	A	T	T	T	80	7	ADAMTSL3	3	3
ZNF592	9640	broad.mit.edu	37	15	85328123	85328123	+	Silent	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:85328123G>A	uc002bld.2	+	c.2217G>A	c.(2215-2217)GGG>GGA	p.G739G	ZNF592_uc010upb.1_Non-coding_Transcript	NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592	739					cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4			BRCA - Breast invasive adenocarcinoma(143;0.0587)											0.258621	35.764628	38.861803	15	43	KEEP	---	---	---	---	capture		Silent	SNP	85328123	85328123	18617	15	G	A	A	A	535	42	ZNF592	2	2
BLM	641	broad.mit.edu	37	15	91312742	91312742	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:91312742G>A	uc002bpr.2	+	c.2481G>A	c.(2479-2481)ATG>ATA	p.M827I	BLM_uc010uqh.1_Missense_Mutation_p.M827I|BLM_uc010uqi.1_Missense_Mutation_p.M452I|BLM_uc010bnx.2_Missense_Mutation_p.M827I|BLM_uc002bps.1_Missense_Mutation_p.M389I	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein	827	Helicase ATP-binding.				double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)	3	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)							462				0.2	29.566878	34.588046	12	48	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	91312742	91312742	1470	15	G	A	A	A	611	47	BLM	2	2
PALB2	79728	broad.mit.edu	37	16	23641491	23641491	+	Missense_Mutation	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:23641491T>C	uc002dlx.1	-	c.1984A>G	c.(1984-1986)AAA>GAA	p.K662E		NM_024675	NP_078951	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	662					double-strand break repair via homologous recombination	nucleoplasm	DNA binding|protein binding			breast(2)|ovary(2)|lung(1)|skin(1)|kidney(1)|pancreas(1)	8				GBM - Glioblastoma multiforme(48;0.0167)						263				0.390977	171.476512	172.858636	52	81	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	23641491	23641491	11822	16	T	C	C	C	793	61	PALB2	4	4
SBK1	388228	broad.mit.edu	37	16	28331793	28331793	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:28331793G>C	uc002dpd.2	+	c.826G>C	c.(826-828)GGG>CGG	p.G276R		NM_001024401	NP_001019572	Q52WX2	SBK1_HUMAN	SH3-binding kinase 1	276	Protein kinase.					cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(1)|kidney(1)	2										82				0.392857	27.808983	28.092315	11	17	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	28331793	28331793	14341	16	G	C	C	C	559	43	SBK1	3	3
ABCC12	94160	broad.mit.edu	37	16	48121986	48121986	+	Silent	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:48121986C>T	uc002efc.1	-	c.3486G>A	c.(3484-3486)TCG>TCA	p.S1162S	ABCC12_uc002eey.1_Non-coding_Transcript|ABCC12_uc002eez.1_Non-coding_Transcript|ABCC12_uc002efa.1_Non-coding_Transcript|ABCC12_uc002efb.1_Non-coding_Transcript|ABCC12_uc002efd.1_Non-coding_Transcript	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12	1162	ABC transporter 2.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)	2		all_cancers(37;0.0474)|all_lung(18;0.047)												0.222222	7.988005	9.268772	4	14	KEEP	---	---	---	---	capture		Silent	SNP	48121986	48121986	53	16	C	T	T	T	236	19	ABCC12	1	1
SALL1	6299	broad.mit.edu	37	16	51174546	51174546	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:51174546G>T	uc010vgs.1	-	c.1587C>A	c.(1585-1587)GGC>GGA	p.G529G	SALL1_uc010vgr.1_Silent_p.G432G|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	529					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|transcription activator activity|transcription repressor activity|zinc ion binding			ovary(3)	3		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GBM(103;1352 1446 1855 4775 8890)								0.236842	46.416323	51.223155	18	58	KEEP	---	---	---	---	capture		Silent	SNP	51174546	51174546	14290	16	G	T	T	T	587	46	SALL1	2	2
IRX5	10265	broad.mit.edu	37	16	54967483	54967483	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:54967483C>G	uc002ehv.2	+	c.1150C>G	c.(1150-1152)CGC>GGC	p.R384G	IRX5_uc002ehw.2_Missense_Mutation_p.R318G	NM_005853	NP_005844	P78411	IRX5_HUMAN	iroquois homeobox protein 5	384					regulation of transcription, DNA-dependent|response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity|vitamin D binding				0														0.461538	21.149691	21.166326	6	7	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	54967483	54967483	8151	16	C	G	G	G	247	19	IRX5	3	3
CAPNS2	84290	broad.mit.edu	37	16	55601252	55601252	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:55601252G>T	uc002eid.1	+	c.584G>T	c.(583-585)CGC>CTC	p.R195L	LPCAT2_uc002eie.3_Intron|LPCAT2_uc002eic.2_Intron	NM_032330	NP_115706	Q96L46	CPNS2_HUMAN	calpain small subunit 2	195	EF-hand 3.					cytoplasm|plasma membrane	calcium ion binding				0														0.215909	93.881129	106.896457	38	138	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55601252	55601252	2753	16	G	T	T	T	494	38	CAPNS2	1	1
GPR56	9289	broad.mit.edu	37	16	57695697	57695697	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:57695697A>T	uc002emb.2	+	c.1771A>T	c.(1771-1773)ACC>TCC	p.T591S	GPR56_uc002ema.1_Missense_Mutation_p.T416S|GPR56_uc002emc.2_Missense_Mutation_p.T585S|GPR56_uc002emf.2_Missense_Mutation_p.T585S|GPR56_uc010vhs.1_Missense_Mutation_p.T591S|GPR56_uc002emd.2_Missense_Mutation_p.T585S|GPR56_uc002eme.2_Missense_Mutation_p.T585S|GPR56_uc010vht.1_Missense_Mutation_p.T590S|GPR56_uc002emg.3_Missense_Mutation_p.T585S|GPR56_uc010vhu.1_Missense_Mutation_p.T410S	NM_005682	NP_005673	Q9Y653	GPR56_HUMAN	G protein-coupled receptor 56 isoform a	591	Helical; Name=5; (Potential).				brain development|cell adhesion|cell-cell signaling|neuropeptide signaling pathway	integral to plasma membrane	G-protein coupled receptor activity				0														0.528302	96.316077	96.354524	28	25	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	57695697	57695697	6975	16	A	T	T	T	78	6	GPR56	3	3
WDR90	197335	broad.mit.edu	37	16	701983	701983	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:701983C>A	uc002cii.1	+	c.997C>A	c.(997-999)CAC>AAC	p.H333N	WDR90_uc002cig.1_Missense_Mutation_p.H333N|WDR90_uc002cih.1_Missense_Mutation_p.H334N|WDR90_uc002cij.1_Non-coding_Transcript	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	333										ovary(1)	1		Hepatocellular(780;0.0218)												0.25	7.919252	8.600956	3	9	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	701983	701983	17911	16	C	A	A	A	273	21	WDR90	2	2
GLG1	2734	broad.mit.edu	37	16	74502911	74502911	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:74502911T>A	uc002fcx.2	-	c.2369A>T	c.(2368-2370)CAG>CTG	p.Q790L	GLG1_uc002fcy.3_Missense_Mutation_p.Q790L|GLG1_uc002fcw.3_Missense_Mutation_p.Q779L|GLG1_uc002fcz.3_Missense_Mutation_p.Q207L	NM_012201	NP_036333	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 1	790	Extracellular (Potential).					Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2										1034				0.219512	23.654664	26.624187	9	32	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	74502911	74502911	6704	16	T	A	A	A	715	55	GLG1	3	3
MVD	4597	broad.mit.edu	37	16	88722590	88722590	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:88722590C>A	uc002flg.1	-	c.526G>T	c.(526-528)GCC>TCC	p.A176S	MVD_uc002flf.1_Missense_Mutation_p.A45S	NM_002461	NP_002452	P53602	MVD1_HUMAN	diphosphomevalonate decarboxylase	176					cholesterol biosynthetic process|positive regulation of cell proliferation	cytosol	ATP binding|diphosphomevalonate decarboxylase activity|Hsp70 protein binding|kinase activity|protein homodimerization activity				0				BRCA - Breast invasive adenocarcinoma(80;0.0478)										0.309859	56.452659	58.72461	22	49	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	88722590	88722590	10388	16	C	A	A	A	338	26	MVD	2	2
DNAH9	1770	broad.mit.edu	37	17	11806089	11806089	+	Silent	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:11806089T>C	uc002gne.2	+	c.11460T>C	c.(11458-11460)TCT>TCC	p.S3820S	DNAH9_uc010coo.2_Silent_p.S3114S|DNAH9_uc002gnf.2_Silent_p.S132S|DNAH9_uc010vvh.1_Silent_p.S173S	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	3820					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	10		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)										0.423077	95.47322	95.872177	33	45	KEEP	---	---	---	---	capture		Silent	SNP	11806089	11806089	4791	17	T	C	C	C	704	55	DNAH9	4	4
POLDIP2	26073	broad.mit.edu	37	17	26680783	26680783	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:26680783C>A	uc002haz.2	-	c.376G>T	c.(376-378)GTG>TTG	p.V126L	POLDIP2_uc010wag.1_Non-coding_Transcript	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2	126						mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)										0.168831	50.69437	66.657399	26	128	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	26680783	26680783	12622	17	C	A	A	A	234	18	POLDIP2	2	2
LIG3	3980	broad.mit.edu	37	17	33319597	33319597	+	Silent	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:33319597G>A	uc002hik.1	+	c.1341G>A	c.(1339-1341)CTG>CTA	p.L447L	LIG3_uc002hij.2_Silent_p.L447L|LIG3_uc010cth.1_Silent_p.L456L	NM_013975	NP_039269	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent isoform alpha	447					base-excision repair|cell division|DNA ligation involved in DNA repair|DNA replication|reciprocal meiotic recombination|spermatogenesis	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|protein binding|zinc ion binding			ovary(2)|large_intestine(1)|pancreas(1)	4		Ovarian(249;0.17)			Bleomycin(DB00290)									0.285714	38.570955	40.882939	16	40	KEEP	---	---	---	---	capture		Silent	SNP	33319597	33319597	9108	17	G	A	A	A	587	46	LIG3	2	2
SYNRG	11276	broad.mit.edu	37	17	35930851	35930851	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:35930851C>G	uc002hoa.2	-	c.1232G>C	c.(1231-1233)GGC>GCC	p.G411A	SYNRG_uc010wde.1_Missense_Mutation_p.G333A|SYNRG_uc010wdf.1_Missense_Mutation_p.G333A|SYNRG_uc002hoc.2_Missense_Mutation_p.G332A|SYNRG_uc002hoe.2_Missense_Mutation_p.G333A|SYNRG_uc002hod.2_Missense_Mutation_p.G333A|SYNRG_uc010wdg.1_Intron|SYNRG_uc002hob.2_Missense_Mutation_p.G411A|SYNRG_uc002hof.2_Missense_Mutation_p.G123A|SYNRG_uc010cvd.1_Missense_Mutation_p.G211A|SYNRG_uc002hog.1_Missense_Mutation_p.G545A	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1	411					endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2														0.166667	15.718039	20.737424	8	40	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	35930851	35930851	15981	17	C	G	G	G	338	26	SYNRG	3	3
KRT28	162605	broad.mit.edu	37	17	38953436	38953436	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:38953436C>G	uc002hvh.1	-	c.788G>C	c.(787-789)CGA>CCA	p.R263P		NM_181535	NP_853513	Q7Z3Y7	K1C28_HUMAN	keratin 25D	263	Rod.|Coil 2.					cytoplasm|intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)				Melanoma(19;789 869 15380 26882 39836)								0.126984	12.772126	21.308386	8	55	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	38953436	38953436	8780	17	C	G	G	G	403	31	KRT28	3	3
KRT31	3881	broad.mit.edu	37	17	39553787	39553787	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:39553787G>T	uc002hwn.2	-	c.5C>A	c.(4-6)CCC>CAC	p.P2H	KRT31_uc010cxn.2_Missense_Mutation_p.P2H	NM_002277	NP_002268	Q15323	K1H1_HUMAN	keratin 31	2	Head.				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000496)												0.115385	3.5068	7.294541	3	23	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	39553787	39553787	8782	17	G	T	T	T	559	43	KRT31	2	2
STAT3	6774	broad.mit.edu	37	17	40474406	40474406	+	Silent	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:40474406G>A	uc002hzl.1	-	c.1995C>T	c.(1993-1995)ATC>ATT	p.I665I	STAT3_uc002hzk.1_Silent_p.I665I|STAT3_uc002hzm.1_Silent_p.I665I|STAT3_uc010wgh.1_Silent_p.I567I|STAT3_uc002hzn.1_Silent_p.I665I	NM_139276	NP_644805	P40763	STAT3_HUMAN	signal transducer and activator of transcription	665	SH2.				cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription activator activity|transcription factor binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)						793				0.271318	92.102399	98.165436	35	94	KEEP	---	---	---	---	capture		Silent	SNP	40474406	40474406	15786	17	G	A	A	A	525	41	STAT3	2	2
FZD2	2535	broad.mit.edu	37	17	42636375	42636375	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:42636375G>T	uc002igx.1	+	c.1319G>T	c.(1318-1320)CGC>CTC	p.R440L		NM_001466	NP_001457	Q14332	FZD2_HUMAN	frizzled 2 precursor	440	Cytoplasmic (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|positive regulation of cGMP metabolic process|positive regulation of transcription regulator activity|positive regulation of transcription, DNA-dependent|regulation of gene-specific transcription from RNA polymerase II promoter|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)	2		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)										0.223881	33.363321	38.097854	15	52	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	42636375	42636375	6381	17	G	T	T	T	494	38	FZD2	1	1
HOXB3	3213	broad.mit.edu	37	17	46628146	46628146	+	Missense_Mutation	SNP	C	G	G	rs117055376	by1000genomes	TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:46628146C>G	uc002inn.2	-	c.846G>C	c.(844-846)ATG>ATC	p.M282I	HOXB3_uc010wlm.1_Missense_Mutation_p.M209I|HOXB3_uc010dbf.2_Missense_Mutation_p.M282I|HOXB3_uc010dbg.2_Missense_Mutation_p.M282I|HOXB3_uc002ino.2_Missense_Mutation_p.M282I|HOXB3_uc010wlk.1_Missense_Mutation_p.M150I|HOXB3_uc010wll.1_Missense_Mutation_p.M209I	NM_002146	NP_002137	P14651	HXB3_HUMAN	homeobox B3	282					angiogenesis|regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity				0												OREG0024516	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.173469	27.900638	37.815016	17	81	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	46628146	46628146	7594	17	C	G	G	G	377	29	HOXB3	3	3
RSAD1	55316	broad.mit.edu	37	17	48561096	48561096	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:48561096G>T	uc002iqw.1	+	c.1082G>T	c.(1081-1083)CGC>CTC	p.R361L	RSAD1_uc010wmq.1_Intron	NM_018346	NP_060816	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing	361					oxidation-reduction process|porphyrin biosynthetic process	mitochondrion	4 iron, 4 sulfur cluster binding|coproporphyrinogen oxidase activity|metal ion binding				0	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)											0.083333	1.415187	9.83595	4	44	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	48561096	48561096	14174	17	G	T	T	T	494	38	RSAD1	1	1
ABCC3	8714	broad.mit.edu	37	17	48745281	48745281	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:48745281G>T	uc002isl.2	+	c.1693G>T	c.(1693-1695)GCC>TCC	p.A565S	ABCC3_uc002isk.3_3'UTR	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3	565	Extracellular (By similarity).|ABC transmembrane type-1 1.				bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			central_nervous_system(1)	1			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)					438				0.3	18.543839	19.257602	6	14	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	48745281	48745281	55	17	G	T	T	T	494	38	ABCC3	1	1
C17orf71	55181	broad.mit.edu	37	17	57288128	57288128	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:57288128C>G	uc002ixi.2	+	c.716C>G	c.(715-717)CCG>CGG	p.P239R		NM_018149	NP_060619	Q8ND04	SMG8_HUMAN	SMG8 protein	239					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of protein kinase activity		protein binding			ovary(3)	3	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)													0.333333	38.839859	39.87116	14	28	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	57288128	57288128	1935	17	C	G	G	G	299	23	C17orf71	3	3
CLTC	1213	broad.mit.edu	37	17	57762959	57762959	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:57762959G>T	uc002ixr.1	+	c.4629G>T	c.(4627-4629)CAG>CAT	p.Q1543H	CLTC_uc002ixp.2_Missense_Mutation_p.Q1539H|CLTC_uc002ixq.1_Missense_Mutation_p.Q1539H	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	1539	Heavy chain arm.|Proximal segment.				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)	47	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)									397				0.180556	26.628337	33.539315	13	59	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	57762959	57762959	3704	17	G	T	T	T	464	36	CLTC	2	2
KIF19	124602	broad.mit.edu	37	17	72348372	72348372	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:72348372G>A	uc002jkm.3	+	c.1873G>A	c.(1873-1875)GTC>ATC	p.V625I	KIF19_uc002jkl.2_Missense_Mutation_p.V583I	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19	625					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0														0.185185	11.260173	13.76802	5	22	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72348372	72348372	8593	17	G	A	A	A	520	40	KIF19	1	1
GPR142	350383	broad.mit.edu	37	17	72367995	72367995	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:72367995C>A	uc010wqy.1	+	c.645C>A	c.(643-645)TTC>TTA	p.F215L	GPR142_uc010wqx.1_Missense_Mutation_p.F127L	NM_181790	NP_861455	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	215	Helical; Name=2; (Potential).					cell junction|cytoplasm|integral to membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)	3														0.26087	14.138401	15.329819	6	17	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72367995	72367995	6924	17	C	A	A	A	389	30	GPR142	2	2
GPRC5C	55890	broad.mit.edu	37	17	72443106	72443106	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:72443106C>G	uc002jkp.2	+	c.1400C>G	c.(1399-1401)GCC>GGC	p.A467G	GPRC5C_uc002jkq.2_3'UTR|GPRC5C_uc002jkr.2_Missense_Mutation_p.A434G|GPRC5C_uc002jks.2_Missense_Mutation_p.A422G|GPRC5C_uc002jkt.2_Missense_Mutation_p.A422G|GPRC5C_uc002jku.2_Missense_Mutation_p.A177G	NM_022036	NP_071319	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,	422	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4														0.174603	22.576311	28.892685	11	52	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72443106	72443106	7002	17	C	G	G	G	338	26	GPRC5C	3	3
USP36	57602	broad.mit.edu	37	17	76794510	76794510	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:76794510G>A	uc002jvz.1	-	c.3364C>T	c.(3364-3366)CGC>TGC	p.R1122C	USP36_uc002jwa.1_Missense_Mutation_p.R1122C|USP36_uc002jvy.1_Missense_Mutation_p.R182C	NM_025090	NP_079366	Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	1120					ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|kidney(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)											0.295455	35.861454	37.506222	13	31	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	76794510	76794510	17631	17	G	A	A	A	481	37	USP36	1	1
RNF213	57674	broad.mit.edu	37	17	78327866	78327866	+	Silent	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:78327866C>T	uc002jyh.1	+	c.4845C>T	c.(4843-4845)AGC>AGT	p.S1615S	RNF213_uc010dhw.1_5'UTR	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	12	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)											0.16129	8.185413	11.556102	5	26	KEEP	---	---	---	---	capture		Silent	SNP	78327866	78327866	13955	17	C	T	T	T	350	27	RNF213	1	1
DHRS7C	201140	broad.mit.edu	37	17	9694599	9694599	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:9694599C>A	uc010vvb.1	-	c.3G>T	c.(1-3)ATG>ATT	p.M1I	DHRS7C_uc010cof.2_Missense_Mutation_p.M1I	NM_001105571	NP_001099041			dehydrogenase/reductase (SDR family) member 7C												0														0.428571	19.84875	19.910851	6	8	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	9694599	9694599	4676	17	C	A	A	A	273	21	DHRS7C	2	2
KIAA1012	22878	broad.mit.edu	37	18	29451056	29451056	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:29451056C>T	uc002kxc.3	-	c.2090G>A	c.(2089-2091)AGT>AAT	p.S697N	KIAA1012_uc002kxb.3_Missense_Mutation_p.S643N|KIAA1012_uc002kxd.3_Non-coding_Transcript	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878	697					ER to Golgi vesicle-mediated transport	cis-Golgi network					0														0.129032	6.882058	11.032877	4	27	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	29451056	29451056	8511	18	C	T	T	T	260	20	KIAA1012	2	2
KIAA1012	22878	broad.mit.edu	37	18	29451058	29451058	+	Silent	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:29451058T>A	uc002kxc.3	-	c.2088A>T	c.(2086-2088)GTA>GTT	p.V696V	KIAA1012_uc002kxb.3_Silent_p.V642V|KIAA1012_uc002kxd.3_Non-coding_Transcript	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878	696					ER to Golgi vesicle-mediated transport	cis-Golgi network					0														0.129032	6.483573	10.633191	4	27	KEEP	---	---	---	---	capture		Silent	SNP	29451058	29451058	8511	18	T	A	A	A	782	61	KIAA1012	3	3
DCC	1630	broad.mit.edu	37	18	50278530	50278530	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:50278530C>A	uc002lfe.1	+	c.198C>A	c.(196-198)GAC>GAA	p.D66E	DCC_uc010xdr.1_5'UTR	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	66	Extracellular (Potential).|Ig-like C2-type 1.				apoptosis|induction of apoptosis	cytosol|integral to membrane				ovary(6)|large_intestine(1)|central_nervous_system(1)|skin(1)	9		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)										0.240741	32.049854	35.361123	13	41	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	50278530	50278530	4453	18	C	A	A	A	233	18	DCC	2	2
MALT1	10892	broad.mit.edu	37	18	56348550	56348550	+	Nonsense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:56348550C>T	uc002lhm.1	+	c.358C>T	c.(358-360)CAG>TAG	p.Q120*	MALT1_uc002lhn.1_Nonsense_Mutation_p.Q120*	NM_006785	NP_006776	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma	120	Death.				activation of NF-kappaB-inducing kinase activity|anti-apoptosis|nuclear export|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of protein ubiquitination|positive regulation of T cell activation|positive regulation of T cell cytokine production|protein oligomerization|proteolysis|T cell receptor signaling pathway	CBM complex|cytosol|nucleus|perinuclear region of cytoplasm	cysteine-type endopeptidase activity|protein self-association|signal transducer activity|ubiquitin-protein ligase activity			ovary(2)|central_nervous_system(1)	3										549				0.592593	98.214875	98.624564	32	22	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	56348550	56348550	9585	18	C	T	T	T	377	29	MALT1	5	2
CDH7	1005	broad.mit.edu	37	18	63529993	63529993	+	Silent	SNP	A	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:63529993A>T	uc002ljz.2	+	c.1704A>T	c.(1702-1704)GGA>GGT	p.G568G	CDH7_uc002lka.2_Silent_p.G568G|CDH7_uc002lkb.2_Silent_p.G568G	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	568	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)	3		Esophageal squamous(42;0.129)												0.160714	16.139318	22.278401	9	47	KEEP	---	---	---	---	capture		Silent	SNP	63529993	63529993	3244	18	A	T	T	T	145	12	CDH7	3	3
TSHZ1	10194	broad.mit.edu	37	18	72999000	72999000	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:72999000G>C	uc002lly.2	+	c.1503G>C	c.(1501-1503)AAG>AAC	p.K501N		NM_005786	NP_005777	Q6ZSZ6	TSH1_HUMAN	teashirt family zinc finger 1	546					regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)										0.481675	261.643263	261.704103	92	99	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72999000	72999000	17174	18	G	C	C	C	451	35	TSHZ1	3	3
