Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	Oncotatorv0393GAF20hg19Feb2011dbSNPbuild132UniProtRelease2011_6	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	context_orig	context65	gene_name	categ	categ_ignoring_null_categ
SORCS3	22986	broad.mit.edu	37	10	107016648	107016648	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:107016648G>C	uc001kyi.1	+	c.3409G>C	c.(3409-3411)GGC>CGC	p.G1137R		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	1137	Helical; (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|central_nervous_system(1)	7		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		NSCLC(116;1497 1690 7108 13108 14106)								0.1	2.801148	7.597256	3	27	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	107016648	107016648	15432	10	G	C	C	C	611	47	SORCS3	3	3
SORCS1	114815	broad.mit.edu	37	10	108716302	108716302	+	Silent	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:108716302G>A	uc001kyl.2	-	c.595C>T	c.(595-597)CTG>TTG	p.L199L	SORCS1_uc001kym.2_Silent_p.L199L|SORCS1_uc009xxs.2_Silent_p.L199L|SORCS1_uc001kyn.1_Silent_p.L199L|SORCS1_uc001kyo.2_Silent_p.L199L	NM_001013031	NP_001013049	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform b	199	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)	1		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)										0.113208	8.111324	15.935372	6	47	KEEP	---	---	---	---	capture		Silent	SNP	108716302	108716302	15430	10	G	A	A	A	451	35	SORCS1	2	2
C10orf90	118611	broad.mit.edu	37	10	128149993	128149993	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:128149993G>T	uc010qum.1	-	c.1987C>A	c.(1987-1989)CCT>ACT	p.P663T	C10orf90_uc001ljp.2_Missense_Mutation_p.P422T|C10orf90_uc001ljq.2_Missense_Mutation_p.P566T|C10orf90_uc001ljo.2_Non-coding_Transcript	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611	566											0		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)										0.212766	20.343611	23.924688	10	37	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	128149993	128149993	1660	10	G	T	T	T	546	42	C10orf90	2	2
C10orf90	118611	broad.mit.edu	37	10	128193340	128193340	+	Silent	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:128193340C>T	uc010qum.1	-	c.720G>A	c.(718-720)ACG>ACA	p.T240T	C10orf90_uc001ljp.2_Silent_p.T96T|C10orf90_uc001ljq.2_Silent_p.T143T|C10orf90_uc009yao.2_Silent_p.T240T|C10orf90_uc001ljs.1_Silent_p.T96T	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611	143											0		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)								OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.19403	26.754871	32.622963	13	54	KEEP	---	---	---	---	capture		Silent	SNP	128193340	128193340	1660	10	C	T	T	T	288	23	C10orf90	1	1
KIAA1274	27143	broad.mit.edu	37	10	72299432	72299432	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:72299432G>A	uc001jrd.3	+	c.1822G>A	c.(1822-1824)GAG>AAG	p.E608K	KIAA1274_uc001jre.3_5'UTR	NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274	608										ovary(2)|central_nervous_system(1)	3														0.258065	40.384919	43.664602	16	46	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72299432	72299432	8529	10	G	A	A	A	533	41	KIAA1274	2	2
MAT1A	4143	broad.mit.edu	37	10	82043758	82043758	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:82043758C>T	uc001kbw.2	-	c.206G>A	c.(205-207)GGT>GAT	p.G69D		NM_000429	NP_000420	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	69					cellular amino acid metabolic process|methylation|xenobiotic metabolic process	cytosol	ATP binding|metal ion binding|methionine adenosyltransferase activity				0			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)									0.230769	13.85323	15.568798	6	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	82043758	82043758	9713	10	C	T	T	T	234	18	MAT1A	2	2
TRPC6	7225	broad.mit.edu	37	11	101344259	101344259	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:101344259G>T	uc001pgk.3	-	c.1990C>A	c.(1990-1992)CAA>AAA	p.Q664K	TRPC6_uc009ywy.2_Missense_Mutation_p.Q548K|TRPC6_uc009ywz.1_Missense_Mutation_p.Q609K	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,	664	Extracellular (Potential).				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		Colon(166;1315 1927 11094 12848 34731)								0.214286	20.352249	23.51859	9	33	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	101344259	101344259	17134	11	G	T	T	T	624	48	TRPC6	2	2
MMP20	9313	broad.mit.edu	37	11	102464254	102464254	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:102464254G>T	uc001phc.2	-	c.1163C>A	c.(1162-1164)CCA>CAA	p.P388Q		NM_004771	NP_004762	O60882	MMP20_HUMAN	matrix metalloproteinase 20 preproprotein	388	Hemopexin-like 2.				proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding			urinary_tract(1)|skin(1)	2	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)						637				0.193548	27.76514	33.197908	12	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	102464254	102464254	10049	11	G	T	T	T	611	47	MMP20	2	2
HIPK3	10114	broad.mit.edu	37	11	33373699	33373699	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:33373699C>T	uc001mul.1	+	c.3059C>T	c.(3058-3060)CCA>CTA	p.P1020L	HIPK3_uc001mum.1_Missense_Mutation_p.P999L|HIPK3_uc009yjv.1_Missense_Mutation_p.P999L	NM_005734	NP_005725	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3 isoform	1020					anti-apoptosis|apoptosis|negative regulation of JUN kinase activity|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)|ovary(1)|pancreas(1)	3										376				0.154412	41.616274	57.116271	21	115	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	33373699	33373699	7403	11	C	T	T	T	273	21	HIPK3	2	2
ACCSL	390110	broad.mit.edu	37	11	44069816	44069816	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:44069816G>T	uc001mxw.1	+	c.230G>T	c.(229-231)CGG>CTG	p.R77L	ACCSL_uc009ykr.2_5'UTR	NM_001031854	NP_001027025	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase	77							1-aminocyclopropane-1-carboxylate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(5)	5														0.172043	34.963189	44.398233	16	77	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	44069816	44069816	135	11	G	T	T	T	507	39	ACCSL	1	1
OR4B1	119765	broad.mit.edu	37	11	48238701	48238701	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:48238701G>T	uc010rhs.1	+	c.340G>T	c.(340-342)GTG>TTG	p.V114L		NM_001005470	NP_001005470	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B,	114	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2														0.176471	46.810411	58.541496	21	98	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	48238701	48238701	11450	11	G	T	T	T	624	48	OR4B1	2	2
OR5F1	338674	broad.mit.edu	37	11	55761523	55761523	+	Silent	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:55761523G>T	uc010riv.1	-	c.579C>A	c.(577-579)ATC>ATA	p.I193I		NM_003697	NP_003688	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F,	193	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)													0.12	5.739223	12.805497	6	44	KEEP	---	---	---	---	capture		Silent	SNP	55761523	55761523	11568	11	G	T	T	T	525	41	OR5F1	2	2
OR1S2	219958	broad.mit.edu	37	11	57970805	57970805	+	Silent	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:57970805A>T	uc010rkb.1	-	c.849T>A	c.(847-849)ACT>ACA	p.T283T		NM_001004459	NP_001004459	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S,	283	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.0589)												0.132075	20.226915	34.127932	14	92	KEEP	---	---	---	---	capture		Silent	SNP	57970805	57970805	11379	11	A	T	T	T	80	7	OR1S2	3	3
OR5B2	390190	broad.mit.edu	37	11	58190310	58190310	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:58190310A>T	uc010rkg.1	-	c.425T>A	c.(424-426)CTG>CAG	p.L142Q		NM_001005566	NP_001005566	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B,	142	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)												0.177778	16.678366	21.07369	8	37	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	58190310	58190310	11560	11	A	T	T	T	91	7	OR5B2	3	3
B3GNT6	192134	broad.mit.edu	37	11	76751142	76751142	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:76751142G>T	uc001oxw.2	+	c.547G>T	c.(547-549)GGC>TGC	p.G183C		NM_138706	NP_619651	Q6ZMB0	B3GN6_HUMAN	UDP-GlcNAc:betaGal	183	Lumenal (Potential).				O-glycan processing, core 3	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity|galactosyltransferase activity				0														0.25	9.897474	10.803231	4	12	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	76751142	76751142	1282	11	G	T	T	T	507	39	B3GNT6	1	1
KRAS	3845	broad.mit.edu	37	12	25380276	25380276	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:25380276T>A	uc001rgp.1	-	c.182A>T	c.(181-183)CAA>CTA	p.Q61L	KRAS_uc001rgq.1_Missense_Mutation_p.Q61L	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	61	GTP.		Q -> R (in a colorectal cancer sample; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.Q61L(47)|p.Q61R(40)|p.Q61H(23)|p.Q61P(11)|p.Q61D(1)		large_intestine(11742)|pancreas(3256)|lung(2694)|biliary_tract(514)|ovary(437)|endometrium(339)|haematopoietic_and_lymphoid_tissue(303)|stomach(179)|thyroid(145)|prostate(85)|soft_tissue(75)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|breast(27)|liver(21)|testis(17)|oesophagus(15)|central_nervous_system(8)|peritoneum(5)|kidney(5)|salivary_gland(5)|thymus(5)|eye(4)|gastrointestinal_tract_(site_indeterminate)(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	20148	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Q61R(PANC0213_PANCREAS)|Q61L(NCIH650_LUNG)|Q61L(SW948_LARGE_INTESTINE)	119		262	TSP Lung(1;<1E-8)|Multiple Myeloma(2;<1E-6)			0.142857	10.722953	15.88384	6	36	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	25380276	25380276	8753	12	T	A	A	A	819	63	KRAS	3	3
OVCH1	341350	broad.mit.edu	37	12	29648339	29648339	+	Silent	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:29648339C>T	uc001rix.1	-	c.333G>A	c.(331-333)CAG>CAA	p.Q111Q		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor	111	Peptidase S1 1.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)													0.163636	19.842189	25.751021	9	46	KEEP	---	---	---	---	capture		Silent	SNP	29648339	29648339	11736	12	C	T	T	T	415	32	OVCH1	2	2
DDX11	1663	broad.mit.edu	37	12	31236811	31236811	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:31236811G>A	uc001rjt.1	+	c.209G>A	c.(208-210)CGT>CAT	p.R70H	DDX11_uc010sjw.1_Missense_Mutation_p.R70H|DDX11_uc010sjx.1_Non-coding_Transcript|DDX11_uc001rjr.1_Missense_Mutation_p.R70H|DDX11_uc001rjs.1_Missense_Mutation_p.R70H|DDX11_uc001rju.1_De_novo_Start_OutOfFrame|DDX11_uc001rjv.1_Missense_Mutation_p.R70H|DDX11_uc001rjw.1_Missense_Mutation_p.R44H	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11	70	Helicase ATP-binding.				G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)										Multiple Myeloma(12;0.14)			0.194805	32.30347	38.976663	15	62	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	31236811	31236811	4514	12	G	A	A	A	520	40	DDX11	1	1
AQP2	359	broad.mit.edu	37	12	50348099	50348099	+	Silent	SNP	T	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:50348099T>A	uc001rvn.2	+	c.522T>A	c.(520-522)CTT>CTA	p.L174L	AQP2_uc009zll.1_5'Flank	NM_000486	NP_000477	P41181	AQP2_HUMAN	aquaporin 2	174	Helical; (Potential).				cellular response to copper ion|cellular response to mercury ion|excretion	apical plasma membrane|integral to membrane|transport vesicle membrane	glycerol transmembrane transporter activity|water channel activity			ovary(2)	2														0.380952	22.993842	23.255208	8	13	KEEP	---	---	---	---	capture		Silent	SNP	50348099	50348099	837	12	T	A	A	A	808	63	AQP2	3	3
KRT74	121391	broad.mit.edu	37	12	52964528	52964528	+	Silent	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:52964528G>T	uc001sap.1	-	c.933C>A	c.(931-933)ATC>ATA	p.I311I		NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN	keratin 6 irs4	311	Rod.|Coil 2.					keratin filament	structural molecule activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(357;0.191)										0.2	16.129026	20.449542	10	40	KEEP	---	---	---	---	capture		Silent	SNP	52964528	52964528	8802	12	G	T	T	T	473	37	KRT74	1	1
VWF	7450	broad.mit.edu	37	12	6161858	6161858	+	Nonsense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:6161858G>T	uc001qnn.1	-	c.2037C>A	c.(2035-2037)TGC>TGA	p.C679*	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	679	TIL 2.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			ovary(3)|pancreas(2)|breast(1)|central_nervous_system(1)	7					Antihemophilic Factor(DB00025)									0.133333	9.220469	15.09105	6	39	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	6161858	6161858	17818	12	G	T	T	T	594	46	VWF	5	2
GLIPR1	11010	broad.mit.edu	37	12	75875650	75875650	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:75875650T>A	uc001sxs.2	+	c.211T>A	c.(211-213)TGG>AGG	p.W71R	GLIPR1_uc009zsb.1_Missense_Mutation_p.W71R	NM_006851	NP_006842	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1 precursor	71					cellular lipid metabolic process	extracellular region|integral to membrane				large_intestine(1)|ovary(1)	2														0.218182	63.167998	71.199418	24	86	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	75875650	75875650	6709	12	T	A	A	A	663	51	GLIPR1	3	3
NTS	4922	broad.mit.edu	37	12	86272289	86272289	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:86272289T>A	uc001tag.2	+	c.302T>A	c.(301-303)ATG>AAG	p.M101K		NM_006183	NP_006174	P30990	NEUT_HUMAN	neurotensin/neuromedin N preproprotein	101					regulation of blood vessel size|signal transduction	extracellular region|soluble fraction|transport vesicle	neuropeptide hormone activity				0														0.180556	29.999928	36.85413	13	59	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	86272289	86272289	11114	12	T	A	A	A	663	51	NTS	3	3
TMTC4	84899	broad.mit.edu	37	13	101278052	101278052	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:101278052C>A	uc001vot.2	-	c.1681G>T	c.(1681-1683)GCT>TCT	p.A561S	TMTC4_uc001vou.2_Missense_Mutation_p.A542S|TMTC4_uc010tja.1_Missense_Mutation_p.A431S|TMTC4_uc001vov.1_Missense_Mutation_p.A287S|TMTC4_uc001vow.1_Missense_Mutation_p.A325S	NM_032813	NP_116202	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat	542	TPR 3.					integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)													0.171875	21.186216	27.699892	11	53	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	101278052	101278052	16804	13	C	A	A	A	338	26	TMTC4	2	2
MTUS2	23281	broad.mit.edu	37	13	29599523	29599523	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:29599523C>T	uc001usl.3	+	c.718C>T	c.(718-720)CCT>TCT	p.P240S		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	230						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0										344				0.136364	4.010122	6.828114	3	19	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	29599523	29599523	10359	13	C	T	T	T	286	22	MTUS2	2	2
TDRD9	122402	broad.mit.edu	37	14	104452579	104452579	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:104452579C>T	uc001yom.3	+	c.1037C>T	c.(1036-1038)CCG>CTG	p.P346L	TDRD9_uc001yon.3_Missense_Mutation_p.P84L	NM_153046	NP_694591	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	346					cell differentiation|DNA methylation involved in gamete generation|fertilization|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	nucleus|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)												0.12	4.907725	8.448248	3	22	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	104452579	104452579	16263	14	C	T	T	T	299	23	TDRD9	1	1
JAG2	3714	broad.mit.edu	37	14	105622114	105622114	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:105622114C>A	uc001yqg.2	-	c.688G>T	c.(688-690)GCC>TCC	p.A230S	JAG2_uc001yqh.2_Missense_Mutation_p.A230S	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	230	DSL.|Extracellular (Potential).				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)	3		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)						501				0.16129	5.927471	9.370893	5	26	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	105622114	105622114	8239	14	C	A	A	A	338	26	JAG2	2	2
