Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KAZ	23254	broad.mit.edu	37	1	15428077	15428077	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15428077C>A	uc001avm.3	+	11	1867	c.1586C>A	c.(1585-1587)GCC>GAC	p.A529D	KAZ_uc001avs.3_5'UTR	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E	529	SAM 2.				keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						CACTGGGTGGCCAAGGCCTGG	0.592													3	4	---	---	---	---	PASS
EPHB2	2048	broad.mit.edu	37	1	23110939	23110939	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23110939G>C	uc009vqj.1	+	3	326	c.181G>C	c.(181-183)GTG>CTG	p.V61L	EPHB2_uc001bge.2_Missense_Mutation_p.V61L|EPHB2_uc001bgf.2_Missense_Mutation_p.V61L|EPHB2_uc010odu.1_Missense_Mutation_p.V61L	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor	61	Extracellular (Potential).				axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		CACGTACCAGGTGTGCAACGT	0.567									Hereditary_Prostate_Cancer				15	34	---	---	---	---	PASS
RAB42	115273	broad.mit.edu	37	1	28920446	28920446	+	Silent	SNP	C	T	T	rs148146932	byFrequency	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28920446C>T	uc001bqu.2	+	2	441	c.135C>T	c.(133-135)ACC>ACT	p.T45T	RAB42_uc001bqv.2_Silent_p.T45T	NM_152304	NP_689517	Q8N4Z0	RAB42_HUMAN	RAB42, member RAS oncogene family	45					small GTPase mediated signal transduction	membrane	GTP binding				0		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00618)|all_lung(284;0.00909)|Breast(348;0.0249)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0577)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00298)|KIRC - Kidney renal clear cell carcinoma(1967;0.00948)|BRCA - Breast invasive adenocarcinoma(304;0.0213)|READ - Rectum adenocarcinoma(331;0.0649)		TCGTGGAGACCTCGGTTAAAA	0.602													9	21	---	---	---	---	PASS
EPB41	2035	broad.mit.edu	37	1	29385131	29385131	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29385131C>G	uc001brm.1	+	12	1883	c.1876C>G	c.(1876-1878)CCC>GCC	p.P626A	EPB41_uc001brg.1_Missense_Mutation_p.P417A|EPB41_uc001brh.1_Intron|EPB41_uc001bri.1_Intron|EPB41_uc001brj.1_Intron|EPB41_uc001brk.2_Missense_Mutation_p.P626A|EPB41_uc001brl.1_Intron|EPB41_uc009vtl.1_Intron|EPB41_uc009vtm.1_Intron	NM_203342	NP_976217	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	626	Spectrin--actin-binding.				blood circulation|cortical actin cytoskeleton organization|positive regulation of protein binding	extrinsic to membrane|Golgi apparatus|nucleus|plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	1-phosphatidylinositol binding|actin binding|spectrin binding|structural constituent of cytoskeleton			ovary(1)	1		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		GGTGACAGTACCCACCTCAAA	0.403													3	29	---	---	---	---	PASS
OSCP1	127700	broad.mit.edu	37	1	36894077	36894077	+	Intron	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36894077C>A	uc001cap.2	-						OSCP1_uc001caq.2_Intron|OSCP1_uc001car.2_Intron	NM_145047	NP_659484	Q8WVF1	OSCP1_HUMAN	oxidored-nitro domain-containing protein isoform						transport	basal plasma membrane				ovary(2)|central_nervous_system(1)|pancreas(1)	4						AGCACTCTCTCTGTATATGCA	0.284													15	30	---	---	---	---	PASS
MTF1	4520	broad.mit.edu	37	1	38288049	38288049	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38288049C>T	uc001cce.1	-	9	1652	c.1511G>A	c.(1510-1512)GGG>GAG	p.G504E	MTF1_uc009vvj.1_Missense_Mutation_p.G195E	NM_005955	NP_005946	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	504						nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			ovary(1)|pancreas(1)	2	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TGCAGAAGCCCCAGCAACAAC	0.587													6	10	---	---	---	---	PASS
ZFYVE9	9372	broad.mit.edu	37	1	52703869	52703869	+	Silent	SNP	G	A	A	rs149478229		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52703869G>A	uc001cto.2	+	4	952	c.780G>A	c.(778-780)GCG>GCA	p.A260A	ZFYVE9_uc001ctn.2_Silent_p.A260A|ZFYVE9_uc001ctp.2_Silent_p.A260A	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	260					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						CCATGTCTGCGATTACAAGTT	0.438													25	181	---	---	---	---	PASS
LEPROT	54741	broad.mit.edu	37	1	65897531	65897531	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65897531A>G	uc001dcf.2	+	4	414	c.325A>G	c.(325-327)ATT>GTT	p.I109V	LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc001dci.2_Intron|LEPR_uc009waq.2_Intron|LEPROT_uc009wap.2_Missense_Mutation_p.I118V	NM_017526	NP_059996	O15243	OBRG_HUMAN	leptin receptor gene-related protein	109	Helical; (Potential).					endosome membrane|Golgi membrane|integral to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		CAATGCAGTCATTTTCCTTAC	0.393													12	25	---	---	---	---	PASS
LEPR	3953	broad.mit.edu	37	1	66102457	66102457	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66102457A>G	uc001dci.2	+	20	3459	c.3257A>G	c.(3256-3258)AAA>AGA	p.K1086R	LEPR_uc009waq.2_3'UTR	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1	1086	Cytoplasmic (Potential).				energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		ACCTCAATCAAAAAGAGAGAG	0.413													8	24	---	---	---	---	PASS
RPAP2	79871	broad.mit.edu	37	1	92798948	92798948	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92798948C>T	uc001dot.2	+	9	1565	c.1456C>T	c.(1456-1458)CAT>TAT	p.H486Y	RPAP2_uc009wdh.2_RNA	NM_024813	NP_079089	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	486						integral to membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)	1		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		TGTGATTCAGCATGATTCCAC	0.318													9	13	---	---	---	---	PASS
OTUD7B	56957	broad.mit.edu	37	1	149916922	149916922	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149916922C>G	uc001etn.2	-	12	1722	c.1366G>C	c.(1366-1368)GAT>CAT	p.D456H		NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne	456					negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			CGGGGCTCATCTCCAGCTGAG	0.612													17	20	---	---	---	---	PASS
GPATCH4	54865	broad.mit.edu	37	1	156571241	156571241	+	5'UTR	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156571241C>G	uc001fpm.2	-	1					GPATCH4_uc001fpl.2_5'UTR	NM_015590	NP_056405	Q5T3I0	GPTC4_HUMAN	G patch domain containing 4 isoform 1							intracellular	nucleic acid binding			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGTGCCGGACCTGACTTGTGC	0.577													4	11	---	---	---	---	PASS
OR10X1	128367	broad.mit.edu	37	1	158548923	158548923	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158548923G>C	uc010pin.1	-	1	767	c.767C>G	c.(766-768)ACC>AGC	p.T256S		NM_001004477	NP_001004477	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X,	256	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					GGAGGCACAGGTGGTGAAGGC	0.483													25	100	---	---	---	---	PASS
OR6N1	128372	broad.mit.edu	37	1	158735980	158735980	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158735980G>A	uc010piq.1	-	1	493	c.493C>T	c.(493-495)CGC>TGC	p.R165C		NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					AATGGGAGGCGTGAAATCAAG	0.502													23	67	---	---	---	---	PASS
RASAL2	9462	broad.mit.edu	37	1	178063816	178063816	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178063816G>T	uc001glq.2	+	1	953	c.189G>T	c.(187-189)TGG>TGT	p.W63C	RASAL2_uc009wxb.2_Missense_Mutation_p.W63C|LOC100302401_uc001gln.1_5'Flank|LOC100302401_uc001glo.1_5'Flank|RASAL2_uc009wxa.2_RNA	NM_170692	NP_733793	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 2	Error:Variant_position_missing_in_Q9UJF2_after_alignment					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5						AACAGAGCTGGGTCCGGGTGT	0.582													15	23	---	---	---	---	PASS
IVNS1ABP	10625	broad.mit.edu	37	1	185277948	185277948	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185277948A>G	uc001grl.2	-	5	964	c.341T>C	c.(340-342)ATG>ACG	p.M114T	IVNS1ABP_uc001grj.2_5'Flank|IVNS1ABP_uc009wyj.2_5'UTR|IVNS1ABP_uc009wyk.2_RNA	NM_006469	NP_006460	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	114					interspecies interaction between organisms|response to virus|RNA splicing|transcription from RNA polymerase III promoter	cytoplasm|cytoskeleton|spliceosomal complex|transcription factor complex				ovary(4)|central_nervous_system(1)	5						TACTCGATCCATCTTCAGCTT	0.303													25	39	---	---	---	---	PASS
CFH	3075	broad.mit.edu	37	1	196684863	196684863	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196684863G>A	uc001gtj.3	+	11	1900	c.1660G>A	c.(1660-1662)GGT>AGT	p.G554S		NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	554	Sushi 9.				complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6						CATAGTGTGTGGTTACAATGG	0.279													8	61	---	---	---	---	PASS
CFHR5	81494	broad.mit.edu	37	1	196965332	196965332	+	Splice_Site	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196965332G>C	uc001gts.3	+	6	1098	c.970_splice	c.e6+1	p.A324_splice		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor						complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2						ATGTGTGTTGGTGAGAAAACA	0.224													5	31	---	---	---	---	PASS
PTPN7	5778	broad.mit.edu	37	1	202117834	202117834	+	Intron	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202117834G>T	uc001gxm.1	-						PTPN7_uc001gxl.1_Intron|PTPN7_uc001gxn.1_Intron|PTPN7_uc010ppv.1_Intron|PTPN7_uc010ppw.1_Intron|PTPN7_uc010ppx.1_Intron|PTPN7_uc010ppy.1_Intron	NM_002832	NP_002823	P35236	PTN7_HUMAN	protein tyrosine phosphatase, non-receptor type							cytosol|internal side of plasma membrane	protein binding|protein tyrosine phosphatase activity			skin(1)	1						CCCTCTGCAAGGAGAAACACA	0.572													4	20	---	---	---	---	PASS
ZC3H11A	9877	broad.mit.edu	37	1	203799341	203799341	+	Intron	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203799341C>T	uc001hac.2	+						ZC3H11A_uc001had.2_Intron|ZC3H11A_uc001hae.2_Intron|ZC3H11A_uc001haf.2_Intron|ZC3H11A_uc010pqm.1_Intron|ZC3H11A_uc001hag.1_Intron	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A								nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GGTAAGTCATCACGTTTTGGC	0.353													34	119	---	---	---	---	PASS
ELK4	2005	broad.mit.edu	37	1	205589867	205589867	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205589867C>A	uc001hcy.1	-	3	1557	c.307G>T	c.(307-309)GGT>TGT	p.G103C	ELK4_uc001hcz.2_Missense_Mutation_p.G103C	NM_001973	NP_001964	P28324	ELK4_HUMAN	ELK4 protein isoform a	103						cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity				0	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			TCACAGTCACCCTCAATCCTG	0.428			T	SLC45A3	prostate								16	40	---	---	---	---	PASS
CDC42BPA	8476	broad.mit.edu	37	1	227381487	227381487	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227381487C>A	uc001hqr.2	-	5	1542	c.599G>T	c.(598-600)AGA>ATA	p.R200I	CDC42BPA_uc001hqs.2_Missense_Mutation_p.R200I|CDC42BPA_uc009xes.2_Missense_Mutation_p.R200I|CDC42BPA_uc010pvs.1_Missense_Mutation_p.R200I	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B	200	Protein kinase.				actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				ACTGTTTTACCTGTGTACATA	0.378													17	33	---	---	---	---	PASS
TOMM20	9804	broad.mit.edu	37	1	235291986	235291986	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235291986G>A	uc001hwl.2	-	1	271	c.45C>T	c.(43-45)GCC>GCT	p.A15A	SNORA14B_uc001hwm.1_5'Flank	NM_014765	NP_055580	Q15388	TOM20_HUMAN	translocase of outer mitochondrial membrane 20	15	Helical; (Potential).				protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane translocase complex	P-P-bond-hydrolysis-driven protein transmembrane transporter activity|unfolded protein binding				0	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;6.33e-05)|Epithelial(3;8.26e-05)			CAATGAAAAGGGCCCCGCATA	0.607													35	76	---	---	---	---	PASS
EXO1	9156	broad.mit.edu	37	1	242035336	242035336	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242035336G>T	uc001hzh.2	+	12	1810	c.1270G>T	c.(1270-1272)GAG>TAG	p.E424*	EXO1_uc001hzi.2_Nonsense_Mutation_p.E424*|EXO1_uc001hzj.2_Nonsense_Mutation_p.E424*|EXO1_uc009xgq.2_Splice_Site_p.E423_splice	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b	424	Interaction with MLH1.				meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			TTATTTAGCAGAGCTGTCAGA	0.333								Direct_reversal_of_damage|Editing_and_processing_nucleases					13	21	---	---	---	---	PASS
OR6F1	343169	broad.mit.edu	37	1	247875736	247875736	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247875736C>A	uc001idj.1	-	1	322	c.322G>T	c.(322-324)GGC>TGC	p.G108C		NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F,	108	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TCTGTGCAGCCTAATGAGAAA	0.498													13	65	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1842979	1842979	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1842979G>T	uc002qxe.2	-	21	3849	c.3022C>A	c.(3022-3024)CCC>ACC	p.P1008T	MYT1L_uc002qxd.2_Missense_Mutation_p.P1006T|MYT1L_uc010ewk.2_Missense_Mutation_p.P4T	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1008	C2HC-type 6.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CCTGGCGTGGGGCAGGACATG	0.672													7	13	---	---	---	---	PASS
KIDINS220	57498	broad.mit.edu	37	2	8871217	8871217	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8871217T>C	uc002qzc.2	-	30	5131	c.4949A>G	c.(4948-4950)AAG>AGG	p.K1650R	KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Missense_Mutation_p.K1551R|KIDINS220_uc002qzb.2_Missense_Mutation_p.K504R	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa	1650	Cytoplasmic (Potential).				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AGGGCTTTTCTTGTCTTCTGA	0.522													16	39	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25965124	25965124	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25965124G>A	uc002rgs.2	-	12	4303	c.4082C>T	c.(4081-4083)TCA>TTA	p.S1361L	ASXL2_uc002rgt.1_Missense_Mutation_p.S844L	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	1361					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACAGTCACTGAAAATGACAT	0.493													22	44	---	---	---	---	PASS
ZNF513	130557	broad.mit.edu	37	2	27603054	27603054	+	Silent	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27603054T>C	uc002rkk.2	-	2	317	c.117A>G	c.(115-117)CTA>CTG	p.L39L	ZNF513_uc002rkj.2_5'UTR	NM_144631	NP_653232	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	39					regulation of transcription, DNA-dependent|response to stimulus|retina development in camera-type eye|transcription, DNA-dependent|visual perception	nucleus	transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGGCCTAGTAGCAAATCAC	0.572													49	103	---	---	---	---	PASS
EML4	27436	broad.mit.edu	37	2	42396747	42396747	+	5'UTR	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42396747G>T	uc002rsi.2	+	1					EML4_uc002rsh.3_5'UTR|EML4_uc010fap.2_5'UTR	NM_019063	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4						microtubule-based process|mitosis	cytoplasm|microtubule	protein binding		EML4/ALK(246)	lung(246)|ovary(2)|central_nervous_system(1)|skin(1)	250						CGCTTTCCCCGCAAGATGGAC	0.637			T	ALK	NSCLC								4	16	---	---	---	---	PASS
ABCG8	64241	broad.mit.edu	37	2	44104801	44104801	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44104801C>A	uc002rtq.2	+	12	1948	c.1858C>A	c.(1858-1860)CTC>ATC	p.L620I	ABCG8_uc010yoa.1_Missense_Mutation_p.L619I	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN	ATP-binding cassette sub-family G member 8	620	ABC transmembrane type-2.|Extracellular (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			skin(3)|ovary(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TCTCGGGAACCTCACCATCGC	0.517											OREG0014582	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	44	---	---	---	---	PASS
DNAH6	1768	broad.mit.edu	37	2	84785056	84785056	+	Silent	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84785056A>T	uc010fgb.2	+	11	1937	c.1800A>T	c.(1798-1800)ATA>ATT	p.I600I	DNAH6_uc002soo.2_Silent_p.I179I|DNAH6_uc002sop.2_Silent_p.I179I	NM_001370	NP_001361	Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy polypeptide 6	600	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			central_nervous_system(1)	1						TTTCTCAAATAAAGGTATGTT	0.259													11	27	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89309696	89309696	+	RNA	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89309696C>G	uc010ytr.1	-	74		c.6651G>C			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		ACTGGCCCGGCAAGTGATGGT	0.488													60	145	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89475975	89475975	+	RNA	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89475975C>A	uc010ytr.1	-	28		c.3506G>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TGGAGGCTGGCCTGGCCTCTG	0.527													38	84	---	---	---	---	PASS
INPP4A	3631	broad.mit.edu	37	2	99181196	99181196	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99181196G>T	uc002syy.2	+	20	2530	c.2137G>T	c.(2137-2139)GCC>TCC	p.A713S	INPP4A_uc010yvj.1_Missense_Mutation_p.A674S|INPP4A_uc010yvk.1_Missense_Mutation_p.A674S|INPP4A_uc002syx.2_Missense_Mutation_p.A708S|INPP4A_uc010fik.2_Intron	NM_001134224	NP_001127696	Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type 1	713					signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			kidney(1)	1						CGGGCTGCTGGCCCAGTTCGA	0.622													4	4	---	---	---	---	PASS
MBD5	55777	broad.mit.edu	37	2	149247363	149247363	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149247363G>T	uc002twm.3	+	12	4451	c.3463G>T	c.(3463-3465)GAT>TAT	p.D1155Y	MBD5_uc010zbs.1_Intron|MBD5_uc010fns.2_Missense_Mutation_p.D1155Y|MBD5_uc002two.2_Missense_Mutation_p.D413Y|MBD5_uc002twp.2_Missense_Mutation_p.D205Y	NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1155						chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		TGTTGATCATGATGGTAGGCT	0.488													15	41	---	---	---	---	PASS
STAM2	10254	broad.mit.edu	37	2	152977290	152977290	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152977290G>T	uc002tyc.3	-	14	1726	c.1376C>A	c.(1375-1377)CCT>CAT	p.P459H		NM_005843	NP_005834	O75886	STAM2_HUMAN	signal transducing adaptor molecule 2	459					cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.22)		CATATAAGTAGGATTGGAAAC	0.358													5	57	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166897952	166897952	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166897952G>A	uc010zcz.1	-	13	2189	c.2171C>T	c.(2170-2172)CCA>CTA	p.P724L	SCN1A_uc002udo.3_Missense_Mutation_p.P604L|SCN1A_uc010fpk.2_Missense_Mutation_p.P576L	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	735						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	CCAACAGGGTGGGCATTTCTG	0.348													17	47	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	167760268	167760268	+	Silent	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167760268G>T	uc002udx.2	+	1	294	c.276G>T	c.(274-276)CGG>CGT	p.R92R	XIRP2_uc010fpn.2_Silent_p.R92R|XIRP2_uc010fpo.2_Silent_p.R92R|XIRP2_uc010fpp.2_Silent_p.R92R	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	Error:Variant_position_missing_in_A4UGR9_after_alignment					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						AATATGGTCGGCCAGAAGTGC	0.522													20	28	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168103133	168103133	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168103133A>T	uc002udx.2	+	8	5249	c.5231A>T	c.(5230-5232)CAG>CTG	p.Q1744L	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.Q1569L|XIRP2_uc010fpq.2_Missense_Mutation_p.Q1522L|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1569					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GGAAATGTTCAGTTTTTCACA	0.378													17	21	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168106057	168106057	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168106057G>C	uc002udx.2	+	8	8173	c.8155G>C	c.(8155-8157)GAT>CAT	p.D2719H	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.D2544H|XIRP2_uc010fpq.2_Missense_Mutation_p.D2497H|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Missense_Mutation_p.D65H	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2544					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TCCAACTCTAGATCATACATT	0.348													17	83	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170042267	170042267	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170042267G>A	uc002ues.2	-	50	9804	c.9591C>T	c.(9589-9591)ATC>ATT	p.I3197I		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3197	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	GATAGGGTTCGATGTTACTGT	0.438													36	116	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179636118	179636118	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179636118G>A	uc010zfg.1	-	34	8160	c.7936C>T	c.(7936-7938)CCA>TCA	p.P2646S	TTN_uc010zfh.1_Missense_Mutation_p.P2600S|TTN_uc010zfi.1_Missense_Mutation_p.P2600S|TTN_uc010zfj.1_Missense_Mutation_p.P2600S|TTN_uc002unb.2_Missense_Mutation_p.P2646S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2646							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGAATCTGGGTTGGCAACT	0.483													15	28	---	---	---	---	PASS
NDUFS1	4719	broad.mit.edu	37	2	207008770	207008770	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207008770T>A	uc002vbe.2	-	10	1086	c.959A>T	c.(958-960)GAG>GTG	p.E320V	NDUFS1_uc010ziq.1_Missense_Mutation_p.E334V|NDUFS1_uc010zir.1_Missense_Mutation_p.E284V|NDUFS1_uc010zis.1_Missense_Mutation_p.E263V|NDUFS1_uc010zit.1_Missense_Mutation_p.E209V|NDUFS1_uc010ziu.1_Missense_Mutation_p.E204V	NM_005006	NP_004997	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1,	320					apoptosis|ATP metabolic process|mitochondrial electron transport, NADH to ubiquinone|reactive oxygen species metabolic process|regulation of mitochondrial membrane potential|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	GAGCGCATCCTCCCAAGAAGT	0.393													25	23	---	---	---	---	PASS
IQCA1	79781	broad.mit.edu	37	2	237300976	237300976	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237300976C>A	uc002vvz.1	-	10	1410	c.1228G>T	c.(1228-1230)GAT>TAT	p.D410Y	IQCA1_uc002vwb.2_Missense_Mutation_p.D417Y|IQCA1_uc002vwa.1_RNA|IQCA1_uc010zni.1_Missense_Mutation_p.D369Y	NM_024726	NP_079002	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	410	Lys-rich.						ATP binding			ovary(1)	1						CAAGACTCATCTTTTTTCATC	0.333													3	6	---	---	---	---	PASS
C2orf85	285093	broad.mit.edu	37	2	242814655	242814655	+	Silent	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242814655C>G	uc010fzu.1	+	2	971	c.948C>G	c.(946-948)GTC>GTG	p.V316V		NM_173821	NP_776182	Q14D33	CB085_HUMAN	hypothetical protein LOC285093	316						integral to membrane				ovary(1)	1						ATGGCCTCGTCCCTGTGGGGA	0.657													7	12	---	---	---	---	PASS
CACNA2D2	9254	broad.mit.edu	37	3	50402790	50402790	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50402790G>A	uc003daq.2	-	36	3154	c.3116C>T	c.(3115-3117)TCC>TTC	p.S1039F	CACNA2D2_uc003dap.2_Missense_Mutation_p.S1032F|CACNA2D2_uc003dao.2_Silent_p.L77L	NM_006030	NP_006021	Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha	1039	Extracellular (Potential).				energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)	CCAGCACCTGGAGCAGTTTCC	0.562													9	9	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62522231	62522231	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62522231G>A	uc003dll.2	-	12	2352	c.1992C>T	c.(1990-1992)GGC>GGT	p.G664G	CADPS_uc003dlk.1_Silent_p.G168G|CADPS_uc003dlm.2_Silent_p.G664G|CADPS_uc003dln.2_Silent_p.G664G	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	664					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		ATTCATCCATGCCATGTTTTT	0.383													21	33	---	---	---	---	PASS
ABI3BP	25890	broad.mit.edu	37	3	100594368	100594368	+	Silent	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100594368C>G	uc003dun.2	-	8	907	c.822G>C	c.(820-822)CTG>CTC	p.L274L	ABI3BP_uc003duo.2_Silent_p.L267L|ABI3BP_uc003dup.3_Silent_p.L267L	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein	274						extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						TCACTCCTCCCAGTGGAGCTT	0.438													12	62	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108211976	108211976	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108211976C>G	uc003dxa.1	-	9	877	c.820G>C	c.(820-822)GTG>CTG	p.V274L		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	274	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						TCAATGTCCACAGATGACAGC	0.318													4	60	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108724127	108724127	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108724127G>A	uc003dxl.2	-	19	1890	c.1803C>T	c.(1801-1803)GGC>GGT	p.G601G	MORC1_uc011bhn.1_Silent_p.G580G	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	601					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						TCAAGTCATCGCCCAAAAGCC	0.353													7	56	---	---	---	---	PASS
RABL3	285282	broad.mit.edu	37	3	120408716	120408716	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120408716C>T	uc003edx.2	-	8	695	c.665G>A	c.(664-666)CGG>CAG	p.R222Q		NM_173825	NP_776186	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3	222	Small GTPase-like.				small GTPase mediated signal transduction		GTP binding				0				GBM - Glioblastoma multiforme(114;0.151)		AAATCTTTTCCGATCAGGAAA	0.378													11	100	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126734175	126734175	+	Intron	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126734175A>G	uc003ejg.2	+							NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1						axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		TACGGGGTGCAGGTGGGGGTG	0.657													7	17	---	---	---	---	PASS
EEFSEC	60678	broad.mit.edu	37	3	127965812	127965812	+	Silent	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127965812C>G	uc003eki.2	+	2	488	c.450C>G	c.(448-450)CTC>CTG	p.L150L	EEFSEC_uc003ekj.2_Silent_p.L150L	NM_021937	NP_068756	P57772	SELB_HUMAN	eukaryotic elongation factor,	150	GTP (Potential).					cytoplasm|nucleus	GTP binding|GTPase activity|translation elongation factor activity			ovary(1)	1						AAATAGACCTCTTACCTGAAG	0.483													86	253	---	---	---	---	PASS
AGTR1	185	broad.mit.edu	37	3	148459456	148459456	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148459456C>A	uc003ewg.2	+	4	1080	c.634C>A	c.(634-636)CTT>ATT	p.L212I	AGTR1_uc003ewh.2_Missense_Mutation_p.L212I|AGTR1_uc003ewi.2_Missense_Mutation_p.L212I|AGTR1_uc003ewj.2_Missense_Mutation_p.L212I|AGTR1_uc003ewk.2_Missense_Mutation_p.L212I	NM_031850	NP_114038	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	212	Helical; Name=5; (Potential).				calcium-mediated signaling|cell chemotaxis|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|kidney development|low-density lipoprotein particle remodeling|positive regulation of cellular protein metabolic process|positive regulation of cholesterol esterification|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of phospholipase A2 activity|positive regulation of reactive oxygen species metabolic process|regulation of cell growth|regulation of cell proliferation|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|Rho protein signal transduction		acetyltransferase activator activity|angiotensin type I receptor activity|angiotensin type II receptor activity|bradykinin receptor binding|protein heterodimerization activity				0			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Spironolactone(DB00421)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	TCTGATCATTCTTACAAGTTA	0.363													8	56	---	---	---	---	PASS
IGSF10	285313	broad.mit.edu	37	3	151164451	151164451	+	Silent	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151164451G>T	uc011bod.1	-	4	3318	c.3318C>A	c.(3316-3318)GTC>GTA	p.V1106V		NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	1106					cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTGGATTCTGGACTAGAGTTG	0.443													31	184	---	---	---	---	PASS
GPR149	344758	broad.mit.edu	37	3	154055904	154055904	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154055904A>T	uc003faa.2	-	4	1880	c.1780T>A	c.(1780-1782)TCC>ACC	p.S594T		NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	594	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			ACACTTTTGGATCGATAGACT	0.413													10	177	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155203419	155203419	+	Silent	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155203419T>C	uc011bok.1	-	22	3001	c.2724A>G	c.(2722-2724)GTA>GTG	p.V908V	PLCH1_uc011boj.1_Silent_p.V908V|PLCH1_uc011bol.1_Silent_p.V870V	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	908					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			ATCGCTTCCGTACATAATGGG	0.463													38	23	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164709160	164709160	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164709160C>A	uc003fei.2	-	44	5151	c.5089G>T	c.(5089-5091)GCT>TCT	p.A1697S		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1697	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	GTGTTTTGAGCTGGCTCTTGA	0.333										HNSCC(35;0.089)			18	77	---	---	---	---	PASS
PLD1	5337	broad.mit.edu	37	3	171320967	171320967	+	Silent	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171320967T>C	uc003fhs.2	-	27	3242	c.3126A>G	c.(3124-3126)GGA>GGG	p.G1042G	PLD1_uc003fht.2_Silent_p.G1004G	NM_002662	NP_002653	Q13393	PLD1_HUMAN	phospholipase D1 isoform a	1042					cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	GCACCAAAAATCCACGGATCT	0.433													18	63	---	---	---	---	PASS
NDUFB5	4711	broad.mit.edu	37	3	179322629	179322629	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179322629G>C	uc003fkc.2	+	1	55	c.26G>C	c.(25-27)CGG>CCG	p.R9P	MRPL47_uc003fjz.2_5'Flank|MRPL47_uc003fka.2_5'Flank|MRPL47_uc003fkb.2_5'Flank|NDUFB5_uc003fkd.2_RNA|NDUFB5_uc003fke.2_Missense_Mutation_p.R9P	NM_002492	NP_002483	O43674	NDUB5_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	9					mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			skin(1)	1	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)		NADH(DB00157)	TTGTTGCGGCGGGTTTCGGTT	0.607													22	36	---	---	---	---	PASS
IGF2BP2	10644	broad.mit.edu	37	3	185407290	185407290	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185407290C>T	uc003fpo.2	-	6	609	c.530G>A	c.(529-531)CGG>CAG	p.R177Q	IGF2BP2_uc010hyi.2_Missense_Mutation_p.R120Q|IGF2BP2_uc010hyj.2_Missense_Mutation_p.R114Q|IGF2BP2_uc010hyk.2_Missense_Mutation_p.R41Q|IGF2BP2_uc010hyl.2_Missense_Mutation_p.R114Q|IGF2BP2_uc003fpp.2_Missense_Mutation_p.R177Q|IGF2BP2_uc003fpq.2_Missense_Mutation_p.R182Q	NM_006548	NP_006539	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding	177					anatomical structure morphogenesis|negative regulation of translation	cytoskeletal part|cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity				0	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			GCCTTGCTCCCGGGAAGAGTG	0.602													13	107	---	---	---	---	PASS
OPA1	4976	broad.mit.edu	37	3	193380757	193380757	+	Intron	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193380757A>T	uc003ftm.2	+						OPA1_uc003ftg.2_Intron|OPA1_uc003fth.2_Intron|OPA1_uc003fti.2_Intron|OPA1_uc003ftj.2_Intron|OPA1_uc003ftk.2_Intron|OPA1_uc003ftl.2_Intron|OPA1_uc003ftn.2_Intron	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1						apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		GCTTGGTAATAAATACTGCTG	0.378													8	58	---	---	---	---	PASS
ATP13A3	79572	broad.mit.edu	37	3	194167745	194167745	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194167745G>C	uc003fty.3	-	13	1810	c.1408C>G	c.(1408-1410)CAG>GAG	p.Q470E	ATP13A3_uc003ftz.1_Missense_Mutation_p.Q176E	NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3	470					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		AGTCTTCTCTGAGCATACACA	0.403													7	108	---	---	---	---	PASS
BDH1	622	broad.mit.edu	37	3	197260416	197260416	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197260416C>A	uc003fxr.2	-	4	502	c.100G>T	c.(100-102)GGT>TGT	p.G34C	BDH1_uc003fxs.2_Missense_Mutation_p.G34C|BDH1_uc003fxt.2_5'UTR|BDH1_uc003fxu.2_Missense_Mutation_p.G34C	NM_203314	NP_976059	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1	34					cellular lipid metabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	3-hydroxybutyrate dehydrogenase activity			ovary(1)	1	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)	NADH(DB00157)	GAAGTAGAACCAAGCAATAGT	0.572													6	145	---	---	---	---	PASS
EVC2	132884	broad.mit.edu	37	4	5687126	5687126	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5687126C>A	uc003gij.2	-	6	841	c.787G>T	c.(787-789)GCC>TCC	p.A263S	EVC2_uc011bwb.1_5'UTR|EVC2_uc003gik.2_Missense_Mutation_p.A183S	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin	263						integral to membrane				large_intestine(3)|ovary(2)	5						GTGAGTTGGGCAGGAAGCTTG	0.527													73	52	---	---	---	---	PASS
TBC1D14	57533	broad.mit.edu	37	4	6969027	6969027	+	Intron	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6969027A>G	uc011bwg.1	+						TBC1D14_uc003gjs.3_Intron	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a							intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						TTTTCTTCCTATAGGAACTTG	0.423													12	75	---	---	---	---	PASS
CPZ	8532	broad.mit.edu	37	4	8613863	8613863	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8613863G>T	uc003glm.2	+	8	1463	c.1337G>T	c.(1336-1338)GGG>GTG	p.G446V	CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Missense_Mutation_p.G309V|CPZ_uc003glo.2_Missense_Mutation_p.G435V|CPZ_uc003glp.2_RNA	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	446					proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3						ATCATCAACGGGGCGGACTGG	0.408													4	16	---	---	---	---	PASS
BST1	683	broad.mit.edu	37	4	15716916	15716916	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15716916G>T	uc003goh.3	+	5	738	c.543G>T	c.(541-543)AAG>AAT	p.K181N	BST1_uc003goi.2_Translation_Start_Site	NM_004334	NP_004325	Q10588	BST1_HUMAN	bone marrow stromal cell antigen 1 precursor	181					humoral immune response|multicellular organismal development	anchored to membrane|extrinsic to membrane|plasma membrane	binding|NAD+ nucleosidase activity			central_nervous_system(1)	1						AGTATTCCAAGGATAGTTCTG	0.323													4	27	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	54257168	54257168	+	Intron	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54257168A>T	uc003haa.2	+						FIP1L1_uc003gzx.3_Intron|FIP1L1_uc011bzt.1_Intron|FIP1L1_uc003gzy.2_Intron|FIP1L1_uc011bzu.1_Intron|FIP1L1_uc003gzz.2_Intron|FIP1L1_uc003hab.2_Intron|FIP1L1_uc003hac.2_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	GTTGTGTTTTATCTTTAGGTG	0.279			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			12	21	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134072866	134072866	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134072866A>G	uc003iha.2	+	1	2397	c.1571A>G	c.(1570-1572)TAC>TGC	p.Y524C	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.Y524C	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	524	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		GAGAACGGCTACTTGTACGCC	0.587													9	39	---	---	---	---	PASS
TBC1D9	23158	broad.mit.edu	37	4	141600878	141600878	+	Silent	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141600878G>C	uc010ioj.2	-	4	752	c.480C>G	c.(478-480)CTC>CTG	p.L160L		NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	160	GRAM 1.					intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				AATAGTTGACGAGTTTCTCTT	0.418													6	26	---	---	---	---	PASS
RNF150	57484	broad.mit.edu	37	4	141888789	141888789	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141888789C>G	uc003iio.1	-	2	1377	c.723G>C	c.(721-723)AGG>AGC	p.R241S	RNF150_uc010iok.1_Intron|RNF150_uc003iip.1_Missense_Mutation_p.R241S	NM_020724	NP_065775	Q9ULK6	RN150_HUMAN	ring finger protein 150 precursor	241	Cytoplasmic (Potential).					integral to membrane	zinc ion binding			ovary(1)	1	all_hematologic(180;0.162)					GGTTCCTATCCCTGGCATTTG	0.368													14	38	---	---	---	---	PASS
HHIP	64399	broad.mit.edu	37	4	145655962	145655962	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145655962G>T	uc003ijs.1	+	12	2485	c.1830G>T	c.(1828-1830)AGG>AGT	p.R610S		NM_022475	NP_071920	Q96QV1	HHIP_HUMAN	hedgehog-interacting protein precursor	610	EGF-like 1.					cytoplasm|extracellular region	catalytic activity|protein binding|zinc ion binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		AGTGCTCCAGGCTCTGTCGAA	0.502													11	28	---	---	---	---	PASS
ABCE1	6059	broad.mit.edu	37	4	146026771	146026771	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146026771G>C	uc003ijx.2	+	3	558	c.118G>C	c.(118-120)GAG>CAG	p.E40Q	ABCE1_uc003ijy.2_Missense_Mutation_p.E40Q|ABCE1_uc010iot.2_RNA	NM_001040876	NP_001035809	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E, member 1	40					interspecies interaction between organisms|response to virus|RNA catabolic process	mitochondrion	ATP binding|ATPase activity|electron carrier activity|iron-sulfur cluster binding|ribonuclease inhibitor activity			skin(1)	1	all_hematologic(180;0.151)					ATTATGCATAGAGGTTACACC	0.328													13	36	---	---	---	---	PASS
KIAA0922	23240	broad.mit.edu	37	4	154512253	154512253	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154512253G>T	uc003inm.3	+	17	1768	c.1716G>T	c.(1714-1716)AAG>AAT	p.K572N	KIAA0922_uc010ipp.2_Missense_Mutation_p.K573N|KIAA0922_uc010ipq.2_Intron	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2	572	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				AGAAATCCAAGGAGTCAGAGT	0.378													5	73	---	---	---	---	PASS
TDO2	6999	broad.mit.edu	37	4	156831260	156831260	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156831260G>C	uc003ipf.1	+	6	579	c.515G>C	c.(514-516)AGA>ACA	p.R172T		NM_005651	NP_005642	P48775	T23O_HUMAN	tryptophan 2,3-dioxygenase	172					tryptophan catabolic process to kynurenine	cytosol	tryptophan 2,3-dioxygenase activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)	L-Tryptophan(DB00150)	CAGAACATGAGAGTCCCTTAT	0.373													9	39	---	---	---	---	PASS
DDX60L	91351	broad.mit.edu	37	4	169342912	169342912	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169342912T>A	uc003irq.3	-	17	2614	c.2393A>T	c.(2392-2394)AAG>ATG	p.K798M	DDX60L_uc003irr.1_Missense_Mutation_p.K798M|DDX60L_uc003irs.1_Missense_Mutation_p.K525M	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	798	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		AAACACTACCTTTGCGGGTGC	0.453													36	76	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	226069	226069	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:226069G>C	uc003jao.3	+	5	643	c.528G>C	c.(526-528)CAG>CAC	p.Q176H	SDHA_uc003jan.2_Missense_Mutation_p.Q176H|SDHA_uc011clv.1_Missense_Mutation_p.Q176H|SDHA_uc011clw.1_Missense_Mutation_p.Q128H|SDHA_uc003jap.3_Missense_Mutation_p.Q176H|SDHA_uc003jaq.3_5'Flank	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,	176					nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	TTGGTGGACAGAGCCTCAAGT	0.483									Familial_Paragangliomas				7	149	---	---	---	---	PASS
SLC6A3	6531	broad.mit.edu	37	5	1432761	1432761	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1432761G>A	uc003jck.2	-	4	592	c.471C>T	c.(469-471)AAC>AAT	p.N157N		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	157	Helical; Name=3; (Potential).				cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	CGATGATGACGTTGTAGAAGA	0.597													22	46	---	---	---	---	PASS
SEMA5A	9037	broad.mit.edu	37	5	9154614	9154614	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9154614G>A	uc003jek.2	-	12	2179	c.1467C>T	c.(1465-1467)TTC>TTT	p.F489F		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	489	Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						GTGTGCGGTAGAACTGGCACC	0.627													12	60	---	---	---	---	PASS
PRLR	5618	broad.mit.edu	37	5	35086375	35086375	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35086375G>T	uc003jjm.2	-	4	668	c.138C>A	c.(136-138)TGC>TGA	p.C46*	PRLR_uc003jjg.1_Nonsense_Mutation_p.C46*|PRLR_uc003jjh.1_Nonsense_Mutation_p.C46*|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Nonsense_Mutation_p.C46*|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Intron|PRLR_uc010iuw.1_Translation_Start_Site	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor	46	Fibronectin type-III 1.|Extracellular (Potential).				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	GCCTCCACCAGCAGGTGAATG	0.458													49	60	---	---	---	---	PASS
NUP155	9631	broad.mit.edu	37	5	37337909	37337909	+	Intron	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37337909G>T	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGAATTGTCAGGATAACTTAC	0.318													5	71	---	---	---	---	PASS
HTR1A	3350	broad.mit.edu	37	5	63256881	63256881	+	Silent	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63256881C>G	uc011cqt.1	-	1	666	c.666G>C	c.(664-666)GCG>GCC	p.A222A		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	222	Cytoplasmic (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	TGCGGAAGCGCGCAGCTCGGA	0.562													33	51	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70840961	70840961	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70840961A>T	uc003kbp.1	+	32	6922	c.6659A>T	c.(6658-6660)GAT>GTT	p.D2220V	BDP1_uc003kbo.2_Missense_Mutation_p.D2220V|BDP1_uc003kbq.1_RNA|BDP1_uc003kbr.1_RNA	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	2220					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		CTTGGTTTGGATAGGGGTCTT	0.463													18	60	---	---	---	---	PASS
CAMK4	814	broad.mit.edu	37	5	110809012	110809012	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110809012C>A	uc011cvj.1	+	9	728	c.629C>A	c.(628-630)CCT>CAT	p.P210H	CAMK4_uc003kpf.2_Missense_Mutation_p.P210H|CAMK4_uc010jbv.2_Missense_Mutation_p.P13H	NM_001744	NP_001735	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	210	Protein kinase.				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(3)|lung(2)	5		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		TCTGCAGCACCTGAAATTCTT	0.318													5	69	---	---	---	---	PASS
APC	324	broad.mit.edu	37	5	112173893	112173893	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112173893G>C	uc010jby.2	+	16	2982	c.2602G>C	c.(2602-2604)GAA>CAA	p.E868Q	APC_uc011cvt.1_Missense_Mutation_p.E850Q|APC_uc003kpz.3_Missense_Mutation_p.E868Q|APC_uc003kpy.3_Missense_Mutation_p.E868Q|APC_uc010jbz.2_Missense_Mutation_p.E585Q|APC_uc010jca.2_Missense_Mutation_p.E168Q	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	868	Ser-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.E868*(1)|p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCCAGCAACAGAAAATCCAGG	0.453		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			25	23	---	---	---	---	PASS
DMXL1	1657	broad.mit.edu	37	5	118484909	118484909	+	Silent	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118484909A>G	uc003ksd.2	+	18	3568	c.3387A>G	c.(3385-3387)AAA>AAG	p.K1129K	DMXL1_uc010jcl.1_Silent_p.K1129K	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1129										ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TATCTAGTAAAGAGAATATCA	0.333													10	53	---	---	---	---	PASS
TCF7	6932	broad.mit.edu	37	5	133478442	133478442	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133478442G>T	uc003kyt.2	+	7	982	c.786G>T	c.(784-786)AAG>AAT	p.K262N	TCF7_uc003kyu.1_Missense_Mutation_p.K147N|TCF7_uc003kyv.2_Missense_Mutation_p.K147N|TCF7_uc003kyw.2_Missense_Mutation_p.K147N|TCF7_uc003kyx.2_Missense_Mutation_p.K60N|TCF7_uc003kyy.2_Missense_Mutation_p.K147N|TCF7_uc003kyz.2_Missense_Mutation_p.K147N|TCF7_uc003kza.2_Missense_Mutation_p.K147N|TCF7_uc003kzb.2_Missense_Mutation_p.K76N|TCF7_uc010jdu.2_5'Flank	NM_003202	NP_003193	P36402	TCF7_HUMAN	transcription factor 7 (T-cell specific,	262					cellular response to interleukin-4|immune response|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription regulatory region DNA binding				0		Breast(839;0.058)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGCAGAGAAGGAGGCCAAGA	0.532													5	67	---	---	---	---	PASS
CATSPER3	347732	broad.mit.edu	37	5	134305628	134305628	+	Splice_Site	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134305628G>T	uc003lag.2	+	2	167	c.99_splice	c.e2-1	p.K33_splice		NM_178019	NP_821138	Q86XQ3	CTSR3_HUMAN	cation channel, sperm associated 3						cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTTTTTGACAGGAGGAACGAT	0.393													5	71	---	---	---	---	PASS
KDM3B	51780	broad.mit.edu	37	5	137762958	137762958	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137762958C>G	uc003lcy.1	+	19	4783	c.4583C>G	c.(4582-4584)CCT>CGT	p.P1528R	KDM3B_uc010jew.1_Missense_Mutation_p.P1184R|KDM3B_uc011cys.1_Missense_Mutation_p.P560R	NM_016604	NP_057688	Q7LBC6	KDM3B_HUMAN	jumonji domain containing 1B	1528	JmjC.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11						TCTAGGCTACCTAGCTACTTT	0.463													24	41	---	---	---	---	PASS
PCDHB6	56130	broad.mit.edu	37	5	140531962	140531962	+	Silent	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140531962G>C	uc003lir.2	+	1	2124	c.2124G>C	c.(2122-2124)GCG>GCC	p.A708A	PCDHB6_uc011dah.1_Silent_p.A572A	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	708	Helical; (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGTTCGTGGCGGTGCGGCTGT	0.682													16	57	---	---	---	---	PASS
PCDHGA5	56110	broad.mit.edu	37	5	140744848	140744848	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140744848G>T	uc003lju.1	+	1	951	c.951G>T	c.(949-951)ATG>ATT	p.M317I	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Missense_Mutation_p.M317I	NM_018918	NP_061741	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5 isoform 1	317	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTACCTCATGGAAGTGGTAG	0.478													10	18	---	---	---	---	PASS
PCDHGA6	56109	broad.mit.edu	37	5	140756055	140756055	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140756055G>T	uc003ljy.1	+	1	2405	c.2405G>T	c.(2404-2406)GGA>GTA	p.G802V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Missense_Mutation_p.G802V	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	802	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAACGAAAGGAGAACCCAGG	0.478													21	38	---	---	---	---	PASS
PCDHGA6	56109	broad.mit.edu	37	5	140756056	140756056	+	Silent	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140756056A>T	uc003ljy.1	+	1	2406	c.2406A>T	c.(2404-2406)GGA>GGT	p.G802G	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Silent_p.G802G	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	802	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAACGAAAGGAGAACCCAGGC	0.483													21	38	---	---	---	---	PASS
PCDHGB4	8641	broad.mit.edu	37	5	140769650	140769650	+	Silent	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140769650C>T	uc003lkc.1	+	1	2199	c.2199C>T	c.(2197-2199)TCC>TCT	p.S733S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Silent_p.S733S	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	733	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGTTAAATCCGAATCCGTGG	0.527													45	114	---	---	---	---	PASS
PCDHGA10	56106	broad.mit.edu	37	5	140794536	140794536	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140794536G>A	uc003lkl.1	+	1	1794	c.1794G>A	c.(1792-1794)GTG>GTA	p.V598V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc011day.1_Silent_p.V598V|PCDHGB7_uc003lkm.2_5'Flank|PCDHGB7_uc003lkn.1_5'Flank	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1	598	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTGGCGGTGGACAGAGACT	0.697													13	60	---	---	---	---	PASS
HAVCR2	84868	broad.mit.edu	37	5	156533930	156533930	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156533930G>A	uc003lwk.1	-	2	246	c.102C>T	c.(100-102)GCC>GCT	p.A34A	HAVCR2_uc003lwl.2_Silent_p.A34A	NM_032782	NP_116171	Q8TDQ0	HAVR2_HUMAN	T cell immunoglobulin mucin 3 precursor	34	Ig-like V-type.|Extracellular (Potential).					integral to membrane					0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGGGCAGATAGGCATTCTGAC	0.572													17	68	---	---	---	---	PASS
HNRNPH1	3187	broad.mit.edu	37	5	179044048	179044048	+	Intron	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179044048C>A	uc003mkf.3	-						HNRNPH1_uc011dgn.1_Missense_Mutation_p.S104I|HNRNPH1_uc003mkg.3_Intron|HNRNPH1_uc003mke.3_Intron|HNRNPH1_uc003mkh.3_Intron	NM_005520	NP_005511	P31943	HNRH1_HUMAN	heterogeneous nuclear ribonucleoprotein H1						regulation of RNA splicing	actin cytoskeleton|catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|poly(U) RNA binding|protein binding				0						TAGCATTTGGCTACCGTAAGC	0.368													4	68	---	---	---	---	PASS
KIF13A	63971	broad.mit.edu	37	6	17781053	17781053	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17781053G>T	uc003ncg.3	-	31	3859	c.3754C>A	c.(3754-3756)CTA>ATA	p.L1252I	KIF13A_uc003ncf.2_Missense_Mutation_p.L1239I|KIF13A_uc003nch.3_Missense_Mutation_p.L1252I|KIF13A_uc003nci.3_Missense_Mutation_p.L1239I|KIF13A_uc003nce.1_5'Flank	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	1252					cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TTCACAATTAGGTAAATCCTT	0.428													6	82	---	---	---	---	PASS
KIF13A	63971	broad.mit.edu	37	6	17817326	17817326	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17817326T>G	uc003ncg.3	-	17	2030	c.1925A>C	c.(1924-1926)CAG>CCG	p.Q642P	KIF13A_uc003ncf.2_Missense_Mutation_p.Q642P|KIF13A_uc003nch.3_Missense_Mutation_p.Q642P|KIF13A_uc003nci.3_Missense_Mutation_p.Q642P|KIF13A_uc003ncj.2_Missense_Mutation_p.Q318P	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	642	Potential.				cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GCCGCTACTCTGTGGCTGCCT	0.622													6	10	---	---	---	---	PASS
CDKAL1	54901	broad.mit.edu	37	6	20955674	20955674	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20955674C>G	uc003ndc.1	+	10	941	c.767C>G	c.(766-768)ACC>AGC	p.T256S	CDKAL1_uc003ndd.1_Missense_Mutation_p.T256S|CDKAL1_uc003nde.1_Missense_Mutation_p.T186S	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein	256					RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			ATATGGTTGACCAGTGAAGAC	0.458													42	25	---	---	---	---	PASS
GPLD1	2822	broad.mit.edu	37	6	24476472	24476472	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24476472C>A	uc003ned.1	-	4	378	c.267G>T	c.(265-267)TGG>TGT	p.W89C	GPLD1_uc010jpr.1_5'UTR|GPLD1_uc010jps.1_Missense_Mutation_p.W89C|GPLD1_uc003nee.2_Missense_Mutation_p.W89C	NM_001503	NP_001494	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific	89						extracellular region	glycosylphosphatidylinositol phospholipase D activity			ovary(2)|kidney(1)	3						GAAACGGAGTCCAGTGAGTGC	0.433													5	6	---	---	---	---	PASS
HIST1H2BJ	8970	broad.mit.edu	37	6	27100230	27100230	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27100230G>A	uc003niv.2	-	1	346	c.300C>T	c.(298-300)CGC>CGT	p.R100R	HIST1H2BJ_uc003niu.1_Intron|HIST1H2AG_uc003niw.2_5'Flank	NM_021058	NP_066402	P06899	H2B1J_HUMAN	histone cluster 1, H2bj	100					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding				0						GCAGCAGCAGGCGCACGGCCG	0.592													52	35	---	---	---	---	PASS
C6orf222	389384	broad.mit.edu	37	6	36298332	36298332	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36298332T>C	uc003oly.2	-	2	314	c.136A>G	c.(136-138)AAG>GAG	p.K46E		NM_001010903	NP_001010903	P0C671	CF222_HUMAN	hypothetical protein LOC389384	46										skin(2)|ovary(1)|breast(1)	4						TGAAGCGCCTTCCTGGAGGGG	0.652													37	21	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57512691	57512691	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57512691G>T	uc003pdx.2	+	15	1606	c.1519G>T	c.(1519-1521)GAA>TAA	p.E507*		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	507					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTACTTTAGTGAAGATTCTTA	0.333													39	229	---	---	---	---	PASS
FUT9	10690	broad.mit.edu	37	6	96651734	96651734	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96651734A>G	uc003pop.3	+	3	1044	c.703A>G	c.(703-705)ATA>GTA	p.I235V		NM_006581	NP_006572	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3)	235	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			skin(4)|ovary(1)	5		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		GATTCCTACCATATCTACTTG	0.353													6	26	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112452259	112452259	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112452259C>T	uc003pvu.2	-	29	4188	c.3879G>A	c.(3877-3879)ATG>ATA	p.M1293I	LAMA4_uc003pvv.2_Missense_Mutation_p.M1286I|LAMA4_uc003pvt.2_Missense_Mutation_p.M1286I	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	1293	Laminin G-like 3.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	p.M1286I(1)		ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CCTTTACATCCATGATGACAG	0.453													17	64	---	---	---	---	PASS
VNN2	8875	broad.mit.edu	37	6	133065475	133065475	+	Silent	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133065475T>C	uc003qdt.2	-	7	1538	c.1527A>G	c.(1525-1527)TTA>TTG	p.L509L	VNN2_uc003qds.2_Silent_p.L218L|VNN2_uc010kgb.2_Silent_p.L288L|VNN2_uc003qdv.2_Silent_p.L456L	NM_004665	NP_004656	O95498	VNN2_HUMAN	vanin 2 isoform 1 precursor	509					cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		CTATGATCATTAATAATATGA	0.398													13	94	---	---	---	---	PASS
ICA1	3382	broad.mit.edu	37	7	8167536	8167536	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8167536G>T	uc003srm.2	-	13	1364	c.1297C>A	c.(1297-1299)CAA>AAA	p.Q433K	ICA1_uc010ktr.2_Missense_Mutation_p.Q462K|ICA1_uc003srl.2_Missense_Mutation_p.Q421K|ICA1_uc003srn.3_Missense_Mutation_p.Q359K|ICA1_uc003srp.3_Missense_Mutation_p.Q432K|ICA1_uc010kts.2_RNA|ICA1_uc003srq.2_Missense_Mutation_p.Q433K|ICA1_uc003srr.2_Missense_Mutation_p.Q432K|ICA1_uc003sro.3_Missense_Mutation_p.Q433K	NM_022307	NP_071682	Q05084	ICA69_HUMAN	islet cell autoantigen 1	433					neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		TTCATATTTTGGTCTAAAAGC	0.488													7	157	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20682900	20682900	+	Silent	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20682900C>A	uc010kuh.2	+	6	645	c.408C>A	c.(406-408)ACC>ACA	p.T136T		NM_001163941	NP_001157413	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	320	Extracellular (Potential).|ABC transmembrane type-1.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						CACGACAGACCAAGAGGATTC	0.423													5	23	---	---	---	---	PASS