EPS15L1	58513	broad.mit.edu	37	19	16528760	16528760	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:16528760G>A	uc002ndx.2	-	c.1106C>T	c.(1105-1107)CCG>CTG	p.P369L	EPS15L1_uc002ndy.2_Non-coding_Transcript|EPS15L1_uc010xpe.1_Missense_Mutation_p.P259L|EPS15L1_uc002ndz.1_Missense_Mutation_p.P369L|EPS15L1_uc010xpf.1_Missense_Mutation_p.P272L|EPS15L1_uc002nea.1_Missense_Mutation_p.P369L|EPS15L1_uc010eah.1_Missense_Mutation_p.P369L|EPS15L1_uc002neb.1_Missense_Mutation_p.P215L|EPS15L1_uc002nec.1_Missense_Mutation_p.P369L	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway	369					endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)	3												OREG0025334	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.157895	11.030132	15.268633	6	32	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	16528760	16528760	5386	19	G	A	A	A	507	39	EPS15L1	1	1
TMEM59L	25789	broad.mit.edu	37	19	18724957	18724957	+	Silent	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:18724957T>C	uc010ebu.1	+	c.360T>C	c.(358-360)TGT>TGC	p.C120C	TMEM59L_uc002njy.3_Silent_p.C120C	NM_012109	NP_036241	Q9UK28	TM59L_HUMAN	brain-specific membrane-anchored protein	120						Golgi membrane|integral to membrane|membrane fraction				ovary(2)	2														0.4	6.549237	6.592899	2	3	KEEP	---	---	---	---	capture		Silent	SNP	18724957	18724957	16725	19	T	C	C	C	738	57	TMEM59L	4	4
ZNF43	7594	broad.mit.edu	37	19	21990856	21990856	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:21990856C>A	uc002nqj.2	-	c.1983G>T	c.(1981-1983)TGG>TGT	p.W661C	ZNF43_uc010ecv.2_Missense_Mutation_p.W655C|ZNF43_uc002nql.2_Missense_Mutation_p.W655C|ZNF43_uc002nqm.2_Missense_Mutation_p.W655C|ZNF43_uc002nqk.2_Missense_Mutation_p.W591C	NM_003423	NP_003414	P17038	ZNF43_HUMAN	zinc finger protein 43	661	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)										0.455882	92.625404	92.739014	31	37	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	21990856	21990856	18496	19	C	A	A	A	234	18	ZNF43	2	2
ZNF536	9745	broad.mit.edu	37	19	31039485	31039485	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:31039485C>T	uc002nsu.1	+	c.2959C>T	c.(2959-2961)CTC>TTC	p.L987F	ZNF536_uc010edd.1_Missense_Mutation_p.L987F	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	987					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)	9	Esophageal squamous(110;0.0834)													0.173469	35.190063	44.998902	17	81	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	31039485	31039485	18568	19	C	T	T	T	312	24	ZNF536	2	2
CHST8	64377	broad.mit.edu	37	19	34180192	34180192	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:34180192C>A	uc002nus.3	+	c.25C>A	c.(25-27)CGG>AGG	p.R9R	CHST8_uc002nut.3_Silent_p.R9R|CHST8_uc002nuu.2_Silent_p.R9R	NM_001127895	NP_001121367	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0)	9	Cytoplasmic (Potential).				carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			large_intestine(1)|ovary(1)	2	Esophageal squamous(110;0.162)													0.139785	20.319461	32.015112	13	80	KEEP	---	---	---	---	capture		Silent	SNP	34180192	34180192	3544	19	C	A	A	A	347	27	CHST8	1	1
PSMC4	5704	broad.mit.edu	37	19	40478082	40478082	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:40478082G>T	uc002omq.2	+	c.66G>T	c.(64-66)CGG>CGT	p.R22R	PSMC4_uc002omr.2_Silent_p.R22R	NM_006503	NP_006494	P43686	PRS6B_HUMAN	proteasome 26S ATPase subunit 4 isoform 1	22					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding			ovary(1)	1	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					Colon(105;1478 1543 4034 6132 38638)								0.225806	48.011727	54.380925	21	72	KEEP	---	---	---	---	capture		Silent	SNP	40478082	40478082	13142	19	G	T	T	T	535	42	PSMC4	2	2
ZNF780B	163131	broad.mit.edu	37	19	40541581	40541581	+	Silent	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:40541581C>G	uc002omu.2	-	c.1185G>C	c.(1183-1185)GGG>GGC	p.G395G	ZNF780B_uc002omv.2_Silent_p.G247G	NM_001005851	NP_001005851	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	395	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)													0.267176	102.391562	108.78831	35	96	KEEP	---	---	---	---	capture		Silent	SNP	40541581	40541581	18751	19	C	G	G	G	379	30	ZNF780B	3	3
LTBP4	8425	broad.mit.edu	37	19	41111393	41111393	+	Silent	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:41111393C>T	uc002ooh.1	+	c.726C>T	c.(724-726)GGC>GGT	p.G242G	LTBP4_uc002oog.1_Silent_p.G205G|LTBP4_uc002ooi.1_Silent_p.G175G	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding	242					growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)											0.263158	10.460013	11.42968	5	14	KEEP	---	---	---	---	capture		Silent	SNP	41111393	41111393	9452	19	C	T	T	T	327	26	LTBP4	2	2
SIRT6	51548	broad.mit.edu	37	19	4180786	4180786	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:4180786C>A	uc002lzo.2	-	c.187G>T	c.(187-189)GAC>TAC	p.D63Y	ANKRD24_uc010dtt.1_5'Flank|SIRT6_uc002lzn.2_5'UTR|SIRT6_uc002lzp.2_Missense_Mutation_p.D63Y|SIRT6_uc010xid.1_Intron|SIRT6_uc002lzq.2_Missense_Mutation_p.D63Y|SIRT6_uc002lzr.2_Intron	NM_016539	NP_057623	Q8N6T7	SIRT6_HUMAN	sirtuin 6	63	NAD (By similarity).|Deacetylase sirtuin-type.				chromatin silencing|protein ADP-ribosylation	nuclear telomeric heterochromatin|nucleoplasm	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity|NAD+ binding|NAD-dependent histone deacetylase activity (H3-K9 specific)|protein binding|zinc ion binding			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)										0.363636	22.300019	22.657164	8	14	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	4180786	4180786	14837	19	C	A	A	A	403	31	SIRT6	1	1
CIC	23152	broad.mit.edu	37	19	42797203	42797203	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:42797203G>T	uc002otf.1	+	c.3565G>T	c.(3565-3567)GTG>TTG	p.V1189L		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	1189	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)	8		Prostate(69;0.00682)								241				0.642857	28.430143	28.670167	9	5	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	42797203	42797203	3558	19	G	T	T	T	520	40	CIC	1	1
CD177	57126	broad.mit.edu	37	19	43859930	43859930	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:43859930G>T	uc002owi.2	+	c.497G>T	c.(496-498)AGG>ATG	p.R166M	CD177_uc010eis.2_Non-coding_Transcript|CD177_uc002owj.2_Non-coding_Transcript	NM_020406	NP_065139	Q8N6Q3	CD177_HUMAN	CD177 molecule precursor	166	UPAR/Ly6 1.				blood coagulation|leukocyte migration	anchored to membrane|plasma membrane					0		Prostate(69;0.00682)												0.230769	19.522875	22.150107	9	30	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43859930	43859930	3098	19	G	T	T	T	455	35	CD177	2	2
IRGQ	126298	broad.mit.edu	37	19	44099262	44099262	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:44099262C>A	uc002oww.2	-	c.229G>T	c.(229-231)GTG>TTG	p.V77L	IRGQ_uc010eiv.2_Missense_Mutation_p.V77L|ZNF576_uc002owy.2_5'Flank|ZNF576_uc002owz.2_5'Flank|SRRM5_uc002oxb.2_5'Flank	NM_001007561	NP_001007562	Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	77							protein binding			ovary(1)|pancreas(1)	2		Prostate(69;0.0199)												0.75	31.781787	32.466029	9	3	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	44099262	44099262	8143	19	C	A	A	A	247	19	IRGQ	1	1
ZC3H4	23211	broad.mit.edu	37	19	47584880	47584880	+	Splice_Site_SNP	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:47584880G>A	uc002pga.3	-	c.1331_splice	c.e11-1	p.G444_splice	ZC3H4_uc002pgb.1_Intron	NM_015168	NP_055983			zinc finger CCCH-type containing 4								nucleic acid binding|zinc ion binding			ovary(2)	2		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)										0.222222	14.336664	16.25262	6	21	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	47584880	47584880	18158	19	G	A	A	A	520	40	ZC3H4	5	1
CPT1C	126129	broad.mit.edu	37	19	50208532	50208532	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:50208532C>A	uc002ppj.2	+	c.941C>A	c.(940-942)ACG>AAG	p.T314K	CPT1C_uc002ppl.3_Missense_Mutation_p.T280K|CPT1C_uc002ppi.2_Missense_Mutation_p.T231K|CPT1C_uc002ppk.2_Missense_Mutation_p.T303K|CPT1C_uc010eng.2_Missense_Mutation_p.T314K|CPT1C_uc010enh.2_Missense_Mutation_p.T314K|CPT1C_uc010ybc.1_Missense_Mutation_p.T185K|CPT1C_uc010eni.1_5'Flank	NM_152359	NP_689572	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C isoform 2	314	Cytoplasmic (Potential).				fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)										0.222222	52.190198	58.551374	20	70	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	50208532	50208532	3972	19	C	A	A	A	247	19	CPT1C	1	1
KLK3	354	broad.mit.edu	37	19	51361540	51361540	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:51361540C>A	uc002pts.1	+	c.462C>A	c.(460-462)GCC>GCA	p.A154A	KLK3_uc010ycj.1_Intron|KLK3_uc002ptr.1_Silent_p.A111A|KLK3_uc010eof.1_Non-coding_Transcript	NM_001030047	NP_001025218	P07288	KLK3_HUMAN	prostate specific antigen isoform 3	154	Peptidase S1.				negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)|kidney(1)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		Colon(185;1767 2023 13025 30120 37630)				94				0.246575	44.205423	48.482006	18	55	KEEP	---	---	---	---	capture		Silent	SNP	51361540	51361540	8719	19	C	A	A	A	301	24	KLK3	2	2
FPR1	2357	broad.mit.edu	37	19	52249336	52249336	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:52249336C>A	uc002pxq.2	-	c.912G>T	c.(910-912)ATG>ATT	p.M304I		NM_002029	NP_002020	P21462	FPR1_HUMAN	formyl peptide receptor 1	304	Helical; Name=7; (Potential).				activation of MAPK activity|cellular component movement|chemotaxis|G-protein signaling, coupled to cAMP nucleotide second messenger|nitric oxide mediated signal transduction	endosome|integral to membrane|plasma membrane	N-formyl peptide receptor activity			ovary(1)	1		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)									0.269231	37.926228	40.425649	14	38	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	52249336	52249336	6284	19	C	A	A	A	273	21	FPR1	2	2
ZNF480	147657	broad.mit.edu	37	19	52819189	52819189	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:52819189G>T	uc010ydl.1	+	c.302G>T	c.(301-303)AGG>ATG	p.R101M	ZNF480_uc002pyv.2_Missense_Mutation_p.R24M|ZNF480_uc010ydm.1_Intron|ZNF480_uc010epn.2_Intron	NM_144684	NP_653285	Q8WV37	ZN480_HUMAN	zinc finger protein 480	101					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)										0.208333	9.238605	11.161782	5	19	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	52819189	52819189	18529	19	G	T	T	T	455	35	ZNF480	2	2
ZNF813	126017	broad.mit.edu	37	19	53994890	53994890	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:53994890G>T	uc002qbu.2	+	c.1404G>T	c.(1402-1404)AAG>AAT	p.K468N	ZNF813_uc010eqq.1_Intron	NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	468	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)										0.377049	69.764807	70.589333	23	38	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	53994890	53994890	18773	19	G	T	T	T	464	36	ZNF813	2	2
PRKCG	5582	broad.mit.edu	37	19	54406361	54406361	+	Missense_Mutation	SNP	A	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:54406361A>G	uc010yeg.1	+	c.1610A>G	c.(1609-1611)GAT>GGT	p.D537G	PRKCG_uc002qcq.1_Missense_Mutation_p.D537G|PRKCG_uc010yeh.1_Missense_Mutation_p.D424G	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	537	Protein kinase.				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|protein phosphorylation|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)						505				0.097345	18.758539	55.387053	22	204	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	54406361	54406361	12955	19	A	G	G	G	156	12	PRKCG	4	4
KIR3DL1	3811	broad.mit.edu	37	19	55341568	55341568	+	Silent	SNP	A	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:55341568A>G	uc002qhk.3	+	c.1173A>G	c.(1171-1173)CAA>CAG	p.Q391Q	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Silent_p.Q316Q|KIR3DL1_uc010esf.2_Silent_p.Q296Q|KIR3DL1_uc010yfo.1_Silent_p.Q333Q|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_5'Flank|KIR2DS4_uc002qhm.1_5'Flank	NM_013289	NP_037421	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three	391	Cytoplasmic (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|kidney(1)	3				GBM - Glioblastoma multiforme(193;0.0192)										0.149533	63.726303	88.878807	32	182	KEEP	---	---	---	---	capture		Silent	SNP	55341568	55341568	8632	19	A	G	G	G	37	3	KIR3DL1	4	4
NLRP8	126205	broad.mit.edu	37	19	56485022	56485022	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:56485022G>A	uc002qmh.2	+	c.2539G>A	c.(2539-2541)GAG>AAG	p.E847K	NLRP8_uc010etg.2_Intron	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	847	LRR 3.					cytoplasm	ATP binding			ovary(4)|breast(3)|large_intestine(1)|kidney(1)|skin(1)	10		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)										0.152074	59.457528	84.797197	33	184	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	56485022	56485022	10886	19	G	A	A	A	429	33	NLRP8	2	2
ZSCAN4	201516	broad.mit.edu	37	19	58189890	58189890	+	Nonsense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:58189890G>T	uc002qpu.2	+	c.919G>T	c.(919-921)GGA>TGA	p.G307*		NM_152677	NP_689890	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	307					regulation of transcription, DNA-dependent|telomere maintenance via telomere lengthening|viral reproduction	nuclear chromosome, telomeric region	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)										0.305556	63.921695	66.350437	22	50	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	58189890	58189890	18841	19	G	T	T	T	611	47	ZSCAN4	5	2
ZNF135	7694	broad.mit.edu	37	19	58578379	58578379	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:58578379C>A	uc010yhq.1	+	c.563C>A	c.(562-564)CCA>CAA	p.P188Q	ZNF135_uc002qre.2_Missense_Mutation_p.P176Q|ZNF135_uc002qrd.1_Missense_Mutation_p.P134Q|ZNF135_uc002qrf.2_Missense_Mutation_p.P134Q|ZNF135_uc002qrg.2_Missense_Mutation_p.P146Q|ZNF135_uc010yhr.1_5'UTR	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN	zinc finger protein 135 isoform 2	188					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)										0.214286	14.033623	16.14584	6	22	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	58578379	58578379	18316	19	C	A	A	A	273	21	ZNF135	2	2
STXBP2	6813	broad.mit.edu	37	19	7707105	7707105	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:7707105G>T	uc010xjr.1	+	c.713G>T	c.(712-714)CGC>CTC	p.R238L	STXBP2_uc002mha.3_Missense_Mutation_p.R227L|STXBP2_uc002mhb.3_Missense_Mutation_p.R224L|STXBP2_uc010dvj.2_Non-coding_Transcript|STXBP2_uc010dvk.2_Missense_Mutation_p.R195L|STXBP2_uc002mhc.3_5'UTR|STXBP2_uc002mhe.1_5'Flank	NM_006949	NP_008880	Q15833	STXB2_HUMAN	syntaxin binding protein 2 isoform a	227					neutrophil degranulation|protein transport|regulation of mast cell degranulation|vesicle docking involved in exocytosis	azurophil granule|cytosol|specific granule|tertiary granule	syntaxin-3 binding			central_nervous_system(1)	1														0.5	34.852656	34.852656	12	12	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	7707105	7707105	15873	19	G	T	T	T	494	38	STXBP2	1	1
MUC16	94025	broad.mit.edu	37	19	9049834	9049834	+	Nonsense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:9049834C>T	uc002mkp.2	-	c.31797G>A	c.(31795-31797)TGG>TGA	p.W10599*		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10601	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			ovary(15)|large_intestine(1)|pancreas(1)|breast(1)|skin(1)	19														0.415094	68.236223	68.570746	22	31	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	9049834	9049834	10367	19	C	T	T	T	286	22	MUC16	5	2
MUC16	94025	broad.mit.edu	37	19	9063009	9063009	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:9063009G>T	uc002mkp.2	-	c.24437C>A	c.(24436-24438)CCC>CAC	p.P8146H		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8148	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			ovary(15)|large_intestine(1)|pancreas(1)|breast(1)|skin(1)	19														0.46	66.911096	66.981545	23	27	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	9063009	9063009	10367	19	G	T	T	T	559	43	MUC16	2	2
C1orf103	55791	broad.mit.edu	37	1	111495394	111495395	+	Missense_Mutation	DNP	CC	TA	TA			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:111495394_111495395CC>TA	uc001eaa.2	-	c.111_112GG>TA	c.(109-114)TCGGAT>TCTAAT	p.D38N	C1orf103_uc001dzz.2_5'UTR|C1orf103_uc001eab.2_Intron|C1orf103_uc001eac.1_Intron	NM_018372	NP_060842	Q5T3J3	CA103_HUMAN	receptor-interacting factor 1 isoform 1	38							protein binding				0		all_cancers(81;1.02e-05)|all_epithelial(167;1.87e-05)|all_lung(203;0.000234)|Lung NSC(277;0.000451)		Lung(183;0.0155)|Colorectal(144;0.0314)|all cancers(265;0.082)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0891)|COAD - Colon adenocarcinoma(174;0.134)										0.472222	53.102385	53.123461	17	19	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	111495394	111495395	2044	1	CC	TA	TA	TA	390	30	C1orf103	2	2
MTOR	2475	broad.mit.edu	37	1	11319445	11319445	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:11319445C>A	uc001asd.2	-	c.22G>T	c.(22-24)GCC>TCC	p.A8S		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	8			A -> S (in a lung large cell carcinoma sample; somatic mutation).		cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity	p.A8S(1)		central_nervous_system(7)|ovary(4)|kidney(3)|large_intestine(2)|skin(2)|lung(1)	19										1389				0.616071	231.936835	233.287856	69	43	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	11319445	11319445	10347	1	C	A	A	A	351	27	MTOR	1	1
PTCHD2	57540	broad.mit.edu	37	1	11596579	11596579	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:11596579G>A	uc001ash.3	+	c.4015G>A	c.(4015-4017)GCC>ACC	p.A1339T		NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1339	Helical; (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)										0.666667	52.712108	53.492483	20	10	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	11596579	11596579	13187	1	G	A	A	A	494	38	PTCHD2	1	1
TBX15	6913	broad.mit.edu	37	1	119427386	119427386	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:119427386G>T	uc001ehl.1	-	c.1460C>A	c.(1459-1461)TCC>TAC	p.S487Y	TBX15_uc009whj.1_Missense_Mutation_p.S311Y	NM_152380	NP_689593	Q96SF7	TBX15_HUMAN	T-box 15	593					regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)	2	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)										0.366197	63.92771	65.045055	26	45	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	119427386	119427386	16178	1	G	T	T	T	533	41	TBX15	2	2
ACAP3	116983	broad.mit.edu	37	1	1233393	1233393	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:1233393T>A	uc001aeb.2	-	c.1016A>T	c.(1015-1017)AAG>ATG	p.K339M	ACAP3_uc001ady.2_Missense_Mutation_p.K69M|ACAP3_uc001aea.2_Missense_Mutation_p.K297M	NM_030649	NP_085152	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH	339	PH.				filopodium assembly|regulation of ARF GTPase activity|signal transduction		ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding				0														0.157895	5.712258	7.832975	3	16	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	1233393	1233393	121	1	T	A	A	A	728	56	ACAP3	3	3
HNRNPCL1	343069	broad.mit.edu	37	1	12907513	12907513	+	Missense_Mutation	SNP	T	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:12907513T>G	uc010obf.1	-	c.630A>C	c.(628-630)AAA>AAC	p.K210N	LOC649330_uc009vno.2_TX-REF-MISMATCH	NM_001013631	NP_001013653	O60812	HNRCL_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	210						ribonucleoprotein complex	nucleotide binding				0														0.547264	356.709642	357.078006	110	91	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	12907513	12907513	7555	1	T	G	G	G	777	60	HNRNPCL1	4	4
TCHH	7062	broad.mit.edu	37	1	152081990	152081990	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:152081990C>A	uc001ezp.2	-	c.3703G>T	c.(3703-3705)GTT>TTT	p.V1235F	TCHH_uc009wne.1_Missense_Mutation_p.V1235F	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1235					keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.25	50.190201	54.506724	19	57	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	152081990	152081990	16226	1	C	A	A	A	260	20	TCHH	2	2
FLG	2312	broad.mit.edu	37	1	152284709	152284709	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:152284709C>A	uc001ezu.1	-	c.2653G>T	c.(2653-2655)GGG>TGG	p.G885W		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	885	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)	9	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.336842	462.095426	473.261257	160	315	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	152284709	152284709	6160	1	C	A	A	A	273	21	FLG	2	2
AQP10	89872	broad.mit.edu	37	1	154294481	154294481	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:154294481C>A	uc001feu.2	+	c.178C>A	c.(178-180)CTG>ATG	p.L60M	AQP10_uc001fev.2_Missense_Mutation_p.L60M	NM_080429	NP_536354	Q96PS8	AQP10_HUMAN	aquaporin 10	60	Helical; (Potential).				response to toxin|transmembrane transport|water transport	integral to membrane|plasma membrane	transporter activity			central_nervous_system(1)	1	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)											0.125	4.009618	7.305739	3	21	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	154294481	154294481	833	1	C	A	A	A	415	32	AQP10	2	2
RABGAP1L	9910	broad.mit.edu	37	1	174606543	174606543	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:174606543G>C	uc001gjx.2	+	c.1741G>C	c.(1741-1743)GAT>CAT	p.D581H		NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A	581	Rab-GAP TBC.				regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4														0.262295	48.673256	51.790349	16	45	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	174606543	174606543	13424	1	G	C	C	C	429	33	RABGAP1L	3	3
ASTN1	460	broad.mit.edu	37	1	177001922	177001922	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:177001922G>T	uc001glc.2	-	c.535C>A	c.(535-537)CGC>AGC	p.R179S	ASTN1_uc001glb.1_Missense_Mutation_p.R179S|ASTN1_uc001gld.1_Missense_Mutation_p.R179S|ASTN1_uc009wwx.1_Missense_Mutation_p.R179S|ASTN1_uc001gle.3_Non-coding_Transcript	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	179					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	11										849				0.240741	32.855567	36.165798	13	41	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	177001922	177001922	1083	1	G	T	T	T	494	38	ASTN1	1	1
QSOX1	5768	broad.mit.edu	37	1	180135707	180135707	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:180135707C>T	uc001gnz.2	+	c.347C>T	c.(346-348)CCT>CTT	p.P116L	QSOX1_uc001gny.2_Missense_Mutation_p.P116L|QSOX1_uc001goa.2_Missense_Mutation_p.P116L	NM_002826	NP_002817	O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1 isoform a	116	Thioredoxin.				cell redox homeostasis|oxidation-reduction process|protein thiol-disulfide exchange	extracellular space|integral to Golgi membrane	flavin-linked sulfhydryl oxidase activity			ovary(1)|central_nervous_system(1)	2														0.25	42.699873	46.105795	15	45	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	180135707	180135707	13341	1	C	T	T	T	312	24	QSOX1	2	2
CACNA1E	777	broad.mit.edu	37	1	181754858	181754858	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:181754858C>T	uc001gow.2	+	c.5689C>T	c.(5689-5691)CCC>TCC	p.P1897S	CACNA1E_uc009wxs.2_Missense_Mutation_p.P1785S|CACNA1E_uc009wxt.2_Missense_Mutation_p.P1123S	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1897	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6														0.207101	86.395562	99.882512	35	134	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	181754858	181754858	2658	1	C	T	T	T	286	22	CACNA1E	2	2