TTC5	91875	broad.mit.edu	37	14	20767602	20767602	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:20767602C>A	uc001vwt.2	-	c.402G>T	c.(400-402)AGG>AGT	p.R134S	TTC5_uc001vwu.2_5'UTR	NM_138376	NP_612385	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5	134	TPR 2.				DNA repair	cytoplasm|nucleus	binding			ovary(1)	1	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)										0.142857	10.70059	16.716841	7	42	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20767602	20767602	17266	14	C	A	A	A	389	30	TTC5	2	2
ARID4A	5926	broad.mit.edu	37	14	58814512	58814512	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:58814512A>T	uc001xdp.2	+	c.1320A>T	c.(1318-1320)TTA>TTT	p.L440F	ARID4A_uc001xdo.2_Missense_Mutation_p.L440F|ARID4A_uc001xdq.2_Missense_Mutation_p.L440F|ARID4A_uc010apg.1_Missense_Mutation_p.L118F	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	440					chromatin assembly or disassembly|negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromatin|transcriptional repressor complex	chromatin binding|DNA binding|sequence-specific DNA binding transcription factor activity|transcription repressor activity			ovary(3)|lung(1)	4														0.133333	10.856076	18.69403	8	52	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	58814512	58814512	934	14	A	T	T	T	167	13	ARID4A	3	3
LIN52	91750	broad.mit.edu	37	14	74551696	74551696	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:74551696G>A	uc001xpp.2	+	c.31G>A	c.(31-33)GGG>AGG	p.G11R	LIN52_uc010asb.2_Non-coding_Transcript|ALDH6A1_uc001xpo.2_5'Flank|ALDH6A1_uc010asa.2_5'Flank|ALDH6A1_uc010tuq.1_5'Flank	NM_001024674	NP_001019845	Q52LA3	LIN52_HUMAN	lin-52 homolog	11										breast(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00471)										0.113636	12.997973	25.94556	10	78	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	74551696	74551696	9135	14	G	A	A	A	507	39	LIN52	1	1
MLH3	27030	broad.mit.edu	37	14	75515969	75515969	+	Silent	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:75515969C>A	uc001xrd.1	-	c.390G>T	c.(388-390)CTG>CTT	p.L130L	MLH3_uc001xre.1_Silent_p.L130L|MLH3_uc010tuy.1_Non-coding_Transcript	NM_001040108	NP_001035197	Q9UHC1	MLH3_HUMAN	mutL homolog 3 isoform 1	130					mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)										0.043956	-11.850258	8.388175	4	87	KEEP	---	---	---	---	capture		Silent	SNP	75515969	75515969	10008	14	C	A	A	A	366	29	MLH3	2	2
ISM2	145501	broad.mit.edu	37	14	77951118	77951118	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:77951118G>T	uc001xtz.2	-	c.286C>A	c.(286-288)CCT>ACT	p.P96T	ISM2_uc001xua.2_Missense_Mutation_p.P96T|ISM2_uc001xty.2_Missense_Mutation_p.P8T|ISM2_uc010tvl.1_Missense_Mutation_p.P96T	NM_199296	NP_954993	Q6H9L7	ISM2_HUMAN	isthmin 2 homolog isoform 1	96						extracellular region					0														0.27907	31.642187	33.493521	12	31	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	77951118	77951118	8165	14	G	T	T	T	559	43	ISM2	2	2
KCNK10	54207	broad.mit.edu	37	14	88729653	88729653	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:88729653C>T	uc001xwm.2	-	c.295G>A	c.(295-297)GAG>AAG	p.E99K	KCNK10_uc001xwn.2_Missense_Mutation_p.E99K|KCNK10_uc001xwo.2_Missense_Mutation_p.E94K	NM_138318	NP_612191	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	94					signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|pancreas(1)	3														0.181818	21.633648	26.851452	10	45	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	88729653	88729653	8364	14	C	T	T	T	390	30	KCNK10	2	2
C15orf2	23742	broad.mit.edu	37	15	24923058	24923058	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:24923058G>T	uc001ywo.2	+	c.2044G>T	c.(2044-2046)GTG>TTG	p.V682L		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	682					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|kidney(1)|central_nervous_system(1)	6		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)						443				0.160494	48.039432	65.826724	26	136	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	24923058	24923058	1834	15	G	T	T	T	468	36	C15orf2	2	2
OCA2	4948	broad.mit.edu	37	15	28116372	28116372	+	Silent	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:28116372G>T	uc001zbh.3	-	c.2172C>A	c.(2170-2172)GCC>GCA	p.A724A	OCA2_uc010ayv.2_Silent_p.A700A	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	724	Helical; (Potential).		A -> P (in OCA2).		eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)										0.085106	0.470401	8.671674	4	43	KEEP	---	---	---	---	capture		Silent	SNP	28116372	28116372	11220	15	G	T	T	T	600	47	OCA2	2	2
RYR3	6263	broad.mit.edu	37	15	33893671	33893671	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:33893671G>T	uc001zhi.2	+	c.1840G>T	c.(1840-1842)GCC>TCC	p.A614S	RYR3_uc010bar.2_Missense_Mutation_p.A614S	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	614	Cytoplasmic (By similarity).|B30.2/SPRY 1.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)										0.130435	4.363284	7.37309	3	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	33893671	33893671	14250	15	G	T	T	T	442	34	RYR3	2	2
AVEN	57099	broad.mit.edu	37	15	34295296	34295296	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:34295296C>A	uc001zhj.2	-	c.382G>T	c.(382-384)GTC>TTC	p.V128F	CHRM5_uc001zhk.1_Intron	NM_020371	NP_065104	Q9NQS1	AVEN_HUMAN	cell death regulator aven	128					anti-apoptosis|apoptosis	endomembrane system|intracellular|membrane|membrane fraction	protein binding			kidney(1)	1		all_lung(180;1.78e-08)		all cancers(64;1.66e-15)|GBM - Glioblastoma multiforme(113;1.42e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0359)										0.2	21.698804	26.305218	11	44	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	34295296	34295296	1247	15	C	A	A	A	234	18	AVEN	2	2
ACTC1	70	broad.mit.edu	37	15	35083387	35083387	+	Silent	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:35083387A>T	uc001ziu.1	-	c.918T>A	c.(916-918)ACT>ACA	p.T306T		NM_005159	NP_005150	P68032	ACTC_HUMAN	cardiac muscle alpha actin 1 proprotein	306					apoptosis|cardiac muscle tissue morphogenesis|cardiac myofibril assembly|muscle filament sliding|skeletal muscle thin filament assembly	actomyosin, actin part|cytosol|I band	ATP binding|ATPase activity|myosin binding			ovary(1)	1		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)										0.18232	68.628234	85.856464	33	148	KEEP	---	---	---	---	capture		Silent	SNP	35083387	35083387	196	15	A	T	T	T	184	15	ACTC1	3	3
MEIS2	4212	broad.mit.edu	37	15	37184416	37184416	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:37184416A>T	uc001zjr.2	-	c.1392T>A	c.(1390-1392)GAT>GAA	p.D464E	MEIS2_uc001zjl.2_3'UTR|MEIS2_uc010ucj.1_Missense_Mutation_p.D444E|MEIS2_uc001zjm.2_3'UTR|MEIS2_uc001zjn.2_3'UTR|MEIS2_uc001zjo.2_3'UTR|MEIS2_uc001zjp.2_3'UTR|MEIS2_uc001zjs.2_Missense_Mutation_p.D457E|MEIS2_uc001zju.2_3'UTR|MEIS2_uc001zjt.2_Missense_Mutation_p.D457E|MEIS2_uc001zjj.2_Missense_Mutation_p.D160E|MEIS2_uc001zjk.2_Missense_Mutation_p.D153E	NM_170675	NP_733775	O14770	MEIS2_HUMAN	Meis homeobox 2 isoform c	464					negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|specific RNA polymerase II transcription factor activity|transcription corepressor activity			ovary(2)	2		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)										0.138211	55.634009	86.645048	34	212	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	37184416	37184416	9857	15	A	T	T	T	154	12	MEIS2	3	3
EIF2AK4	440275	broad.mit.edu	37	15	40265942	40265942	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:40265942G>A	uc001zkm.1	+	c.1810G>A	c.(1810-1812)GTC>ATC	p.V604I	EIF2AK4_uc001zkl.2_Missense_Mutation_p.V604I|EIF2AK4_uc010bbj.1_Missense_Mutation_p.V333I	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha	604	ATP (By similarity).|Protein kinase 2.				protein phosphorylation|translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)						876				0.177215	27.002657	34.758394	14	65	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	40265942	40265942	5188	15	G	A	A	A	624	48	EIF2AK4	2	2
DUOX2	50506	broad.mit.edu	37	15	45399643	45399643	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:45399643C>A	uc010bea.2	-	c.1593G>T	c.(1591-1593)GAG>GAT	p.E531D	DUOX2_uc001zun.2_Missense_Mutation_p.E531D	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	531	Extracellular (Potential).|Peroxidase-like; mediates peroxidase activity (By similarity).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|oxidation-reduction process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|pancreas(1)	3		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)										0.171429	23.359414	30.501815	12	58	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	45399643	45399643	4986	15	C	A	A	A	415	32	DUOX2	2	2
FURIN	5045	broad.mit.edu	37	15	91424922	91424922	+	Silent	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:91424922C>T	uc002bpu.1	+	c.2199C>T	c.(2197-2199)TTC>TTT	p.F733F	FES_uc010uqj.1_5'Flank|FES_uc010uqk.1_5'Flank|FES_uc002bpw.2_5'Flank|FES_uc002bpv.2_5'Flank	NM_002569	NP_002560	P09958	FURIN_HUMAN	furin preproprotein	733	Helical; (Potential).				cell proliferation|negative regulation of low-density lipoprotein particle receptor catabolic process|negative regulation of transforming growth factor-beta1 production|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|Notch signaling pathway|peptide biosynthetic process|peptidyl-glutamic acid carboxylation|positive regulation of membrane protein ectodomain proteolysis|post-translational protein modification|secretion by cell|signal peptide processing|transforming growth factor beta receptor signaling pathway|viral assembly, maturation, egress, and release	cell surface|Golgi lumen|Golgi membrane|integral to membrane|membrane raft|plasma membrane|trans-Golgi network|trans-Golgi network transport vesicle	metal ion binding|nerve growth factor binding|peptide binding|protease binding|serine-type endopeptidase activity|serine-type endopeptidase inhibitor activity			central_nervous_system(4)	4	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)							290				0.142857	22.400694	34.433592	14	84	KEEP	---	---	---	---	capture		Silent	SNP	91424922	91424922	6350	15	C	T	T	T	389	30	FURIN	2	2
JMJD5	79831	broad.mit.edu	37	16	27221911	27221911	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:27221911G>A	uc010vcn.1	+	c.581G>A	c.(580-582)CGT>CAT	p.R194H	JMJD5_uc010bxv.2_Missense_Mutation_p.V85M|JMJD5_uc002doh.2_Missense_Mutation_p.R156H|JMJD5_uc010bxw.2_Missense_Mutation_p.R156H	NM_001145348	NP_001138820	Q8N371	KDM8_HUMAN	jumonji domain containing 5 isoform 1	156					G2/M transition of mitotic cell cycle|oxidation-reduction process|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|histone demethylase activity (H3-K36 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(2)	2														0.181818	12.983786	16.080974	6	27	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	27221911	27221911	8256	16	G	A	A	A	520	40	JMJD5	1	1
ATXN2L	11273	broad.mit.edu	37	16	28845864	28845864	+	Silent	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:28845864A>T	uc002dqy.2	+	c.2283A>T	c.(2281-2283)CCA>CCT	p.P761P	ATXN2L_uc002drb.2_Silent_p.P761P|ATXN2L_uc002dra.2_Silent_p.P761P|ATXN2L_uc002dqz.2_Silent_p.P761P|ATXN2L_uc002drc.2_Silent_p.P761P|ATXN2L_uc010vdb.1_Silent_p.P767P|ATXN2L_uc002dre.2_Silent_p.P761P|ATXN2L_uc002drf.2_Silent_p.P170P|ATXN2L_uc002drg.2_Silent_p.P43P	NM_148414	NP_680780	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform C	761						membrane				ovary(1)	1														0.142857	31.565303	47.889177	19	114	KEEP	---	---	---	---	capture		Silent	SNP	28845864	28845864	1232	16	A	T	T	T	80	7	ATXN2L	3	3
SRCAP	10847	broad.mit.edu	37	16	30748494	30748494	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:30748494C>T	uc002dze.1	+	c.7133C>T	c.(7132-7134)ACC>ATC	p.T2378I	SRCAP_uc002dzf.2_Non-coding_Transcript|SRCAP_uc002dzg.1_Missense_Mutation_p.T2173I	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	2378					interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)	3			Colorectal(24;0.198)											0.171429	11.731412	15.300973	6	29	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	30748494	30748494	15649	16	C	T	T	T	234	18	SRCAP	2	2
TGFB1I1	7041	broad.mit.edu	37	16	31488202	31488202	+	Silent	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:31488202C>A	uc002ecd.1	+	c.990C>A	c.(988-990)GGC>GGA	p.G330G	TGFB1I1_uc002ece.1_Silent_p.G313G|TGFB1I1_uc010caq.1_Silent_p.G169G	NM_001042454	NP_001035919	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced	330	LIM zinc-binding 2.				androgen receptor signaling pathway|cell adhesion|negative regulation of cell proliferation|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor beta receptor signaling pathway|transcription from RNA polymerase II promoter|ubiquitin-dependent SMAD protein catabolic process|Wnt receptor signaling pathway	cytoplasm|cytoskeleton|focal adhesion|nuclear matrix	androgen receptor binding|I-SMAD binding|Roundabout binding|transcription coactivator activity|zinc ion binding				0														0.227273	9.725924	11.185825	5	17	KEEP	---	---	---	---	capture		Silent	SNP	31488202	31488202	16345	16	C	A	A	A	327	26	TGFB1I1	2	2
GFOD2	81577	broad.mit.edu	37	16	67719580	67719580	+	Silent	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:67719580G>A	uc002eub.2	-	c.39C>T	c.(37-39)GGC>GGT	p.G13G	GFOD2_uc002euc.2_Intron|GFOD2_uc010cen.2_Silent_p.G13G	NM_030819	NP_110446	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain	13					oxidation-reduction process	proteinaceous extracellular matrix	binding|oxidoreductase activity			ovary(2)	2		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)										0.153846	9.978205	15.939132	8	44	KEEP	---	---	---	---	capture		Silent	SNP	67719580	67719580	6612	16	G	A	A	A	587	46	GFOD2	2	2
DHX38	9785	broad.mit.edu	37	16	72139923	72139923	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:72139923G>T	uc002fcb.2	+	c.2507G>T	c.(2506-2508)GGC>GTC	p.G836V	DHX38_uc010vmp.1_Missense_Mutation_p.G148V	NM_014003	NP_054722	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	836	Helicase C-terminal.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding				0		Ovarian(137;0.125)				Melanoma(97;711 1442 7855 13832 28836)								0.153846	21.37825	30.291752	12	66	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	72139923	72139923	4690	16	G	T	T	T	546	42	DHX38	2	2
MYH8	4626	broad.mit.edu	37	17	10315771	10315771	+	Silent	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:10315771G>T	uc002gmm.2	-	c.1332C>A	c.(1330-1332)ACC>ACA	p.T444T		NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	444	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(3)|breast(2)	5														0.216749	97.939811	112.928382	44	159	KEEP	---	---	---	---	capture		Silent	SNP	10315771	10315771	10436	17	G	T	T	T	548	43	MYH8	2	2
DNAH9	1770	broad.mit.edu	37	17	11572727	11572727	+	Missense_Mutation	SNP	G	T	T	rs61745415	by1000genomes	TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:11572727G>T	uc002gne.2	+	c.2969G>T	c.(2968-2970)CGC>CTC	p.R990L	DNAH9_uc010coo.2_Missense_Mutation_p.R284L	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	990	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	10		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)										0.214286	15.854722	17.950519	6	22	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	11572727	11572727	4791	17	G	T	T	T	494	38	DNAH9	1	1