HIBADH	11112	broad.mit.edu	37	7	27582650	27582650	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27582650G>T	uc003szf.2	-	5	749	c.554C>A	c.(553-555)GCC>GAC	p.A185D	HIBADH_uc003szg.2_Missense_Mutation_p.A136D|HIBADH_uc003szh.2_Missense_Mutation_p.A84D|HIBADH_uc003szi.2_Missense_Mutation_p.A136D	NM_152740	NP_689953	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase precursor	185					branched chain family amino acid catabolic process|pentose-phosphate shunt|valine metabolic process	mitochondrial matrix	3-hydroxyisobutyrate dehydrogenase activity|NAD binding|phosphogluconate dehydrogenase (decarboxylating) activity			ovary(2)	2			GBM - Glioblastoma multiforme(3;0.0368)		NADH(DB00157)	CAACTCTTGGGCAGCAGCAAA	0.493													11	38	---	---	---	---	PASS
TBX20	57057	broad.mit.edu	37	7	35289604	35289604	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35289604G>T	uc011kas.1	-	2	350	c.339C>A	c.(337-339)TTC>TTA	p.F113L		NM_001077653	NP_001071121	Q9UMR3	TBX20_HUMAN	T-box transcription factor TBX20	113	T-box.					nucleus	DNA binding			central_nervous_system(1)	1						CCAGCTCATGGAATTTGTCCC	0.582													11	29	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38389105	38389105	+	Intron	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38389105C>A	uc003tgp.1	+						uc003tgq.1_Missense_Mutation_p.D69Y					Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		TTGGAGACGTCATAGTACAGA	0.458													22	60	---	---	---	---	PASS
POU6F2	11281	broad.mit.edu	37	7	39446339	39446339	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39446339G>T	uc003thb.1	+	6	1068	c.1026G>T	c.(1024-1026)CAG>CAT	p.Q342H		NM_007252	NP_009183	P78424	PO6F2_HUMAN	POU class 6 homeobox 2 isoform 1	342	Gln-rich.				central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						CACAAGGACAGGTGAGTGGGA	0.468													15	51	---	---	---	---	PASS
PKD1L1	168507	broad.mit.edu	37	7	47968883	47968883	+	Silent	SNP	G	A	A	rs142684649		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47968883G>A	uc003tny.1	-	7	978	c.978C>T	c.(976-978)TTC>TTT	p.F326F		NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	326	Extracellular (Potential).				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						AACTGTCCCCGAAATCCATCA	0.512													63	140	---	---	---	---	PASS
ANKIB1	54467	broad.mit.edu	37	7	91974291	91974291	+	Splice_Site	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91974291G>A	uc003ulw.2	+	7	1373	c.997_splice	c.e7-1	p.C333_splice		NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1								protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TTCATCTCCAGTGTGACATTT	0.353													52	153	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100675507	100675507	+	Silent	SNP	T	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100675507T>A	uc003uxp.1	+	3	863	c.810T>A	c.(808-810)CCT>CCA	p.P270P	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	270	Extracellular (Potential).|59 X approximate tandem repeats.|2.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ACTCAGCTCCTAGTGGAGGAA	0.507													60	123	---	---	---	---	PASS
LHFPL3	375612	broad.mit.edu	37	7	103969486	103969486	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103969486G>T	uc003vce.2	+	1	383	c.259G>T	c.(259-261)GAG>TAG	p.E87*	LHFPL3_uc003vcf.2_Nonsense_Mutation_p.E87*	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	73						integral to membrane					0						CTTCTCCCGGGAGCTGACCTG	0.617													4	21	---	---	---	---	PASS
RINT1	60561	broad.mit.edu	37	7	105204355	105204355	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105204355G>T	uc003vda.1	+	12	2078	c.1847G>T	c.(1846-1848)AGA>ATA	p.R616I	RINT1_uc010ljj.1_Missense_Mutation_p.R191I	NM_021930	NP_068749	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	616	RINT1/TIP20.				cell cycle|G2/M transition DNA damage checkpoint|protein transport|vesicle-mediated transport	endoplasmic reticulum membrane	protein binding			ovary(3)|central_nervous_system(1)	4						CACGTTTTTAGAGAAGTTAAA	0.368													5	43	---	---	---	---	PASS
LAMB4	22798	broad.mit.edu	37	7	107688550	107688550	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107688550C>G	uc010ljo.1	-	28	4213	c.4129G>C	c.(4129-4131)GGA>CGA	p.G1377R	LAMB4_uc003vey.2_Missense_Mutation_p.G1377R|LAMB4_uc010ljp.1_Missense_Mutation_p.G346R	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	1377	Domain alpha.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						CCTGGATCTCCGCACACCTTG	0.433													10	30	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142104152	142104152	+	Intron	SNP	T	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142104152T>A	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc003vyy.3_RNA					SubName: Full=V_segment translation product; Flags: Fragment;																		TATACAGATGTCTGGGAGGGA	0.537													50	115	---	---	---	---	PASS
OR2A25	392138	broad.mit.edu	37	7	143771754	143771754	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143771754T>C	uc011ktx.1	+	1	442	c.442T>C	c.(442-444)TGG>CGG	p.W148R		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	148	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					ATTGACTTCCTGGATTTTAGG	0.458													30	67	---	---	---	---	PASS
ZNF395	55893	broad.mit.edu	37	8	28207684	28207684	+	Intron	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28207684C>G	uc003xgq.2	-						ZNF395_uc003xgt.2_Intron|ZNF395_uc003xgr.2_Intron|ZNF395_uc003xgs.2_Intron	NM_018660	NP_061130	Q9H8N7	ZN395_HUMAN	zinc finger protein 395						transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding				0		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		CTGCGGAAGACGAGGGTGTCA	0.592													3	5	---	---	---	---	PASS
INTS9	55756	broad.mit.edu	37	8	28695255	28695255	+	Silent	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28695255G>T	uc003xha.2	-	5	599	c.300C>A	c.(298-300)CTC>CTA	p.L100L	INTS9_uc011lav.1_Silent_p.L76L|INTS9_uc011law.1_Silent_p.L79L|INTS9_uc011lax.1_5'UTR|INTS9_uc010lvc.2_RNA|INTS9_uc003xhb.2_Silent_p.L100L	NM_018250	NP_060720	Q9NV88	INT9_HUMAN	integrator complex subunit 9 isoform 1	100					snRNA processing	integrator complex	protein binding			central_nervous_system(1)|pancreas(1)	2		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		AGTTAGAGATGAGAATCACAT	0.468													4	35	---	---	---	---	PASS
RAB11FIP1	80223	broad.mit.edu	37	8	37734976	37734976	+	Silent	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37734976G>T	uc003xkm.1	-	2	509	c.465C>A	c.(463-465)GCC>GCA	p.A155A	RAB11FIP1_uc010lvz.1_Silent_p.A3A|RAB11FIP1_uc003xkn.1_Silent_p.A155A|RAB11FIP1_uc003xkp.1_Silent_p.A3A	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3	155					protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			CAAACATGCTGGCAGTCATGT	0.438													8	190	---	---	---	---	PASS
ADAM18	8749	broad.mit.edu	37	8	39502981	39502981	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39502981A>T	uc003xni.2	+	11	1034	c.1034A>T	c.(1033-1035)AAT>ATT	p.N345I	ADAM18_uc010lww.2_RNA|ADAM18_uc010lwx.2_Missense_Mutation_p.N321I	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	a disintegrin and metalloprotease domain 18	345	Peptidase M12B.|Extracellular (Potential).				cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			TGCATCATGAATCATGAAGCA	0.303													26	16	---	---	---	---	PASS
CHRNA6	8973	broad.mit.edu	37	8	42608341	42608341	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42608341C>G	uc003xpj.2	-	6	1512	c.1466G>C	c.(1465-1467)GGG>GCG	p.G489A	CHRNA6_uc011lcw.1_Missense_Mutation_p.G474A	NM_004198	NP_004189	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6	489						cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)			TCCTGTGTTCCCAAGTAGTGG	0.383													18	188	---	---	---	---	PASS
FNTA	2339	broad.mit.edu	37	8	42924714	42924714	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42924714C>G	uc003xps.2	+	4	466	c.418C>G	c.(418-420)CTT>GTT	p.L140V	FNTA_uc003xpt.2_Missense_Mutation_p.L49V|FNTA_uc003xpu.2_Missense_Mutation_p.L73V|FNTA_uc003xpv.2_RNA	NM_002027	NP_002018	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha isoform a	140	PFTA 1.				cellular component disassembly involved in apoptosis|positive regulation of deacetylase activity|positive regulation of tubulin deacetylation|protein farnesylation|protein geranylgeranylation|transforming growth factor beta receptor signaling pathway	cytosol|microtubule associated complex	alpha-tubulin binding|CAAX-protein geranylgeranyltransferase activity|microtubule binding|protein farnesyltransferase activity			ovary(1)	1	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			CCGGAGAGTTCTTTTGAAGTC	0.373													13	92	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69129843	69129843	+	Intron	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69129843G>C	uc003xxv.1	+							NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						CCTTGCCTTGGCCCACAGGTG	0.512													3	20	---	---	---	---	PASS
PI15	51050	broad.mit.edu	37	8	75757649	75757649	+	Silent	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75757649C>T	uc003yal.2	+	5	737	c.558C>T	c.(556-558)TGC>TGT	p.C186C	uc003yak.1_Intron|PI15_uc003yam.2_Silent_p.C186C	NM_015886	NP_056970	O43692	PI15_HUMAN	protease inhibitor 15 preproprotein	186						extracellular region	peptidase inhibitor activity			central_nervous_system(2)|ovary(1)	3	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			GGATAGGATGCGCAATTCATA	0.428													9	34	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77618662	77618662	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77618662G>C	uc003yav.2	+	2	2726	c.2339G>C	c.(2338-2340)AGG>ACG	p.R780T	ZFHX4_uc003yat.1_Missense_Mutation_p.R780T|ZFHX4_uc003yau.1_Missense_Mutation_p.R780T|ZFHX4_uc003yaw.1_Missense_Mutation_p.R780T	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	780	C2H2-type 4; degenerate.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AATGTCGCCAGGAACCTCCGA	0.493										HNSCC(33;0.089)			13	16	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110457075	110457075	+	Silent	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110457075A>G	uc003yne.2	+	38	5081	c.4977A>G	c.(4975-4977)CCA>CCG	p.P1659P		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1659	IPT/TIG 9.|Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TACTTTTGCCAAACATTGACC	0.433										HNSCC(38;0.096)			18	86	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139268978	139268978	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139268978C>G	uc003yuy.2	-	5	493	c.322G>C	c.(322-324)GAT>CAT	p.D108H	FAM135B_uc003yux.2_Missense_Mutation_p.D9H|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	108										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AGTTGAAAATCTACTTCACTC	0.433										HNSCC(54;0.14)			3	19	---	---	---	---	PASS
TLN1	7094	broad.mit.edu	37	9	35710609	35710609	+	Silent	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35710609G>T	uc003zxt.2	-	33	4629	c.4275C>A	c.(4273-4275)GCC>GCA	p.A1425A		NM_006289	NP_006280	Q9Y490	TLN1_HUMAN	talin 1	1425	Interaction with SYNM.				axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding			lung(7)|breast(3)|ovary(2)|central_nervous_system(1)	13	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTGTGGAAATGGCATCTCCAA	0.527													4	24	---	---	---	---	PASS
TLN1	7094	broad.mit.edu	37	9	35720146	35720146	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35720146T>C	uc003zxt.2	-	13	1708	c.1354A>G	c.(1354-1356)ATC>GTC	p.I452V		NM_006289	NP_006280	Q9Y490	TLN1_HUMAN	talin 1	452					axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding			lung(7)|breast(3)|ovary(2)|central_nervous_system(1)	13	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GAGCGCATGATGGCAGGCAGG	0.592													8	25	---	---	---	---	PASS
C9orf85	138241	broad.mit.edu	37	9	74526735	74526735	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74526735A>T	uc004ain.2	+	1	313	c.85A>T	c.(85-87)AAA>TAA	p.K29*	C9orf85_uc004aio.2_RNA|C9orf85_uc010mou.2_RNA|C9orf85_uc010mov.2_RNA|FAM108B1_uc004ail.2_5'Flank|FAM108B1_uc004aim.1_5'Flank	NM_182505	NP_872311	Q96MD7	CI085_HUMAN	hypothetical protein LOC138241	29	Lys-rich.										0						CAAGTTCGATAAAAGTGTGCA	0.507													25	58	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79325136	79325136	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79325136G>C	uc010mpk.2	-	8	2178	c.2054C>G	c.(2053-2055)TCA>TGA	p.S685*		NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	685					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						CTCTTTCCATGATTCAGGGCT	0.473													7	29	---	---	---	---	PASS
AGTPBP1	23287	broad.mit.edu	37	9	88200380	88200380	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88200380T>A	uc011ltd.1	-	22	3196	c.3163A>T	c.(3163-3165)AGG>TGG	p.R1055W	AGTPBP1_uc004aod.3_Missense_Mutation_p.R681W|AGTPBP1_uc011ltc.1_Intron|AGTPBP1_uc010mqc.2_Missense_Mutation_p.R1015W|AGTPBP1_uc011lte.1_Missense_Mutation_p.R1067W	NM_015239	NP_056054	Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	1055					C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(4)|large_intestine(2)|skin(1)	7						ATAATTACCCTGTATCCCGTA	0.313													9	52	---	---	---	---	PASS
PHF2	5253	broad.mit.edu	37	9	96416756	96416756	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96416756G>T	uc004aub.2	+	7	998	c.851G>T	c.(850-852)TGG>TTG	p.W284L	PHF2_uc011lug.1_Missense_Mutation_p.W167L	NM_005392	NP_005383	O75151	PHF2_HUMAN	PHD finger protein 2	284	JmjC.				liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		TATGAGCGCTGGCGGTCTGCC	0.582													5	51	---	---	---	---	PASS
PHF2	5253	broad.mit.edu	37	9	96437969	96437969	+	Silent	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96437969C>T	uc004aub.2	+	20	2877	c.2730C>T	c.(2728-2730)GTC>GTT	p.V910V	PHF2_uc011lug.1_Silent_p.V793V|PHF2_uc004auc.2_Silent_p.V330V	NM_005392	NP_005383	O75151	PHF2_HUMAN	PHD finger protein 2	910					liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		CAGCAAGGGTCGGCCCATCGG	0.657													11	28	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101747997	101747997	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101747997C>T	uc004azb.1	+	3	457	c.251C>T	c.(250-252)CCA>CTA	p.P84L	COL15A1_uc004aza.2_Missense_Mutation_p.P84L	NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	84	TSP N-terminal.				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				ACTCTCATCCCATCCACCTTC	0.617													5	37	---	---	---	---	PASS
HSPA5	3309	broad.mit.edu	37	9	128001220	128001220	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128001220C>A	uc004bpn.2	-	5	1252	c.996G>T	c.(994-996)ATG>ATT	p.M332I		NM_005347	NP_005338	P11021	GRP78_HUMAN	heat shock 70kDa protein 5	332					anti-apoptosis|cellular response to glucose starvation|ER-associated protein catabolic process|platelet activation|platelet degranulation|regulation of protein folding in endoplasmic reticulum	cell surface|endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|integral to endoplasmic reticulum membrane|melanosome|midbody|nucleus|perinuclear region of cytoplasm	ATP binding|ATPase activity|calcium ion binding|caspase inhibitor activity|chaperone binding|misfolded protein binding|protein binding, bridging|protein domain specific binding|ubiquitin protein ligase binding|unfolded protein binding			ovary(3)|skin(1)	4					Antihemophilic Factor(DB00025)	AGGAACATACCATGTTGAGCT	0.398										Prostate(1;0.17)			5	48	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137655528	137655528	+	Intron	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137655528C>A	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TGCCTTTTTTCTCCTCTGCAG	0.597													5	50	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37508523	37508523	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37508523A>G	uc001iza.1	+	34	3814	c.3715A>G	c.(3715-3717)ATG>GTG	p.M1239V		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1295	Potential.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						ACAGTGTCAAATGAAGGAAGC	0.358													7	17	---	---	---	---	PASS
PGBD3	267004	broad.mit.edu	37	10	50723876	50723876	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50723876G>T	uc001jht.2	-	2	1540	c.1285C>A	c.(1285-1287)CAT>AAT	p.H429N	ERCC6_uc001jhs.3_Intron|PGBD3_uc009xoe.2_Missense_Mutation_p.H897N|PGBD3_uc001jhu.2_Missense_Mutation_p.H897N	NM_170753	NP_736609	Q8N328	PGBD3_HUMAN	hypothetical protein LOC267004	429										pancreas(1)|breast(1)|skin(1)	3						CACAGGGGATGGATACCAGCA	0.428													5	73	---	---	---	---	PASS
PRKG1	5592	broad.mit.edu	37	10	54048748	54048748	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54048748G>A	uc001jjm.2	+	16	2039	c.1845G>A	c.(1843-1845)AAG>AAA	p.K615K	PRKG1_uc001jjo.2_Silent_p.K630K|PRKG1_uc009xow.1_Silent_p.K333K|uc001jjq.1_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform	615	Protein kinase.				actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		ACATTCAAAAGCACAAGTAAG	0.313													19	51	---	---	---	---	PASS
BICC1	80114	broad.mit.edu	37	10	60546717	60546717	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60546717A>T	uc001jki.1	+	5	422	c.422A>T	c.(421-423)CAT>CTT	p.H141L		NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1	141	KH 1.				multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4						GATGTTTCACATACAGAACAT	0.363													5	16	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61835211	61835211	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61835211C>A	uc001jky.2	-	37	5620	c.5428G>T	c.(5428-5430)GCA>TCA	p.A1810S	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	1810	Ser-rich.				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						GAGGTAGTTGCAGATATTGAC	0.423													21	91	---	---	---	---	PASS
HK1	3098	broad.mit.edu	37	10	71075707	71075707	+	5'Flank	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71075707C>T	uc001jpl.3	+						HK1_uc009xqc.1_Intron|HK1_uc001jpg.3_Intron|HK1_uc001jph.3_Intron|HK1_uc001jpi.3_Intron|HK1_uc001jpj.3_Intron|HK1_uc001jpk.3_5'UTR|HK1_uc009xqd.2_5'Flank	NM_000188	NP_000179	P19367	HXK1_HUMAN	hexokinase 1 isoform HKI						glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity			ovary(1)	1						GGGTGTATATCCAGATGGACT	0.328													27	57	---	---	---	---	PASS
LRIT2	340745	broad.mit.edu	37	10	85982088	85982088	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85982088C>A	uc001kcy.2	-	3	1249	c.1241G>T	c.(1240-1242)GGA>GTA	p.G414V	LRIT2_uc010qmc.1_Missense_Mutation_p.G424V	NM_001017924	NP_001017924	A6NDA9	LRIT2_HUMAN	leucine rich repeat containing 22 precursor	414	Fibronectin type-III.					integral to membrane				ovary(2)	2						AGTATTGATTCCGGGGCCAAT	0.552													29	29	---	---	---	---	PASS
SLK	9748	broad.mit.edu	37	10	105779491	105779491	+	Splice_Site	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105779491G>T	uc001kxo.1	+	16	3167	c.3133_splice	c.e16-1	p.E1045_splice	SLK_uc001kxp.1_Splice_Site_p.E1014_splice	NM_014720	NP_055535	Q9H2G2	SLK_HUMAN	serine/threonine kinase 2						apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity			ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		AACTTTCATAGGAAACAGAGC	0.358													5	74	---	---	---	---	PASS
AFAP1L2	84632	broad.mit.edu	37	10	116060044	116060044	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116060044G>C	uc001lbn.2	-	15	2167	c.1866C>G	c.(1864-1866)ATC>ATG	p.I622M	AFAP1L2_uc001lbo.2_Missense_Mutation_p.I622M|AFAP1L2_uc010qse.1_Missense_Mutation_p.I675M|AFAP1L2_uc001lbp.2_Missense_Mutation_p.I650M|AFAP1L2_uc001lbr.1_Missense_Mutation_p.I621M|AFAP1L2_uc001lbm.2_Missense_Mutation_p.I61M|AFAP1L2_uc010qsd.1_Missense_Mutation_p.I188M|AFAP1L2_uc001lbq.1_Missense_Mutation_p.I144M	NM_001001936	NP_001001936	Q8N4X5	AF1L2_HUMAN	KIAA1914 protein isoform 1	622					inflammatory response|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of transcription, DNA-dependent|regulation of interleukin-6 production|regulation of mitotic cell cycle	cytoplasm	protein tyrosine kinase activator activity|SH2 domain binding|SH3 domain binding			ovary(1)|breast(1)	2		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		GTGGGAAGGAGATTCTCTGCT	0.597													25	39	---	---	---	---	PASS
DOCK1	1793	broad.mit.edu	37	10	129237453	129237453	+	Silent	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129237453C>T	uc001ljt.2	+	49	5224	c.5160C>T	c.(5158-5160)TCC>TCT	p.S1720S	DOCK1_uc010qun.1_Silent_p.S1741S|DOCK1_uc009yaq.2_Silent_p.S715S	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1720					apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CCGACATTTCCCTGCAGCAGT	0.403													8	12	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1031985	1031985	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1031985C>G	uc001lsw.2	-	3	235	c.184G>C	c.(184-186)GAC>CAC	p.D62H		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	62	VWFD 1.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCCGAGAAGTCGTACACGTGG	0.632													19	33	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1248602	1248602	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1248602C>A	uc009ycr.1	+	22	2735	c.2609C>A	c.(2608-2610)CCG>CAG	p.P870Q	MUC5B_uc009yct.1_Missense_Mutation_p.P214Q|MUC5B_uc001ltb.2_Missense_Mutation_p.P214Q|MUC5B_uc001lta.2_5'Flank	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	214	VWFD 1.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AACGGCCTCCCGGCCTTCAAC	0.637													4	18	---	---	---	---	PASS
OR52K2	119774	broad.mit.edu	37	11	4471455	4471455	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4471455G>A	uc001lyz.1	+	1	886	c.886G>A	c.(886-888)GTC>ATC	p.V296I		NM_001005172	NP_001005172	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K,	296	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		AATCTATGGTGTCAAGACCAA	0.507													12	45	---	---	---	---	PASS
OR52J3	119679	broad.mit.edu	37	11	5068652	5068652	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5068652G>T	uc010qyv.1	+	1	897	c.897G>T	c.(895-897)CAG>CAT	p.Q299H		NM_001001916	NP_001001916	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J,	299	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|lung(1)|skin(1)	3		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGACCAAACAGATTCGAGAAC	0.378													20	38	---	---	---	---	PASS
TPP1	1200	broad.mit.edu	37	11	6635769	6635769	+	3'UTR	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6635769G>C	uc001mel.1	-	13					TAF10_uc001mej.1_5'Flank|TPP1_uc001mek.1_3'UTR	NM_000391	NP_000382	O14773	TPP1_HUMAN	tripeptidyl-peptidase I preproprotein						bone resorption|cell death|lipid metabolic process|lysosome organization|nervous system development|neuromuscular process controlling balance|peptide catabolic process|protein catabolic process|proteolysis	lysosome|melanosome|soluble fraction	metal ion binding|peptide binding|protein binding|serine-type endopeptidase activity|tripeptidyl-peptidase activity				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)		TCTCCTGATAGGAAAGGGTCA	0.552													15	28	---	---	---	---	PASS
WT1	7490	broad.mit.edu	37	11	32439126	32439126	+	Missense_Mutation	SNP	T	G	G	rs67297380		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32439126T>G	uc001mtn.1	-	4	1143	c.947A>C	c.(946-948)AAG>ACG	p.K316T	WT1_uc001mtl.1_Missense_Mutation_p.K104T|WT1_uc001mtm.1_Missense_Mutation_p.K104T|WT1_uc001mto.1_Missense_Mutation_p.K316T|WT1_uc001mtp.1_Missense_Mutation_p.K316T|WT1_uc001mtq.1_Missense_Mutation_p.K316T|WT1_uc009yjs.1_RNA	NM_024426	NP_077744	P19544	WT1_HUMAN	Wilms tumor 1 isoform D	248					adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	p.E316fs*4(1)	EWSR1/WT1(231)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			ACCTTACCCCTTTAAGGTGGC	0.368			D|Mis|N|F|S	EWSR1	Wilms|desmoplastic small round cell tumor	Wilms			Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				5	37	---	---	---	---	PASS
EXT2	2132	broad.mit.edu	37	11	44105241	44105241	+	Intron	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44105241C>G	uc010rfo.1	+						ACCS_uc009yks.1_Intron|ACCS_uc001mxx.2_Intron	NM_207122	NP_997005	Q93063	EXT2_HUMAN	exostosin 2 isoform 2						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity			lung(2)|breast(2)|skin(1)	5						CTTCCCCTTCCCAGGGATGCA	0.617			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses				8	15	---	---	---	---	PASS
FOLH1	2346	broad.mit.edu	37	11	49175867	49175867	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49175867C>T	uc001ngy.2	-	16	2062	c.1801G>A	c.(1801-1803)GCT>ACT	p.A601T	FOLH1_uc001ngx.2_Missense_Mutation_p.A33T|FOLH1_uc001ngz.2_Missense_Mutation_p.A601T|FOLH1_uc009yly.2_Missense_Mutation_p.A586T|FOLH1_uc009ylz.2_Missense_Mutation_p.A586T|FOLH1_uc009yma.2_Missense_Mutation_p.A293T	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	601	Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	AAAACTACAGCATAATCTCGA	0.393													11	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	56143109	56143109	+	IGR	SNP	A	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56143109A>C								OR8J1 (14438 upstream) : OR5R1 (41627 downstream)																							TATGGCTCACATCAATTGCAC	0.393													8	20	---	---	---	---	PASS
OR5M3	219482	broad.mit.edu	37	11	56237681	56237681	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56237681T>C	uc010rjk.1	-	1	293	c.293A>G	c.(292-294)CAG>CGG	p.Q98R		NM_001004742	NP_001004742	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M,	98	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					GAAGAAACACTGTACTAAACA	0.368													23	53	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62288412	62288412	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62288412C>T	uc001ntl.2	-	5	13777	c.13477G>A	c.(13477-13479)GTA>ATA	p.V4493I	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4493					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				TCAATGTCTACCTCTGGCCCT	0.448													25	64	---	---	---	---	PASS
CDK2AP2	10263	broad.mit.edu	37	11	67275064	67275064	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67275064T>A	uc001oma.2	-	2	728	c.179A>T	c.(178-180)CAG>CTG	p.Q60L	PITPNM1_uc001oly.2_5'Flank|PITPNM1_uc001olz.2_5'Flank|CDK2AP2_uc009yry.2_RNA|CDK2AP2_uc001omb.2_Missense_Mutation_p.Q69L	NM_005851	NP_005842	O75956	CDKA2_HUMAN	cyclin-dependent kinase 2 associated protein 2	60											0						CCCACTCACCTGCACGTAGCC	0.622													12	26	---	---	---	---	PASS
TYR	7299	broad.mit.edu	37	11	89017960	89017960	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89017960C>T	uc001pcs.2	+	4	1286	c.1204C>T	c.(1204-1206)CGA>TGA	p.R402*		NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor	402	Lumenal, melanosome (Potential).		R -> L (in OCA1A).|R -> G (in OCA1B).		eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)	GCAGTGGCTCCGAAGGCACCG	0.373									Oculocutaneous_Albinism				6	11	---	---	---	---	PASS
ACAT1	38	broad.mit.edu	37	11	108004595	108004595	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108004595G>T	uc001pjy.2	+	3	245	c.169G>T	c.(169-171)GGC>TGC	p.G57C	ACAT1_uc001pjw.1_Missense_Mutation_p.G57C|ACAT1_uc001pjx.2_Translation_Start_Site	NM_000019	NP_000010	P24752	THIL_HUMAN	acetyl-Coenzyme A acetyltransferase 1 precursor	57					acetoacetic acid biosynthetic process|branched chain family amino acid catabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	acetyl-CoA C-acetyltransferase activity|metal ion binding			ovary(3)	3		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	ATCTTTTTTAGGCAGCCTTTC	0.418													4	29	---	---	---	---	PASS
ALG9	79796	broad.mit.edu	37	11	111706942	111706942	+	Silent	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111706942G>T	uc001pmb.2	-	14	1626	c.1527C>A	c.(1525-1527)ACC>ACA	p.T509T	ALG9_uc001ply.2_Silent_p.T338T|ALG9_uc001plz.2_Silent_p.T345T|ALG9_uc010rwm.1_Silent_p.T516T|ALG9_uc010rwn.1_Silent_p.T463T|ALG9_uc010rwo.1_Silent_p.T337T	NM_001077690	NP_001071158	Q9H6U8	ALG9_HUMAN	asparagine-linked glycosylation 9 protein	509	Lumenal (Potential).				dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			large_intestine(1)|ovary(1)	2		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		GAACAATCCGGGTGGCCAGAG	0.438													5	46	---	---	---	---	PASS
OR4D5	219875	broad.mit.edu	37	11	123811094	123811094	+	Silent	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123811094C>A	uc001pzk.1	+	1	771	c.771C>A	c.(769-771)GTC>GTA	p.V257V		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	257	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GCATCTACGTCTATACAAGGC	0.532													25	36	---	---	---	---	PASS
TMEM45B	120224	broad.mit.edu	37	11	129722407	129722407	+	Silent	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129722407A>G	uc001qfe.1	+	2	91	c.30A>G	c.(28-30)CCA>CCG	p.P10P	TMEM45B_uc001qff.1_Silent_p.P10P	NM_138788	NP_620143	Q96B21	TM45B_HUMAN	transmembrane protein 45B	10	Helical; (Potential).					integral to membrane					0	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.012)|Lung(977;0.179)|LUSC - Lung squamous cell carcinoma(976;0.189)		ACGCGCTTCCAGGGAGTTTCT	0.468													10	26	---	---	---	---	PASS
GLB1L2	89944	broad.mit.edu	37	11	134239766	134239766	+	Missense_Mutation	SNP	C	A	A	rs149460505		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134239766C>A	uc001qhp.2	+	11	1283	c.1095C>A	c.(1093-1095)TTC>TTA	p.F365L	GLB1L2_uc009zdg.1_RNA	NM_138342	NP_612351	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2 precursor	365					carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(1)|pancreas(1)|skin(1)	3	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		GAGACTTCTTCGGCTCCATCT	0.537													4	53	---	---	---	---	PASS
MFAP5	8076	broad.mit.edu	37	12	8813482	8813482	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8813482A>T	uc001qut.1	-	3	284	c.71T>A	c.(70-72)CTG>CAG	p.L24Q	MFAP5_uc001qus.2_Missense_Mutation_p.L24Q|MFAP5_uc009zge.1_Missense_Mutation_p.L24Q	NM_003480	NP_003471	Q13361	MFAP5_HUMAN	microfibrillar associated protein 5 precursor	24						microfibril	extracellular matrix structural constituent			breast(1)	1	Lung SC(5;0.184)					ATTGACCCCCAGGGGTATCCA	0.428													10	61	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9305507	9305507	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9305507G>T	uc001qvl.2	-	31	4063	c.4034C>A	c.(4033-4035)TCC>TAC	p.S1345Y	PZP_uc009zgl.2_Missense_Mutation_p.S1131Y	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						AGCAAATGGGGAGTCCTCTTT	0.443													30	43	---	---	---	---	PASS
PRB1	5542	broad.mit.edu	37	12	11506883	11506883	+	Missense_Mutation	SNP	G	T	T	rs141106766		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11506883G>T	uc001qzw.1	-	3	191	c.154C>A	c.(154-156)CCT>ACT	p.P52T	PRB1_uc001qzu.1_Missense_Mutation_p.P52T|PRB1_uc001qzv.1_Missense_Mutation_p.P52T	NM_005039	NP_005030	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1 isoform 1	52						extracellular region					0			OV - Ovarian serous cystadenocarcinoma(49;0.185)			CCTGGAGGAGGTGGGGGGCCC	0.577													41	130	---	---	---	---	PASS
PTPRO	5800	broad.mit.edu	37	12	15654661	15654661	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15654661G>A	uc001rcv.1	+	5	943	c.769G>A	c.(769-771)GAT>AAT	p.D257N	PTPRO_uc001rcw.1_Missense_Mutation_p.D257N|PTPRO_uc001rcu.1_Missense_Mutation_p.D257N	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	257	Fibronectin type-III 3.|Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				GAGATCACAAGATACAATAGG	0.393													11	33	---	---	---	---	PASS
CCNT1	904	broad.mit.edu	37	12	49086827	49086827	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49086827G>T	uc001rse.1	-	9	2493	c.2170C>A	c.(2170-2172)CTT>ATT	p.L724I	LOC144438_uc001rsd.3_5'Flank|CCNT1_uc009zkz.1_Missense_Mutation_p.L439I	NM_001240	NP_001231	O60563	CCNT1_HUMAN	cyclin T1	724	Pro-rich.				cell cycle|cell division|interspecies interaction between organisms|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	DNA binding|protein kinase binding			ovary(3)|lung(1)|breast(1)|skin(1)	6						TACTTAGGAAGGGGTGGAAGT	0.388													4	20	---	---	---	---	PASS
RPS26	6231	broad.mit.edu	37	12	56436328	56436328	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56436328T>G	uc001sjf.2	+	2	388	c.123T>G	c.(121-123)ATT>ATG	p.I41M		NM_001029	NP_001020	P62854	RS26_HUMAN	ribosomal protein S26	41					endocrine pancreas development|negative regulation of RNA splicing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	mRNA binding|protein binding|structural constituent of ribosome			breast(1)	1			OV - Ovarian serous cystadenocarcinoma(18;0.123)			AATTCGTCATTCGAAACATAG	0.557													5	33	---	---	---	---	PASS
ATP5B	506	broad.mit.edu	37	12	57033843	57033843	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57033843G>T	uc001slr.2	-	8	1313	c.1208C>A	c.(1207-1209)TCC>TAC	p.S403Y		NM_001686	NP_001677	P06576	ATPB_HUMAN	mitochondrial ATP synthase beta subunit	403					angiogenesis|ATP hydrolysis coupled proton transport|regulation of intracellular pH|respiratory electron transport chain	cell surface|mitochondrial nucleoid|mitochondrial proton-transporting ATP synthase, catalytic core|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|hydrogen-exporting ATPase activity, phosphorylative mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)	1						ACGAGAGGTGGAGTCTAGAGG	0.522													5	62	---	---	---	---	PASS
SLC16A7	9194	broad.mit.edu	37	12	60169075	60169075	+	Silent	SNP	G	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60169075G>C	uc001sqs.2	+	5	1298	c.999G>C	c.(997-999)CTG>CTC	p.L333L	SLC16A7_uc001sqt.2_Silent_p.L333L|SLC16A7_uc001squ.2_Silent_p.L333L|SLC16A7_uc009zqi.2_Silent_p.L234L|SLC16A7_uc010ssi.1_Silent_p.L234L	NM_004731	NP_004722	O60669	MOT2_HUMAN	solute carrier family 16, member 7	333	Helical; (Potential).					integral to plasma membrane|membrane fraction	pyruvate secondary active transmembrane transporter activity|secondary active monocarboxylate transmembrane transporter activity|symporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(3;0.0303)	Pyruvic acid(DB00119)	TGTGCCCACTGGCACAGGACT	0.423													14	81	---	---	---	---	PASS
ACSS3	79611	broad.mit.edu	37	12	81624881	81624881	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81624881G>T	uc001szl.1	+	12	1651	c.1560G>T	c.(1558-1560)CAG>CAT	p.Q520H	ACSS3_uc001szm.1_Missense_Mutation_p.Q519H|ACSS3_uc001szn.1_Missense_Mutation_p.Q202H	NM_024560	NP_078836	Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	520						mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						GGAAGAATCAGGAAGCATTCA	0.303													5	18	---	---	---	---	PASS
RASSF9	9182	broad.mit.edu	37	12	86199109	86199109	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86199109C>A	uc001taf.1	-	2	1018	c.679G>T	c.(679-681)GGA>TGA	p.G227*		NM_005447	NP_005438	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family	227	Potential.				endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity			ovary(1)	1						TAGTTTTCTCCATCATTTTCT	0.398													51	56	---	---	---	---	PASS
MYBPC1	4604	broad.mit.edu	37	12	102076422	102076422	+	Intron	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102076422C>A	uc001tii.2	+						MYBPC1_uc001tig.2_Intron|MYBPC1_uc010svq.1_Intron|MYBPC1_uc001tih.2_Missense_Mutation_p.F1158L|MYBPC1_uc001tij.2_Intron|MYBPC1_uc010svr.1_Missense_Mutation_p.F1133L|MYBPC1_uc010svs.1_Missense_Mutation_p.F1151L|MYBPC1_uc010svt.1_Missense_Mutation_p.F1121L|MYBPC1_uc010svu.1_Missense_Mutation_p.F1114L|MYBPC1_uc001tik.2_Missense_Mutation_p.F1107L|MYBPC1_uc001til.2_Intron|MYBPC1_uc001tim.2_Intron	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3						cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						AACCAGTCTTCCTGGAGGGGC	0.378													12	14	---	---	---	---	PASS
POLR3B	55703	broad.mit.edu	37	12	106889912	106889912	+	Silent	SNP	A	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106889912A>C	uc001tlp.2	+	24	3015	c.2793A>C	c.(2791-2793)CCA>CCC	p.P931P	POLR3B_uc001tlq.2_Silent_p.P873P	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1	931					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						TCATGAACCCACACGGCTTCC	0.488													16	98	---	---	---	---	PASS
KSR2	283455	broad.mit.edu	37	12	118199246	118199246	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118199246C>A	uc001two.2	-	4	524	c.469G>T	c.(469-471)GAG>TAG	p.E157*		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	186	Pro-rich.				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGGGTGGGCTCCGGGGGGCAC	0.637													9	47	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124330532	124330532	+	Missense_Mutation	SNP	G	T	T	rs56096831	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124330532G>T	uc001uft.3	+	31	5316	c.5291G>T	c.(5290-5292)CGA>CTA	p.R1764L		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1764	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CTGGAGGCCCGAGAGTTTGAC	0.557													7	94	---	---	---	---	PASS
RIMBP2	23504	broad.mit.edu	37	12	130897317	130897317	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130897317C>A	uc001uil.2	-	15	2832	c.2668G>T	c.(2668-2670)GAC>TAC	p.D890Y		NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	890	SH3 2.					cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CCATCAGCGTCTTTATCACCA	0.448													17	29	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132516566	132516566	+	Silent	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132516566C>A	uc001ujn.2	+	29	5858	c.5823C>A	c.(5821-5823)ACC>ACA	p.T1941T	EP400_uc001ujl.2_Silent_p.T1940T|EP400_uc001ujm.2_Silent_p.T1860T	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	1977	Helicase C-terminal.				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		ACAGCCGTACCACAGGTATAA	0.463													6	126	---	---	---	---	PASS
ALOX5AP	241	broad.mit.edu	37	13	31326270	31326270	+	Intron	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31326270C>A	uc001utf.1	+						ALOX5AP_uc010tdr.1_Intron	NM_001629	NP_001620	P20292	AL5AP_HUMAN	arachidonate 5-lipoxygenase-activating protein						cellular response to calcium ion|leukotriene biosynthetic process|leukotriene production involved in inflammatory response|protein homotrimerization	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	arachidonic acid binding|protein N-terminus binding				0		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0187)|Epithelial(112;0.0803)|OV - Ovarian serous cystadenocarcinoma(117;0.0864)		GTAACTCAGACTTCCCTTTGT	0.488													11	16	---	---	---	---	PASS
KBTBD6	89890	broad.mit.edu	37	13	41706151	41706151	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41706151C>A	uc001uxu.1	-	1	786	c.497G>T	c.(496-498)CGA>CTA	p.R166L	KBTBD6_uc010ace.1_Intron|KBTBD6_uc010tfe.1_Missense_Mutation_p.R100L|uc001uxv.1_5'Flank	NM_152903	NP_690867	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain-containing 6	166							protein binding			ovary(1)|skin(1)	2		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		GTCAAGACGTCGGGCTAAGAA	0.582													25	26	---	---	---	---	PASS
KCTD4	386618	broad.mit.edu	37	13	45768460	45768460	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45768460C>G	uc001uzx.3	-	2	647	c.243G>C	c.(241-243)AGG>AGC	p.R81S	GTF2F2_uc001uzv.2_Intron|GTF2F2_uc001uzw.2_Intron	NM_198404	NP_940686	Q8WVF5	KCTD4_HUMAN	potassium channel tetramerisation domain	81	BTB.					voltage-gated potassium channel complex	voltage-gated potassium channel activity				0		Lung NSC(96;6.55e-05)|Breast(139;0.00378)|Prostate(109;0.00438)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000249)|BRCA - Breast invasive adenocarcinoma(63;0.207)		GGAGACCATCCCTGTCTATGA	0.428													20	41	---	---	---	---	PASS
C13orf18	80183	broad.mit.edu	37	13	46942955	46942955	+	Intron	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46942955C>A	uc010acl.2	-						C13orf18_uc001vbf.3_Intron|C13orf18_uc001vbg.3_Intron|C13orf18_uc010tfz.1_Intron|C13orf18_uc010acm.2_Intron|C13orf18_uc010acn.2_Intron|C13orf18_uc001vbe.3_Intron|C13orf18_uc001vbh.3_Intron|C13orf18_uc001vbi.3_Intron|C13orf18_uc010aco.1_Intron|C13orf18_uc010tga.1_Intron	NM_025113	NP_079389	Q9H714	CM018_HUMAN	hypothetical protein LOC80183												0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)		CAGCACCTGCCAATATAGCAA	0.328													5	31	---	---	---	---	PASS
UBAC2	337867	broad.mit.edu	37	13	99966480	99966480	+	Intron	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99966480G>A	uc001voa.3	+						UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron|UBAC2_uc001voh.2_Intron	NM_001144072	NP_001137544	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2 isoform 1							integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGCAGGTACAGTATGCATTTT	0.343													20	45	---	---	---	---	PASS
ERCC5	2073	broad.mit.edu	37	13	103515036	103515036	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103515036G>A	uc001vpw.2	+	8	1980	c.1537G>A	c.(1537-1539)GCA>ACA	p.A513T	ERCC5_uc001vpu.1_Missense_Mutation_p.A967T|ERCC5_uc010tjb.1_Missense_Mutation_p.A513T|ERCC5_uc010tjc.1_RNA|ERCC5_uc010tjd.1_Missense_Mutation_p.A345T	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	513					negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					ACATAGTGACGCACCTGGGCT	0.488			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				5	32	---	---	---	---	PASS
OR4M1	441670	broad.mit.edu	37	14	20248477	20248477	+	5'Flank	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20248477A>T	uc010tku.1	+							NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GAGTAAATTGAAGAAATGGAA	0.323													18	33	---	---	---	---	PASS
OR4L1	122742	broad.mit.edu	37	14	20528227	20528227	+	Silent	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20528227A>G	uc001vwn.1	+	1	24	c.24A>G	c.(22-24)CTA>CTG	p.L8L		NM_001004717	NP_001004717	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L,	8	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		ATGGATCTCTAGTGACCGAGT	0.338													20	26	---	---	---	---	PASS
GMPR2	51292	broad.mit.edu	37	14	24705036	24705036	+	Intron	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24705036G>T	uc001wnr.2	+						GMPR2_uc001wnv.2_Intron|GMPR2_uc001wns.2_Intron|GMPR2_uc001wnt.2_Intron|GMPR2_uc001wnu.2_Intron|GMPR2_uc001wnw.2_Intron|GMPR2_uc010all.2_Intron|GMPR2_uc001wnx.2_Intron|GMPR2_uc010tod.1_Intron|GMPR2_uc010alk.1_Intron|GMPR2_uc010toe.1_Intron	NM_001002001	NP_001002001	Q9P2T1	GMPR2_HUMAN	guanosine monophosphate reductase 2 isoform 2						nucleotide metabolic process|purine base metabolic process|purine-containing compound salvage	cytosol	GMP reductase activity|metal ion binding			ovary(3)	3				GBM - Glioblastoma multiforme(265;0.0181)		GGTAACACTGGGCATACCCTG	0.512													5	39	---	---	---	---	PASS
RALGAPA1	253959	broad.mit.edu	37	14	36159126	36159126	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36159126C>A	uc001wti.2	-	17	2741	c.2350G>T	c.(2350-2352)GGT>TGT	p.G784C	RALGAPA1_uc001wtj.2_Missense_Mutation_p.G784C|RALGAPA1_uc010tpv.1_Missense_Mutation_p.G784C|RALGAPA1_uc010tpw.1_Missense_Mutation_p.G831C|RALGAPA1_uc001wtk.1_Missense_Mutation_p.G682C	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1	784					activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						TTCAAAGCACCAAAAACTTCA	0.408													4	35	---	---	---	---	PASS
C14orf28	122525	broad.mit.edu	37	14	45369749	45369749	+	Silent	SNP	T	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45369749T>G	uc001wvo.2	+	2	377	c.111T>G	c.(109-111)GCT>GCG	p.A37A	C14orf28_uc001wvp.1_Silent_p.A37A	NM_001017923	NP_001017923	Q4W4Y0	CN028_HUMAN	hypothetical protein LOC122525	37										ovary(1)	1						CTATCAAAGCTGGCCGCAAAG	0.363													12	27	---	---	---	---	PASS
AK7	122481	broad.mit.edu	37	14	96864475	96864475	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96864475G>A	uc001yfn.2	+	2	213	c.169G>A	c.(169-171)GAT>AAT	p.D57N	AK7_uc001yfm.1_Missense_Mutation_p.D57N	NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7	57	Poly-Glu.|Potential.				cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		GGAAGAGGAAGATGAAAATAA	0.468													16	77	---	---	---	---	PASS
BUB1B	701	broad.mit.edu	37	15	40462841	40462841	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40462841T>C	uc001zkx.3	+	4	555	c.343T>C	c.(343-345)TAT>CAT	p.Y115H		NM_001211	NP_001202	O60566	BUB1B_HUMAN	budding uninhibited by benzimidazoles 1 beta	115	BUB1 N-terminal.|Nuclear localization signal (Potential).				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|kidney(1)	4		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		AGAAAAACGATATTATAGTGA	0.363			Mis|N|F|S			rhabdomyosarcoma			Mosaic_Variegated_Aneuploidy_Syndrome				12	32	---	---	---	---	PASS
TP53BP1	7158	broad.mit.edu	37	15	43749421	43749421	+	Intron	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43749421G>T	uc001zrs.2	-						TP53BP1_uc010udp.1_Intron|TP53BP1_uc001zrq.3_Intron|TP53BP1_uc001zrr.3_Intron|TP53BP1_uc010udq.1_Intron	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3						double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		AATGTCCTAAGGAAGAACAGA	0.289								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					5	49	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54305912	54305912	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54305912A>G	uc002ack.2	+	1	812	c.812A>G	c.(811-813)AAG>AGG	p.K271R		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	271					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AATGCTCTCAAGCACTCCATC	0.453													52	71	---	---	---	---	PASS
SCAPER	49855	broad.mit.edu	37	15	77092589	77092589	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77092589C>A	uc002bby.2	-	6	670	c.611G>T	c.(610-612)GGA>GTA	p.G204V	SCAPER_uc002bbx.2_5'UTR|SCAPER_uc002bbz.1_Missense_Mutation_p.G69V|SCAPER_uc002bca.1_Missense_Mutation_p.G69V|SCAPER_uc002bcb.1_Missense_Mutation_p.G204V|SCAPER_uc002bcc.1_Missense_Mutation_p.G204V	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	203						endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						TTCATCTCACCCAAAATTTAA	0.318													11	24	---	---	---	---	PASS
PSTPIP1	9051	broad.mit.edu	37	15	77328172	77328172	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77328172G>A	uc002bcf.2	+	14	1465	c.1015G>A	c.(1015-1017)GAG>AAG	p.E339K	PSTPIP1_uc010bkt.1_RNA|PSTPIP1_uc010bku.1_Missense_Mutation_p.E330K|PSTPIP1_uc002bcg.2_Missense_Mutation_p.E336K|PSTPIP1_uc010bkw.1_Missense_Mutation_p.E320K|PSTPIP1_uc002bch.1_Missense_Mutation_p.E100K|PSTPIP1_uc002bci.1_RNA	NM_003978	NP_003969	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting	339					cell adhesion|signal transduction	cleavage furrow|lamellipodium|perinuclear region of cytoplasm	catalytic activity			ovary(1)	1						CCCCACCCCCGAGCGGAATGA	0.607													6	16	---	---	---	---	PASS
PCSK6	5046	broad.mit.edu	37	15	101933589	101933589	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101933589C>A	uc002bwy.2	-	9	1351	c.1037G>T	c.(1036-1038)GGG>GTG	p.G346V	PCSK6_uc010bpd.2_Missense_Mutation_p.G216V|PCSK6_uc010bpe.2_Missense_Mutation_p.G346V|PCSK6_uc002bxa.2_Missense_Mutation_p.G346V|PCSK6_uc002bxb.2_Missense_Mutation_p.G346V|PCSK6_uc002bxc.1_Missense_Mutation_p.G346V|PCSK6_uc002bxd.1_Missense_Mutation_p.G346V|PCSK6_uc002bxe.2_Missense_Mutation_p.G346V|PCSK6_uc002bxg.1_Missense_Mutation_p.G346V	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	346	Catalytic.				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCCGCCATTCCCAGATGCCCA	0.622													14	16	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2141865	2141865	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2141865G>A	uc002cos.1	-	41	11663	c.11454C>T	c.(11452-11454)GGC>GGT	p.G3818G	PKD1_uc002cot.1_Silent_p.G3817G|MIR1225_hsa-mir-1225|MI0006311_5'Flank|PKD1_uc010bse.1_RNA	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	3818	Extracellular (Potential).				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						CCTGCACGTAGCCCCCGCTGT	0.711													3	3	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2816580	2816580	+	Silent	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2816580C>T	uc002crk.2	+	11	6600	c.6051C>T	c.(6049-6051)CGC>CGT	p.R2017R	SRRM2_uc002crj.1_Silent_p.R1921R|SRRM2_uc002crl.1_Silent_p.R2017R|SRRM2_uc010bsu.1_Silent_p.R1921R	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	2017	Arg-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CACGCCGCCGCTCTAGGTCCC	0.582													6	29	---	---	---	---	PASS
ACSM5	54988	broad.mit.edu	37	16	20430682	20430682	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20430682G>A	uc002dhe.2	+	4	695	c.548G>A	c.(547-549)TGC>TAC	p.C183Y	ACSM5_uc002dhd.1_Missense_Mutation_p.C183Y	NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	183					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						AGTGCCGAATGCCCCTCCCTC	0.592													13	23	---	---	---	---	PASS
GTF3C1	2975	broad.mit.edu	37	16	27518417	27518417	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27518417C>A	uc002dov.1	-	9	1343	c.1303G>T	c.(1303-1305)GAG>TAG	p.E435*	GTF3C1_uc002dou.2_Nonsense_Mutation_p.E435*	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide	435						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						TCGCTCTCCTCTGCAAACACG	0.557													10	27	---	---	---	---	PASS
SLC5A2	6524	broad.mit.edu	37	16	31500246	31500246	+	Silent	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31500246C>A	uc002ecf.3	+	11	1345	c.1326C>A	c.(1324-1326)CCC>CCA	p.P442P	SLC5A2_uc010car.2_Intron|C16orf58_uc002ecg.2_RNA	NM_003041	NP_003032	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose	442	Helical; (Potential).				carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity			ovary(1)	1						CCTGGCTTCCCGTGGTGCAGG	0.682													3	15	---	---	---	---	PASS
ABCC12	94160	broad.mit.edu	37	16	48142361	48142361	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48142361C>A	uc002efc.1	-	17	2707	c.2361G>T	c.(2359-2361)AAG>AAT	p.K787N	ABCC12_uc002eey.1_RNA|ABCC12_uc002eez.1_RNA|ABCC12_uc002efa.1_RNA|ABCC12_uc002efb.1_RNA|ABCC12_uc002efd.1_RNA	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12	787						integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				CTCCAGAAGCCTTAATGTACG	0.398													4	31	---	---	---	---	PASS
RBL2	5934	broad.mit.edu	37	16	53524121	53524121	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53524121G>A	uc002ehi.3	+	22	3447	c.3329G>A	c.(3328-3330)AGT>AAT	p.S1110N	RBL2_uc002ehj.2_Missense_Mutation_p.S820N|RBL2_uc010vgw.1_Missense_Mutation_p.S489N	NM_005611	NP_005602	Q08999	RBL2_HUMAN	retinoblastoma-like 2 (p130)	1110					cell cycle|chromatin modification|regulation of cell cycle|regulation of lipid kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						GAAGATGGAAGTGAATCACCT	0.403													7	42	---	---	---	---	PASS
DPEP2	64174	broad.mit.edu	37	16	68023977	68023977	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68023977G>T	uc010cey.2	-	7	1131	c.967C>A	c.(967-969)CCA>ACA	p.P323T	DPEP2_uc002evd.3_Missense_Mutation_p.P323T|DPEP2_uc002eve.2_Missense_Mutation_p.P323T|DPEP2_uc002evf.2_RNA	NM_022355	NP_071750	Q9H4A9	DPEP2_HUMAN	dipeptidase 2 precursor	323					hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|proteolysis	anchored to membrane|plasma membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity			skin(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)		TTGGCTGATGGGTTGCACTGT	0.572													6	85	---	---	---	---	PASS
CAMKK1	84254	broad.mit.edu	37	17	3785617	3785617	+	Intron	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3785617C>A	uc002fwt.2	-						CAMKK1_uc002fwu.2_Intron|CAMKK1_uc002fwv.2_Missense_Mutation_p.A245S	NM_172206	NP_757343	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase 1						synaptic transmission	cytosol|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)	1				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		TGGGGCTTGGCGATATTTGTT	0.567													19	17	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577580	7577580	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577580T>C	uc002gim.2	-	7	895	c.701A>G	c.(700-702)TAC>TGC	p.Y234C	TP53_uc002gig.1_Missense_Mutation_p.Y234C|TP53_uc002gih.2_Missense_Mutation_p.Y234C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y102C|TP53_uc010cng.1_Missense_Mutation_p.Y102C|TP53_uc002gii.1_Missense_Mutation_p.Y102C|TP53_uc010cnh.1_Missense_Mutation_p.Y234C|TP53_uc010cni.1_Missense_Mutation_p.Y234C|TP53_uc002gij.2_Missense_Mutation_p.Y234C|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.Y141C|TP53_uc002gio.2_Missense_Mutation_p.Y102C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	234	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> F (in a sporadic cancer; somatic mutation).|Y -> K (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> N (in sporadic cancers; somatic mutation).|Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> Q (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y234C(70)|p.Y234H(13)|p.Y234N(11)|p.0?(7)|p.Y234S(6)|p.Y234*(4)|p.Y234D(3)|p.Y234del(3)|p.Y234fs*2(1)|p.V225fs*23(1)|p.Y234fs*6(1)|p.Y234fs*5(1)|p.Y234fs*4(1)|p.Y234R(1)|p.Y234Y(1)|p.H233_C242del10(1)|p.D228fs*12(1)|p.Y234F(1)|p.I232_Y236delIHYNY(1)|p.Y141S(1)|p.T230_Y234delTTIHY(1)|p.H233fs*6(1)|p.Y234_N235insX(1)|p.I232fs*5(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CATGTAGTTGTAGTGGATGGT	0.572		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			23	10	---	---	---	---	PASS
MAP2K3	5606	broad.mit.edu	37	17	21204224	21204224	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21204224G>A	uc002gys.2	+	5	583	c.318G>A	c.(316-318)CGG>CGA	p.R106R	MAP2K3_uc002gyt.2_Silent_p.R77R|MAP2K3_uc002gyu.2_Silent_p.R77R	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	106	Protein kinase.				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		AGCAGAAGCGGCTGCTCATGG	0.582													5	32	---	---	---	---	PASS