FAM5C	339479	broad.mit.edu	37	1	190203559	190203559	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:190203559G>T	uc001gse.1	-	c.667C>A	c.(667-669)CTA>ATA	p.L223I	FAM5C_uc010pot.1_Missense_Mutation_p.L121I	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	223						extracellular region				lung(2)|ovary(1)|kidney(1)	4	Prostate(682;0.198)													0.394737	91.734587	92.47131	30	46	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	190203559	190203559	5817	1	G	T	T	T	451	35	FAM5C	2	2
RGS18	64407	broad.mit.edu	37	1	192150556	192150556	+	Nonsense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:192150556G>T	uc001gsg.2	+	c.418G>T	c.(418-420)GAG>TAG	p.E140*		NM_130782	NP_570138	Q9NS28	RGS18_HUMAN	regulator of G-protein signalling 18	140	RGS.				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)	3														0.237288	31.413002	35.141841	14	45	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	192150556	192150556	13774	1	G	T	T	T	585	45	RGS18	5	2
F13B	2165	broad.mit.edu	37	1	197021812	197021812	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:197021812C>A	uc001gtt.1	-	c.1507G>T	c.(1507-1509)GTG>TTG	p.V503L		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	503	Sushi 8.				blood coagulation	extracellular region				central_nervous_system(1)	1														0.4	71.441147	71.921511	22	33	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	197021812	197021812	5535	1	C	A	A	A	221	17	F13B	2	2
KIF21B	23046	broad.mit.edu	37	1	200977969	200977969	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:200977969G>T	uc001gvs.1	-	c.375C>A	c.(373-375)GCC>GCA	p.A125A	KIF21B_uc001gvr.1_Silent_p.A125A|KIF21B_uc009wzl.1_Silent_p.A125A|KIF21B_uc010ppn.1_Silent_p.A125A	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B	125	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3														0.223684	38.465113	43.787044	17	59	KEEP	---	---	---	---	capture		Silent	SNP	200977969	200977969	8600	1	G	T	T	T	496	39	KIF21B	1	1
MIA3	375056	broad.mit.edu	37	1	222798126	222798126	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:222798126G>A	uc001hnl.2	+	c.284G>A	c.(283-285)GGA>GAA	p.G95E	MIA3_uc009xea.1_5'Flank	NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	95	SH3.|Extracellular (Potential).				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)										0.225	21.95636	24.734325	9	31	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	222798126	222798126	9955	1	G	A	A	A	533	41	MIA3	2	2
OBSCN	84033	broad.mit.edu	37	1	228495021	228495021	+	Silent	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:228495021C>G	uc009xez.1	+	c.12255C>G	c.(12253-12255)GCC>GCG	p.A4085A	OBSCN_uc001hsn.2_Silent_p.A4085A	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	4085	Ig-like 42.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			large_intestine(7)|breast(5)|ovary(4)|skin(2)|stomach(1)|central_nervous_system(1)|pancreas(1)	21		Prostate(94;0.0405)								4006				0.341463	38.147355	39.053263	14	27	KEEP	---	---	---	---	capture		Silent	SNP	228495021	228495021	11217	1	C	G	G	G	275	22	OBSCN	3	3
SIPA1L2	57568	broad.mit.edu	37	1	232600634	232600634	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:232600634C>A	uc001hvg.2	-	c.2772G>T	c.(2770-2772)TCG>TCT	p.S924S	SIPA1L2_uc001hvf.2_5'Flank	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	924					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)												0.211538	26.800928	30.805175	11	41	KEEP	---	---	---	---	capture		Silent	SNP	232600634	232600634	14825	1	C	A	A	A	288	23	SIPA1L2	1	1
WDR64	128025	broad.mit.edu	37	1	241904910	241904910	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:241904910C>G	uc001hzf.1	+	c.544C>G	c.(544-546)CTT>GTT	p.L182V	WDR64_uc001hze.1_Missense_Mutation_p.L462V	NM_144625	NP_653226	B1ANS9	WDR64_HUMAN	WD repeat domain 64	462	WD 6.										0	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)											0.333333	43.802092	44.803001	14	28	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	241904910	241904910	17888	1	C	G	G	G	364	28	WDR64	3	3
CEP170	9859	broad.mit.edu	37	1	243328308	243328308	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:243328308C>T	uc001hzs.2	-	c.2954G>A	c.(2953-2955)AGG>AAG	p.R985K	CEP170_uc001hzt.2_Missense_Mutation_p.R887K|CEP170_uc001hzu.2_Missense_Mutation_p.R887K|CEP170_uc001hzv.1_Missense_Mutation_p.R363K	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	985	Targeting to microtubules.					centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)											0.119048	6.970489	12.933144	5	37	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	243328308	243328308	3383	1	C	T	T	T	312	24	CEP170	2	2
OR2M2	391194	broad.mit.edu	37	1	248344044	248344045	+	Missense_Mutation	DNP	GG	TT	TT			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:248344044_248344045GG>TT	uc010pzf.1	+	c.757_758GG>TT	c.(757-759)GGA>TTA	p.G253L		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	253	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)											0.208955	103.209571	119.011707	42	159	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	248344044	248344045	11416	1	GG	TT	TT	TT	611	47	OR2M2	2	2
OR2T6	254879	broad.mit.edu	37	1	248550933	248550933	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:248550933G>T	uc001iei.1	+	c.24G>T	c.(22-24)TTG>TTT	p.L8F		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	8	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)											0.125	7.247926	16.12366	8	56	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	248550933	248550933	11435	1	G	T	T	T	581	45	OR2T6	2	2
OR2T6	254879	broad.mit.edu	37	1	248551538	248551538	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:248551538C>A	uc001iei.1	+	c.629C>A	c.(628-630)CCC>CAC	p.P210H		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	210	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)											0.358491	54.291753	55.23379	19	34	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	248551538	248551538	11435	1	C	A	A	A	286	22	OR2T6	2	2
CNKSR1	10256	broad.mit.edu	37	1	26515135	26515135	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:26515135C>G	uc001bln.3	+	c.1658C>G	c.(1657-1659)CCT>CGT	p.P553R	CNKSR1_uc001blm.3_Missense_Mutation_p.P546R|CNKSR1_uc009vsd.2_Missense_Mutation_p.P288R|CNKSR1_uc009vse.2_Missense_Mutation_p.P288R|CNKSR1_uc001blo.2_Missense_Mutation_p.P288R|CATSPER4_uc010oey.1_5'Flank|CATSPER4_uc010oez.1_5'Flank|CATSPER4_uc009vsf.2_5'Flank	NM_006314	NP_006305	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras	553					Rho protein signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cell cortex|cell-cell junction	protein binding, bridging			kidney(1)	1		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		NSCLC(180;1396 2109 28270 30756 34275)								0.238095	11.765155	13.080994	5	16	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	26515135	26515135	3744	1	C	G	G	G	312	24	CNKSR1	3	3
WDR63	126820	broad.mit.edu	37	1	85547000	85547000	+	Nonsense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:85547000G>T	uc001dkt.2	+	c.187G>T	c.(187-189)GAA>TAA	p.E63*	WDR63_uc009wcl.2_Nonsense_Mutation_p.E63*	NM_145172	NP_660155	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	63										ovary(2)	2				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)										0.372549	55.509081	56.237789	19	32	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	85547000	85547000	17887	1	G	T	T	T	585	45	WDR63	5	2
EVI5	7813	broad.mit.edu	37	1	93101784	93101784	+	Missense_Mutation	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:93101784T>C	uc010otf.1	-	c.1487A>G	c.(1486-1488)CAG>CGG	p.Q496R	EVI5_uc001dox.2_Missense_Mutation_p.Q485R|EVI5_uc001doy.1_Non-coding_Transcript	NM_005665	NP_005656	O60447	EVI5_HUMAN	ecotropic viral integration site 5	485	Targeting to the centrosomes.|Potential.|Dimerization.				cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)										0.402439	93.952212	94.636114	33	49	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	93101784	93101784	5482	1	T	C	C	C	715	55	EVI5	4	4
PLUNC	51297	broad.mit.edu	37	20	31825664	31825664	+	Silent	SNP	A	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:31825664A>G	uc002wyv.2	+	c.147A>G	c.(145-147)GGA>GGG	p.G49G	PLUNC_uc002wyt.3_Silent_p.G49G|PLUNC_uc002wyu.3_Silent_p.G49G	NM_130852	NP_570913	Q9NP55	PLUNC_HUMAN	palate, lung and nasal epithelium associated	49					innate immune response	extracellular region	lipid binding				0														0.162791	15.534242	20.151778	7	36	KEEP	---	---	---	---	capture		Silent	SNP	31825664	31825664	12541	20	A	G	G	G	106	9	PLUNC	4	4
C20orf117	140710	broad.mit.edu	37	20	35443738	35443738	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:35443738C>A	uc002xgd.1	-	c.1393G>T	c.(1393-1395)GGC>TGC	p.G465C	C20orf117_uc002xge.1_Non-coding_Transcript	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2	465											0		Myeloproliferative disorder(115;0.00874)												0.411765	18.120778	18.236526	7	10	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	35443738	35443738	2159	20	C	A	A	A	286	22	C20orf117	2	2
RALGAPB	57148	broad.mit.edu	37	20	37126060	37126060	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:37126060G>T	uc002xiw.2	+	c.454G>T	c.(454-456)GCC>TCC	p.A152S	RALGAPB_uc010zvz.1_Missense_Mutation_p.A152S|RALGAPB_uc002xix.2_Missense_Mutation_p.A152S|RALGAPB_uc002xiy.1_Missense_Mutation_p.A152S|RALGAPB_uc002xiz.2_Intron	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit	152					activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)	1														0.270588	58.455121	62.518961	23	62	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	37126060	37126060	13475	20	G	T	T	T	546	42	RALGAPB	2	2
TOX2	84969	broad.mit.edu	37	20	42694601	42694601	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:42694601C>A	uc010ggo.2	+	c.1210C>A	c.(1210-1212)CAG>AAG	p.Q404K	TOX2_uc002xle.3_Missense_Mutation_p.Q362K|TOX2_uc010ggp.2_Missense_Mutation_p.Q362K|TOX2_uc002xlf.3_Missense_Mutation_p.Q386K|TOX2_uc002xlg.2_Intron|TOX2_uc010zwk.1_Missense_Mutation_p.Q282K	NM_001098797	NP_001092267	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	386	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)											0.461538	58.547741	58.597794	18	21	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	42694601	42694601	16920	20	C	A	A	A	273	21	TOX2	2	2
HNF4A	3172	broad.mit.edu	37	20	43043227	43043227	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:43043227G>A	uc002xma.2	+	c.573G>A	c.(571-573)ATG>ATA	p.M191I	HNF4A_uc002xlt.2_Missense_Mutation_p.M169I|HNF4A_uc002xlu.2_Missense_Mutation_p.M169I|HNF4A_uc002xlv.2_Missense_Mutation_p.M169I|HNF4A_uc002xly.2_Missense_Mutation_p.M191I|HNF4A_uc002xlz.2_Missense_Mutation_p.M191I|HNF4A_uc010ggq.2_Missense_Mutation_p.M184I	NM_000457	NP_000448	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform b	191					blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|positive regulation of gene-specific transcription from RNA polymerase II promoter|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|promoter binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			Colon(79;2 1269 8820 14841 52347)								0.193548	13.931589	16.64877	6	25	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43043227	43043227	7545	20	G	A	A	A	585	45	HNF4A	2	2
SEMG1	6406	broad.mit.edu	37	20	43836174	43836174	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:43836174C>A	uc002xni.2	+	c.236C>A	c.(235-237)TCC>TAC	p.S79Y	SEMG1_uc002xnj.2_Missense_Mutation_p.S79Y|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Missense_Mutation_p.S79Y	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	79					insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity				0		Myeloproliferative disorder(115;0.0122)												0.180723	21.074097	29.205797	15	68	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43836174	43836174	14530	20	C	A	A	A	390	30	SEMG1	2	2
PREX1	57580	broad.mit.edu	37	20	47276568	47276568	+	Silent	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:47276568G>A	uc002xtw.1	-	c.1770C>T	c.(1768-1770)TCC>TCT	p.S590S		NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	590	DEP 2.				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)											0.333333	78.495943	80.602254	28	56	KEEP	---	---	---	---	capture		Silent	SNP	47276568	47276568	12919	20	G	A	A	A	548	43	PREX1	2	2
CASS4	57091	broad.mit.edu	37	20	55027988	55027988	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:55027988C>A	uc002xxp.2	+	c.1756C>A	c.(1756-1758)CTC>ATC	p.L586I	CASS4_uc002xxq.3_Missense_Mutation_p.L586I|CASS4_uc002xxr.2_Missense_Mutation_p.L586I|CASS4_uc010zze.1_Missense_Mutation_p.L532I|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	586					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)	2														0.263158	37.204622	40.094018	15	42	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55027988	55027988	2802	20	C	A	A	A	364	28	CASS4	2	2
TRMT6	51605	broad.mit.edu	37	20	5921898	5921898	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:5921898C>A	uc002wmh.1	-	c.1206G>T	c.(1204-1206)CAG>CAT	p.Q402H	TRMT6_uc010zra.1_Missense_Mutation_p.Q232H	NM_015939	NP_057023	Q9UJA5	TRM6_HUMAN	tRNA methyltransferase 6	402					regulation of translational initiation|tRNA processing	nucleus	protein binding|translation initiation factor activity			pancreas(1)	1														0.184211	31.629825	38.720763	14	62	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	5921898	5921898	17118	20	C	A	A	A	259	20	TRMT6	2	2
PLCB1	23236	broad.mit.edu	37	20	8862318	8862318	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:8862318C>A	uc002wnb.2	+	c.3473C>A	c.(3472-3474)CCC>CAC	p.P1158H	PLCB1_uc002wna.2_3'UTR	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1	1158					activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of gene-specific transcription|negative regulation of monocyte extravasation|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of gene-specific transcription|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity|transcription repressor activity			ovary(4)|breast(3)|lung(1)	8														0.155556	34.090265	49.40447	21	114	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	8862318	8862318	12453	20	C	A	A	A	286	22	PLCB1	2	2
SON	6651	broad.mit.edu	37	21	34931573	34931573	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:34931573A>T	uc002yse.1	+	c.6359A>T	c.(6358-6360)GAT>GTT	p.D2120V	SON_uc002ysc.2_Missense_Mutation_p.D2120V|SON_uc002ysd.2_Missense_Mutation_p.D1111V|SON_uc002ysf.1_Missense_Mutation_p.D148V|SON_uc002ysg.2_Missense_Mutation_p.D1111V	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	2120					anti-apoptosis	nuclear speck	DNA binding|double-stranded RNA binding			ovary(3)	3														0.402985	81.742365	82.283155	27	40	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	34931573	34931573	15426	21	A	T	T	T	156	12	SON	3	3
ITSN1	6453	broad.mit.edu	37	21	35183407	35183407	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:35183407G>T	uc002yta.1	+	c.2448G>T	c.(2446-2448)GTG>GTT	p.V816V	DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_Non-coding_Transcript|ITSN1_uc002ysz.2_Silent_p.V811V|ITSN1_uc010gmg.2_Silent_p.V774V|ITSN1_uc010gmh.2_Non-coding_Transcript|ITSN1_uc002ysw.2_Silent_p.V816V|ITSN1_uc010gmi.2_Silent_p.V779V|ITSN1_uc010gmj.2_Silent_p.V695V|ITSN1_uc002ysy.2_Silent_p.V811V|ITSN1_uc002ysx.2_Silent_p.V774V|ITSN1_uc002ytb.1_Silent_p.V811V|ITSN1_uc002ytc.1_Silent_p.V811V|ITSN1_uc002ytd.2_Non-coding_Transcript|ITSN1_uc010gmk.2_Silent_p.V779V|ITSN1_uc010gml.2_Non-coding_Transcript|ITSN1_uc002ytj.2_Silent_p.V811V|ITSN1_uc010gmm.1_Non-coding_Transcript|ITSN1_uc002yte.2_Silent_p.V750V|ITSN1_uc002ytf.1_Non-coding_Transcript	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	816					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)	3														0.240741	30.65581	33.963546	13	41	KEEP	---	---	---	---	capture		Silent	SNP	35183407	35183407	8230	21	G	T	T	T	574	45	ITSN1	2	2
DSCAM	1826	broad.mit.edu	37	21	42064832	42064832	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:42064832C>A	uc002yyq.1	-	c.412G>T	c.(412-414)GGC>TGC	p.G138C	DSCAM_uc002yyr.1_Non-coding_Transcript	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	138	Ig-like C2-type 2.|Extracellular (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)	6		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				Melanoma(134;970 1778 1785 21664 32388)								0.487179	57.32314	57.328678	19	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	42064832	42064832	4952	21	C	A	A	A	312	24	DSCAM	2	2
EFCAB6	64800	broad.mit.edu	37	22	43996080	43996080	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:43996080G>C	uc003bdy.1	-	c.2745C>G	c.(2743-2745)AAC>AAG	p.N915K	EFCAB6_uc003bdz.1_Missense_Mutation_p.N763K|EFCAB6_uc010gzi.1_Missense_Mutation_p.N763K|EFCAB6_uc010gzj.1_Missense_Mutation_p.N141K	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	915	EF-hand 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|pancreas(1)	4		Ovarian(80;0.0247)|all_neural(38;0.025)												0.194595	91.595034	107.686486	36	149	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43996080	43996080	5126	22	G	C	C	C	464	36	EFCAB6	3	3
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45122459	45122459	+	Silent	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:45122459C>T	uc003bfd.2	+	c.267C>T	c.(265-267)AAC>AAT	p.N89N	PRR5_uc003bew.1_Silent_p.N80N|PRR5_uc003bex.1_5'UTR|PRR5_uc010gzt.1_Silent_p.N112N|PRR5_uc010gzu.1_Silent_p.N53N|PRR5_uc003bey.1_Silent_p.N80N|PRR5_uc003bez.1_5'UTR|PRR5-ARHGAP8_uc003bfc.2_Silent_p.N89N|PRR5-ARHGAP8_uc011aqi.1_Silent_p.N80N|PRR5-ARHGAP8_uc011aqj.1_5'UTR|PRR5_uc003bfa.1_5'UTR|PRR5_uc003bfb.1_Silent_p.N89N|PRR5_uc003bfe.1_Non-coding_Transcript|PRR5-ARHGAP8_uc003bfg.1_5'UTR	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2												0														0.142857	6.485494	9.923505	4	24	KEEP	---	---	---	---	capture		Silent	SNP	45122459	45122459	13050	22	C	T	T	T	233	18	PRR5-ARHGAP8	2	2
MLC1	23209	broad.mit.edu	37	22	50515832	50515832	+	Missense_Mutation	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:50515832T>C	uc003bjg.1	-	c.523A>G	c.(523-525)AAG>GAG	p.K175E	MLC1_uc011arl.1_Missense_Mutation_p.K123E|MLC1_uc003bjh.1_Missense_Mutation_p.K175E|MLC1_uc011arm.1_Missense_Mutation_p.K145E|MLC1_uc011arn.1_Missense_Mutation_p.K96E|MLC1_uc011aro.1_Missense_Mutation_p.K141E	NM_139202	NP_631941	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with	175	Poly-Lys.					basolateral plasma membrane|endosome|integral to membrane|integral to membrane of membrane fraction	ion channel activity			pancreas(1)	1		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)										0.444444	52.202352	52.29766	16	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	50515832	50515832	10002	22	T	C	C	C	806	62	MLC1	4	4
EDAR	10913	broad.mit.edu	37	2	109513673	109513673	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:109513673G>T	uc010fjn.2	-	c.1133C>A	c.(1132-1134)ACG>AAG	p.T378K	EDAR_uc002teq.3_Missense_Mutation_p.T346K|EDAR_uc010yws.1_Missense_Mutation_p.T378K	NM_022336	NP_071731	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor precursor	346	Cytoplasmic (Potential).				apoptosis|cell differentiation	integral to membrane	protein binding|transmembrane receptor activity				0														0.5	96.904883	96.904883	28	28	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	109513673	109513673	5092	2	G	T	T	T	520	40	EDAR	1	1
KCNF1	3754	broad.mit.edu	37	2	11054013	11054013	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:11054013G>T	uc002rax.2	+	c.1461G>T	c.(1459-1461)AGG>AGT	p.R487S		NM_002236	NP_002227	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F,	487	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)										0.277778	9.762311	10.566102	5	13	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	11054013	11054013	8331	2	G	T	T	T	529	41	KCNF1	2	2
DPP10	57628	broad.mit.edu	37	2	116525980	116525980	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:116525980G>T	uc002tle.2	+	c.1233G>T	c.(1231-1233)CAG>CAT	p.Q411H	DPP10_uc002tla.1_Missense_Mutation_p.Q407H|DPP10_uc002tlb.1_Missense_Mutation_p.Q357H|DPP10_uc002tlc.1_Missense_Mutation_p.Q403H|DPP10_uc002tlf.1_Missense_Mutation_p.Q400H	NM_001004360	NP_001004360	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform short	407	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|breast(1)|skin(1)	9														0.142857	10.328644	15.485008	6	36	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	116525980	116525980	4911	2	G	T	T	T	451	35	DPP10	2	2
CNTNAP5	129684	broad.mit.edu	37	2	125547524	125547524	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:125547524C>A	uc010flu.2	+	c.2798C>A	c.(2797-2799)TCC>TAC	p.S933Y	CNTNAP5_uc002tno.2_Missense_Mutation_p.S932Y	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	932	Laminin G-like 3.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)										0.25	24.92648	27.412551	11	33	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	125547524	125547524	3788	2	C	A	A	A	390	30	CNTNAP5	2	2
SAP130	79595	broad.mit.edu	37	2	128775259	128775259	+	Missense_Mutation	SNP	T	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:128775259T>G	uc010fmd.2	-	c.421A>C	c.(421-423)ATG>CTG	p.M141L	SAP130_uc002tpo.2_5'Flank|SAP130_uc002tpp.2_Missense_Mutation_p.M141L|SAP130_uc002tpq.1_Missense_Mutation_p.M115L	NM_001145928	NP_001139400	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa isoform a	141	Pro-rich.				histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)										0.111111	3.272814	11.47111	6	48	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	128775259	128775259	14311	2	T	G	G	G	637	49	SAP130	4	4
POTEE	445582	broad.mit.edu	37	2	132021677	132021678	+	Nonsense_Mutation	DNP	GG	TT	TT			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:132021677_132021678GG>TT	uc002tsn.2	+	c.2649_2650GG>TT	c.(2647-2652)CGGGAA>CGTTAA	p.E884*	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Nonsense_Mutation_p.E484*|POTEE_uc002tsl.2_Nonsense_Mutation_p.E466*|POTEE_uc010fmy.1_Nonsense_Mutation_p.E348*	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	884	Actin-like.						ATP binding				0														0.298851	69.104988	72.25896	26	61	KEEP	---	---	---	---	capture		Nonsense_Mutation	DNP	132021677	132021678	12694	2	GG	TT	TT	TT	548	43	POTEE	5	2
UPP2	151531	broad.mit.edu	37	2	158980300	158980300	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:158980300G>T	uc002tzo.2	+	c.875G>T	c.(874-876)AGA>ATA	p.R292I	UPP2_uc002tzp.2_Missense_Mutation_p.R235I	NM_001135098	NP_001128570	O95045	UPP2_HUMAN	uridine phosphorylase 2 isoform b	235					nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|uridine metabolic process	cytosol|type III intermediate filament	uridine phosphorylase activity				0														0.32	41.874361	43.318243	16	34	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	158980300	158980300	17574	2	G	T	T	T	429	33	UPP2	2	2
XIRP2	129446	broad.mit.edu	37	2	168099625	168099625	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:168099625C>A	uc002udx.2	+	c.1723C>A	c.(1723-1725)CAG>AAG	p.Q575K	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.Q400K|XIRP2_uc010fpq.2_Missense_Mutation_p.Q353K|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	400	Xin 2.				actin cytoskeleton organization	cell junction	actin binding			ovary(6)|pancreas(1)|skin(1)	8														0.748344	364.909549	373.357419	113	38	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	168099625	168099625	18011	2	C	A	A	A	325	25	XIRP2	2	2