ERBB2	2064	broad.mit.edu	37	17	37864628	37864628	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:37864628G>A	uc002hso.2	+	c.280G>A	c.(280-282)GTC>ATC	p.V94I	ERBB2_uc002hsm.2_Missense_Mutation_p.V64I|ERBB2_uc010cwa.2_Missense_Mutation_p.V79I|ERBB2_uc002hsp.2_5'UTR|ERBB2_uc010cwb.2_Missense_Mutation_p.V94I|ERBB2_uc010wek.1_Intron|ERBB2_uc002hsl.2_Missense_Mutation_p.V64I|ERBB2_uc002hsn.1_Missense_Mutation_p.V94I	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	94	Extracellular (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(71)|central_nervous_system(16)|ovary(13)|stomach(12)|breast(5)|upper_aerodigestive_tract(4)|large_intestine(3)|liver(3)|endometrium(2)|pancreas(1)	130	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)			1		271	TCGA GBM(5;<1E-8)			0.157895	27.868404	38.467196	15	80	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	37864628	37864628	5399	17	G	A	A	A	572	44	ERBB2	2	2
TEX14	56155	broad.mit.edu	37	17	56679854	56679854	+	Nonsense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:56679854G>T	uc010dcz.1	-	c.1452C>A	c.(1450-1452)TAC>TAA	p.Y484*	TEX14_uc002iwr.1_Nonsense_Mutation_p.Y478*|TEX14_uc002iws.1_Nonsense_Mutation_p.Y478*|TEX14_uc010dda.1_Nonsense_Mutation_p.Y258*	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a	484	Protein kinase.				protein phosphorylation	cytoplasm	ATP binding|protein kinase activity			stomach(4)|ovary(3)|large_intestine(1)|lung(1)|skin(1)|pancreas(1)	11	Medulloblastoma(34;0.127)|all_neural(34;0.237)									598				0.236111	38.183789	42.832828	17	55	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	56679854	56679854	16305	17	G	T	T	T	464	36	TEX14	5	2
DCAF7	10238	broad.mit.edu	37	17	61657267	61657267	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:61657267G>A	uc002jbc.2	+	c.491G>A	c.(490-492)GGC>GAC	p.G164D	DCAF7_uc002jbb.2_Non-coding_Transcript|DCAF7_uc010wpn.1_Intron	NM_005828	NP_005819	P61962	DCAF7_HUMAN	WD-repeat protein	164					multicellular organismal development|protein ubiquitination	CUL4 RING ubiquitin ligase complex|cytoplasm|nucleus	protein binding			ovary(1)	1														0.35	36.334227	37.129864	14	26	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	61657267	61657267	4446	17	G	A	A	A	546	42	DCAF7	2	2
SCN4A	6329	broad.mit.edu	37	17	62018277	62018277	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:62018277A>T	uc002jds.1	-	c.5365T>A	c.(5365-5367)TCG>ACG	p.S1789T		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	1789					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)									0.264706	44.727312	48.125585	18	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	62018277	62018277	14402	17	A	T	T	T	143	11	SCN4A	3	3
APOH	350	broad.mit.edu	37	17	64210617	64210617	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:64210617A>T	uc002jfn.3	-	c.936T>A	c.(934-936)GAT>GAA	p.D312E		NM_000042	NP_000033	P02749	APOH_HUMAN	apolipoprotein H precursor	312	Sushi-like.				blood coagulation, intrinsic pathway|negative regulation of angiogenesis|negative regulation of blood coagulation|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of myeloid cell apoptosis|negative regulation of smooth muscle cell apoptosis|plasminogen activation|positive regulation of lipoprotein lipase activity|triglyceride metabolic process|triglyceride transport	cell surface|chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	eukaryotic cell surface binding|glycoprotein binding|heparin binding|lipoprotein lipase activator activity|phospholipid binding				0			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			Melanoma(155;624 1882 16869 48804 51309)								0.221311	67.668594	76.394693	27	95	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	64210617	64210617	815	17	A	T	T	T	102	8	APOH	3	3
PRPSAP1	5635	broad.mit.edu	37	17	74324814	74324814	+	Silent	SNP	T	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:74324814T>A	uc010wta.1	-	c.765A>T	c.(763-765)CCA>CCT	p.P255P	PRPSAP1_uc010wtb.1_Silent_p.P152P	NM_002766	NP_002757	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate	226					nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity			ovary(1)	1														0.2	12.160239	14.253065	5	20	KEEP	---	---	---	---	capture		Silent	SNP	74324814	74324814	13024	17	T	A	A	A	704	55	PRPSAP1	3	3
DSG1	1828	broad.mit.edu	37	18	28906921	28906921	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:28906921G>A	uc002kwp.2	+	c.169G>A	c.(169-171)GCC>ACC	p.A57T		NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	57	Extracellular (Potential).|Cadherin 1.				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			ovary(2)|central_nervous_system(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00559)											0.173077	17.567155	22.797803	9	43	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	28906921	28906921	4960	18	G	A	A	A	442	34	DSG1	2	2
KRI1	65095	broad.mit.edu	37	19	10671747	10671747	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:10671747C>G	uc002moy.1	-	c.613G>C	c.(613-615)GAG>CAG	p.E205Q	KRI1_uc002mow.1_5'Flank|KRI1_uc002mox.1_Missense_Mutation_p.E201Q	NM_023008	NP_075384	Q8N9T8	KRI1_HUMAN	KRI1 homolog	205	Glu-rich.									ovary(1)	1			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)											0.166667	16.968821	22.026192	8	40	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	10671747	10671747	8759	19	C	G	G	G	390	30	KRI1	3	3
LPHN1	22859	broad.mit.edu	37	19	14274115	14274115	+	Silent	SNP	A	C	C			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:14274115A>C	uc010xnn.1	-	c.513T>G	c.(511-513)GGT>GGG	p.G171G	LPHN1_uc010xno.1_Silent_p.G166G	NM_001008701	NP_001008701	O94910	LPHN1_HUMAN	latrophilin 1 isoform 1 precursor	171	Olfactomedin-like.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			ovary(1)|central_nervous_system(1)	2														0.307692	7.108657	8.083844	8	18	KEEP	---	---	---	---	capture		Silent	SNP	14274115	14274115	9288	19	A	C	C	C	67	6	LPHN1	4	4
ZNF253	56242	broad.mit.edu	37	19	20003092	20003092	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:20003092G>T	uc002noj.2	+	c.1036G>T	c.(1036-1038)GGC>TGC	p.G346C	ZNF253_uc002nok.2_Missense_Mutation_p.G270C|ZNF253_uc002nol.2_Non-coding_Transcript	NM_021047	NP_066385	O75346	ZN253_HUMAN	zinc finger protein 253	346	C2H2-type 7.			Missing (in Ref. 1; AAC26844).	regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription repressor activity|zinc ion binding				0														0.111111	4.34237	11.072279	5	40	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	20003092	20003092	18388	19	G	T	T	T	611	47	ZNF253	2	2
ZNF536	9745	broad.mit.edu	37	19	30936248	30936248	+	Silent	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:30936248C>T	uc002nsu.1	+	c.1779C>T	c.(1777-1779)GAC>GAT	p.D593D	ZNF536_uc010edd.1_Silent_p.D593D	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	593					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)	9	Esophageal squamous(110;0.0834)													0.168421	27.38454	37.248113	16	79	KEEP	---	---	---	---	capture		Silent	SNP	30936248	30936248	18568	19	C	T	T	T	233	18	ZNF536	2	2
TSHZ3	57616	broad.mit.edu	37	19	31768002	31768002	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:31768002G>T	uc002nsy.3	-	c.2697C>A	c.(2695-2697)AAC>AAA	p.N899K		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	899	Homeobox; atypical.				regulation of respiratory gaseous exchange by neurological system process|regulation of transcription, DNA-dependent	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription repressor activity|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|skin(1)	7	Esophageal squamous(110;0.226)													0.189189	14.43823	17.758712	7	30	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	31768002	31768002	17176	19	G	T	T	T	568	44	TSHZ3	2	2
CELF5	60680	broad.mit.edu	37	19	3273914	3273914	+	Silent	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:3273914C>T	uc002lxm.2	+	c.387C>T	c.(385-387)CGC>CGT	p.R129R	CELF5_uc002lxl.1_Silent_p.R129R|CELF5_uc010dtj.1_Silent_p.R129R|CELF5_uc010xhg.1_Silent_p.R15R|CELF5_uc002lxn.2_Non-coding_Transcript	NM_021938	NP_068757	Q8N6W0	CELF5_HUMAN	bruno-like 5, RNA binding protein	129					mRNA processing	cytoplasm|nucleus	nucleotide binding|RNA binding			ovary(1)	1														0.130952	15.917526	26.999192	11	73	KEEP	---	---	---	---	capture		Silent	SNP	3273914	3273914	3352	19	C	T	T	T	340	27	CELF5	1	1
SIPA1L3	23094	broad.mit.edu	37	19	38600929	38600929	+	Silent	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:38600929G>A	uc002ohk.2	+	c.2196G>A	c.(2194-2196)GCG>GCA	p.A732A		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	732	Rap-GAP.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)											0.111111	5.955696	16.720204	8	64	KEEP	---	---	---	---	capture		Silent	SNP	38600929	38600929	14826	19	G	A	A	A	483	38	SIPA1L3	1	1
RINL	126432	broad.mit.edu	37	19	39359959	39359959	+	Silent	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:39359959G>A	uc010xuo.1	-	c.1566C>T	c.(1564-1566)TCC>TCT	p.S522S	RINL_uc002ojr.1_Silent_p.S43S|RINL_uc002ojq.2_Silent_p.S408S	NM_198445	NP_940847	Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	408							GTPase activator activity			pancreas(1)	1														0.258824	55.224429	59.694855	22	63	KEEP	---	---	---	---	capture		Silent	SNP	39359959	39359959	13852	19	G	A	A	A	496	39	RINL	1	1
SUPT5H	6829	broad.mit.edu	37	19	39963500	39963501	+	Missense_Mutation	DNP	AG	TT	TT			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:39963500_39963501AG>TT	uc002olo.3	+	c.2086_2087AG>TT	c.(2086-2088)AGG>TTG	p.R696L	SUPT5H_uc002olp.3_Missense_Mutation_p.R696L|SUPT5H_uc002olq.3_Missense_Mutation_p.R692L|SUPT5H_uc002oln.3_Missense_Mutation_p.R696L|SUPT5H_uc002olr.3_Missense_Mutation_p.R696L|SUPT5H_uc002ols.1_Missense_Mutation_p.R319L|SUPT5H_uc010egp.1_Missense_Mutation_p.R62L	NM_001111020	NP_001104490	O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog isoform a	696				R->K: Increases promoter association and enhances transcriptional elongation; when associated with K-681 and K-698.|R->A: Enhances interactions with CDK9 and RNA polymerase II and enhances transcriptional elongation; when associated with A-681 and A-698.	cell cycle|chromatin remodeling|mRNA capping|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription elongation from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|response to organic substance|retroviral genome replication|transcription elongation from RNA polymerase II promoter	nucleoplasm	enzyme binding|negative transcription elongation factor activity|positive transcription elongation factor activity|protein heterodimerization activity			ovary(3)|pancreas(1)	4	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)											0.192308	11.359959	13.65866	5	21	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	39963500	39963501	15919	19	AG	TT	TT	TT	88	7	SUPT5H	3	3
GPR4	2828	broad.mit.edu	37	19	46094525	46094525	+	Silent	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:46094525C>A	uc002pcm.2	-	c.600G>T	c.(598-600)TCG>TCT	p.S200S	OPA3_uc010xxk.1_Intron	NM_005282	NP_005273	P46093	GPR4_HUMAN	G protein-coupled receptor 4	200	Helical; Name=5; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		Esophageal Squamous(117;181 1612 1673 14956 42937)								0.113636	6.350315	12.822844	5	39	KEEP	---	---	---	---	capture		Silent	SNP	46094525	46094525	6969	19	C	A	A	A	236	19	GPR4	1	1
EML2	24139	broad.mit.edu	37	19	46124786	46124786	+	Silent	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:46124786C>A	uc010xxm.1	-	c.1554G>T	c.(1552-1554)CGG>CGT	p.R518R	EML2_uc002pcn.2_Silent_p.R317R|EML2_uc002pco.2_Non-coding_Transcript|EML2_uc002pcp.2_Silent_p.R201R|EML2_uc010xxl.1_Silent_p.R464R|EML2_uc010xxn.1_Non-coding_Transcript|EML2_uc010xxo.1_Silent_p.R317R|EML2_uc010ekj.2_Missense_Mutation_p.G284V	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like	317	WD 5.				sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)										0.270833	28.540558	30.825767	13	35	KEEP	---	---	---	---	capture		Silent	SNP	46124786	46124786	5289	19	C	A	A	A	275	22	EML2	2	2
ACPT	93650	broad.mit.edu	37	19	51298092	51298092	+	Silent	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:51298092C>T	uc002pta.1	+	c.1036C>T	c.(1036-1038)CTG>TTG	p.L346L		NM_033068	NP_149059	Q9BZG2	PPAT_HUMAN	testicular acid phosphatase precursor	346	Extracellular (Potential).					integral to membrane	acid phosphatase activity				0		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)										0.130682	34.248465	57.729888	23	153	KEEP	---	---	---	---	capture		Silent	SNP	51298092	51298092	169	19	C	T	T	T	311	24	ACPT	2	2
CD33	945	broad.mit.edu	37	19	51728785	51728785	+	Missense_Mutation	SNP	T	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:51728785T>G	uc002pwa.2	+	c.349T>G	c.(349-351)TTC>GTC	p.F117V	CD33_uc010eos.1_Missense_Mutation_p.F117V|CD33_uc010eot.1_Intron|CD33_uc010eou.1_5'Flank	NM_001772	NP_001763	P20138	CD33_HUMAN	CD33 antigen isoform 1 precursor	117	Extracellular (Potential).|Ig-like V-type.				cell adhesion|cell-cell signaling|negative regulation of cell proliferation	integral to plasma membrane	receptor activity|sugar binding				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)									0.095238	0.796211	11.174751	6	57	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	51728785	51728785	3133	19	T	G	G	G	728	56	CD33	4	4
LILRB2	10288	broad.mit.edu	37	19	54780244	54780244	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:54780244A>T	uc002qfb.2	-	c.1550T>A	c.(1549-1551)CTG>CAG	p.L517Q	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Intron|LILRB2_uc010erj.2_Non-coding_Transcript|LILRB2_uc002qfc.2_Missense_Mutation_p.L516Q|LILRB2_uc010yet.1_Missense_Mutation_p.L401Q	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	517	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)										0.114754	7.490192	16.406492	7	54	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	54780244	54780244	9117	19	A	T	T	T	91	7	LILRB2	3	3
NLRP9	338321	broad.mit.edu	37	19	56244334	56244334	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:56244334C>T	uc002qly.2	-	c.863G>A	c.(862-864)CGG>CAG	p.R288Q		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	288	NACHT.					cytoplasm	ATP binding			ovary(2)|skin(2)|breast(1)	5		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)										0.16129	20.33116	27.081214	10	52	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	56244334	56244334	10887	19	C	T	T	T	299	23	NLRP9	1	1
OR7E24	26648	broad.mit.edu	37	19	9361871	9361872	+	Nonsense_Mutation	DNP	CC	AA	AA			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:9361871_9361872CC>AA	uc002mlb.1	+	c.152_153CC>AA	c.(151-153)TCC>TAA	p.S51*		NM_001079935	NP_001073404	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E,	51	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.219512	20.752295	23.72416	9	32	KEEP	---	---	---	---	capture		Nonsense_Mutation	DNP	9361871	9361872	11632	19	CC	AA	AA	AA	390	30	OR7E24	5	2
DENND2D	79961	broad.mit.edu	37	1	111731363	111731363	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:111731363T>A	uc001eak.1	-	c.1060A>T	c.(1060-1062)ATC>TTC	p.I354F	DENND2D_uc001eal.1_Missense_Mutation_p.I351F	NM_024901	NP_079177	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	354										ovary(1)	1		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)										0.128079	40.181842	67.653907	26	177	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	111731363	111731363	4610	1	T	A	A	A	663	51	DENND2D	3	3
CASQ2	845	broad.mit.edu	37	1	116243867	116243867	+	Nonsense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:116243867C>A	uc001efx.3	-	c.1195G>T	c.(1195-1197)GAA>TAA	p.E399*	CASQ2_uc010owu.1_Nonsense_Mutation_p.E328*	NM_001232	NP_001223	O14958	CASQ2_HUMAN	cardiac calsequestrin 2 precursor	399	Asp/Glu-rich (acidic).				heart development|striated muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding				0	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)										0.186047	10.476289	14.613307	8	35	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	116243867	116243867	2800	1	C	A	A	A	377	29	CASQ2	5	2
VPS13D	55187	broad.mit.edu	37	1	12343685	12343685	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:12343685C>G	uc001atv.2	+	c.5526C>G	c.(5524-5526)CAC>CAG	p.H1842Q	VPS13D_uc001atw.2_Missense_Mutation_p.H1842Q|VPS13D_uc001atx.2_Missense_Mutation_p.H1030Q	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	1842					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)										0.147727	21.033423	31.545265	13	75	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	12343685	12343685	17759	1	C	G	G	G	246	19	VPS13D	3	3