ACACA	31	broad.mit.edu	37	17	35591902	35591902	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35591902G>A	uc002hnm.2	-	25	3314	c.3123C>T	c.(3121-3123)GTC>GTT	p.V1041V	ACACA_uc002hnk.2_Silent_p.V963V|ACACA_uc002hnl.2_Silent_p.V983V|ACACA_uc002hnn.2_Silent_p.V1041V|ACACA_uc002hno.2_Silent_p.V1078V|ACACA_uc010cuz.2_Silent_p.V1041V	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	1041					acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	TAAGCATTGTGACCAGAAGAT	0.378													10	38	---	---	---	---	PASS
ITGB3	3690	broad.mit.edu	37	17	45369758	45369758	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45369758G>A	uc002ilj.2	+	10	1534	c.1514G>A	c.(1513-1515)CGC>CAC	p.R505H	ITGB3_uc010wkr.1_RNA	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor	505	I.|Extracellular (Potential).|Cysteine-rich tandem repeats.				activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	GAGGACTATCGCCCTTCCCAG	0.627													20	27	---	---	---	---	PASS
C17orf57	124989	broad.mit.edu	37	17	45447834	45447834	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45447834A>G	uc002iln.2	+	11	1248	c.837A>G	c.(835-837)ATA>ATG	p.I279M	C17orf57_uc002ilm.2_Missense_Mutation_p.I183M|C17orf57_uc002ill.1_Missense_Mutation_p.I35M|C17orf57_uc010daz.1_Missense_Mutation_p.I231M	NM_152347	NP_689560	Q8IY85	CQ057_HUMAN	hypothetical protein LOC124989	279							calcium ion binding			breast(1)|central_nervous_system(1)|skin(1)	3						GGGATATTATATTTACTTTGA	0.299													13	28	---	---	---	---	PASS
KCNJ16	3773	broad.mit.edu	37	17	68129006	68129006	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68129006G>T	uc002jin.2	+	5	1264	c.778G>T	c.(778-780)GAG>TAG	p.E260*	KCNJ16_uc002jio.2_Nonsense_Mutation_p.E260*|KCNJ16_uc002jip.2_Nonsense_Mutation_p.E260*|KCNJ16_uc002jiq.2_Nonsense_Mutation_p.E292*	NM_018658	NP_061128	Q9NPI9	IRK16_HUMAN	potassium inwardly-rectifying channel J16	260	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Breast(10;2.96e-09)					AATTGACCATGAGAGCCCTCT	0.438													6	124	---	---	---	---	PASS
ITGB4	3691	broad.mit.edu	37	17	73736921	73736921	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73736921G>T	uc002jpg.2	+	22	2785	c.2598G>T	c.(2596-2598)CAG>CAT	p.Q866H	ITGB4_uc002jph.2_Missense_Mutation_p.Q866H|ITGB4_uc010dgo.2_Missense_Mutation_p.Q866H|ITGB4_uc002jpi.3_Missense_Mutation_p.Q866H|ITGB4_uc010dgp.1_Missense_Mutation_p.D879Y|ITGB4_uc002jpj.2_Missense_Mutation_p.Q866H	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor	866	Cytoplasmic (Potential).				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGCTCCAGCAGACCAAGTTCC	0.682													12	45	---	---	---	---	PASS
QRICH2	84074	broad.mit.edu	37	17	74287768	74287768	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74287768G>T	uc002jrd.1	-	4	2722	c.2542C>A	c.(2542-2544)CCT>ACT	p.P848T	QRICH2_uc010wsz.1_Missense_Mutation_p.P774T|QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	848							protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						TCTCTGCCAGGAGGTACCATA	0.473													5	64	---	---	---	---	PASS
SLC25A10	1468	broad.mit.edu	37	17	79671373	79671373	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79671373G>T	uc010wut.1	+	2	299	c.174G>T	c.(172-174)AAG>AAT	p.K58N	MRPL12_uc002kbh.1_Missense_Mutation_p.K58N	NM_012140	NP_036272	Q9UBX3	DIC_HUMAN	solute carrier family 25 (mitochondrial carrier;	Error:Variant_position_missing_in_Q9UBX3_after_alignment					gluconeogenesis|mitochondrial transport	integral to membrane|mitochondrial inner membrane|nucleus	protein binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0117)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)		Succinic acid(DB00139)	ACGCCCCCAAGGAGTACCCCC	0.602													7	17	---	---	---	---	PASS
NDC80	10403	broad.mit.edu	37	18	2577814	2577814	+	Silent	SNP	G	T	T	rs148077669		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2577814G>T	uc002kli.2	+	4	431	c.249G>T	c.(247-249)CCG>CCT	p.P83P		NM_006101	NP_006092	O14777	NDC80_HUMAN	kinetochore associated 2	83	Interaction with the N-terminus of CDCA1.|Nuclear localization.				attachment of spindle microtubules to kinetochore|cell division|establishment of mitotic spindle orientation|mitotic prometaphase|mitotic sister chromatid segregation|mitotic spindle organization|phosphatidylinositol-mediated signaling	condensed nuclear chromosome outer kinetochore|cytosol|Ndc80 complex	protein binding			ovary(1)	1						TCAAGGACCCGAGACCACTTA	0.363													5	76	---	---	---	---	PASS
ZCCHC2	54877	broad.mit.edu	37	18	60223502	60223502	+	Silent	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60223502C>T	uc002lip.3	+	6	1380	c.1380C>T	c.(1378-1380)TCC>TCT	p.S460S	ZCCHC2_uc002lio.2_RNA	NM_017742	NP_060212	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	460					cell communication	cytoplasm	nucleic acid binding|phosphatidylinositol binding|zinc ion binding			lung(1)|prostate(1)	2						TCTTTCAGTCCATATCATCAG	0.358													9	23	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67698100	67698100	+	Intron	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67698100C>T	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron|RTTN_uc010dqp.2_Intron	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				GCTGATGTGTCATGTGGCTCA	0.363													11	34	---	---	---	---	PASS
LRG1	116844	broad.mit.edu	37	19	4538521	4538521	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4538521A>C	uc002mau.2	-	2	486	c.475T>G	c.(475-477)TGG>GGG	p.W159G	PLIN5_uc002mat.1_Intron	NM_052972	NP_443204	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1 precursor	159	LRR 3.					extracellular region|membrane				ovary(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGTGTAGCCACGAGACCTCC	0.652													29	41	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9025609	9025609	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9025609C>A	uc002mkp.2	-	15	37049	c.36845G>T	c.(36844-36846)TGC>TTC	p.C12282F		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12284	SEA 2.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGTCAATCTGCAGCCAGAGTA	0.512													24	63	---	---	---	---	PASS
CALR	811	broad.mit.edu	37	19	13051633	13051633	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13051633G>T	uc002mvu.2	+	7	972	c.892G>T	c.(892-894)GAG>TAG	p.E298*	CALR_uc002mvv.2_5'Flank	NM_004343	NP_004334	P27797	CALR_HUMAN	calreticulin precursor	298	P-domain.				cell cycle arrest|cellular senescence|glucocorticoid receptor signaling pathway|negative regulation of neuron differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of steroid hormone receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of translation|peptide antigen assembly with MHC class I protein complex|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of DNA replication|positive regulation of phagocytosis|post-translational protein modification|protein export from nucleus|protein maturation by protein folding|protein N-linked glycosylation via asparagine|protein stabilization|regulation of apoptosis|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|extracellular space|MHC class I peptide loading complex|nucleus|perinuclear region of cytoplasm|polysome|proteinaceous extracellular matrix	androgen receptor binding|calcium ion binding|chaperone binding|complement component C1q binding|DNA binding|integrin binding|mRNA binding|protein binding involved in protein folding|sugar binding|ubiquitin protein ligase binding|unfolded protein binding|zinc ion binding			ovary(1)	1					Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGACAACCCCGAGTATTCTCC	0.542													4	56	---	---	---	---	PASS
INSL3	3640	broad.mit.edu	37	19	17927797	17927797	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17927797C>A	uc002nhm.1	-	2	267	c.262G>T	c.(262-264)GGA>TGA	p.G88*	INSL3_uc010ebf.1_Missense_Mutation_p.W119C|INSL3_uc010ebg.1_RNA	NM_005543	NP_005534	P51460	INSL3_HUMAN	insulin-like 3 precursor	88					cell-cell signaling|spermatogenesis	soluble fraction	hormone activity|insulin receptor binding|signal transducer activity				0						AGGCCAGGTCCCAGCGTGAGA	0.622													8	18	---	---	---	---	PASS
SLC5A5	6528	broad.mit.edu	37	19	17983413	17983413	+	Silent	SNP	T	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17983413T>A	uc002nhr.3	+	1	632	c.285T>A	c.(283-285)CTT>CTA	p.L95L		NM_000453	NP_000444	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium iodide	95	Helical; (Potential).				cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity			skin(2)|ovary(1)|central_nervous_system(1)	4						TGGGCCAGCTTCTGAACTCGG	0.652													10	4	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19337671	19337671	+	Silent	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19337671C>T	uc002nlz.2	+	7	1548	c.1449C>T	c.(1447-1449)TTC>TTT	p.F483F	NCAN_uc010ecc.1_Silent_p.F47F	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	483					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			GGGGGCGCTTCAAAGGGTTGA	0.672													17	20	---	---	---	---	PASS
ZNF14	7561	broad.mit.edu	37	19	19823162	19823162	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19823162T>C	uc002nnk.1	-	4	1082	c.928A>G	c.(928-930)AAA>GAA	p.K310E		NM_021030	NP_066358	P17017	ZNF14_HUMAN	zinc finger protein 14	310	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Renal(1328;0.0474)				CCACATTCTTTACATTCATAG	0.378													10	30	---	---	---	---	PASS
ZNF431	170959	broad.mit.edu	37	19	21366712	21366712	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21366712A>G	uc002npp.2	+	5	1753	c.1606A>G	c.(1606-1608)AGA>GGA	p.R536G	ZNF431_uc010ecq.2_Missense_Mutation_p.R445G|ZNF431_uc010ecr.2_Missense_Mutation_p.R537G	NM_133473	NP_597730	Q8TF32	ZN431_HUMAN	zinc finger protein 431	536					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(2)	2						AATTCATACTAGACAGAAACC	0.318													7	59	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22154642	22154642	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22154642G>T	uc002nqp.2	-	6	2959	c.2810C>A	c.(2809-2811)GCC>GAC	p.A937D	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				CCAGCTGAAGGCTTTGCCACA	0.463													15	61	---	---	---	---	PASS
ATP4A	495	broad.mit.edu	37	19	36051525	36051525	+	Intron	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36051525G>T	uc002oal.1	-						ATP4A_uc010eee.1_5'Flank	NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A						ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)	TTGCTGCGGGGCAGGGGCACC	0.607													6	13	---	---	---	---	PASS
ZNF461	92283	broad.mit.edu	37	19	37149214	37149214	+	Silent	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37149214G>A	uc002oem.2	-	3	351	c.123C>T	c.(121-123)AAC>AAT	p.N41N	ZNF461_uc002oen.2_Intron|ZNF461_uc010xtj.1_Silent_p.N41N	NM_153257	NP_694989	Q8TAF7	ZN461_HUMAN	gonadotropin inducible transcription repressor	41	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GTGACACCAAGTTGCTATAAT	0.413													5	15	---	---	---	---	PASS
TTC9B	148014	broad.mit.edu	37	19	40722081	40722081	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40722081C>T	uc002onc.2	-	3	727	c.709G>A	c.(709-711)GTA>ATA	p.V237I		NM_152479	NP_689692	Q8N6N2	TTC9B_HUMAN	tetratricopeptide repeat domain 9B	237							binding				0						CAGCCAATTACATCCCGAGTC	0.557													13	47	---	---	---	---	PASS
AKT2	208	broad.mit.edu	37	19	40747908	40747908	+	Silent	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40747908C>A	uc002onf.2	-	6	772	c.510G>T	c.(508-510)CGG>CGT	p.R170R	AKT2_uc010egs.2_Silent_p.R170R|AKT2_uc010egt.2_Silent_p.R108R|AKT2_uc010xvj.1_Silent_p.R108R|AKT2_uc010egu.1_Silent_p.R108R|AKT2_uc010xvk.1_Silent_p.R170R|AKT2_uc002one.2_Silent_p.R66R	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase	170	Protein kinase.				insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)			TGGCCTTCTCCCGCACCAGGA	0.582			A		ovarian|pancreatic 								15	25	---	---	---	---	PASS
CEACAM16	388551	broad.mit.edu	37	19	45207358	45207358	+	Silent	SNP	T	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45207358T>A	uc010xxd.1	+	4	659	c.453T>A	c.(451-453)CTT>CTA	p.L151L	CEACAM16_uc002ozq.2_Silent_p.L210L	NM_001039213	NP_001034302	A7LI12	A7LI12_HUMAN	carcinoembryonic antigen-related cell adhesion	151										ovary(1)	1	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				CCCTGCGCCTTATGTGCAGCA	0.697													5	6	---	---	---	---	PASS
TOMM40	10452	broad.mit.edu	37	19	45396132	45396132	+	Silent	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45396132C>A	uc002ozx.3	+	4	482	c.381C>A	c.(379-381)TCC>TCA	p.S127S	TOMM40_uc002ozy.3_Silent_p.S127S|TOMM40_uc002paa.3_Silent_p.S127S|TOMM40_uc002ozz.2_Silent_p.S127S	NM_006114	NP_006105	O96008	TOM40_HUMAN	translocase of outer mitochondrial membrane 40	127					protein targeting to mitochondrion	integral to membrane of membrane fraction|integral to mitochondrial outer membrane|mitochondrial outer membrane translocase complex|pore complex	porin activity|protein transmembrane transporter activity|voltage-gated anion channel activity				0	Lung NSC(12;0.0018)|all_lung(12;0.00481)			OV - Ovarian serous cystadenocarcinoma(262;0.0033)|Epithelial(262;0.176)		TCGGGGAGTCCAACTACCACT	0.502													4	37	---	---	---	---	PASS
ZNF611	81856	broad.mit.edu	37	19	53209454	53209454	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53209454T>C	uc002pzz.2	-	7	1171	c.854A>G	c.(853-855)AAA>AGA	p.K285R	ZNF611_uc010eqc.2_Missense_Mutation_p.K215R|ZNF611_uc010ydo.1_Missense_Mutation_p.K215R|ZNF611_uc010ydr.1_Missense_Mutation_p.K216R|ZNF611_uc010ydp.1_Missense_Mutation_p.K285R|ZNF611_uc010ydq.1_Missense_Mutation_p.K285R|ZNF611_uc002qaa.3_Missense_Mutation_p.K215R	NM_030972	NP_112234	Q8N823	ZN611_HUMAN	zinc finger protein 611 isoform a	285					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		CTTGTAAGGTTTCTCAACAGT	0.408													44	72	---	---	---	---	PASS
MIR518D	574489	broad.mit.edu	37	19	54238188	54238188	+	RNA	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54238188C>T	hsa-mir-518d|MI0003171	+			c.58C>T			MIR516B1_hsa-mir-516b-1|MI0003172_5'Flank																	0						GAAACCAAAGCGCTTCCCTTT	0.438													16	80	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54760477	54760477	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54760477G>T	uc002qex.2	-	3	341	c.230C>A	c.(229-231)CCT>CAT	p.P77H	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.P77H|LILRB5_uc002qey.2_Missense_Mutation_p.P77H|LILRB5_uc002qez.2_Missense_Mutation_p.P77H|LILRB5_uc002qfa.1_Missense_Mutation_p.P67H|LILRB5_uc010yes.1_RNA	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	77	Ig-like C2-type 1.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CTTGGCTCCAGGCTCCAGTGG	0.612													38	115	---	---	---	---	PASS
ATRN	8455	broad.mit.edu	37	20	3578558	3578558	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3578558C>G	uc002wim.2	+	22	3565	c.3475C>G	c.(3475-3477)CTT>GTT	p.L1159V	ATRN_uc002wil.2_Missense_Mutation_p.L1159V	NM_139321	NP_647537	O75882	ATRN_HUMAN	attractin isoform 1	1159	Extracellular (Potential).				inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2						CATAGATACTCTTCTTATTGA	0.328													23	57	---	---	---	---	PASS
C20orf30	29058	broad.mit.edu	37	20	5086887	5086887	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5086887C>A	uc002wll.2	-	4	635	c.169G>T	c.(169-171)GCC>TCC	p.A57S	C20orf30_uc010gbi.2_Missense_Mutation_p.A57S|C20orf30_uc002wlk.2_Missense_Mutation_p.A120S|C20orf30_uc002wlm.2_Missense_Mutation_p.A57S|C20orf30_uc002wln.2_Missense_Mutation_p.A57S|C20orf30_uc002wlo.2_Intron	NM_001009924	NP_001009924	Q96A57	CT030_HUMAN	hypothetical protein LOC29058 isoform 2	57	Helical; (Potential).					integral to membrane					0						ATGAGAAAGGCGCCAATCAAA	0.433													21	41	---	---	---	---	PASS
PLCB4	5332	broad.mit.edu	37	20	9388713	9388713	+	Intron	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9388713C>A	uc002wnf.2	+						PLCB4_uc010gbw.1_Intron|PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron|PLCB4_uc002wnh.2_Intron	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						AAGGTAACACCAAAGGTTAAA	0.408													7	155	---	---	---	---	PASS
ESF1	51575	broad.mit.edu	37	20	13763342	13763342	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13763342C>T	uc002woj.2	-	2	553	c.445G>A	c.(445-447)GAT>AAT	p.D149N	ESF1_uc002wok.1_Missense_Mutation_p.D149N|C20orf7_uc002wol.1_5'Flank|C20orf7_uc002wom.2_5'Flank|C20orf7_uc002won.2_5'Flank|C20orf7_uc002woo.2_5'Flank	NM_016649	NP_057733	Q9H501	ESF1_HUMAN	ABT1-associated protein	149	Lys-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm				ovary(1)	1						ATGTTTGAATCTATCTTAAAT	0.284													6	21	---	---	---	---	PASS
BFSP1	631	broad.mit.edu	37	20	17492636	17492636	+	Silent	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17492636C>A	uc002wpo.2	-	4	651	c.612G>T	c.(610-612)ACG>ACT	p.T204T	BFSP1_uc002wpp.2_Silent_p.T79T|BFSP1_uc010zrn.1_Silent_p.T65T|BFSP1_uc010zro.1_Silent_p.T65T	NM_001195	NP_001186	Q12934	BFSP1_HUMAN	filensin isoform 1	204	Rod.|Coil 2.					cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens			central_nervous_system(1)	1						TCATCCCACTCGTCACAATGG	0.527													11	33	---	---	---	---	PASS
PLCG1	5335	broad.mit.edu	37	20	39791871	39791871	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39791871G>A	uc002xjp.1	+	8	866	c.745G>A	c.(745-747)GTG>ATG	p.V249M	PLCG1_uc002xjo.1_Missense_Mutation_p.V249M|PLCG1_uc010zwe.1_5'Flank|PLCG1_uc010ggf.2_5'Flank	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b	249					activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				GCTTTGCCGAGTGTCCCTTCC	0.602													10	28	---	---	---	---	PASS
TOX2	84969	broad.mit.edu	37	20	42693419	42693419	+	Intron	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42693419C>A	uc002xlf.3	+						TOX2_uc010ggo.2_Silent_p.A294A|TOX2_uc002xle.3_Silent_p.A252A|TOX2_uc010ggp.2_Silent_p.A252A|TOX2_uc002xlg.2_Intron|TOX2_uc010zwk.1_Silent_p.A172A	NM_001098798	NP_001092268	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			TCTTCCAGGCCTACAAGAGGA	0.552													42	114	---	---	---	---	PASS
DIDO1	11083	broad.mit.edu	37	20	61511762	61511762	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61511762T>A	uc002ydr.1	-	16	5810	c.5546A>T	c.(5545-5547)CAT>CTT	p.H1849L	DIDO1_uc002yds.1_Missense_Mutation_p.H1849L	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	1849	Pro-rich.				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					CTTCTCCCCATGGGGATCCTT	0.607													30	33	---	---	---	---	PASS
COL20A1	57642	broad.mit.edu	37	20	61939423	61939423	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61939423G>T	uc011aau.1	+	7	856	c.756G>T	c.(754-756)AAG>AAT	p.K252N	COL20A1_uc011aav.1_Missense_Mutation_p.K73N	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	252	VWFA.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					TCCGCTACAAGGGGGGGAACA	0.647													5	20	---	---	---	---	PASS
TIAM1	7074	broad.mit.edu	37	21	32497015	32497015	+	Intron	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32497015A>G	uc002yow.1	-						TIAM1_uc011adk.1_Intron|TIAM1_uc011adl.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						CTGGGGAGCTAGGAAAAGAAG	0.453													9	7	---	---	---	---	PASS
CLIC6	54102	broad.mit.edu	37	21	36079604	36079604	+	Silent	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36079604A>T	uc010gmt.1	+	3	1455	c.1455A>T	c.(1453-1455)GGA>GGT	p.G485G	CLIC6_uc002yuf.1_Silent_p.G467G	NM_053277	NP_444507	Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	485						chloride channel complex|cytoplasm|plasma membrane	voltage-gated chloride channel activity			ovary(1)|central_nervous_system(1)	2						AGAGTATCGGAAATTGCCCGT	0.443													19	29	---	---	---	---	PASS
PFKL	5211	broad.mit.edu	37	21	45732984	45732984	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45732984G>T	uc002zel.2	+	5	610	c.551G>T	c.(550-552)CGC>CTC	p.R184L	PFKL_uc002zek.2_Missense_Mutation_p.R231L|PFKL_uc011afd.1_Missense_Mutation_p.R231L	NM_002626	NP_002617	P17858	K6PL_HUMAN	liver phosphofructokinase	184					fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding				0				Colorectal(79;0.0811)		GCCCTCCACCGCATCATGGAG	0.667													37	21	---	---	---	---	PASS
KRTAP10-4	386672	broad.mit.edu	37	21	45994758	45994758	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45994758G>T	uc002zfk.1	+	1	1153	c.1123G>T	c.(1123-1125)GTG>TTG	p.V375L	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198687	NP_941960	P60372	KR104_HUMAN	keratin associated protein 10-4	375	36 X 5 AA repeats of C-C-X(3).|35.					keratin filament					0						CGCCTGCTGCGTGCCCGTCCC	0.701													22	28	---	---	---	---	PASS
SLC5A1	6523	broad.mit.edu	37	22	32487631	32487631	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32487631G>T	uc003amc.2	+	11	1394	c.1162G>T	c.(1162-1164)GCC>TCC	p.A388S	SLC5A1_uc011alz.1_Missense_Mutation_p.A261S	NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	388	Helical; (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						AGTCATGCTGGCCTCCCTCAT	0.498													25	52	---	---	---	---	PASS
MCHR1	2847	broad.mit.edu	37	22	41077580	41077580	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41077580C>T	uc003ayz.2	+	2	1185	c.917C>T	c.(916-918)TCC>TTC	p.S306F	MCHR1_uc003aza.2_Missense_Mutation_p.S195F|uc003azb.1_RNA	NM_005297	NP_005288	Q99705	MCHR1_HUMAN	G protein-coupled receptor 24	306	Cytoplasmic (Potential).				elevation of cytosolic calcium ion concentration|feeding behavior|generation of precursor metabolites and energy|inhibition of adenylate cyclase activity by G-protein signaling pathway	integral to plasma membrane|nonmotile primary cilium	neuropeptide receptor activity				0						CGCATGACGTCCTCAGTGGCC	0.602													17	17	---	---	---	---	PASS
WNT7B	7477	broad.mit.edu	37	22	46327059	46327059	+	Silent	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46327059G>T	uc003bgo.2	-	3	863	c.489C>A	c.(487-489)TCC>TCA	p.S163S	WNT7B_uc010haa.2_Silent_p.S167S	NM_058238	NP_478679	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family,	163					activation of JUN kinase activity|anterior/posterior pattern formation|axis specification|axonogenesis|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|central nervous system vasculogenesis|chorio-allantoic fusion|developmental growth involved in morphogenesis|embryonic placenta morphogenesis|establishment or maintenance of polarity of embryonic epithelium|fibroblast proliferation|forebrain regionalization|inner medullary collecting duct development|lens fiber cell development|lobar bronchus development|lung epithelium development|lung morphogenesis|lung-associated mesenchyme development|mammary gland epithelium development|metanephric collecting duct development|metanephric loop of Henle development|metanephros morphogenesis|negative regulation of smoothened signaling pathway|outer medullary collecting duct development|oxygen homeostasis|positive regulation of JNK cascade|positive regulation of osteoblast differentiation|renal inner medulla development|renal outer medulla development|stem cell proliferation|synapse organization|trachea cartilage morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|frizzled binding|signal transducer activity			lung(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		CGAAGCGCCGGGAGAAGTCGA	0.652													4	29	---	---	---	---	PASS
OFD1	8481	broad.mit.edu	37	X	13774698	13774698	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13774698T>A	uc004cvp.3	+	13	1582	c.1223T>A	c.(1222-1224)CTT>CAT	p.L408H	OFD1_uc004cvr.3_Translation_Start_Site|OFD1_uc011mil.1_Translation_Start_Site|OFD1_uc004cvq.3_Missense_Mutation_p.L268H|OFD1_uc010nen.2_Missense_Mutation_p.L407H|OFD1_uc004cvs.3_RNA|OFD1_uc004cvu.3_Missense_Mutation_p.L367H|OFD1_uc004cvv.3_Missense_Mutation_p.L367H	NM_003611	NP_003602	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	408	Potential.				cilium movement involved in determination of left/right asymmetry|G2/M transition of mitotic cell cycle	centriole|cilium|cytosol|microtubule basal body|nuclear membrane	alpha-tubulin binding|gamma-tubulin binding				0						GAATTTTAGCTTGAATTAGAG	0.323													19	65	---	---	---	---	PASS
MAP3K15	389840	broad.mit.edu	37	X	19398285	19398285	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19398285T>C	uc004czk.1	-	20	2604	c.967A>G	c.(967-969)AAG>GAG	p.K323E	MAP3K15_uc004czj.1_Missense_Mutation_p.K283E	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase	848	Protein kinase.						ATP binding|MAP kinase kinase kinase activity|metal ion binding			ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					AACGGAGGCTTGCTGGTGGCC	0.512													3	5	---	---	---	---	PASS
ZNF645	158506	broad.mit.edu	37	X	22291549	22291549	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22291549C>A	uc004dai.1	+	1	490	c.441C>A	c.(439-441)AGC>AGA	p.S147R		NM_152577	NP_689790	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	147						intracellular	zinc ion binding			lung(1)|pancreas(1)	2						AAGTTACCAGCGCTTCGCTTG	0.438													12	46	---	---	---	---	PASS
DCAF8L1	139425	broad.mit.edu	37	X	27997798	27997798	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27997798C>A	uc004dbx.1	-	1	1769	c.1654G>T	c.(1654-1656)GTG>TTG	p.V552L		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	552										ovary(3)|skin(1)	4						AGGTGACGCACGAAGAACCGA	0.478													13	50	---	---	---	---	PASS
CXorf21	80231	broad.mit.edu	37	X	30577646	30577646	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30577646A>G	uc004dcg.1	-	3	1103	c.827T>C	c.(826-828)TTG>TCG	p.L276S		NM_025159	NP_079435	Q9HAI6	CX021_HUMAN	hypothetical protein LOC80231	276										ovary(1)	1						CATCAATTGCAATAGGCGGCT	0.388													11	42	---	---	---	---	PASS
RPGR	6103	broad.mit.edu	37	X	38146392	38146392	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38146392C>G	uc004ded.1	-	15	2028	c.1860G>C	c.(1858-1860)AAG>AAC	p.K620N	RPGR_uc004deb.2_Missense_Mutation_p.K620N|RPGR_uc004dea.2_RNA|RPGR_uc004dec.2_Intron	NM_001034853	NP_001030025	Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator isoform C	620	Glu-rich.				intracellular protein transport|response to stimulus|visual perception	Golgi apparatus|photoreceptor outer segment	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						CTGTTttctcctttcttcctc	0.239													18	54	---	---	---	---	PASS
EFHC2	80258	broad.mit.edu	37	X	44120491	44120491	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44120491A>G	uc004dgb.3	-	5	526	c.436T>C	c.(436-438)TTT>CTT	p.F146L		NM_025184	NP_079460	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	146	DM10 1.						calcium ion binding			breast(3)|ovary(2)|central_nervous_system(1)	6						ACAGTATAAAACTGATCCTCA	0.408													10	60	---	---	---	---	PASS
ZNF630	57232	broad.mit.edu	37	X	47918465	47918465	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47918465C>T	uc004div.3	-	5	1618	c.1366G>A	c.(1366-1368)GAA>AAA	p.E456K	ZNF630_uc010nhz.1_Intron|ZNF630_uc004diw.2_Missense_Mutation_p.E332K	NM_001037735	NP_001032824	Q2M218	ZN630_HUMAN	zinc finger protein 630	456					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|lung(1)	2						TAAGGTTTTTCTCCTGTATGA	0.448													6	30	---	---	---	---	PASS
PAGE1	8712	broad.mit.edu	37	X	49459326	49459326	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49459326A>T	uc004dom.2	-	2	181	c.48T>A	c.(46-48)TAT>TAA	p.Y16*		NM_003785	NP_003776	O75459	GAGB1_HUMAN	P antigen family, member 1	16					cellular defense response					skin(1)	1	Ovarian(276;0.236)					AAGATTCTACATAGATCATTG	0.353													7	44	---	---	---	---	PASS
CLCN5	1184	broad.mit.edu	37	X	49840470	49840470	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49840470G>A	uc004dos.1	+	4	474	c.226G>A	c.(226-228)GAC>AAC	p.D76N	CLCN5_uc004dor.1_Missense_Mutation_p.D146N|CLCN5_uc004doq.1_Missense_Mutation_p.D146N|CLCN5_uc004dot.1_Missense_Mutation_p.D76N	NM_000084	NP_000075	P51795	CLCN5_HUMAN	chloride channel 5 isoform b	76	Helical; (By similarity).				excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)					TGGTTTGATAGACATCTCTGC	0.433													12	34	---	---	---	---	PASS
AR	367	broad.mit.edu	37	X	66766093	66766093	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66766093C>G	uc004dwu.1	+	1	2220	c.1105C>G	c.(1105-1107)CTG>GTG	p.L369V	AR_uc011mpd.1_Missense_Mutation_p.L369V|AR_uc011mpe.1_RNA|AR_uc011mpf.1_Missense_Mutation_p.L369V	NM_000044	NP_000035	P10275	ANDR_HUMAN	androgen receptor isoform 1	367	Modulating.				cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)	CAACTTTCCACTGGCTCTGGC	0.662									Androgen_Insensitivity_Syndrome				5	11	---	---	---	---	PASS
CYSLTR1	10800	broad.mit.edu	37	X	77528442	77528442	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77528442C>T	uc004edb.2	-	3	1202	c.802G>A	c.(802-804)GAT>AAT	p.D268N	CYSLTR1_uc010nma.2_Missense_Mutation_p.D268N|CYSLTR1_uc010nmb.2_Missense_Mutation_p.D268N	NM_006639	NP_006630	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	268	Extracellular (Potential).				elevation of cytosolic calcium ion concentration|respiratory gaseous exchange	integral to plasma membrane|membrane fraction	leukotriene receptor activity			ovary(1)	1					Amlexanox(DB01025)|Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	AGGACAGAATCACAGGGTTTA	0.418													10	47	---	---	---	---	PASS
BRWD3	254065	broad.mit.edu	37	X	79942506	79942506	+	Intron	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79942506C>G	uc004edt.2	-						BRWD3_uc010nmi.1_Intron|BRWD3_uc004edo.2_Intron|BRWD3_uc004edp.2_Intron|BRWD3_uc004edq.2_Intron|BRWD3_uc010nmj.1_Intron|BRWD3_uc004edr.2_Intron|BRWD3_uc004eds.2_Intron|BRWD3_uc004edu.2_Intron|BRWD3_uc004edv.2_Intron|BRWD3_uc004edw.2_Intron|BRWD3_uc004edx.2_Intron|BRWD3_uc004edy.2_Intron|BRWD3_uc004edz.2_Intron|BRWD3_uc004eea.2_Intron|BRWD3_uc004eeb.2_Intron	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3											ovary(4)	4						ATTTGACCTACAGATTTTAAT	0.299													3	21	---	---	---	---	PASS
CYLC1	1538	broad.mit.edu	37	X	83128189	83128189	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83128189C>A	uc004eei.1	+	4	494	c.473C>A	c.(472-474)GCA>GAA	p.A158E	CYLC1_uc004eeh.1_Missense_Mutation_p.A157E	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	158					cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5						CAAAATGAGGCAGATAAAACT	0.338													7	11	---	---	---	---	PASS
PABPC5	140886	broad.mit.edu	37	X	90691646	90691646	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90691646C>T	uc004efg.2	+	2	1510	c.1070C>T	c.(1069-1071)GCA>GTA	p.A357V	PABPC5_uc004eff.1_Missense_Mutation_p.A193V	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	357	RRM 4.					cytoplasm	nucleotide binding|RNA binding			ovary(1)|lung(1)|pancreas(1)	3						GCTACCAAAGCAGTGGATGAG	0.527													12	21	---	---	---	---	PASS
BTK	695	broad.mit.edu	37	X	100630231	100630231	+	Silent	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100630231G>T	uc004ehg.2	-	2	235	c.42C>A	c.(40-42)TCC>TCA	p.S14S	BTK_uc010nnn.2_Silent_p.S14S|BTK_uc010nno.2_Silent_p.S48S|BTK_uc004ehi.2_Silent_p.S14S	NM_000061	NP_000052	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	14	PH.		S -> F (in XLA).		calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding			lung(3)|central_nervous_system(2)|ovary(1)	6						TTTTCTGTTGGGATCGCTTCA	0.458									Agammaglobulinemia_X-linked				12	98	---	---	---	---	PASS
GPRASP1	9737	broad.mit.edu	37	X	101912635	101912635	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101912635C>A	uc004ejj.3	+	5	4595	c.3794C>A	c.(3793-3795)ACT>AAT	p.T1265N	GPRASP1_uc004eji.3_Missense_Mutation_p.T1265N|GPRASP1_uc010nod.2_Missense_Mutation_p.T1265N	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting	1265	OPRD1-binding.					cytoplasm	protein binding			ovary(1)|lung(1)	2						AGACATCTCACTACTACTACT	0.398													8	66	---	---	---	---	PASS
TCEAL3	85012	broad.mit.edu	37	X	102864368	102864368	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102864368C>A	uc004ekq.2	+	3	638	c.376C>A	c.(376-378)CAG>AAG	p.Q126K	TCEAL3_uc004ekr.2_Missense_Mutation_p.Q126K	NM_001006933	NP_001006934	Q969E4	TCAL3_HUMAN	transcription elongation factor A (SII)-like 3	126					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						CAAGGACTCTCAGGAGGACTT	0.532													11	82	---	---	---	---	PASS
ESX1	80712	broad.mit.edu	37	X	103495396	103495396	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103495396G>A	uc004ely.2	-	4	792	c.734C>T	c.(733-735)CCT>CTT	p.P245L		NM_153448	NP_703149	Q8N693	ESX1_HUMAN	extraembryonic, spermatogenesis, homeobox	245	15 X 9 AA tandem repeats of P-P-x-x-P-x- P-P-x.|1.				negative regulation of transcription, DNA-dependent|regulation of cell cycle	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						AGGCAGCACAGGTGGTCTAGG	0.368													19	98	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106083927	106083927	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106083927C>A	uc004emo.2	+	10	1697	c.1532C>A	c.(1531-1533)CCT>CAT	p.P511H	MORC4_uc004emp.3_Intron|TBC1D8B_uc004emn.2_Missense_Mutation_p.P511H	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	511	Rab-GAP TBC.					intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						GCTACTAATCCTGACTATTAT	0.388													12	46	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106097494	106097494	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106097494C>A	uc004emo.2	+	14	2485	c.2320C>A	c.(2320-2322)CAG>AAG	p.Q774K	MORC4_uc004emp.3_Intron	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	774						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						GTATGTGATACAGACCCTAGA	0.343													7	47	---	---	---	---	PASS
SLC6A14	11254	broad.mit.edu	37	X	115577907	115577907	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115577907G>T	uc004eqi.2	+	7	894	c.790G>T	c.(790-792)GTG>TTG	p.V264L	SLC6A14_uc011mtm.1_RNA	NM_007231	NP_009162	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid	264	Helical; Name=5; (Potential).				cellular amino acid metabolic process|response to toxin	integral to membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)|pancreas(1)	3					L-Proline(DB00172)	TTCTTGGTAGGTGGTATATTT	0.323													22	36	---	---	---	---	PASS
ZCCHC12	170261	broad.mit.edu	37	X	117959684	117959684	+	Silent	SNP	T	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117959684T>A	uc004equ.2	+	4	950	c.477T>A	c.(475-477)GCT>GCA	p.A159A		NM_173798	NP_776159	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	159					regulation of transcription, DNA-dependent|transcription, DNA-dependent		nucleic acid binding|zinc ion binding			ovary(1)	1						tccagaacgctattcaggcag	0.124													83	116	---	---	---	---	PASS
UPF3B	65109	broad.mit.edu	37	X	118972475	118972475	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118972475C>A	uc004erz.1	-	9	939	c.862G>T	c.(862-864)GAA>TAA	p.E288*	UPF3B_uc004esa.1_Nonsense_Mutation_p.E275*	NM_080632	NP_542199	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B	288	Sufficient for association with EJC core.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(2)|kidney(1)	3						TCTCCTTTTTCTGGCTTCTTG	0.323													42	90	---	---	---	---	PASS
UPF3B	65109	broad.mit.edu	37	X	118975200	118975200	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118975200C>T	uc004erz.1	-	7	723	c.646G>A	c.(646-648)GAA>AAA	p.E216K	UPF3B_uc004esa.1_Missense_Mutation_p.E216K	NM_080632	NP_542199	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B	216	Sufficient for association with EJC core.|Necessary for interaction with UPF2.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(2)|kidney(1)	3						ctcctttcttctctcttttct	0.149													12	98	---	---	---	---	PASS
UPF3B	65109	broad.mit.edu	37	X	118977226	118977226	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118977226C>T	uc004erz.1	-	5	585	c.508G>A	c.(508-510)GAT>AAT	p.D170N	UPF3B_uc004esa.1_Missense_Mutation_p.D170N	NM_080632	NP_542199	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B	170	Sufficient for association with EJC core.|Necessary for interaction with UPF2.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(2)|kidney(1)	3						TTCTCATTATCTGTGGCATAA	0.308													6	88	---	---	---	---	PASS
THOC2	57187	broad.mit.edu	37	X	122801009	122801009	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122801009C>T	uc004etu.2	-	11	1170	c.1138G>A	c.(1138-1140)GCC>ACC	p.A380T	THOC2_uc011muh.1_Missense_Mutation_p.A301T|THOC2_uc011mui.1_Missense_Mutation_p.A265T	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	380					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						ATAGCAAGGGCTATTAGCTTG	0.383													11	55	---	---	---	---	PASS
CCDC160	347475	broad.mit.edu	37	X	133379769	133379769	+	Silent	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133379769A>T	uc011mvj.1	+	2	1260	c.939A>T	c.(937-939)TCA>TCT	p.S313S		NM_001101357	NP_001094827	A6NGH7	CC160_HUMAN	coiled-coil domain containing 160	313										skin(1)	1						TGGTAACATCATCAAGTATCC	0.348													4	22	---	---	---	---	PASS
ZNF75D	7626	broad.mit.edu	37	X	134421514	134421514	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134421514T>A	uc004eyp.2	-	7	3743	c.1088A>T	c.(1087-1089)AAA>ATA	p.K363I	ZNF75D_uc004eym.2_Intron|ZNF75D_uc004eyn.2_Missense_Mutation_p.K142I|ZNF75D_uc004eyo.2_Missense_Mutation_p.K268I	NM_007131	NP_009062	P51815	ZN75D_HUMAN	zinc finger protein 75	363					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CTTAAAAGGTTTCTCCCCTGT	0.408													9	35	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135496475	135496475	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135496475G>T	uc004ezu.1	+	25	9485	c.9194G>T	c.(9193-9195)AGC>ATC	p.S3065I	GPR112_uc010nsb.1_Missense_Mutation_p.S2860I	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	3065	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					TCAGAAATAAGCTTTCCAAAT	0.393													16	102	---	---	---	---	PASS
CD40LG	959	broad.mit.edu	37	X	135738588	135738588	+	Intron	SNP	C	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135738588C>G	uc004faa.2	+						CD40LG_uc010nsd.2_Intron	NM_000074	NP_000065	P29965	CD40L_HUMAN	CD40 ligand						anti-apoptosis|B cell proliferation|inflammatory response|isotype switching|leukocyte cell-cell adhesion|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of interleukin-12 production	extracellular space|integral to plasma membrane|soluble fraction	CD40 receptor binding|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)				Atorvastatin(DB01076)	GTAAGTCACACAGCATCTGAG	0.473									Immune_Deficiency_with_Hyper-IgM				10	68	---	---	---	---	PASS
GPR101	83550	broad.mit.edu	37	X	136112439	136112439	+	Silent	SNP	G	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136112439G>T	uc011mwh.1	-	1	1395	c.1395C>A	c.(1393-1395)ATC>ATA	p.I465I		NM_054021	NP_473362	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	465	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)					GCATGTCCTGGATTTCCTTCT	0.507													28	38	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138708792	138708792	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138708792T>C	uc004fau.2	-	5	856	c.562A>G	c.(562-564)ACT>GCT	p.T188A	MCF2_uc004fav.2_Missense_Mutation_p.T188A|MCF2_uc011mwl.1_Missense_Mutation_p.T149A|MCF2_uc010nsh.1_Missense_Mutation_p.T188A|MCF2_uc011mwm.1_Missense_Mutation_p.T149A|MCF2_uc011mwn.1_Missense_Mutation_p.T333A|MCF2_uc004faw.2_Missense_Mutation_p.T248A|MCF2_uc011mwo.1_Missense_Mutation_p.T248A	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	188					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					TTATTAATAGTTTGCCAGTCA	0.333													13	107	---	---	---	---	PASS
CXorf66	347487	broad.mit.edu	37	X	139038261	139038261	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139038261T>A	uc004fbb.2	-	3	902	c.880A>T	c.(880-882)ACT>TCT	p.T294S		NM_001013403	NP_001013421	Q5JRM2	CX066_HUMAN	hypothetical protein LOC347487 precursor	294	Cytoplasmic (Potential).					integral to membrane					0						AGGTTTTGAGTGTTTTTCTCC	0.388													10	64	---	---	---	---	PASS
MAGEC3	139081	broad.mit.edu	37	X	140969303	140969303	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140969303G>A	uc011mwp.1	+	4	630	c.630G>A	c.(628-630)ATG>ATA	p.M210I		NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	210	MAGE 1.									skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GAGCAGAGATGCAGATGAATG	0.433													21	106	---	---	---	---	PASS
SLITRK4	139065	broad.mit.edu	37	X	142718108	142718108	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142718108G>A	uc004fbx.2	-	2	1193	c.817C>T	c.(817-819)CGC>TGC	p.R273C	SLITRK4_uc004fby.2_Missense_Mutation_p.R273C	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	273	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					GGCAGGATGCGCACGTCAAAA	0.448													13	56	---	---	---	---	PASS
F8	2157	broad.mit.edu	37	X	154185349	154185349	+	Silent	SNP	A	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154185349A>T	uc004fmt.2	-	11	1806	c.1635T>A	c.(1633-1635)CCT>CCA	p.P545P		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	545	F5/8 type A 2.|Plastocyanin-like 3.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TCAGGCACCGAGGATCTGATT	0.413													8	81	---	---	---	---	PASS
KIAA1751	85452	broad.mit.edu	37	1	1887845	1887847	+	Intron	DEL	CTG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1887845_1887847delCTG	uc001aim.1	-						KIAA1751_uc009vkz.1_Intron	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452											pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		AGGGAGTGTCCTGCTGCTGCTGC	0.640													4	2	---	---	---	---	
SKI	6497	broad.mit.edu	37	1	2194163	2194164	+	Intron	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2194163_2194164insT	uc001aja.3	+							NM_003036	NP_003027	P12755	SKI_HUMAN	v-ski sarcoma viral oncogene homolog						anterior/posterior axis specification|BMP signaling pathway|bone morphogenesis|cell motility|cell proliferation|embryonic limb morphogenesis|face morphogenesis|lens morphogenesis in camera-type eye|myelination in peripheral nervous system|myotube differentiation|negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of fibroblast proliferation|negative regulation of osteoblast differentiation|negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|neural tube closure|nose morphogenesis|olfactory bulb development|palate development|positive regulation of DNA binding|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|protein homotrimerization|regulation of apoptosis|retina development in camera-type eye|skeletal muscle fiber development|SMAD protein signal transduction|somatic stem cell maintenance|transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|PML body|transcription factor complex|transcriptional repressor complex	histone deacetylase inhibitor activity|nucleotide binding|protein domain specific binding|protein kinase binding|repressing transcription factor binding|SMAD binding|transcription corepressor activity|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		tttgtcaggtgtttttttttct	0.000													4	2	---	---	---	---	
RER1	11079	broad.mit.edu	37	1	2332703	2332710	+	Intron	DEL	CCACCCTC	-	-	rs115475814		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2332703_2332710delCCACCCTC	uc001aje.1	+						RER1_uc001ajf.1_Intron	NM_007033	NP_008964	O15258	RER1_HUMAN	RER1 retention in endoplasmic reticulum 1						retrograde vesicle-mediated transport, Golgi to ER	integral to Golgi membrane					0	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.28e-37)|OV - Ovarian serous cystadenocarcinoma(86;8.29e-23)|GBM - Glioblastoma multiforme(42;4.71e-08)|Colorectal(212;4.73e-05)|COAD - Colon adenocarcinoma(227;0.00021)|Kidney(185;0.00116)|BRCA - Breast invasive adenocarcinoma(365;0.00459)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0182)|Lung(427;0.204)		cctccctcctccaccctccctcctccct	0.130													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	2906030	2906031	+	IGR	INS	-	CATC	CATC	rs139150411		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2906030_2906031insCATC								MMEL1 (341549 upstream) : ACTRT2 (32015 downstream)																							ctatactccatcatccatccat	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	5531403	5531404	+	IGR	DEL	CA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5531403_5531404delCA								AJAP1 (687553 upstream) : NPHP4 (391466 downstream)																							aacatgcacgcacacacacaca	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	5877090	5877090	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5877090delG								None (None upstream) : NPHP4 (45780 downstream)																							TGTGGACACAGGGGATTACTG	0.547													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	6458218	6458218	+	IGR	DEL	T	-	-	rs112250885		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6458218delT								ACOT7 (4392 upstream) : HES2 (14282 downstream)																							gtctcatcacttttttttttt	0.000													6	3	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	7164313	7164314	+	Intron	DEL	AT	-	-	rs111267354		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7164313_7164314delAT	uc001aoi.2	+							NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		cacaacacacatacacacaACT	0.104													4	4	---	---	---	---	
GPR157	80045	broad.mit.edu	37	1	9172267	9172267	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9172267delC	uc001apq.1	-						GPR157_uc010oad.1_Intron|GPR157_uc001apr.2_Intron	NM_024980	NP_079256	Q5UAW9	GP157_HUMAN	G protein-coupled receptor 157							integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_lung(157;0.185)	all_epithelial(116;5.02e-20)|all_lung(118;3.6e-06)|Lung NSC(185;7.93e-06)|Renal(390;0.000147)|Breast(348;0.000688)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.16e-07)|COAD - Colon adenocarcinoma(227;7.73e-05)|Kidney(185;0.000252)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.00178)|BRCA - Breast invasive adenocarcinoma(304;0.00186)|READ - Rectum adenocarcinoma(331;0.0642)		acaatcagcgccccctggtca	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	9218320	9218321	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9218320_9218321insA	uc009vmq.2	-											EF609116																		tactaagaaataaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	9700645	9700646	+	IGR	INS	-	A	A	rs12073165		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9700645_9700646insA								TMEM201 (25710 upstream) : PIK3CD (11144 downstream)																							ctcaaaaaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	11407472	11407473	+	IGR	INS	-	A	A	rs150032584	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11407472_11407473insA								UBIAD1 (58982 upstream) : PTCHD2 (131822 downstream)																							ttagtgcagttaataatttgtc	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	11811022	11811023	+	IGR	DEL	GA	-	-	rs142991690		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11811022_11811023delGA								AGTRAP (195 upstream) : MTHFR (34764 downstream)																							GAGGCCACAGGAGAGAGAGACA	0.431													3	4	---	---	---	---	
VPS13D	55187	broad.mit.edu	37	1	12442041	12442042	+	Intron	INS	-	TT	TT	rs35247625		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12442041_12442042insTT	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc009vnl.2_Intron	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		ttctttctttctctctctctct	0.025													4	2	---	---	---	---	
FHAD1	114827	broad.mit.edu	37	1	15661975	15661975	+	Intron	DEL	T	-	-	rs34503287		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15661975delT	uc001awb.2	+						FHAD1_uc001awa.1_Intron|uc001awc.1_Intron	NM_052929	NP_443161	B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding											skin(1)	1						CTTGGTGTGCTTTTTTTTTTT	0.373													4	2	---	---	---	---	
CLCNKB	1188	broad.mit.edu	37	1	16372283	16372283	+	Intron	DEL	T	-	-	rs67016480		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16372283delT	uc001axw.3	+						FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Intron	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		TTGGGGGGGGTGCTCTGGGTG	0.358													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	16517923	16517926	+	IGR	DEL	GGAG	-	-	rs111976774		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16517923_16517926delGGAG								EPHA2 (35359 upstream) : ARHGEF19 (6673 downstream)																							agggagggatggagggagggaggg	0.221													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	16858336	16858337	+	IGR	INS	-	AA	AA			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16858336_16858337insAA								CROCCL2 (39140 upstream) : NBPF1 (32075 downstream)																							ccaccagcaacaaaaaagcaaa	0.000													4	3	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17224596	17224596	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17224596delC	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TACTCAATGTCCCCCCTCCCA	0.383													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	17492710	17492713	+	IGR	DEL	CCAC	-	-	rs111561356		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17492710_17492713delCCAC								PADI2 (46762 upstream) : PADI1 (38908 downstream)																							aacatccccaccacccaccatgcc	0.000													1	5	---	---	---	---	
AKR7L	246181	broad.mit.edu	37	1	19596297	19596297	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19596297delT	uc010ocx.1	-						AKR7L_uc010ocy.1_Intron	NM_201252	NP_957704			aflatoxin B1 aldehyde reductase 3 isoform 1												0						GGGCATATACTTATTCTTACT	0.294													4	2	---	---	---	---	
CAPZB	832	broad.mit.edu	37	1	19692334	19692334	+	Intron	DEL	G	-	-	rs111881430		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19692334delG	uc010ocz.1	-						CAPZB_uc001bce.2_Intron|CAPZB_uc009vpk.2_Intron|CAPZB_uc001bcd.2_Intron	NM_004930	NP_004921	P47756	CAPZB_HUMAN	F-actin capping protein beta subunit						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement	cytosol|F-actin capping protein complex|WASH complex	actin binding				0		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)		gtctcaaaaagaaaaaaagaa	0.234													4	3	---	---	---	---	
MUL1	79594	broad.mit.edu	37	1	20832100	20832100	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20832100delG	uc001bdi.3	-							NM_024544	NP_078820	Q969V5	MUL1_HUMAN	mitochondrial ubiquitin ligase activator of NFKB						activation of caspase activity|activation of JUN kinase activity|induction of apoptosis|mitochondrial fission|mitochondrion localization|negative regulation of cell growth|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to mitochondrial outer membrane|nucleus|peroxisome	identical protein binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding				0		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00748)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000137)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		aaaaaaaaaagaagaGGAAaa	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	20884098	20884099	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20884098_20884099insT								FAM43B (2586 upstream) : CDA (31345 downstream)																							tcactgctccctagacatcacc	0.114													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	23006397	23006398	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23006397_23006398insT								C1QB (18369 upstream) : EPHB2 (30933 downstream)																							ctctttgtctctttttttttct	0.153													4	2	---	---	---	---	
CNR2	1269	broad.mit.edu	37	1	24240261	24240261	+	5'Flank	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24240261delG	uc001bif.2	-							NM_001841	NP_001832	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)						behavior|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	dendrite|integral to plasma membrane|perikaryon	cannabinoid receptor activity			skin(2)|central_nervous_system(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Nabilone(DB00486)	atcctggtgtggggcaatagg	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	26823893	26823894	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26823893_26823894insT								HMGN2 (20762 upstream) : RPS6KA1 (32355 downstream)																							gtctgaatatcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	26965743	26965743	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26965743delA								RPS6KA1 (64223 upstream) : ARID1A (56779 downstream)																							tgtctcaaagaaaaaaaaaTA	0.030													4	2	---	---	---	---	
GMEB1	10691	broad.mit.edu	37	1	29018529	29018529	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29018529delT	uc001bra.2	+						GMEB1_uc001bqz.2_Intron|GMEB1_uc001brb.2_Intron	NM_006582	NP_006573	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|metal ion binding|transcription coactivator activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		cTTGGCtttcttttttttttt	0.015													4	3	---	---	---	---	
PTPRU	10076	broad.mit.edu	37	1	29576575	29576576	+	Intron	INS	-	G	G	rs72508799		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29576575_29576576insG	uc001bru.2	+						PTPRU_uc001brv.2_Intron|PTPRU_uc001brw.2_Intron|PTPRU_uc009vtq.2_Intron|PTPRU_uc009vtr.2_Intron	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U						canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		ttgccacaaatccttccaccca	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	32177464	32177464	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32177464delA								COL16A1 (7696 upstream) : BAI2 (15255 downstream)																							tcctgtttccaaaaaaaaaaa	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	36573005	36573005	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36573005delA								COL8A2 (7155 upstream) : TRAPPC3 (29170 downstream)																							accctgtctcaaaaaaaaaaa	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	38588125	38588125	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38588125delT								POU3F1 (75675 upstream) : RRAGC (716890 downstream)																							attaaaacaattttttttttt	0.000													6	3	---	---	---	---	
ZNF642	339559	broad.mit.edu	37	1	40943795	40943796	+	Intron	DEL	CA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40943795_40943796delCA	uc001cfo.2	+						ZNF642_uc009vwb.2_Intron|ZNF642_uc010ojk.1_Intron	NM_198494	NP_940896	Q49AA0	ZN642_HUMAN	zinc finger protein 642						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;8.81e-19)			TGCATATAGTcacacacacaca	0.401													4	3	---	---	---	---	