ABCB11	8647	broad.mit.edu	37	2	169792773	169792773	+	Silent	SNP	A	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:169792773A>T	uc002ueo.1	-	c.2781T>A	c.(2779-2781)TCT>TCA	p.S927S	ABCB11_uc010zda.1_Silent_p.S369S|ABCB11_uc010zdb.1_Silent_p.S403S	NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	927	Cytoplasmic (Potential).|ABC transmembrane type-1 2.				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)									0.676056	159.417374	161.370149	48	23	KEEP	---	---	---	---	capture		Silent	SNP	169792773	169792773	43	2	A	T	T	T	132	11	ABCB11	3	3
LRP2	4036	broad.mit.edu	37	2	170070315	170070315	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:170070315C>A	uc002ues.2	-	c.5892G>T	c.(5890-5892)TGG>TGT	p.W1964C		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1964	LDL-receptor class B 18.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	23				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)					2055				0.162921	50.241132	69.41956	29	149	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	170070315	170070315	9329	2	C	A	A	A	286	22	LRP2	2	2
FASTKD1	79675	broad.mit.edu	37	2	170428301	170428301	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:170428301T>A	uc002uev.3	-	c.239A>T	c.(238-240)AAG>ATG	p.K80M	FASTKD1_uc002uew.3_Non-coding_Transcript|FASTKD1_uc002uex.3_Missense_Mutation_p.K66M|FASTKD1_uc002uey.2_Missense_Mutation_p.K66M	NM_024622	NP_078898	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	80					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(4)	4														0.463918	136.971414	137.080494	45	52	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	170428301	170428301	5921	2	T	A	A	A	728	56	FASTKD1	3	3
ITGA6	3655	broad.mit.edu	37	2	173355838	173355838	+	Silent	SNP	A	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:173355838A>G	uc002uhp.1	+	c.2766A>G	c.(2764-2766)AAA>AAG	p.K922K	ITGA6_uc010zdy.1_Silent_p.K803K|ITGA6_uc002uho.1_Silent_p.K922K|ITGA6_uc010fqm.1_Silent_p.K553K	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a	961	Extracellular (Potential).				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|positive regulation of apoptosis	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)											0.196809	91.705687	107.777124	37	151	KEEP	---	---	---	---	capture		Silent	SNP	173355838	173355838	8184	2	A	G	G	G	50	4	ITGA6	4	4
TTN	7273	broad.mit.edu	37	2	179433898	179433898	+	Missense_Mutation	SNP	T	C	C	rs75544937	byFrequency;by1000genomes	TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:179433898T>C	uc010zfg.1	-	c.69257A>G	c.(69256-69258)AAC>AGC	p.N23086S	TTN_uc010zfh.1_Missense_Mutation_p.N16781S|TTN_uc010zfi.1_Missense_Mutation_p.N16714S|TTN_uc010zfj.1_Missense_Mutation_p.N16589S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2855										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)							8722				0.243119	129.295733	142.528508	53	165	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	179433898	179433898	17290	2	T	C	C	C	780	60	TTN	4	4
ZNF385B	151126	broad.mit.edu	37	2	180634429	180634429	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:180634429G>C	uc002unn.3	-	c.54C>G	c.(52-54)GAC>GAG	p.D18E		NM_152520	NP_689733	Q569K4	Z385B_HUMAN	zinc finger protein 385B isoform 1	18						nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			Colon(155;204 2491 32774 51842)								0.138298	23.492472	35.457847	13	81	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	180634429	180634429	18469	2	G	C	C	C	620	48	ZNF385B	3	3
ITGA4	3676	broad.mit.edu	37	2	182360546	182360546	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:182360546C>A	uc002unu.2	+	c.1422C>A	c.(1420-1422)AGC>AGA	p.S474R	ITGA4_uc010frj.1_5'Flank	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	474	FG-GAP 7.|Extracellular (Potential).				B cell differentiation|blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)									0.178082	24.546869	31.668704	13	60	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	182360546	182360546	8182	2	C	A	A	A	337	26	ITGA4	2	2
COL5A2	1290	broad.mit.edu	37	2	189922092	189922092	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:189922092G>C	uc002uqk.2	-	c.2291C>G	c.(2290-2292)CCG>CGG	p.P764R	COL5A2_uc010frx.2_Missense_Mutation_p.P340R	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	764					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)											0.402597	98.183853	98.827532	31	46	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	189922092	189922092	3835	2	G	C	C	C	507	39	COL5A2	3	3
STAT1	6772	broad.mit.edu	37	2	191856010	191856010	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:191856010C>A	uc002usj.2	-	c.981G>T	c.(979-981)ACG>ACT	p.T327T	STAT1_uc010fse.1_Silent_p.T327T|STAT1_uc002usk.2_Silent_p.T327T|STAT1_uc002usl.2_Silent_p.T329T|STAT1_uc010fsf.1_Silent_p.T139T	NM_007315	NP_009330	P42224	STAT1_HUMAN	signal transducer and activator of transcription	327					activation of caspase activity|I-kappaB kinase/NF-kappaB cascade|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of interferon-gamma-mediated signaling pathway|regulation of transcription, DNA-dependent|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway|tyrosine phosphorylation of STAT protein	cytosol|nucleolus|nucleoplasm	calcium ion binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)		Fludarabine(DB01073)					350				0.458333	36.18821	36.214991	11	13	KEEP	---	---	---	---	capture		Silent	SNP	191856010	191856010	15784	2	C	A	A	A	340	27	STAT1	1	1
CDK15	65061	broad.mit.edu	37	2	202671450	202671450	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:202671450G>T	uc002uyt.2	+	c.63G>T	c.(61-63)GAG>GAT	p.E21D	CDK15_uc010ftm.2_Intron|CDK15_uc002uys.2_Intron|CDK15_uc010ftn.1_Intron|CDK15_uc010fto.1_Missense_Mutation_p.E21D	NM_139158	NP_631897	Q96Q40	CDK15_HUMAN	PFTAIRE protein kinase 2	21					protein phosphorylation		ATP binding|cyclin-dependent protein kinase activity|metal ion binding|protein binding			breast(2)|ovary(1)|lung(1)|kidney(1)	5					Adenosine triphosphate(DB00171)					431				0.346154	26.166427	26.710092	9	17	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	202671450	202671450	3260	2	G	T	T	T	443	35	CDK15	2	2
ZDBF2	57683	broad.mit.edu	37	2	207174292	207174292	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:207174292G>T	uc002vbp.2	+	c.5040G>T	c.(5038-5040)CTG>CTT	p.L1680L		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1680							nucleic acid binding|zinc ion binding			ovary(3)	3														0.212766	24.926401	28.50775	10	37	KEEP	---	---	---	---	capture		Silent	SNP	207174292	207174292	18187	2	G	T	T	T	587	46	ZDBF2	2	2
MAP2	4133	broad.mit.edu	37	2	210560646	210560646	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:210560646G>A	uc002vde.1	+	c.3752G>A	c.(3751-3753)CGC>CAC	p.R1251H	MAP2_uc002vdc.1_Missense_Mutation_p.R1251H|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.R1247H	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	1251					negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|large_intestine(2)|pancreas(2)|central_nervous_system(1)	14		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	Pancreas(27;423 979 28787 29963)								0.288462	40.013626	42.094219	15	37	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	210560646	210560646	9618	2	G	A	A	A	494	38	MAP2	1	1
PTPRN	5798	broad.mit.edu	37	2	220161165	220161165	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:220161165C>A	uc002vkz.2	-	c.2384G>T	c.(2383-2385)TGG>TTG	p.W795L	PTPRN_uc010zlc.1_Missense_Mutation_p.W705L|PTPRN_uc002vla.2_Missense_Mutation_p.W766L|MIR153-1_hsa-mir-153-1|MI0000463_5'Flank	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	795	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)	3		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)										0.254545	36.744465	39.738027	14	41	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	220161165	220161165	13264	2	C	A	A	A	273	21	PTPRN	2	2
CHPF	79586	broad.mit.edu	37	2	220404538	220404538	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:220404538G>C	uc002vmc.3	-	c.1895C>G	c.(1894-1896)GCC>GGC	p.A632G	CHPF_uc010zlh.1_Missense_Mutation_p.A470G	NM_024536	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	632	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity|protein binding				0		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)										0.484536	145.017965	145.037429	47	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	220404538	220404538	3502	2	G	C	C	C	546	42	CHPF	3	3
SCG2	7857	broad.mit.edu	37	2	224462250	224462250	+	Missense_Mutation	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:224462250T>C	uc002vnm.2	-	c.1751A>G	c.(1750-1752)TAC>TGC	p.Y584C		NM_003469	NP_003460	P13521	SCG2_HUMAN	secretogranin II precursor	584					angiogenesis|endothelial cell migration|eosinophil chemotaxis|induction of positive chemotaxis|inflammatory response|MAPKKK cascade|negative regulation of apoptosis|negative regulation of endothelial cell proliferation|positive regulation of endothelial cell proliferation|protein secretion	extracellular space	chemoattractant activity|cytokine activity			ovary(1)	1		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)										0.369565	106.840545	108.210111	34	58	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	224462250	224462250	14372	2	T	C	C	C	741	57	SCG2	4	4
SPHKAP	80309	broad.mit.edu	37	2	228884871	228884871	+	Silent	SNP	A	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:228884871A>G	uc002vpq.2	-	c.699T>C	c.(697-699)GAT>GAC	p.D233D	SPHKAP_uc002vpp.2_Silent_p.D233D|SPHKAP_uc010zlx.1_Silent_p.D233D	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	233						cytoplasm	protein binding			ovary(4)|lung(1)	5		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)										0.058394	-7.645246	20.285765	8	129	KEEP	---	---	---	---	capture		Silent	SNP	228884871	228884871	15560	2	A	G	G	G	50	4	SPHKAP	4	4
C2orf53	339779	broad.mit.edu	37	2	27360443	27360443	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:27360443C>A	uc002rjb.2	-	c.755G>T	c.(754-756)TGC>TTC	p.C252F	PREB_uc002rix.1_5'Flank|PREB_uc002riy.1_5'Flank|PREB_uc002riz.1_5'Flank|PREB_uc002rja.1_5'Flank	NM_178553	NP_848648	Q53SZ7	CB053_HUMAN	hypothetical protein LOC339779	252											0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)													0.454545	31.258397	31.296204	10	12	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	27360443	27360443	2262	2	C	A	A	A	325	25	C2orf53	2	2
SRD5A2	6716	broad.mit.edu	37	2	31751320	31751320	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:31751320C>G	uc002rnw.1	-	c.711G>C	c.(709-711)AAG>AAC	p.K237N		NM_000348	NP_000339	P31213	S5A2_HUMAN	3-oxo-5 alpha-steroid 4-dehydrogenase 2	237					androgen biosynthetic process|cell differentiation|cell-cell signaling|male gonad development|oxidation-reduction process	endoplasmic reticulum membrane|integral to membrane|microsome	3-oxo-5-alpha-steroid 4-dehydrogenase activity|sterol 5-alpha reductase activity				0	Acute lymphoblastic leukemia(172;0.155)				Azelaic Acid(DB00548)|Dutasteride(DB01126)									0.5	9.122225	9.122225	3	3	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	31751320	31751320	15653	2	C	G	G	G	415	32	SRD5A2	3	3
SLC8A1	6546	broad.mit.edu	37	2	40657160	40657160	+	Nonsense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:40657160G>T	uc002rrx.2	-	c.261C>A	c.(259-261)TAC>TAA	p.Y87*	SLC8A1_uc002rry.2_Nonsense_Mutation_p.Y87*|SLC8A1_uc002rrz.2_Nonsense_Mutation_p.Y87*|SLC8A1_uc002rsa.2_Nonsense_Mutation_p.Y87*|SLC8A1_uc002rsd.3_Nonsense_Mutation_p.Y87*|SLC8A1_uc002rsb.1_Nonsense_Mutation_p.Y87*|SLC8A1_uc010fan.1_Nonsense_Mutation_p.Y87*|SLC8A1_uc002rsc.1_Nonsense_Mutation_p.Y87*	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	87	Helical; (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)	3					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)									0.424242	89.99631	90.325008	28	38	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	40657160	40657160	15203	2	G	T	T	T	620	48	SLC8A1	5	2
SIX2	10736	broad.mit.edu	37	2	45235686	45235686	+	Nonsense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:45235686G>T	uc002rup.2	-	c.564C>A	c.(562-564)TAC>TAA	p.Y188*	SIX2_uc002ruo.2_Intron	NM_016932	NP_058628	Q9NPC8	SIX2_HUMAN	SIX homeobox 2	187						nucleus	sequence-specific DNA binding transcription factor activity|transcription regulator activity			pancreas(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)												0.583942	273.586645	274.461179	80	57	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	45235686	45235686	14842	2	G	T	T	T	508	40	SIX2	5	1
CCDC88A	55704	broad.mit.edu	37	2	55582735	55582735	+	Silent	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:55582735T>A	uc002ryv.2	-	c.780A>T	c.(778-780)ATA>ATT	p.I260I	CCDC88A_uc010yoz.1_Silent_p.I260I|CCDC88A_uc010ypa.1_Silent_p.I260I|CCDC88A_uc010ypb.1_Silent_p.I162I	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	260	Potential.				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)	2														0.303371	72.356213	75.451731	27	62	KEEP	---	---	---	---	capture		Silent	SNP	55582735	55582735	2988	2	T	A	A	A	784	61	CCDC88A	3	3
ANTXR1	84168	broad.mit.edu	37	2	69409624	69409624	+	Splice_Site_SNP	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:69409624G>T	uc002sfg.2	+	c.1186_splice	c.e16-1	p.V396_splice		NM_032208	NP_115584			anthrax toxin receptor 1 isoform 1 precursor						actin cytoskeleton reorganization|substrate adhesion-dependent cell spreading	filopodium membrane|integral to membrane|lamellipodium membrane	actin filament binding|collagen binding|metal ion binding|protein binding|transmembrane receptor activity			ovary(2)	2														0.27027	26.332959	28.094883	10	27	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	69409624	69409624	719	2	G	T	T	T	455	35	ANTXR1	5	2
CMPK2	129607	broad.mit.edu	37	2	6991603	6991603	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:6991603C>A	uc002qyo.2	-	c.1204G>T	c.(1204-1206)GCC>TCC	p.A402S	CMPK2_uc002qyn.1_Non-coding_Transcript|CMPK2_uc010yis.1_Intron|CMPK2_uc010ewv.2_Missense_Mutation_p.A402S	NM_207315	NP_997198	Q5EBM0	CMPK2_HUMAN	UMP-CMP kinase 2 precursor	402	Potential.				dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)													0.516129	49.059083	49.069844	16	15	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	6991603	6991603	3719	2	C	A	A	A	338	26	CMPK2	2	2
ASPRV1	151516	broad.mit.edu	37	2	70188744	70188744	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:70188744G>C	uc002sfz.3	-	c.77C>G	c.(76-78)GCC>GGC	p.A26G		NM_152792	NP_690005	Q53RT3	APRV1_HUMAN	aspartic peptidase, retroviral-like 1 precursor	26	Cytoplasmic (Potential).				protein maturation by peptide bond cleavage|skin development		aspartic-type endopeptidase activity			ovary(1)	1														0.179775	34.578119	43.137397	16	73	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	70188744	70188744	1077	2	G	C	C	C	546	42	ASPRV1	3	3
ADD2	119	broad.mit.edu	37	2	70903946	70903946	+	Silent	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:70903946G>A	uc002sgz.2	-	c.1575C>T	c.(1573-1575)GCC>GCT	p.A525A	ADD2_uc010fds.1_Non-coding_Transcript|ADD2_uc002sgy.2_Silent_p.A525A|ADD2_uc002sha.2_Silent_p.A219A|ADD2_uc002sgx.2_Silent_p.A525A|ADD2_uc010fdt.1_Silent_p.A525A|ADD2_uc002shc.1_Silent_p.A525A|ADD2_uc002shd.1_Silent_p.A219A|ADD2_uc010fdu.1_Silent_p.A541A	NM_001617	NP_001608	P35612	ADDB_HUMAN	adducin 2 isoform a	525					actin filament bundle assembly|barbed-end actin filament capping|positive regulation of protein binding	cytoplasm|F-actin capping protein complex|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding			ovary(2)|pancreas(1)	3														0.15625	17.797436	24.947604	10	54	KEEP	---	---	---	---	capture		Silent	SNP	70903946	70903946	306	2	G	A	A	A	496	39	ADD2	1	1
SLC4A5	57835	broad.mit.edu	37	2	74479366	74479366	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:74479366C>A	uc002sko.1	-	c.1418G>T	c.(1417-1419)GGG>GTG	p.G473V	SLC4A5_uc002skl.2_Non-coding_Transcript|SLC4A5_uc002skn.2_Missense_Mutation_p.G473V|SLC4A5_uc010ffc.1_Missense_Mutation_p.G473V|SLC4A5_uc002skp.1_Missense_Mutation_p.G409V|SLC4A5_uc002sks.1_Missense_Mutation_p.G473V	NM_021196	NP_067019	Q9BY07	S4A5_HUMAN	sodium bicarbonate transporter 4 isoform a	473	Cytoplasmic (Potential).|Gly-rich.					apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|central_nervous_system(1)|skin(1)	7														0.217391	9.151576	10.860108	5	18	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	74479366	74479366	15154	2	C	A	A	A	286	22	SLC4A5	2	2
LRRTM4	80059	broad.mit.edu	37	2	77745984	77745984	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:77745984C>T	uc002snr.2	-	c.1011G>A	c.(1009-1011)ATG>ATA	p.M337I	LRRTM4_uc002snq.2_Missense_Mutation_p.M337I|LRRTM4_uc002sns.2_Missense_Mutation_p.M337I|LRRTM4_uc002snt.2_Missense_Mutation_p.M338I	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	337	LRRCT.|Extracellular (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)										0.25	7.921463	8.6017	3	9	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	77745984	77745984	9418	2	C	T	T	T	377	29	LRRTM4	2	2
REG3A	5068	broad.mit.edu	37	2	79386527	79386527	+	Missense_Mutation	SNP	A	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:79386527A>G	uc002sod.1	-	c.5T>C	c.(4-6)CTG>CCG	p.L2P	REG3A_uc002soe.1_Missense_Mutation_p.L2P|REG3A_uc002sof.1_Missense_Mutation_p.L2P	NM_138938	NP_620355	Q06141	REG3A_HUMAN	pancreatitis-associated protein precursor	2					acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding				0														0.205882	16.805065	19.532963	7	27	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	79386527	79386527	13681	2	A	G	G	G	91	7	REG3A	4	4
PROM2	150696	broad.mit.edu	37	2	95952241	95952241	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:95952241G>T	uc002suh.1	+	c.1962G>T	c.(1960-1962)CTG>CTT	p.L654L	PROM2_uc002sui.2_Silent_p.L654L|PROM2_uc002suj.2_Silent_p.L308L|PROM2_uc002suk.2_Silent_p.L654L|PROM2_uc002sul.2_Silent_p.L180L|PROM2_uc002sum.2_Non-coding_Transcript	NM_144707	NP_653308	Q8N271	PROM2_HUMAN	prominin 2 precursor	654	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane				ovary(1)	1														0.67	225.826162	228.384426	67	33	KEEP	---	---	---	---	capture		Silent	SNP	95952241	95952241	12999	2	G	T	T	T	600	47	PROM2	2	2
DZIP3	9666	broad.mit.edu	37	3	108363233	108363233	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:108363233C>A	uc003dxd.2	+	c.1364C>A	c.(1363-1365)CCT>CAT	p.P455H	DZIP3_uc003dxf.1_Missense_Mutation_p.P455H|DZIP3_uc011bhm.1_Intron|DZIP3_uc003dxe.1_Missense_Mutation_p.P455H|DZIP3_uc003dxg.1_Missense_Mutation_p.P178H	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	455					protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2														0.176471	37.402294	47.452515	18	84	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	108363233	108363233	5051	3	C	A	A	A	312	24	DZIP3	2	2
HRH1	3269	broad.mit.edu	37	3	11301960	11301960	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:11301960G>T	uc010hdr.2	+	c.1237G>T	c.(1237-1239)GCC>TCC	p.A413S	HRH1_uc010hds.2_Missense_Mutation_p.A413S|HRH1_uc010hdt.2_Missense_Mutation_p.A413S|HRH1_uc003bwb.3_Missense_Mutation_p.A413S	NM_001098213	NP_001091683	P35367	HRH1_HUMAN	histamine receptor H1	413	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|inflammatory response	cytoplasm|integral to plasma membrane|nucleus	histamine receptor activity			large_intestine(1)|ovary(1)	2					Aceprometazine(DB01615)|Astemizole(DB00637)|Azatadine(DB00719)|Azelastine(DB00972)|Benzquinamide(DB00767)|Bepotastine(DB04890)|Bromodiphenhydramine(DB01237)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbinoxamine(DB00748)|Cetirizine(DB00341)|Chlophedianol(DB04837)|Chlorpheniramine(DB01114)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clemastine(DB00283)|Clozapine(DB00363)|Cyclizine(DB01176)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexbrompheniramine(DB00405)|Dimenhydrinate(DB00985)|Diphenhydramine(DB01075)|Diphenylpyraline(DB01146)|Doxepin(DB01142)|Doxylamine(DB00366)|Emedastine(DB01084)|Epinastine(DB00751)|Fexofenadine(DB00950)|Flunarizine(DB04841)|Histamine Phosphate(DB00667)|Hydroxyzine(DB00557)|Ketotifen(DB00920)|Levocabastine(DB01106)|Loratadine(DB00455)|Maprotiline(DB00934)|Meclizine(DB00737)|Mequitazine(DB01071)|Methdilazine(DB00902)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Nedocromil(DB00716)|Olanzapine(DB00334)|Olopatadine(DB00768)|Orphenadrine(DB01173)|Pemirolast(DB00885)|Phenindamine(DB01619)|Pheniramine(DB01620)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Terfenadine(DB00342)|Thiethylperazine(DB00372)|Trazodone(DB00656)|Trimeprazine(DB01246)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Ziprasidone(DB00246)									0.275	78.817466	84.294735	33	87	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	11301960	11301960	7647	3	G	T	T	T	546	42	HRH1	2	2
ARHGAP31	57514	broad.mit.edu	37	3	119132757	119132757	+	Missense_Mutation	SNP	A	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:119132757A>G	uc003ecj.3	+	c.1981A>G	c.(1981-1983)AAA>GAA	p.K661E		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	661					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						Pancreas(7;176 297 5394 51128 51241)								0.294118	77.646503	80.867847	25	60	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	119132757	119132757	892	3	A	G	G	G	117	9	ARHGAP31	4	4
TRIM42	287015	broad.mit.edu	37	3	140401341	140401341	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:140401341C>A	uc003eto.1	+	c.379C>A	c.(379-381)CAG>AAG	p.Q127K		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	127						intracellular	zinc ion binding			lung(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)|skin(1)	6										261				0.1	5.513046	15.095121	6	54	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140401341	140401341	17061	3	C	A	A	A	273	21	TRIM42	2	2
TRIM42	287015	broad.mit.edu	37	3	140401536	140401536	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:140401536G>T	uc003eto.1	+	c.574G>T	c.(574-576)GAC>TAC	p.D192Y		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	192	RING-type.					intracellular	zinc ion binding			lung(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)|skin(1)	6										261				0.163462	31.935305	43.044723	17	87	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140401536	140401536	17061	3	G	T	T	T	481	37	TRIM42	1	1
SLC9A9	285195	broad.mit.edu	37	3	143550975	143550975	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:143550975G>C	uc003evn.2	-	c.264C>G	c.(262-264)TTC>TTG	p.F88L	SLC9A9_uc011bnk.1_Intron	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen	88					regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)	2														0.223684	47.34554	52.671918	17	59	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	143550975	143550975	15218	3	G	C	C	C	581	45	SLC9A9	3	3