NBPF14	25832	broad.mit.edu	37	1	148012569	148012569	+	Nonsense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:148012569G>A	uc001eqq.2	-	c.1390C>T	c.(1390-1392)CAG>TAG	p.Q464*	LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqf.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Nonsense_Mutation_p.Q375*|NBPF14_uc010pae.1_Nonsense_Mutation_p.Q131*|NBPF14_uc010paf.1_Nonsense_Mutation_p.Q619*|NBPF14_uc010pad.1_5'Flank|NBPF14_uc001eqs.1_Intron	NM_015383	NP_056198	Q5TI25	NBPFE_HUMAN	hypothetical protein LOC25832	464	NBPF 5.					cytoplasm				ovary(1)	1	all_hematologic(923;0.032)													0.02799	-77.306278	19.196904	11	382	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	148012569	148012569	10591	1	G	A	A	A	611	47	NBPF14	5	2
TTC24	164118	broad.mit.edu	37	1	156552882	156552882	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:156552882C>T	uc009wsc.1	+	c.119C>T	c.(118-120)GCC>GTC	p.A40V		NM_001105669	NP_001099139	A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	320	TPR 7.						binding			pancreas(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)													0.235294	17.983589	20.162774	8	26	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	156552882	156552882	17246	1	C	T	T	T	338	26	TTC24	2	2
ATP1A2	477	broad.mit.edu	37	1	160106081	160106081	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:160106081C>G	uc001fvc.2	+	c.2484C>G	c.(2482-2484)ATC>ATG	p.I828M	ATP1A2_uc001fvb.2_Missense_Mutation_p.I828M|ATP1A2_uc001fvd.2_Missense_Mutation_p.I564M	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein	828	Cytoplasmic (Potential).				ATP biosynthetic process	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|central_nervous_system(2)	4	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)											0.164557	27.030906	35.465965	13	66	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	160106081	160106081	1148	1	C	G	G	G	369	29	ATP1A2	3	3
HSPA6	3310	broad.mit.edu	37	1	161495342	161495342	+	Silent	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:161495342C>T	uc001gap.2	+	c.894C>T	c.(892-894)TCC>TCT	p.S298S	HSPA6_uc001gaq.2_Silent_p.S298S	NM_002155	NP_002146	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	298					response to unfolded protein		ATP binding			skin(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)											0.12	3.207958	6.749843	3	22	KEEP	---	---	---	---	capture		Silent	SNP	161495342	161495342	7714	1	C	T	T	T	262	21	HSPA6	2	2
RXRG	6258	broad.mit.edu	37	1	165397965	165397965	+	Silent	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:165397965G>T	uc001gda.2	-	c.288C>A	c.(286-288)CCC>CCA	p.P96P		NM_006917	NP_008848	P48443	RXRG_HUMAN	retinoid X receptor, gamma isoform a	96	Modulating (By similarity).				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)									0.083333	0.796651	7.148427	3	33	KEEP	---	---	---	---	capture		Silent	SNP	165397965	165397965	14245	1	G	T	T	T	600	47	RXRG	2	2
TNR	7143	broad.mit.edu	37	1	175355195	175355195	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:175355195C>A	uc001gkp.1	-	c.1750G>T	c.(1750-1752)GAT>TAT	p.D584Y	TNR_uc009wwu.1_Missense_Mutation_p.D584Y	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	584	Fibronectin type-III 3.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)													0.322581	80.212199	82.814577	30	63	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	175355195	175355195	16879	1	C	A	A	A	403	31	TNR	1	1
PAPPA2	60676	broad.mit.edu	37	1	176659389	176659389	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:176659389G>C	uc001gkz.2	+	c.2254G>C	c.(2254-2256)GAA>CAA	p.E752Q	PAPPA2_uc001gky.1_Missense_Mutation_p.E752Q|PAPPA2_uc009www.2_Non-coding_Transcript	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	752	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|lung(1)|breast(1)	14														0.108844	13.640663	35.907498	16	131	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	176659389	176659389	11850	1	G	C	C	C	429	33	PAPPA2	3	3
FAM5B	57795	broad.mit.edu	37	1	177247895	177247895	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:177247895G>T	uc001glf.2	+	c.1209G>T	c.(1207-1209)CAG>CAT	p.Q403H	FAM5B_uc010pna.1_Missense_Mutation_p.Q153H|FAM5B_uc001glg.2_Missense_Mutation_p.Q298H	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	403						extracellular region				ovary(2)	2														0.139241	-4.149633	6.32583	11	68	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	177247895	177247895	5816	1	G	T	T	T	438	34	FAM5B	2	2
PTPN14	5784	broad.mit.edu	37	1	214638034	214638034	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:214638034G>C	uc001hkk.1	-	c.113C>G	c.(112-114)TCG>TGG	p.S38W	PTPN14_uc010pty.1_Intron	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type	38	FERM.					cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		Colon(92;557 1424 24372 34121 40073)								0.2	22.063565	25.819332	9	36	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	214638034	214638034	13238	1	G	C	C	C	481	37	PTPN14	3	3
FMN2	56776	broad.mit.edu	37	1	240370528	240370528	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:240370528A>T	uc010pye.1	+	c.2428A>T	c.(2428-2430)AGC>TGC	p.S810C	FMN2_uc010pyd.1_Missense_Mutation_p.S806C	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	806	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|large_intestine(1)|central_nervous_system(1)	9	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)							1289				0.258065	37.258468	40.558872	16	46	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	240370528	240370528	6192	1	A	T	T	T	143	11	FMN2	3	3
SCCPDH	51097	broad.mit.edu	37	1	246930495	246930495	+	Splice_Site_SNP	SNP	A	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:246930495A>G	uc001ibr.2	+	c.1185_splice	c.e12-2	p.A395_splice		NM_016002	NP_057086			saccharopine dehydrogenase (putative)						oxidation-reduction process	midbody	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity			ovary(1)	1	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)										0.137931	8.007983	11.660988	4	25	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	246930495	246930495	14366	1	A	G	G	G	195	15	SCCPDH	5	4
OR14A16	284532	broad.mit.edu	37	1	247978955	247978955	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:247978955G>A	uc001idm.1	-	c.77C>T	c.(76-78)TCG>TTG	p.S26L		NM_001001966	NP_001001966	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A,	26	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						Ovarian(112;180 1586 15073 21914 33526)								0.075	-0.405321	7.005893	3	37	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	247978955	247978955	11351	1	G	A	A	A	481	37	OR14A16	1	1
OR2AK2	391191	broad.mit.edu	37	1	248129110	248129110	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:248129110G>T	uc010pzd.1	+	c.477G>T	c.(475-477)ATG>ATT	p.M159I	OR2L13_uc001ids.2_Intron	NM_001004491	NP_001004491	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK,	159	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			Melanoma(45;390 1181 23848 28461 41504)								0.133971	42.98631	70.125868	28	181	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	248129110	248129110	11392	1	G	T	T	T	611	47	OR2AK2	2	2
OR2L13	284521	broad.mit.edu	37	1	248263034	248263034	+	Silent	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:248263034C>T	uc001ids.2	+	c.357C>T	c.(355-357)TAC>TAT	p.Y119Y		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	119	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)							85				0.150685	51.537181	77.112403	33	186	KEEP	---	---	---	---	capture		Silent	SNP	248263034	248263034	11412	1	C	T	T	T	246	19	OR2L13	1	1
OR2T34	127068	broad.mit.edu	37	1	248737762	248737762	+	Silent	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:248737762C>T	uc001iep.1	-	c.297G>A	c.(295-297)CCG>CCA	p.P99P		NM_001001821	NP_001001821	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T,	99	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)											0.055556	-4.851789	6.307188	3	51	KEEP	---	---	---	---	capture		Silent	SNP	248737762	248737762	11431	1	C	T	T	T	236	19	OR2T34	1	1
KCNQ4	9132	broad.mit.edu	37	1	41284241	41284241	+	Silent	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:41284241C>T	uc001cgh.1	+	c.597C>T	c.(595-597)GCC>GCT	p.A199A	KCNQ4_uc001cgi.1_Silent_p.A199A	NM_004700	NP_004691	P56696	KCNQ4_HUMAN	potassium voltage-gated channel KQT-like protein	199	Extracellular.				sensory perception of sound	basal plasma membrane|voltage-gated potassium channel complex				central_nervous_system(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)											0.078947	-0.402628	6.476237	3	35	KEEP	---	---	---	---	capture		Silent	SNP	41284241	41284241	8390	1	C	T	T	T	262	21	KCNQ4	2	2
FAAH	2166	broad.mit.edu	37	1	46874210	46874210	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:46874210G>A	uc001cpu.2	+	c.1031G>A	c.(1030-1032)CGG>CAG	p.R344Q	FAAH_uc001cpv.2_Non-coding_Transcript	NM_001441	NP_001432	O00519	FAAH1_HUMAN	fatty acid amide hydrolase	344	Cytoplasmic (By similarity).				fatty acid catabolic process	cytoplasm|cytoskeleton|endomembrane system|integral to membrane|organelle membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|fatty acid amide hydrolase activity			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)									0.207843	126.674188	146.807837	53	202	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	46874210	46874210	5550	1	G	A	A	A	507	39	FAAH	1	1
C1orf141	400757	broad.mit.edu	37	1	67559199	67559199	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:67559199G>T	uc001ddl.1	-	c.692C>A	c.(691-693)CCT>CAT	p.P231H	C1orf141_uc001ddm.1_Missense_Mutation_p.P231H|C1orf141_uc001ddn.1_Non-coding_Transcript	NM_001013674	NP_001013696	Q5JVX7	CA141_HUMAN	hypothetical protein LOC400757	231										ovary(1)	1														0.113636	5.241063	11.72244	5	39	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	67559199	67559199	2068	1	G	T	T	T	455	35	C1orf141	2	2
BRDT	676	broad.mit.edu	37	1	92470776	92470776	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:92470776C>A	uc010osz.1	+	c.2707C>A	c.(2707-2709)CAA>AAA	p.Q903K	BRDT_uc001dok.3_Missense_Mutation_p.Q899K|BRDT_uc001dol.3_Missense_Mutation_p.Q899K|BRDT_uc009wdf.2_Missense_Mutation_p.Q826K|BRDT_uc010ota.1_Missense_Mutation_p.Q853K|BRDT_uc010otb.1_Missense_Mutation_p.Q853K|BRDT_uc001dom.3_Missense_Mutation_p.Q899K	NM_207189	NP_997072	Q58F21	BRDT_HUMAN	testis-specific bromodomain protein	899					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(1)|ovary(1)|lung(1)	3		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)						576				0.155556	25.103395	35.292876	14	76	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	92470776	92470776	1539	1	C	A	A	A	377	29	BRDT	2	2
ABCD3	5825	broad.mit.edu	37	1	94933552	94933552	+	Silent	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:94933552A>T	uc010oto.1	+	c.396A>T	c.(394-396)ACA>ACT	p.T132T	ABCD3_uc001dqm.3_Silent_p.T108T|ABCD3_uc001dqn.3_Silent_p.T108T|ABCD3_uc010otp.1_Silent_p.T35T|ABCD3_uc009wdr.2_Silent_p.T108T	NM_002858	NP_002849	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D, member 3	108	ABC transmembrane type-1.|Targeting to peroxisomes.|Interaction with PEX19.				peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)										0.097561	3.370075	10.017836	4	37	KEEP	---	---	---	---	capture		Silent	SNP	94933552	94933552	63	1	A	T	T	T	67	6	ABCD3	3	3
RIMS4	140730	broad.mit.edu	37	20	43386385	43386385	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:43386385C>T	uc010ggu.2	-	c.380G>A	c.(379-381)CGG>CAG	p.R127Q	RIMS4_uc002xms.2_Missense_Mutation_p.R126Q	NM_182970	NP_892015	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	126	C2.				exocytosis|neurotransmitter transport	cell junction|synapse				ovary(4)|central_nervous_system(1)	5		Myeloproliferative disorder(115;0.0122)												0.190476	35.468438	42.97828	16	68	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43386385	43386385	13847	20	C	T	T	T	299	23	RIMS4	1	1
SEMG2	6407	broad.mit.edu	37	20	43835719	43835719	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:43835719C>T	uc010ggz.2	+	c.25C>T	c.(25-27)CTT>TTT	p.L9F	SEMG1_uc002xni.2_Missense_Mutation_p.L9F|SEMG1_uc002xnj.2_Missense_Mutation_p.L9F|SEMG1_uc002xnh.2_Missense_Mutation_p.L9F	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor	9					sexual reproduction	extracellular space|stored secretory granule	structural molecule activity				0		Myeloproliferative disorder(115;0.0122)												0.15493	19.997289	28.06249	11	60	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43835719	43835719	14531	20	C	T	T	T	260	20	SEMG2	2	2
ZFP64	55734	broad.mit.edu	37	20	50769536	50769536	+	Nonsense_Mutation	SNP	T	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:50769536T>A	uc002xwl.2	-	c.1195A>T	c.(1195-1197)AAG>TAG	p.K399*	ZFP64_uc002xwk.2_Intron|ZFP64_uc002xwm.2_Nonsense_Mutation_p.K397*|ZFP64_uc002xwn.2_Nonsense_Mutation_p.K345*	NM_018197	NP_060667	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform a	399					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1														0.17757	33.847539	44.359728	19	88	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	50769536	50769536	18241	20	T	A	A	A	793	61	ZFP64	5	3
CASS4	57091	broad.mit.edu	37	20	55027579	55027579	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:55027579C>A	uc002xxp.2	+	c.1347C>A	c.(1345-1347)CAC>CAA	p.H449Q	CASS4_uc002xxq.3_Missense_Mutation_p.H449Q|CASS4_uc002xxr.2_Missense_Mutation_p.H449Q|CASS4_uc010zze.1_Missense_Mutation_p.H395Q|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	449					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)	2														0.208333	13.261818	15.152184	5	19	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55027579	55027579	2802	20	C	A	A	A	220	17	CASS4	2	2
PPDPF	79144	broad.mit.edu	37	20	62153051	62153051	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:62153051G>T	uc002yff.2	+	c.164G>T	c.(163-165)TGG>TTG	p.W55L		NM_024299	NP_077275	Q9H3Y8	PPDPF_HUMAN	pancreatic progenitor cell differentiation and	55					cell differentiation|multicellular organismal development						0														0.163636	15.64177	21.560598	9	46	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	62153051	62153051	12736	20	G	T	T	T	611	47	PPDPF	2	2
TIAM1	7074	broad.mit.edu	37	21	32617938	32617938	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:32617938C>A	uc002yow.1	-	c.1450G>T	c.(1450-1452)GGG>TGG	p.G484W	TIAM1_uc011adk.1_Missense_Mutation_p.G484W|TIAM1_uc011adl.1_Missense_Mutation_p.G484W|TIAM1_uc002yox.1_Missense_Mutation_p.G92W	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	484	PH 1.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|lung(1)	5										780				0.1	2.106105	6.898249	3	27	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32617938	32617938	16418	21	C	A	A	A	273	21	TIAM1	2	2
PCNT	5116	broad.mit.edu	37	21	47746331	47746331	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:47746331C>G	uc002zji.3	+	c.95C>G	c.(94-96)TCG>TGG	p.S32W	PCNT_uc002zjj.2_5'UTR|C21orf58_uc011afx.1_5'Flank|C21orf58_uc002zjf.2_5'Flank|C21orf58_uc010gqj.1_5'Flank|C21orf58_uc002zjg.1_5'Flank	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	32					cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)													0.157895	11.817315	16.076099	6	32	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	47746331	47746331	12010	21	C	G	G	G	403	31	PCNT	3	3