HIVEP3	59269	broad.mit.edu	37	1	41997830	41997833	+	Intron	DEL	AGAT	-	-	rs145873344		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41997830_41997833delAGAT	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001cgy.2_Intron	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				AAGACATGAGAGATAGAGGACAGG	0.225													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	51696914	51696914	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51696914delT								C1orf185 (83162 upstream) : RNF11 (5031 downstream)																							TTCAGGATAATTTTTTTTtca	0.164													4	2	---	---	---	---	
RNF11	26994	broad.mit.edu	37	1	51713127	51713127	+	Intron	DEL	T	-	-	rs111522620		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51713127delT	uc001csi.3	+							NM_014372	NP_055187	Q9Y3C5	RNF11_HUMAN	ring finger protein 11						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	DNA binding|protein binding|zinc ion binding				0						tgtttttttgttttttttttt	0.000													3	4	---	---	---	---	
ZCCHC11	23318	broad.mit.edu	37	1	52926163	52926165	+	Intron	DEL	AAC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52926163_52926165delAAC	uc001ctx.2	-						ZCCHC11_uc001cty.2_Intron|ZCCHC11_uc001ctz.2_Intron|ZCCHC11_uc009vze.1_Intron|ZCCHC11_uc009vzf.1_Intron|ZCCHC11_uc001cua.1_Intron	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform						miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						caacaacaggaacaacaacaaca	0.153													4	2	---	---	---	---	
ZYG11B	79699	broad.mit.edu	37	1	53282404	53282405	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53282404_53282405insA	uc001cuj.2	+						ZYG11B_uc010onj.1_Intron|ZYG11B_uc009vzh.2_Intron	NM_024646	NP_078922	Q9C0D3	ZY11B_HUMAN	zyg-11 homolog B								protein binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						TTTTTAAGAACACTGACTTAAA	0.193													8	4	---	---	---	---	
GLIS1	148979	broad.mit.edu	37	1	54056477	54056478	+	Intron	INS	-	A	A	rs147012271	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54056477_54056478insA	uc001cvr.1	-							NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						GTGGGGGATGGTGATGCCATTG	0.564													1	6	---	---	---	---	
TNNI3K	51086	broad.mit.edu	37	1	74996728	74996728	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74996728delT	uc001dgf.1	+						TNNI3K_uc001dge.1_Intron	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b							cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						AGCTGAGACCTTGGATATTTG	0.378													4	2	---	---	---	---	
SLC44A5	204962	broad.mit.edu	37	1	75974459	75974460	+	Intron	INS	-	A	A	rs145410083	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75974459_75974460insA	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						ctTCTTTATGTAAGAAAAGGTT	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	76506771	76506772	+	IGR	INS	-	TTTTTT	TTTTTT	rs58431165		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76506771_76506772insTTTTTT								ASB17 (108655 upstream) : ST6GALNAC3 (33617 downstream)																							GGGGAGGGCGGttttttttttt	0.277													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	81564713	81564713	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81564713delT								None (None upstream) : LPHN2 (207132 downstream)																							GAAAAGAGGCttttttttttc	0.219													4	2	---	---	---	---	
DDAH1	23576	broad.mit.edu	37	1	85991806	85991807	+	Intron	INS	-	GA	GA	rs147393938		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85991806_85991807insGA	uc001dlc.2	-							NM_001134445	NP_001127917	O94760	DDAH1_HUMAN	dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)	TGGTGACAAAGGACATGGAAAT	0.421													2	5	---	---	---	---	
PKN2	5586	broad.mit.edu	37	1	89248065	89248065	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89248065delT	uc001dmn.2	+						PKN2_uc001dmm.1_Intron|PKN2_uc010osp.1_Intron|PKN2_uc010osq.1_Intron|PKN2_uc009wcv.2_Intron|PKN2_uc010osr.1_Intron	NM_006256	NP_006247	Q16513	PKN2_HUMAN	protein kinase N2						signal transduction	cytoplasm	ATP binding|histone deacetylase binding|protein kinase C activity			large_intestine(1)|lung(1)|skin(1)	3		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		attcatggccttttttttttc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	94334987	94334988	+	IGR	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94334987_94334988delAC								BCAR3 (22281 upstream) : DNTTIP2 (350 downstream)																							CCCTacacagacacacacacac	0.272													4	2	---	---	---	---	
KCND3	3752	broad.mit.edu	37	1	112516111	112516111	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112516111delC	uc001ebu.1	-						KCND3_uc001ebv.1_Intron	NM_004980	NP_004971	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related							sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)		GGCTATGTTTCCAGTCCTGTT	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	114551039	114551040	+	IGR	INS	-	G	G	rs138285909	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114551039_114551040insG								OLFML3 (26163 upstream) : SYT6 (80875 downstream)																							TTAAAGTTGGATGCCCTAAATG	0.297													4	2	---	---	---	---	
HSD3B2	3284	broad.mit.edu	37	1	119970829	119970829	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119970829delG	uc001ehu.2	+									P26439	3BHS2_HUMAN	RecName: Full=3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 2; AltName: Full=3-beta-HSD II; Includes:   RecName: Full=3-beta-hydroxy-Delta(5)-steroid dehydrogenase;            EC=1.1.1.145;   AltName: Full=3-beta-hydroxy-5-ene steroid dehydrogenase;   AltName: Full=Progesterone reductase; Includes:   RecName: Full=Steroid Delta-isomerase;            EC=5.3.3.1;   AltName: Full=Delta-5-3-ketosteroid isomerase;						androgen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	NADH(DB00157)|Trilostane(DB01108)	gtggctgtttgagtaaataca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121329658	121329658	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121329658delA								LOC647121 (15972 upstream) : None (None downstream)																							CTTATATGCTAAAATGATTAA	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142645818	142645819	+	Intron	INS	-	TTC	TTC	rs145275104		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142645818_142645819insTTC	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		tttttttttttccccccttcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142805096	142805099	+	Intron	DEL	CTGC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142805096_142805099delCTGC	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejd.1_RNA|uc001ejc.2_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		CTCCTCACCTCTGCCTCTTTTCAC	0.520													5	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144528213	144528214	+	Intron	INS	-	CACT	CACT	rs148652392		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144528213_144528214insCACT	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						gcccaatgatacactgatctat	0.000													8	4	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144593874	144593875	+	Intron	INS	-	G	G	rs150259865		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144593874_144593875insG	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_5'Flank|uc001elc.2_RNA|NBPF9_uc009wif.1_RNA|uc001ele.2_5'Flank	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						CGAGGCGCGGCGCACGGATGCC	0.693													4	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145076977	145076984	+	Intron	DEL	ATAGATAG	-	-	rs68189964		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145076977_145076984delATAGATAG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_5'Flank|PDE4DIP_uc001emh.2_5'Flank|PDE4DIP_uc001emk.2_5'Flank			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						ctctctctctatagatagatagatagat	0.010													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145091997	145091998	+	Intron	DEL	TT	-	-	rs112622642		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145091997_145091998delTT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						AAAGTCATAAtttttttttttt	0.168													4	4	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145200787	145200788	+	Intron	INS	-	TG	TG	rs147830053		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145200787_145200788insTG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						TTTTTTTTTTTTTGTTGTTGTT	0.144													4	4	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145786830	145786830	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145786830delA	uc001emp.3	+						GPR89A_uc001eop.2_Intron|GPR89A_uc001eoq.2_Intron|GPR89A_uc001eor.2_Intron|GPR89A_uc010ozb.1_Intron|GPR89A_uc001eos.2_Intron|GPR89A_uc001eot.2_Intron|GPR89A_uc010ozc.1_Intron|GPR89A_uc010ozd.1_Intron|GPR89A_uc010oze.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ACCCAGTAGGAAAGTCATCAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	146556148	146556149	+	IGR	INS	-	AA	AA	rs66740888		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146556148_146556149insAA								LOC728989 (41549 upstream) : PRKAB2 (70538 downstream)																							TTCCACACTGCAAAAAAAAAAA	0.228													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148898510	148898510	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148898510delG	uc009wkv.1	+											Homo sapiens cDNA, FLJ17483.																		tttaccccatgttttttttat	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149032202	149032202	+	IGR	DEL	G	-	-	rs76534002	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149032202delG								LOC645166 (79148 upstream) : LOC388692 (247274 downstream)																							CTGGGAACATGGAGGCCTGGA	0.403													5	3	---	---	---	---	
INTS3	65123	broad.mit.edu	37	1	153711840	153711841	+	Intron	INS	-	T	T	rs147864655		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153711840_153711841insT	uc009wom.2	+						INTS3_uc001fct.2_Intron|INTS3_uc001fcu.2_Intron|INTS3_uc001fcv.2_Intron	NM_023015	NP_075391	Q68E01	INT3_HUMAN	integrator complex subunit 3						DNA repair|G2/M transition checkpoint|response to ionizing radiation|snRNA processing	integrator complex|SOSS complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			cgcgcccggccggagtttcact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	154603489	154603489	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154603489delA								ADAR (3052 upstream) : KCNN3 (76428 downstream)																							actccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154686669	154686670	+	Intron	INS	-	GTGT	GTGT			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154686669_154686670insGTGT	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			gtgtgtgtgtggtgtgtgtgtc	0.000													4	2	---	---	---	---	
SYT11	23208	broad.mit.edu	37	1	155836781	155836784	+	Intron	DEL	ACAT	-	-	rs10531680		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155836781_155836784delACAT	uc001fmg.2	+						SYT11_uc010pgq.1_Intron	NM_152280	NP_689493	Q9BT88	SYT11_HUMAN	synaptotagmin XI							cell junction|synaptic vesicle membrane	protein binding|transporter activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			acacacacacacatatatatatat	0.083													4	2	---	---	---	---	
CCDC19	25790	broad.mit.edu	37	1	159891161	159891163	+	Intron	DEL	AAC	-	-	rs72007288		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159891161_159891163delAAC	uc001ful.2	-						TAGLN2_uc001fum.1_5'Flank|TAGLN2_uc001fun.1_Intron|TAGLN2_uc001fuo.1_Intron|TAGLN2_uc010piy.1_Intron	NM_012337	NP_036469	Q9UL16	CCD19_HUMAN	nasopharyngeal epithelium specific protein 1							mitochondrion|soluble fraction				ovary(1)	1	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			tgggagaagtaacaacaacaaca	0.000													5	3	---	---	---	---	
VANGL2	57216	broad.mit.edu	37	1	160371773	160371773	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160371773delT	uc001fwb.1	+						VANGL2_uc001fwc.1_Intron	NM_020335	NP_065068	Q9ULK5	VANG2_HUMAN	vang-like 2						apical protein localization|heart looping|nonmotile primary cilium assembly	apical plasma membrane|integral to membrane				ovary(1)	1	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGCAGGCAGATTTTCCTGGCA	0.488													4	2	---	---	---	---	
ATF6	22926	broad.mit.edu	37	1	161813080	161813080	+	Intron	DEL	T	-	-	rs35375131		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161813080delT	uc001gbr.2	+						ATF6_uc001gbq.1_Intron	NM_007348	NP_031374	P18850	ATF6A_HUMAN	activating transcription factor 6						positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)			gggaattgactttttttttgt	0.035													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	165435667	165435669	+	IGR	DEL	ATC	-	-	rs143496052		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165435667_165435669delATC								RXRG (21237 upstream) : LOC400794 (10410 downstream)																							CACAGCTCTGATCATCAGACTTG	0.389													6	3	---	---	---	---	
MPZL1	9019	broad.mit.edu	37	1	167747069	167747069	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167747069delT	uc001geo.2	+						MPZL1_uc001gep.2_Intron|MPZL1_uc001geq.2_Intron|MPZL1_uc009wvh.2_Intron	NM_003953	NP_003944	O95297	MPZL1_HUMAN	myelin protein zero-like 1 isoform a						cell-cell signaling|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	protein binding|structural molecule activity			ovary(2)	2	all_hematologic(923;0.215)					tggtcatacctaaatgggtta	0.000													4	2	---	---	---	---	
ADCY10	55811	broad.mit.edu	37	1	167828142	167828144	+	Intron	DEL	ATG	-	-	rs113590877		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167828142_167828144delATG	uc001ger.2	-						ADCY10_uc009wvk.2_Intron|ADCY10_uc010plj.1_Intron|ADCY10_uc009wvl.2_Intron	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10						intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3						ccaggaaaaaatgataagagcct	0.015													3	4	---	---	---	---	
C1orf112	55732	broad.mit.edu	37	1	169636855	169636860	+	Intron	DEL	AAAGAG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169636855_169636860delAAAGAG	uc001ggj.2	+									Q9NSG2	CA112_HUMAN	Homo sapiens cDNA FLJ10706 fis, clone NT2RP3000852.												0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					aggagaagtcaaagagaaagagaaag	0.005													3	3	---	---	---	---	
RABGAP1L	9910	broad.mit.edu	37	1	174190464	174190464	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174190464delA	uc001gjx.2	+						RABGAP1L_uc009wwq.1_Intron|RABGAP1L_uc001gjw.2_Intron	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						CTCTGCCTATAAAAATCAGGT	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	181836286	181836286	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181836286delC								CACNA1E (65573 upstream) : ZNF648 (187421 downstream)																							TTGGCAGCCACCCAACTAAGT	0.303													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	181977867	181977868	+	IGR	DEL	CA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181977867_181977868delCA								CACNA1E (207154 upstream) : ZNF648 (45839 downstream)																							aaaattgccgcacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	183584068	183584069	+	IGR	DEL	TC	-	-	rs113152065		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183584068_183584069delTC								NCF2 (24022 upstream) : ARPC5 (11264 downstream)																							tcctccttcttctctcccttag	0.000													4	2	---	---	---	---	
GLT25D2	23127	broad.mit.edu	37	1	183993495	183993495	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183993495delT	uc001gqr.2	-						GLT25D2_uc010poj.1_Intron|GLT25D2_uc001gqs.2_Intron	NM_015101	NP_055916	Q8IYK4	GT252_HUMAN	glycosyltransferase 25 domain containing 2						lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity			ovary(1)|breast(1)	2						tttctttttcttttttttttt	0.154													4	2	---	---	---	---	
C1orf27	54953	broad.mit.edu	37	1	186368339	186368339	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186368339delT	uc001grw.2	+						C1orf27_uc010poq.1_Intron|C1orf27_uc010por.1_Intron|OCLM_uc001gry.2_5'Flank	NM_017847	NP_060317	Q5SWX8	ODR4_HUMAN	odorant response abnormal 4 isoform 1							integral to membrane	oxidoreductase activity|zinc ion binding			ovary(1)	1						GCTACTCAGAttttttttttt	0.144													4	2	---	---	---	---	
PLA2G4A	5321	broad.mit.edu	37	1	186816489	186816490	+	Intron	INS	-	GT	GT	rs138027698	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186816489_186816490insGT	uc001gsc.2	+						PLA2G4A_uc010pos.1_Intron	NM_024420	NP_077734	P47712	PA24A_HUMAN	cytosolic phospholipase A2, group IVA						phospholipid catabolic process|platelet activating factor biosynthetic process|platelet activation	cytosol|endoplasmic reticulum membrane	calcium ion binding|calcium-dependent phospholipid binding|lysophospholipase activity			lung(2)|breast(1)	3					Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Medrysone(DB00253)|Quinacrine(DB01103)	ttattTCATACgtgtgtgtgtg	0.149													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	194526342	194526343	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194526342_194526343insT								None (None upstream) : None (None downstream)																							gaaaaatgtccttttttttcag	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	199537882	199537883	+	IGR	INS	-	A	A	rs148414741	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199537882_199537883insA								MIR181A1 (709600 upstream) : NR5A2 (458887 downstream)																							TATGCACTTAGAAAAAGCAggc	0.223													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	199734316	199734316	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199734316delA								MIR181A1 (906034 upstream) : NR5A2 (262454 downstream)																							tagaataaataccatttaaca	0.109													4	2	---	---	---	---	
CSRP1	1465	broad.mit.edu	37	1	201461181	201461181	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201461181delA	uc001gws.2	-						CSRP1_uc001gwr.1_RNA|CSRP1_uc010ppr.1_Intron|CSRP1_uc010pps.1_Intron	NM_004078	NP_004069	P21291	CSRP1_HUMAN	cysteine and glycine-rich protein 1 isoform 1							nucleus	zinc ion binding			ovary(1)	1						AGCTCCCAAGAAGGAGGGAGA	0.537													4	2	---	---	---	---	
ZC3H11A	9877	broad.mit.edu	37	1	203790890	203790891	+	Intron	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203790890_203790891insT	uc001hac.2	+						ZC3H11A_uc001had.2_Intron|ZC3H11A_uc001hae.2_Intron|ZC3H11A_uc001haf.2_Intron|ZC3H11A_uc010pqm.1_Intron|ZC3H11A_uc001hag.1_Intron	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A								nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ttttggttttgttttttttttt	0.000													3	3	---	---	---	---	
NFASC	23114	broad.mit.edu	37	1	204842805	204842805	+	Intron	DEL	C	-	-	rs76149314		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204842805delC	uc001hbj.2	+						NFASC_uc001hbh.2_Intron|NFASC_uc010pqz.1_Intron|NFASC_uc010pra.1_Intron|NFASC_uc001hbi.2_Intron|NFASC_uc009xbg.1_Intron	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor						axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TGGGGGCCTTCCATTCTGAGG	0.572													4	2	---	---	---	---	
MFSD4	148808	broad.mit.edu	37	1	205567472	205567472	+	Intron	DEL	A	-	-	rs71689821		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205567472delA	uc001hcv.3	+						MFSD4_uc010prk.1_Intron|MFSD4_uc010prl.1_Intron|MFSD4_uc010prm.1_Intron|MFSD4_uc009xbn.2_Intron	NM_181644	NP_857595	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane				skin(2)|central_nervous_system(1)	3	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			ATTCACCAGGAAAAAAAAAAA	0.299													4	2	---	---	---	---	
CR1L	1379	broad.mit.edu	37	1	207871319	207871320	+	Intron	DEL	AG	-	-	rs45575738		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207871319_207871320delAG	uc001hga.3	+						CR1L_uc001hfz.2_Intron|CR1L_uc001hgb.1_Intron	NM_175710	NP_783641	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like							cytoplasm|extracellular region|membrane					0						acagacagacagacacacacac	0.307													19	9	---	---	---	---	
PLXNA2	5362	broad.mit.edu	37	1	208235418	208235418	+	Intron	DEL	A	-	-	rs77592655		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208235418delA	uc001hgz.2	-							NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor						axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)		AGGAAGGAGCAAAAAAAAAGG	0.433													4	2	---	---	---	---	
C1orf74	148304	broad.mit.edu	37	1	209958141	209958142	+	5'Flank	DEL	GC	-	-	rs147238249		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209958141_209958142delGC	uc001hhp.1	-							NM_152485	NP_689698	Q96LT6	CA074_HUMAN	hypothetical protein LOC148304											skin(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		GTTTCCCGCTGCTGCCCTCATT	0.550													4	2	---	---	---	---	
KCNH1	3756	broad.mit.edu	37	1	211099607	211099608	+	Intron	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211099607_211099608delAC	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		ctccatctAAacacacacacac	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	212073117	212073118	+	IGR	INS	-	TTG	TTG	rs145033844	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212073117_212073118insTTG								LPGAT1 (69003 upstream) : INTS7 (41580 downstream)																							TAGCCATCGTTttgttgttgtt	0.099													4	2	---	---	---	---	
TMEM206	55248	broad.mit.edu	37	1	212586521	212586521	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212586521delC	uc001hjc.3	-						TMEM206_uc010pte.1_Intron	NM_018252	NP_060722	Q9H813	TM206_HUMAN	transmembrane protein 206							integral to membrane				breast(1)	1				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		TCCTTTCAGACAAAGGAAACA	0.453													4	2	---	---	---	---	
FLVCR1	28982	broad.mit.edu	37	1	213064787	213064787	+	Intron	DEL	A	-	-	rs60547500		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213064787delA	uc001hjt.2	+							NM_014053	NP_054772	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular						cell death|cellular iron ion homeostasis|heme export|transmembrane transport	integral to plasma membrane	heme transporter activity|protein binding|receptor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		actccgtctcaaaaaaaaaaa	0.134													5	5	---	---	---	---	
SLC30A10	55532	broad.mit.edu	37	1	219918083	219918083	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219918083delA	uc001hlu.1	-									Q6XR72	ZNT10_HUMAN	Synthetic construct DNA, clone: pF1KB7405, Homo sapiens SLC30A10 gene for solute carrier family 30, member 10, without stop codon, in Flexi system.						zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		TCACAATCACAAAAAATAAAG	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	222451528	222451528	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222451528delC								DUSP10 (536067 upstream) : HHIPL2 (244074 downstream)																							TTATCCATTTCCCCATCTTCC	0.473													4	2	---	---	---	---	
LIN9	286826	broad.mit.edu	37	1	226435375	226435376	+	Intron	INS	-	T	T	rs113897527		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226435375_226435376insT	uc001hqa.2	-						LIN9_uc001hqb.2_Intron|LIN9_uc001hqc.2_Intron|LIN9_uc009xel.1_Intron	NM_173083	NP_775106	Q5TKA1	LIN9_HUMAN	lin-9 homolog						cell cycle|DNA replication	nucleoplasm					0	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		tgttttctttcttttttttttt	0.000													4	2	---	---	---	---	
LIN9	286826	broad.mit.edu	37	1	226442612	226442614	+	Intron	DEL	AAA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226442612_226442614delAAA	uc001hqa.2	-						LIN9_uc001hqb.2_Intron|LIN9_uc001hqc.2_Intron|LIN9_uc009xel.1_Intron	NM_173083	NP_775106	Q5TKA1	LIN9_HUMAN	lin-9 homolog						cell cycle|DNA replication	nucleoplasm					0	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		actctgtctcaaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	227677990	227677990	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227677990delT								CDC42BPA (172164 upstream) : ZNF678 (73254 downstream)																							GTCCAAGGGGTTTTCCCAAGC	0.562													4	2	---	---	---	---	
OBSCN	84033	broad.mit.edu	37	1	228535859	228535867	+	Intron	DEL	TCTTCTTCT	-	-	rs72158419		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228535859_228535867delTCTTCTTCT	uc009xez.1	+						OBSCN_uc001hsn.2_Intron|OBSCN_uc001hsr.1_Intron	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				tactctactctcttcttcttcttctattc	0.033													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229280170	229280170	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229280170delA								RHOU (397761 upstream) : RAB4A (126709 downstream)																							ctctgggtggaaaaagagaca	0.000													4	2	---	---	---	---	
GALNT2	2590	broad.mit.edu	37	1	230225068	230225069	+	Intron	DEL	GT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230225068_230225069delGT	uc010pwa.1	+						GALNT2_uc010pvy.1_Intron|GALNT2_uc010pvz.1_Intron	NM_004481	NP_004472	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2						immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				tgttttttgcgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
GALNT2	2590	broad.mit.edu	37	1	230229158	230229158	+	Intron	DEL	T	-	-	rs67267484		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230229158delT	uc010pwa.1	+						GALNT2_uc010pvy.1_Intron|GALNT2_uc010pvz.1_Intron	NM_004481	NP_004472	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2						immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				tagatcacagttgtgtaaagg	0.065													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230567085	230567087	+	IGR	DEL	TTG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230567085_230567087delTTG								PGBD5 (53718 upstream) : COG2 (211115 downstream)																							cttgtttgctttgttgttgttgt	0.000													4	2	---	---	---	---	
KIAA1804	84451	broad.mit.edu	37	1	233475118	233475120	+	Intron	DEL	CTC	-	-	rs140823769		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233475118_233475120delCTC	uc001hvt.3	+						KIAA1804_uc001hvs.1_Intron	NM_032435	NP_115811	Q5TCX8	M3KL4_HUMAN	mixed lineage kinase 4						activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity			lung(5)|central_nervous_system(2)|skin(1)	8		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)				tctcctccttctccttcttctcc	0.000													4	2	---	---	---	---	
SLC35F3	148641	broad.mit.edu	37	1	234320891	234320891	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234320891delA	uc001hvy.1	+							NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			CAGAAGGAGGAGGGAGCTCTA	0.458													4	2	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241384294	241384295	+	Intron	INS	-	AAGAAAGA	AAGAAAGA	rs12039594	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241384294_241384295insAAGAAAGA	uc001hyv.2	-						RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			aggaaggaaggaagagagagag	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242960812	242960813	+	IGR	INS	-	CA	CA	rs141021009	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242960812_242960813insCA								PLD5 (272814 upstream) : CEP170 (326918 downstream)																							CACCAAACACCGTCTTTCAATG	0.337													1	6	---	---	---	---	
C1orf100	200159	broad.mit.edu	37	1	244521885	244521885	+	Intron	DEL	A	-	-	rs72337032		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244521885delA	uc001iah.2	+						C1orf100_uc001iai.2_Intron	NM_001012970	NP_001012988	Q5SVJ3	CA100_HUMAN	hypothetical protein LOC200159												0	all_cancers(71;3.94e-05)|all_epithelial(71;0.000138)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|all_lung(81;0.0736)|Ovarian(71;0.0761)|Lung NSC(105;0.103)		all cancers(7;8.19e-08)|GBM - Glioblastoma multiforme(7;2.05e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.000984)			agagtgtctcaaaaaaaaaaa	0.035													4	4	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245479013	245479013	+	Intron	DEL	A	-	-	rs34972152		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245479013delA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			gacagagtgcaaaaaaaaaaa	0.000													5	3	---	---	---	---	
SMYD3	64754	broad.mit.edu	37	1	246457907	246457908	+	Intron	INS	-	T	T	rs68176082		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246457907_246457908insT	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron	NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		attaagcttccttttttttttt	0.020													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	246978281	246978282	+	IGR	INS	-	GTTAA	GTTAA	rs138192431	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246978281_246978282insGTTAA								LOC149134 (22596 upstream) : AHCTF1 (24120 downstream)																							TTGAGCTGGATGTTTAGTGGTG	0.342													4	3	---	---	---	---	
SNTG2	54221	broad.mit.edu	37	2	1285097	1285098	+	Intron	DEL	GT	-	-	rs142654588		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1285097_1285098delGT	uc002qwq.2	+						SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		tgtttgtgtggtgtgtgtgtgt	0.000													4	2	---	---	---	---	
COLEC11	78989	broad.mit.edu	37	2	3658787	3658790	+	Intron	DEL	AAAC	-	-	rs79891538		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3658787_3658790delAAAC	uc002qya.2	+						COLEC11_uc002qxz.2_Intron|COLEC11_uc002qyb.2_Intron|COLEC11_uc002qyc.2_Intron|COLEC11_uc010ewo.2_Intron|COLEC11_uc010ewp.2_Intron|COLEC11_uc010ewq.2_Intron|COLEC11_uc010ewr.2_Intron|COLEC11_uc010ews.2_Intron	NM_024027	NP_076932	Q9BWP8	COL11_HUMAN	collectin sub-family member 11 isoform a							collagen	mannose binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		CGTAACTTCAAAACAAACAAACAA	0.495													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6423502	6423503	+	IGR	INS	-	TG	TG	rs139523940	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6423502_6423503insTG								LOC400940 (295138 upstream) : CMPK2 (557000 downstream)																							GAGTGCGTGCAtgtgtgtgtgt	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	9943592	9943592	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9943592delC								YWHAQ (172486 upstream) : TAF1B (39979 downstream)																							CCATTCGAGGCCCTCTCTCCC	0.602													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	10230545	10230548	+	IGR	DEL	AAAA	-	-	rs139996085		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10230545_10230548delAAAA								CYS1 (10007 upstream) : RRM2 (32187 downstream)																							actccatctcaaaaaaaaaaaaaa	0.172													5	3	---	---	---	---	
ROCK2	9475	broad.mit.edu	37	2	11452560	11452560	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11452560delC	uc002rbd.1	-							NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein						axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		atccccctctcctgcccctct	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12214227	12214228	+	Intron	DEL	TC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12214227_12214228delTC	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		ATCATtctcttctctctctctc	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	19405435	19405435	+	IGR	DEL	C	-	-	rs35077932		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19405435delC								NT5C1B (634597 upstream) : OSR1 (145812 downstream)																							TTTGAAGTTACTTTCAGGGCT	0.393													4	2	---	---	---	---	
UBXN2A	165324	broad.mit.edu	37	2	24164001	24164002	+	Intron	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24164001_24164002insT	uc010exy.2	+						UBXN2A_uc002rem.2_Intron|UBXN2A_uc002ren.2_Intron|UBXN2A_uc010ykj.1_Intron	NM_181713	NP_859064	P68543	UBX2A_HUMAN	UBX domain containing 4												0						TTCTTTGTGCCTTTTTTTTTTC	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	26909433	26909434	+	IGR	DEL	AC	-	-	rs66839615		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26909433_26909434delAC								CIB4 (45222 upstream) : KCNK3 (6147 downstream)																							CTGCCCTGAGacacacacacac	0.490													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	29415145	29415146	+	IGR	INS	-	CAG	CAG	rs138094696	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29415145_29415146insCAG								CLIP4 (8467 upstream) : ALK (495 downstream)																							AGTTTGGTAGTTCATTCCATGA	0.475													1	5	---	---	---	---	
NLRC4	58484	broad.mit.edu	37	2	32458240	32458241	+	Intron	INS	-	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32458240_32458241insG	uc002roi.2	-						NLRC4_uc002roj.1_Intron|NLRC4_uc010ezt.1_Intron	NM_021209	NP_067032	Q9NPP4	NLRC4_HUMAN	caspase recruitment domain protein 12						activation of caspase activity|defense response to bacterium|detection of bacterium|interleukin-1 beta secretion|positive regulation of apoptosis	cytoplasm	ATP binding|magnesium ion binding|protein homodimerization activity			ovary(3)|large_intestine(1)|lung(1)|skin(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					gaaggaaggaaggaaggaagga	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34570438	34570438	+	IGR	DEL	T	-	-	rs34263262		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34570438delT								MYADML (617154 upstream) : None (None downstream)																							GTTTCTCATGTGGTTCTCCTT	0.343													4	2	---	---	---	---	
VIT	5212	broad.mit.edu	37	2	37003344	37003344	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37003344delT	uc002rpl.2	+						VIT_uc002rpm.2_Intron|VIT_uc010ezv.2_Intron|VIT_uc010ezw.2_Intron	NM_053276	NP_444506	Q6UXI7	VITRN_HUMAN	vitrin							proteinaceous extracellular matrix				ovary(1)|pancreas(1)	2		all_hematologic(82;0.248)				TCATTACTAATTTGTCTAAAC	0.219													4	2	---	---	---	---	
MTA3	57504	broad.mit.edu	37	2	42760224	42760225	+	Intron	DEL	TT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42760224_42760225delTT	uc002rso.1	+							NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						TGGGGCAttctttttttttttt	0.238													4	2	---	---	---	---	
TTC7A	57217	broad.mit.edu	37	2	47196074	47196074	+	Intron	DEL	T	-	-	rs34000426		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47196074delT	uc002rvo.2	+						TTC7A_uc002rvm.2_Intron|TTC7A_uc002rvn.1_Intron|TTC7A_uc010fbb.2_Intron|TTC7A_uc010fbc.2_Intron|TTC7A_uc002rvp.2_Intron	NM_020458	NP_065191	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A								binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			tgtttttgtgttttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	48531936	48531936	+	IGR	DEL	T	-	-	rs75998103		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48531936delT								FBXO11 (399122 upstream) : FOXN2 (9859 downstream)																							ttttcttttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	52004090	52004090	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52004090delT								NRXN1 (744416 upstream) : None (None downstream)																							ggccttagaattttatttttg	0.144													4	2	---	---	---	---	
ACYP2	98	broad.mit.edu	37	2	54396594	54396595	+	Intron	INS	-	T	T	rs112372558		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54396594_54396595insT	uc002rxq.3	+							NM_138448	NP_612457	P14621	ACYP2_HUMAN	acylphosphatase 2						phosphate metabolic process		acylphosphatase activity				0						AGCCTCTAGAAttttttttttt	0.168													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60580155	60580156	+	IGR	DEL	AC	-	-	rs147505191		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60580155_60580156delAC								None (None upstream) : BCL11A (98147 downstream)																							CATTACAGCAacacacacacac	0.460													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65402315	65402316	+	IGR	DEL	AC	-	-	rs71904203		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65402315_65402316delAC								RAB1A (44880 upstream) : ACTR2 (52513 downstream)																							ctaaaTacatacacacacacac	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65844681	65844681	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65844681delC	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																		TTTCATTTGTCCACTGATATC	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	72259022	72259023	+	IGR	INS	-	GCT	GCT	rs141733368	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72259022_72259023insGCT								DYSF (345130 upstream) : CYP26B1 (97344 downstream)																							GCCTCCACGGAGCTGCTGGGCA	0.569													3	4	---	---	---	---	
LRRTM4	80059	broad.mit.edu	37	2	77032936	77032939	+	Intron	DEL	AAAC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77032936_77032939delAAAC	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		gacctccataaaacaaacaaacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	81091803	81091803	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:81091803delA								CTNNA2 (215899 upstream) : None (None downstream)																							Tgcagccatcaacattgatgt	0.189													4	2	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87644152	87644152	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87644152delG	uc002srs.3	+									Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						cagccagccagccaagccagc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91670126	91670126	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91670126delA								None (None upstream) : LOC654342 (135066 downstream)																							TCGGCTTTTTAACCCCCCCGC	0.687													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91765423	91765424	+	IGR	INS	-	T	T	rs148923379		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91765423_91765424insT								None (None upstream) : LOC654342 (39768 downstream)																							tatCAATTGGAttttttttttt	0.015													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92241573	92241573	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92241573delT								FKSG73 (111079 upstream) : None (None downstream)																							cctttctttctttttcttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	95406568	95406569	+	IGR	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95406568_95406569delAC								None (None upstream) : ANKRD20B (20106 downstream)																							ctacacacagacacacacacac	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	97716709	97716709	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97716709delG								FAM178B (64408 upstream) : FAHD2B (32615 downstream)																							AAAATCAGCCGGGTGGAGCTG	0.532													5	3	---	---	---	---	
ANKRD36	375248	broad.mit.edu	37	2	97812185	97812187	+	Intron	DEL	TTG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97812185_97812187delTTG	uc010yva.1	+						ANKRD36_uc010yuz.1_Intron|ANKRD36_uc010fic.2_Intron|ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_Intron	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36												0						TAGGTTCCTATTGTTGATTTAAA	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	104238277	104238277	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104238277delA								TMEM182 (804141 upstream) : LOC150568 (812528 downstream)																							aaccaaaggcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
SH3RF3	344558	broad.mit.edu	37	2	110017961	110017962	+	Intron	INS	-	T	T	rs145040443	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110017961_110017962insT	uc010ywt.1	+							NM_001099289	NP_001092759	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1						TGCCAGGCCAGTGCCTATCCTG	0.540													4	3	---	---	---	---	
ACOXL	55289	broad.mit.edu	37	2	111644492	111644492	+	Intron	DEL	A	-	-	rs72298710		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111644492delA	uc002tgr.3	+						ACOXL_uc010fkc.2_Intron|ACOXL_uc010yxk.1_Intron	NM_001105516	NP_001098986	Q9NUZ1	ACOXL_HUMAN	acyl-Coenzyme A oxidase-like 2						fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0						TCAGCCACTTAACTGTTCTGG	0.458													4	4	---	---	---	---	
ANAPC1	64682	broad.mit.edu	37	2	112544737	112544738	+	Intron	INS	-	C	C	rs74267316	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112544737_112544738insC	uc002thi.2	-							NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						aaaaaaaaaaaaaaaGATTCTT	0.213													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114435852	114435852	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114435852delT								RABL2A (34878 upstream) : SLC35F5 (36079 downstream)																							ATTTATGGTATTTTCCTTATT	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114918640	114918641	+	IGR	DEL	CA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114918640_114918641delCA								ACTR3 (202473 upstream) : DPP10 (281258 downstream)																							ctctctGTGTcacacacacaca	0.188													4	3	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	115226707	115226710	+	Intron	DEL	GAGA	-	-	rs10574247		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115226707_115226710delGAGA	uc002tla.1	+						DPP10_uc002tlb.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						GATTTCACTTGAGAGAGACAAAAC	0.363													3	4	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	115270570	115270570	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115270570delT	uc002tla.1	+						DPP10_uc002tlb.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TTGGAATACCTTTTAAAGTga	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	121425209	121425209	+	IGR	DEL	T	-	-	rs34991000		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121425209delT								LOC84931 (201284 upstream) : GLI2 (67990 downstream)																							gcccggctaattttttttttt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122839816	122839818	+	IGR	DEL	CAT	-	-	rs3074950		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122839816_122839818delCAT								TSN (314390 upstream) : None (None downstream)																							CTGTCCTTACCATCAATCGGTCC	0.365													4	2	---	---	---	---	
CNTNAP5	129684	broad.mit.edu	37	2	125280271	125280272	+	Intron	INS	-	CTGAGA	CTGAGA	rs144072477	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125280271_125280272insCTGAGA	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TTAAAGTCCTCCTGGTATGTGA	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	126425713	126425714	+	IGR	INS	-	TG	TG	rs143402792	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126425713_126425714insTG								CNTNAP5 (752852 upstream) : GYPC (987970 downstream)																							GGGATGTGAGCtgtgtgtgtgt	0.307													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127674212	127674212	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127674212delG								GYPC (219967 upstream) : BIN1 (131395 downstream)																							ATATTCTTCTGGCATTCCCAG	0.428													4	2	---	---	---	---	
SAP130	79595	broad.mit.edu	37	2	128751054	128751055	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128751054_128751055insA	uc002tpp.2	-						SAP130_uc002tpn.2_Intron|SAP130_uc002tpo.2_Intron|SAP130_uc010fmd.2_Intron|SAP130_uc002tpq.1_Intron	NM_024545	NP_078821	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa isoform b						histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		AATGCAAAATTAAAAAAAAAAA	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130647126	130647126	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130647126delA								None (None upstream) : LOC389033 (33309 downstream)																							aggcaagtccaaaacctagca	0.045													4	2	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	132981967	132981968	+	Intron	INS	-	C	C	rs148657484		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132981967_132981968insC	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						atttcatagagccttttgaaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133024017	133024018	+	IGR	INS	-	AA	AA			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133024017_133024018insAA								NCRNA00164 (8475 upstream) : GPR39 (150129 downstream)																							gagagagacagacagacagata	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133111221	133111222	+	IGR	INS	-	G	G	rs138380578	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133111221_133111222insG								NCRNA00164 (95679 upstream) : GPR39 (62925 downstream)																							AGAAGAGGGGCGGAGTCACGGC	0.733													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133119737	133119738	+	IGR	INS	-	C	C	rs111716745		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133119737_133119738insC								NCRNA00164 (104195 upstream) : GPR39 (54409 downstream)																							tatatacaaggttttgtggaga	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133119985	133119985	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133119985delT								NCRNA00164 (104443 upstream) : GPR39 (54162 downstream)																							ttaattttaatttttttttta	0.000													4	2	---	---	---	---	
GPR39	2863	broad.mit.edu	37	2	133346784	133346785	+	Intron	INS	-	T	T	rs148007095	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133346784_133346785insT	uc002ttl.2	+							NM_001508	NP_001499	O43194	GPR39_HUMAN	G protein-coupled receptor 39							integral to plasma membrane	G-protein coupled receptor activity|metal ion binding				0						TTCTGGCCATGTCCCCCCCTCC	0.545													4	2	---	---	---	---	
HNMT	3176	broad.mit.edu	37	2	138747047	138747047	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138747047delT	uc002tvc.2	+						HNMT_uc002tvf.2_Intron	NM_006895	NP_008826	P50135	HNMT_HUMAN	histamine N-methyltransferase isoform 1						respiratory gaseous exchange	cytoplasm	histamine N-methyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)	ttgtttgttcttttacttatc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	147694713	147694714	+	IGR	DEL	TT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147694713_147694714delTT								PABPC1P2 (346156 upstream) : ACVR2A (907372 downstream)																							atgTGCAGACtttttttttttt	0.069													4	2	---	---	---	---	
KIF5C	3800	broad.mit.edu	37	2	149805100	149805101	+	Intron	DEL	CA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149805100_149805101delCA	uc010zbu.1	+						KIF5C_uc002tws.1_Intron	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C						microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		TTCTTTTGCTCACACACACCTG	0.356													4	2	---	---	---	---	
FMNL2	114793	broad.mit.edu	37	2	153481699	153481699	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153481699delA	uc002tye.2	+						FMNL2_uc010fob.2_Intron|FMNL2_uc002tyf.2_Intron	NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						GAGTTAAAAGAAAAAAAAAAA	0.368													4	2	---	---	---	---	
FMNL2	114793	broad.mit.edu	37	2	153505704	153505704	+	3'UTR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153505704delT	uc002tye.2	+	26					FMNL2_uc010fob.2_3'UTR|FMNL2_uc002tyf.2_3'UTR	NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						TGAAGGTCCCTTTTCCTTGGA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	158488856	158488856	+	IGR	DEL	T	-	-	rs72257343		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158488856delT								ACVR1C (3457 upstream) : ACVR1 (104102 downstream)																							TTGTTTGGGATTTTTTTTTTA	0.323													4	3	---	---	---	---	
XIRP2	129446	broad.mit.edu	37	2	167989022	167989023	+	Intron	DEL	AC	-	-	rs111324301		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167989022_167989023delAC	uc002udx.2	+						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						gcatgtgtatacacacacacac	0.000													6	3	---	---	---	---	
UBR3	130507	broad.mit.edu	37	2	170860153	170860153	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170860153delT	uc010zdi.1	+						UBR3_uc002ufr.3_Intron|UBR3_uc010fqa.2_Intron|UBR3_uc002uft.3_Intron|UBR3_uc010zdj.1_Intron	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3						sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						acacagagtCttttttttttc	0.005													4	2	---	---	---	---	
MYO3B	140469	broad.mit.edu	37	2	171428080	171428080	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171428080delT	uc002ufy.2	+						MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002ugb.2_Intron	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						gacatgttcatttagaagatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174143291	174143292	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174143291_174143292insA	uc002uib.2	-											Homo sapiens hypothetical protein LOC339751, mRNA (cDNA clone IMAGE:5266974).																		gcatctctactaaaaatacaaa	0.000													4	2	---	---	---	---	
OLA1	29789	broad.mit.edu	37	2	175110621	175110622	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175110621_175110622insA	uc002uih.2	-						OLA1_uc002uii.2_Intron|OLA1_uc010fqq.2_Intron|OLA1_uc002uij.2_Intron|OLA1_uc002uik.2_Intron|OLA1_uc010fqr.2_Intron	NM_013341	NP_037473	Q9NTK5	OLA1_HUMAN	Obg-like ATPase 1 isoform 1						ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding			ovary(1)|breast(1)	2						gactccatctcaaaaaaaaaga	0.139													4	2	---	---	---	---	
NFE2L2	4780	broad.mit.edu	37	2	178141808	178141808	+	Intron	DEL	T	-	-	rs112502446		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178141808delT	uc002uli.3	-							NM_001145412	NP_001138884	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 2						transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TTTTAATGAAttttttttttt	0.050			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			4	2	---	---	---	---	
NFE2L2	4780	broad.mit.edu	37	2	178168148	178168149	+	Intron	INS	-	A	A	rs147607077	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178168148_178168149insA	uc002uli.3	-						LOC100130691_uc002ulj.1_Intron	NM_001145412	NP_001138884	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 2						transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			aacaaacaaacaaaaaaaccaa	0.158			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			4	3	---	---	---	---	
PDE11A	50940	broad.mit.edu	37	2	178946572	178946572	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178946572delC	uc002ulr.2	-						PDE11A_uc002ult.1_Intron	NM_001077197	NP_001070665	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 3						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			TCAAAGGTTTCCTCACAAAAG	0.328									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	179939573	179939573	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179939573delC								CCDC141 (24787 upstream) : SESTD1 (26848 downstream)																							AATCTACCCTCCAGGATAATG	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	189140733	189140733	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189140733delG								TFPI (721514 upstream) : GULP1 (15871 downstream)																							ttaaaaaaaaGGAATCAAATC	0.144													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	191481461	191481461	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191481461delA								TMEM194B (81993 upstream) : NAB1 (32387 downstream)																							TGTTTCTCATAAAAATTTCTC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	196074581	196074581	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196074581delT								None (None upstream) : SLC39A10 (446951 downstream)																							TGGTTGTCCCTTTTACTTgtc	0.154													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	201561321	201561321	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201561321delC								AOX1 (25106 upstream) : AOX2P (74074 downstream)																							CCCACATTCACCCCATAGTAG	0.418													4	2	---	---	---	---	
PLEKHM3	389072	broad.mit.edu	37	2	208760621	208760621	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208760621delG	uc002vcl.2	-							NM_001080475	NP_001073944	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M,						intracellular signal transduction		metal ion binding			ovary(1)	1						GATCATATTTGTCAAAATGCT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	226024318	226024318	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226024318delG								DOCK10 (116988 upstream) : KIAA1486 (241284 downstream)																							aaatgtgttaggaatgaggag	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	238867698	238867698	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238867698delT								RAMP1 (46945 upstream) : UBE2F (8002 downstream)																							cttaattacctttaagggccc	0.000													4	2	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241752259	241752259	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241752259delG	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CCTTCACCTCGGGGATCTGCC	0.622													4	2	---	---	---	---	
CNTN4	152330	broad.mit.edu	37	3	2178378	2178378	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2178378delA	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		TCCTTGGTTTAAAAAAAAAAA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	14330165	14330166	+	IGR	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14330165_14330166delTG								LSM3 (90329 upstream) : SLC6A6 (113940 downstream)																							tgtgtgtgcatgtgtgtgtgtg	0.342													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	19115975	19115975	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19115975delA								SATB1 (635723 upstream) : KCNH8 (74042 downstream)																							tacttttaacaacctatgatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	23831008	23831008	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23831008delA								UBE2E2 (198712 upstream) : UBE2E1 (16431 downstream)																							GGCTTACTGGAATCTATCAAT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	30129240	30129241	+	IGR	INS	-	CTC	CTC	rs138245228	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30129240_30129241insCTC								RBMS3 (82621 upstream) : TGFBR2 (518753 downstream)																							tcctcctccttctcctcctcct	0.114													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	32244233	32244234	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32244233_32244234insT								GPD1L (34037 upstream) : CMTM8 (35937 downstream)																							ccatgggtgacttttttttcta	0.000													4	2	---	---	---	---	