IGSF10	285313	broad.mit.edu	37	3	151165710	151165710	+	Missense_Mutation	SNP	T	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:151165710T>G	uc011bod.1	-	c.2059A>C	c.(2059-2061)ATT>CTT	p.I687L		NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	687					cell differentiation|multicellular organismal development|ossification	extracellular region				ovary(4)|central_nervous_system(1)	5			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)											0.387755	64.317109	64.856837	19	30	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	151165710	151165710	7898	3	T	G	G	G	637	49	IGSF10	4	4
GOLIM4	27333	broad.mit.edu	37	3	167754671	167754671	+	Nonsense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:167754671G>A	uc011bpe.1	-	c.796C>T	c.(796-798)CAA>TAA	p.Q266*	GOLIM4_uc003ffe.2_Nonsense_Mutation_p.Q266*|GOLIM4_uc011bpf.1_Nonsense_Mutation_p.Q238*|GOLIM4_uc011bpg.1_Nonsense_Mutation_p.Q238*	NM_014498	NP_055313	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	266	Lumenal (Potential).				transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus				breast(4)	4														0.364407	119.099047	121.00463	43	75	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	167754671	167754671	6839	3	G	A	A	A	624	48	GOLIM4	5	2
AHSG	197	broad.mit.edu	37	3	186338505	186338505	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:186338505C>A	uc003fql.3	+	c.893C>A	c.(892-894)TCC>TAC	p.S298Y	AHSG_uc003fqk.3_Missense_Mutation_p.S297Y|AHSG_uc003fqm.3_Missense_Mutation_p.S296Y|AHSG_uc010hyp.2_Missense_Mutation_p.S260Y	NM_001622	NP_001613	P02765	FETUA_HUMAN	alpha-2-HS-glycoprotein	297					acute-phase response|negative regulation of bone mineralization|negative regulation of insulin receptor signaling pathway|pinocytosis|positive regulation of phagocytosis|regulation of inflammatory response|skeletal system development	extracellular space	cysteine-type endopeptidase inhibitor activity|protein binding				0	all_cancers(143;3.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.27e-20)	GBM - Glioblastoma multiforme(93;0.0463)										0.333333	115.566009	118.919802	45	90	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	186338505	186338505	423	3	C	A	A	A	390	30	AHSG	2	2
LRRC15	131578	broad.mit.edu	37	3	194080398	194080398	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:194080398C>T	uc003ftt.2	-	c.1393G>A	c.(1393-1395)GTC>ATC	p.V465I	LRRC15_uc003ftu.2_Missense_Mutation_p.V459I	NM_001135057	NP_001128529	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15 isoform a	459	LRRCT.|Extracellular (Potential).					integral to membrane				ovary(3)	3	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)										0.2	5.214009	6.474134	3	12	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	194080398	194080398	9344	3	C	T	T	T	221	17	LRRC15	2	2
RNF168	165918	broad.mit.edu	37	3	196210727	196210727	+	Silent	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:196210727G>A	uc003fwq.2	-	c.594C>T	c.(592-594)CCC>CCT	p.P198P	RNF168_uc010iah.2_Silent_p.P31P	NM_152617	NP_689830	Q8IYW5	RN168_HUMAN	ring finger protein 168	198					double-strand break repair|histone H2A K63-linked ubiquitination|positive regulation of DNA repair|response to ionizing radiation	nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)										0.360656	136.257658	138.346092	44	78	KEEP	---	---	---	---	capture		Silent	SNP	196210727	196210727	13936	3	G	A	A	A	444	35	RNF168	2	2
CRTAP	10491	broad.mit.edu	37	3	33155722	33155722	+	Silent	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:33155722G>C	uc003cfl.3	+	c.153G>C	c.(151-153)GCG>GCC	p.A51A	CRTAP_uc010hfz.2_Silent_p.A51A|CRTAP_uc003cfm.2_5'UTR|CRTAP_uc003cfn.2_Intron	NM_006371	NP_006362	O75718	CRTAP_HUMAN	cartilage associated protein precursor	51						proteinaceous extracellular matrix	binding				0														0.4	6.451095	6.494136	2	3	KEEP	---	---	---	---	capture		Silent	SNP	33155722	33155722	4037	3	G	C	C	C	483	38	CRTAP	3	3
DLEC1	9940	broad.mit.edu	37	3	38136527	38136527	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:38136527G>T	uc003chp.1	+	c.2077G>T	c.(2077-2079)GAC>TAC	p.D693Y	DLEC1_uc003cho.1_Missense_Mutation_p.D693Y|DLEC1_uc010hgv.1_Missense_Mutation_p.D693Y|DLEC1_uc003chr.1_5'UTR|DLEC1_uc010hgx.1_5'Flank|DLEC1_uc003chq.1_Intron	NM_007337	NP_031363	Q9Y238	DLEC1_HUMAN	deleted in lung and esophageal cancer 1 isoform	693					negative regulation of cell proliferation	cytoplasm				ovary(2)|pancreas(2)|central_nervous_system(2)|breast(1)|skin(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)										0.266667	30.378849	32.592551	12	33	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	38136527	38136527	4732	3	G	T	T	T	429	33	DLEC1	2	2
XIRP1	165904	broad.mit.edu	37	3	39226990	39226990	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:39226990G>A	uc003cjk.1	-	c.3947C>T	c.(3946-3948)CCC>CTC	p.P1316L	XIRP1_uc003cji.2_3'UTR|XIRP1_uc003cjj.2_5'UTR	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1316	Pro-rich.						actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)										0.139535	9.789806	15.130133	6	37	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	39226990	39226990	18010	3	G	A	A	A	559	43	XIRP1	2	2
CHL1	10752	broad.mit.edu	37	3	447274	447274	+	Missense_Mutation	SNP	G	T	T	rs77982207	by1000genomes	TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:447274G>T	uc003bot.2	+	c.3555G>T	c.(3553-3555)GAG>GAT	p.E1185D	CHL1_uc003bou.2_Missense_Mutation_p.E1169D|CHL1_uc011asi.1_Missense_Mutation_p.E1132D	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	1169	Cytoplasmic (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				central_nervous_system(4)|large_intestine(2)|ovary(1)	7		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)						659				0.185185	18.428814	23.447611	10	44	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	447274	447274	3483	3	G	T	T	T	451	35	CHL1	2	2
ZMYND10	51364	broad.mit.edu	37	3	50379321	50379321	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:50379321G>T	uc003dag.1	-	c.1041C>A	c.(1039-1041)GGC>GGA	p.G347G	RASSF1_uc003dad.1_5'Flank|RASSF1_uc003dae.1_5'Flank|RASSF1_uc010hlk.1_5'Flank|RASSF1_uc003daf.1_5'Flank|RASSF1_uc011bdq.1_5'Flank|ZMYND10_uc010hll.1_Silent_p.G342G|ZMYND10_uc003dah.1_Silent_p.G268G	NM_015896	NP_056980	O75800	ZMY10_HUMAN	zinc finger, MYND domain-containing 10	347						cytoplasm	protein binding|zinc ion binding			lung(4)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)						203	TSP Lung(30;0.18)			0.107143	2.604347	6.8928	3	25	KEEP	---	---	---	---	capture		Silent	SNP	50379321	50379321	18296	3	G	T	T	T	587	46	ZMYND10	2	2
ARHGEF3	50650	broad.mit.edu	37	3	56763635	56763635	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:56763635C>A	uc003dih.2	-	c.1340G>T	c.(1339-1341)AGA>ATA	p.R447I	ARHGEF3_uc011bew.1_Missense_Mutation_p.R415I|ARHGEF3_uc011bev.1_Missense_Mutation_p.R386I|ARHGEF3_uc003dif.2_Missense_Mutation_p.R421I|ARHGEF3_uc003dig.2_Missense_Mutation_p.R415I|ARHGEF3_uc010hmy.1_Missense_Mutation_p.R213I	NM_001128615	NP_001122087	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor 3 isoform	415	PH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)										0.126984	9.853956	18.408202	8	55	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	56763635	56763635	918	3	C	A	A	A	416	32	ARHGEF3	2	2
ABHD6	57406	broad.mit.edu	37	3	58253072	58253072	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:58253072G>T	uc003djr.2	+	c.276G>T	c.(274-276)AAG>AAT	p.K92N	ABHD6_uc003djs.3_Missense_Mutation_p.K92N|ABHD6_uc003djt.3_Missense_Mutation_p.K92N	NM_020676	NP_065727	Q9BV23	ABHD6_HUMAN	abhydrolase domain containing 6	92	Cytoplasmic (Potential).					integral to membrane	acylglycerol lipase activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(55;0.000225)|KIRC - Kidney renal clear cell carcinoma(284;0.0471)|Kidney(284;0.0589)|OV - Ovarian serous cystadenocarcinoma(275;0.209)										0.148148	4.978702	8.196515	4	23	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	58253072	58253072	87	3	G	T	T	T	451	35	ABHD6	2	2
EPHA6	285220	broad.mit.edu	37	3	97356925	97356925	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:97356925C>G	uc010how.1	+	c.2783C>G	c.(2782-2784)ACT>AGT	p.T928S	EPHA6_uc011bgp.1_3'UTR|EPHA6_uc003drs.3_Missense_Mutation_p.T320S|EPHA6_uc003drr.3_Missense_Mutation_p.T320S|EPHA6_uc003drt.2_Missense_Mutation_p.T320S|EPHA6_uc010hox.1_Non-coding_Transcript	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	833	Protein kinase.|Cytoplasmic (Potential).				protein phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(3)|lung(3)|stomach(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	12										480				0.428571	49.454554	49.601871	15	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	97356925	97356925	5364	3	C	G	G	G	260	20	EPHA6	3	3
TTLL3	26140	broad.mit.edu	37	3	9877020	9877020	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:9877020G>T	uc003btg.2	+	c.2166G>T	c.(2164-2166)AAG>AAT	p.K722N	ARPC4_uc003btc.1_Intron|TTLL3_uc003btd.3_3'UTR|TTLL3_uc003btf.3_3'UTR|TTLL3_uc003bth.3_3'UTR|TTLL3_uc011atj.1_3'UTR|TTLL3_uc003btj.3_3'UTR|TTLL3_uc003bti.3_3'UTR	NM_001025930	NP_001021100	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	722					axoneme assembly|cilium assembly|protein polyglycylation	cilium axoneme|cytoplasm|microtubule	protein-glycine ligase activity, initiating|tubulin-tyrosine ligase activity			large_intestine(2)	2	Medulloblastoma(99;0.227)													0.076923	-0.426269	9.088348	4	48	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	9877020	9877020	17283	3	G	T	T	T	438	34	TTLL3	2	2
NPNT	255743	broad.mit.edu	37	4	106858268	106858268	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:106858268C>G	uc011cfd.1	+	c.458C>G	c.(457-459)CCG>CGG	p.P153R	NPNT_uc003hya.2_Missense_Mutation_p.P123R|NPNT_uc011cfc.1_Missense_Mutation_p.P140R|NPNT_uc011cfe.1_Missense_Mutation_p.P153R|NPNT_uc010ilt.1_Missense_Mutation_p.P123R|NPNT_uc011cff.1_Missense_Mutation_p.P123R|NPNT_uc010ilu.1_Missense_Mutation_p.P19R	NM_001033047	NP_001028219	Q6UXI9	NPNT_HUMAN	nephronectin precursor	123	EGF-like 2; calcium-binding (Potential).				cell differentiation	membrane	calcium ion binding				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)										0.153846	23.559994	35.461893	16	88	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	106858268	106858268	10995	4	C	G	G	G	299	23	NPNT	3	3
PCDH10	57575	broad.mit.edu	37	4	134073219	134073219	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:134073219C>G	uc003iha.2	+	c.1924C>G	c.(1924-1926)CGC>GGC	p.R642G	PCDH10_uc003igz.2_Missense_Mutation_p.R642G	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	642	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1				LUSC - Lung squamous cell carcinoma(193;0.227)										0.410256	49.499497	49.771431	16	23	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	134073219	134073219	11927	4	C	G	G	G	247	19	PCDH10	3	3
PCDH10	57575	broad.mit.edu	37	4	134084244	134084245	+	Missense_Mutation	DNP	CA	AG	AG			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:134084244_134084245CA>AG	uc003iha.2	+	c.2910_2911CA>AG	c.(2908-2913)CGCAGC>CGAGGC	p.S971G		NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	971	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1				LUSC - Lung squamous cell carcinoma(193;0.227)										0.41791	88.208998	88.597331	28	39	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	134084244	134084245	11927	4	CA	AG	AG	AG	314	25	PCDH10	2	2
DCHS2	54798	broad.mit.edu	37	4	155312364	155312364	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:155312364C>G	uc003inw.2	-	c.86G>C	c.(85-87)TGT>TCT	p.C29S	DCHS2_uc003inx.2_Intron	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	29					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)										0.478261	39.325274	39.334627	11	12	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	155312364	155312364	4459	4	C	G	G	G	221	17	DCHS2	3	3
DDX60	55601	broad.mit.edu	37	4	169201532	169201532	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:169201532T>A	uc003irp.2	-	c.1932A>T	c.(1930-1932)TTA>TTT	p.L644F		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	644							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)										0.384615	84.2261	85.137867	30	48	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	169201532	169201532	4549	4	T	A	A	A	790	61	DDX60	3	3
DDX60	55601	broad.mit.edu	37	4	169213030	169213030	+	Nonsense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:169213030C>A	uc003irp.2	-	c.910G>T	c.(910-912)GAG>TAG	p.E304*		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	304							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)										0.36	24.226888	24.633449	9	16	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	169213030	169213030	4549	4	C	A	A	A	390	30	DDX60	5	2
VEGFC	7424	broad.mit.edu	37	4	177608442	177608442	+	Silent	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:177608442G>A	uc003ius.1	-	c.1044C>T	c.(1042-1044)CCC>CCT	p.P348P		NM_005429	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	348	4 X 16 AA repeats of C-X(10)-C-X-C- X(1,3)-C.|4.				angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity			lung(2)	2		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)						148				0.443182	239.807022	240.303412	78	98	KEEP	---	---	---	---	capture		Silent	SNP	177608442	177608442	17719	4	G	A	A	A	600	47	VEGFC	2	2
DCTD	1635	broad.mit.edu	37	4	183814239	183814239	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:183814239T>A	uc003ivg.2	-	c.436A>T	c.(436-438)AGT>TGT	p.S146C	DCTD_uc003ivf.2_Missense_Mutation_p.S135C|DCTD_uc010irw.2_Missense_Mutation_p.S76C|DCTD_uc003ivh.2_Missense_Mutation_p.S76C	NM_001012732	NP_001012750	P32321	DCTD_HUMAN	dCMP deaminase isoform a	135					nucleotide biosynthetic process|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide metabolic process	cytosol	dCMP deaminase activity|zinc ion binding				0		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00666)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.202)		all cancers(43;1.65e-24)|Epithelial(43;3.44e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.39e-10)|Colorectal(24;4.69e-07)|COAD - Colon adenocarcinoma(29;7.07e-05)|STAD - Stomach adenocarcinoma(60;0.000118)|GBM - Glioblastoma multiforme(59;0.000472)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.0419)										0.5	19.95007	19.95007	6	6	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	183814239	183814239	4476	4	T	A	A	A	689	53	DCTD	3	3
PCDH7	5099	broad.mit.edu	37	4	31144138	31144138	+	Silent	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:31144138T>A	uc011bxx.1	+	c.3411T>A	c.(3409-3411)ACT>ACA	p.T1137T	PCDH7_uc011bxw.1_Silent_p.T1090T	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	Error:Variant_position_missing_in_O60245_after_alignment					homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4														0.355072	132.046018	134.594933	49	89	KEEP	---	---	---	---	capture		Silent	SNP	31144138	31144138	11936	4	T	A	A	A	691	54	PCDH7	3	3
AASDH	132949	broad.mit.edu	37	4	57220956	57220957	+	Missense_Mutation	DNP	CA	AT	AT			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:57220956_57220957CA>AT	uc003hbn.2	-	c.1124_1125TG>AT	c.(1123-1125)CTG>CAT	p.L375H	AASDH_uc010ihb.2_De_novo_Start_OutOfFrame|AASDH_uc011caa.1_Missense_Mutation_p.L222H|AASDH_uc003hbo.2_Missense_Mutation_p.L275H|AASDH_uc011cab.1_Intron|AASDH_uc010ihc.2_Missense_Mutation_p.L375H|AASDH_uc003hbp.2_Missense_Mutation_p.L375H	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	375					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)												0.388889	78.788527	79.564141	28	44	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	57220956	57220957	23	4	CA	AT	AT	AT	262	21	AASDH	2	2
POLR2B	5431	broad.mit.edu	37	4	57871515	57871515	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:57871515G>T	uc003hcl.1	+	c.1004G>T	c.(1003-1005)AGA>ATA	p.R335I	POLR2B_uc011cae.1_Missense_Mutation_p.R328I|POLR2B_uc011caf.1_Missense_Mutation_p.R260I	NM_000938	NP_000929	P30876	RPB2_HUMAN	DNA directed RNA polymerase II polypeptide B	335					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(2)	2	Glioma(25;0.08)|all_neural(26;0.181)													0.283333	37.947614	40.480953	17	43	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	57871515	57871515	12643	4	G	T	T	T	429	33	POLR2B	2	2
TECRL	253017	broad.mit.edu	37	4	65188411	65188411	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:65188411G>T	uc003hcv.2	-	c.431C>A	c.(430-432)ACC>AAC	p.T144N	TECRL_uc003hcw.2_Missense_Mutation_p.T144N	NM_001010874	NP_001010874	Q5HYJ1	TECRL_HUMAN	steroid 5 alpha-reductase 2-like 2	144	Helical; (Potential).				lipid metabolic process|oxidation-reduction process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors				0														0.137255	8.612633	15.098342	7	44	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	65188411	65188411	16273	4	G	T	T	T	572	44	TECRL	2	2
TMPRSS11B	132724	broad.mit.edu	37	4	69097025	69097025	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:69097025C>A	uc003hdw.3	-	c.582G>T	c.(580-582)GGG>GGT	p.G194G		NM_182502	NP_872308	Q86T26	TM11B_HUMAN	transmembrane protease, serine 11B	194	Peptidase S1.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1														0.195122	16.878039	20.430912	8	33	KEEP	---	---	---	---	capture		Silent	SNP	69097025	69097025	16780	4	C	A	A	A	275	22	TMPRSS11B	2	2
TBC1D14	57533	broad.mit.edu	37	4	6969151	6969151	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:6969151G>T	uc011bwg.1	+	c.843G>T	c.(841-843)AAG>AAT	p.K281N	TBC1D14_uc003gjs.3_Missense_Mutation_p.K281N	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a	281						intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2														0.205128	16.555292	19.758244	8	31	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	6969151	6969151	16125	4	G	T	T	T	451	35	TBC1D14	2	2
MUC7	4589	broad.mit.edu	37	4	71346872	71346872	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:71346872C>A	uc011cat.1	+	c.411C>A	c.(409-411)ACC>ACA	p.T137T	MUC7_uc011cau.1_Silent_p.T137T|MUC7_uc003hfj.2_Silent_p.T137T	NM_001145006	NP_001138478	Q8TAX7	MUC7_HUMAN	mucin 7, secreted precursor	137	Thr-rich.					extracellular region	protein binding			ovary(2)|central_nervous_system(1)	3			Lung(101;0.211)											0.242105	56.393585	62.147828	23	72	KEEP	---	---	---	---	capture		Silent	SNP	71346872	71346872	10375	4	C	A	A	A	262	21	MUC7	2	2
GC	2638	broad.mit.edu	37	4	72623793	72623793	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:72623793C>T	uc010iif.2	-	c.854G>A	c.(853-855)TGT>TAT	p.C285Y	GC_uc003hgd.2_Missense_Mutation_p.C144Y|GC_uc010iie.2_Missense_Mutation_p.C266Y|GC_uc003hge.2_Missense_Mutation_p.C266Y	NM_000583	NP_000574	P02774	VTDB_HUMAN	vitamin D-binding protein precursor	266	Albumin 2.				hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity			ovary(2)	2		all_hematologic(202;0.107)	Lung(101;0.148)		Cholecalciferol(DB00169)									0.311828	80.746789	83.67579	29	64	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72623793	72623793	6548	4	C	T	T	T	221	17	GC	2	2
ADAMTS3	9508	broad.mit.edu	37	4	73185608	73185608	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:73185608G>A	uc003hgk.1	-	c.1175C>T	c.(1174-1176)TCT>TTT	p.S392F		NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	392	Peptidase M12B.				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			NSCLC(168;1941 2048 2918 13048 43078)								0.5	65.095421	65.095421	20	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	73185608	73185608	268	4	G	A	A	A	429	33	ADAMTS3	2	2
ANKRD56	345079	broad.mit.edu	37	4	77816878	77816878	+	Nonsense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:77816878G>A	uc003hki.2	-	c.2125C>T	c.(2125-2127)CAG>TAG	p.Q709*		NM_001029870	NP_001025041	A6NEL2	ANR56_HUMAN	ankyrin repeat domain 56	709											0														0.185965	99.070574	125.308132	53	232	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	77816878	77816878	690	4	G	A	A	A	598	46	ANKRD56	5	2
NAA11	84779	broad.mit.edu	37	4	80246495	80246495	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:80246495C>A	uc003hlt.3	-	c.537G>T	c.(535-537)GAG>GAT	p.E179D		NM_032693	NP_116082	Q9BSU3	NAA11_HUMAN	alpha-N-acetyltransferase 1B	179						cytoplasm|nucleus	peptide alpha-N-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2														0.386364	46.375904	46.869577	17	27	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	80246495	80246495	10512	4	C	A	A	A	415	32	NAA11	2	2
ANTXR2	118429	broad.mit.edu	37	4	80905035	80905035	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:80905035C>A	uc003hlz.3	-	c.1176G>T	c.(1174-1176)ATG>ATT	p.M392I	ANTXR2_uc003hly.3_Missense_Mutation_p.M392I|ANTXR2_uc003hlx.1_Non-coding_Transcript|ANTXR2_uc010ijn.2_Missense_Mutation_p.M289I	NM_001145794	NP_001139266	P58335	ANTR2_HUMAN	anthrax toxin receptor 2 isoform 2	392	Cytoplasmic (Potential).					endoplasmic reticulum membrane|extracellular region|integral to membrane|plasma membrane	metal ion binding|protein binding|receptor activity			ovary(1)	1														0.15	6.012408	8.360436	3	17	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	80905035	80905035	720	4	C	A	A	A	273	21	ANTXR2	2	2
CHSY3	337876	broad.mit.edu	37	5	129243809	129243809	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:129243809G>T	uc003kvd.2	+	c.842G>T	c.(841-843)AGT>ATT	p.S281I		NM_175856	NP_787052	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	281	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)										0.214286	23.35104	26.517347	9	33	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	129243809	129243809	3547	5	G	T	T	T	468	36	CHSY3	2	2
HINT1	3094	broad.mit.edu	37	5	130500892	130500892	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:130500892C>T	uc003kve.3	-	c.7G>A	c.(7-9)GAT>AAT	p.D3N	HINT1_uc011cxd.1_Non-coding_Transcript|HINT1_uc003kvf.3_Non-coding_Transcript	NM_005340	NP_005331	P49773	HINT1_HUMAN	histidine triad nucleotide binding protein 1	3					signal transduction	cytoplasm|cytoskeleton|nucleus	hydrolase activity|protein kinase C binding				0		all_cancers(142;0.0452)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Adenosine monophosphate(DB00131)									0.222222	12.53276	14.453544	6	21	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	130500892	130500892	7396	5	C	T	T	T	416	32	HINT1	2	2
WNT8A	7478	broad.mit.edu	37	5	137424664	137424664	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:137424664G>T	uc003lcd.1	+	c.416G>T	c.(415-417)GGG>GTG	p.G139V	BRD8_uc003lcc.1_Intron|WNT8A_uc011cyj.1_Missense_Mutation_p.G157V|WNT8A_uc011cyk.1_Missense_Mutation_p.G157V	NM_058244	NP_490645	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family,	139					brain segmentation|canonical Wnt receptor signaling pathway involved in neural crest cell differentiation|cell migration involved in gastrulation|dorsal/ventral pattern formation|ectoderm development|endoderm development|eye development|hindbrain development|mesodermal cell fate commitment|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of Wnt receptor signaling pathway|neural crest cell fate commitment|neural plate pattern specification|notochord development|palate development|polarity specification of anterior/posterior axis|polarity specification of proximal/distal axis|positive regulation of fibroblast growth factor receptor signaling pathway|regulation of transcription involved in anterior/posterior axis specification|response to retinoic acid|somitogenesis|spinal cord anterior/posterior patterning|tail morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled binding|signal transducer activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)											0.178571	17.103235	22.570014	10	46	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	137424664	137424664	17970	5	G	T	T	T	559	43	WNT8A	2	2