GNAZ	2781	broad.mit.edu	37	22	23438412	23438412	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:23438412G>C	uc002zwu.1	+	c.530G>C	c.(529-531)CGC>CCC	p.R177P	RTDR1_uc002zwt.2_Intron	NM_002073	NP_002064	P19086	GNAZ_HUMAN	guanine nucleotide binding protein, alpha z	177						endoplasmic reticulum|heterotrimeric G-protein complex|nuclear envelope	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|metabotropic serotonin receptor binding|receptor signaling protein activity			kidney(1)	1	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)										0.246154	43.395408	47.124026	16	49	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	23438412	23438412	6783	22	G	C	C	C	494	38	GNAZ	3	3
C22orf43	51233	broad.mit.edu	37	22	23964346	23964346	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:23964346G>T	uc002zxf.2	-	c.316C>A	c.(316-318)CTG>ATG	p.L106M		NM_016449	NP_057533	Q6PGQ1	CV043_HUMAN	hypothetical protein LOC51233	106											0														0.150943	14.262671	20.451688	8	45	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	23964346	23964346	2232	22	G	T	T	T	451	35	C22orf43	2	2
SEZ6L	23544	broad.mit.edu	37	22	26688407	26688407	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:26688407C>G	uc003acb.2	+	c.130C>G	c.(130-132)CCT>GCT	p.P44A	SEZ6L_uc003acc.2_Missense_Mutation_p.P44A|SEZ6L_uc011akc.1_Missense_Mutation_p.P44A|SEZ6L_uc003acd.2_Missense_Mutation_p.P44A|SEZ6L_uc011akd.1_Missense_Mutation_p.P44A|SEZ6L_uc003ace.2_Missense_Mutation_p.P44A|SEZ6L_uc003acf.1_5'UTR|SEZ6L_uc010gvc.1_5'UTR	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	44	Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6														0.113636	5.146806	11.623899	5	39	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	26688407	26688407	14632	22	C	G	G	G	390	30	SEZ6L	3	3
SEZ6L	23544	broad.mit.edu	37	22	26743796	26743796	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:26743796C>A	uc003acb.2	+	c.2324C>A	c.(2323-2325)CCC>CAC	p.P775H	SEZ6L_uc003acc.2_Missense_Mutation_p.P775H|SEZ6L_uc011akc.1_Missense_Mutation_p.P775H|SEZ6L_uc003acd.2_Missense_Mutation_p.P775H|SEZ6L_uc011akd.1_Missense_Mutation_p.P775H|SEZ6L_uc003ace.2_Missense_Mutation_p.P775H|SEZ6L_uc003acf.1_Missense_Mutation_p.P548H|SEZ6L_uc010gvc.1_Missense_Mutation_p.P548H|SEZ6L_uc011ake.1_Non-coding_Transcript	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	775	Sushi 3.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6														0.215686	24.146552	27.918845	11	40	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	26743796	26743796	14632	22	C	A	A	A	286	22	SEZ6L	2	2
C22orf28	51493	broad.mit.edu	37	22	32783990	32783990	+	Missense_Mutation	SNP	T	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:32783990T>A	uc003amm.2	-	c.1507A>T	c.(1507-1509)ATC>TTC	p.I503F		NM_014306	NP_055121	Q9Y3I0	RTCB_HUMAN	hypothetical protein LOC51493	503					cell-matrix adhesion|substrate adhesion-dependent cell spreading|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|tRNA-splicing ligase complex	ATP binding|metal ion binding|RNA ligase (ATP) activity|vinculin binding				0														0.209302	20.050413	23.548994	9	34	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32783990	32783990	2221	22	T	A	A	A	650	50	C22orf28	3	3
XIRP2	129446	broad.mit.edu	37	2	168102285	168102286	+	Missense_Mutation	DNP	GG	TT	TT			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:168102285_168102286GG>TT	uc002udx.2	+	c.4383_4384GG>TT	c.(4381-4386)ATGGAT>ATTTAT	p.1461_1462MD>IY	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.1286_1287MD>IY|XIRP2_uc010fpq.2_Missense_Mutation_p.1239_1240MD>IY|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1286_1287	Xin 26.				actin cytoskeleton organization	cell junction	actin binding			ovary(6)|pancreas(1)|skin(1)	8														0.069767	-1.60638	6.609075	3	40	KEEP	---	---	---	---	capture		Missense_Mutation	DNP	168102285	168102286	18011	2	GG	TT	TT	TT	611	47	XIRP2	2	2
HECW2	57520	broad.mit.edu	37	2	197297866	197297866	+	Silent	SNP	A	C	C			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:197297866A>C	uc002utm.1	-	c.282T>G	c.(280-282)CTT>CTG	p.L94L		NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	94					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			ovary(5)|pancreas(1)|kidney(1)|central_nervous_system(1)|skin(1)	9														0.25	30.538545	33.015073	11	33	KEEP	---	---	---	---	capture		Silent	SNP	197297866	197297866	7326	2	A	C	C	C	2	1	HECW2	4	4
SATB2	23314	broad.mit.edu	37	2	200245208	200245208	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:200245208C>A	uc002uuy.1	-	c.476G>T	c.(475-477)TGT>TTT	p.C159F	SATB2_uc010fsq.1_Intron|SATB2_uc002uuz.1_Missense_Mutation_p.C159F|SATB2_uc002uva.1_Missense_Mutation_p.C159F	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	159						cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						Colon(30;262 767 11040 24421 36230)								0.108696	5.661681	12.622248	5	41	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	200245208	200245208	14335	2	C	A	A	A	221	17	SATB2	2	2
PRKAG3	53632	broad.mit.edu	37	2	219689061	219689061	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:219689061G>T	uc002vjb.1	-	c.1237C>A	c.(1237-1239)CTG>ATG	p.L413M		NM_017431	NP_059127	Q9UGI9	AAKG3_HUMAN	AMP-activated protein kinase, non-catalytic	413	CBS 3.				cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|intracellular protein kinase cascade|regulation of fatty acid oxidation	cytosol	AMP-activated protein kinase activity|protein kinase binding			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.173913	14.269356	18.889583	8	38	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	219689061	219689061	12945	2	G	T	T	T	451	35	PRKAG3	2	2
DNER	92737	broad.mit.edu	37	2	230231656	230231656	+	Nonsense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:230231656C>A	uc002vpv.2	-	c.2035G>T	c.(2035-2037)GAG>TAG	p.E679*		NM_139072	NP_620711	Q8NFT8	DNER_HUMAN	delta-notch-like EGF repeat-containing	679	Cytoplasmic (Potential).|Interaction with AP1G1 and somatodendritic targeting (By similarity).				central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity			ovary(1)	1		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)										0.181818	15.516236	19.592569	8	36	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	230231656	230231656	4850	2	C	A	A	A	390	30	DNER	5	2
INPP5D	3635	broad.mit.edu	37	2	233925275	233925275	+	Silent	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:233925275C>A	uc010zmo.1	+	c.87C>A	c.(85-87)CTC>CTA	p.L29L	INPP5D_uc010zmp.1_Silent_p.L29L	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN	SH2 containing inositol phosphatase isoform a	29	SH2.				apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		NSCLC(82;1215 1426 16163 20348 41018)				816				0.216216	15.977999	18.729766	8	29	KEEP	---	---	---	---	capture		Silent	SNP	233925275	233925275	8057	2	C	A	A	A	392	31	INPP5D	1	1
AQP12B	653437	broad.mit.edu	37	2	241621967	241621967	+	Silent	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:241621967C>A	uc010fzj.2	-	c.288G>T	c.(286-288)GTG>GTT	p.V96V	AQP12B_uc002vzt.2_Intron	NM_001102467	NP_001095937	A6NM10	AQ12B_HUMAN	aquaporin 12B	84						integral to membrane	transporter activity				0		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)										0.349206	58.924984	60.191646	22	41	KEEP	---	---	---	---	capture		Silent	SNP	241621967	241621967	836	2	C	A	A	A	210	17	AQP12B	2	2
ANO7	50636	broad.mit.edu	37	2	242149716	242149716	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:242149716G>T	uc002wax.2	+	c.1528G>T	c.(1528-1530)GTG>TTG	p.V510L		NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN	transmembrane protein 16G isoform NGEP long	510	Helical; (Potential).					cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3														0.262295	44.980907	48.093263	16	45	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	242149716	242149716	710	2	G	T	T	T	520	40	ANO7	1	1
MSH6	2956	broad.mit.edu	37	2	48033416	48033416	+	Silent	SNP	A	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:48033416A>G	uc002rwd.3	+	c.3720A>G	c.(3718-3720)AAA>AAG	p.K1240K	MSH6_uc010fbj.2_Silent_p.K938K|MSH6_uc010yoi.1_Silent_p.K1110K|MSH6_uc010yoj.1_Silent_p.K938K	NM_000179	NP_000170	P52701	MSH6_HUMAN	mutS homolog 6	1240					determination of adult lifespan|DNA damage response, signal transduction resulting in induction of apoptosis|isotype switching|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|response to UV|somatic hypermutation of immunoglobulin genes	MutSalpha complex	ATP binding|DNA-dependent ATPase activity|protein binding			large_intestine(53)|endometrium(28)|central_nervous_system(27)|stomach(21)|haematopoietic_and_lymphoid_tissue(9)|skin(6)|urinary_tract(5)|lung(5)|ovary(3)|breast(2)|thyroid(1)	160		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)							517				0.15493	20.183804	28.288652	11	60	KEEP	---	---	---	---	capture		Silent	SNP	48033416	48033416	10267	2	A	G	G	G	50	4	MSH6	4	4
BCL11A	53335	broad.mit.edu	37	2	60689438	60689438	+	Silent	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:60689438G>A	uc002sae.1	-	c.609C>T	c.(607-609)CAC>CAT	p.H203H	BCL11A_uc002sab.2_Silent_p.H203H|BCL11A_uc002sac.2_Silent_p.H203H|BCL11A_uc010ypi.1_Silent_p.H51H|BCL11A_uc010ypj.1_Silent_p.H169H|BCL11A_uc002sad.1_Silent_p.H51H|BCL11A_uc002saf.1_Silent_p.H169H	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	203	Required for nuclear body formation and for SUMO1 recruitment (By similarity).				protein sumoylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)							131				0.125	7.820429	14.411898	6	42	KEEP	---	---	---	---	capture		Silent	SNP	60689438	60689438	1384	2	G	A	A	A	516	40	BCL11A	1	1
CCDC142	84865	broad.mit.edu	37	2	74708198	74708198	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:74708198G>A	uc002slr.2	-	c.1274C>T	c.(1273-1275)GCC>GTC	p.A425V	TTC31_uc002sls.2_5'Flank|TTC31_uc010yrv.1_5'Flank|TTC31_uc002slt.2_5'Flank|TTC31_uc002slu.2_5'Flank|CCDC142_uc002slo.2_Non-coding_Transcript|CCDC142_uc002slq.2_Intron|CCDC142_uc002slp.2_Missense_Mutation_p.A425V	NM_032779	NP_116168	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	425										central_nervous_system(1)	1														0.231884	35.676177	40.212048	16	53	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	74708198	74708198	2896	2	G	A	A	A	534	42	CCDC142	2	2
GPR128	84873	broad.mit.edu	37	3	100373949	100373949	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:100373949G>T	uc003duc.2	+	c.1650G>T	c.(1648-1650)CAG>CAT	p.Q550H	GPR128_uc011bhc.1_Missense_Mutation_p.Q251H|GPR128_uc003dud.2_Missense_Mutation_p.Q73H	NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor	550	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3						Pancreas(87;185 1975 7223 18722)								0.177966	43.994224	55.446061	21	97	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	100373949	100373949	6915	3	G	T	T	T	438	34	GPR128	2	2
IMPG2	50939	broad.mit.edu	37	3	100961629	100961629	+	Silent	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:100961629G>A	uc003duq.1	-	c.2925C>T	c.(2923-2925)GTC>GTT	p.V975V	IMPG2_uc011bhe.1_Silent_p.V838V	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	975	Extracellular (Potential).|SEA 2.				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3														0.20339	53.631215	63.274242	24	94	KEEP	---	---	---	---	capture		Silent	SNP	100961629	100961629	8030	3	G	A	A	A	574	45	IMPG2	2	2
POLQ	10721	broad.mit.edu	37	3	121207346	121207346	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:121207346C>A	uc003eee.3	-	c.4432G>T	c.(4432-4434)GTT>TTT	p.V1478F	POLQ_uc003eed.2_Missense_Mutation_p.V650F	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	1478					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity			ovary(4)|skin(1)	5				GBM - Glioblastoma multiforme(114;0.0915)		Pancreas(152;907 1925 26081 31236 36904)								0.19403	28.947198	34.791379	13	54	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	121207346	121207346	12636	3	C	A	A	A	260	20	POLQ	2	2
CASR	846	broad.mit.edu	37	3	121981079	121981079	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:121981079G>C	uc003eew.3	+	c.1197G>C	c.(1195-1197)GAG>GAC	p.E399D	CASR_uc003eev.3_Missense_Mutation_p.E399D	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	399	Extracellular (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)									0.147541	13.449208	20.722514	9	52	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	121981079	121981079	2801	3	G	C	C	C	425	33	CASR	3	3
EEFSEC	60678	broad.mit.edu	37	3	128060612	128060612	+	Silent	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:128060612G>A	uc003eki.2	+	c.1323G>A	c.(1321-1323)ACG>ACA	p.T441T	EEFSEC_uc003ekj.2_Silent_p.T386T	NM_021937	NP_068756	P57772	SELB_HUMAN	eukaryotic elongation factor,	441						cytoplasm|nucleus	GTP binding|GTPase activity|translation elongation factor activity			ovary(1)	1														0.228571	36.667879	41.396292	16	54	KEEP	---	---	---	---	capture		Silent	SNP	128060612	128060612	5118	3	G	A	A	A	509	40	EEFSEC	1	1
ZIC4	84107	broad.mit.edu	37	3	147108811	147108811	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:147108811G>T	uc011bno.1	-	c.1061C>A	c.(1060-1062)TCT>TAT	p.S354Y	ZIC4_uc003ewc.1_Missense_Mutation_p.S234Y|ZIC4_uc003ewd.1_Missense_Mutation_p.S304Y	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	304						nucleus	DNA binding|zinc ion binding				0														0.338462	55.613973	57.121509	22	43	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	147108811	147108811	18272	3	G	T	T	T	429	33	ZIC4	2	2
IGSF10	285313	broad.mit.edu	37	3	151171189	151171189	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:151171189C>A	uc011bod.1	-	c.698G>T	c.(697-699)TGG>TTG	p.W233L		NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	233	LRRCT.				cell differentiation|multicellular organismal development|ossification	extracellular region				ovary(4)|central_nervous_system(1)	5			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)											0.273684	65.50655	69.894168	26	69	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	151171189	151171189	7898	3	C	A	A	A	273	21	IGSF10	2	2
BCHE	590	broad.mit.edu	37	3	165548045	165548045	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:165548045C>A	uc003fem.3	-	c.777G>T	c.(775-777)TGG>TGT	p.W259C	BCHE_uc003fen.3_Intron	NM_000055	NP_000046	P06276	CHLE_HUMAN	butyrylcholinesterase precursor	259					acetylcholine catabolic process|choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|cholinesterase activity|enzyme binding			ovary(3)|pancreas(1)	4					Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)									0.131579	14.704235	24.724224	10	66	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	165548045	165548045	1379	3	C	A	A	A	286	22	BCHE	2	2
SPATA16	83893	broad.mit.edu	37	3	172835364	172835364	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:172835364C>A	uc003fin.3	-	c.158G>T	c.(157-159)GGT>GTT	p.G53V		NM_031955	NP_114161	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	53					cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)	2	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)											0.150794	65.666601	95.063977	38	214	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	172835364	172835364	15509	3	C	A	A	A	234	18	SPATA16	2	2
KCNH8	131096	broad.mit.edu	37	3	19479843	19479843	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:19479843G>T	uc003cbk.1	+	c.1365G>T	c.(1363-1365)ATG>ATT	p.M455I	KCNH8_uc011awe.1_Missense_Mutation_p.M455I|KCNH8_uc010hex.1_5'UTR|KCNH8_uc011awf.1_Missense_Mutation_p.M86I	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	455	Helical; Name=Segment S6; (Potential).				regulation of transcription, DNA-dependent	integral to membrane	two-component sensor activity			ovary(1)	1						NSCLC(124;1625 1765 8018 24930 42026)								0.307692	19.972	20.84069	8	18	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	19479843	19479843	8343	3	G	T	T	T	598	46	KCNH8	2	2
SENP5	205564	broad.mit.edu	37	3	196612677	196612677	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:196612677G>T	uc003fwz.3	+	c.625G>T	c.(625-627)GGG>TGG	p.G209W	SENP5_uc011bty.1_Missense_Mutation_p.G209W	NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	209					cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			lung(1)	1	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		Ovarian(47;891 1095 11174 13858 51271)								0.230769	35.631877	39.922045	15	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	196612677	196612677	14535	3	G	T	T	T	611	47	SENP5	2	2