OXSR1	9943	broad.mit.edu	37	3	38294138	38294138	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38294138delT	uc003chy.2	+						OXSR1_uc010hhb.2_Intron	NM_005109	NP_005100	O95747	OXSR1_HUMAN	oxidative-stress responsive 1						intracellular protein kinase cascade|response to oxidative stress		ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		ACTCTAGCTGTTTACCCAGCC	0.502													4	2	---	---	---	---	
MOBP	4336	broad.mit.edu	37	3	39514424	39514424	+	Intron	DEL	T	-	-	rs11351882		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39514424delT	uc003cjv.2	+						MOBP_uc003cju.2_Intron|MOBP_uc003cjw.2_Intron	NM_182935	NP_891980	Q13875	MOBP_HUMAN	myelin-associated oligodendrocyte basic protein						nervous system development	nucleolus|perinuclear region of cytoplasm|soluble fraction				ovary(1)|central_nervous_system(1)	2				KIRC - Kidney renal clear cell carcinoma(284;0.082)|Kidney(284;0.0998)		actgggactcttgtctcaaaa	0.209													3	3	---	---	---	---	
LIMD1	8994	broad.mit.edu	37	3	45715378	45715379	+	Intron	INS	-	A	A	rs76521583		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45715378_45715379insA	uc003coq.2	+							NM_014240	NP_055055	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1						cytoplasmic mRNA processing body assembly|gene silencing by miRNA|multicellular organismal development|negative regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasmic mRNA processing body|nucleus|RNA-induced silencing complex	protein binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		accttgtctccaaaaaaaaaaa	0.203													4	2	---	---	---	---	
PRSS45	377047	broad.mit.edu	37	3	46783664	46783665	+	3'UTR	INS	-	CCAAGG	CCAAGG	rs139246885	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46783664_46783665insCCAAGG	uc010hjl.2	-	4					PRSS45_uc011bam.1_RNA	NM_199183	NP_954652	Q7RTY3	PRS45_HUMAN	testis serine protease 5						proteolysis		serine-type endopeptidase activity				0						CTCCTGCTCACCCAAGGCCTAG	0.515													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	49500349	49500349	+	IGR	DEL	T	-	-	rs113461219		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49500349delT								NICN1 (33592 upstream) : DAG1 (7216 downstream)																							ttctttattcttttttttttt	0.035													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	51544294	51544294	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51544294delG								VPRBP (10293 upstream) : RAD54L2 (31302 downstream)																							ccaacatggtgaaagcctgtc	0.000													4	2	---	---	---	---	
FHIT	2272	broad.mit.edu	37	3	61187742	61187743	+	Intron	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61187742_61187743delAC	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		GCACATAGAtacacacacacac	0.139			T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	70317180	70317181	+	IGR	INS	-	CTC	CTC			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70317180_70317181insCTC								MITF (299694 upstream) : FOXP1 (687556 downstream)																							tcttcctctttctcctcctcct	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	86876215	86876215	+	IGR	DEL	T	-	-	rs111921694		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86876215delT								CADM2 (758267 upstream) : VGLL3 (110910 downstream)																							GAAGAAAGAATTTTTTTTTTT	0.085													2	5	---	---	---	---	
NSUN3	63899	broad.mit.edu	37	3	93782629	93782629	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93782629delT	uc003drl.1	+						DHFRL1_uc003dri.2_5'Flank|DHFRL1_uc003drj.2_5'Flank|NSUN3_uc003drk.2_Intron	NM_022072	NP_071355	Q9H649	NSUN3_HUMAN	NOL1/NOP2/Sun domain family, member 3								methyltransferase activity			skin(1)	1						gcctggctaattttttttttt	0.005													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	93926896	93926896	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93926896delT								NSUN3 (81266 upstream) : LOC255025 (730211 downstream)																							CACTACTTCCTTTTTTTTGTC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	93996379	93996379	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93996379delC								NSUN3 (150749 upstream) : LOC255025 (660728 downstream)																							GGAGCCCTGTCCAAGTCCTGA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	97845951	97845952	+	IGR	INS	-	C	C	rs144142326	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97845951_97845952insC								OR5AC2 (39007 upstream) : OR5H1 (5590 downstream)																							cctgtagttctccaggatgcca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	99941381	99941383	+	IGR	DEL	AAA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99941381_99941383delAAA								TMEM30C (28355 upstream) : TBC1D23 (38303 downstream)																							tggaggtCTCaaaaaaaaaaaaa	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	100729143	100729143	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100729143delC								ABI3BP (16809 upstream) : IMPG2 (216145 downstream)																							TAAAGCTTTTCCTCCTTGTTT	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	101237096	101237096	+	5'Flank	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101237096delA	uc003duy.1	+											RecName: Full=Putative UPF0528 protein FAM172B;																		ataagtgccgaaaaaaaaagg	0.000													4	2	---	---	---	---	
ZPLD1	131368	broad.mit.edu	37	3	102102765	102102770	+	Intron	DEL	GTGTGT	-	-	rs10609311		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102102765_102102770delGTGTGT	uc003dvs.1	+							NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1							integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						gtgtgtgtgcgtgtgtgtgtgtgtat	0.262													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	103911399	103911399	+	IGR	DEL	G	-	-	rs35335789		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103911399delG								None (None upstream) : None (None downstream)																							tgtccctcatgacctccagcc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	105069222	105069223	+	IGR	INS	-	TG	TG	rs60572874		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105069222_105069223insTG								None (None upstream) : ALCAM (16490 downstream)																							tgggaaaccactgtgtgtgtgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	106265217	106265218	+	IGR	DEL	AC	-	-	rs79572502		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106265217_106265218delAC								CBLB (676951 upstream) : LOC100302640 (290442 downstream)																							ttcatagaggacttacaagcac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	106506895	106506896	+	IGR	DEL	TT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106506895_106506896delTT								CBLB (918629 upstream) : LOC100302640 (48764 downstream)																							ATTCTTAGTGtttttttttttt	0.163													4	3	---	---	---	---	
BBX	56987	broad.mit.edu	37	3	107529564	107529564	+	3'UTR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107529564delT	uc010hpr.2	+	18					BBX_uc003dwk.3_3'UTR|BBX_uc003dwl.3_3'UTR|BBX_uc003dwm.3_3'UTR|BBX_uc003dwo.3_3'UTR	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			CTCCATTTCATTAGCACTAAA	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	109560678	109560681	+	IGR	DEL	TGTG	-	-	rs140197284		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109560678_109560681delTGTG								FLJ25363 (346664 upstream) : None (None downstream)																							TGGgtgtgcatgtgtgtgtgtgtg	0.333													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	109739761	109739761	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109739761delA								FLJ25363 (525747 upstream) : None (None downstream)																							agttgaaggcaaaaaaaCCCA	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	112492189	112492189	+	IGR	DEL	A	-	-	rs112677976		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112492189delA								CCDC80 (132212 upstream) : CD200R1L (42367 downstream)																							ctccgtcttcaaaaaaaaaaa	0.164													4	2	---	---	---	---	
GTPBP8	29083	broad.mit.edu	37	3	112708793	112708796	+	5'Flank	DEL	TGTT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112708793_112708796delTGTT	uc003dzn.2	+						GTPBP8_uc011bhy.1_5'Flank|GTPBP8_uc003dzp.2_5'Flank|GTPBP8_uc003dzo.2_5'Flank	NM_014170	NP_054889	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 isoform 1						barrier septum formation		GTP binding				0						acacaaagactgtttggtgatctc	0.113													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	116336912	116336913	+	IGR	DEL	AA	-	-	rs11328391		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116336912_116336913delAA								LSAMP (812894 upstream) : LOC285194 (91722 downstream)																							actccatctcaaaaaaaaaaaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	117512914	117512915	+	IGR	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117512914_117512915delAC								None (None upstream) : None (None downstream)																							acagacacagacacacacacac	0.267													4	2	---	---	---	---	
C3orf15	89876	broad.mit.edu	37	3	119442852	119442853	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119442852_119442853insA	uc003ede.3	+						C3orf15_uc010hqy.1_Intron|C3orf15_uc010hqz.2_Intron|C3orf15_uc011bjd.1_Intron|C3orf15_uc011bje.1_Intron|C3orf15_uc010hra.1_Intron	NM_033364	NP_203528	Q7Z4T9	AAT1_HUMAN	AAT1-alpha							mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		actaaaaatacaaaaaaaaatg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	119882226	119882226	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119882226delG								GSK3B (68962 upstream) : GPR156 (3654 downstream)																							AGTGACTCCTGGGTCTGCAGG	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	120020993	120020995	+	IGR	DEL	AGA	-	-	rs71800268		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120020993_120020995delAGA								GPR156 (57668 upstream) : LRRC58 (22581 downstream)																							tggggtagggagaagaagggccg	0.000													4	3	---	---	---	---	
PTPLB	201562	broad.mit.edu	37	3	123289793	123289794	+	Intron	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123289793_123289794delAC	uc003egj.2	-							NM_198402	NP_940684	Q6Y1H2	HACD2_HUMAN	protein tyrosine phosphatase-like (proline						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	lyase activity|protein binding			kidney(1)	1				GBM - Glioblastoma multiforme(114;0.1)		acacacacatacacacacacac	0.223													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	125624344	125624351	+	IGR	DEL	ATACACAC	-	-	rs13071955	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125624344_125624351delATACACAC								MIR548I1 (114949 upstream) : LOC100125556 (11093 downstream)																							gattctatatatacacacacacacacac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	127086170	127086170	+	Intron	DEL	A	-	-	rs76979444		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127086170delA	uc003ejj.2	-											Homo sapiens, clone IMAGE:4618125, mRNA.																		GCTTGATTAGAAAAAAAAAAA	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	128128205	128128206	+	IGR	DEL	GT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128128205_128128206delGT								EEFSEC (717 upstream) : DNAJB8 (53076 downstream)																							CCCCAGAGCCgtgtgtgtgtgt	0.426													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	128275656	128275657	+	IGR	INS	-	TG	TG	rs143397568	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128275656_128275657insTG								LOC90246 (46229 upstream) : C3orf27 (15187 downstream)																							tcatgtgtagatgtgtgtgtgt	0.163													5	4	---	---	---	---	
ALG1L2	644974	broad.mit.edu	37	3	129807589	129807589	+	Intron	DEL	C	-	-	rs112642994		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129807589delC	uc011bld.1	+						ALG1L2_uc010hth.2_Intron	NM_001136152	NP_001129624	C9J202	AG1L2_HUMAN	asparagine-linked glycosylation 1-like 2						biosynthetic process		transferase activity, transferring glycosyl groups				0						aaggggagctcccctgcacaa	0.000													3	6	---	---	---	---	
CPNE4	131034	broad.mit.edu	37	3	131280182	131280183	+	Intron	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131280182_131280183delTG	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						tgtgtgggcctgtgtgtgtgtg	0.351													4	3	---	---	---	---	
PPP2R3A	5523	broad.mit.edu	37	3	135831459	135831459	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135831459delA	uc003eqv.1	+						PPP2R3A_uc011blz.1_Intron|PPP2R3A_uc003eqw.1_Intron	NM_002718	NP_002709	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'',						protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7						aatcactgccaaaagaaatca	0.000													4	2	---	---	---	---	
NCK1	4690	broad.mit.edu	37	3	136623850	136623850	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136623850delT	uc003erh.2	+							NM_006153	NP_006144	P16333	NCK1_HUMAN	NCK adaptor protein 1						axon guidance|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of translation|signal complex assembly|T cell activation|T cell receptor signaling pathway	cytosol|endoplasmic reticulum|nucleus	cytoskeletal adaptor activity|receptor binding|receptor signaling complex scaffold activity			pancreas(1)	1						tggtttttccttttttttttt	0.000													4	2	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	140260666	140260666	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140260666delC	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						ttctgtttttcccccaaaggc	0.000										HNSCC(16;0.037)			4	2	---	---	---	---	
PLS1	5357	broad.mit.edu	37	3	142354898	142354898	+	Intron	DEL	T	-	-	rs111815917		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142354898delT	uc010huv.2	+						PLS1_uc003euz.2_Intron	NM_001145319	NP_001138791	Q14651	PLSI_HUMAN	plastin 1							cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(1)	1						cacctgctaattttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	146700339	146700339	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146700339delA								PLSCR5 (376336 upstream) : ZIC4 (403498 downstream)																							gactccgtctaaaaaaaaaaa	0.149													4	3	---	---	---	---	
GYG1	2992	broad.mit.edu	37	3	148730785	148730786	+	Intron	DEL	TG	-	-	rs35708764		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148730785_148730786delTG	uc003ewn.2	+						GYG1_uc011bnp.1_Intron|GYG1_uc003ewo.2_Intron|GYG1_uc003ewp.2_Intron	NM_004130	NP_004121	P46976	GLYG_HUMAN	glycogenin 1						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	glycogenin glucosyltransferase activity|metal ion binding|protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			tcagttaatttgtgtgtgtgtg	0.000													6	5	---	---	---	---	
CP	1356	broad.mit.edu	37	3	148898792	148898793	+	Intron	INS	-	GAT	GAT	rs141639018	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148898792_148898793insGAT	uc003ewy.3	-						CP_uc011bnr.1_Intron|CP_uc003eww.3_5'Flank|CP_uc003ewx.3_Intron|CP_uc003ewz.2_Intron	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor						cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	ttccaaatctcgatgatgatga	0.000													3	3	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149311435	149311435	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149311435delT	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ATTAAACGACTTATACAAATG	0.393													4	2	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149417080	149417080	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149417080delT	uc003exh.2	-							NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			gtcatcattcttttttttttt	0.000													4	3	---	---	---	---	
CLRN1OS	116933	broad.mit.edu	37	3	150794771	150794771	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150794771delC	uc011bny.1	+						CLRN1OS_uc003eyl.2_Intron					Homo sapiens usher critical region protein (UCRP) pseudogene mRNA, complete sequence.												0						aattgccatacctatacagtt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	151297601	151297616	+	IGR	DEL	ACGAAGGAAAGAAGAA	-	-	rs147971506		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151297601_151297616delACGAAGGAAAGAAGAA								IGSF10 (121104 upstream) : AADACL2 (154088 downstream)																							aataaatattacgaaggaaagaagaaaggaaggaag	0.000													4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	153139896	153139897	+	IGR	DEL	GT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153139896_153139897delGT								RAP2B (253635 upstream) : C3orf79 (62387 downstream)																							gcttgtgaacgtgtgtgtgtgt	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	153734027	153734027	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153734027delT								C3orf79 (513544 upstream) : SGEF (105122 downstream)																							agactctgtctaaaaaaaaaa	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	156800697	156800697	+	RNA	DEL	A	-	-	rs66530816		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156800697delA	uc003fbc.2	-	4		c.775delT								Homo sapiens cDNA, FLJ18260.																		CTCAGGCAGGAAAAAAAAAAG	0.418													3	6	---	---	---	---	
VEPH1	79674	broad.mit.edu	37	3	157086265	157086266	+	Intron	INS	-	TTTT	TTTT	rs144774541	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157086265_157086266insTTTT	uc003fbj.1	-						VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1							plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			taaacaataagttttttgtttg	0.124													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	157429355	157429356	+	IGR	INS	-	A	A	rs112832271		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157429355_157429356insA								C3orf55 (110336 upstream) : SHOX2 (384445 downstream)																							caaaaatgattaaaaaaaaaaa	0.000													2	4	---	---	---	---	
RARRES1	5918	broad.mit.edu	37	3	158448155	158448166	+	Intron	DEL	TCCTTCCTTCCT	-	-	rs75324604		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158448155_158448166delTCCTTCCTTCCT	uc003fci.2	-						RARRES1_uc003fcj.2_Intron	NM_206963	NP_996846	P49788	TIG1_HUMAN	retinoic acid receptor responder (tazarotene						negative regulation of cell proliferation	integral to membrane					0			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)		Tretinoin(DB00755)	AATAGGTTGCtccttccttccttccttccttc	0.071													4	6	---	---	---	---	
SCHIP1	29970	broad.mit.edu	37	3	159027389	159027390	+	Intron	INS	-	A	A	rs141695351	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159027389_159027390insA	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			AGGTATCTTGTACCTTCCAGGT	0.386													1	7	---	---	---	---	
IFT80	57560	broad.mit.edu	37	3	159986069	159986069	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159986069delA	uc011boy.1	-						IFT80_uc003fda.2_Intron|IFT80_uc003fdb.1_Intron|IFT80_uc003fdd.1_Intron|IFT80_uc003fde.1_Intron	NM_020800	NP_065851	Q9P2H3	IFT80_HUMAN	WD repeat domain 56							cilium axoneme|microtubule basal body				ovary(1)	1			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AAGATGTCATAAGGCAAAAAG	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161473303	161473304	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161473303_161473304insA								OTOL1 (251575 upstream) : None (None downstream)																							ccttccttccttccttccttcc	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	162857901	162857902	+	Intron	INS	-	G	G	rs138664221	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162857901_162857902insG	uc003feg.2	+											Homo sapiens, clone IMAGE:2905387, mRNA.																		tcaaggcctatgtaagtactgc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	167826132	167826138	+	IGR	DEL	CAACTAT	-	-	rs57816786		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167826132_167826138delCAACTAT								GOLIM4 (12715 upstream) : MIR551B (443504 downstream)																							ttacatgatacaactatcatgtgtaca	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	167871947	167871948	+	IGR	INS	-	GTA	GTA	rs148975828	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167871947_167871948insGTA								GOLIM4 (58530 upstream) : MIR551B (397694 downstream)																							aaatgctggttgtagtagtgta	0.000													5	4	---	---	---	---	
MECOM	2122	broad.mit.edu	37	3	169023629	169023629	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169023629delT	uc011bpj.1	-						MECOM_uc003ffl.2_Intron|MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						TGTGTAAAGGTTTTTTTTTTT	0.378													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	170604457	170604460	+	IGR	DEL	TTTA	-	-	rs71634487		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170604457_170604460delTTTA								RPL22L1 (16412 upstream) : EIF5A2 (1745 downstream)																							ttccttttggtttatttttctagc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	174049929	174049932	+	IGR	DEL	AAAC	-	-	rs72194211		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174049929_174049932delAAAC								NLGN1 (48813 upstream) : NAALADL2 (527179 downstream)																							ctacagcaaaaaacaaacaaacaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	174565798	174565798	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174565798delT								NLGN1 (564682 upstream) : NAALADL2 (11313 downstream)																							tttctctctcttttttttttt	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	176367747	176367748	+	IGR	DEL	AC	-	-	rs10552928		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176367747_176367748delAC								NAALADL2 (844321 upstream) : TBL1XR1 (370795 downstream)																							GTTTAAGTATacacacacacac	0.124													5	3	---	---	---	---	
TBL1XR1	79718	broad.mit.edu	37	3	176879572	176879572	+	Intron	DEL	A	-	-	rs145826317		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176879572delA	uc003fiw.3	-						TBL1XR1_uc003fix.3_Intron|TBL1XR1_uc011bpz.1_Intron|TBL1XR1_uc003fiy.2_Intron	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			actctgactcaaaaaaaaaaa	0.065													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	182065572	182065573	+	IGR	DEL	AA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182065572_182065573delAA								SOX2OT (606569 upstream) : ATP11B (445718 downstream)																							gactccatctaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ABCC5	10057	broad.mit.edu	37	3	183678578	183678579	+	Intron	INS	-	T	T	rs144728240	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183678578_183678579insT	uc003fmg.2	-						ABCC5_uc011bqt.1_Intron|ABCC5_uc010hxl.2_Intron	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5							integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TCTCTTATGTCttttttttttc	0.213													4	3	---	---	---	---	
EIF4G1	1981	broad.mit.edu	37	3	184043926	184043927	+	Intron	DEL	AC	-	-	rs112208190		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184043926_184043927delAC	uc003fnp.2	+						EIF4G1_uc003fnt.2_Intron|EIF4G1_uc003fnq.2_Intron|EIF4G1_uc003fnr.2_Intron|EIF4G1_uc010hxx.2_Intron|EIF4G1_uc003fns.2_Intron|EIF4G1_uc010hxy.2_Intron|EIF4G1_uc003fnv.3_Intron|EIF4G1_uc003fnu.3_Intron|EIF4G1_uc003fnw.2_Intron|EIF4G1_uc003fnx.2_Intron|EIF4G1_uc003fny.3_Intron|EIF4G1_uc003foa.2_5'Flank	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4						insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGTTTGGCAAacacacacacac	0.252													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184170779	184170783	+	IGR	DEL	ACAAA	-	-	rs112376031		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184170779_184170783delACAAA								CHRD (63160 upstream) : EPHB3 (108804 downstream)																							CTGGTCTCTTacaaaacaaaacaaa	0.059													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184307808	184307809	+	IGR	INS	-	ATGA	ATGA	rs149784183	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184307808_184307809insATGA								EPHB3 (7613 upstream) : MAGEF1 (120347 downstream)																							tggatggaaagatgaatggtag	0.109													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184470843	184470844	+	IGR	INS	-	AGG	AGG	rs35590401		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184470843_184470844insAGG								MAGEF1 (41007 upstream) : VPS8 (59087 downstream)																							gtgttgggagaaggtggtggga	0.109													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184490634	184490637	+	IGR	DEL	GAGA	-	-	rs72187470		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184490634_184490637delGAGA								MAGEF1 (60798 upstream) : VPS8 (39294 downstream)																							gagggagggggagagagagagaaa	0.029													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	185843827	185843828	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185843827_185843828insA								ETV5 (16926 upstream) : DGKG (21163 downstream)																							tgtggtgtgggggtgtgtgtgt	0.000													7	4	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	185980951	185980952	+	Intron	INS	-	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185980951_185980952insC	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	aaacaaacaaaaaacaCCACCA	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186491624	186491624	+	IGR	DEL	T	-	-	rs71730214		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186491624delT								KNG1 (29883 upstream) : EIF4A2 (9737 downstream)																							atcttcatgattttttttttt	0.000													3	3	---	---	---	---	
ST6GAL1	6480	broad.mit.edu	37	3	186784389	186784390	+	Intron	INS	-	GT	GT	rs149493446	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186784389_186784390insGT	uc003frb.2	+						ST6GAL1_uc003frc.2_Intron|ST6GAL1_uc003frd.2_Intron	NM_173216	NP_775323	P15907	SIAT1_HUMAN	ST6 beta-galactosamide						humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			central_nervous_system(1)	1	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		tgcgtgcgtgcgtgtgtgtgtg	0.218													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186922609	186922610	+	IGR	INS	-	T	T	rs143794872		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186922609_186922610insT								RTP1 (3358 upstream) : MASP1 (13328 downstream)																							ttcttcttctattttttttttt	0.233													3	4	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188492844	188492844	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188492844delT	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		ATGCTTAGTGttttttttttt	0.169			T	HMGA2|MLL|C12orf9	lipoma|leukemia								4	2	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188537177	188537177	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188537177delA	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		cgctATAAAGAAAAAAAAAAC	0.214			T	HMGA2|MLL|C12orf9	lipoma|leukemia								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	190226697	190226697	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190226697delG								TMEM207 (59032 upstream) : IL1RAP (5194 downstream)																							aaaaggaaaagaaaagaaaTG	0.174													4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	191356961	191356966	+	IGR	DEL	TAAACG	-	-	rs112408284	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191356961_191356966delTAAACG								PYDC2 (177718 upstream) : FGF12 (502718 downstream)																							gttgcatagataaacgtgtgccatag	0.000													3	3	---	---	---	---	
FGF12	2257	broad.mit.edu	37	3	191984588	191984589	+	Intron	DEL	CA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191984588_191984589delCA	uc003fsx.2	-						FGF12_uc003fsy.2_Intron	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		CTTTAAacaccacacacacaca	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	192672616	192672617	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192672616_192672617insT								C3orf59 (36666 upstream) : HRASLS (286301 downstream)																							tgttttgtttgttttttttttt	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193516311	193516314	+	IGR	DEL	ACAC	-	-	rs145897160		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193516311_193516314delACAC								OPA1 (100712 upstream) : LOC100128023 (194570 downstream)																							TCAATATGGTacacacacacacac	0.250													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193623947	193623947	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193623947delA								OPA1 (208348 upstream) : LOC100128023 (86937 downstream)																							GAGGAAAGGGAAAGTTCTTTG	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193640103	193640103	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193640103delT								OPA1 (224504 upstream) : LOC100128023 (70781 downstream)																							CCTAGTCTCCTTTTTTTTTTT	0.433													4	2	---	---	---	---	
LOC100131551	100131551	broad.mit.edu	37	3	194031504	194031504	+	5'Flank	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194031504delG	uc003ftr.2	-						LOC100131551_uc011bsu.1_5'Flank					Homo sapiens cDNA FLJ30066 fis, clone ADRGL2000428.												0						attTCCAGTTGGGCCCTGGCC	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194359178	194359178	+	IGR	DEL	A	-	-	rs72105363		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194359178delA								TMEM44 (4760 upstream) : LSG1 (2340 downstream)																							tctcaagaccaaaaaaaaaaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194758921	194758921	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194758921delT								FAM43A (349157 upstream) : C3orf21 (30094 downstream)																							atgttgagcattttttcatat	0.000													5	4	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194940914	194940915	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194940914_194940915insA	uc003fum.3	-						C3orf21_uc011bsw.1_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		actgttaccccggctggagtac	0.149													1	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195444099	195444109	+	IGR	DEL	CAGTATTTAGT	-	-	rs151176012		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195444099_195444109delCAGTATTTAGT								MIR570 (17731 upstream) : MUC20 (3644 downstream)																							CTCCCCACACCAGTATTTAGTACTGCAGCTG	0.493													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195907747	195907748	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195907747_195907748insT								TFRC (98715 upstream) : ZDHHC19 (16576 downstream)																							atgtgttttacttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	196423023	196423024	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196423023_196423024insT								LRRC33 (34151 upstream) : C3orf34 (10125 downstream)																							TTGACCTCTTCTTTTTTTTGCC	0.450													2	8	---	---	---	---	
SENP5	205564	broad.mit.edu	37	3	196638542	196638544	+	Intron	DEL	GTG	-	-	rs143747732		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196638542_196638544delGTG	uc003fwz.3	+						SENP5_uc011bty.1_Intron	NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5						cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			breast(2)|lung(1)	3	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		tgaggcagttgtggtggtggggg	0.005													4	2	---	---	---	---	
PIGZ	80235	broad.mit.edu	37	3	196684043	196684044	+	Intron	DEL	TG	-	-	rs112403220		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196684043_196684044delTG	uc003fxh.2	-							NM_025163	NP_079439	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						GPI anchor biosynthetic process	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			ovary(3)	3	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		ctccaggttttgtgtgtgtgtg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	197233797	197233798	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197233797_197233798insA								DLG1 (207654 upstream) : BDH1 (2857 downstream)																							gactctgtcgcaaaaaaaagag	0.233													4	2	---	---	---	---	
IQCG	84223	broad.mit.edu	37	3	197665189	197665189	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197665189delA	uc003fyo.2	-						IQCG_uc003fyn.2_Intron|IQCG_uc003fyp.2_Intron|IQCG_uc003fyq.3_Intron	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	IQ motif containing G												0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		actccatctcaaaaaaaaaaa	0.159													7	4	---	---	---	---	
ZNF595	152687	broad.mit.edu	37	4	65736	65736	+	Intron	DEL	A	-	-	rs113723441		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65736delA	uc003fzv.1	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc010iay.1_Intron|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		ggcctcccctaaagcagaagc	0.000													6	3	---	---	---	---	
GAK	2580	broad.mit.edu	37	4	859270	859272	+	Intron	DEL	GAG	-	-	rs3836589		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:859270_859272delGAG	uc003gbm.3	-						GAK_uc003gbn.3_Intron|GAK_uc010ibi.2_Intron|GAK_uc010ibj.2_Intron|GAK_uc003gbl.3_Intron	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase						cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		AGGCCAGGCTGAGAACAAGCATC	0.596													0	6	---	---	---	---	
GAK	2580	broad.mit.edu	37	4	892651	892651	+	Intron	DEL	A	-	-	rs35380272		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:892651delA	uc003gbm.3	-						GAK_uc003gbn.3_Intron|GAK_uc010ibk.1_Intron|GAK_uc003gbl.3_Intron	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase						cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		actccgactcaaaaaaaaaaa	0.214													3	6	---	---	---	---	
POLN	353497	broad.mit.edu	37	4	2134875	2134876	+	Intron	INS	-	A	A	rs111453115		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2134875_2134876insA	uc003ger.2	-						POLN_uc010icg.1_Intron|POLN_uc010ich.1_Intron	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			taaaaaatggcaaaaaaaaaaa	0.000								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	2547119	2547120	+	IGR	INS	-	T	T	rs149002803	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2547119_2547120insT								RNF4 (29538 upstream) : FAM193A (50708 downstream)																							gcagtggatcattttttttttc	0.040													5	3	---	---	---	---	
TNIP2	79155	broad.mit.edu	37	4	2757172	2757173	+	Intron	INS	-	G	G	rs3733221	byFrequency	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2757172_2757173insG	uc003gfg.2	-						TNIP2_uc003gff.2_Intron|TNIP2_uc003gfh.2_Intron	NM_024309	NP_077285	Q8NFZ5	TNIP2_HUMAN	A20-binding inhibitor of NF-kappaB activation 2							cytosol	protein binding			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCCTCACCATCCCCCAGGACCC	0.604													2	4	---	---	---	---	
RGS12	6002	broad.mit.edu	37	4	3314644	3314644	+	5'Flank	DEL	A	-	-	rs71652768		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3314644delA	uc003ggw.2	+						RGS12_uc003ggu.2_Intron|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_Intron|RGS12_uc003ggv.2_5'Flank	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1							condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AGTTTTCTCCAAAAAAAAAAA	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3581736	3581736	+	Intron	DEL	A	-	-	rs68187014		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3581736delA	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																		GATTCGGCTCAATAGTTTAAG	0.254													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3583672	3583673	+	Intron	INS	-	GA	GA	rs148829881	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3583672_3583673insGA	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																		CCTGCAAGTCTGATTCTTCTGT	0.614													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3611941	3611942	+	IGR	INS	-	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3611941_3611942insC								LRPAP1 (77717 upstream) : ADRA2C (156133 downstream)																							catccatccatcatccacccac	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	4893268	4893269	+	IGR	DEL	GT	-	-	rs141953709		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4893268_4893269delGT								MSX1 (27610 upstream) : CYTL1 (123047 downstream)																							TCTTCCTAGGgtgtgtgtgtgt	0.272													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	6005960	6005962	+	IGR	DEL	TGA	-	-	rs139963232	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6005960_6005962delTGA								C4orf50 (15794 upstream) : JAKMIP1 (21964 downstream)																							gatgtgatggtgatgatgatggt	0.000													4	2	---	---	---	---	
JAKMIP1	152789	broad.mit.edu	37	4	6127482	6127487	+	Intron	DEL	CACACG	-	-	rs139509734	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6127482_6127487delCACACG	uc003giu.3	-						JAKMIP1_uc010idb.1_Intron|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Intron|JAKMIP1_uc003giv.3_Intron|JAKMIP1_uc010ide.2_Intron	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein						protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						tacagaaacacacacgcacaccatac	0.000													4	2	---	---	---	---	
JAKMIP1	152789	broad.mit.edu	37	4	6127710	6127711	+	Intron	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6127710_6127711delAC	uc003giu.3	-						JAKMIP1_uc010idb.1_Intron|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Intron|JAKMIP1_uc003giv.3_Intron|JAKMIP1_uc010ide.2_Intron	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein						protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						ccatgcagaaacacacacacac	0.000													4	2	---	---	---	---	
MRFAP1L1	114932	broad.mit.edu	37	4	6713961	6713961	+	5'Flank	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6713961delT	uc003gjn.2	-						MRFAP1L1_uc003gjo.2_5'Flank	NM_203462	NP_982287	Q96HT8	MR1L1_HUMAN	Morf4 family associated protein 1-like 1												0						ttatgcatccttttttttttt	0.000													6	3	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7641275	7641276	+	Intron	DEL	TG	-	-	rs10582191		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7641275_7641276delTG	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						TTAgtgtgaatgtgtgtgactg	0.054													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	8181517	8181517	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8181517delC								ABLIM2 (20958 upstream) : SH3TC1 (19543 downstream)																							CTCTTCTCAGCCCCAGGGCCT	0.642													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	20069173	20069173	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20069173delA								None (None upstream) : SLIT2 (186062 downstream)																							TCTAGAAGGTATGTAGAAAAC	0.328													4	2	---	---	---	---	
LGI2	55203	broad.mit.edu	37	4	25031713	25031714	+	Intron	INS	-	AC	AC	rs147262006	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25031713_25031714insAC	uc003grf.2	-							NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2							extracellular region					0		Breast(46;0.173)				ccaacccgcaaacacacacaca	0.203													5	3	---	---	---	---	
CCKAR	886	broad.mit.edu	37	4	26494197	26494198	+	5'Flank	INS	-	TTCA	TTCA			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26494197_26494198insTTCA	uc003gse.1	-							NM_000730	NP_000721	P32238	CCKAR_HUMAN	cholecystokinin A receptor						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity			lung(3)|pancreas(1)	4		Breast(46;0.0503)			Ceruletide(DB00403)	tccttccttccttccttccttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	29818229	29818231	+	IGR	DEL	AGG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29818229_29818231delAGG								None (None upstream) : PCDH7 (903806 downstream)																							gaggaggagaaggaggaggagga	0.227													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	37822924	37822924	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37822924delA								RELL1 (134925 upstream) : PGM2 (5358 downstream)																							aaaaaaaaagaaaaaaaaAAA	0.204													4	2	---	---	---	---	
WDR19	57728	broad.mit.edu	37	4	39216394	39216395	+	Intron	DEL	TT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39216394_39216395delTT	uc003gtv.2	+						WDR19_uc010ifl.1_Intron|WDR19_uc003gtu.1_Intron|WDR19_uc011byi.1_Intron|WDR19_uc003gtw.1_5'Flank	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						GGAGGAATAAtttttttttttt	0.168													4	2	---	---	---	---	
UGDH	7358	broad.mit.edu	37	4	39507525	39507525	+	Intron	DEL	A	-	-	rs35867925		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39507525delA	uc003guk.1	-						UGDH_uc011byp.1_Intron|UGDH_uc003gul.1_Intron	NM_003359	NP_003350	O60701	UGDH_HUMAN	UDP-glucose dehydrogenase						glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4					NADH(DB00157)	CCTATGGATTAAAAAAAAAAA	0.229													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	42328613	42328627	+	IGR	DEL	AGGAAGGAAGGACAG	-	-	rs150891319		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42328613_42328627delAGGAAGGAAGGACAG								BEND4 (173718 upstream) : SHISA3 (71229 downstream)																							aaagaatggaaggaaggaaggacagaggaaggaag	0.033													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	45327661	45327662	+	IGR	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45327661_45327662delTG								GNPDA2 (599049 upstream) : GABRG1 (710127 downstream)																							tgtgtgcgcatgtgtgtgtgtg	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49148215	49148216	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49148215_49148216insA								CWH43 (84122 upstream) : None (None downstream)																							accattccaccaagttgattgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49159356	49159357	+	IGR	INS	-	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49159356_49159357insG								CWH43 (95263 upstream) : None (None downstream)																							atctagttttttttgagggttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49217676	49217677	+	IGR	INS	-	C	C	rs146012723	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49217676_49217677insC								CWH43 (153583 upstream) : None (None downstream)																							TTTTCCTTCCACCCaaccccct	0.109													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	56135530	56135531	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56135530_56135531insA								KDR (143768 upstream) : SRD5A3 (76878 downstream)																							gactccatctcaaaaaaaaaat	0.005													4	2	---	---	---	---	
EXOC1	55763	broad.mit.edu	37	4	56756697	56756698	+	Intron	INS	-	A	A	rs34003680		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56756697_56756698insA	uc003hbe.1	+						EXOC1_uc003hbf.1_Intron|EXOC1_uc003hbg.1_Intron	NM_018261	NP_060731	Q9NV70	EXOC1_HUMAN	exocyst complex component 1 isoform 1						exocytosis|protein transport	exocyst	protein binding			ovary(2)|skin(2)|lung(1)|central_nervous_system(1)	6	Glioma(25;0.08)|all_neural(26;0.101)					TCGAATCTGGGAAAAAAAAAAA	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	73880527	73880527	+	IGR	DEL	T	-	-	rs35388007		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73880527delT								ADAMTS3 (446011 upstream) : COX18 (39889 downstream)																							AAAAACACACttttttttttt	0.129													3	3	---	---	---	---	
UNC5C	8633	broad.mit.edu	37	4	96113432	96113433	+	Intron	INS	-	CCT	CCT	rs149831809	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96113432_96113433insCCT	uc003htp.1	-						UNC5C_uc010ilc.1_Intron	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor						apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		tcttctgcccacctcttctcac	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	111532230	111532230	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111532230delC								ENPEP (47739 upstream) : PITX2 (6352 downstream)																							GACTCAGTCACCCCCCTTCCT	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	124309046	124309046	+	IGR	DEL	A	-	-	rs35058726		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124309046delA								SPATA5 (68444 upstream) : SPRY1 (8910 downstream)																							actctgtctcaaaaaaaaaaa	0.104													4	2	---	---	---	---	
LOC285419	285419	broad.mit.edu	37	4	124725576	124725576	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124725576delT	uc011cgn.1	+						LOC285419_uc003ifd.2_Intron	NR_027105				Homo sapiens mRNA; cDNA DKFZp686P12109 (from clone DKFZp686P12109).												0						aggttagctattttggcctaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	132874783	132874783	+	IGR	DEL	A	-	-	rs148303530		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:132874783delA								None (None upstream) : None (None downstream)																							CTTCTCTAATAAAAAAAGCAT	0.264													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	138749334	138749334	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138749334delG								PCDH18 (295686 upstream) : SLC7A11 (335914 downstream)																							ggggaaggaaggggaagaaaa	0.000													3	3	---	---	---	---	
TBC1D9	23158	broad.mit.edu	37	4	141621975	141621976	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141621975_141621976insA	uc010ioj.2	-							NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)							intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				ctccgtctgggaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	154050504	154050506	+	IGR	DEL	CAC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154050504_154050506delCAC								FHDC1 (149656 upstream) : TRIM2 (23764 downstream)																							ccatcagcatcaccaccaccatt	0.000													4	4	---	---	---	---	
TDO2	6999	broad.mit.edu	37	4	156823956	156823958	+	5'Flank	DEL	TTG	-	-	rs71600402		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156823956_156823958delTTG	uc003ipf.1	+							NM_005651	NP_005642	P48775	T23O_HUMAN	tryptophan 2,3-dioxygenase						tryptophan catabolic process to kynurenine	cytosol	tryptophan 2,3-dioxygenase activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)	L-Tryptophan(DB00150)	TTATTGgttcttgttgttgttgt	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	161199437	161199438	+	IGR	DEL	TG	-	-	rs111879441		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161199437_161199438delTG								RAPGEF2 (918138 upstream) : None (None downstream)																							aaggaaaaaatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
TLL1	7092	broad.mit.edu	37	4	166832941	166832941	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166832941delA	uc003irh.1	+						TLL1_uc011cjn.1_Intron|TLL1_uc011cjo.1_Intron	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor						cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TCTGAAACCCAAATGTCTTGT	0.318													4	2	---	---	---	---	
LOC285501	285501	broad.mit.edu	37	4	178860714	178860714	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178860714delT	uc010iru.2	+							NR_028342				Homo sapiens cDNA clone IMAGE:4828874.												0		all_lung(41;6.03e-08)|Lung NSC(41;4.26e-07)|Breast(14;0.00066)|Melanoma(52;0.00168)|Prostate(90;0.0129)|all_hematologic(60;0.0202)|Renal(120;0.0246)|Colorectal(36;0.0508)|Hepatocellular(41;0.236)		all cancers(43;9.24e-25)|Epithelial(43;6.28e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.29e-10)|LUSC - Lung squamous cell carcinoma(1;2.61e-05)|Lung(1;3.22e-05)|GBM - Glioblastoma multiforme(59;0.000185)|Colorectal(24;0.000244)|STAD - Stomach adenocarcinoma(60;0.000777)|COAD - Colon adenocarcinoma(29;0.000884)		GAAAAGCAACttttttttttt	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	181981756	181981756	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181981756delC								None (None upstream) : None (None downstream)																							GCCTCGCCAGCCCCGATCCAT	0.488													4	2	---	---	---	---	
SORBS2	8470	broad.mit.edu	37	4	186748433	186748434	+	Intron	INS	-	CA	CA			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186748433_186748434insCA	uc003iyl.2	-						SORBS2_uc003iym.2_Intron|SORBS2_uc011cky.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		atcatcaccatcatcatcacca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190347252	190347253	+	IGR	DEL	CA	-	-	rs72252775		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190347252_190347253delCA								None (None upstream) : FRG1 (514721 downstream)																							CACTCCAACCcacacacacaca	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190661325	190661326	+	IGR	INS	-	AA	AA	rs35156204		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190661325_190661326insAA								None (None upstream) : FRG1 (200648 downstream)																							tttttttttttataaagatgat	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2821680	2821681	+	IGR	INS	-	T	T	rs142075557	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2821680_2821681insT								C5orf38 (66168 upstream) : IRX1 (774487 downstream)																							ttttttccttctttttttttga	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4418549	4418550	+	IGR	INS	-	TG	TG	rs150101086	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4418549_4418550insTG								IRX1 (817033 upstream) : LOC340094 (615922 downstream)																							TCTCTCgtgtatgtgtgtgtgt	0.297													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6597467	6597467	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6597467delG								LOC255167 (8855 upstream) : NSUN2 (1888 downstream)																							CCCAACCTATGGGGCTGGCTA	0.488													6	3	---	---	---	---	
C5orf49	134121	broad.mit.edu	37	5	7845226	7845227	+	Intron	DEL	AC	-	-	rs326198	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7845226_7845227delAC	uc003jea.3	-							NM_001089584	NP_001083053	A4QMS7	CE049_HUMAN	hypothetical protein LOC134121												0						ggcaggagagacagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8033159	8033159	+	IGR	DEL	T	-	-	rs34882669		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8033159delT								MTRR (131926 upstream) : None (None downstream)																							ttgatgcacattgtctggagt	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10336864	10336870	+	IGR	DEL	CCAAGAT	-	-	rs2578611		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10336864_10336870delCCAAGAT								CMBL (28696 upstream) : MARCH6 (16958 downstream)																							ttgcagtgagccaagatcacaccactg	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	12434623	12434624	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12434623_12434624insA								CTNND2 (530513 upstream) : None (None downstream)																							aaagaaagaaggagagagaggg	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	13629600	13629600	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13629600delA								None (None upstream) : DNAH5 (60837 downstream)																							aacttagcacaaaaaaaaata	0.010													4	2	---	---	---	---	
DNAH5	1767	broad.mit.edu	37	5	13838925	13838925	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13838925delT	uc003jfd.2	-							NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					gaccactggcttagctcatct	0.050									Kartagener_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	14106188	14106188	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14106188delT								DNAH5 (161599 upstream) : TRIO (37641 downstream)																							TGTCCCTGACTTTATTGTTCT	0.418													3	4	---	---	---	---	
FBXL7	23194	broad.mit.edu	37	5	15634615	15634615	+	Intron	DEL	G	-	-	rs78822870		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15634615delG	uc003jfn.1	+							NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3						atttttagttggggggggggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	16430752	16430755	+	IGR	DEL	AGAG	-	-	rs71963261		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16430752_16430755delAGAG								MARCH11 (250855 upstream) : ZNF622 (20874 downstream)																							aaagagtgaaagagagagagagag	0.118													5	5	---	---	---	---	
MYO10	4651	broad.mit.edu	37	5	16712796	16712796	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16712796delT	uc003jft.3	-						MYO10_uc011cnd.1_Intron|MYO10_uc011cne.1_Intron|MYO10_uc010itx.2_Intron	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X						axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						CCCTCACAGCTTTTGATGGAA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	17067163	17067164	+	IGR	INS	-	T	T	rs71601706		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17067163_17067164insT								MYO10 (130778 upstream) : LOC285696 (62973 downstream)																							ccttttgactcttttttttttt	0.079													3	4	---	---	---	---	
LOC285696	285696	broad.mit.edu	37	5	17146811	17146814	+	Intron	DEL	CTTC	-	-	rs57191104		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17146811_17146814delCTTC	uc003jfw.2	-							NR_027253				Homo sapiens cDNA FLJ34047 fis, clone FCBBF3000001.												0						ttttccttcgcttccttccttcct	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	18378229	18378229	+	IGR	DEL	A	-	-	rs66641136		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18378229delA								None (None upstream) : None (None downstream)																							TAAAACTAGCAAAACTGAAGA	0.363													6	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	19262848	19262848	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19262848delA								None (None upstream) : CDH18 (210309 downstream)																							tccgtctcagaaaaaaaaaaa	0.010													4	3	---	---	---	---	
CDH18	1016	broad.mit.edu	37	5	19558358	19558358	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19558358delA	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					gagaaacaagaacaaaccaca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20000965	20000965	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20000965delA								CDH18 (12658 upstream) : None (None downstream)																							ACTTTAAAGGAAAAGTCTGAA	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	21067724	21067725	+	IGR	INS	-	A	A	rs35527250		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21067724_21067725insA								None (None upstream) : GUSBP1 (274217 downstream)																							gtctcaagaacaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	21209871	21209872	+	IGR	INS	-	T	T	rs141565883	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21209871_21209872insT								None (None upstream) : GUSBP1 (132070 downstream)																							GAACAGATGTATTTTTTTTGTC	0.356													3	3	---	---	---	---	