PCDHA1	56147	broad.mit.edu	37	5	140167627	140167628	+	Missense_Mutation	DNP	GG	TC	TC			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140167627_140167628GG>TC	uc003lhb.2	+	c.1752_1753GG>TC	c.(1750-1755)TTGGTG>TTTCTG	p.584_585LV>FL	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Missense_Mutation_p.584_585LV>FL	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	584_585	Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.192308	32.998832	39.880714	15	63	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	140167627	140167628	11939	5	GG	TC	TC	TC	607	47	PCDHA1	2	2
PCDHA2	56146	broad.mit.edu	37	5	140174650	140174651	+	Nonsense_Mutation	DNP	CC	AG	AG			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140174650_140174651CC>AG	uc003lhd.2	+	c.101_102CC>AG	c.(100-102)TCC>TAG	p.S34*	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Nonsense_Mutation_p.S34*|PCDHA2_uc011czy.1_Nonsense_Mutation_p.S34*	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	34	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.229508	36.064089	40.124235	14	47	KEEP	---	---	---	---	capture		Nonsense_Mutation	DNP	140174650	140174651	11944	5	CC	AG	AG	AG	390	30	PCDHA2	5	2
PCDHA8	56140	broad.mit.edu	37	5	140222651	140222651	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140222651C>A	uc003lhs.2	+	c.1745C>A	c.(1744-1746)CCG>CAG	p.P582Q	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.P582Q	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	582	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.184615	23.979849	30.032136	12	53	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140222651	140222651	11950	5	C	A	A	A	299	23	PCDHA8	1	1
PCDHB14	56122	broad.mit.edu	37	5	140605248	140605248	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140605248G>A	uc003ljb.2	+	c.2171G>A	c.(2170-2172)CGC>CAC	p.R724H	PCDHB14_uc011dal.1_Missense_Mutation_p.R571H	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	724	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			Ovarian(141;50 1831 27899 33809 37648)								0.251701	83.291038	91.407735	37	110	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140605248	140605248	11959	5	G	A	A	A	494	38	PCDHB14	1	1
PCDHGA2	56113	broad.mit.edu	37	5	140718872	140718872	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140718872G>T	uc003ljk.1	+	c.334G>T	c.(334-336)GAT>TAT	p.D112Y	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Missense_Mutation_p.D112Y	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	112	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.2	20.247794	24.015687	9	36	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140718872	140718872	11974	5	G	T	T	T	533	41	PCDHGA2	2	2
ARAP3	64411	broad.mit.edu	37	5	141051722	141051722	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:141051722C>T	uc003llm.2	-	c.1532G>A	c.(1531-1533)CGC>CAC	p.R511H	ARAP3_uc011dbe.1_Missense_Mutation_p.R173H|ARAP3_uc003lln.2_Missense_Mutation_p.R433H|ARAP3_uc003llo.1_Missense_Mutation_p.R511H	NM_022481	NP_071926	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	511	Arf-GAP.|C4-type.				cytoskeleton organization|negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of ARF GTPase activity|regulation of cell shape|small GTPase mediated signal transduction|vesicle-mediated transport	cytoskeleton|cytosol|lamellipodium|plasma membrane|ruffle	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|Rho GTPase activator activity|zinc ion binding			breast(5)|ovary(1)|large_intestine(1)	7														0.112583	16.44231	38.757225	17	134	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	141051722	141051722	851	5	C	T	T	T	351	27	ARAP3	1	1
JAKMIP2	9832	broad.mit.edu	37	5	147027966	147027966	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:147027966G>T	uc010jgo.1	-	c.909C>A	c.(907-909)ACC>ACA	p.T303T	JAKMIP2_uc003loq.1_Silent_p.T303T|JAKMIP2_uc011dbx.1_Silent_p.T261T|JAKMIP2_uc003lor.1_Silent_p.T303T	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein	303	Potential.					Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.223301	57.272067	64.521937	23	80	KEEP	---	---	---	---	capture		Silent	SNP	147027966	147027966	8245	5	G	T	T	T	444	35	JAKMIP2	2	2
ODZ2	57451	broad.mit.edu	37	5	167689182	167689182	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:167689182C>A	uc010jjd.2	+	c.7665C>A	c.(7663-7665)ACC>ACA	p.T2555T	ODZ2_uc003lzr.3_Silent_p.T2325T|ODZ2_uc003lzt.3_Silent_p.T1928T|ODZ2_uc010jje.2_Silent_p.T1819T	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)										0.444444	10.797691	10.822009	4	5	KEEP	---	---	---	---	capture		Silent	SNP	167689182	167689182	11240	5	C	A	A	A	262	21	ODZ2	2	2
HMP19	51617	broad.mit.edu	37	5	173534486	173534486	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:173534486C>A	uc003mcx.2	+	c.494C>A	c.(493-495)CCG>CAG	p.P165Q	HMP19_uc011dfh.1_Missense_Mutation_p.R69S	NM_015980	NP_057064	Q9Y328	NSG2_HUMAN	HMP19 protein	165	Lumenal (Potential).				dopamine receptor signaling pathway	cytoplasmic vesicle membrane|Golgi cisterna membrane|integral to membrane|multivesicular body membrane	dopamine receptor binding			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00925)|all_lung(126;0.0148)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)											0.272727	8.625802	9.13436	3	8	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	173534486	173534486	7537	5	C	A	A	A	299	23	HMP19	1	1
HK3	3101	broad.mit.edu	37	5	176323160	176323160	+	Missense_Mutation	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:176323160T>C	uc003mfa.2	-	c.1A>G	c.(1-3)ATG>GTG	p.M1V		NM_002115	NP_002106	P52790	HXK3_HUMAN	hexokinase 3	1	Regulatory.				glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity			ovary(3)|large_intestine(1)|breast(1)	5	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)											0.233333	13.507766	15.464031	7	23	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	176323160	176323160	7483	5	T	C	C	C	663	51	HK3	4	4
ZFR	51663	broad.mit.edu	37	5	32415138	32415138	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:32415138C>A	uc003jhr.1	-	c.720G>T	c.(718-720)GCG>GCT	p.A240A	ZFR_uc010iun.1_Silent_p.A240A	NM_016107	NP_057191	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	240	Ala-rich.				multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding				0				STAD - Stomach adenocarcinoma(35;0.19)										0.372093	46.629882	47.269046	16	27	KEEP	---	---	---	---	capture		Silent	SNP	32415138	32415138	18249	5	C	A	A	A	288	23	ZFR	1	1
AGXT2	64902	broad.mit.edu	37	5	35035391	35035391	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:35035391C>T	uc003jjf.2	-	c.517G>A	c.(517-519)GCC>ACC	p.A173T	AGXT2_uc011com.1_Missense_Mutation_p.A173T|AGXT2_uc011con.1_Missense_Mutation_p.A81T	NM_031900	NP_114106	Q9BYV1	AGT2_HUMAN	alanine-glyoxylate aminotransferase 2 precursor	173					glyoxylate metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity|alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(3)	3	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)									0.507042	121.945919	121.950223	36	35	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	35035391	35035391	408	5	C	T	T	T	364	28	AGXT2	2	2
MRPS36	92259	broad.mit.edu	37	5	68522176	68522176	+	Silent	SNP	A	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:68522176A>G	uc003jvq.2	+	c.54A>G	c.(52-54)CCA>CCG	p.P18P	MRPS36_uc003jvr.2_Non-coding_Transcript	NM_033281	NP_150597	P82909	RT36_HUMAN	mitochondrial ribosomal protein S36	18					translation	mitochondrial small ribosomal subunit	structural constituent of ribosome				0		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.04e-56)|Epithelial(20;8.79e-53)|all cancers(19;2.01e-48)|Lung(70;0.0176)										0.142857	10.831823	15.985557	6	36	KEEP	---	---	---	---	capture		Silent	SNP	68522176	68522176	10238	5	A	G	G	G	67	6	MRPS36	4	4
VCAN	1462	broad.mit.edu	37	5	82808109	82808109	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:82808109G>C	uc003kii.3	+	c.936G>C	c.(934-936)AGG>AGC	p.R312S	VCAN_uc003kij.3_Missense_Mutation_p.R312S|VCAN_uc010jau.2_Missense_Mutation_p.R312S|VCAN_uc003kik.3_Missense_Mutation_p.R312S|VCAN_uc003kih.3_Missense_Mutation_p.R312S	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	312	Link 2.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(3)|lung(2)|central_nervous_system(1)	13		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)										0.157895	5.91351	8.033119	3	16	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	82808109	82808109	17703	5	G	C	C	C	555	43	VCAN	3	3
VCAN	1462	broad.mit.edu	37	5	82868259	82868259	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:82868259C>A	uc003kii.3	+	c.9760C>A	c.(9760-9762)CAG>AAG	p.Q3254K	VCAN_uc003kij.3_Missense_Mutation_p.Q2267K|VCAN_uc010jau.2_Missense_Mutation_p.Q1500K|VCAN_uc003kik.3_Missense_Mutation_p.Q513K|VCAN_uc003kil.3_Missense_Mutation_p.Q1918K	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	3254	C-type lectin.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(3)|lung(2)|central_nervous_system(1)	13		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)										0.152941	22.097503	31.942866	13	72	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	82868259	82868259	17703	5	C	A	A	A	273	21	VCAN	2	2
ZDHHC11	79844	broad.mit.edu	37	5	840719	840719	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:840719C>A	uc011cma.1	-	c.675G>T	c.(673-675)CCG>CCT	p.P225P	ZDHHC11_uc003jbj.2_Non-coding_Transcript|ZDHHC11_uc010itd.1_Non-coding_Transcript|ZDHHC11_uc003jbk.2_Silent_p.P12P	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	225						integral to membrane	acyltransferase activity|zinc ion binding			pancreas(1)	1			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)											0.085714	9.579133	52.11509	21	224	KEEP	---	---	---	---	capture		Silent	SNP	840719	840719	18189	5	C	A	A	A	288	23	ZDHHC11	1	1
ASCC3	10973	broad.mit.edu	37	6	101248359	101248359	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:101248359C>A	uc003pqk.2	-	c.944G>T	c.(943-945)GGA>GTA	p.G315V	ASCC3_uc011eai.1_Missense_Mutation_p.G217V|ASCC3_uc003pql.2_Missense_Mutation_p.G315V	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	315					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)	5		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)										0.363636	21.683058	22.04711	8	14	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	101248359	101248359	1051	6	C	A	A	A	390	30	ASCC3	2	2
C6orf186	728464	broad.mit.edu	37	6	110620165	110620165	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:110620165C>A	uc010kdu.1	-	c.746G>T	c.(745-747)AGA>ATA	p.R249I	C6orf186_uc003pub.2_Missense_Mutation_p.R52I	NM_001123364	NP_001116836	Q5JXM2	CF186_HUMAN	chromosome 6 open reading frame 186 precursor	249						extracellular region					0														0.490909	82.124037	82.127924	27	28	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	110620165	110620165	2452	6	C	A	A	A	416	32	C6orf186	2	2
COL10A1	1300	broad.mit.edu	37	6	116442848	116442848	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:116442848G>T	uc003pwm.2	-	c.431C>A	c.(430-432)CCT>CAT	p.P144H	NT5DC1_uc003pwj.2_Intron|NT5DC1_uc003pwk.2_Intron|NT5DC1_uc003pwl.2_Intron	NM_000493	NP_000484	Q03692	COAA1_HUMAN	type X collagen alpha 1 precursor	144	Triple-helical region.				skeletal system development	collagen	metal ion binding				0		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)										0.393939	37.573488	37.896391	13	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	116442848	116442848	3804	6	G	T	T	T	455	35	COL10A1	2	2
RNF217	154214	broad.mit.edu	37	6	125404010	125404010	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:125404010G>T	uc003pzs.2	+	c.795G>T	c.(793-795)GTG>GTT	p.V265V	RNF217_uc003pzr.2_Missense_Mutation_p.G284V|RNF217_uc003pzt.2_Non-coding_Transcript	NM_152553	NP_689766	Q8TC41	RN217_HUMAN	ring finger protein 217	265					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)										0.375	24.873416	25.200818	9	15	KEEP	---	---	---	---	capture		Silent	SNP	125404010	125404010	13959	6	G	T	T	T	561	44	RNF217	2	2
TMEM200A	114801	broad.mit.edu	37	6	130762587	130762587	+	Silent	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:130762587C>T	uc003qca.2	+	c.1020C>T	c.(1018-1020)CCC>CCT	p.P340P	TMEM200A_uc010kfh.2_Silent_p.P340P|TMEM200A_uc010kfi.2_Silent_p.P340P|TMEM200A_uc003qcb.2_Silent_p.P340P	NM_052913	NP_443145	Q86VY9	T200A_HUMAN	transmembrane protein 200A	340	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)					p.P340P(HEC6-Tumor)	66				0.433962	76.025474	76.225161	23	30	KEEP	---	---	---	---	capture		Silent	SNP	130762587	130762587	16658	6	C	T	T	T	288	23	TMEM200A	1	1
HIVEP2	3097	broad.mit.edu	37	6	143091240	143091240	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:143091240C>A	uc003qjd.2	-	c.4636G>T	c.(4636-4638)GGT>TGT	p.G1546C		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	1546	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		Esophageal Squamous(107;843 1510 13293 16805 42198)								0.448276	83.448022	83.58218	26	32	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	143091240	143091240	7478	6	C	A	A	A	299	23	HIVEP2	1	1
UTRN	7402	broad.mit.edu	37	6	144844215	144844215	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:144844215G>T	uc003qkt.2	+	c.5797G>T	c.(5797-5799)GAT>TAT	p.D1933Y		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	1933	Spectrin 13.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(3)|pancreas(1)	4		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)										0.295455	28.403567	30.088505	13	31	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	144844215	144844215	17668	6	G	T	T	T	429	33	UTRN	2	2
BTN1A1	696	broad.mit.edu	37	6	26508188	26508188	+	Silent	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:26508188G>C	uc003nif.3	+	c.870G>C	c.(868-870)CTG>CTC	p.L290L		NM_001732	NP_001723	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1 precursor	290	B30.2/SPRY.|Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	receptor activity			ovary(1)	1														0.219697	70.152545	79.682453	29	103	KEEP	---	---	---	---	capture		Silent	SNP	26508188	26508188	1593	6	G	C	C	C	600	47	BTN1A1	3	3
MYLK4	340156	broad.mit.edu	37	6	2683352	2683352	+	Missense_Mutation	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:2683352T>C	uc003mty.3	-	c.590A>G	c.(589-591)TAC>TGC	p.Y197C		NM_001012418	NP_001012418	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	197	Protein kinase.				protein phosphorylation		ATP binding|protein serine/threonine kinase activity			breast(3)|ovary(1)	4	Ovarian(93;0.0412)	all_hematologic(90;0.0897)								535				0.306122	43.76191	45.433743	15	34	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	2683352	2683352	10454	6	T	C	C	C	741	57	MYLK4	4	4
OR11A1	26531	broad.mit.edu	37	6	29394566	29394566	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:29394566G>A	uc003nmg.2	-	c.853C>T	c.(853-855)CTC>TTC	p.L285F		NM_013937	NP_039225	Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A,	285	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1														0.322581	92.921051	95.518424	30	63	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	29394566	29394566	11330	6	G	A	A	A	429	33	OR11A1	2	2
MDC1	9656	broad.mit.edu	37	6	30675940	30675940	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:30675940C>A	uc003nrg.3	-	c.2416G>T	c.(2416-2418)GGG>TGG	p.G806W	MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Intron	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	806				Missing (in Ref. 2; CAH18685).	cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4														0.311258	121.053332	125.855062	47	104	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	30675940	30675940	9792	6	C	A	A	A	312	24	MDC1	2	2
CYP39A1	51302	broad.mit.edu	37	6	46555804	46555804	+	Silent	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:46555804T>C	uc003oyf.1	-	c.1128A>G	c.(1126-1128)CCA>CCG	p.P376P	CYP39A1_uc011dwa.1_Silent_p.P356P|CYP39A1_uc010jzd.1_Silent_p.P204P	NM_016593	NP_057677	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A,	376					bile acid biosynthetic process|bile acid catabolic process|digestion|oxidation-reduction process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	24-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(1)	1														0.27451	34.900397	37.258546	14	37	KEEP	---	---	---	---	capture		Silent	SNP	46555804	46555804	4342	6	T	C	C	C	808	63	CYP39A1	4	4
DEFB112	245915	broad.mit.edu	37	6	50016252	50016252	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:50016252G>T	uc011dws.1	-	c.113C>A	c.(112-114)ACA>AAA	p.T38K		NM_001037498	NP_001032587	Q30KQ8	DB112_HUMAN	beta-defensin 112 precursor	38					defense response to bacterium	extracellular region				central_nervous_system(1)	1	Lung NSC(77;0.042)													0.227273	49.247394	55.379274	20	68	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	50016252	50016252	4578	6	G	T	T	T	624	48	DEFB112	2	2
HCRTR2	3062	broad.mit.edu	37	6	55113548	55113548	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:55113548T>A	uc003pcl.2	+	c.335T>A	c.(334-336)CTG>CAG	p.L112Q	HCRTR2_uc010jzv.2_Non-coding_Transcript|HCRTR2_uc010jzw.1_Missense_Mutation_p.L47Q	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2	112	Extracellular (Potential).				feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)	2	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)											0.253521	139.329172	151.097615	54	159	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55113548	55113548	7285	6	T	A	A	A	715	55	HCRTR2	3	3
HCRTR2	3062	broad.mit.edu	37	6	55145137	55145137	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:55145137G>T	uc003pcl.2	+	c.1000G>T	c.(1000-1002)GCC>TCC	p.A334S	HCRTR2_uc010jzv.2_Non-coding_Transcript	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2	334	Extracellular (Potential).				feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)	2	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)											0.222973	77.48068	87.957724	33	115	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55145137	55145137	7285	6	G	T	T	T	598	46	HCRTR2	2	2
DST	667	broad.mit.edu	37	6	56496092	56496092	+	Silent	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:56496092T>C	uc003pdf.2	-	c.3960A>G	c.(3958-3960)TCA>TCG	p.S1320S	DST_uc003pcz.3_Silent_p.S1142S|DST_uc011dxj.1_Silent_p.S1171S|DST_uc011dxk.1_Silent_p.S1182S|DST_uc003pcy.3_Silent_p.S816S|DST_uc003pdb.2_Silent_p.S816S|DST_uc003pdc.3_Silent_p.S816S|DST_uc003pdd.3_Silent_p.S816S	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	1142					cell adhesion|cell cycle arrest|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasmic membrane-bounded vesicle|hemidesmosome|microtubule plus end|nucleus	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein C-terminus binding			ovary(7)|central_nervous_system(6)	13	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)							2498				0.3	55.543721	58.048165	21	49	KEEP	---	---	---	---	capture		Silent	SNP	56496092	56496092	4967	6	T	C	C	C	704	55	DST	4	4
BAI3	577	broad.mit.edu	37	6	70064179	70064179	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:70064179G>T	uc003pev.3	+	c.3514G>T	c.(3514-3516)GAT>TAT	p.D1172Y	BAI3_uc010kak.2_Missense_Mutation_p.D1172Y|BAI3_uc011dxx.1_Missense_Mutation_p.D378Y	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1172	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(7)|skin(6)|pancreas(4)|central_nervous_system(3)|lung(3)|urinary_tract(1)	24		all_lung(197;0.212)								992				0.40708	135.024811	135.878315	46	67	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	70064179	70064179	1321	6	G	T	T	T	429	33	BAI3	2	2
COL12A1	1303	broad.mit.edu	37	6	75831100	75831100	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:75831100C>T	uc003phs.2	-	c.7004G>A	c.(7003-7005)GGG>GAG	p.G2335E	COL12A1_uc003pht.2_Missense_Mutation_p.G1171E	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	2335	VWFA 4.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)	8														0.37037	89.229934	90.424443	30	51	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	75831100	75831100	3807	6	C	T	T	T	286	22	COL12A1	2	2
VGF	7425	broad.mit.edu	37	7	100806508	100806508	+	Silent	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:100806508C>T	uc003uxx.3	-	c.1617G>A	c.(1615-1617)CCG>CCA	p.P539P		NM_003378	NP_003369	O15240	VGF_HUMAN	VGF nerve growth factor inducible precursor	539					response to cAMP	extracellular space|transport vesicle	growth factor activity				0	Lung NSC(181;0.168)|all_lung(186;0.215)													0.5	31.251794	31.251794	10	10	KEEP	---	---	---	---	capture		Silent	SNP	100806508	100806508	17724	7	C	T	T	T	340	27	VGF	1	1
RELN	5649	broad.mit.edu	37	7	103205881	103205881	+	Missense_Mutation	SNP	T	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:103205881T>G	uc003vca.2	-	c.5054A>C	c.(5053-5055)CAG>CCG	p.Q1685P	RELN_uc010liz.2_Missense_Mutation_p.Q1685P	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	1685	BNR 7.				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|large_intestine(2)|central_nervous_system(2)|pancreas(1)|skin(1)	14				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		NSCLC(146;835 1944 15585 22231 52158)								0.411765	22.321012	22.436781	7	10	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	103205881	103205881	13689	7	T	G	G	G	715	55	RELN	4	4
NAMPT	10135	broad.mit.edu	37	7	105909741	105909741	+	Silent	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:105909741G>A	uc003vdq.2	-	c.465C>T	c.(463-465)TCC>TCT	p.S155S	NAMPT_uc003vdr.1_Silent_p.S155S|NAMPT_uc011klu.1_Silent_p.S68S	NM_005746	NP_005737	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	155					cell-cell signaling|NAD biosynthetic process|nicotinamide metabolic process|positive regulation of cell proliferation|positive regulation of nitric-oxide synthase biosynthetic process|signal transduction	cytosol	cytokine activity|nicotinamide phosphoribosyltransferase activity|nicotinate phosphoribosyltransferase activity|nicotinate-nucleotide diphosphorylase (carboxylating) activity			large_intestine(1)	1														0.371429	43.681579	44.183646	13	22	KEEP	---	---	---	---	capture		Silent	SNP	105909741	105909741	10545	7	G	A	A	A	444	35	NAMPT	2	2
LAMB4	22798	broad.mit.edu	37	7	107677874	107677874	+	Silent	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:107677874T>C	uc010ljo.1	-	c.4638A>G	c.(4636-4638)GCA>GCG	p.A1546A	LAMB4_uc003vey.2_Silent_p.A1546A|LAMB4_uc010ljp.1_Silent_p.A515A	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	1546	Potential.|Domain I.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)	7														0.435583	214.158399	214.754387	71	92	KEEP	---	---	---	---	capture		Silent	SNP	107677874	107677874	8936	7	T	C	C	C	704	55	LAMB4	4	4