DLG1	1739	broad.mit.edu	37	3	196792237	196792237	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:196792237A>T	uc003fxn.3	-	c.2382T>A	c.(2380-2382)GAT>GAA	p.D794E	DLG1_uc011bub.1_Missense_Mutation_p.D668E|DLG1_uc011buc.1_Missense_Mutation_p.D656E|DLG1_uc011bud.1_Missense_Mutation_p.D455E|DLG1_uc003fxo.3_Missense_Mutation_p.D772E|DLG1_uc011bue.1_Missense_Mutation_p.D760E|DLG1_uc010ial.2_Missense_Mutation_p.D772E	NM_004087	NP_004078	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 2	772	Guanylate kinase-like.				actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)										0.235632	103.799427	114.919909	41	133	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	196792237	196792237	4734	3	A	T	T	T	206	16	DLG1	3	3
SCN5A	6331	broad.mit.edu	37	3	38595835	38595835	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:38595835C>G	uc003cio.2	-	c.4748G>C	c.(4747-4749)CGC>CCC	p.R1583P	SCN5A_uc003cin.2_Missense_Mutation_p.R1582P|SCN5A_uc003cil.3_Missense_Mutation_p.R1583P|SCN5A_uc010hhi.2_Missense_Mutation_p.R1565P|SCN5A_uc010hhk.2_Intron|SCN5A_uc011ayr.1_Missense_Mutation_p.R1529P	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1583					blood circulation|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|central_nervous_system(1)	7	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)									0.056604	-4.207815	6.730147	3	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	38595835	38595835	14404	3	C	G	G	G	351	27	SCN5A	3	3
COL7A1	1294	broad.mit.edu	37	3	48604563	48604563	+	Silent	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:48604563G>T	uc003ctz.2	-	c.8107C>A	c.(8107-8109)CGG>AGG	p.R2703R		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2703	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(2)	9				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)										0.211268	32.465116	37.992505	15	56	KEEP	---	---	---	---	capture		Silent	SNP	48604563	48604563	3842	3	G	T	T	T	493	38	COL7A1	1	1
AIMP1	9255	broad.mit.edu	37	4	107248721	107248721	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:107248721G>T	uc003hyh.2	+	c.295G>T	c.(295-297)GTG>TTG	p.V99L	AIMP1_uc011cfg.1_Missense_Mutation_p.V75L|AIMP1_uc003hyg.2_Missense_Mutation_p.V75L	NM_001142416	NP_001135888	Q12904	AIMP1_HUMAN	small inducible cytokine subfamily E, member 1	75	Interaction with HSP90B1 (By similarity).				angiogenesis|apoptosis|cell adhesion|cell-cell signaling|chemotaxis|glucose metabolic process|inflammatory response|leukocyte migration|negative regulation of endothelial cell proliferation|signal transduction|tRNA aminoacylation for protein translation	aminoacyl-tRNA synthetase multienzyme complex|cytosol|endoplasmic reticulum|extracellular space|Golgi apparatus|nucleus|transport vesicle	cell surface binding|cytokine activity|protein homodimerization activity|tRNA binding				0														0.294118	13.467899	14.11302	5	12	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	107248721	107248721	436	4	G	T	T	T	455	35	AIMP1	2	2
RBM46	166863	broad.mit.edu	37	4	155720082	155720082	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:155720082C>A	uc003ioo.2	+	c.768C>A	c.(766-768)TTC>TTA	p.F256L	RBM46_uc011cim.1_Missense_Mutation_p.F256L|RBM46_uc003iop.1_Missense_Mutation_p.F256L	NM_144979	NP_659416	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	256	RRM 3.						nucleotide binding|RNA binding			central_nervous_system(1)	1	all_hematologic(180;0.24)	Renal(120;0.0854)												0.2	10.959739	13.053292	5	20	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	155720082	155720082	13602	4	C	A	A	A	376	29	RBM46	2	2
CLCN3	1182	broad.mit.edu	37	4	170610315	170610315	+	Silent	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:170610315A>T	uc003ish.2	+	c.540A>T	c.(538-540)ACA>ACT	p.T180T	CLCN3_uc003isi.2_Silent_p.T180T|CLCN3_uc011cjz.1_Silent_p.T163T|CLCN3_uc011cka.1_Silent_p.T180T|CLCN3_uc003isj.1_Silent_p.T153T	NM_173872	NP_776297	P51790	CLCN3_HUMAN	chloride channel 3 isoform e	180					endosomal lumen acidification	cell surface|early endosome membrane|Golgi membrane|integral to membrane|late endosome membrane|transport vesicle membrane	antiporter activity|ATP binding|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|voltage-gated chloride channel activity			breast(2)|ovary(1)	3		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)										0.211538	27.031424	31.006788	11	41	KEEP	---	---	---	---	capture		Silent	SNP	170610315	170610315	3600	4	A	T	T	T	93	8	CLCN3	3	3
VEGFC	7424	broad.mit.edu	37	4	177649058	177649058	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:177649058C>A	uc003ius.1	-	c.426G>T	c.(424-426)AAG>AAT	p.K142N		NM_005429	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	142					angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity			lung(2)	2		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)					p.K142N(HT115-Tumor)	148				0.2	30.179017	36.083039	14	56	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	177649058	177649058	17719	4	C	A	A	A	311	24	VEGFC	2	2
ACSL1	2180	broad.mit.edu	37	4	185705147	185705147	+	Splice_Site_SNP	SNP	T	C	C			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:185705147T>C	uc003iww.2	-	c.311_splice	c.e4-1	p.N104_splice	ACSL1_uc011ckm.1_Splice_Site_SNP|ACSL1_uc003iwt.1_Splice_Site_SNP_p.N104_splice|ACSL1_uc003iwu.1_Splice_Site_SNP_p.N104_splice|ACSL1_uc011ckn.1_Splice_Site_SNP_p.N104_splice|ACSL1_uc003iwv.1_Splice_Site_SNP_p.N104_splice	NM_001995	NP_001986			acyl-CoA synthetase long-chain family member 1						digestion|fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|regulation of fatty acid oxidation|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			ovary(2)	2		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)									0.120879	14.580942	27.400915	11	80	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	185705147	185705147	178	4	T	C	C	C	689	53	ACSL1	5	4
UGT2B10	7365	broad.mit.edu	37	4	69696511	69696511	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:69696511G>T	uc003hee.2	+	c.1501G>T	c.(1501-1503)GCA>TCA	p.A501S	UGT2B10_uc011cam.1_Missense_Mutation_p.A417S	NM_001075	NP_001066	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2B10 isoform 1	501	Helical; (Potential).				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(2)	2						Melanoma(133;755 1763 25578 26334 46021)								0.138614	21.213325	33.93871	14	87	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	69696511	69696511	17514	4	G	T	T	T	546	42	UGT2B10	2	2
PPBP	5473	broad.mit.edu	37	4	74852992	74852992	+	Silent	SNP	A	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:74852992A>G	uc003hhj.2	-	c.384T>C	c.(382-384)GAT>GAC	p.D128D		NM_002704	NP_002695	P02775	CXCL7_HUMAN	pro-platelet basic protein precursor	128					chemotaxis|defense response to bacterium|immune response|platelet activation|platelet degranulation|positive regulation of cell division	extracellular space|platelet alpha granule lumen	chemokine activity|glucose transmembrane transporter activity|growth factor activity			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00136)		all cancers(17;0.00273)|Lung(101;0.196)											0.180556	32.532277	39.438088	13	59	KEEP	---	---	---	---	capture		Silent	SNP	74852992	74852992	12733	4	A	G	G	G	50	4	PPBP	4	4
SHROOM3	57619	broad.mit.edu	37	4	77660075	77660075	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:77660075G>T	uc011cbx.1	+	c.749G>T	c.(748-750)AGC>ATC	p.S250I	SHROOM3_uc011cbz.1_Missense_Mutation_p.S74I|SHROOM3_uc003hkf.1_Missense_Mutation_p.S125I|SHROOM3_uc003hkg.2_Missense_Mutation_p.S28I	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein	250					apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			ovary(1)	1			Lung(101;0.0903)											0.25	27.524568	30.010728	11	33	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	77660075	77660075	14790	4	G	T	T	T	442	34	SHROOM3	2	2
CPZ	8532	broad.mit.edu	37	4	8616222	8616222	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:8616222G>T	uc003glm.2	+	c.1500G>T	c.(1498-1500)GAG>GAT	p.E500D	CPZ_uc003gll.2_Non-coding_Transcript|CPZ_uc003gln.2_Missense_Mutation_p.E363D|CPZ_uc003glo.2_Missense_Mutation_p.E489D|CPZ_uc003glp.2_Non-coding_Transcript	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	500					proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3														0.192308	8.01231	10.385625	5	21	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	8616222	8616222	3978	4	G	T	T	T	425	33	CPZ	2	2
PPIP5K2	23262	broad.mit.edu	37	5	102519086	102519086	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:102519086G>T	uc003kod.3	+	c.3074G>T	c.(3073-3075)AGT>ATT	p.S1025I	PPIP5K2_uc011cva.1_Non-coding_Transcript|PPIP5K2_uc003koe.2_Missense_Mutation_p.S1025I|PPIP5K2_uc003kof.2_Intron	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1	1025					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity	p.S1025N(1)		ovary(1)	1														0.149254	18.408726	26.312331	10	57	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	102519086	102519086	12768	5	G	T	T	T	468	36	PPIP5K2	2	2
PCDHGA1	56114	broad.mit.edu	37	5	140711971	140711971	+	Missense_Mutation	SNP	G	T	T	rs115926650	by1000genomes	TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140711971G>T	uc003lji.1	+	c.1720G>T	c.(1720-1722)GGC>TGC	p.G574C	PCDHGA1_uc011dan.1_Missense_Mutation_p.G574C	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	574	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.446078	271.440269	271.94707	91	113	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140711971	140711971	11970	5	G	T	T	T	507	39	PCDHGA1	1	1
FAM71B	153745	broad.mit.edu	37	5	156592944	156592944	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:156592944G>T	uc003lwn.2	-	c.236C>A	c.(235-237)CCC>CAC	p.P79H		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	79						nucleus				ovary(3)|pancreas(1)	4	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)											0.040404	-14.958739	7.447021	4	95	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	156592944	156592944	5831	5	G	T	T	T	559	43	FAM71B	2	2
WWC1	23286	broad.mit.edu	37	5	167881064	167881064	+	Nonsense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:167881064G>T	uc011den.1	+	c.2617G>T	c.(2617-2619)GAG>TAG	p.E873*	WWC1_uc003lzv.2_Nonsense_Mutation_p.E873*|WWC1_uc003lzu.2_Nonsense_Mutation_p.E873*|WWC1_uc003lzw.2_Nonsense_Mutation_p.E672*|WWC1_uc010jjf.1_Nonsense_Mutation_p.E145*	NM_001161661	NP_001155133	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 1	873	Glu-rich.|Interaction with histone H3.				cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|breast(1)	3	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)										0.405405	181.919622	183.061032	60	88	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	167881064	167881064	17985	5	G	T	T	T	481	37	WWC1	5	1
GFPT2	9945	broad.mit.edu	37	5	179739458	179739458	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:179739458C>A	uc003mlw.1	-	c.1518G>T	c.(1516-1518)GAG>GAT	p.E506D		NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	506					dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)	1	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)									0.354839	58.406111	59.568358	22	40	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	179739458	179739458	6614	5	C	A	A	A	415	32	GFPT2	2	2
MTMR12	54545	broad.mit.edu	37	5	32230132	32230132	+	Nonsense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:32230132C>A	uc003jhq.2	-	c.1996G>T	c.(1996-1998)GAA>TAA	p.E666*	MTMR12_uc010iuk.2_Nonsense_Mutation_p.E612*|MTMR12_uc010iul.2_Nonsense_Mutation_p.E556*	NM_001040446	NP_001035536	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	666						cytoplasm	phosphatase activity			ovary(1)	1														0.129944	28.641445	52.200484	23	154	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	32230132	32230132	10334	5	C	A	A	A	390	30	MTMR12	5	2
SLC1A3	6507	broad.mit.edu	37	5	36679929	36679929	+	Missense_Mutation	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:36679929A>T	uc003jkj.3	+	c.1061A>T	c.(1060-1062)CAA>CTA	p.Q354L	SLC1A3_uc011cox.1_Missense_Mutation_p.Q247L|SLC1A3_uc010iuy.2_Missense_Mutation_p.Q354L	NM_004172	NP_004163	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity	354					D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		L-Glutamic Acid(DB00142)									0.321429	49.032909	50.617601	18	38	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	36679929	36679929	14929	5	A	T	T	T	65	5	SLC1A3	3	3
CARD6	84674	broad.mit.edu	37	5	40853444	40853444	+	Silent	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:40853444C>T	uc003jmg.2	+	c.2010C>T	c.(2008-2010)TCC>TCT	p.S670S		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	670					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5														0.253623	96.500858	104.076982	35	103	KEEP	---	---	---	---	capture		Silent	SNP	40853444	40853444	2769	5	C	T	T	T	301	24	CARD6	2	2
C5orf35	133383	broad.mit.edu	37	5	56210785	56210785	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:56210785C>G	uc003jqx.2	+	c.804C>G	c.(802-804)GAC>GAG	p.D268E	C5orf35_uc003jqy.2_Non-coding_Transcript	NM_153706	NP_714917	Q8NE22	CE035_HUMAN	hypothetical protein LOC133383	268										ovary(1)	1		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.173)		OV - Ovarian serous cystadenocarcinoma(10;2.58e-39)										0.15	12.729708	17.421785	6	34	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	56210785	56210785	2392	5	C	G	G	G	220	17	C5orf35	3	3
SEMA5A	9037	broad.mit.edu	37	5	9052129	9052129	+	Nonsense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:9052129C>A	uc003jek.2	-	c.2701G>T	c.(2701-2703)GAG>TAG	p.E901*		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	901	Extracellular (Potential).|TSP type-1 7.				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2														0.222222	9.097355	10.370192	4	14	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	9052129	9052129	14523	5	C	A	A	A	390	30	SEMA5A	5	2
FIG4	9896	broad.mit.edu	37	6	110146400	110146400	+	Missense_Mutation	SNP	A	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:110146400A>G	uc003ptt.2	+	c.2656A>G	c.(2656-2658)ATC>GTC	p.I886V	FIG4_uc011eau.1_Missense_Mutation_p.I580V	NM_014845	NP_055660	Q92562	FIG4_HUMAN	Sac domain-containing inositol phosphatase 3	886					cell death	endosome membrane	protein binding			ovary(1)	1		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)										0.267857	40.599546	43.327049	15	41	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	110146400	110146400	6126	6	A	G	G	G	208	16	FIG4	4	4
HDAC2	3066	broad.mit.edu	37	6	114262225	114262225	+	Silent	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:114262225G>A	uc003pwd.1	-	c.1746C>T	c.(1744-1746)CCC>CCT	p.P582P	HDAC2_uc003pwc.1_Silent_p.P458P|HDAC2_uc003pwe.1_Silent_p.P458P	NM_001527	NP_001518	Q92769	HDAC2_HUMAN	histone deacetylase 2	488					blood coagulation|chromatin remodeling|dendrite development|embryonic digit morphogenesis|epidermal cell differentiation|eyelid development in camera-type eye|fungiform papilla formation|hair follicle placode formation|maintenance of chromatin silencing|negative regulation of apoptosis|negative regulation of cell cycle|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of MHC class II biosynthetic process|negative regulation of neuron projection development|negative regulation of sequence-specific DNA binding transcription factor activity|nerve growth factor receptor signaling pathway|odontogenesis of dentine-containing tooth|positive regulation of cell proliferation|positive regulation of collagen biosynthetic process|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of proteolysis|positive regulation of receptor biosynthetic process	cytoplasm|ESC/E(Z) complex|NuRD complex|Sin3 complex	chromatin binding|enzyme binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|sequence-specific DNA binding|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|central_nervous_system(1)	3		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Vorinostat(DB02546)					302				0.307692	36.206274	37.480473	12	27	KEEP	---	---	---	---	capture		Silent	SNP	114262225	114262225	7290	6	G	A	A	A	444	35	HDAC2	2	2