CDH12	1010	broad.mit.edu	37	5	21949559	21949560	+	Intron	DEL	AA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21949559_21949560delAA	uc010iuc.2	-						CDH12_uc011cno.1_Intron|CDH12_uc003jgk.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						actctgtctcaaaaaaaaaaaa	0.000										HNSCC(59;0.17)			4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	23553726	23553726	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23553726delT								PRDM9 (25022 upstream) : CDH10 (933484 downstream)																							ctgctgatacttttttttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	23865175	23865175	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23865175delC								PRDM9 (336471 upstream) : CDH10 (622035 downstream)																							ttcacgtggacccctttgagt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	25576844	25576849	+	IGR	DEL	TTGCTT	-	-	rs72180926	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25576844_25576849delTTGCTT								CDH10 (931933 upstream) : None (None downstream)																							tttctctttcttgctttttctttctt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	28870934	28870935	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28870934_28870935insT								None (None upstream) : None (None downstream)																							caccaggataattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	29977608	29977608	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29977608delC								None (None upstream) : None (None downstream)																							CTTGAAGAGTCCCTCATCACC	0.368													4	2	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	31900617	31900617	+	Intron	DEL	A	-	-	rs143916510		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31900617delA	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						TTAAGAAGGGAAAAGGGGTCA	0.562													5	3	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	31992970	31992971	+	Intron	INS	-	A	A	rs71598916		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31992970_31992971insA	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CTCTTCCATGGAAAAAAAAAAA	0.535													4	6	---	---	---	---	
GOLPH3	64083	broad.mit.edu	37	5	32128910	32128910	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32128910delA	uc003jhp.1	-							NM_022130	NP_071413	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3						cell proliferation|positive regulation of TOR signaling cascade|regulation of mitochondrion organization	cytosol|endosome|Golgi cisterna membrane|mitochondrial intermembrane space|plasma membrane|trans-Golgi network	protein binding			ovary(1)	1						catcgaagttaaaaaaaaaaa	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	34572564	34572565	+	IGR	DEL	AG	-	-	rs57634982		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34572564_34572565delAG								C1QTNF3 (529247 upstream) : RAI14 (83868 downstream)																							aaaaaaaaaaagaacgaaagaa	0.005													4	2	---	---	---	---	
RAI14	26064	broad.mit.edu	37	5	34658062	34658062	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34658062delT	uc003jir.2	+						RAI14_uc010iur.2_Intron|RAI14_uc011coj.1_Intron	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a							cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					ACAAGTGTGATTTTTTTCCCC	0.408													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	38033741	38033744	+	IGR	DEL	ACAC	-	-	rs66649440		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38033741_38033744delACAC								GDNF (193959 upstream) : EGFLAM (224789 downstream)																							CTTTGGGAAAacacacacacacac	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	38638325	38638325	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38638325delT	uc003jlj.2	+											Homo sapiens cDNA clone IMAGE:4829282.																		gtagatcgtgttggacttgac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	39677504	39677504	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39677504delC								DAB2 (252169 upstream) : None (None downstream)																							tttactcattcccaattcatt	0.109													4	2	---	---	---	---	
C6	729	broad.mit.edu	37	5	41229436	41229436	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41229436delT	uc003jml.1	-							NM_001115131	NP_001108603	P13671	CO6_HUMAN	complement component 6 precursor						complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				cattcagaacttttttttttt	0.000													4	2	---	---	---	---	
PLCXD3	345557	broad.mit.edu	37	5	41444411	41444412	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41444411_41444412insA	uc003jmm.1	-							NM_001005473	NP_001005473	Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X						intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						CTGAGGATGGCAAAGTTAGAAT	0.406													2	4	---	---	---	---	
FBXO4	26272	broad.mit.edu	37	5	41922692	41922693	+	5'Flank	INS	-	TG	TG	rs138419734	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41922692_41922693insTG	uc003jmq.2	+						FBXO4_uc003jmp.2_5'Flank|FBXO4_uc003jmr.2_5'Flank	NM_012176	NP_036308	Q9UKT5	FBX4_HUMAN	F-box only protein 4 isoform 1						positive regulation of protein ubiquitination|protein polyubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|telomere maintenance|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	protein binding|protein homodimerization activity|ubiquitin-protein ligase activity			liver(1)	1		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				atatatatatatgtgtgtgtgt	0.000													5	3	---	---	---	---	
GHR	2690	broad.mit.edu	37	5	42514354	42514354	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42514354delC	uc003jmt.2	+						uc003jmu.2_RNA	NM_000163	NP_000154	P10912	GHR_HUMAN	growth hormone receptor precursor						2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	TGCAAATCTTCCATGACCAAG	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44262369	44262369	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44262369delT								NNT (556702 upstream) : FGF10 (42728 downstream)																							acctggctaattttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44594460	44594461	+	IGR	DEL	AC	-	-	rs35053942		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44594460_44594461delAC								FGF10 (205676 upstream) : MRPS30 (214566 downstream)																							CAAAGGCTTTacacacacacac	0.302													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	52824520	52824521	+	IGR	DEL	TT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52824520_52824521delTT								FST (42618 upstream) : NDUFS4 (31944 downstream)																							ttttctattctttttttttttt	0.000													4	2	---	---	---	---	
ANKRD55	79722	broad.mit.edu	37	5	55403699	55403700	+	Intron	INS	-	T	T	rs72425105		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55403699_55403700insT	uc003jqu.2	-						ANKRD55_uc003jqt.2_Intron	NM_024669	NP_078945	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55 isoform 1											skin(1)	1		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				tagcaataaacttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	57780125	57780126	+	IGR	INS	-	T	T	rs59246863		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57780125_57780126insT								PLK2 (24212 upstream) : GAPT (7204 downstream)																							tccttcctttcttttttttttt	0.050													4	2	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	59224061	59224061	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59224061delT	uc003jsb.2	-							NM_006203	NP_006194	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 2						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	GAAACTCTCCTCCAAGGACAG	0.403													4	2	---	---	---	---	
FCHO2	115548	broad.mit.edu	37	5	72320959	72320959	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72320959delG	uc003kcl.2	+						FCHO2_uc011csl.1_Intron|FCHO2_uc011csk.1_Intron|FCHO2_uc011csm.1_Intron	NM_138782	NP_620137	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2 isoform a											ovary(1)	1		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		GGGGTGGAGTGGAAGGGATAA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	72764302	72764303	+	IGR	INS	-	T	T	rs112480473		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72764302_72764303insT								FOXD1 (19950 upstream) : BTF3 (29947 downstream)																							ttttccttcacttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	73606552	73606552	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73606552delC								RGNEF (369139 upstream) : ENC1 (316683 downstream)																							GCCTAGTTTTCCAATCTAGGC	0.502													4	2	---	---	---	---	
PDE8B	8622	broad.mit.edu	37	5	76570889	76570890	+	Intron	DEL	CA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76570889_76570890delCA	uc003kfa.2	+						PDE8B_uc003kfb.2_Intron|PDE8B_uc003kfc.2_Intron|PDE8B_uc003kfd.2_Intron|PDE8B_uc003kfe.2_Intron	NM_003719	NP_003710	O95263	PDE8B_HUMAN	phosphodiesterase 8B isoform 1						cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity				0		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)		CACATAGTATCACACACACACA	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	78905081	78905082	+	IGR	DEL	AA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78905081_78905082delAA								HOMER1 (95381 upstream) : PAPD4 (3161 downstream)																							accctatctcaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ATG10	83734	broad.mit.edu	37	5	81267384	81267384	+	5'Flank	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81267384delT	uc003khs.2	+						ATG10_uc003khq.2_5'Flank|ATG10_uc003khr.2_5'Flank|ATG10_uc010jas.2_5'Flank	NM_001131028	NP_001124500	Q9H0Y0	ATG10_HUMAN	APG10 autophagy 10-like						autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding				0		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		TTGCTGCTAGTTTTTTTTTTT	0.393													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	88829764	88829765	+	IGR	INS	-	AAG	AAG	rs148437541	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88829764_88829765insAAG								MEF2C (629895 upstream) : CETN3 (859766 downstream)																							TAGAACATACTAAGAAGTTAGG	0.356													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	96156658	96156663	+	Intron	DEL	GAAGAG	-	-	rs114636312		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96156658_96156663delGAAGAG	uc003kmo.1	-											Homo sapiens cDNA FLJ37666 fis, clone BRHIP2011576.																		ggagaaagaagaagaggaagaagagg	0.087													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	97656196	97656197	+	IGR	DEL	CA	-	-	rs7721130		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97656196_97656197delCA								None (None upstream) : RGMB (448802 downstream)																							acaccacacgcacacacacaca	0.361													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	100974773	100974773	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:100974773delT								ST8SIA4 (735786 upstream) : SLCO4C1 (594921 downstream)																							GCCCCTGTACTTTTTTTTGCT	0.403													4	2	---	---	---	---	
MAN2A1	4124	broad.mit.edu	37	5	109086908	109086908	+	Intron	DEL	T	-	-	rs115462052	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109086908delT	uc003kou.1	+							NM_002372	NP_002363	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1						mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		tgagatcaacttttttttttt	0.000													4	2	---	---	---	---	
MARCH3	115123	broad.mit.edu	37	5	126254075	126254076	+	Intron	DEL	CA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126254075_126254076delCA	uc003kuf.2	-						MARCH3_uc011cxc.1_Intron	NM_178450	NP_848545	Q86UD3	MARH3_HUMAN	membrane-associated ring finger (C3HC4) 3						endocytosis	cytoplasmic vesicle membrane|early endosome membrane|integral to membrane|lysosome	ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.074)|OV - Ovarian serous cystadenocarcinoma(64;0.0793)		AATACAAGTGcacacacacaca	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	152352844	152352844	+	5'Flank	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152352844delA	uc003lux.1	-											Homo sapiens cDNA FLJ35529 fis, clone SPLEN2001912.																		CACAGACCCCATTCTCATAAG	0.403													4	2	---	---	---	---	
TIMD4	91937	broad.mit.edu	37	5	156376465	156376465	+	Intron	DEL	T	-	-	rs147566138	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156376465delT	uc003lwh.2	-						TIMD4_uc010jii.2_Intron	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain							integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ctcctcctccttctcTCTCTC	0.378													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	158940752	158940752	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158940752delA								LOC285627 (47468 upstream) : ADRA1B (402988 downstream)																							TTGACCAAGGAAGGAAAGGGG	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163124202	163124203	+	IGR	INS	-	T	T	rs149662881	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163124202_163124203insT								MAT2B (177869 upstream) : None (None downstream)																							AAATTTGTACACTTTTTTTTTT	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163340741	163340741	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163340741delT								MAT2B (394408 upstream) : None (None downstream)																							TAGCCATATCTTTTTTTTTTA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	164580211	164580211	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164580211delA								None (None upstream) : None (None downstream)																							aaacagttccaaaaaaaattt	0.010													4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	167351126	167351126	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167351126delT	uc010jjd.2	+						ODZ2_uc003lzq.2_Intron|ODZ2_uc003lzr.3_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		GGATGCTTCATTTTAGCTCAG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	171962240	171962241	+	IGR	DEL	GT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171962240_171962241delGT								SH3PXD2B (80713 upstream) : NEURL1B (106035 downstream)																							tgtgtgttgggtgtgtgtgtgt	0.302													4	2	---	---	---	---	
C5orf41	153222	broad.mit.edu	37	5	172516220	172516221	+	Intron	DEL	AC	-	-	rs113514387		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172516220_172516221delAC	uc003mch.2	+						C5orf41_uc003mcg.2_Intron|C5orf41_uc003mcf.2_Intron|C5orf41_uc011dfd.1_Intron	NM_153607	NP_705835	Q8IUR6	CE041_HUMAN	luman-recruiting factor								protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Renal(175;0.000159)|Lung NSC(126;0.00223)|all_lung(126;0.00391)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			tacacagacaacacacacacac	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	175645640	175645640	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175645640delC								FAM153B (102185 upstream) : C5orf25 (19730 downstream)																							atgttatttacccccaccaca	0.000													4	2	---	---	---	---	
NSD1	64324	broad.mit.edu	37	5	176598308	176598308	+	Intron	DEL	A	-	-	rs80079680		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176598308delA	uc003mfr.3	+						NSD1_uc003mft.3_Intron|NSD1_uc003mfs.1_Intron|NSD1_uc011dfx.1_Intron|NSD1_uc003mfp.2_Intron	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		ctccgtctccaaaaaaaaaaa	0.000			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			4	2	---	---	---	---	
ZNF354A	6940	broad.mit.edu	37	5	178151638	178151638	+	Intron	DEL	A	-	-	rs150808142	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178151638delA	uc003mjj.2	-							NM_005649	NP_005640	O60765	Z354A_HUMAN	zinc finger protein 354A						regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(1)	3	all_cancers(89;0.000536)|Renal(175;0.000159)|all_epithelial(37;0.000221)|Lung NSC(126;0.00308)|all_lung(126;0.00536)	all_cancers(40;0.0452)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.185)		TACTACATGTAAGTAATGCCC	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	901540	901540	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:901540delT								EXOC2 (208431 upstream) : LOC285768 (59702 downstream)																							GGCACAGATGTTCCTGGTATA	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	6020560	6020561	+	IGR	INS	-	GT	GT	rs144921588	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6020560_6020561insGT								NRN1 (12927 upstream) : F13A1 (123751 downstream)																							tgtgtgtgtgcgtgtgtgtgtg	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	7428074	7428074	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7428074delT								RIOK1 (9806 upstream) : DSP (113796 downstream)																							ctccgctttctcatctgtaaa	0.204													4	2	---	---	---	---	
DSP	1832	broad.mit.edu	37	6	7562606	7562607	+	Intron	INS	-	T	T	rs77312649	byFrequency	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7562606_7562607insT	uc003mxp.1	+						DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I						cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GGTAGATTTGGTTTTTTTTTTT	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	10320005	10320006	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10320005_10320006insT								None (None upstream) : TFAP2A (76911 downstream)																							AGGGACGTGGGCGGTTTTCCGT	0.574													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	13731020	13731020	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13731020delT								RANBP9 (19224 upstream) : CCDC90A (60001 downstream)																							ctcttctcccttatggatgct	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	20288329	20288329	+	IGR	DEL	A	-	-	rs34640071		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20288329delA								MBOAT1 (75659 upstream) : E2F3 (113808 downstream)																							actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	21328451	21328451	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21328451delA								CDKAL1 (95819 upstream) : SOX4 (265521 downstream)																							tcccaggttcaagtgattctt	0.000													4	2	---	---	---	---	
FLJ22536	401237	broad.mit.edu	37	6	21941890	21941890	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21941890delC	uc003ndj.2	+						FLJ22536_uc011djk.1_Intron|FLJ22536_uc003ndl.2_Intron|FLJ22536_uc011djj.1_Intron|FLJ22536_uc003ndk.1_Intron	NR_015410				Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0						ctcctgacctcgtgatccgcc	0.000													4	2	---	---	---	---	
BTN2A1	11120	broad.mit.edu	37	6	26463977	26463979	+	Intron	DEL	TTG	-	-	rs71925201		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26463977_26463979delTTG	uc003nib.1	+						BTN2A1_uc003nic.1_Intron|BTN2A1_uc003nid.1_Intron|BTN2A1_uc011dko.1_Intron|BTN2A1_uc010jqk.1_5'Flank	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1						lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						AAACCtgtttttgttgttgttgt	0.315													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29135353	29135353	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29135353delG								OR2J3 (54751 upstream) : OR2J2 (5958 downstream)																							tgctgaaagtggtatacagat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29735525	29735526	+	IGR	INS	-	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29735525_29735526insG								IFITM4P (16600 upstream) : HCG4 (23283 downstream)																							atctacttaaagtgttagttca	0.000													4	2	---	---	---	---	
BAT2	7916	broad.mit.edu	37	6	31590316	31590316	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31590316delT	uc003nvb.3	+						BAT2_uc011dnv.1_Intron|BAT2_uc003nvc.3_Intron|SNORA38_uc003nvd.2_5'Flank|BAT2_uc003nve.2_5'Flank	NM_080686	NP_542417	P48634	PRC2A_HUMAN	HLA-B associated transcript-2							cytoplasm|nucleus	protein binding				0						GAACATGGCATTTGAGCTATG	0.463													4	2	---	---	---	---	
DNAH8	1769	broad.mit.edu	37	6	38763358	38763358	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38763358delA	uc003ooe.1	+							NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						tgtgtctcagaaaaaaaaaaa	0.209													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	40603808	40603809	+	IGR	DEL	AC	-	-	rs71884651		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40603808_40603809delAC								LRFN2 (48682 upstream) : UNC5CL (390963 downstream)																							cacatactatacacacacacac	0.371													5	4	---	---	---	---	
TMEM63B	55362	broad.mit.edu	37	6	44119666	44119666	+	Frame_Shift_Del	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44119666delT	uc003owr.2	+	19	1821	c.1757delT	c.(1756-1758)CTGfs	p.L586fs	TMEM63B_uc003ows.2_Frame_Shift_Del_p.L489fs|TMEM63B_uc010jyz.2_RNA	NM_018426	NP_060896	Q5T3F8	TM63B_HUMAN	transmembrane protein 63B	586						integral to membrane	nucleotide binding|protein binding			pancreas(2)|central_nervous_system(1)	3	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			ATGGACCTGCTGCGCATCCCA	0.657											OREG0017465	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	12	---	---	---	---	
ICK	22858	broad.mit.edu	37	6	52893619	52893620	+	Intron	DEL	GT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52893619_52893620delGT	uc003pbh.2	-						ICK_uc003pbi.2_Intron|ICK_uc003pbj.2_Intron	NM_016513	NP_057597	Q9UPZ9	ICK_HUMAN	intestinal cell kinase						intracellular protein kinase cascade|multicellular organismal development	cytosol|nucleus	ATP binding|cyclin-dependent protein kinase activity|magnesium ion binding			ovary(1)|large_intestine(1)|lung(1)|kidney(1)|central_nervous_system(1)	5	Lung NSC(77;0.103)					CTACAGATGAgtgtgtgtgtgt	0.198													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57370657	57370658	+	Intron	INS	-	TCTT	TCTT			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57370657_57370658insTCTT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		agatgtgAAAATCTTTCCTATG	0.168													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57469420	57469420	+	Intron	DEL	G	-	-	rs111512806		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57469420delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttattgaatagggagtccttt	0.000													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57485390	57485390	+	Intron	DEL	C	-	-	rs111507019		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57485390delC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		gtgaaagcctctggcaagttt	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	62000205	62000205	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62000205delT								None (None upstream) : KHDRBS2 (389660 downstream)																							cacgtttttattagggatttc	0.000													4	2	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	65417557	65417559	+	Intron	DEL	AAA	-	-	rs138533515		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65417557_65417559delAAA	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						gactcgtatcaaaaaaaaaaaaa	0.000													4	3	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	65473974	65473974	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65473974delG	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						agctgttggtggatctaccat	0.000													4	2	---	---	---	---	
LMBRD1	55788	broad.mit.edu	37	6	70414795	70414796	+	Intron	INS	-	TTTT	TTTT			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70414795_70414796insTTTT	uc003pfa.2	-						LMBRD1_uc003pey.2_Intron|LMBRD1_uc003pez.2_Intron|LMBRD1_uc010kal.2_Intron|LMBRD1_uc003pfb.2_Intron	NM_018368	NP_060838	Q9NUN5	LMBD1_HUMAN	liver regeneration p-53 related protein						interspecies interaction between organisms|transport	integral to membrane|lysosomal membrane	cobalamin binding			ovary(1)	1						GGGATTGGACATTTGTTTTTTT	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	75531548	75531548	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75531548delC								CD109 (993508 upstream) : COL12A1 (262495 downstream)																							tatcatatgacccactaatcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	77784802	77784802	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:77784802delC								None (None upstream) : HTR1B (387146 downstream)																							TCTTACTTGTCTCTTGTAGAA	0.308													4	2	---	---	---	---	
BCKDHB	594	broad.mit.edu	37	6	80839331	80839334	+	Intron	DEL	AGAG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80839331_80839334delAGAG	uc003pjd.2	+						BCKDHB_uc003pje.2_Intron	NM_000056	NP_000047	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		CTTTTCGGGAAGAGAGAGAGAGAG	0.255													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	85748680	85748680	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85748680delT								TBX18 (274781 upstream) : NT5E (410622 downstream)																							CAGTTTCTGAttttttttttt	0.164													4	2	---	---	---	---	
RNGTT	8732	broad.mit.edu	37	6	89614281	89614282	+	Intron	INS	-	A	A	rs113231405		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89614281_89614282insA	uc003pmr.2	-						RNGTT_uc003pms.2_Intron|RNGTT_uc011dzu.1_Intron|RNGTT_uc003pmt.2_Intron	NM_003800	NP_003791	O60942	MCE1_HUMAN	RNA guanylyltransferase and 5'-phosphatase						interspecies interaction between organisms|mRNA capping|transcription from RNA polymerase II promoter|viral reproduction	nucleoplasm	GTP binding|mRNA guanylyltransferase activity|polynucleotide 5'-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)		actttctctccaaaaaaaaaaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	92887207	92887208	+	IGR	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92887207_92887208delAC								None (None upstream) : None (None downstream)																							ACTATTATAGacacacacacac	0.287													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	100142434	100142434	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100142434delA								PRDM13 (78980 upstream) : MCHR2 (225352 downstream)																							attttaagacaaaaactataa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	102869676	102869677	+	IGR	DEL	AC	-	-	rs72956086	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102869676_102869677delAC								GRIK2 (351719 upstream) : None (None downstream)																							ttcacaatagacacacacacac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	103409645	103409646	+	IGR	INS	-	T	T	rs142158189	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:103409645_103409646insT								GRIK2 (891688 upstream) : None (None downstream)																							ATTTTTTGTCATTTTTTTCCAT	0.267													4	4	---	---	---	---	
PREP	5550	broad.mit.edu	37	6	105834786	105834786	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105834786delG	uc003prc.2	-							NM_002726	NP_002717	P48147	PPCE_HUMAN	prolyl endopeptidase						proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	TAAACATGGTGGGGGAAAAAA	0.189													4	2	---	---	---	---	
PDSS2	57107	broad.mit.edu	37	6	107579596	107579596	+	Intron	DEL	G	-	-	rs145598402		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107579596delG	uc003prt.2	-						PDSS2_uc011eak.1_Intron|PDSS2_uc011eal.1_Intron|PDSS2_uc003pru.2_Intron	NM_020381	NP_065114	Q86YH6	DLP1_HUMAN	prenyl diphosphate synthase, subunit 2						isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	protein heterodimerization activity			ovary(2)	2	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		TACAACAtttggaaccataga	0.219													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	108447066	108447066	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108447066delT	uc003psf.1	+											Homo sapiens clone c222389 mRNA sequence.																		AAATAACAACttttttttttt	0.199													3	3	---	---	---	---	
FIG4	9896	broad.mit.edu	37	6	110044277	110044277	+	Intron	DEL	T	-	-	rs116722286	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110044277delT	uc003ptt.2	+						FIG4_uc011eau.1_Intron	NM_014845	NP_055660	Q92562	FIG4_HUMAN	Sac domain-containing inositol phosphatase 3						cell death	endosome membrane	protein binding			ovary(1)	1		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		cttaacaagatttattagatt	0.000													4	2	---	---	---	---	
CDK19	23097	broad.mit.edu	37	6	111108948	111108948	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111108948delT	uc003puh.1	-						CDK19_uc003pui.1_Intron	NM_015076	NP_055891	Q9BWU1	CDK19_HUMAN	cell division cycle 2-like 6 (CDK8-like)								ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4						acctggcaggttttgagcttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	113715471	113715473	+	IGR	DEL	TTA	-	-	rs79171667		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:113715471_113715473delTTA								None (None upstream) : MARCKS (463054 downstream)																							GGGATTAGTGTTATTGTTGTTGT	0.281													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	118671641	118671641	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118671641delA								SLC35F1 (32804 upstream) : C6orf204 (114598 downstream)																							TTCTTGGGGGAAAAAAAAACA	0.224													4	2	---	---	---	---	
C6orf170	221322	broad.mit.edu	37	6	121606564	121606564	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121606564delA	uc003pyo.1	-						C6orf170_uc003pyq.1_Intron|C6orf170_uc003pyp.1_Intron	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322						multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		atctaccaggaaaattcatta	0.000													4	2	---	---	---	---	
PKIB	5570	broad.mit.edu	37	6	122876174	122876174	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122876174delT	uc003pyz.2	+							NM_181794	NP_861459	Q9C010	IPKB_HUMAN	cAMP-dependent protein kinase inhibitor beta								cAMP-dependent protein kinase inhibitor activity				0				GBM - Glioblastoma multiforme(226;0.164)		AGATCACATGTTTATGATGCT	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	130284548	130284548	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130284548delG								C6orf191 (102132 upstream) : L3MBTL3 (55186 downstream)																							ATTTTGCTCTGTGATCTGACA	0.413													4	2	---	---	---	---	
SAMD3	154075	broad.mit.edu	37	6	130514648	130514649	+	Intron	INS	-	CA	CA			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130514648_130514649insCA	uc003qbv.2	-						SAMD3_uc003qbx.2_Intron|SAMD3_uc003qbw.2_Intron|SAMD3_uc010kfg.1_Intron|SAMD3_uc003qby.2_Intron|SAMD3_uc003qbz.1_Intron	NM_001017373	NP_001017373	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3 isoform											ovary(1)	1				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		gacccctttcccgcttttctgg	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	131430140	131430141	+	IGR	INS	-	T	T	rs34397018		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131430140_131430141insT								EPB41L2 (45678 upstream) : AKAP7 (26730 downstream)																							ataacagttggttttttttttt	0.010													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	131868746	131868747	+	IGR	INS	-	C	C	rs138830705	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131868746_131868747insC								AKAP7 (264073 upstream) : ARG1 (25618 downstream)																							ACGTCTGGCCACCAGGAGCAGA	0.505													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134678860	134678861	+	IGR	DEL	TC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134678860_134678861delTC								SGK1 (39664 upstream) : ALDH8A1 (559668 downstream)																							ATGGGTAATTTCTCTCTCTCTC	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134752544	134752545	+	Intron	INS	-	TG	TG	rs149426076	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134752544_134752545insTG	uc003qeq.1	-						uc003qer.1_Intron|uc003qes.1_Intron					Homo sapiens cDNA clone IMAGE:4837072.																		cttcaaccatttgtgtgtgtgt	0.000													4	2	---	---	---	---	
AHI1	54806	broad.mit.edu	37	6	135804196	135804197	+	Intron	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135804196_135804197insT	uc003qgi.2	-						AHI1_uc003qgh.2_Intron|AHI1_uc003qgj.2_Intron|AHI1_uc003qgk.3_Intron|AHI1_uc003qgl.3_Intron	NM_001134831	NP_001128303	Q8N157	AHI1_HUMAN	Abelson helper integration site 1 isoform a							adherens junction|cilium|microtubule basal body				ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		cacctggctaattttttttttt	0.000													4	2	---	---	---	---	
PDE7B	27115	broad.mit.edu	37	6	136467325	136467325	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136467325delG	uc003qgp.2	+						uc003qgq.1_Intron|PDE7B_uc003qgr.2_Intron	NM_018945	NP_061818	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)	GGAGAAGGTAGGACAGAAGCC	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	139005786	139005789	+	IGR	DEL	AAAC	-	-	rs6940904	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139005786_139005789delAAAC								NHSL1 (112118 upstream) : CCDC28A (88868 downstream)																							cgtctcagaaaaacaaacaaacaa	0.196													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	139502462	139502462	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139502462delA								HECA (517 upstream) : TXLNB (58737 downstream)																							tggtcaccctaaatggaaaat	0.070													4	2	---	---	---	---	
LOC153910	153910	broad.mit.edu	37	6	142885983	142885983	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142885983delC	uc003qjc.1	-						LOC153910_uc010khg.1_Intron	NR_027312				Homo sapiens cDNA FLJ31371 fis, clone NB9N42000196.												0						ACCTCCCAGTCCCCAGCAGCA	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	145396282	145396289	+	IGR	DEL	AGGGAGAA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145396282_145396289delAGGGAGAA								UTRN (222114 upstream) : EPM2A (550157 downstream)																							gaaggaaaggagggagaaaggaaggaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	145540676	145540676	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145540676delA								UTRN (366508 upstream) : EPM2A (405770 downstream)																							cccaaagcagaaaaaaaaaat	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	146197395	146197396	+	Intron	INS	-	CTA	CTA	rs150533679	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146197395_146197396insCTA	uc003qky.1	+						uc003qlb.2_Intron|uc010khs.1_Intron|uc003qlc.2_Intron					Homo sapiens cDNA FLJ42767 fis, clone BRAWH3003343.																		tgtagtcccagctacttgagga	0.000													3	4	---	---	---	---	
UST	10090	broad.mit.edu	37	6	149191873	149191873	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149191873delC	uc003qmg.2	+							NM_005715	NP_005706	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase						protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		TGACCTGGGGCCCAGCACAGG	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	150729063	150729064	+	IGR	DEL	TG	-	-	rs72451345		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150729063_150729064delTG								IYD (3299 upstream) : PLEKHG1 (191935 downstream)																							ATAAGGAGCATGTGTGCAGAAG	0.515													2	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	151179494	151179495	+	IGR	INS	-	T	T	rs67390261		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151179494_151179495insT								PLEKHG1 (14695 upstream) : MTHFD1L (7196 downstream)																							tccctccattcttttttttttt	0.000													3	3	---	---	---	---	
RGS17	26575	broad.mit.edu	37	6	153364622	153364623	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153364622_153364623insA	uc003qpm.2	-							NM_012419	NP_036551	Q9UGC6	RGS17_HUMAN	regulator of G-protein signalling 17						negative regulation of signal transduction	cytoplasm|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			pancreas(1)	1		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)		AGCAGAGAACTAAAAAAAAAAA	0.347									Lung_Cancer_Familial_Clustering_of				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	153818901	153818901	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153818901delG								RGS17 (366512 upstream) : OPRM1 (512735 downstream)																							tttcatgcctggtaacacaac	0.000													4	2	---	---	---	---	
TIAM2	26230	broad.mit.edu	37	6	155318138	155318139	+	Intron	DEL	AT	-	-	rs138748666		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155318138_155318139delAT	uc003qqb.2	+							NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		TTCACATACCATACTAAGATGc	0.213													4	3	---	---	---	---	
TIAM2	26230	broad.mit.edu	37	6	155366589	155366590	+	Intron	INS	-	T	T	rs141972338	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155366589_155366590insT	uc003qqb.2	+							NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		ACTTATTAGAATTTTTTTTAAG	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	155664532	155664534	+	IGR	DEL	CTT	-	-	rs150549323		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155664532_155664534delCTT								TFB1M (28906 upstream) : NOX3 (51969 downstream)																							GCTGGCTGTCCTTCTATTGATGC	0.360													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	156475551	156475551	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156475551delA								MIR1202 (207538 upstream) : ARID1B (623535 downstream)																							actccgtctcaaaaaaaaaaa	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	157004605	157004606	+	IGR	INS	-	T	T	rs67977022		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157004605_157004606insT								MIR1202 (736592 upstream) : ARID1B (94480 downstream)																							TTAGttttttgttttttttttt	0.153													3	4	---	---	---	---	
ARID1B	57492	broad.mit.edu	37	6	157220560	157220560	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157220560delT	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CAGCCCAGGCTTACAGAAGGT	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	157691675	157691677	+	IGR	DEL	CAC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157691675_157691677delCAC								ARID1B (161274 upstream) : C6orf35 (18378 downstream)																							caaacaccatcaccaccaccacc	0.020													3	4	---	---	---	---	
C6orf35	729515	broad.mit.edu	37	6	157733256	157733257	+	Intron	INS	-	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157733256_157733257insC	uc003sih.3	-							NM_018452	NP_060922	Q9NWH2	CF035_HUMAN	hypothetical protein LOC729515							integral to membrane					0						TCATCATAGTGCCCCAGTGTAC	0.530													4	2	---	---	---	---	
TMEM181	57583	broad.mit.edu	37	6	159047966	159047967	+	Intron	INS	-	CTCACC	CTCACC	rs140164490	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159047966_159047967insCTCACC	uc003qrm.3	+						TMEM181_uc010kjr.1_Intron	NM_020823	NP_065874	Q9P2C4	TM181_HUMAN	G protein-coupled receptor 178						pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		tcaccctcattctcaccctcac	0.168													3	3	---	---	---	---	
IGF2R	3482	broad.mit.edu	37	6	160483802	160483802	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160483802delT	uc003qta.2	+							NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor						receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		TTCCTTGAGCTTTTTTTTTTA	0.428													6	3	---	---	---	---	
SLC22A2	6582	broad.mit.edu	37	6	160599325	160599326	+	Intron	INS	-	AGAG	AGAG	rs146721345	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160599325_160599326insAGAG	uc003qte.1	-							NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2						body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		gagagagagaaagagagagaga	0.035													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	165337151	165337152	+	IGR	DEL	TG	-	-	rs57634938		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165337151_165337152delTG								None (None upstream) : C6orf118 (356003 downstream)																							ctggttaatttgtgtgtgtgtg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	165376251	165376251	+	IGR	DEL	T	-	-	rs138440275		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165376251delT								None (None upstream) : C6orf118 (316904 downstream)																							accagggaaatttccaaggga	0.000													5	3	---	---	---	---	
RPS6KA2	6196	broad.mit.edu	37	6	166946333	166946334	+	Intron	DEL	GT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166946333_166946334delGT	uc003qvb.1	-						RPS6KA2_uc011ego.1_Intron|RPS6KA2_uc010kkl.1_Intron|RPS6KA2_uc003qvc.1_Intron|RPS6KA2_uc003qvd.1_Intron	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		GAGAGAGAGAgtgtgtgtgtgt	0.465													6	3	---	---	---	---	
MLLT4	4301	broad.mit.edu	37	6	168236123	168236123	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168236123delT	uc003qwd.2	+						MLLT4_uc003qwb.1_Intron|MLLT4_uc003qwc.1_Intron	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		gctcatatactttttttttga	0.000			T	MLL	AL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	426380	426381	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:426380_426381insT								FAM20C (125669 upstream) : PDGFA (110518 downstream)																							accttccgccaggttggagctc	0.000													2	5	---	---	---	---	
PRKAR1B	5575	broad.mit.edu	37	7	623336	623337	+	Intron	DEL	CT	-	-	rs66527179		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:623336_623337delCT	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron|PRKAR1B_uc003six.1_Intron	NM_002735	NP_002726	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		CACTCACACCCTCACACACGTG	0.139													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1228406	1228407	+	IGR	INS	-	GAA	GAA	rs141625711	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1228406_1228407insGAA								ZFAND2A (28551 upstream) : UNCX (44247 downstream)																							acaaataaTAGgaagaagaaga	0.025													4	5	---	---	---	---	
MAD1L1	8379	broad.mit.edu	37	7	2099876	2099885	+	Intron	DEL	GCCGAGATAC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2099876_2099885delGCCGAGATAC	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		ATACGCCGATGCCGAGATACGCCGATGCCG	0.581													4	2	---	---	---	---	
AMZ1	155185	broad.mit.edu	37	7	2746911	2746911	+	Intron	DEL	A	-	-	rs34223369		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2746911delA	uc003smr.1	+						AMZ1_uc003sms.1_Intron|AMZ1_uc011jwa.1_Intron	NM_133463	NP_597720	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1								metallopeptidase activity|zinc ion binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		actccatctcaaaaaaaaaaa	0.184													2	5	---	---	---	---	
HDAC9	9734	broad.mit.edu	37	7	18296740	18296741	+	Intron	DEL	TA	-	-	rs150400645	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18296740_18296741delTA	uc011jya.1	+							NM_014707	NP_055522	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 3						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	tgtgtgcatgtatgtgtgtgtg	0.045													4	2	---	---	---	---	
HDAC9	9734	broad.mit.edu	37	7	19011939	19011939	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19011939delG	uc003sui.2	+						HDAC9_uc003sue.2_Intron|HDAC9_uc003suj.2_Intron|HDAC9_uc003suk.2_Intron	NM_178425	NP_848512	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 5						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	GGATTAGTGTGGGATCTCCAA	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	19948543	19948543	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19948543delA								TMEM196 (135327 upstream) : MACC1 (225745 downstream)																							actccatctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
MACC1	346389	broad.mit.edu	37	7	20211210	20211210	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20211210delT	uc003sus.3	-						MACC1_uc010kug.2_Intron	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						ATTATATCTGttttttttttt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	20983196	20983197	+	IGR	DEL	AG	-	-	rs11524130		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20983196_20983197delAG								RPL23P8 (115757 upstream) : SP4 (484492 downstream)																							tggattagaaagagaagttgaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	24020743	24020743	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24020743delA								STK31 (76378 upstream) : NPY (303066 downstream)																							CTTCCCAGTGAAAGTTCTAGA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	27508422	27508422	+	IGR	DEL	C	-	-	rs75998598		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27508422delC								EVX1 (222230 upstream) : HIBADH (56641 downstream)																							aagagcaccgccccccccccg	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	28882624	28882625	+	IGR	DEL	TC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28882624_28882625delTC								CREB5 (17115 upstream) : TRIL (110351 downstream)																							AACTCTtctgtctctctctctc	0.099													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	33863159	33863160	+	IGR	DEL	AC	-	-	rs72342743		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33863159_33863160delAC								BBS9 (217479 upstream) : BMPER (81952 downstream)																							agatacacatacacacacacac	0.272													3	3	---	---	---	---	
HECW1	23072	broad.mit.edu	37	7	43494726	43494727	+	Intron	INS	-	T	T	rs139339162	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43494726_43494727insT	uc003tid.1	+						HECW1_uc011kbi.1_Intron	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						Tttttgttttctttttttttgt	0.381											OREG0018025	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	48894373	48894374	+	IGR	INS	-	G	G	rs148999448	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48894373_48894374insG								ABCA13 (207282 upstream) : CDC14C (69783 downstream)																							TAATGAGAGGTGGGGGAAGAAG	0.277													4	2	---	---	---	---	
PSPH	5723	broad.mit.edu	37	7	56083208	56083208	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56083208delA	uc003trg.2	-						PSPH_uc003trh.2_Intron|PSPH_uc003tri.2_Intron|PSPH_uc003trj.2_Intron	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTTTGCTTTTAAATTATAACT	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56557408	56557409	+	IGR	INS	-	G	G	rs146847538	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56557408_56557409insG								PSPH (373318 upstream) : DKFZp434L192 (6507 downstream)																							CCATGGATGATGGCCTGTGGCT	0.416													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56558076	56558077	+	IGR	INS	-	G	G	rs144407407	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56558076_56558077insG								PSPH (373986 upstream) : DKFZp434L192 (5839 downstream)																							GTGAGTGTAGAGGGAGGGTCTT	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57774292	57774292	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57774292delA								ZNF716 (241027 upstream) : None (None downstream)																							cactatacccagctatttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61513863	61513864	+	IGR	DEL	AA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61513863_61513864delAA								None (None upstream) : None (None downstream)																							atcttcacataaaaagtagaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61903964	61903964	+	IGR	DEL	A	-	-	rs76039913		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61903964delA								None (None upstream) : LOC643955 (847708 downstream)																							accttcagataaaaaaaacag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61972849	61972849	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61972849delT								None (None upstream) : LOC643955 (778823 downstream)																							tgaaacactctttttgtggaa	0.000													6	3	---	---	---	---	
TPST1	8460	broad.mit.edu	37	7	65673463	65673464	+	Intron	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65673463_65673464insT	uc003tuw.2	+						TPST1_uc010kzy.2_Intron|TPST1_uc010kzz.2_Intron|TPST1_uc010laa.2_Intron	NM_003596	NP_003587	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1						inflammatory response|peptidyl-tyrosine sulfation	Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity				0						accatttttagttttttttttg	0.005													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67342639	67342640	+	IGR	DEL	CT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67342639_67342640delCT								STAG3L4 (556127 upstream) : None (None downstream)																							CTCTTTCACACTCTCtctctct	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67493285	67493286	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67493285_67493286insT								STAG3L4 (706773 upstream) : None (None downstream)																							CTTTGTCCTGATTTTTTTTTTT	0.401													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68018841	68018841	+	IGR	DEL	A	-	-	rs35718590		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68018841delA								None (None upstream) : None (None downstream)																							ctctctctctaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68064178	68064178	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68064178delA								None (None upstream) : AUTS2 (999727 downstream)																							AGTGCATCTGAAAGCACCAGC	0.383													4	2	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	69118630	69118630	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69118630delT	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GTGGGTTTGGTTTTTTTTTTT	0.358													4	2	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71483446	71483447	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71483446_71483447insA	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				ACTGCAGTAACAAAAAAACACA	0.431													4	2	---	---	---	---	
WBSCR27	155368	broad.mit.edu	37	7	73252427	73252427	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73252427delC	uc003tzj.2	-						RFC2_uc011kfa.1_Intron	NM_152559	NP_689772	Q8N6F8	WBS27_HUMAN	Williams-Beuren syndrome chromosome region 27											central_nervous_system(1)	1		Lung NSC(55;0.159)				aagggatcctcctgcctcggt	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	74022710	74022711	+	IGR	DEL	AA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74022710_74022711delAA								GTF2IRD1 (5792 upstream) : GTF2I (49319 downstream)																							actccatctcaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
GTF2I	2969	broad.mit.edu	37	7	74100109	74100109	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74100109delA	uc003uau.2	+						GTF2I_uc003uat.2_Intron|GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						ttaaaaaaagaaaaaaaaaaG	0.005													4	3	---	---	---	---	
YWHAG	7532	broad.mit.edu	37	7	75966853	75966853	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75966853delT	uc011kgj.1	-							NM_012479	NP_036611	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan						G2/M transition of mitotic cell cycle|regulation of neuron differentiation|regulation of signal transduction|regulation of synaptic plasticity	cytosol	insulin-like growth factor receptor binding|protein kinase C binding|protein kinase C inhibitor activity			ovary(1)|lung(1)	2						cctttgctaattttttttttt	0.000													5	3	---	---	---	---	
PMS2L11	441263	broad.mit.edu	37	7	76626961	76626962	+	Intron	INS	-	TG	TG	rs140820337		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76626961_76626962insTG	uc003ufw.3	+						PMS2L11_uc011kgn.1_Intron	NR_023383				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						ggaggtggggatgtggggtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	79961743	79961743	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79961743delA								GNAI1 (113018 upstream) : CD36 (37148 downstream)																							ccagatttctaaggcattttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	81179781	81179781	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81179781delA								SEMA3C (628106 upstream) : HGF (151664 downstream)																							actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SEMA3E	9723	broad.mit.edu	37	7	83246043	83246044	+	Intron	INS	-	T	T	rs67160899		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83246043_83246044insT	uc003uhy.1	-							NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				ttctttctttcttttttttttt	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	97329684	97329685	+	IGR	INS	-	A	A	rs35312052		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97329684_97329685insA								ACN9 (518611 upstream) : TAC1 (31586 downstream)																							acaaagctcccaaaaaaaaggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	97470456	97470456	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97470456delA								TAC1 (100674 upstream) : ASNS (10987 downstream)																							ccatgaacctaggatgggtga	0.159													4	2	---	---	---	---	
BAIAP2L1	55971	broad.mit.edu	37	7	97939918	97939918	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97939918delT	uc003upj.2	-							NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			TGAAAAATTCTTTATTAGTCC	0.343													35	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100310987	100310987	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100310987delT								POP7 (5865 upstream) : EPO (7436 downstream)																							TAAAAGTTGCttttttttttt	0.159													4	2	---	---	---	---	
CUX1	1523	broad.mit.edu	37	7	101892763	101892764	+	3'UTR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101892763_101892764insT	uc003uyx.3	+	24					CUX1_uc003uys.3_3'UTR|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						ACCCTGAAGTGTTTTTTTTATT	0.391													4	2	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105320448	105320449	+	Intron	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105320448_105320449insT	uc003vde.2	-						ATXN7L1_uc003vdf.2_5'Flank|ATXN7L1_uc003vdh.3_5'Flank|ATXN7L1_uc011klr.1_5'Flank	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						GGCATCCAACATTTCTTTGCAA	0.292													4	2	---	---	---	---	