DGKI	9162	broad.mit.edu	37	7	137270015	137270015	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:137270015G>C	uc003vtt.2	-	c.1503C>G	c.(1501-1503)AAC>AAG	p.N501K	DGKI_uc003vtu.2_Missense_Mutation_p.N201K	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	501	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2														0.416667	101.353437	101.785535	30	42	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	137270015	137270015	4650	7	G	C	C	C	568	44	DGKI	3	3
MGAM	8972	broad.mit.edu	37	7	141750658	141750658	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:141750658C>A	uc003vwy.2	+	c.2799C>A	c.(2797-2799)AAC>AAA	p.N933K		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	933	Lumenal (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)									0.296296	43.188375	45.187064	16	38	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	141750658	141750658	9931	7	C	A	A	A	233	18	MGAM	2	2
ZNF786	136051	broad.mit.edu	37	7	148767932	148767932	+	Silent	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:148767932G>A	uc003wfh.2	-	c.1932C>T	c.(1930-1932)AGC>AGT	p.S644S	ZNF786_uc011kuk.1_Silent_p.S607S|ZNF786_uc003wfi.2_Silent_p.S558S	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786	644					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)											0.442308	68.647763	68.79208	23	29	KEEP	---	---	---	---	capture		Silent	SNP	148767932	148767932	18756	7	G	A	A	A	490	38	ZNF786	1	1
TWISTNB	221830	broad.mit.edu	37	7	19738228	19738228	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:19738228C>A	uc003sup.1	-	c.728G>T	c.(727-729)GGT>GTT	p.G243V		NM_001002926	NP_001002926	Q3B726	RPA43_HUMAN	TWIST neighbor	243	Lys-rich.					microtubule cytoskeleton|nucleolus	DNA-directed RNA polymerase activity			ovary(1)	1														0.318072	351.165712	363.322762	132	283	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	19738228	19738228	17340	7	C	A	A	A	234	18	TWISTNB	2	2
CHST12	55501	broad.mit.edu	37	7	2473357	2473357	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:2473357G>T	uc003smc.2	+	c.1083G>T	c.(1081-1083)CAG>CAT	p.Q361H	CHST12_uc003smd.2_Missense_Mutation_p.Q361H	NM_018641	NP_061111	Q9NRB3	CHSTC_HUMAN	carbohydrate sulfotransferase 12	361	Lumenal (Potential).				dermatan sulfate biosynthetic process	integral to Golgi membrane	3'-phosphoadenosine 5'-phosphosulfate binding|chondroitin 4-sulfotransferase activity|protein binding			kidney(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)										0.419355	33.9532	34.13202	13	18	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	2473357	2473357	3534	7	G	T	T	T	438	34	CHST12	2	2
GCK	2645	broad.mit.edu	37	7	44192964	44192964	+	Silent	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:44192964C>T	uc003tkk.1	-	c.147G>A	c.(145-147)GAG>GAA	p.E49E	GCK_uc003tkj.1_Silent_p.E47E|GCK_uc003tkl.2_Silent_p.E48E	NM_033507	NP_277042	P35557	HXK4_HUMAN	glucokinase isoform 2	48					cellular response to insulin stimulus|cellular response to leptin stimulus|detection of glucose|endocrine pancreas development|glucose homeostasis|glucose transport|glycolysis|negative regulation of gluconeogenesis|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|regulation of glucose transport|regulation of glycolysis|transmembrane transport	cytosol|nucleoplasm	ATP binding|glucokinase activity|glucose binding|protein binding			lung(1)|skin(1)	2										356				0.230337	93.178574	105.074557	41	137	KEEP	---	---	---	---	capture		Silent	SNP	44192964	44192964	6559	7	C	T	T	T	415	32	GCK	2	2
NPC1L1	29881	broad.mit.edu	37	7	44579884	44579884	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:44579884C>T	uc003tlb.2	-	c.112G>A	c.(112-114)GAA>AAA	p.E38K	NPC1L1_uc003tlc.2_Missense_Mutation_p.E38K|NPC1L1_uc011kbw.1_Missense_Mutation_p.E38K|NPC1L1_uc003tld.2_Missense_Mutation_p.E38K	NM_013389	NP_037521	Q9UHC9	NPCL1_HUMAN	Niemann-Pick C1-like protein 1 isoform 1	38	Extracellular (Potential).				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding			ovary(3)|central_nervous_system(1)	4					Ezetimibe(DB00973)									0.321429	26.479738	27.265111	9	19	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	44579884	44579884	10975	7	C	T	T	T	403	31	NPC1L1	1	1
CYTH3	9265	broad.mit.edu	37	7	6210909	6210909	+	Silent	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:6210909C>T	uc003spt.2	-	c.486G>A	c.(484-486)GCG>GCA	p.A162A	CYTH3_uc011jws.1_Silent_p.A77A	NM_004227	NP_004218	O43739	CYH3_HUMAN	cytohesin 3	162	SEC7.				regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|membrane fraction|plasma membrane	1-phosphatidylinositol binding|ARF guanyl-nucleotide exchange factor activity|inositol-1,4,5-trisphosphate receptor activity				0														0.175824	30.78976	39.789866	16	75	KEEP	---	---	---	---	capture		Silent	SNP	6210909	6210909	4370	7	C	T	T	T	340	27	CYTH3	1	1
ASL	435	broad.mit.edu	37	7	65548112	65548112	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:65548112T>A	uc003tuo.2	+	c.397T>A	c.(397-399)TCG>ACG	p.S133T	ASL_uc011kdu.1_Missense_Mutation_p.S133T|ASL_uc010kzx.1_3'UTR|ASL_uc011kdv.1_Missense_Mutation_p.S133T|ASL_uc003tup.2_Missense_Mutation_p.S133T|ASL_uc003tur.2_Missense_Mutation_p.S133T|ASL_uc003tuq.2_Missense_Mutation_p.S133T	NM_000048	NP_000039	P04424	ARLY_HUMAN	argininosuccinate lyase isoform 1	133					arginine biosynthetic process via ornithine|arginine catabolic process|urea cycle	cytosol	argininosuccinate lyase activity			breast(2)	2					L-Arginine(DB00125)									0.307692	18.575747	19.442044	8	18	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	65548112	65548112	1063	7	T	A	A	A	702	54	ASL	3	3
CACNA2D1	781	broad.mit.edu	37	7	81579777	81579777	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:81579777C>A	uc003uhr.1	-	c.3207G>T	c.(3205-3207)CTG>CTT	p.L1069L	CACNA2D1_uc011kgy.1_Silent_p.L281L	NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	1081	Helical; (Potential).					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)									0.357143	15.170658	15.422521	5	9	KEEP	---	---	---	---	capture		Silent	SNP	81579777	81579777	2664	7	C	A	A	A	210	17	CACNA2D1	2	2
RP1L1	94137	broad.mit.edu	37	8	10464888	10464888	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:10464888C>A	uc003wtc.2	-	c.6720G>T	c.(6718-6720)GAG>GAT	p.E2240D		NM_178857	NP_849188	A6NKC6	A6NKC6_HUMAN	retinitis pigmentosa 1-like 1	2240					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)										0.28	107.403195	114.007793	42	108	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	10464888	10464888	14012	8	C	A	A	A	259	20	RP1L1	2	2
RP1L1	94137	broad.mit.edu	37	8	10466260	10466260	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:10466260G>T	uc003wtc.2	-	c.5348C>A	c.(5347-5349)GCG>GAG	p.A1783E		NM_178857	NP_849188	A6NKC6	A6NKC6_HUMAN	retinitis pigmentosa 1-like 1	1783					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)										0.265625	133.404537	142.976184	51	141	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	10466260	10466260	14012	8	G	T	T	T	494	38	RP1L1	1	1
DPYS	1807	broad.mit.edu	37	8	105405219	105405220	+	Splice_Site_DNP	DNP	CC	AA	AA			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:105405219_105405220CC>AA	uc003yly.3	-	c.1236_splice	c.e8-1	p.R412_splice	DPYS_uc010mcf.1_Splice_Site_DNP	NM_001385	NP_001376			dihydropyrimidinase						protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)											0.18	38.006619	47.623659	18	82	KEEP	---	---	---	---	capture		Splice_Site_DNP	DNP	105405219	105405220	4930	8	CC	AA	AA	AA	389	30	DPYS	5	2
SYBU	55638	broad.mit.edu	37	8	110587660	110587660	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:110587660C>G	uc003ynj.3	-	c.1467G>C	c.(1465-1467)CAG>CAC	p.Q489H	SYBU_uc003yni.3_Missense_Mutation_p.Q486H|SYBU_uc003ynk.3_Missense_Mutation_p.Q370H|SYBU_uc010mco.2_Missense_Mutation_p.Q488H|SYBU_uc003ynl.3_Missense_Mutation_p.Q488H|SYBU_uc010mcp.2_Missense_Mutation_p.Q489H|SYBU_uc010mcq.2_Missense_Mutation_p.Q489H|SYBU_uc003yno.3_Missense_Mutation_p.Q370H|SYBU_uc010mcr.2_Missense_Mutation_p.Q489H|SYBU_uc003ynm.3_Missense_Mutation_p.Q488H|SYBU_uc003ynn.3_Missense_Mutation_p.Q488H|SYBU_uc010mcs.2_Missense_Mutation_p.Q370H|SYBU_uc010mct.2_Missense_Mutation_p.Q489H|SYBU_uc010mcu.2_Missense_Mutation_p.Q488H|SYBU_uc003ynp.3_Missense_Mutation_p.Q421H|SYBU_uc010mcv.2_Missense_Mutation_p.Q489H|SYBU_uc003ynh.3_Missense_Mutation_p.Q283H|SYBU_uc011lhw.1_Missense_Mutation_p.Q359H	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein	489						cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1														0.180556	25.534348	32.442278	13	59	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	110587660	110587660	15947	8	C	G	G	G	415	32	SYBU	3	3
USP17L2	377630	broad.mit.edu	37	8	11994734	11994734	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:11994734G>T	uc003wvc.1	-	c.1536C>A	c.(1534-1536)ACC>ACA	p.T512T	FAM66D_uc011kxp.1_Intron|FAM66D_uc011kxo.1_Intron	NM_201402	NP_958804	Q6R6M4	U17L2_HUMAN	deubiquitinating enzyme 3	512				T -> A (in Ref. 1; AAR91701).	apoptosis|cell cycle|G2/M transition checkpoint|mitotic cell cycle G1/S transition checkpoint|protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity				0														0.086957	4.234958	20.116946	8	84	KEEP	---	---	---	---	capture		Silent	SNP	11994734	11994734	17611	8	G	T	T	T	600	47	USP17L2	2	2
ANXA13	312	broad.mit.edu	37	8	124748012	124748012	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:124748012G>T	uc003yqt.2	-	c.121C>A	c.(121-123)CCA>ACA	p.P41T	ANXA13_uc003yqu.2_Intron	NM_001003954	NP_001003954	P27216	ANX13_HUMAN	annexin A13 isoform b	Error:Variant_position_missing_in_P27216_after_alignment					cell differentiation	plasma membrane	calcium ion binding|calcium-dependent phospholipid binding			ovary(1)|pancreas(1)	2	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)											0.133858	20.671762	37.155977	17	110	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	124748012	124748012	725	8	G	T	T	T	546	42	ANXA13	2	2
FAM135B	51059	broad.mit.edu	37	8	139149430	139149430	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:139149430C>A	uc003yuy.2	-	c.3975G>T	c.(3973-3975)AGG>AGT	p.R1325S	FAM135B_uc003yux.2_Missense_Mutation_p.R1226S|FAM135B_uc003yuz.2_Non-coding_Transcript	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	1325										ovary(7)	7	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)											0.234568	45.406258	50.61202	19	62	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	139149430	139149430	5646	8	C	A	A	A	389	30	FAM135B	2	2
FAM135B	51059	broad.mit.edu	37	8	139158277	139158277	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:139158277G>T	uc003yuy.2	-	c.3465C>A	c.(3463-3465)CTC>CTA	p.L1155L	FAM135B_uc003yux.2_Silent_p.L1056L|FAM135B_uc003yuz.2_Non-coding_Transcript|FAM135B_uc003yva.2_Silent_p.L717L|FAM135B_uc003yvb.2_Missense_Mutation_p.P683T	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	1155										ovary(7)	7	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)											0.271739	62.738086	67.058373	25	67	KEEP	---	---	---	---	capture		Silent	SNP	139158277	139158277	5646	8	G	T	T	T	522	41	FAM135B	2	2
PLEC	5339	broad.mit.edu	37	8	144997456	144997456	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:144997456G>A	uc003zaf.1	-	c.7052C>T	c.(7051-7053)GCG>GTG	p.A2351V	PLEC_uc003zab.1_Missense_Mutation_p.A2214V|PLEC_uc003zac.1_Missense_Mutation_p.A2218V|PLEC_uc003zad.2_Missense_Mutation_p.A2214V|PLEC_uc003zae.1_Missense_Mutation_p.A2182V|PLEC_uc003zag.1_Missense_Mutation_p.A2192V|PLEC_uc003zah.2_Missense_Mutation_p.A2200V|PLEC_uc003zaj.2_Missense_Mutation_p.A2241V	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	2351	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|central_nervous_system(1)	7														0.375	21.656195	21.989625	9	15	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	144997456	144997456	12478	8	G	A	A	A	494	38	PLEC	1	1
DLGAP2	9228	broad.mit.edu	37	8	1626405	1626405	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:1626405A>T	uc003wpl.2	+	c.2074A>T	c.(2074-2076)AGC>TGC	p.S692C	DLGAP2_uc003wpm.2_Missense_Mutation_p.S678C	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	771					nerve-nerve synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)										0.277778	55.475732	58.670802	20	52	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	1626405	1626405	4740	8	A	T	T	T	91	7	DLGAP2	3	3
EPHX2	2053	broad.mit.edu	37	8	27401287	27401287	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:27401287G>T	uc003xfu.2	+	c.1471G>T	c.(1471-1473)GTC>TTC	p.V491F	EPHX2_uc010luu.2_Missense_Mutation_p.V459F|EPHX2_uc010luv.2_Missense_Mutation_p.V425F|EPHX2_uc003xfv.2_Missense_Mutation_p.V438F|EPHX2_uc010luw.2_Missense_Mutation_p.V425F	NM_001979	NP_001970	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	491	Epoxide hydrolase.				aromatic compound catabolic process|cellular calcium ion homeostasis|drug metabolic process|inflammatory response|positive regulation of vasodilation|reactive oxygen species metabolic process|regulation of blood pressure|response to toxin|xenobiotic metabolic process	cytosol|focal adhesion|Golgi apparatus|nucleolus|peroxisome|soluble fraction	epoxide hydrolase activity|metal ion binding|protein homodimerization activity			ovary(1)	1		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)	Tamoxifen(DB00675)									0.263158	39.39895	42.290827	15	42	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	27401287	27401287	5373	8	G	T	T	T	572	44	EPHX2	2	2
CSMD1	64478	broad.mit.edu	37	8	3000045	3000045	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:3000045G>T	uc011kwk.1	-	c.6186C>A	c.(6184-6186)CTC>CTA	p.L2062L	CSMD1_uc011kwj.1_Silent_p.L1454L|CSMD1_uc010lrg.2_Silent_p.L130L	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2062	Extracellular (Potential).|CUB 12.			L -> F (in Ref. 5; AK126936).		integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)										0.170732	11.296745	15.507769	7	34	KEEP	---	---	---	---	capture		Silent	SNP	3000045	3000045	4085	8	G	T	T	T	574	45	CSMD1	2	2
CSMD1	64478	broad.mit.edu	37	8	3038664	3038664	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:3038664A>T	uc011kwk.1	-	c.5696T>A	c.(5695-5697)GTG>GAG	p.V1899E	CSMD1_uc011kwj.1_Missense_Mutation_p.V1291E|CSMD1_uc003wqe.2_Missense_Mutation_p.V1055E|CSMD1_uc010lrg.2_5'UTR	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1899	Extracellular (Potential).|CUB 11.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)										0.296296	22.894912	23.893816	8	19	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	3038664	3038664	4085	8	A	T	T	T	78	6	CSMD1	3	3
NRG1	3084	broad.mit.edu	37	8	32621581	32621581	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:32621581C>A	uc003xiu.2	+	c.1599C>A	c.(1597-1599)ACC>ACA	p.T533T	NRG1_uc010lvo.2_3'UTR|NRG1_uc003xiw.2_Silent_p.T525T|NRG1_uc003xit.2_3'UTR|NRG1_uc003xiv.2_Silent_p.T528T|NRG1_uc010lvr.2_Silent_p.T270T|NRG1_uc010lvs.2_Silent_p.T270T|NRG1_uc010lvp.2_Silent_p.T482T|NRG1_uc010lvq.2_Silent_p.T465T|NRG1_uc011lbg.1_3'UTR|NRG1_uc011lbh.1_Silent_p.T371T|NRG1_uc003xja.2_Silent_p.T339T	NM_013956	NP_039250	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-beta1	528	Cytoplasmic (Potential).				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)										0.193548	11.932628	14.651049	6	25	KEEP	---	---	---	---	capture		Silent	SNP	32621581	32621581	11052	8	C	A	A	A	275	22	NRG1	2	2
CSMD1	64478	broad.mit.edu	37	8	3474274	3474274	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:3474274G>T	uc011kwk.1	-	c.1055C>A	c.(1054-1056)CCT>CAT	p.P352H		NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	352	Extracellular (Potential).|Sushi 2.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)										0.297297	32.210338	33.569665	11	26	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	3474274	3474274	4085	8	G	T	T	T	455	35	CSMD1	2	2
ANK1	286	broad.mit.edu	37	8	41550261	41550261	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:41550261G>T	uc003xom.2	-	c.3886C>A	c.(3886-3888)CGC>AGC	p.R1296S	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Missense_Mutation_p.R571S|ANK1_uc003xoi.2_Missense_Mutation_p.R1255S|ANK1_uc003xoj.2_Missense_Mutation_p.R1255S|ANK1_uc003xok.2_Missense_Mutation_p.R1255S|ANK1_uc003xol.2_Missense_Mutation_p.R1255S	NM_001142446	NP_001135918	P16157	ANK1_HUMAN	ankyrin 1 isoform 9	1255					axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)|breast(1)	8	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)											0.260417	306.378225	331.37674	125	355	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	41550261	41550261	623	8	G	T	T	T	494	38	ANK1	1	1
SLC20A2	6575	broad.mit.edu	37	8	42275403	42275403	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:42275403C>G	uc010lxl.2	-	c.1877G>C	c.(1876-1878)TGG>TCG	p.W626S	SLC20A2_uc010lxm.2_Missense_Mutation_p.W626S|SLC20A2_uc003xpe.2_Missense_Mutation_p.W626S|SLC20A2_uc011lcu.1_Missense_Mutation_p.W428S	NM_006749	NP_006740	Q08357	S20A2_HUMAN	solute carrier family 20, member 2	626	Helical; (Potential).				interspecies interaction between organisms	integral to plasma membrane|membrane fraction	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			ovary(2)	2	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)											0.222222	32.359153	36.801685	14	49	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	42275403	42275403	14935	8	C	G	G	G	273	21	SLC20A2	3	3
PRKDC	5591	broad.mit.edu	37	8	48775078	48775078	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:48775078C>A	uc003xqi.2	-	c.5775G>T	c.(5773-5775)GAG>GAT	p.E1925D	PRKDC_uc003xqj.2_Missense_Mutation_p.E1925D|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	1925					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of gene-specific transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				Esophageal Squamous(79;1091 1253 12329 31680 40677)				1566				0.551724	43.4301	43.490261	16	13	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	48775078	48775078	12964	8	C	A	A	A	415	32	PRKDC	2	2
PXDNL	137902	broad.mit.edu	37	8	52321549	52321549	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:52321549C>A	uc003xqu.3	-	c.2635G>T	c.(2635-2637)GAT>TAT	p.D879Y	PXDNL_uc003xqt.3_Non-coding_Transcript	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	879					hydrogen peroxide catabolic process|oxidation-reduction process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)												0.484375	76.584949	76.599363	31	33	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	52321549	52321549	13306	8	C	A	A	A	390	30	PXDNL	2	2
ST18	9705	broad.mit.edu	37	8	53076548	53076548	+	Silent	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:53076548G>A	uc003xqz.2	-	c.1398C>T	c.(1396-1398)CAC>CAT	p.H466H	ST18_uc011ldq.1_Silent_p.H113H|ST18_uc011ldr.1_Silent_p.H431H|ST18_uc011lds.1_Silent_p.H371H|ST18_uc003xra.2_Silent_p.H466H|ST18_uc003xrb.2_Silent_p.H466H	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	466						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)												0.175676	24.328669	31.670499	13	61	KEEP	---	---	---	---	capture		Silent	SNP	53076548	53076548	15730	8	G	A	A	A	620	48	ST18	2	2
RGS20	8601	broad.mit.edu	37	8	54764487	54764487	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:54764487G>A	uc003xrp.2	+	c.28G>A	c.(28-30)GAG>AAG	p.E10K	RGS20_uc003xrq.2_Missense_Mutation_p.E10K|RGS20_uc010lye.2_5'UTR|RGS20_uc010lyf.2_5'UTR	NM_170587	NP_733466	O76081	RGS20_HUMAN	regulator of G-protein signaling 20 isoform a	10					negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|nucleus|plasma membrane	GTPase activator activity|protein binding|signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)											0.490323	239.9356	239.949405	76	79	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	54764487	54764487	13777	8	G	A	A	A	429	33	RGS20	2	2
RP1	6101	broad.mit.edu	37	8	55539627	55539627	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:55539627G>A	uc003xsd.1	+	c.3185G>A	c.(3184-3186)AGG>AAG	p.R1062K	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1062					cell projection organization|intracellular signal transduction|phototransduction, visible light|visual perception	cilium axoneme|cytoplasm|microtubule|photoreceptor connecting cilium|photoreceptor outer segment				ovary(4)|pancreas(1)	5		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			Colon(91;1014 1389 7634 14542 40420)								0.465649	197.679443	197.811379	61	70	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55539627	55539627	14011	8	G	A	A	A	455	35	RP1	2	2
MOS	4342	broad.mit.edu	37	8	57026479	57026479	+	Silent	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:57026479C>T	uc011leb.1	-	c.63G>A	c.(61-63)GCG>GCA	p.A21A		NM_005372	NP_005363	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene	21					protein phosphorylation		ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)	3			Epithelial(17;0.00117)|all cancers(17;0.00879)			Esophageal Squamous(124;373 2870 4778)				32				0.166667	8.506613	11.628106	5	25	KEEP	---	---	---	---	capture		Silent	SNP	57026479	57026479	10104	8	C	T	T	T	340	27	MOS	1	1
SGK3	23678	broad.mit.edu	37	8	67763155	67763155	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:67763155G>T	uc003xwr.2	+	c.1320G>T	c.(1318-1320)GTG>GTT	p.V440V	SGK3_uc003xwp.2_Silent_p.V434V|SGK3_uc003xwt.2_Silent_p.V440V|SGK3_uc003xwu.2_Silent_p.V408V	NM_001033578	NP_001028750	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase 3 isoform	440	AGC-kinase C-terminal.				cell communication|protein phosphorylation|response to stress	cytoplasmic membrane-bounded vesicle|early endosome	ATP binding|phosphatidylinositol binding|protein serine/threonine kinase activity			ovary(1)|large_intestine(1)|lung(1)|breast(1)	4	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)							285				0.538462	43.744719	43.777654	14	12	KEEP	---	---	---	---	capture		Silent	SNP	67763155	67763155	14703	8	G	T	T	T	600	47	SGK3	2	2
RUNX1T1	862	broad.mit.edu	37	8	93003969	93003969	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:93003969G>T	uc011lgi.1	-	c.922C>A	c.(922-924)CCT>ACT	p.P308T	RUNX1T1_uc003yfc.1_Missense_Mutation_p.P270T|RUNX1T1_uc003yfd.2_Missense_Mutation_p.P297T|RUNX1T1_uc003yfe.1_Missense_Mutation_p.P260T|RUNX1T1_uc010mao.2_Missense_Mutation_p.P270T|RUNX1T1_uc010man.1_5'UTR|RUNX1T1_uc003yfb.1_Missense_Mutation_p.P260T	NM_175636	NP_783554	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1	297	Poly-Pro.				generation of precursor metabolites and energy|regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(3)|central_nervous_system(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(11;0.0141)							213				0.369369	124.859346	126.518481	41	70	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	93003969	93003969	14227	8	G	T	T	T	572	44	RUNX1T1	2	2
NR4A3	8013	broad.mit.edu	37	9	102590739	102590739	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:102590739C>T	uc004bai.2	+	c.448C>T	c.(448-450)CCA>TCA	p.P150S	NR4A3_uc004bae.2_Missense_Mutation_p.P139S|NR4A3_uc004baf.1_Missense_Mutation_p.P139S|NR4A3_uc004bag.1_Missense_Mutation_p.P139S	NM_173200	NP_775292	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	139					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)								86				0.477273	62.668292	62.687931	21	23	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	102590739	102590739	11039	9	C	T	T	T	286	22	NR4A3	2	2