DLL1	28514	broad.mit.edu	37	6	170599211	170599211	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:170599211G>T	uc003qxm.2	-	c.17C>A	c.(16-18)GCG>GAG	p.A6E	DLL1_uc011ehc.1_Missense_Mutation_p.A6E|DLL1_uc003qxn.3_Missense_Mutation_p.A6E	NM_005618	NP_005609	O00548	DLL1_HUMAN	delta-like 1 precursor	6					cell communication|cell fate determination|hemopoiesis|Notch receptor processing|Notch signaling pathway|regulation of cell adhesion	extracellular region|integral to plasma membrane	calcium ion binding|Notch binding			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)						187				0.222222	19.494373	22.040335	8	28	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	170599211	170599211	4746	6	G	T	T	T	494	38	DLL1	1	1
SLC17A3	10786	broad.mit.edu	37	6	25850090	25850090	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:25850090C>A	uc003nfk.3	-	c.1214G>T	c.(1213-1215)GGA>GTA	p.G405V	SLC17A3_uc003nfi.3_Missense_Mutation_p.G327V	NM_001098486	NP_001091956	O00476	NPT4_HUMAN	solute carrier family 17 (sodium phosphate),	327	Helical; (Potential).				glucose-6-phosphate transport|urate metabolic process	apical plasma membrane|brush border membrane|endoplasmic reticulum membrane|integral to plasma membrane|perinuclear region of cytoplasm	drug transmembrane transporter activity|efflux transmembrane transporter activity|organic anion transmembrane transporter activity|sodium:phosphate symporter activity|toxin transporter activity|urate transmembrane transporter activity|voltage-gated anion channel activity				0														0.142857	13.698468	22.312946	10	60	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	25850090	25850090	14914	6	C	A	A	A	390	30	SLC17A3	2	2
ZFP57	346171	broad.mit.edu	37	6	29640833	29640833	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:29640833G>T	uc011dlw.1	-	c.1055C>A	c.(1054-1056)GCA>GAA	p.A352E	ZFP57_uc003nnl.3_Missense_Mutation_p.A332E	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN	zinc finger protein 57 homolog	268					DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)	3														0.175573	40.769492	53.80372	23	108	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	29640833	29640833	18239	6	G	T	T	T	598	46	ZFP57	2	2
MDC1	9656	broad.mit.edu	37	6	30682849	30682849	+	Missense_Mutation	SNP	T	C	C			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:30682849T>C	uc003nrg.3	-	c.104A>G	c.(103-105)CAT>CGT	p.H35R	MDC1_uc003nrf.3_5'Flank|MDC1_uc011dmp.1_5'UTR|MDC1_uc003nrh.1_5'UTR|MDC1_uc003nri.2_Missense_Mutation_p.H35R	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	35	Interaction with the MRN complex.|Interaction with CHEK2.				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4														0.203125	28.940191	34.178754	13	51	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	30682849	30682849	9792	6	T	C	C	C	663	51	MDC1	4	4
TNXB	7148	broad.mit.edu	37	6	32046888	32046888	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:32046888C>T	uc003nzl.2	-	c.4297G>A	c.(4297-4299)GGG>AGG	p.G1433R		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	1520	Fibronectin type-III 7.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0														0.213333	36.958577	42.654865	16	59	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	32046888	32046888	16887	6	C	T	T	T	299	23	TNXB	1	1
PTK7	5754	broad.mit.edu	37	6	43128496	43128496	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:43128496G>T	uc011dve.1	+	c.3114G>T	c.(3112-3114)GAG>GAT	p.E1038D	PTK7_uc003oub.1_Missense_Mutation_p.E1030D|PTK7_uc003ouc.1_Missense_Mutation_p.E974D|PTK7_uc003oud.1_Missense_Mutation_p.E990D|PTK7_uc003oue.1_Missense_Mutation_p.E900D|PTK7_uc003ouf.1_Non-coding_Transcript|PTK7_uc003oug.1_Non-coding_Transcript|PTK7_uc010jyj.1_Missense_Mutation_p.E356D|PTK7_uc003ouh.1_3'UTR	NM_002821	NP_002812	Q13308	PTK7_HUMAN	PTK7 protein tyrosine kinase 7 isoform a	1030	Cytoplasmic (Potential).|Protein kinase; inactive.|Interaction with CTNNB1.				actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration|protein phosphorylation	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			large_intestine(1)	1			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)							398				0.25	20.756993	22.803811	9	27	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	43128496	43128496	13220	6	G	T	T	T	451	35	PTK7	2	2
COL21A1	81578	broad.mit.edu	37	6	56044588	56044588	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:56044588G>A	uc003pcs.2	-	c.428C>T	c.(427-429)ACG>ATG	p.T143M	COL21A1_uc003pct.1_Non-coding_Transcript|COL21A1_uc011dxi.1_Missense_Mutation_p.T143M|COL21A1_uc003pcu.1_Missense_Mutation_p.T143M	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor	143	VWFA.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)											0.206897	12.332542	14.643754	6	23	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	56044588	56044588	3818	6	G	A	A	A	520	40	COL21A1	1	1
COL19A1	1310	broad.mit.edu	37	6	70851786	70851786	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:70851786G>A	uc003pfc.1	+	c.1484G>A	c.(1483-1485)GGA>GAA	p.G495E	COL19A1_uc010kam.1_Missense_Mutation_p.G391E	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	495	Triple-helical region 3 (COL3).				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4														0.208333	20.965653	24.720752	10	38	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	70851786	70851786	3814	6	G	A	A	A	533	41	COL19A1	2	2
MAP3K7	6885	broad.mit.edu	37	6	91257770	91257770	+	Missense_Mutation	SNP	T	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:91257770T>G	uc003pnz.1	-	c.1076A>C	c.(1075-1077)CAA>CCA	p.Q359P	MAP3K7_uc003poa.1_Missense_Mutation_p.Q359P|MAP3K7_uc003pob.1_Missense_Mutation_p.Q359P|MAP3K7_uc003poc.1_Missense_Mutation_p.Q359P	NM_145331	NP_663304	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	359					activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|histone H3 acetylation|I-kappaB phosphorylation|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell activation|positive regulation of T cell cytokine production|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytosol|endosome membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)						329				0.142857	9.27996	13.558302	5	30	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	91257770	91257770	9638	6	T	G	G	G	819	63	MAP3K7	4	4
ZAN	7455	broad.mit.edu	37	7	100349878	100349878	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:100349878C>T	uc003uwj.2	+	c.2150C>T	c.(2149-2151)CCC>CTC	p.P717L	ZAN_uc003uwk.2_Missense_Mutation_p.P717L|ZAN_uc003uwl.2_Non-coding_Transcript|ZAN_uc010lhh.2_Non-coding_Transcript|ZAN_uc010lhi.2_Non-coding_Transcript	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	717	66 X heptapeptide repeats (approximate) (mucin-like domain).|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)											0.088235	1.724375	7.528534	3	31	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	100349878	100349878	18096	7	C	T	T	T	286	22	ZAN	2	2
THSD7A	221981	broad.mit.edu	37	7	11487045	11487045	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:11487045G>T	uc003ssf.3	-	c.2612C>A	c.(2611-2613)ACT>AAT	p.T871N		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	871	Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)										0.3	9.221069	9.578437	3	7	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	11487045	11487045	16407	7	G	T	T	T	468	36	THSD7A	2	2
THSD7A	221981	broad.mit.edu	37	7	11630124	11630124	+	Silent	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:11630124G>A	uc003ssf.3	-	c.1416C>T	c.(1414-1416)AAC>AAT	p.N472N		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	472	Extracellular (Potential).|TSP type-1 4.					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)										0.177778	13.865662	18.278201	8	37	KEEP	---	---	---	---	capture		Silent	SNP	11630124	11630124	16407	7	G	A	A	A	568	44	THSD7A	2	2
C7orf58	79974	broad.mit.edu	37	7	120704338	120704338	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:120704338G>C	uc003vjq.3	+	c.587G>C	c.(586-588)GGA>GCA	p.G196A	C7orf58_uc003vjr.1_Missense_Mutation_p.G196A|C7orf58_uc003vjs.3_Missense_Mutation_p.G196A|C7orf58_uc003vjt.3_5'UTR	NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1	196						endoplasmic reticulum				ovary(4)|large_intestine(2)|pancreas(1)	7	all_neural(327;0.117)													0.107143	7.907255	16.483437	6	50	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	120704338	120704338	2512	7	G	C	C	C	533	41	C7orf58	3	3
ASB15	142685	broad.mit.edu	37	7	123268939	123268939	+	Silent	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:123268939A>T	uc003vku.1	+	c.891A>T	c.(889-891)CCA>CCT	p.P297P	ASB15_uc003vkw.1_Silent_p.P297P	NM_080928	NP_563616	Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box-containing 15	297					intracellular signal transduction					lung(1)	1														0.243243	22.963843	25.182327	9	28	KEEP	---	---	---	---	capture		Silent	SNP	123268939	123268939	1037	7	A	T	T	T	80	7	ASB15	3	3
GCC1	79571	broad.mit.edu	37	7	127222089	127222089	+	Nonsense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:127222089C>T	uc003vma.2	-	c.2307G>A	c.(2305-2307)TGG>TGA	p.W769*		NM_024523	NP_078799	Q96CN9	GCC1_HUMAN	Golgi coiled-coil protein 1	769						Golgi membrane|plasma membrane	protein binding			ovary(2)	2														0.040816	-14.984914	7.261367	4	94	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	127222089	127222089	6551	7	C	T	T	T	234	18	GCC1	5	2
GCC1	79571	broad.mit.edu	37	7	127224378	127224378	+	Nonsense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:127224378C>A	uc003vma.2	-	c.859G>T	c.(859-861)GGA>TGA	p.G287*		NM_024523	NP_078799	Q96CN9	GCC1_HUMAN	Golgi coiled-coil protein 1	287	Potential.					Golgi membrane|plasma membrane	protein binding			ovary(2)	2												OREG0003809	type=REGULATORY REGION|Gene=GCC1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	0.175	12.699072	16.687019	7	33	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	127224378	127224378	6551	7	C	A	A	A	312	24	GCC1	5	2
FLNC	2318	broad.mit.edu	37	7	128485006	128485006	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:128485006C>A	uc003vnz.3	+	c.3487C>A	c.(3487-3489)CCG>ACG	p.P1163T	FLNC_uc003voa.3_Missense_Mutation_p.P1163T	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1163	Filamin 10.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)	10										892				0.34	41.783674	42.903714	17	33	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	128485006	128485006	6177	7	C	A	A	A	234	18	FLNC	2	2
EPHB6	2051	broad.mit.edu	37	7	142563350	142563350	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:142563350G>T	uc011kst.1	+	c.1067G>T	c.(1066-1068)CGG>CTG	p.R356L	EPHB6_uc011ksu.1_Missense_Mutation_p.R356L|EPHB6_uc003wbs.2_Missense_Mutation_p.R64L|EPHB6_uc003wbt.2_5'UTR|EPHB6_uc003wbu.2_Missense_Mutation_p.R64L|EPHB6_uc003wbv.2_5'Flank	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	356	Extracellular (Potential).|Cys-rich.				protein phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(5)|large_intestine(4)|central_nervous_system(3)|ovary(1)|pancreas(1)	14	Melanoma(164;0.059)									313				0.333333	17.844369	18.286996	6	12	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	142563350	142563350	5371	7	G	T	T	T	507	39	EPHB6	1	1
CNTNAP2	26047	broad.mit.edu	37	7	147869451	147869451	+	Nonsense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:147869451C>A	uc003weu.1	+	c.2891C>A	c.(2890-2892)TCG>TAG	p.S964*		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	964	EGF-like 2.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)											0.175439	18.222542	23.88371	10	47	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	147869451	147869451	3785	7	C	A	A	A	403	31	CNTNAP2	5	1
ZNF786	136051	broad.mit.edu	37	7	148771596	148771596	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:148771596C>A	uc003wfh.2	-	c.180G>T	c.(178-180)TGG>TGT	p.W60C	ZNF786_uc011kuk.1_Missense_Mutation_p.W23C|ZNF786_uc003wfi.2_5'UTR	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786	60	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)											0.24	14.538227	16.080298	6	19	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	148771596	148771596	18756	7	C	A	A	A	390	30	ZNF786	2	2
AOAH	313	broad.mit.edu	37	7	36571810	36571810	+	Silent	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:36571810G>T	uc003tfh.3	-	c.1368C>A	c.(1366-1368)GTC>GTA	p.V456V	AOAH_uc010kxf.2_Silent_p.V456V|AOAH_uc011kba.1_Silent_p.V424V	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor	456					inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity				0														0.253333	44.948572	49.143557	19	56	KEEP	---	---	---	---	capture		Silent	SNP	36571810	36571810	736	7	G	T	T	T	574	45	AOAH	2	2
ABCA13	154664	broad.mit.edu	37	7	48335365	48335365	+	Silent	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:48335365C>T	uc003toq.2	+	c.9024C>T	c.(9022-9024)AGC>AGT	p.S3008S	ABCA13_uc010kys.1_Silent_p.S82S	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	3008					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10														0.219178	67.242672	77.838151	32	114	KEEP	---	---	---	---	capture		Silent	SNP	48335365	48335365	32	7	C	T	T	T	324	25	ABCA13	2	2
ZNF479	90827	broad.mit.edu	37	7	57187759	57187759	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:57187759G>T	uc010kzo.2	-	c.1363C>A	c.(1363-1365)CAC>AAC	p.H455N		NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479	455	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3			GBM - Glioblastoma multiforme(1;9.18e-12)											0.204545	61.628139	72.36834	27	105	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	57187759	57187759	18527	7	G	T	T	T	611	47	ZNF479	2	2
CYTH3	9265	broad.mit.edu	37	7	6213366	6213366	+	Splice_Site_SNP	SNP	T	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:6213366T>A	uc003spt.2	-	c.369_splice	c.e6-1	p.R123_splice	CYTH3_uc011jws.1_5'Flank	NM_004227	NP_004218			cytohesin 3						regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|membrane fraction|plasma membrane	1-phosphatidylinositol binding|ARF guanyl-nucleotide exchange factor activity|inositol-1,4,5-trisphosphate receptor activity				0														0.081081	1.502096	8.111041	3	34	KEEP	---	---	---	---	capture		Splice_Site_SNP	SNP	6213366	6213366	4370	7	T	A	A	A	715	55	CYTH3	5	3
CACNA2D1	781	broad.mit.edu	37	7	81579742	81579742	+	Nonsense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:81579742C>T	uc003uhr.1	-	c.3242G>A	c.(3241-3243)TGG>TAG	p.W1081*	CACNA2D1_uc011kgy.1_Nonsense_Mutation_p.W293*	NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	1093	Helical; (Potential).					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)									0.181818	11.526391	14.670525	6	27	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	81579742	81579742	2664	7	C	T	T	T	273	21	CACNA2D1	5	2
SAMD9	54809	broad.mit.edu	37	7	92734862	92734862	+	Silent	SNP	A	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:92734862A>G	uc003umf.2	-	c.549T>C	c.(547-549)CCT>CCC	p.P183P	SAMD9_uc003umg.2_Silent_p.P183P	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	183						cytoplasm				ovary(3)|breast(1)|central_nervous_system(1)	5	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)											0.020548	-31.195152	6.384228	3	143	KEEP	---	---	---	---	capture		Silent	SNP	92734862	92734862	14306	7	A	G	G	G	80	7	SAMD9	4	4