PRKAR2B	5577	broad.mit.edu	37	7	106697808	106697808	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106697808delT	uc003vdx.2	+							NM_002736	NP_002727	P31323	KAP3_HUMAN	cAMP-dependent protein kinase, regulatory						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1						GATGTCATTCTTTTTTTTTTT	0.209													4	2	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127325469	127325469	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127325469delT	uc003vmi.2	+							NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						TTCGAAGCTATTTTTTATGAA	0.428													4	2	---	---	---	---	
AHCYL2	23382	broad.mit.edu	37	7	128875099	128875099	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128875099delT	uc011kov.1	+						AHCYL2_uc003vot.2_Intron	NM_015328	NP_056143	Q96HN2	SAHH3_HUMAN	S-adenosylhomocysteine hydrolase-like 2 isoform						one-carbon metabolic process		adenosylhomocysteinase activity			ovary(2)	2						attcttcttcttttttttttt	0.000													4	2	---	---	---	---	
PLXNA4	91584	broad.mit.edu	37	7	131864294	131864295	+	Intron	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131864294_131864295delAC	uc003vra.3	-							NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1						attcgcacagacacacacacCG	0.317													5	4	---	---	---	---	
SVOPL	136306	broad.mit.edu	37	7	138357910	138357912	+	Intron	DEL	ATA	-	-	rs35990403		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138357910_138357912delATA	uc011kqh.1	-							NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1							integral to membrane	transmembrane transporter activity				0						ATGGGTTATTATAATAATGTTTA	0.350													3	4	---	---	---	---	
UBN2	254048	broad.mit.edu	37	7	138977005	138977007	+	Intron	DEL	AAG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138977005_138977007delAAG	uc011kqr.1	+							NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2											ovary(1)|skin(1)	2						tctcaaaaaaaaGGGGGCGGAGT	0.207													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	140138831	140138831	+	IGR	DEL	T	-	-	rs71520094		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140138831delT								RAB19 (12781 upstream) : MKRN1 (14009 downstream)																							TTTTTCTttcttttttttttt	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	143174705	143174706	+	Intron	INS	-	C	C	rs149284360	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143174705_143174706insC	uc003wda.2	+						TAS2R41_uc003wdc.1_5'Flank					Homo sapiens mRNA; cDNA DKFZp686O0656 (from clone DKFZp686O0656).																		CAGCATGCAGGAAAACTGGACA	0.460													3	5	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	146380259	146380259	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146380259delG	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			gccagtagctgggattacagg	0.000										HNSCC(39;0.1)			4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	147956447	147956448	+	Intron	INS	-	A	A	rs76647861		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147956447_147956448insA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			gaccctgcctcaaaaaaaaaaa	0.124										HNSCC(39;0.1)			4	2	---	---	---	---	
ZNF398	57541	broad.mit.edu	37	7	148874209	148874210	+	Intron	INS	-	G	G	rs141506713	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148874209_148874210insG	uc003wfl.2	+						ZNF398_uc011kul.1_Intron|ZNF398_uc011kum.1_Intron	NM_170686	NP_733787	Q8TD17	ZN398_HUMAN	zinc finger 398 isoform a						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			TAATGCATTCTGTTTTTTTTTT	0.322													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	152823816	152823816	+	IGR	DEL	G	-	-	rs4629772	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152823816delG								ACTR3B (271353 upstream) : DPP6 (760603 downstream)																							TGCAGCACGAGAAAAGATGGC	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155339047	155339048	+	IGR	INS	-	T	T	rs34943403		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155339047_155339048insT								CNPY1 (12508 upstream) : RBM33 (98155 downstream)																							cacccggctaattttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	156310215	156310216	+	IGR	DEL	GA	-	-	rs71187982		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156310215_156310216delGA								SHH (705248 upstream) : C7orf4 (22969 downstream)																							GAGGCTGTGTGAGGGAGGCTGT	0.604													3	3	---	---	---	---	
UBE3C	9690	broad.mit.edu	37	7	156967832	156967832	+	Intron	DEL	T	-	-	rs72028353		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156967832delT	uc010lqs.2	+						UBE3C_uc003wnf.2_Intron|UBE3C_uc003wng.2_Intron	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C						protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		TTTTCCATACttttttttttt	0.318													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157558545	157558546	+	Intron	INS	-	CATC	CATC	rs142646247	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157558545_157558546insCATC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		actcatccactcatccatccat	0.000													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158263531	158263531	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158263531delT	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ATCACATGGAttttttttttt	0.234													4	2	---	---	---	---	
ADAM7	8756	broad.mit.edu	37	8	24365182	24365182	+	Intron	DEL	T	-	-	rs35492134		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24365182delT	uc003xeb.2	+						ADAM7_uc003xec.2_Intron	NM_003817	NP_003808	Q9H2U9	ADAM7_HUMAN	a disintegrin and metalloproteinase domain 7						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(1)|kidney(1)	5		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		AAGGTTAGAATTTTTTTTTTT	0.318													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	24972373	24972373	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24972373delG								NEFL (158242 upstream) : DOCK5 (69914 downstream)																							TGAGAAcagtgggaatcactg	0.209													4	2	---	---	---	---	
KCNU1	157855	broad.mit.edu	37	8	36744970	36744971	+	Intron	INS	-	TT	TT			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36744970_36744971insTT	uc010lvw.2	+						KCNU1_uc003xjw.2_Intron|uc003xjx.2_5'Flank	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1							voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		gtttttttttgttttttttttt	0.025													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	36867013	36867014	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36867013_36867014insT								KCNU1 (73372 upstream) : ZNF703 (686287 downstream)																							aaaggaggtgcttttttcctgt	0.069													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37525108	37525109	+	IGR	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37525108_37525109delAC								KCNU1 (731467 upstream) : ZNF703 (28192 downstream)																							gcagacacaaacacacacacac	0.000													3	5	---	---	---	---	
LETM2	137994	broad.mit.edu	37	8	38246238	38246239	+	Intron	INS	-	A	A	rs142172066		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38246238_38246239insA	uc003xlm.1	+						LETM2_uc003xlk.2_Intron|LETM2_uc011lbn.1_Intron|LETM2_uc003xll.1_Intron|LETM2_uc003xln.1_Intron|LETM2_uc003xlo.1_Intron	NM_144652	NP_653253	Q2VYF4	LETM2_HUMAN	leucine zipper-EF-hand containing transmembrane							integral to membrane|mitochondrial inner membrane					0	all_cancers(2;6.77e-47)|all_epithelial(2;1.01e-50)|all_lung(3;1.25e-23)|Lung NSC(2;2.76e-23)|Colorectal(12;0.000442)|Esophageal squamous(3;0.00202)	all_lung(54;0.0657)|Hepatocellular(245;0.152)|Lung NSC(58;0.175)	Epithelial(3;1.17e-42)|all cancers(3;5.44e-38)|BRCA - Breast invasive adenocarcinoma(5;5.44e-27)|LUSC - Lung squamous cell carcinoma(2;7.12e-25)|Lung(2;4.49e-22)|COAD - Colon adenocarcinoma(9;0.114)			aaatccatctcaaaaaaaaaaa	0.015													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	38439300	38439300	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38439300delT								C8orf86 (53120 upstream) : RNF5P1 (18395 downstream)																							TCTCGCTCTCttttttttttt	0.249													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	40956790	40956791	+	IGR	DEL	CA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40956790_40956791delCA								ZMAT4 (201447 upstream) : SFRP1 (162688 downstream)																							GCTCCAGGGCCACACACACACA	0.381													5	3	---	---	---	---	
SFRP1	6422	broad.mit.edu	37	8	41158967	41158968	+	Intron	INS	-	A	A	rs141869268	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41158967_41158968insA	uc003xnt.2	-							NM_003012	NP_003003	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1 precursor						brain development|canonical Wnt receptor signaling pathway|cellular response to BMP stimulus|cellular response to estradiol stimulus|cellular response to fibroblast growth factor stimulus|cellular response to heparin|cellular response to hypoxia|cellular response to interleukin-1|cellular response to prostaglandin E stimulus|cellular response to starvation|cellular response to transforming growth factor beta stimulus|cellular response to tumor necrosis factor|cellular response to vitamin D|DNA fragmentation involved in apoptotic nuclear change|dorsal/ventral axis specification|hemopoietic progenitor cell differentiation|hemopoietic stem cell differentiation|menstrual cycle phase|negative regulation of androgen receptor signaling pathway|negative regulation of B cell differentiation|negative regulation of bone remodeling|negative regulation of canonical Wnt receptor signaling pathway involved in controlling type B pancreatic cell proliferation|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cysteine-type endopeptidase activity|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast apoptosis|negative regulation of fibroblast proliferation|negative regulation of insulin secretion|negative regulation of ossification|negative regulation of osteoblast proliferation|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|osteoblast differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell growth|positive regulation of epithelial cell proliferation|positive regulation of fat cell differentiation|positive regulation of fibroblast apoptosis|positive regulation of focal adhesion assembly|positive regulation of non-canonical Wnt receptor signaling pathway|positive regulation of Rac GTPase activity|positive regulation of smoothened signaling pathway|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|regulation of angiogenesis|regulation of cell cycle process|response to drug|response to organic cyclic compound|vasculature development	cell surface|cytosol|extracellular space|plasma membrane|proteinaceous extracellular matrix	cysteine-type endopeptidase activity|drug binding|frizzled binding|heparin binding|identical protein binding|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			CAGAGAGAGAGAAAAAAAAATC	0.421													2	4	---	---	---	---	
ANK1	286	broad.mit.edu	37	8	41748802	41748802	+	Intron	DEL	T	-	-	rs111612663		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41748802delT	uc003xom.2	-							NM_001142446	NP_001135918	P16157	ANK1_HUMAN	ankyrin 1 isoform 9						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GATGAGTTTGTTTTTTTTTTT	0.468													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	47093856	47093856	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47093856delT								None (None upstream) : BEYLA (658652 downstream)																							gacacagtcatcctgcttcaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	51968722	51968723	+	IGR	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51968722_51968723delTG								SNTG1 (263295 upstream) : PXDNL (263421 downstream)																							tttgtgtgtctgtgtgtgtgtg	0.000													4	3	---	---	---	---	
PXDNL	137902	broad.mit.edu	37	8	52520415	52520418	+	Intron	DEL	AGGA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52520415_52520418delAGGA	uc003xqu.3	-							NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				aaaggaagagaggaaggaaggaag	0.000													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57792882	57792882	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57792882delA								PENK (433600 upstream) : IMPAD1 (77609 downstream)																							GAGCATGGGGAAAAAGACTAG	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57847784	57847784	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57847784delA								PENK (488502 upstream) : IMPAD1 (22707 downstream)																							tggttctaccatgtggagatg	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	61981968	61981971	+	IGR	DEL	CTTC	-	-	rs35758644		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61981968_61981971delCTTC								CHD7 (202505 upstream) : CLVS1 (218554 downstream)																							ttctctctctcttccttccttcct	0.255													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	77122144	77122155	+	IGR	DEL	CACACACACACA	-	-	rs10555988		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77122144_77122155delCACACACACACA								HNF4G (643085 upstream) : LOC100192378 (400960 downstream)																							AGCTACTTTTcacacacacacacacacacaca	0.118													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	83061394	83061395	+	IGR	DEL	CT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83061394_83061395delCT								SNX16 (306873 upstream) : None (None downstream)																							ttcctctttgctctctctctct	0.000													4	3	---	---	---	---	
CNGB3	54714	broad.mit.edu	37	8	87705020	87705020	+	Intron	DEL	T	-	-	rs75231515		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87705020delT	uc003ydx.2	-							NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3						signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						cctaaatacctttttttttca	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	93875271	93875271	+	Intron	DEL	T	-	-	rs34406360		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93875271delT	uc003yfj.1	-											Homo sapiens cDNA FLJ46284 fis, clone TESTI4031818.																		TCGATACTTATTTTTACAGCA	0.393													4	3	---	---	---	---	
ANKRD46	157567	broad.mit.edu	37	8	101535391	101535392	+	Intron	INS	-	T	T	rs138466941	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101535391_101535392insT	uc003yjm.2	-						ANKRD46_uc003yjn.1_Intron|ANKRD46_uc003yjo.1_Intron|ANKRD46_uc003yjp.1_Intron	NM_198401	NP_940683	Q86W74	ANR46_HUMAN	ankyrin repeat domain 46							integral to membrane					0	all_cancers(14;5.07e-05)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000353)|all_lung(17;0.000998)		Epithelial(11;2.61e-11)|all cancers(13;5.03e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.49e-06)|STAD - Stomach adenocarcinoma(118;0.0957)			caccatctctaTTTTTTTTTAA	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	101691055	101691056	+	IGR	INS	-	TA	TA	rs144748760	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101691055_101691056insTA								SNX31 (29162 upstream) : PABPC1 (24088 downstream)																							CCCTAACAAACTGTTATAAACC	0.495													2	5	---	---	---	---	
MED30	90390	broad.mit.edu	37	8	118547775	118547775	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118547775delT	uc003yoj.2	+						MED30_uc011lib.1_Intron	NM_080651	NP_542382	Q96HR3	MED30_HUMAN	TRAP/Mediator complex component TRAP25						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding				0	all_cancers(13;3.41e-25)|Lung NSC(37;3.02e-05)|Ovarian(258;0.00163)		STAD - Stomach adenocarcinoma(47;0.0266)			ccGATACATCTTTTTTTTTTT	0.189													3	3	---	---	---	---	
EXT1	2131	broad.mit.edu	37	8	118874121	118874122	+	Intron	INS	-	A	A	rs141652464	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118874121_118874122insA	uc003yok.1	-							NM_000127	NP_000118	Q16394	EXT1_HUMAN	exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			ATCTTGCAGAGAGGTAATCCCT	0.361			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome		OREG0018938	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
EXT1	2131	broad.mit.edu	37	8	119032876	119032877	+	Intron	DEL	CT	-	-	rs149451387		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119032876_119032877delCT	uc003yok.1	-							NM_000127	NP_000118	Q16394	EXT1_HUMAN	exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			GCATTAAGCACTCTGAGGTTAT	0.327			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				3	3	---	---	---	---	
DSCC1	79075	broad.mit.edu	37	8	120857887	120857887	+	Intron	DEL	A	-	-	rs35736132		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120857887delA	uc003yov.2	-							NM_024094	NP_076999	Q9BVC3	DCC1_HUMAN	defective in sister chromatid cohesion 1						DNA replication|maintenance of mitotic sister chromatid cohesion|post-translational protein acetylation|regulation of DNA replication	chromatin|chromosome, centromeric region|nucleoplasm	DNA binding|protein binding			pancreas(1)	1	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ATTTGCCTTTAAAAAAAAAAA	0.219													4	2	---	---	---	---	
C8orf76	84933	broad.mit.edu	37	8	124252225	124252226	+	Intron	INS	-	A	A	rs57937159		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124252225_124252226insA	uc003yqc.1	-						C8orf76_uc003yqd.2_Intron	NM_032847	NP_116236	Q96K31	CH076_HUMAN	hypothetical protein LOC84933								binding			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			aactccacctcaaaaaaaaaaa	0.020													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	125786610	125786610	+	IGR	DEL	G	-	-	rs7015767	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125786610delG								MTSS1 (45880 upstream) : LOC157381 (165274 downstream)																							attagccactgtaaagatgaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	125791622	125791622	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125791622delT								MTSS1 (50892 upstream) : LOC157381 (160262 downstream)																							ccccttcttcttttttttttt	0.010													4	3	---	---	---	---	
NSMCE2	286053	broad.mit.edu	37	8	126332501	126332502	+	Intron	INS	-	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126332501_126332502insG	uc003yrw.2	+							NM_173685	NP_775956	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			gagggaaggaaggaaggaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	127067883	127067884	+	IGR	INS	-	G	G	rs149903847	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127067883_127067884insG								TRIB1 (617241 upstream) : FAM84B (496803 downstream)																							TGGGGGGATGAGGGGTATGTGC	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	128067521	128067521	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128067521delT								FAM84B (497055 upstream) : LOC727677 (234541 downstream)																							TGCGCATGCATTTGATCATAA	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	128314469	128314469	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128314469delT	uc003ysc.1	-						uc003ysd.1_Intron|LOC727677_uc003yse.1_Intron					Homo sapiens isolate DGPc1_8_exons1-2-3-4-6-8 unknown mRNA, alternatively spliced.																		CTCCATTCTCTTTACCATCTC	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	128789767	128789767	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128789767delT								MYC (36089 upstream) : PVT1 (17012 downstream)																							ccctggctaattttttgtatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	129283385	129283386	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129283385_129283386insA								MIR1208 (120951 upstream) : None (None downstream)																							ATTTAAAGTAGAAAAAAAAAAG	0.198													4	2	---	---	---	---	
FAM49B	51571	broad.mit.edu	37	8	130946133	130946134	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130946133_130946134insA	uc003yss.2	-						FAM49B_uc003yst.2_Intron|FAM49B_uc003ysu.2_Intron|FAM49B_uc003ysv.2_Intron|FAM49B_uc003ysw.2_Intron|FAM49B_uc003ysx.2_Intron|FAM49B_uc003ysy.1_Intron	NM_016623	NP_057707	Q9NUQ9	FA49B_HUMAN	hypothetical protein LOC51571												0	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			gtcacacacacaaaaaaaaaaa	0.129													4	2	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131355000	131355001	+	Intron	INS	-	ACG	ACG	rs3079892		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131355000_131355001insACG	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						AACTCTCAGAAACAAGTTAAAG	0.470													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	131556265	131556265	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131556265delA								ASAP1 (142049 upstream) : ADCY8 (236283 downstream)																							ggttgtttccaatatttagca	0.000													4	2	---	---	---	---	
ADCY8	114	broad.mit.edu	37	8	132050661	132050662	+	Intron	DEL	TC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132050661_132050662delTC	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			ACCCCCAAAGTCACTCTCCTGT	0.401										HNSCC(32;0.087)			1	5	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139704411	139704414	+	Intron	DEL	GTGT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139704411_139704414delGTGT	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			atgtgtggaggtgtgtgtgtatgt	0.000										HNSCC(7;0.00092)			5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143267243	143267244	+	IGR	INS	-	CAC	CAC			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143267243_143267244insCAC								MIR1302-7 (399569 upstream) : NCRNA00051 (12473 downstream)																							atcattaccatcaccatcacta	0.015													4	2	---	---	---	---	
BAI1	575	broad.mit.edu	37	8	143583340	143583342	+	Intron	DEL	GGT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143583340_143583342delGGT	uc003ywm.2	+							NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1						axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					atggaggtagggtggtggtggtg	0.054													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	27745828	27745828	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27745828delA								C9orf72 (171986 upstream) : LINGO2 (202700 downstream)																							CAGCATTTGTAAGGACTGTTG	0.299													4	2	---	---	---	---	
CD72	971	broad.mit.edu	37	9	35614419	35614419	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35614419delA	uc003zxb.2	-						CD72_uc003zxc.1_Intron|CD72_uc010mkt.1_Intron|CD72_uc010mku.2_Intron	NM_001782	NP_001773	P21854	CD72_HUMAN	CD72 molecule						axon guidance|cell adhesion	integral to plasma membrane	receptor binding|sugar binding|transmembrane receptor activity				0			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			gaggatggGCAAAAATCCATA	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44207259	44207259	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44207259delG								FAM75A6 (576529 upstream) : FAM27C (782977 downstream)																							cacattttcaggtatctttat	0.005													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44742110	44742111	+	IGR	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44742110_44742111delTG								None (None upstream) : FAM27C (248125 downstream)																							gtgtggattatgtgtgtgtatg	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68410007	68410009	+	RNA	DEL	CCT	-	-	rs111979970		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68410007_68410009delCCT	uc004aew.1	+	1		c.10_12delCCT								Homo sapiens cDNA, FLJ98602.																		tctctctctccctctggttctat	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68491533	68491534	+	IGR	DEL	TC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68491533_68491534delTC								FAM27B (697344 upstream) : MIR1299 (510705 downstream)																							TATTCCtctttctctctttctt	0.089													5	3	---	---	---	---	
TMC1	117531	broad.mit.edu	37	9	75263327	75263328	+	Intron	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75263327_75263328insT	uc004aiz.1	+						TMC1_uc010moz.1_Intron|TMC1_uc004aja.1_Intron|TMC1_uc004ajb.1_Intron|TMC1_uc004ajc.1_Intron|TMC1_uc010mpa.1_Intron	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1						AATTCAACCCCTTTGACCTGAG	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	78808345	78808345	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78808345delA								PCSK5 (7 upstream) : RFK (192088 downstream)																							agccaaaaagaaaaaaaaaaa	0.229													5	3	---	---	---	---	
SHC3	53358	broad.mit.edu	37	9	91757989	91757989	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91757989delA	uc004aqg.2	-							NM_016848	NP_058544	Q92529	SHC3_HUMAN	src homology 2 domain-containing transforming						central nervous system development|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	protein binding|signal transducer activity			lung(3)|skin(1)	4						ggcaaaagtgaaagcaagttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93663455	93663457	+	IGR	DEL	CAA	-	-	rs142719024		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93663455_93663457delCAA								SYK (2622 upstream) : AUH (312642 downstream)																							TCATTTGGTCCAACCCTGAAATC	0.443													0	9	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94397331	94397333	+	Intron	DEL	GAA	-	-	rs140128560	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94397331_94397333delGAA	uc004ari.1	-							NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						ggagggggaggaagaagaggagg	0.000													5	3	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94616290	94616291	+	Intron	INS	-	G	G	rs139874392	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94616290_94616291insG	uc004arj.1	-						ROR2_uc004ari.1_Intron|ROR2_uc004ark.2_Intron	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						cagggggccctgaagtggagta	0.064													4	4	---	---	---	---	
FAM120A	23196	broad.mit.edu	37	9	96322576	96322576	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96322576delA	uc004atw.2	+						FAM120A_uc004aty.2_Intron|FAM120A_uc004atz.2_Intron|FAM120A_uc010mrg.2_Intron|FAM120A_uc004aua.1_5'Flank	NM_014612	NP_055427	Q9NZB2	F120A_HUMAN	oxidative stress-associated Src activator							cytoplasm|plasma membrane	RNA binding				0						accctgtcttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	97317410	97317411	+	RNA	INS	-	T	T	rs145410254	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97317410_97317411insT	uc004aus.1	+	1		c.60_61insT			uc004aut.1_5'Flank|uc004auu.2_5'Flank					Homo sapiens cDNA FLJ41071 fis, clone 3NB692003538.																		ttttgttgttgttttttttgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	98815151	98815151	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98815151delT								NCRNA00092 (31114 upstream) : HSD17B3 (182438 downstream)																							AGAGGAATCATTTTTCCTGGC	0.483													4	2	---	---	---	---	
HABP4	22927	broad.mit.edu	37	9	99246224	99246224	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99246224delA	uc010msg.2	+						HABP4_uc010msh.2_Intron	NM_014282	NP_055097	Q5JVS0	HABP4_HUMAN	hyaluronan binding protein 4						platelet activation|platelet degranulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|extracellular region|nucleus	protein binding			ovary(1)	1		Acute lymphoblastic leukemia(62;0.0169)|all_hematologic(171;0.214)				ccacggttggaaaaaaaaaat	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	103430009	103430010	+	IGR	INS	-	G	G	rs111395101		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103430009_103430010insG								MURC (79838 upstream) : LPPR1 (361021 downstream)																							gtcttctctctctgagagctga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	105025042	105025043	+	IGR	INS	-	A	A	rs145514698	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105025042_105025043insA								GRIN3A (524180 upstream) : CYLC2 (732550 downstream)																							CAAAAACAACCAAAAAAGTTTT	0.371													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	105361972	105361972	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105361972delT								GRIN3A (861110 upstream) : CYLC2 (395621 downstream)																							cacaccatggttttcagcttc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	111340362	111340362	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111340362delG								None (None upstream) : ACTL7B (276509 downstream)																							gaaatatcaaggttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	111571240	111571241	+	IGR	INS	-	AT	AT	rs140909889	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111571240_111571241insAT								None (None upstream) : ACTL7B (45630 downstream)																							TCCAGGAAATGATacacacaca	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	114711945	114711945	+	IGR	DEL	G	-	-	rs11325493		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114711945delG								UGCG (16514 upstream) : SUSD1 (91117 downstream)																							aattttttttgttttgagagg	0.000													6	4	---	---	---	---	
SUSD1	64420	broad.mit.edu	37	9	114936326	114936335	+	Intron	DEL	GGCTTCCAGT	-	-	rs72157169		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114936326_114936335delGGCTTCCAGT	uc004bfu.2	-						SUSD1_uc010mui.2_Intron|SUSD1_uc010muj.2_Intron	NM_022486	NP_071931	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1 precursor							integral to membrane	calcium ion binding				0						TCCCTGAGACGGCTTCCAGTGGCTTCCAGG	0.581													4	2	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119199424	119199425	+	Intron	INS	-	AT	AT			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119199424_119199425insAT	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron|ASTN2_uc004bjp.1_Intron|ASTN2_uc004bjq.1_Intron|ASTN2_uc011lxr.1_Intron|ASTN2_uc011lxs.1_Intron|ASTN2_uc011lxt.1_Intron|ASTN2_uc004bjo.1_Intron	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						cagcatggcacatgtaactaac	0.020													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	125216796	125216796	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125216796delA								PTGS1 (58815 upstream) : OR1J2 (14044 downstream)																							gactcgatctaaaaaaaaaaa	0.184											OREG0019465	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
MAPKAP1	79109	broad.mit.edu	37	9	128328841	128328846	+	Intron	DEL	GAAAAA	-	-	rs72228008		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128328841_128328846delGAAAAA	uc004bpv.2	-						MAPKAP1_uc011lzt.1_Intron|MAPKAP1_uc010mwz.2_Intron|MAPKAP1_uc011lzu.1_Intron|MAPKAP1_uc011lzv.1_Intron|MAPKAP1_uc004bpw.2_Intron|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Intron|MAPKAP1_uc004bpz.2_Intron|MAPKAP1_uc010mxa.2_Intron|MAPKAP1_uc010mxb.1_Intron|MAPKAP1_uc004bqa.2_Intron|MAPKAP1_uc010mxc.1_Intron	NM_001006617	NP_001006618	Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4						acactgtcttgaaaaagaaaaagaaa	0.126													3	3	---	---	---	---	
PKN3	29941	broad.mit.edu	37	9	131478876	131478876	+	Intron	DEL	C	-	-	rs10819432	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131478876delC	uc004bvw.2	+						PKN3_uc010myh.2_Intron|PKN3_uc011mbk.1_Intron	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN	protein kinase PKNbeta						signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity			stomach(2)|lung(2)	4						gactgtgtctcaaaaaaaaaa	0.229													4	2	---	---	---	---	
NUP188	23511	broad.mit.edu	37	9	131725788	131725789	+	Intron	INS	-	G	G	rs141139693	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131725788_131725789insG	uc004bws.1	+							NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						cagccgtaaatgaaatttttat	0.000													3	4	---	---	---	---	
FNBP1	23048	broad.mit.edu	37	9	132685991	132685991	+	Intron	DEL	T	-	-	rs113732030		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132685991delT	uc004byw.1	-						FNBP1_uc011mbv.1_Intron|FNBP1_uc011mbw.1_Intron|FNBP1_uc004bza.2_Intron|FNBP1_uc004byz.1_Intron|FNBP1_uc004byx.1_Intron|FNBP1_uc004byy.1_Intron	NM_015033	NP_055848	Q96RU3	FNBP1_HUMAN	formin binding protein 1						endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|lysosome|plasma membrane	identical protein binding|lipid binding				0		Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		ATGGTTTTTGTTTTTTTTTTT	0.348			T	MLL	AML								4	2	---	---	---	---	
OBP2A	29991	broad.mit.edu	37	9	138441685	138441686	+	3'UTR	INS	-	C	C	rs138689162	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138441685_138441686insC	uc004cgb.2	+	7					OBP2A_uc004cgc.2_Frame_Shift_Ins_p.Q194fs|OBP2A_uc010nau.2_RNA|OBP2A_uc010nav.2_3'UTR	NM_014582	NP_055397	Q9NY56	OBP2A_HUMAN	odorant binding protein 2A precursor						response to stimulus|sensory perception of smell	extracellular region	odorant binding|transporter activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		CAGCACAGCAGCCCCCGGGTCT	0.678													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138859652	138859655	+	IGR	DEL	GTGC	-	-	rs140964141	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138859652_138859655delGTGC								UBAC1 (6426 upstream) : NACC2 (43550 downstream)																							gtgtgtgtgtgtgcgcgcgcgcgc	0.250											OREG0019612	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	139502772	139502775	+	IGR	DEL	GGAG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139502772_139502775delGGAG								NOTCH1 (62534 upstream) : EGFL7 (50533 downstream)																							gagggaggtaggagggagggaggg	0.000													4	2	---	---	---	---	
ABCA2	20	broad.mit.edu	37	9	139915569	139915569	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139915569delA	uc011mem.1	-						ABCA2_uc011mel.1_Intron|ABCA2_uc004ckl.1_Intron|ABCA2_uc004ckm.1_Intron|ABCA2_uc004ckn.1_5'Flank|ABCA2_uc004cko.1_Intron|ABCA2_uc010nca.2_Intron	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2						cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CAGGTGGGTGATAGGTCAGGA	0.662													4	2	---	---	---	---	
ENTPD2	954	broad.mit.edu	37	9	139949242	139949243	+	5'Flank	INS	-	AG	AG	rs138538555	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139949242_139949243insAG	uc004ckw.1	-						ENTPD2_uc004ckx.1_5'Flank	NM_203468	NP_982293	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2							integral to membrane	ATP binding				0	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		AGCCGAGAAACAGGAGAAGCAG	0.668													3	3	---	---	---	---	
ENTPD2	954	broad.mit.edu	37	9	139951286	139951286	+	5'Flank	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139951286delA	uc004ckw.1	-						ENTPD2_uc004ckx.1_5'Flank	NM_203468	NP_982293	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2							integral to membrane	ATP binding				0	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		atctcaaaagaaaaaaaaaaa	0.194													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	2811014	2811015	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2811014_2811015insA								None (None upstream) : PFKP (298737 downstream)																							cacatgtaaccaaaaaagagcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3918180	3918188	+	IGR	DEL	TCCTCCAGC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3918180_3918188delTCCTCCAGC								KLF6 (90707 upstream) : LOC100216001 (703256 downstream)																							GTCATGGAGAtcctccagctcctccagct	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3984341	3984342	+	IGR	DEL	AG	-	-	rs71392420		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3984341_3984342delAG								KLF6 (156868 upstream) : LOC100216001 (637102 downstream)																							aaagaaagaaagaaagaaagaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	5320969	5320969	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5320969delA								AKR1C4 (60059 upstream) : UCN3 (86007 downstream)																							ggagagaagtaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ASB13	79754	broad.mit.edu	37	10	5705404	5705404	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5705404delG	uc001iig.2	-						ASB13_uc001iii.2_Intron|ASB13_uc001iih.2_Intron|ASB13_uc009xic.2_Intron	NM_024701	NP_078977	Q8WXK3	ASB13_HUMAN	ankyrin repeat and SOCS box-containing protein						intracellular signal transduction		protein binding			ovary(1)	1				GBM - Glioblastoma multiforme(2;9.59e-09)		CCTTGCCCCTGGTCCACCCCA	0.468													4	2	---	---	---	---	
PRKCQ	5588	broad.mit.edu	37	10	6546009	6546010	+	Intron	INS	-	ATTATAGGC	ATTATAGGC			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6546009_6546010insATTATAGGC	uc001ijj.1	-						PRKCQ_uc009xim.1_Intron|PRKCQ_uc001iji.1_Intron|PRKCQ_uc009xin.1_Intron|PRKCQ_uc010qax.1_Intron	NM_006257	NP_006248	Q04759	KPCT_HUMAN	protein kinase C, theta						axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity			ovary(3)|lung(2)|large_intestine(1)	6						aaagtgctgggattataggcat	0.084													4	2	---	---	---	---	
PRKCQ	5588	broad.mit.edu	37	10	6587977	6587977	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6587977delA	uc001ijj.1	-						PRKCQ_uc009xin.1_Intron|PRKCQ_uc010qax.1_Intron	NM_006257	NP_006248	Q04759	KPCT_HUMAN	protein kinase C, theta						axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity			ovary(3)|lung(2)|large_intestine(1)	6						ggaaaacgagaaaaaaaaaag	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8074138	8074138	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8074138delA								TAF3 (17425 upstream) : FLJ45983 (18275 downstream)																							GTCACTCATTAAAAAAAAAAA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8723728	8723730	+	IGR	DEL	CTC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8723728_8723730delCTC								GATA3 (606566 upstream) : None (None downstream)																							cctcctccttctcctcctcctcc	0.005													4	2	---	---	---	---	
CELF2	10659	broad.mit.edu	37	10	11341336	11341336	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11341336delC	uc001iki.3	+						CELF2_uc010qbi.1_Intron|CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron|CELF2_uc010qbl.1_Intron|CELF2_uc010qbm.1_Intron|CELF2_uc001iko.3_Intron|CELF2_uc001ikp.3_Intron|CELF2_uc010qbn.1_Intron|CELF2_uc010qbo.1_Intron|CELF2_uc010qbp.1_Intron	NM_001025077	NP_001020248	O95319	CELF2_HUMAN	CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0						TGACCTCTTGCCCCCTGCTAC	0.647													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	11752981	11752981	+	IGR	DEL	T	-	-	rs76771425		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11752981delT								USP6NL (99302 upstream) : ECHDC3 (31375 downstream)																							aaagtttcagttttgcaactt	0.015													2	4	---	---	---	---	
MCM10	55388	broad.mit.edu	37	10	13233564	13233567	+	Intron	DEL	AAGC	-	-	rs112703555		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13233564_13233567delAAGC	uc001ima.2	+						MCM10_uc001imb.2_Intron|MCM10_uc001imc.2_Intron	NM_182751	NP_877428	Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						ATAAATAAATaagcaagcaagcaa	0.137													5	5	---	---	---	---	
FRMD4A	55691	broad.mit.edu	37	10	14266768	14266768	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14266768delA	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imv.2_Intron	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						TGTTAAGAGGAGAGAATTGAC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	16468788	16468788	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16468788delA								FAM188A (566269 upstream) : PTER (10179 downstream)																							TGAGATTCCTAAATCATTGCA	0.323													4	2	---	---	---	---	
RSU1	6251	broad.mit.edu	37	10	16711365	16711365	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16711365delT	uc001iok.2	-						RSU1_uc001iol.2_Intron|RSU1_uc001iom.2_Intron	NM_152724	NP_689937	Q15404	RSU1_HUMAN	ras suppressor protein 1 isoform 2						cell junction assembly|signal transduction	cytosol	protein binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(1;7.54e-08)		ACATTTTCTGTTTTTTTTCCC	0.239													4	2	---	---	---	---	
PLXDC2	84898	broad.mit.edu	37	10	20171230	20171231	+	Intron	DEL	AG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20171230_20171231delAG	uc001iqg.1	+						PLXDC2_uc001iqh.1_Intron	NM_032812	NP_116201	Q6UX71	PXDC2_HUMAN	plexin domain containing 2 precursor							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4						CCATTATTCTAGAGCAGCAACG	0.371													4	2	---	---	---	---	
SVIL	6840	broad.mit.edu	37	10	29855983	29855983	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29855983delT	uc001iut.1	-						SVIL_uc001iuu.1_Intron|SVIL_uc009xld.1_Intron	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				ACCTTTTGGATTTTTTTCCAA	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	33736574	33736575	+	IGR	DEL	GT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33736574_33736575delGT								NRP1 (112568 upstream) : PARD3 (663523 downstream)																							GTGAATAGGGGTGTGTGTGTGT	0.243													4	2	---	---	---	---	
CCNY	219771	broad.mit.edu	37	10	35788744	35788744	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35788744delT	uc001iyw.3	+						CCNY_uc001iyu.3_Intron|CCNY_uc001iyv.3_Intron|CCNY_uc001iyx.3_Intron|CCNY_uc009xmb.2_Intron|CCNY_uc010qet.1_Intron	NM_145012	NP_659449	Q8ND76	CCNY_HUMAN	cyclin Y isoform 1						cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding				0						GTAGAAAGGGTTTCCGGGTCC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42473333	42473333	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42473333delG								None (None upstream) : LOC441666 (353982 downstream)																							tttcactattggcctcaatga	0.000													4	2	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47035929	47035930	+	Intron	INS	-	CA	CA	rs143198470		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47035929_47035930insCA	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						ccataaatatccacacacacac	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	51001826	51001826	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51001826delA								OGDHL (31401 upstream) : PARG (24501 downstream)																							ccacccccccaaaaaaaagca	0.000													4	2	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	62308899	62308900	+	Intron	DEL	AC	-	-	rs140456480		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62308899_62308900delAC	uc010qih.1	-						ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron	NM_001149	NP_001140	Q12955	ANK3_HUMAN	ankyrin 3 isoform 2						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						CATGTTTcatacacacacacac	0.307													3	3	---	---	---	---	
DNAJC12	56521	broad.mit.edu	37	10	69579536	69579537	+	Intron	DEL	GG	-	-	rs112235499	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69579536_69579537delGG	uc001jnb.2	-						DNAJC12_uc001jnc.2_Intron	NM_021800	NP_068572	Q9UKB3	DJC12_HUMAN	J domain containing protein 1 isoform a						protein folding		heat shock protein binding|unfolded protein binding			breast(1)	1						aaggaaggaaggggaaggaagg	0.015													4	3	---	---	---	---	
HERC4	26091	broad.mit.edu	37	10	69700520	69700520	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69700520delA	uc001jng.3	-						HERC4_uc009xpq.2_Intron|HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron	NM_022079	NP_071362	Q5GLZ8	HERC4_HUMAN	hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3						CTTTCAATAGAAAATTTTGAT	0.154													4	2	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73331231	73331231	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73331231delG	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc009xql.2_Intron	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						tgatttttctggtgtgttgca	0.189													4	2	---	---	---	---	
DLG5	9231	broad.mit.edu	37	10	79683632	79683632	+	Intron	DEL	T	-	-	rs79068166		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79683632delT	uc001jzk.2	-						LOC100128292_uc010qln.1_5'Flank	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5						cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			tttttctttctttttttttga	0.244													1	6	---	---	---	---	
ANXA11	311	broad.mit.edu	37	10	81958507	81958508	+	Intron	DEL	GA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81958507_81958508delGA	uc001kbq.1	-						ANXA11_uc001kbr.1_Intron|ANXA11_uc001kbs.1_Intron|ANXA11_uc001kbt.1_Intron|ANXA11_uc010qly.1_Intron|ANXA11_uc009xsq.1_Intron|ANXA11_uc001kbu.1_Intron	NM_145869	NP_665876	P50995	ANX11_HUMAN	annexin A11						cell cycle|cytokinesis, completion of separation|phagocytosis|response to calcium ion	azurophil granule|melanosome|midbody|nuclear envelope|nucleoplasm|phagocytic vesicle|specific granule|spindle	calcium-dependent phospholipid binding|calcium-dependent protein binding|S100 alpha binding			ovary(1)	1	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			gagagtgagtgagagagagaga	0.376													3	3	---	---	---	---	
SH2D4B	387694	broad.mit.edu	37	10	82337186	82337187	+	Intron	INS	-	T	T	rs71482785		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82337186_82337187insT	uc001kck.1	+						SH2D4B_uc001kcl.1_Intron	NM_207372	NP_997255	Q5SQS7	SH24B_HUMAN	SH2 domain containing 4B isoform 1												0			Colorectal(32;0.229)			tgaattttctgttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	83188552	83188552	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83188552delA								SH2D4B (782236 upstream) : NRG3 (446518 downstream)																							AAATTATGCCAAATGGTACAC	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	94838830	94838831	+	IGR	INS	-	TT	TT			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94838830_94838831insTT								CYP26A1 (1189 upstream) : MYOF (227356 downstream)																							TTTAAAACAGCttttttttttt	0.035													4	2	---	---	---	---	
TCTN3	26123	broad.mit.edu	37	10	97424226	97424226	+	Intron	DEL	A	-	-	rs71954790		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97424226delA	uc001klb.3	-						TCTN3_uc001kla.3_Intron|TCTN3_uc010qoi.1_Intron	NM_015631	NP_056446	Q6NUS6	TECT3_HUMAN	tectonic 3 isoform a precursor						apoptosis	integral to membrane					0		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)		AGACACAAGGAAATGAATATC	0.383													1	5	---	---	---	---	
ZNF518A	9849	broad.mit.edu	37	10	97894669	97894669	+	Intron	DEL	G	-	-	rs34164085		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97894669delG	uc001klp.2	+						ZNF518A_uc001klo.1_Intron|ZNF518A_uc001klq.2_Intron|ZNF518A_uc001klr.2_Intron	NM_014803	NP_055618	Q6AHZ1	Z518A_HUMAN	zinc finger protein 518						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		GTTGAAGGTTGTGGCTGGTAA	0.264													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	114625710	114625710	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114625710delG								LOC143188 (10583 upstream) : TCF7L2 (84299 downstream)																							ccagaactttgggaggccaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	119448810	119448810	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119448810delA								EMX2 (139754 upstream) : RAB11FIP2 (315619 downstream)																							TTGCTGGGTGAAGGGAGAGGA	0.537													4	2	---	---	---	---	
NSMCE4A	54780	broad.mit.edu	37	10	123731852	123731853	+	Intron	DEL	CT	-	-	rs74374320		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123731852_123731853delCT	uc001lfs.2	-						NSMCE4A_uc009xzv.2_Intron|NSMCE4A_uc001lft.2_Intron|NSMCE4A_uc010qtu.1_Intron|NSMCE4A_uc001lfu.1_Intron	NM_017615	NP_060085	Q9NXX6	NSE4A_HUMAN	non-SMC element 4 homolog A												0		all_neural(114;0.138)|Glioma(114;0.222)				ATTTTTCATACTCTCTGTTGCC	0.322													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125013914	125013916	+	IGR	DEL	ATC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125013914_125013916delATC								BUB3 (89028 upstream) : GPR26 (411955 downstream)																							catcatcactatcatcatcacac	0.094													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125014795	125014797	+	IGR	DEL	CAT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125014795_125014797delCAT								BUB3 (89909 upstream) : GPR26 (411074 downstream)																							acaccaccaccatcatcacacca	0.000													3	3	---	---	---	---	
LHPP	64077	broad.mit.edu	37	10	126294402	126294403	+	Intron	INS	-	G	G	rs141845838	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126294402_126294403insG	uc001lhs.1	+						LHPP_uc001lht.1_Intron|LHPP_uc009yai.1_Intron|LHPP_uc009yaj.1_Intron	NM_022126	NP_071409	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic						protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		GGCAGGAGGGAGAGCCAGTgga	0.530													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	127241153	127241153	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127241153delG								CTBP2 (391529 upstream) : LOC100169752 (21787 downstream)																							CAGGAACAATGGGTGCCCTGA	0.567													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134199045	134199045	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134199045delG								LRRC27 (4035 upstream) : PWWP2B (11657 downstream)																							CAGTATTTGTGGACTTTTTTC	0.468													4	2	---	---	---	---	
RNH1	6050	broad.mit.edu	37	11	497571	497572	+	Intron	INS	-	CT	CT	rs144693450		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:497571_497572insCT	uc001lpk.1	-						RNH1_uc001lpl.1_Intron|RNH1_uc001lpm.1_Intron|RNH1_uc001lpn.1_Intron|RNH1_uc001lpo.1_Intron|RNH1_uc009ybw.1_Intron|RNH1_uc001lpp.1_Intron|RNH1_uc001lpt.1_Intron|RNH1_uc001lpq.1_Intron|RNH1_uc001lpr.1_Intron|RNH1_uc001lps.1_Intron	NM_203389	NP_976323	P13489	RINI_HUMAN	ribonuclease/angiogenin inhibitor						mRNA catabolic process|regulation of angiogenesis	angiogenin-PRI complex|cytoplasm	protein binding|ribonuclease inhibitor activity				0		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.26e-26)|Epithelial(43;1.34e-25)|OV - Ovarian serous cystadenocarcinoma(40;5.31e-20)|BRCA - Breast invasive adenocarcinoma(625;8.01e-05)|Lung(200;0.0378)|LUSC - Lung squamous cell carcinoma(625;0.0703)		acacacggacacgtgctcattc	0.089													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	1803495	1803523	+	IGR	DEL	GCCCTGGACACAGCCCTAGTGGACAGAGG	-	-	rs12283924		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1803495_1803523delGCCCTGGACACAGCCCTAGTGGACAGAGG								CTSD (18273 upstream) : SYT8 (45186 downstream)																							CCTCCCCTGTGCCCTGGACACAGCCCTAGTGGACAGAGGGCTCTGGTCC	0.638													3	3	---	---	---	---	
KCNQ1	3784	broad.mit.edu	37	11	2496329	2496329	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2496329delT	uc001lwn.2	+						KCNQ1_uc009ydo.1_Intron|KCNQ1_uc009ydp.1_Intron|KCNQ1_uc001lwo.2_Intron	NM_000218	NP_000209	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like						blood circulation|membrane depolarization|muscle contraction|sensory perception of sound		delayed rectifier potassium channel activity|protein binding			ovary(1)	1		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	ttctaattcctgaacatttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	4553042	4553043	+	IGR	DEL	TG	-	-	rs71050412		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4553042_4553043delTG								OR52K1 (41967 upstream) : OR52M1 (13378 downstream)																							gctgctagtctgagattcaact	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	7093269	7093270	+	IGR	DEL	AT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7093269_7093270delAT								NLRP14 (512 upstream) : RBMXL2 (16895 downstream)																							GACACAATAAATTTTGTGTGTG	0.218													2	7	---	---	---	---	
ST5	6764	broad.mit.edu	37	11	8901892	8901893	+	Intron	INS	-	TGTG	TGTG	rs142150617	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8901892_8901893insTGTG	uc001mgv.2	-							NM_005418	NP_005409	P78524	ST5_HUMAN	suppression of tumorigenicity 5 isoform 1						positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		TCACTTTGAACtgtgtgtgtgt	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	9135546	9135547	+	IGR	DEL	AA	-	-	rs11341946		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9135546_9135547delAA								FLJ46111 (17809 upstream) : DENND5A (24830 downstream)																							accctgtctcaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SWAP70	23075	broad.mit.edu	37	11	9697262	9697271	+	Intron	DEL	TTCTCCTTCC	-	-	rs68115351		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9697262_9697271delTTCTCCTTCC	uc001mhw.2	+						SWAP70_uc001mhv.2_Intron|SWAP70_uc001mhx.2_Intron	NM_015055	NP_055870	Q9UH65	SWP70_HUMAN	SWAP-70 protein							cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding			ovary(2)|central_nervous_system(1)	3				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		TTGATTTTTTTTCTCCTTCCTTCTCCTGCA	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	14917127	14917128	+	IGR	INS	-	CA	CA	rs147468430	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14917127_14917128insCA								CYP2R1 (3376 upstream) : CALCA (71088 downstream)																							CTGAATTCGTGCACTTGGATTT	0.396													4	3	---	---	---	---	
NELL1	4745	broad.mit.edu	37	11	21309581	21309591	+	Intron	DEL	AAAGAAAAAAT	-	-	rs113864854	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21309581_21309591delAAAGAAAAAAT	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron|NELL1_uc001mqg.2_Intron|NELL1_uc001mqh.2_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						ggaaggaaagaaagaaaaaataagggaagga	0.043													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	22484588	22484589	+	IGR	INS	-	ACAA	ACAA	rs147906440		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22484588_22484589insACAA								SLC17A6 (83544 upstream) : FANCF (159490 downstream)																							cacacacacacacacaaacaca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	22665527	22665527	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22665527delA								FANCF (18140 upstream) : GAS2 (22633 downstream)																							TGGATGGCTGAAGTTTCCAGA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	34552609	34552609	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34552609delC								ELF5 (17279 upstream) : EHF (90059 downstream)																							TTCAGACCTGCCCCACCCTAT	0.443													4	2	---	---	---	---	