ALDOB	229	broad.mit.edu	37	9	104189769	104189769	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:104189769G>T	uc004bbk.2	-	c.535C>A	c.(535-537)CAG>AAG	p.Q179K		NM_000035	NP_000026	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	179					fructose 1,6-bisphosphate metabolic process|fructose catabolic process|gluconeogenesis|glycolysis|NADH oxidation|positive regulation of ATPase activity|vacuolar proton-transporting V-type ATPase complex assembly	centriolar satellite|cytosol	ATPase binding|cytoskeletal protein binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding			skin(1)	1		Acute lymphoblastic leukemia(62;0.0559)												0.47619	31.148148	31.158538	10	11	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	104189769	104189769	511	9	G	T	T	T	585	45	ALDOB	2	2
GRIN3A	116443	broad.mit.edu	37	9	104341538	104341538	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:104341538C>G	uc004bbp.1	-	c.2871G>C	c.(2869-2871)AGG>AGC	p.R957S	GRIN3A_uc004bbo.1_Missense_Mutation_p.R32S|GRIN3A_uc004bbq.1_Missense_Mutation_p.R957S	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	957	Cytoplasmic (Potential).|PPP2CB binding site (By similarity).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|central_nervous_system(1)|pancreas(1)	6		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)					27				0.5	72.191245	72.191245	21	21	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	104341538	104341538	7062	9	C	G	G	G	337	26	GRIN3A	3	3
ASTN2	23245	broad.mit.edu	37	9	119770435	119770436	+	Missense_Mutation	DNP	CC	AA	AA			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:119770435_119770436CC>AA	uc004bjs.1	-	c.1526_1527GG>TT	c.(1525-1527)TGG>TTT	p.W509F	ASTN2_uc004bjr.1_Missense_Mutation_p.W509F|ASTN2_uc004bjt.1_Missense_Mutation_p.W458F	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	509	Extracellular (Potential).					integral to membrane				ovary(3)|breast(1)|kidney(1)	5														0.555556	48.232566	48.306429	15	12	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	119770435	119770436	1084	9	CC	AA	AA	AA	286	22	ASTN2	2	2
NAIF1	203245	broad.mit.edu	37	9	130829282	130829282	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:130829282G>C	uc004bta.2	-	c.99C>G	c.(97-99)AAC>AAG	p.N33K	NAIF1_uc004bsz.2_Non-coding_Transcript|SLC25A25_uc004btb.2_5'Flank	NM_197956	NP_931045	Q69YI7	NAIF1_HUMAN	nuclear apoptosis inducing factor 1	33	Required for nuclear localization and apoptosis-inducing activity.				apoptosis|induction of apoptosis	nucleus					0														0.177419	42.141676	54.382283	22	102	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	130829282	130829282	10542	9	G	C	C	C	568	44	NAIF1	3	3
BAT2L1	84726	broad.mit.edu	37	9	134351319	134351319	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:134351319G>A	uc004can.3	+	c.3803G>A	c.(3802-3804)GGC>GAC	p.G1268D	BAT2L1_uc010mzj.1_Missense_Mutation_p.G851D|BAT2L1_uc004cao.3_Missense_Mutation_p.G626D	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	1268							protein binding				0												OREG0019561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.418605	52.451332	52.697259	18	25	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	134351319	134351319	1341	9	G	A	A	A	546	42	BAT2L1	2	2
TRAF2	7186	broad.mit.edu	37	9	139815544	139815544	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:139815544G>C	uc010nbu.2	+	c.1015G>C	c.(1015-1017)GAG>CAG	p.E339Q	TRAF2_uc004cjv.2_Missense_Mutation_p.E339Q|TRAF2_uc011mek.1_Missense_Mutation_p.E328Q|TRAF2_uc010nbw.2_Missense_Mutation_p.E314Q	NM_021138	NP_066961	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	339					activation of caspase activity|activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cellular protein complex assembly|induction of apoptosis by extracellular signals|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell activation|positive regulation of T cell cytokine production|protein autoubiquitination|protein homotrimerization|protein K63-linked ubiquitination|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane	CD40 receptor binding|enzyme binding|protein binding|signal transducer activity|sphingolipid binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)						212				0.393939	38.549184	38.878924	13	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	139815544	139815544	16982	9	G	C	C	C	533	41	TRAF2	3	3
C9orf82	79886	broad.mit.edu	37	9	26861082	26861082	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:26861082C>A	uc003zqc.2	-	c.721G>T	c.(721-723)GGT>TGT	p.G241C	C9orf82_uc003zqb.2_Missense_Mutation_p.G96C	NM_024828	NP_079104	Q9H8G2	CI082_HUMAN	hypothetical protein LOC79886	241											0		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(42;1.39e-05)|LUSC - Lung squamous cell carcinoma(38;0.000114)										0.188889	37.118347	45.273143	17	73	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	26861082	26861082	2615	9	C	A	A	A	312	24	C9orf82	2	2
DDX58	23586	broad.mit.edu	37	9	32500900	32500900	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:32500900C>A	uc003zra.2	-	c.144G>T	c.(142-144)AAG>AAT	p.K48N	DDX58_uc010mjj.2_Non-coding_Transcript|DDX58_uc010mjk.1_Intron|DDX58_uc011lnr.1_De_novo_Start_OutOfFrame|DDX58_uc010mji.2_De_novo_Start_OutOfFrame	NM_014314	NP_055129	O95786	DDX58_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide	48	CARD 1.				innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|response to virus	cytosol	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)										0.138889	15.906892	24.976106	10	62	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32500900	32500900	4546	9	C	A	A	A	311	24	DDX58	2	2
TLN1	7094	broad.mit.edu	37	9	35699425	35699425	+	Nonsense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:35699425G>A	uc003zxt.2	-	c.6802C>T	c.(6802-6804)CAG>TAG	p.Q2268*		NM_006289	NP_006280	Q9Y490	TLN1_HUMAN	talin 1	2268					axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|cell-cell junction|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)							587				0.1	2.223408	6.999979	3	27	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	35699425	35699425	16477	9	G	A	A	A	598	46	TLN1	5	2
GDA	9615	broad.mit.edu	37	9	74856165	74856165	+	Silent	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:74856165C>T	uc004air.2	+	c.1086C>T	c.(1084-1086)AGC>AGT	p.S362S	GDA_uc011lse.1_Silent_p.S288S|GDA_uc004aiq.2_Silent_p.S362S|GDA_uc011lsf.1_Silent_p.S288S|GDA_uc010mow.1_Non-coding_Transcript|GDA_uc004ais.2_Silent_p.S284S	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN	guanine deaminase	362					nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)										0.341463	38.227081	39.142575	14	27	KEEP	---	---	---	---	capture		Silent	SNP	74856165	74856165	6573	9	C	T	T	T	337	26	GDA	2	2
ZNF484	83744	broad.mit.edu	37	9	95609741	95609741	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:95609741C>A	uc011lub.1	-	c.1334G>T	c.(1333-1335)AGT>ATT	p.S445I	ANKRD19_uc004asr.3_Intron|ZNF484_uc004asu.1_Missense_Mutation_p.S443I|ZNF484_uc010mrb.1_Missense_Mutation_p.S407I|ZNF484_uc004asv.1_Missense_Mutation_p.S407I	NM_001007101	NP_001007102	Q5JVG2	ZN484_HUMAN	zinc finger protein 484 isoform b	443	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0														0.315789	53.033356	54.751644	18	39	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	95609741	95609741	18531	9	C	A	A	A	260	20	ZNF484	2	2
ARHGAP6	395	broad.mit.edu	37	X	11197549	11197549	+	Silent	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:11197549C>G	uc004cup.1	-	c.1353G>C	c.(1351-1353)GGG>GGC	p.G451G	ARHGAP6_uc004cuo.1_Non-coding_Transcript|ARHGAP6_uc004cur.1_Silent_p.G451G|ARHGAP6_uc004cum.1_Silent_p.G248G|ARHGAP6_uc004cun.1_Silent_p.G271G|ARHGAP6_uc010neb.1_Silent_p.G273G|ARHGAP6_uc011mif.1_Silent_p.G248G	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	451	Rho-GAP.				actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2														0.589744	76.250992	76.511587	23	16	KEEP	---	---	---	---	capture		Silent	SNP	11197549	11197549	901	23	C	G	G	G	379	30	ARHGAP6	3	3
DCAF12L2	340578	broad.mit.edu	37	X	125299259	125299259	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:125299259C>T	uc004euk.1	-	c.649G>A	c.(649-651)GTG>ATG	p.V217M		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	217	WD 2.									lung(2)|large_intestine(1)|ovary(1)|pancreas(1)	5														0.647059	73.359821	74.009132	22	12	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	125299259	125299259	4436	23	C	T	T	T	247	19	DCAF12L2	1	1
ATXN3L	92552	broad.mit.edu	37	X	13337398	13337398	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:13337398G>T	uc010ned.2	-	c.656C>A	c.(655-657)TCT>TAT	p.S219Y		NM_001135995	NP_001129467	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	219					protein deubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ubiquitin-specific protease activity			ovary(2)|large_intestine(1)|skin(1)	4														0.61828	357.258297	359.545861	115	71	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	13337398	13337398	1234	23	G	T	T	T	429	33	ATXN3L	2	2
GPR101	83550	broad.mit.edu	37	X	136113699	136113699	+	Silent	SNP	A	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:136113699A>C	uc011mwh.1	-	c.135T>G	c.(133-135)TCT>TCG	p.S45S		NM_054021	NP_473362	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	45	Helical; Name=1; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|lung(1)	4	Acute lymphoblastic leukemia(192;0.000127)													0.288889	32.05322	33.853539	13	32	KEEP	---	---	---	---	capture		Silent	SNP	136113699	136113699	6896	23	A	C	C	C	28	3	GPR101	4	4
UBE2NL	389898	broad.mit.edu	37	X	142967514	142967515	+	Missense_Mutation	DNP	AG	TC	TC			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:142967514_142967515AG>TC	uc004fca.2	+	c.312_313AG>TC	c.(310-315)ACAGTT>ACTCTT	p.V105L		NM_001012989	NP_001013007	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like	105					post-translational protein modification		acid-amino acid ligase activity				0	Acute lymphoblastic leukemia(192;6.56e-05)													0.38	60.113613	60.745013	19	31	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	142967514	142967515	17424	23	AG	TC	TC	TC	80	7	UBE2NL	3	3
MBTPS2	51360	broad.mit.edu	37	X	21900607	21900607	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:21900607C>T	uc004dae.2	+	c.1394C>T	c.(1393-1395)GCT>GTT	p.A465V	MBTPS2_uc010nfr.2_Missense_Mutation_p.A58V	NM_015884	NP_056968	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase,	465	Helical; (Potential).				cholesterol metabolic process|proteolysis	Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity			ovary(1)	1														0.5375	138.206658	138.302753	43	37	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	21900607	21900607	9751	23	C	T	T	T	364	28	MBTPS2	2	2
MXRA5	25878	broad.mit.edu	37	X	3238371	3238371	+	Silent	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:3238371C>A	uc004crg.3	-	c.5355G>T	c.(5353-5355)CCG>CCT	p.P1785P		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	1785						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(23;0.00031)|Lung NSC(23;0.000946)												0.785714	35.016803	36.065998	11	3	KEEP	---	---	---	---	capture		Silent	SNP	3238371	3238371	10397	23	C	A	A	A	288	23	MXRA5	1	1
FAM47B	170062	broad.mit.edu	37	X	34961518	34961518	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:34961518G>T	uc004ddi.1	+	c.570G>T	c.(568-570)CGG>CGT	p.R190R		NM_152631	NP_689844	Q8NA70	FA47B_HUMAN	hypothetical protein LOC170062	190	Pro-rich.									ovary(3)|breast(1)	4														0.5	25.556994	25.556994	10	10	KEEP	---	---	---	---	capture		Silent	SNP	34961518	34961518	5791	23	G	T	T	T	535	42	FAM47B	2	2
ITIH5L	347365	broad.mit.edu	37	X	54783793	54783793	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:54783793G>A	uc004dtj.2	-	c.2714C>T	c.(2713-2715)CCA>CTA	p.P905L		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	905	Pro-rich.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|ovary(1)|breast(1)|skin(1)	5										249				0.575758	62.427517	62.59243	19	14	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	54783793	54783793	8212	23	G	A	A	A	611	47	ITIH5L	2	2
RLIM	51132	broad.mit.edu	37	X	73811802	73811802	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:73811802C>A	uc004ebu.2	-	c.1348G>T	c.(1348-1350)GGT>TGT	p.G450C	RLIM_uc004ebw.2_Missense_Mutation_p.G450C	NM_183353	NP_899196	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	450	Ser-rich.				random inactivation of X chromosome|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|transcriptional repressor complex	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						Esophageal Squamous(169;1899 1923 14997 18818 32118)								0.636364	115.837779	116.737584	35	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	73811802	73811802	13867	23	C	A	A	A	273	21	RLIM	2	2
KIAA2022	340533	broad.mit.edu	37	X	73961445	73961445	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:73961445C>G	uc004eby.2	-	c.2947G>C	c.(2947-2949)GTC>CTC	p.V983L		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	983					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|central_nervous_system(1)	14										126				0.583333	51.654453	51.799913	14	10	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	73961445	73961445	8580	23	C	G	G	G	260	20	KIAA2022	3	3
UPRT	139596	broad.mit.edu	37	X	74519631	74519631	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:74519631G>T	uc004ecb.1	+	c.624G>T	c.(622-624)CTG>CTT	p.L208L	UPRT_uc004ecc.1_Non-coding_Transcript|UPRT_uc004ecd.1_Silent_p.L208L|UPRT_uc004ece.1_Silent_p.L72L	NM_145052	NP_659489	Q96BW1	UPP_HUMAN	uracil phosphoribosyltransferase (FUR1) homolog	208					nucleoside metabolic process	cytoplasm|nucleus					0														0.633333	124.753697	125.6902	38	22	KEEP	---	---	---	---	capture		Silent	SNP	74519631	74519631	17575	23	G	T	T	T	574	45	UPRT	2	2
ATP7A	538	broad.mit.edu	37	X	77284872	77284872	+	Silent	SNP	G	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:77284872G>T	uc004ecx.3	+	c.3042G>T	c.(3040-3042)GTG>GTT	p.V1014V		NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	1014	Cytoplasmic (Potential).				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0														0.6	172.155931	172.941155	54	36	KEEP	---	---	---	---	capture		Silent	SNP	77284872	77284872	1209	23	G	T	T	T	600	47	ATP7A	2	2
DACH2	117154	broad.mit.edu	37	X	85950113	85950113	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:85950113G>C	uc004eew.2	+	c.862G>C	c.(862-864)GCT>CCT	p.A288P	DACH2_uc004eex.2_Missense_Mutation_p.A275P|DACH2_uc010nmq.2_Missense_Mutation_p.A154P|DACH2_uc011mra.1_Missense_Mutation_p.A121P|DACH2_uc010nmr.2_Missense_Mutation_p.A69P	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a	288					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5														0.444444	22.192933	22.241778	8	10	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	85950113	85950113	4387	23	G	C	C	C	442	34	DACH2	3	3
RPA4	29935	broad.mit.edu	37	X	96139656	96139656	+	Missense_Mutation	SNP	T	C	C			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:96139656T>C	uc004efv.3	+	c.347T>C	c.(346-348)GTG>GCG	p.V116A	DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efu.3_Intron|DIAPH2_uc004efs.2_Intron	NM_013347	NP_037479	Q13156	RFA4_HUMAN	replication protein A4, 34kDa	116					DNA damage checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair	DNA replication factor A complex|nucleoplasm	single-stranded DNA binding				0														0.547619	69.42173	69.504374	23	19	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	96139656	96139656	14018	23	T	C	C	C	767	59	RPA4	4	4
DIAPH2	1730	broad.mit.edu	37	X	96167533	96167535	+	Missense	Complex_substitution	ANC	CNT	CNT			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:96167533A>C	uc004efu.3	+	c.714A>C	c.(712-714)AAA>AAC	p.K238N	DIAPH2_uc004eft.3_Missense_Mutation_p.K238N|DIAPH2_uc004efs.2_Missense_Mutation_p.K245N	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156	238	GBD/FH3.				cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4														0.357143	15.370801	15.622601	5	9	KEEP	---	---	---	---	capture		Missense	Complex_substitution	96167533	96167535	4698	23	ANC	CNT	CNT	C	37	3	DIAPH2	5	5
PCDH19	57526	broad.mit.edu	37	X	99551651	99551651	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:99551651T>A	uc010nmz.2	-	c.3071A>T	c.(3070-3072)GAC>GTC	p.D1024V	PCDH19_uc004efw.3_Missense_Mutation_p.D976V|PCDH19_uc004efx.3_Missense_Mutation_p.D977V	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	1024	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7														0.592593	50.903915	51.10634	16	11	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	99551651	99551651	11934	23	T	A	A	A	754	58	PCDH19	3	3
NLGN4Y	22829	broad.mit.edu	37	Y	16942192	16942192	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chrY:16942192C>A	uc011nas.1	+	c.1454C>A	c.(1453-1455)TCC>TAC	p.S485Y	NLGN4Y_uc004fte.2_Missense_Mutation_p.S297Y|NLGN4Y_uc004ftg.2_Missense_Mutation_p.S465Y|NLGN4Y_uc004ftf.2_Missense_Mutation_p.S158Y|NLGN4Y_uc004fth.2_Missense_Mutation_p.S465Y	NM_014893	NP_055708	Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked isoform 1	465	Extracellular (Potential).				brainstem development|cell adhesion|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of synaptic transmission|social behavior|territorial aggressive behavior|vocalization behavior	integral to membrane|plasma membrane|synapse	carboxylesterase activity|protein binding				0														0.555556	43.539659	43.618606	15	12	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	16942192	16942192	10868	24	C	A	A	A	390	30	NLGN4Y	2	2
ROBO3	64221	broad.mit.edu	37	11	124740590	124740590	+	Frame_Shift_Del	DEL	C	-	-			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:124740590_124740590delC	uc001qbc.2	+	c.999_999delC	c.(997-999)GGCfs	p.G333fs		NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3	333	Ig-like C2-type 3.|Extracellular (Potential).				axon midline choice point recognition	integral to membrane	receptor activity			breast(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)										0.38			8	13		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	124740590	124740590	13994	11	C	-	-	-	327	26	ROBO3	5	5
KRT1	3848	broad.mit.edu	37	12	53069236	53069256	+	In_Frame_Del	DEL	TAGCTGCTACCTCCGGAGCCA	-	-	rs77846840;rs61226348		TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:53069236_53069256delTAGCTGCTACCTCCGGAGCCA	uc001sau.1	-	c.1656_1676delTGGCTCCGGAGGTAGCAGCTA	c.(1654-1677)TATGGCTCCGGAGGTAGCAGCTAC>TAC	p.552_559YGSGGSSY>Y	KRT1_uc001sav.1_Splice_Site_Del_p.G556_splice	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	552_559	Gly/Ser-rich.|Tail.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)	1														0.38			6	10		---	---	---	---	capture_indel		In_Frame_Del	DEL	53069236	53069256	8762	12	TAGCTGCTACCTCCGGAGCCA	-	-	-	741	57	KRT1	5	5
GPC6	10082	broad.mit.edu	37	13	95055375	95055376	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:95055375_95055376delGA	uc001vlt.2	+	c.1572_1573delGA	c.(1570-1575)CGGAGAfs	p.R524fs		NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor	524_525						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)												0.31			18	41		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	95055375	95055376	6876	13	GA	-	-	-	522	41	GPC6	5	5
ZZEF1	23140	broad.mit.edu	37	17	3937517	3937517	+	Frame_Shift_Del	DEL	C	-	-			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:3937517_3937517delC	uc002fxe.2	-	c.6376_6376delG	c.(6376-6378)GCAfs	p.A2126fs	ZZEF1_uc002fxh.2_Frame_Shift_Del_p.A440fs|ZZEF1_uc002fxi.2_Frame_Shift_Del_p.A361fs|ZZEF1_uc002fxj.1_Frame_Shift_Del_p.A739fs	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	2126					regulation of mitotic metaphase/anaphase transition	anaphase-promoting complex	calcium ion binding|zinc ion binding			ovary(1)|pancreas(1)	2														0.43			34	45		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	3937517	3937517	18861	17	C	-	-	-	351	27	ZZEF1	5	5
LRRIQ3	127255	broad.mit.edu	37	1	74649254	74649255	+	Frame_Shift_Ins	INS	-	A	A			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:74649254_74649255insA	uc001dfy.3	-	c.114_115insT	c.(112-117)CTTCATfs	p.L38fs	LRRIQ3_uc001dfz.3_Non-coding_Transcript	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	38_39										ovary(2)	2										2				0.43			22	29		---	---	---	---	capture_indel		Frame_Shift_Ins	INS	74649254	74649255	9406	1	-	A	A	A	585	45	LRRIQ3	5	5
SLC9A8	23315	broad.mit.edu	37	20	48431651	48431651	+	Frame_Shift_Del	DEL	G	-	-			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:48431651_48431651delG	uc002xuv.1	+	c.133_133delG	c.(133-135)GTGfs	p.V45fs	SLC9A8_uc010zym.1_5'UTR|SLC9A8_uc010zyj.1_Frame_Shift_Del_p.V45fs|SLC9A8_uc010zyk.1_Frame_Shift_Del_p.V45fs|SLC9A8_uc010zyl.1_Frame_Shift_Del_p.V45fs|SLC9A8_uc010gib.1_Frame_Shift_Del_p.V45fs	NM_015266	NP_056081	Q9Y2E8	SL9A8_HUMAN	sodium/hydrogen exchanger 8	45						Golgi membrane|integral to membrane	sodium:hydrogen antiporter activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)											0.31			37	84		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	48431651	48431651	15217	20	G	-	-	-	520	40	SLC9A8	5	5
DCBLD2	131566	broad.mit.edu	37	3	98530098	98530098	+	Frame_Shift_Del	DEL	C	-	-			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:98530098_98530098delC	uc003dte.2	-	c.1516_1516delG	c.(1516-1518)GAAfs	p.E506fs	DCBLD2_uc003dtd.2_Frame_Shift_Del_p.E506fs	NM_080927	NP_563615	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	506	Extracellular (Potential).				cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane				ovary(2)|central_nervous_system(1)	3														0.38			71	114		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	98530098	98530098	4452	3	C	-	-	-	416	32	DCBLD2	5	5
CYB5R4	51167	broad.mit.edu	37	6	84574030	84574031	+	Frame_Shift_Ins	INS	-	T	T			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:84574030_84574031insT	uc003pkf.2	+	c.212_213insT	c.(211-213)TGTfs	p.C71fs		NM_016230	NP_057314	Q7L1T6	NB5R4_HUMAN	cytochrome b5 reductase 4	71	Cytochrome b5 heme-binding.				cell development|detection of oxygen|generation of precursor metabolites and energy|glucose homeostasis|insulin secretion|oxidation-reduction process|response to antibiotic|superoxide metabolic process	endoplasmic reticulum|perinuclear region of cytoplasm	cytochrome-b5 reductase activity|heme binding|NAD(P)H oxidase activity			breast(2)	2		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)		BRCA - Breast invasive adenocarcinoma(397;0.0871)		Esophageal Squamous(86;1289 1332 25971 40349 52675)				343				0.46			25	29		---	---	---	---	capture_indel		Frame_Shift_Ins	INS	84574030	84574031	4294	6	-	T	T	T	624	48	CYB5R4	5	5
C8orf74	203076	broad.mit.edu	37	8	10555161	10555161	+	Frame_Shift_Del	DEL	C	-	-			TCGA-64-5779-01	TCGA-64-5779-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:10555161_10555161delC	uc003wtd.1	+	c.294_294delC	c.(292-294)TACfs	p.Y98fs	C8orf74_uc003wte.1_Non-coding_Transcript	NM_001040032	NP_001035121	Q6P047	CH074_HUMAN	hypothetical protein LOC203076	98											0				COAD - Colon adenocarcinoma(149;0.0811)										0.32			49	102		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	10555161	10555161	2548	8	C	-	-	-	233	18	C8orf74	5	5