RNF19A	25897	broad.mit.edu	37	8	101276266	101276266	+	Silent	SNP	A	C	C			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:101276266A>C	uc003yjj.1	-	c.1464T>G	c.(1462-1464)GCT>GCG	p.A488A	RNF19A_uc003yjk.1_Silent_p.A488A	NM_015435	NP_056250	Q9NV58	RN19A_HUMAN	ring finger protein 19	488					microtubule cytoskeleton organization|protein modification process	centrosome|integral to membrane	ligase activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)											0.170732	27.497151	35.907344	14	68	KEEP	---	---	---	---	capture		Silent	SNP	101276266	101276266	13948	8	A	C	C	C	80	7	RNF19A	4	4
RIMS2	9699	broad.mit.edu	37	8	104943582	104943582	+	Missense_Mutation	SNP	G	C	C			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:104943582G>C	uc003yls.2	+	c.1670G>C	c.(1669-1671)AGG>ACG	p.R557T	RIMS2_uc003ylp.2_Missense_Mutation_p.R779T|RIMS2_uc003ylw.2_Missense_Mutation_p.R571T|RIMS2_uc003ylq.2_Missense_Mutation_p.R571T|RIMS2_uc003ylr.2_Missense_Mutation_p.R618T|RIMS2_uc003ylt.2_Missense_Mutation_p.R164T	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	841	C2 1.				intracellular protein transport	cell junction|presynaptic membrane	Rab GTPase binding|zinc ion binding			ovary(6)|lung(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)							728				0.25	17.281461	19.102322	8	24	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	104943582	104943582	13845	8	G	C	C	C	455	35	RIMS2	3	3
CSMD3	114788	broad.mit.edu	37	8	113241099	113241099	+	Nonsense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:113241099G>T	uc003ynu.2	-	c.10850C>A	c.(10849-10851)TCA>TAA	p.S3617*	CSMD3_uc003yns.2_Nonsense_Mutation_p.S2819*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.S3577*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.S3448*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3617	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(20)|lung(11)|kidney(8)|large_intestine(6)|skin(3)|central_nervous_system(2)|urinary_tract(1)|breast(1)	52										2888	TCGA Ovarian(7;0.080)			0.153846	9.623583	14.093443	6	33	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	113241099	113241099	4087	8	G	T	T	T	585	45	CSMD3	5	2
GPR20	2843	broad.mit.edu	37	8	142367968	142367968	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:142367968G>A	uc003ywf.2	-	c.56C>T	c.(55-57)GCA>GTA	p.A19V		NM_005293	NP_005284	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	19	Extracellular (Potential).					integral to plasma membrane	G-protein coupled receptor activity				0	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)											0.363636	10.601109	10.779292	4	7	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	142367968	142367968	6955	8	G	A	A	A	598	46	GPR20	2	2
TRIM35	23087	broad.mit.edu	37	8	27145336	27145336	+	Missense_Mutation	SNP	C	G	G			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:27145336C>G	uc003xfl.1	-	c.1213G>C	c.(1213-1215)GTG>CTG	p.V405L	TRIM35_uc010lup.1_3'UTR	NM_171982	NP_741983	Q9UPQ4	TRI35_HUMAN	tripartite motif-containing 35 isoform 2	405	B30.2/SPRY.				apoptosis|induction of apoptosis|negative regulation of mitotic cell cycle	cytoplasm|nucleus	zinc ion binding				0		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|Epithelial(17;9.34e-10)|Colorectal(74;0.141)										0.25	8.121845	8.801824	3	9	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	27145336	27145336	17053	8	C	G	G	G	247	19	TRIM35	3	3
TEX15	56154	broad.mit.edu	37	8	30702993	30702993	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:30702993C>A	uc003xil.2	-	c.3541G>T	c.(3541-3543)GAT>TAT	p.D1181Y		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1181										ovary(3)	3				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)										0.189189	14.001476	17.34716	7	30	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	30702993	30702993	16306	8	C	A	A	A	416	32	TEX15	2	2
UBE2V2	7336	broad.mit.edu	37	8	48921025	48921025	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:48921025C>T	uc003xqm.2	+	c.11C>T	c.(10-12)TCC>TTC	p.S4F		NM_003350	NP_003341	Q15819	UB2V2_HUMAN	ubiquitin-conjugating enzyme E2v2	4					cell proliferation|DNA double-strand break processing|post-translational protein modification|protein polyubiquitination|regulation of DNA repair	cytoplasm|nucleus|UBC13-MMS2 complex	acid-amino acid ligase activity|protein binding				0		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00171)|all_lung(136;0.00196)												0.16	7.083367	9.836003	4	21	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	48921025	48921025	17434	8	C	T	T	T	390	30	UBE2V2	2	2
RP1	6101	broad.mit.edu	37	8	55537899	55537899	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:55537899G>T	uc003xsd.1	+	c.1457G>T	c.(1456-1458)AGT>ATT	p.S486I	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	486					cell projection organization|intracellular signal transduction|phototransduction, visible light|visual perception	cilium axoneme|cytoplasm|microtubule|photoreceptor connecting cilium|photoreceptor outer segment				ovary(4)|pancreas(1)	5		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			Colon(91;1014 1389 7634 14542 40420)								0.254545	34.919862	37.93067	14	41	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	55537899	55537899	14011	8	G	T	T	T	468	36	RP1	2	2
ZFHX4	79776	broad.mit.edu	37	8	77618441	77618441	+	Nonsense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:77618441C>A	uc003yav.2	+	c.2118C>A	c.(2116-2118)TAC>TAA	p.Y706*	ZFHX4_uc003yat.1_Nonsense_Mutation_p.Y706*|ZFHX4_uc003yau.1_Nonsense_Mutation_p.Y706*|ZFHX4_uc003yaw.1_Nonsense_Mutation_p.Y706*	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	706	C2H2-type 3.				regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)											0.184211	12.638264	16.170768	7	31	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	77618441	77618441	18223	8	C	A	A	A	259	20	ZFHX4	5	2
GRIN3A	116443	broad.mit.edu	37	9	104432620	104432620	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:104432620G>A	uc004bbp.1	-	c.2074C>T	c.(2074-2076)CTC>TTC	p.L692F	GRIN3A_uc004bbq.1_Missense_Mutation_p.L692F	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	692	Helical; (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|central_nervous_system(1)|pancreas(1)	6		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)					27				0.197917	47.171453	55.326559	19	77	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	104432620	104432620	7062	9	G	A	A	A	455	35	GRIN3A	2	2
OR13C4	138804	broad.mit.edu	37	9	107288953	107288953	+	Nonsense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:107288953C>A	uc011lvn.1	-	c.538G>T	c.(538-540)GAG>TAG	p.E180*		NM_001001919	NP_001001919	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C,	180	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.112903	5.020621	14.401015	7	55	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	107288953	107288953	11342	9	C	A	A	A	403	31	OR13C4	5	1
SVEP1	79987	broad.mit.edu	37	9	113173790	113173790	+	Nonsense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:113173790C>T	uc010mtz.2	-	c.6201G>A	c.(6199-6201)TGG>TGA	p.W2067*	SVEP1_uc010mty.2_5'UTR	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	2067	Sushi 11.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7														0.125	4.516517	7.806385	3	21	KEEP	---	---	---	---	capture		Nonsense_Mutation	SNP	113173790	113173790	15940	9	C	T	T	T	286	22	SVEP1	5	2
NAIF1	203245	broad.mit.edu	37	9	130825794	130825794	+	Silent	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:130825794G>A	uc004bta.2	-	c.897C>T	c.(895-897)TAC>TAT	p.Y299Y	NAIF1_uc004bsz.2_Non-coding_Transcript	NM_197956	NP_931045	Q69YI7	NAIF1_HUMAN	nuclear apoptosis inducing factor 1	299					apoptosis|induction of apoptosis	nucleus					0														0.1875	41.004208	51.253606	21	91	KEEP	---	---	---	---	capture		Silent	SNP	130825794	130825794	10542	9	G	A	A	A	568	44	NAIF1	2	2
DOLPP1	57171	broad.mit.edu	37	9	131847496	131847496	+	Silent	SNP	A	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:131847496A>T	uc004bxc.2	+	c.273A>T	c.(271-273)ACA>ACT	p.T91T	DOLPP1_uc004bxd.2_Silent_p.T91T|DOLPP1_uc004bxe.2_Non-coding_Transcript|DOLPP1_uc004bxf.2_5'Flank	NM_020438	NP_065171	Q86YN1	DOPP1_HUMAN	dolichyl pyrophosphate phosphatase 1 isoform a	91					dolichyl diphosphate biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to endoplasmic reticulum membrane	dolichyldiphosphatase activity				0														0.139241	17.116829	27.015146	11	68	KEEP	---	---	---	---	capture		Silent	SNP	131847496	131847496	4888	9	A	T	T	T	80	7	DOLPP1	3	3
POMT1	10585	broad.mit.edu	37	9	134382772	134382772	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:134382772C>T	uc004cav.2	+	c.298C>T	c.(298-300)CCT>TCT	p.P100S	POMT1_uc011mci.1_Missense_Mutation_p.P100S|POMT1_uc004cax.2_Missense_Mutation_p.P100S|POMT1_uc011mcj.1_Intron|POMT1_uc004cau.2_Missense_Mutation_p.P100S|POMT1_uc004caw.2_Missense_Mutation_p.P46S|POMT1_uc011mck.1_5'UTR|POMT1_uc011mcl.1_Intron|POMT1_uc011mcm.1_Missense_Mutation_p.P70S|POMT1_uc011mcn.1_5'Flank	NM_007171	NP_009102	Q9Y6A1	POMT1_HUMAN	protein-O-mannosyltransferase 1 isoform a	100	Helical; (Potential).				multicellular organismal development|protein O-linked glycosylation	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-mannose-protein mannosyltransferase activity|metal ion binding				0		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)										0.138462	24.800708	41.225295	18	112	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	134382772	134382772	12674	9	C	T	T	T	338	26	POMT1	2	2
CER1	9350	broad.mit.edu	37	9	14720224	14720224	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:14720224C>A	uc003zlj.2	-	c.668G>T	c.(667-669)TGC>TTC	p.C223F		NM_005454	NP_005445	O95813	CER1_HUMAN	cerberus 1 precursor	223	CTCK.				BMP signaling pathway	extracellular space	cytokine activity				0				GBM - Glioblastoma multiforme(50;3.16e-06)										0.26087	31.3771	33.759381	12	34	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	14720224	14720224	3398	9	C	A	A	A	325	25	CER1	2	2
KIF24	347240	broad.mit.edu	37	9	34257577	34257577	+	Silent	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:34257577G>T	uc003zua.3	-	c.2028C>A	c.(2026-2028)GGC>GGA	p.G676G	KIF24_uc010mkb.2_Intron	NM_194313	NP_919289	Q5T7B8	KIF24_HUMAN	kinesin family member 24	676					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0			LUSC - Lung squamous cell carcinoma(29;0.0107)											0.035211	-27.186692	6.372498	5	137	KEEP	---	---	---	---	capture		Silent	SNP	34257577	34257577	8603	9	G	T	T	T	587	46	KIF24	2	2
MAGEC1	9947	broad.mit.edu	37	X	140993224	140993224	+	Missense_Mutation	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:140993224C>T	uc004fbt.2	+	c.34C>T	c.(34-36)CCG>TCG	p.P12S	MAGEC1_uc010nsl.1_5'UTR	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	12							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)													0.081081	-0.275384	12.927468	6	68	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	140993224	140993224	9561	23	C	T	T	T	338	26	MAGEC1	2	2
MAGEA5	4104	broad.mit.edu	37	X	151283870	151283870	+	Missense_Mutation	SNP	C	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:151283870C>A	uc004ffj.2	-	c.143G>T	c.(142-144)GGC>GTC	p.G48V		NM_021049	NP_066387	P43359	MAGA5_HUMAN	melanoma antigen family A, 5	48	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)													0.54717	89.100068	89.207903	29	24	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	151283870	151283870	9548	23	C	A	A	A	338	26	MAGEA5	2	2
F8	2157	broad.mit.edu	37	X	154159113	154159113	+	Silent	SNP	C	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:154159113C>T	uc004fmt.2	-	c.2952G>A	c.(2950-2952)TCG>TCA	p.S984S		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	984	B.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|oxidation-reduction process|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)					359				0.243902	48.065706	52.965818	20	62	KEEP	---	---	---	---	capture		Silent	SNP	154159113	154159113	5544	23	C	T	T	T	236	19	F8	1	1
MAGEB18	286514	broad.mit.edu	37	X	26157198	26157198	+	Silent	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:26157198G>T	uc004dbq.1	+	c.96G>T	c.(94-96)GTG>GTT	p.V32V		NM_173699	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	32							protein binding			central_nervous_system(1)	1														0.222222	9.491551	10.768432	4	14	KEEP	---	---	---	---	capture		Silent	SNP	26157198	26157198	9556	23	G	T	T	T	600	47	MAGEB18	2	2
ZCCHC13	389874	broad.mit.edu	37	X	73524138	73524138	+	Missense_Mutation	SNP	G	A	A			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:73524138G>A	uc004ebs.3	+	c.37G>A	c.(37-39)GGC>AGC	p.G13S		NM_203303	NP_976048	Q8WW36	ZCH13_HUMAN	zinc finger, CCHC domain containing 13	13	CCHC-type 1; degenerate.						nucleic acid binding|zinc ion binding				0														0.214286	6.81877	7.873091	3	11	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	73524138	73524138	18170	23	G	A	A	A	611	47	ZCCHC13	2	2
KLHL4	56062	broad.mit.edu	37	X	86869441	86869441	+	Missense_Mutation	SNP	G	T	T			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:86869441G>T	uc004efa.2	+	c.595G>T	c.(595-597)GTT>TTT	p.V199F	KLHL4_uc004efb.2_Missense_Mutation_p.V199F	NM_057162	NP_476503	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 2	199	BTB.					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5														0.222222	10.390827	11.668089	4	14	KEEP	---	---	---	---	capture		Missense_Mutation	SNP	86869441	86869441	8705	23	G	T	T	T	572	44	KLHL4	2	2
KRTAP5-5	439915	broad.mit.edu	37	11	1651191	1651199	+	In_Frame_Del	DEL	GGCTGTGGA	-	-	rs35089393		TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:1651191_1651199delGGCTGTGGA	uc001lty.2	+	c.121_129delGGCTGTGGA	c.(121-129)GGCTGTGGAdel	p.GCG47del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	47_49						keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)										0.35			14	26		---	---	---	---	capture_indel		In_Frame_Del	DEL	1651191	1651199	8886	11	GGCTGTGGA	-	-	-	507	39	KRTAP5-5	5	5
RLTPR	146206	broad.mit.edu	37	16	67681438	67681454	+	Frame_Shift_Del	DEL	GCTGGCGGGACACTCAA	-	-			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:67681438_67681454delGCTGGCGGGACACTCAA	uc002etn.2	+	c.804_820delGCTGGCGGGACACTCAA	c.(802-822)GCGCTGGCGGGACACTCAAGCfs	p.A268fs	RLTPR_uc010cel.1_Frame_Shift_Del_p.A268fs|RLTPR_uc010vjr.1_Frame_Shift_Del_p.A268fs	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin	268_274	LRR 4.									breast(1)	1		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)										0.36			5	9		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	67681438	67681454	13871	16	GCTGGCGGGACACTCAA	-	-	-	483	38	RLTPR	5	5
PLCD3	113026	broad.mit.edu	37	17	43192760	43192762	+	In_Frame_Del	DEL	TCC	-	-			TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:43192760_43192762delTCC	uc002iib.2	-	c.1509_1511delGGA	c.(1507-1512)GAGGAT>GAT	p.E503del		NM_133373	NP_588614	Q8N3E9	PLCD3_HUMAN	phospholipase C delta 3	503					intracellular signal transduction|lipid catabolic process	cleavage furrow|cytoplasm|membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			breast(2)|lung(1)	3					Phosphatidylserine(DB00144)									0.36			4	7		---	---	---	---	capture_indel		In_Frame_Del	DEL	43192760	43192762	12458	17	TCC	-	-	-	650	50	PLCD3	5	5
ATXN1	6310	broad.mit.edu	37	6	16327864	16327865	+	In_Frame_Ins	INS	-	TGCTGC	TGCTGC	rs71806515		TCGA-64-5815-01	TCGA-64-5815-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:16327864_16327865insTGCTGC	uc003nbt.2	-	c.677_678insGCAGCA	c.(676-678)CAC>CAGCAGCAC	p.225_226insQQ	ATXN1_uc010jpi.2_In_Frame_Ins_p.225_226insQQ|ATXN1_uc010jpj.1_Intron	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1	225_226					cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association|transcription repressor activity			central_nervous_system(1)	1	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)												0.38			3	5		---	---	---	---	capture_indel		In_Frame_Ins	INS	16327864	16327865	1228	6	-	TGCTGC	TGCTGC	TGCTGC	568	44	ATXN1	5	5