SLC1A2	6506	broad.mit.edu	37	11	35365388	35365389	+	Intron	DEL	CA	-	-	rs3858469	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35365388_35365389delCA	uc001mwd.2	-						SLC1A2_uc001mwe.2_Intron|SLC1A2_uc010rev.1_Intron	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2						D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	cacacacaggcacacacacaca	0.203													4	2	---	---	---	---	
LDLRAD3	143458	broad.mit.edu	37	11	36221116	36221117	+	Intron	INS	-	AC	AC	rs148811856	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36221116_36221117insAC	uc001mwk.1	+						LDLRAD3_uc010rey.1_Intron|LDLRAD3_uc010rez.1_Intron|LDLRAD3_uc010rfa.1_Intron	NM_174902	NP_777562	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain							integral to membrane	receptor activity			central_nervous_system(1)	1	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				GCTGTGGTTCTacacacacaca	0.426													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	36489476	36489477	+	IGR	INS	-	CAA	CAA	rs148794164	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36489476_36489477insCAA								PRR5L (2723 upstream) : TRAF6 (21246 downstream)																							AGCCCTTCTTCCAACTCCTTGC	0.550													2	5	---	---	---	---	
HSD17B12	51144	broad.mit.edu	37	11	43733321	43733321	+	Intron	DEL	G	-	-	rs113941860	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43733321delG	uc001mxq.3	+						HSD17B12_uc001mxp.2_Intron	NM_016142	NP_057226	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12						long-chain fatty-acyl-CoA biosynthetic process|steroid biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	estradiol 17-beta-dehydrogenase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity				0						caccacacccggccTACAGTG	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48619984	48619984	+	IGR	DEL	T	-	-	rs144255253	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48619984delT								OR4A47 (108712 upstream) : FOLH1 (548204 downstream)																							ggttttccagtttgtgggcat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	50722539	50722539	+	IGR	DEL	A	-	-	rs112602920	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50722539delA								LOC646813 (342736 upstream) : OR4A5 (688909 downstream)																							gcttctgtgtagtttttatgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	59249299	59249299	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59249299delA								OR4D10 (3461 upstream) : OR4D11 (21750 downstream)																							agtgaggagtaaaaggctaca	0.010													4	2	---	---	---	---	
TCN1	6947	broad.mit.edu	37	11	59631836	59631836	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59631836delT	uc001noj.2	-							NM_001062	NP_001053	P20061	TCO1_HUMAN	transcobalamin I precursor						cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding			ovary(2)	2		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTGGGAAATCTAGCATCATTC	0.144													4	2	---	---	---	---	
PACS1	55690	broad.mit.edu	37	11	65903733	65903734	+	Intron	INS	-	AC	AC	rs143893859	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65903733_65903734insAC	uc001oha.1	+						PACS1_uc001ogz.1_Intron	NM_018026	NP_060496	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1						interspecies interaction between organisms|regulation of defense response to virus by virus|viral reproduction	cytosol	protein binding			ovary(6)	6						CAATCCCGCTAacacacacaca	0.356													4	3	---	---	---	---	
CCS	9973	broad.mit.edu	37	11	66365554	66365555	+	Intron	INS	-	A	A	rs111850375		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66365554_66365555insA	uc001oir.2	+						CCS_uc001ois.2_5'Flank	NM_005125	NP_005116	O14618	CCS_HUMAN	copper chaperone for superoxide dismutase						intracellular copper ion transport|oxidation-reduction process|removal of superoxide radicals	cytosol|mitochondrial inner membrane|nucleus|soluble fraction	copper ion transmembrane transporter activity|protein binding|superoxide dismutase copper chaperone activity|zinc ion binding				0						gactctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
RBM4	5936	broad.mit.edu	37	11	66423500	66423500	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66423500delG	uc010rpj.1	+							NM_002896	NP_002887	Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4						circadian regulation of gene expression|entrainment of circadian clock by photoperiod|mRNA processing|negative regulation of translation in response to stress|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|positive regulation of muscle cell differentiation|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of nucleocytoplasmic transport|RNA splicing|stress-activated MAPK cascade	nuclear speck|nucleolus|stress granule	miRNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|zinc ion binding			ovary(1)	1				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		ggagtgcaatggtgcaatctc	0.114													4	2	---	---	---	---	
ALDH3B2	222	broad.mit.edu	37	11	67436100	67436101	+	Intron	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67436100_67436101delTG	uc001omr.2	-						ALDH3B2_uc001oms.2_Intron|ALDH3B2_uc009ysa.1_Intron	NM_000695	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3B2						alcohol metabolic process|cellular aldehyde metabolic process|lipid metabolic process		3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase			lung(1)|kidney(1)	2					NADH(DB00157)	tgtgtgtctatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
RNF121	55298	broad.mit.edu	37	11	71655378	71655379	+	Intron	INS	-	A	A	rs74853873		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71655378_71655379insA	uc001ora.2	+						RNF121_uc001ord.2_Intron|RNF121_uc001orb.2_Intron|RNF121_uc009yst.2_Intron	NM_018320	NP_060790	Q9H920	RN121_HUMAN	ring finger protein 121							integral to membrane	zinc ion binding				0						gactctgtctcaaaaaaaaaga	0.104													4	2	---	---	---	---	
FCHSD2	9873	broad.mit.edu	37	11	72577411	72577411	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72577411delT	uc009ytl.2	-						FCHSD2_uc010rrg.1_Intron|FCHSD2_uc001oth.3_Intron|FCHSD2_uc001oti.2_Intron	NM_014824	NP_055639	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2								protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			gcctcccgggttcaagcgatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	75094853	75094853	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75094853delT								ARRB1 (31980 upstream) : RPS3 (15709 downstream)																							tgttccattctttttttttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	77250148	77250149	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77250148_77250149insA								PAK1 (65040 upstream) : AQP11 (50287 downstream)																							gactccatctcaaaaaaaaaaa	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	112535501	112535502	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112535501_112535502insA								PTS (394824 upstream) : NCAM1 (296493 downstream)																							AAGAGAAACTGAAAAAAAAAGG	0.421													4	2	---	---	---	---	
TMEM136	219902	broad.mit.edu	37	11	120199487	120199488	+	Intron	DEL	GC	-	-	rs11217819	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120199487_120199488delGC	uc001pxh.1	+						TMEM136_uc001pxg.2_Intron|TMEM136_uc010rzm.1_Intron|TMEM136_uc001pxj.2_Intron|TMEM136_uc009zas.1_Intron|TMEM136_uc001pxi.1_Intron	NM_174926	NP_777586	Q6ZRR5	TM136_HUMAN	transmembrane protein 136							integral to membrane				ovary(1)	1		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)		gtgtgtgtgtgcgcgtgtatgt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	125983267	125983284	+	IGR	DEL	TTCACACAGAAAAGTGAC	-	-	rs56226244		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125983267_125983284delTTCACACAGAAAAGTGAC								CDON (50080 upstream) : RPUSD4 (88706 downstream)																							TGGCCTGGTATTCACACAGAAAAGTGACTCCCACACCT	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	133705910	133705910	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133705910delT								OPCML (303507 upstream) : SPATA19 (4607 downstream)																							CACTTCCTGCTTTAACATTCC	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	4586314	4586315	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4586314_4586315insT								FGF6 (31534 upstream) : C12orf4 (10596 downstream)																							AGAGTTGTGCCTTTGACATTTT	0.495													4	2	---	---	---	---	
KCNA6	3742	broad.mit.edu	37	12	4920968	4920968	+	3'UTR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4920968delC	uc001qng.2	+	1						NM_002235	NP_002226	P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related							voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(2)|ovary(1)	3						GTTGCTTAATCCCTGCAGCAT	0.448										HNSCC(72;0.22)			5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5537832	5537833	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5537832_5537833insA								KCNA5 (381884 upstream) : NTF3 (3447 downstream)																							CGATCATGGGGAAAAAAAACAA	0.426											OREG0021608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
VWF	7450	broad.mit.edu	37	12	6188777	6188777	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6188777delA	uc001qnn.1	-						VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	ctctgtctcgaaaaaaaaaaa	0.219													4	2	---	---	---	---	
GPR162	27239	broad.mit.edu	37	12	6931000	6931001	+	5'UTR	INS	-	G	G	rs145198948	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6931000_6931001insG	uc001qqw.1	+	1					GPR162_uc010sfn.1_5'UTR|GPR162_uc001qqx.1_5'UTR|GPR162_uc009zfd.1_5'UTR|GPR162_uc001qqy.1_5'Flank	NM_019858	NP_062832	Q16538	GP162_HUMAN	G protein-coupled receptor 162 isoform 2							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CGGCAGGCAGCGGGAGCCCGAG	0.535													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	8971346	8971347	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8971346_8971347insT								RIMKLB (35661 upstream) : A2ML1 (3803 downstream)																							ctaacttttaattttttttttt	0.000													4	2	---	---	---	---	
A2ML1	144568	broad.mit.edu	37	12	8989078	8989079	+	Intron	DEL	TT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8989078_8989079delTT	uc001quz.3	+							NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor							extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						ATCCAAGACCtttttttttttt	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	19558919	19558919	+	IGR	DEL	C	-	-	rs7314306		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19558919delC								PLEKHA5 (29588 upstream) : AEBP2 (33689 downstream)																							ttttttttttcttttttgaga	0.010													4	2	---	---	---	---	
ST8SIA1	6489	broad.mit.edu	37	12	22429789	22429789	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22429789delA	uc001rfo.3	-						ST8SIA1_uc009zix.2_Intron	NM_003034	NP_003025	Q92185	SIA8A_HUMAN	alpha-2,8-sialyltransferase 1						glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(3)	3						AATAAAATGGAAAAAAAAAAG	0.383													4	2	---	---	---	---	
ARNTL2	56938	broad.mit.edu	37	12	27572952	27572953	+	Intron	INS	-	CACA	CACA	rs142781412	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27572952_27572953insCACA	uc001rht.1	+						ARNTL2_uc001rhw.2_Intron|ARNTL2_uc010sjp.1_Intron|ARNTL2_uc001rhu.1_Intron|ARNTL2_uc009zji.1_Intron|ARNTL2_uc001rhv.1_Intron|uc001rhx.2_Intron	NM_020183	NP_064568	Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear						circadian rhythm|entrainment of circadian clock|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|skin(1)	2	Colorectal(261;0.0847)|Lung SC(9;0.184)					GTTTGCGCGTGcacacacacac	0.322													5	3	---	---	---	---	
PPFIBP1	8496	broad.mit.edu	37	12	27843110	27843110	+	Intron	DEL	T	-	-	rs144276112		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27843110delT	uc001ric.1	+						PPFIBP1_uc010sjr.1_Intron|PPFIBP1_uc001rib.1_Intron|PPFIBP1_uc001ria.2_Intron|PPFIBP1_uc001rid.1_Intron|PPFIBP1_uc001rif.1_Intron	NM_003622	NP_003613	Q86W92	LIPB1_HUMAN	PTPRF interacting protein binding protein 1						cell adhesion	plasma membrane	protein binding		PPFIBP1/ALK(3)	soft_tissue(3)|kidney(1)|skin(1)	5	Lung SC(9;0.0873)					cctactcggattttttttttt	0.020													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	27983266	27983267	+	IGR	INS	-	GT	GT	rs138462966	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27983266_27983267insGT								KLHDC5 (27294 upstream) : PTHLH (127751 downstream)																							GCCATCATGAAGTGGCTTAACT	0.361													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	29122985	29122986	+	IGR	INS	-	TTG	TTG	rs145484400	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29122985_29122986insTTG								CCDC91 (419887 upstream) : FAR2 (179246 downstream)																							tcttttctGTTttgttgttgtt	0.158													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	31962520	31962521	+	IGR	INS	-	ATT	ATT	rs143768455	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31962520_31962521insATT								H3F3C (17345 upstream) : C12orf35 (149832 downstream)																							tccattgtttcattcataatag	0.124													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	32012157	32012157	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32012157delT								H3F3C (66982 upstream) : C12orf35 (100196 downstream)																							GTTCCTGTGATTTTTTTAACG	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	32817704	32817705	+	IGR	DEL	TG	-	-	rs57264085		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32817704_32817705delTG								FGD4 (18722 upstream) : DNM1L (14432 downstream)																							tttttttttttgtttttttttt	0.099													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	38049156	38049156	+	IGR	DEL	A	-	-	rs34046544		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38049156delA								None (None upstream) : ALG10B (661401 downstream)																							gttttgaaacaatctttttgt	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	38108954	38108954	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38108954delT								None (None upstream) : ALG10B (601603 downstream)																							tgaaacactctttttgtagta	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	43341448	43341448	+	IGR	DEL	G	-	-	rs11310541		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43341448delG								PRICKLE1 (357876 upstream) : ADAMTS20 (406565 downstream)																							TGTAAGTTCTGGTAAAGGAAT	0.239													5	3	---	---	---	---	
ADCY6	112	broad.mit.edu	37	12	49179758	49179759	+	5'Flank	INS	-	CT	CT			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49179758_49179759insCT	uc001rsh.3	-						ADCY6_uc001rsj.3_Intron|ADCY6_uc001rsi.3_Intron	NM_015270	NP_056085	O43306	ADCY6_HUMAN	adenylate cyclase 6 isoform a						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane	ATP binding|metal ion binding				0						CTTTAATGTGACTCCTGGCTGA	0.505													4	2	---	---	---	---	
MLL2	8085	broad.mit.edu	37	12	49427160	49427160	+	Frame_Shift_Del	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49427160delA	uc001rta.3	-	39	11328	c.11328delT	c.(11326-11328)CTTfs	p.L3776fs		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	3776	Gln-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						TGGGAGGCATAAGGCCCTGGG	0.617			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			4	2	---	---	---	---	
FAM186B	84070	broad.mit.edu	37	12	50000406	50000406	+	5'Flank	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50000406delA	uc001ruo.2	-						FAM186B_uc010smk.1_5'Flank	NM_032130	NP_115506	Q8IYM0	F186B_HUMAN	hypothetical protein LOC84070							protein complex				ovary(1)	1						acattgcttcaaaatacatga	0.005													4	2	---	---	---	---	
FLJ12825	440101	broad.mit.edu	37	12	54475755	54475758	+	Intron	DEL	AACG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54475755_54475758delAACG	uc001sey.2	+						LOC100240735_uc010sor.1_5'Flank	NR_026655				Homo sapiens cDNA FLJ12825 fis, clone NT2RP2002800.												0						GGGGAAAAAAAACGATCGGAGAAG	0.534													4	2	---	---	---	---	
NCKAP1L	3071	broad.mit.edu	37	12	54930501	54930501	+	Intron	DEL	A	-	-	rs71444857		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54930501delA	uc001sgc.3	+						NCKAP1L_uc010sox.1_Intron|NCKAP1L_uc010soy.1_Intron	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like						actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						CCCTACCCTGAAAAAAAAAAA	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	57106158	57106159	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57106158_57106159insT								PTGES3 (24080 upstream) : NACA (52 downstream)																							ACCTTTTTAAGTTTTTTTTTTT	0.376													9	5	---	---	---	---	
SLC16A7	9194	broad.mit.edu	37	12	60064192	60064192	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60064192delT	uc001sqs.2	+						SLC16A7_uc001sqt.2_Intron	NM_004731	NP_004722	O60669	MOT2_HUMAN	solute carrier family 16, member 7							integral to plasma membrane|membrane fraction	pyruvate secondary active transmembrane transporter activity|secondary active monocarboxylate transmembrane transporter activity|symporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(3;0.0303)	Pyruvic acid(DB00119)	TGCCTTCCAAtccaccccccc	0.055													1	5	---	---	---	---	
FAM19A2	338811	broad.mit.edu	37	12	62126516	62126516	+	Intron	DEL	G	-	-	rs6581423	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62126516delG	uc001sqw.2	-						FAM19A2_uc001sqv.2_Intron|FAM19A2_uc001sqx.2_Intron|FAM19A2_uc001sqy.2_Intron	NM_178539	NP_848634	Q8N3H0	F19A2_HUMAN	family with sequence similarity 19 (chemokine							cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)		GTGATTTTTtgtgtgtgtgtg	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	69608580	69608580	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69608580delC								CPM (251560 upstream) : CPSF6 (24737 downstream)																							ttccttttctccattcctctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	70825287	70825287	+	5'Flank	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70825287delT	uc001svy.1	+											Homo sapiens cDNA FLJ30122 fis, clone BRACE1000087.																		GCTGTTTTCATTTTTTTTTTT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76112463	76112465	+	IGR	DEL	CAC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76112463_76112465delCAC								KRR1 (207045 upstream) : PHLDA1 (306763 downstream)																							tacaggcacacaccaccacaccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76561498	76561498	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76561498delT								NAP1L1 (82760 upstream) : BBS10 (176768 downstream)																							caaaccctgcttttttttttg	0.000													4	2	---	---	---	---	
PPP1R12A	4659	broad.mit.edu	37	12	80270792	80270793	+	Intron	INS	-	A	A	rs145873634	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80270792_80270793insA	uc001syz.2	-						PPP1R12A_uc010suc.1_Intron|PPP1R12A_uc001sza.2_Intron|PPP1R12A_uc010sud.1_Intron|PPP1R12A_uc001szb.2_Intron|PPP1R12A_uc001szc.2_Intron	NM_002480	NP_002471	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory (inhibitor)							contractile fiber	protein binding|signal transducer activity			ovary(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						ctccatctcagaaaaaaaaaGG	0.079													2	7	---	---	---	---	
CRADD	8738	broad.mit.edu	37	12	94242546	94242547	+	Intron	INS	-	T	T	rs72515613		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94242546_94242547insT	uc001tda.2	+						CRADD_uc010sur.1_Intron|CRADD_uc010sus.1_Intron	NM_003805	NP_003796	P78560	CRADD_HUMAN	CASP2 and RIPK1 domain containing adaptor with						apoptosis|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|signal transduction	intracellular	death domain binding|protease binding|protein binding, bridging			ovary(1)	1						TTAGGAGCTCCTCTGTATAACC	0.257													1	5	---	---	---	---	
NR2C1	7181	broad.mit.edu	37	12	95416477	95416477	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95416477delT	uc001tdm.3	-							NM_003297	NP_003288	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	PML body	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1						AGTTATACAAttttttttttt	0.229													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	98267888	98267888	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98267888delG								RMST (309095 upstream) : LOC100128191 (638865 downstream)																							tgagatcataggagtaagcca	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	103368246	103368246	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103368246delC								ASCL1 (13959 upstream) : C12orf42 (263124 downstream)																							TACTTTTCATCCTCCTTAATT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	105890796	105890798	+	IGR	DEL	GGT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105890796_105890798delGGT								C12orf75 (125501 upstream) : NUAK1 (566327 downstream)																							tgatggtggaggtggtggtggtg	0.000													3	3	---	---	---	---	
BTBD11	121551	broad.mit.edu	37	12	108040849	108040849	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108040849delT	uc001tmk.1	+						BTBD11_uc001tmj.2_Intron|BTBD11_uc001tml.1_Intron|BTBD11_uc001tmm.1_Intron	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a							integral to membrane	DNA binding			skin(2)|ovary(1)	3						ctcacacttgtaatcccagtg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110062573	110062574	+	IGR	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110062573_110062574delTG								MVK (27503 upstream) : C12orf34 (89616 downstream)																							tgcatgtgtatgtgtgtgtgtg	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110547300	110547301	+	IGR	DEL	CT	-	-	rs72488481		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110547300_110547301delCT								C12orf76 (35861 upstream) : IFT81 (14839 downstream)																							ctctcctctcctctctctctct	0.327													4	2	---	---	---	---	
IFT81	28981	broad.mit.edu	37	12	110601420	110601420	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110601420delT	uc001tqi.2	+						IFT81_uc001tqh.2_Intron|IFT81_uc001tqj.2_Intron|IFT81_uc001tqg.2_Intron	NM_001143779	NP_001137251	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81-like isoform 1						cell differentiation|multicellular organismal development|spermatogenesis	intraflagellar transport particle B|microtubule-based flagellum				ovary(1)	1						AAATTTTCACttttttttttt	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	112367439	112367440	+	IGR	INS	-	G	G	rs10161310	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112367439_112367440insG								MAPKAPK5 (36212 upstream) : TMEM116 (1663 downstream)																							aaggaaagaaagaaggaaggaa	0.035													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	113473256	113473257	+	IGR	DEL	AA	-	-	rs35714806		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113473256_113473257delAA								OAS2 (23729 upstream) : DTX1 (22405 downstream)																							aacttgtctcaaaaaaaaaaaa	0.079													4	3	---	---	---	---	
TPCN1	53373	broad.mit.edu	37	12	113667907	113667907	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113667907delT	uc001tuw.2	+						TPCN1_uc001tux.2_Intron	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2							endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3						ttgaaaatcctgctgataaca	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114005510	114005511	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114005510_114005511insT								LHX5 (95633 upstream) : RBM19 (249032 downstream)																							tgcagctggccttcagagtccc	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114185973	114185973	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114185973delT	uc001tvk.1	-											Homo sapiens cDNA FLJ39613 fis, clone SKNSH2009357.																		tttctttaggttatacttttc	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114722579	114722580	+	IGR	INS	-	T	T	rs138226910		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114722579_114722580insT								RBM19 (318403 upstream) : TBX5 (69156 downstream)																							ATACGttcttcttttttttttt	0.178													4	3	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	118390790	118390792	+	Intron	DEL	AAA	-	-	rs150406267		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118390790_118390792delAAA	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					actccatctcaaaaaaaaaaaaa	0.039													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119145296	119145298	+	IGR	DEL	CAA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119145296_119145298delCAA								SUDS3 (289457 upstream) : SRRM4 (274098 downstream)																							gtggtgatggcaatggtggtggt	0.000													4	2	---	---	---	---	
RNF34	80196	broad.mit.edu	37	12	121840360	121840361	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121840360_121840361insA	uc001ual.1	+						RNF34_uc010szw.1_Intron|RNF34_uc001uak.1_Intron|RNF34_uc001uam.1_Intron	NM_025126	NP_079402	Q969K3	RNF34_HUMAN	ring finger protein 34 isoform 2						apoptosis	endomembrane system|membrane|nuclear speck	ligase activity|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000432)|Epithelial(86;0.00233)		TATAAGGGATTAAAAAAAAAAA	0.302													3	6	---	---	---	---	
KDM2B	84678	broad.mit.edu	37	12	122001509	122001510	+	Intron	INS	-	A	A	rs35972199		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122001509_122001510insA	uc001uat.2	-						KDM2B_uc001uas.2_Intron|KDM2B_uc001uau.2_Intron|KDM2B_uc001uav.3_Intron	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						gagactctgccaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	130681934	130681935	+	IGR	DEL	GT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130681934_130681935delGT								FZD10 (31650 upstream) : PIWIL1 (140679 downstream)																							TGGGAAgtgggtgtgtgtgtgt	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	133040579	133040593	+	IGR	DEL	CATCACAGTCACTAT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133040579_133040593delCATCACAGTCACTAT								GALNT9 (134674 upstream) : FBRSL1 (26564 downstream)																							ccatcatcaccatcacagtcactatcatcaccatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	32588311	32588332	+	IGR	DEL	TGTGTGTGTGTGTGTGTGTGTG	-	-	rs10525790		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32588311_32588332delTGTGTGTGTGTGTGTGTGTGTG								EEF1DP3 (54591 upstream) : FRY (17105 downstream)																							AACCCCAGGAtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg	0.270													4	3	---	---	---	---	
LRCH1	23143	broad.mit.edu	37	13	47256071	47256072	+	Intron	INS	-	TGTG	TGTG	rs151080336	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47256071_47256072insTGTG	uc001vbj.2	+						LRCH1_uc010acp.2_Intron|LRCH1_uc001vbk.2_Intron|LRCH1_uc001vbl.3_Intron	NM_015116	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH)											ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		GGGTCGATCTTtgtgtgtgtgt	0.292													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	63630275	63630278	+	IGR	DEL	TTTA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63630275_63630278delTTTA								None (None upstream) : OR7E156P (681290 downstream)																							TTGAAAGCTGTTTATTTATTTGTT	0.250													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	64807395	64807396	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64807395_64807396insA								OR7E156P (490694 upstream) : None (None downstream)																							gttctatttttaatttttttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	64948441	64948442	+	IGR	INS	-	A	A	rs143725091	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64948441_64948442insA								OR7E156P (631740 upstream) : None (None downstream)																							caaactttccccatttttctat	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	75774277	75774277	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75774277delA								None (None upstream) : LOC647288 (37613 downstream)																							agcatccattaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	88137405	88137405	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88137405delG	uc001vlm.1	-											Homo sapiens clone IMAGE:32106, mRNA sequence.																		acattggtctggggaaaaaat	0.000													3	4	---	---	---	---	
ABCC4	10257	broad.mit.edu	37	13	95848985	95848991	+	Intron	DEL	AGAAGGG	-	-	rs113892410		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95848985_95848991delAGAAGGG	uc001vmd.3	-						ABCC4_uc010afk.2_Intron|ABCC4_uc001vme.2_Intron|ABCC4_uc010tih.1_Intron|ABCC4_uc001vmf.2_Intron|ABCC4_uc010afl.1_Intron|ABCC4_uc010afm.1_Intron	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	gaaggaaggaagaagggagggagggaa	0.135													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	96716879	96716879	+	IGR	DEL	A	-	-	rs66787433		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96716879delA								UGGT2 (11143 upstream) : HS6ST3 (26214 downstream)																							aagaaagaagagaaagaagga	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	96726991	96726992	+	IGR	DEL	CC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96726991_96726992delCC								UGGT2 (21255 upstream) : HS6ST3 (16101 downstream)																							tgccaccacacctggctaactt	0.000													4	2	---	---	---	---	
MBNL2	10150	broad.mit.edu	37	13	98025500	98025501	+	Intron	DEL	TC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98025500_98025501delTC	uc010aft.2	+						MBNL2_uc001vmz.2_Intron|MBNL2_uc001vna.2_Intron|MBNL2_uc001vnb.2_Intron|MBNL2_uc010tij.1_Intron	NM_144778	NP_659002	Q5VZF2	MBNL2_HUMAN	muscleblind-like 2 isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	cytoplasm|nucleus	RNA binding|zinc ion binding				0	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)			GGCCGAGACATCTCTCTCTGCC	0.470													4	2	---	---	---	---	
FARP1	10160	broad.mit.edu	37	13	98851249	98851250	+	Intron	INS	-	T	T	rs56084701		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98851249_98851250insT	uc001vnj.2	+						FARP1_uc001vnh.2_Intron|FARP1_uc001vni.2_Intron	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1						regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			tggaggattactgagcccaaga	0.149													4	2	---	---	---	---	
UBAC2	337867	broad.mit.edu	37	13	99926591	99926591	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99926591delT	uc001voa.3	+						UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_001144072	NP_001137544	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2 isoform 1							integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					attctactgcttttttttttc	0.000													4	2	---	---	---	---	
NALCN	259232	broad.mit.edu	37	13	101716079	101716079	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101716079delT	uc001vox.1	-							NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1							integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GATCTGATCCTTTTTTTTTTT	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	106446191	106446191	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106446191delT								DAOA (302809 upstream) : EFNB2 (695907 downstream)																							agtgctagaattgcagacgtg	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	111241679	111241683	+	IGR	DEL	AGACA	-	-	rs147209720		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111241679_111241683delAGACA								RAB20 (27608 upstream) : CARKD (26198 downstream)																							ctaagattacagacatgaactactg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112220541	112220542	+	IGR	INS	-	AC	AC	rs10639057		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112220541_112220542insAC								C13orf16 (223948 upstream) : SOX1 (501371 downstream)																							AGTATCTTTCAACACATTGGAC	0.505													4	2	---	---	---	---	
AP1G2	8906	broad.mit.edu	37	14	24034602	24034602	+	Intron	DEL	A	-	-	rs67953844		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24034602delA	uc001wkl.2	-						AP1G2_uc001wkj.2_Intron|AP1G2_uc001wkk.3_Intron|AP1G2_uc001wkn.2_Intron|uc001wko.1_Intron|AP1G2_uc001wkp.1_5'Flank|AP1G2_uc010tnp.1_Intron|AP1G2_uc010aks.2_3'UTR|AP1G2_uc010akt.2_3'UTR|AP1G2_uc010tnq.1_Intron	NM_003917	NP_003908	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2						interspecies interaction between organisms|intracellular protein transport|vesicle-mediated transport	AP-1 adaptor complex|endosome membrane	protein binding|protein transporter activity			ovary(1)	1	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		GGACAGGCTTAAAAAAAAAAT	0.532													3	3	---	---	---	---	
BAZ1A	11177	broad.mit.edu	37	14	35271929	35271929	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35271929delA	uc001wsk.2	-						BAZ1A_uc001wsl.2_Intron|BAZ1A_uc001wsm.1_Intron	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A						chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		GTACACACTTACATACTTTTT	0.368													4	2	---	---	---	---	
FNTB	2342	broad.mit.edu	37	14	65444580	65444580	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65444580delT	uc010tsl.1	+						FNTB_uc010tsm.1_Intron	NM_002028	NP_002019	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta						protein farnesylation	microtubule associated complex	protein binding|protein farnesyltransferase activity			ovary(1)	1				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		tcctaatctcttttttttttt	0.000													6	3	---	---	---	---	
ATP6V1D	51382	broad.mit.edu	37	14	67809927	67809927	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67809927delT	uc001xjf.2	-						ATP6V1D_uc001xje.2_Intron	NM_015994	NP_057078	Q9Y5K8	VATD_HUMAN	H(+)-transporting two-sector ATPase						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting two-sector ATPase complex, catalytic domain|vacuolar proton-transporting V-type ATPase complex	protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)|lung(1)	2				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		TTCATAACACTTTTTTTTTTT	0.373													4	2	---	---	---	---	
RAD51L1	5890	broad.mit.edu	37	14	69044460	69044463	+	Intron	DEL	CACA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69044460_69044463delCACA	uc001xkf.1	+						RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193	O15315	RA51B_HUMAN	RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)		cctctctcatcacacacacacaca	0.123			T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					4	2	---	---	---	---	
SMOC1	64093	broad.mit.edu	37	14	70355494	70355494	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70355494delT	uc001xls.1	+						SMOC1_uc001xlt.1_Intron	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN	secreted modular calcium-binding protein 1						cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding			upper_aerodigestive_tract(1)|pancreas(1)	2				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		GTGCTGGGAGTTTTAAATAAT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	76025562	76025564	+	IGR	DEL	CTC	-	-	rs28435549		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76025562_76025564delCTC								BATF (12235 upstream) : FLVCR2 (19376 downstream)																							cctcccctttctcctcctcctcc	0.089													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	76817717	76817719	+	IGR	DEL	ATG	-	-	rs78889939		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76817717_76817719delATG								C14orf118 (148584 upstream) : ESRRB (19971 downstream)																							ttcctcacttatggtggttgctg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	76974958	76974959	+	IGR	DEL	AG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76974958_76974959delAG								ESRRB (6780 upstream) : VASH1 (253276 downstream)																							caggggagaaagagagagagag	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	77452783	77452783	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77452783delA								C14orf166B (116138 upstream) : C14orf4 (38105 downstream)																							TACTGTGAGCAAAATCTCCAG	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	82284326	82284326	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82284326delT								SEL1L (284121 upstream) : None (None downstream)																							ccttccttccttcttccttcc	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	82383960	82383961	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82383960_82383961insT								SEL1L (383755 upstream) : None (None downstream)																							TGTGGCCAAGCTTGCTGGCTCC	0.554													11	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	84809688	84809688	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84809688delC								None (None upstream) : None (None downstream)																							gtttccccttcccttccttcc	0.214													4	2	---	---	---	---	
CATSPERB	79820	broad.mit.edu	37	14	92077222	92077222	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92077222delT	uc001xzs.1	-						CATSPERB_uc010aub.1_Intron	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				tggtgtcatcttataagaaga	0.000													4	2	---	---	---	---	
GLRX5	51218	broad.mit.edu	37	14	96010114	96010114	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96010114delT	uc001yem.1	+							NM_016417	NP_057501	Q86SX6	GLRX5_HUMAN	glutaredoxin 5						cell redox homeostasis|hemopoiesis	mitochondrion	2 iron, 2 sulfur cluster binding|electron carrier activity|metal ion binding|protein disulfide oxidoreductase activity				0		all_cancers(154;0.135)		Epithelial(152;0.133)|COAD - Colon adenocarcinoma(157;0.21)|all cancers(159;0.212)		cactggtctctttgacacaaa	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	97235205	97235205	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97235205delT								PAPOLA (201759 upstream) : VRK1 (28479 downstream)																							tctccctcccttccttcctat	0.000													5	3	---	---	---	---	
DYNC1H1	1778	broad.mit.edu	37	14	102512505	102512505	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102512505delA	uc001yks.2	+							NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						actttgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
RAGE	5891	broad.mit.edu	37	14	102741312	102741312	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102741312delA	uc001ylm.2	-						RAGE_uc010txv.1_Intron|RAGE_uc001yln.2_Intron	NM_014226	NP_055041	Q9UQ07	MOK_HUMAN	MAPK/MAK/MRK overlapping kinase						signal transduction	Golgi apparatus	ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
EIF5	1983	broad.mit.edu	37	14	103801913	103801913	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103801913delA	uc001ymq.2	+						EIF5_uc001ymr.2_Intron|EIF5_uc001yms.2_Intron|EIF5_uc001ymt.2_Intron|EIF5_uc001ymu.2_5'UTR|SNORA28_uc001ymv.1_5'Flank	NM_001969	NP_001960	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5						regulation of translational initiation|RNA metabolic process	cytosol	GTP binding|GTPase activity|translation initiation factor activity			pancreas(1)|breast(1)|skin(1)	3		Melanoma(154;0.155)	Epithelial(46;0.182)			ACTAGGATGTAAAAAGGAGGC	0.438													4	2	---	---	---	---	
MARK3	4140	broad.mit.edu	37	14	103863663	103863664	+	Intron	INS	-	T	T	rs147544822		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103863663_103863664insT	uc001ymz.3	+						MARK3_uc001ymx.3_Intron|MARK3_uc001ymw.3_Intron|MARK3_uc001yna.3_Intron|MARK3_uc001ymy.3_Intron|MARK3_uc010awp.2_Intron	NM_001128918	NP_001122390	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3								ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|stomach(1)	4		Melanoma(154;0.155)	Epithelial(46;0.241)			CTGAATAAACAttttttttttt	0.193													3	4	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106680969	106680970	+	Intron	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106680969_106680970delTG	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						ATTTAGGGCAtgtgtgtgtgtg	0.149													3	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106766499	106766499	+	Intron	DEL	A	-	-	rs74654893		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106766499delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						AGGTTACAACAAAAAAAATAC	0.328													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20454589	20454589	+	IGR	DEL	T	-	-	rs71399653		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20454589delT								None (None upstream) : GOLGA6L6 (282505 downstream)																							AGGTTCAGAAttttttttttt	0.129													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21905915	21905916	+	IGR	INS	-	A	A	rs113231430		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21905915_21905916insA								NF1P1 (771290 upstream) : LOC646214 (26598 downstream)																							ttggatgagagaaaaaacctct	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22409693	22409693	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22409693delA								OR4N4 (25878 upstream) : OR4N3P (4009 downstream)																							GAGaagaaagaaaaaaaaata	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	25016570	25016571	+	IGR	INS	-	A	A	rs151266975	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25016570_25016571insA								C15orf2 (87978 upstream) : SNRPN (52223 downstream)																							tcaatttctacaaaaaaaaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	30238005	30238006	+	IGR	DEL	CA	-	-	rs150588063		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30238005_30238006delCA								TJP1 (123299 upstream) : FAM7A3 (157929 downstream)																							cacacacacgcacacacacaga	0.000													2	4	---	---	---	---	
MEIS2	4212	broad.mit.edu	37	15	37392005	37392006	+	5'UTR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37392005_37392006insA	uc001zjr.2	-	1					MEIS2_uc001zjl.2_5'Flank|MEIS2_uc010ucj.1_5'Flank|MEIS2_uc001zjm.2_5'Flank|MEIS2_uc001zjn.2_5'Flank|MEIS2_uc001zjo.2_5'UTR|MEIS2_uc001zjp.2_5'UTR|MEIS2_uc001zjs.2_5'UTR|MEIS2_uc001zju.2_Intron|MEIS2_uc001zjt.2_Intron	NM_170675	NP_733775	O14770	MEIS2_HUMAN	Meis homeobox 2 isoform c						negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)	2		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		CCCTCAGTTGGaaaaaaaaaga	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	41171962	41171963	+	IGR	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41171962_41171963delTG								RHOV (5475 upstream) : VPS18 (14665 downstream)																							aaggtgtggctgtgtgtgtgtg	0.020													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	41265637	41265637	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41265637delA								CHAC1 (16920 upstream) : INO80 (5444 downstream)																							cacgtagaacaaaaaggcaga	0.055													4	2	---	---	---	---	
SPG11	80208	broad.mit.edu	37	15	44949207	44949207	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44949207delA	uc001ztx.2	-						SPG11_uc010ueh.1_Intron|SPG11_uc010uei.1_Intron|SPG11_uc001zua.1_Intron	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1						cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		AACACTAGTTAAAAAAAAAAA	0.284													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	51151329	51151329	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51151329delT								SPPL2A (93419 upstream) : AP4E1 (49617 downstream)																							ctggctgttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	53573084	53573084	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53573084delA								ONECUT1 (490875 upstream) : WDR72 (232854 downstream)																							aatgttgaagaaaaaaaatat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	54228153	54228153	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54228153delA								WDR72 (176294 upstream) : UNC13C (76948 downstream)																							tagccctgggaattctggcaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	55235101	55235102	+	IGR	INS	-	AC	AC	rs145034718	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55235101_55235102insAC								UNC13C (314296 upstream) : RSL24D1 (238419 downstream)																							aagaaaatgttacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	55305986	55305987	+	IGR	INS	-	TCTC	TCTC	rs150626838	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55305986_55305987insTCTC								UNC13C (385181 upstream) : RSL24D1 (167534 downstream)																							ccacaatggagtctctgcttct	0.000													4	3	---	---	---	---	
ZNF280D	54816	broad.mit.edu	37	15	57135828	57135829	+	Intron	INS	-	A	A	rs148006533	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57135828_57135829insA	uc002adw.1	-							NM_001002843	NP_001002843	Q6N043	Z280D_HUMAN	suppressor of hairy wing homolog 4 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		aaactgagtttaaaaaaaaaca	0.000													4	2	---	---	---	---	
ALDH1A2	8854	broad.mit.edu	37	15	58440090	58440091	+	Intron	DEL	CA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58440090_58440091delCA	uc010ugw.1	-						AQP9_uc010ugx.1_Intron|AQP9_uc002aez.2_Intron	NM_170697	NP_733798	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1A2 isoform 3						negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	TAAacacatgcacacacacaca	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	62670994	62670997	+	IGR	DEL	AAGG	-	-	rs35967809		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62670994_62670997delAAGG								C2CD4B (213512 upstream) : MGC15885 (258374 downstream)																							gaaggaaagaaaggaaggaaggac	0.044													3	3	---	---	---	---	
HEXA	3073	broad.mit.edu	37	15	72659280	72659280	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72659280delT	uc002aun.3	-						CELF6_uc002auk.3_Intron|HEXA_uc010ukn.1_Intron|HEXA_uc002auo.3_Intron|HEXA_uc010bix.2_Intron|HEXA_uc010biy.2_Intron|HEXA_uc010uko.1_Intron|HEXA_uc010biz.1_Intron	NM_000520	NP_000511	P06865	HEXA_HUMAN	hexosaminidase A preproprotein						cell death	lysosome	beta-N-acetylhexosaminidase activity|cation binding|protein heterodimerization activity			ovary(3)|upper_aerodigestive_tract(1)	4						AATTTCACTGttttttttttg	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78102570	78102571	+	IGR	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78102570_78102571delAC								LINGO1 (114095 upstream) : LOC645752 (103988 downstream)																							acacaaacatacacacacacac	0.243													4	2	---	---	---	---	
WDR61	80349	broad.mit.edu	37	15	78585309	78585309	+	Intron	DEL	T	-	-	rs71947790		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78585309delT	uc002bdn.2	-						WDR61_uc002bdo.2_Intron|WDR61_uc010umz.1_Intron|WDR61_uc010una.1_Intron	NM_025234	NP_079510	Q9GZS3	WDR61_HUMAN	WD repeat domain 61								protein binding			ovary(1)|skin(1)	2						GACTTTAAGATTTTTTTTTTT	0.333													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	79771448	79771449	+	IGR	DEL	AG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79771448_79771449delAG								KIAA1024 (6806 upstream) : MTHFS (365871 downstream)																							gtcaggaggcagagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	80919315	80919316	+	IGR	INS	-	CCTT	CCTT			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80919315_80919316insCCTT								ARNT2 (29043 upstream) : FAM108C1 (68336 downstream)																							tttctttcctaccttccttcct	0.010													4	2	---	---	---	---	
TM6SF1	53346	broad.mit.edu	37	15	83798616	83798616	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83798616delT	uc002bjp.2	+						TM6SF1_uc010bmq.2_Intron|TM6SF1_uc002bjq.2_Intron|TM6SF1_uc010bmr.2_Intron|TM6SF1_uc002bjr.2_Intron	NM_023003	NP_075379	Q9BZW5	TM6S1_HUMAN	transmembrane 6 superfamily member 1 isoform 1							integral to membrane				ovary(1)	1						AAGCCTTGCCTTTTTTTTTGG	0.502													4	2	---	---	---	---	
BLM	641	broad.mit.edu	37	15	91301126	91301127	+	Intron	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91301126_91301127insT	uc002bpr.2	+						BLM_uc010uqh.1_Intron|BLM_uc010uqi.1_Intron|BLM_uc010bnx.2_Intron|BLM_uc002bps.1_5'Flank	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein						double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			tttttttcatcttttttttttt	0.005			Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92097293	92097293	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92097293delC								SV2B (258645 upstream) : SLCO3A1 (299645 downstream)																							CTGATGGGCTCTGGGAGGGTG	0.478													4	2	---	---	---	---	
ST8SIA2	8128	broad.mit.edu	37	15	92984933	92984933	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92984933delT	uc002bra.2	+						ST8SIA2_uc002brb.2_Intron	NM_006011	NP_006002	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide						axon guidance|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity				0	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			TCCCTTACcattttttggcca	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	97395235	97395235	+	IGR	DEL	T	-	-	rs77757006		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97395235delT								SPATA8 (66391 upstream) : LOC91948 (890611 downstream)																							GTCAGGGAGAttttttttttt	0.249													4	2	---	---	---	---	
TTC23	64927	broad.mit.edu	37	15	99737310	99737310	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99737310delT	uc002bur.2	-						TTC23_uc002bus.2_Intron|TTC23_uc002but.2_Intron|TTC23_uc002buu.2_Intron|TTC23_uc002buv.2_Intron|TTC23_uc002bux.2_Intron|TTC23_uc002buw.2_Intron|TTC23_uc010boq.2_Intron|TTC23_uc002buy.2_Intron|TTC23_uc010bor.2_Intron|TTC23_uc002buz.2_Intron	NM_022905	NP_075056	Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23								binding				0	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			Gtttctgttcttttttttttt	0.159													4	2	---	---	---	---	
TTC23	64927	broad.mit.edu	37	15	99739663	99739664	+	Intron	INS	-	TG	TG	rs149241257	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99739663_99739664insTG	uc002bur.2	-						TTC23_uc002bus.2_Intron|TTC23_uc002but.2_Intron|TTC23_uc002buu.2_Intron|TTC23_uc002buv.2_Intron|TTC23_uc002bux.2_Intron|TTC23_uc002buw.2_Intron|TTC23_uc010boq.2_Intron|TTC23_uc002buy.2_Intron|TTC23_uc010bor.2_Intron|TTC23_uc002buz.2_Intron	NM_022905	NP_075056	Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23								binding				0	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			gtgtgtgtgtttgtgtgtgtgt	0.079													3	3	---	---	---	---	
MSLNL	401827	broad.mit.edu	37	16	825541	825541	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:825541delC	uc002cjz.1	-	5	1220	c.1220delG	c.(1219-1221)GGCfs	p.G407fs		NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	integral to membrane				breast(3)|ovary(1)	4						TCTGGACTCGCCGTGGCAGCC	0.697													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5840511	5840512	+	IGR	INS	-	A	A	rs113588610		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5840511_5840512insA								FAM86A (692722 upstream) : A2BP1 (228620 downstream)																							ACAATATGCTGAAAAAAAAAAA	0.243													4	2	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	6551830	6551832	+	Intron	DEL	TTC	-	-	rs1610863	byFrequency	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6551830_6551832delTTC	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		TGGGGGGAAATTCTTCTTGGTTT	0.330													4	2	---	---	---	---	
PMM2	5373	broad.mit.edu	37	16	8909433	8909434	+	Intron	DEL	AT	-	-	rs146026219		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8909433_8909434delAT	uc002czf.3	+						PMM2_uc010uyf.1_Intron|PMM2_uc010uyg.1_Intron|PMM2_uc010uyh.1_Intron|PMM2_uc010buj.2_Intron|PMM2_uc010uyi.1_Intron	NM_000303	NP_000294	O15305	PMM2_HUMAN	phosphomannomutase 2						dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	phosphomannomutase activity			ovary(1)	1						cagtagacacatgagttgtttc	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9181875	9181875	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9181875delT								USP7 (124534 upstream) : C16orf72 (3662 downstream)																							TGACAAGGTCTTCTATTTGCT	0.318													4	2	---	---	---	---	
SNX29	92017	broad.mit.edu	37	16	12484738	12484738	+	Intron	DEL	A	-	-	rs113993775		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12484738delA	uc002dby.3	+							NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1						ttcAGtctttaaaaaaaaaaa	0.005													4	3	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14698482	14698483	+	Intron	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14698482_14698483insT	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						TGCCATTAGAAttttttttttg	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	24538323	24538324	+	IGR	DEL	AC	-	-	rs72202785		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24538323_24538324delAC								CACNG3 (164587 upstream) : RBBP6 (10690 downstream)																							caaaaaacaaacacacacacac	0.109													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	25276656	25276657	+	IGR	INS	-	T	T	rs146823283	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25276656_25276657insT								ZKSCAN2 (7801 upstream) : HS3ST4 (426690 downstream)																							TTTCTCATTTCTTTTATTTTCT	0.020													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26344949	26344950	+	IGR	INS	-	A	A	rs142167005	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26344949_26344950insA								HS3ST4 (195941 upstream) : C16orf82 (733269 downstream)																							cagccgagaggaaaaaaaaagg	0.000													3	4	---	---	---	---	
NSMCE1	197370	broad.mit.edu	37	16	27237572	27237573	+	Intron	INS	-	TGTA	TGTA	rs140899161	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27237572_27237573insTGTA	uc002doi.1	-						NSMCE1_uc002doj.1_Intron	NM_145080	NP_659547	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog						DNA recombination|DNA repair|intracellular signal transduction	nucleus	zinc ion binding				0						aaggatacaggtgtacgaggCC	0.208													3	4	---	---	---	---	
SBK1	388228	broad.mit.edu	37	16	28314283	28314284	+	Intron	INS	-	T	T	rs66874685		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28314283_28314284insT	uc002dpd.2	+							NM_001024401	NP_001019572	Q52WX2	SBK1_HUMAN	SH3-binding kinase 1							cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(1)|kidney(1)	2						agcagggcatgggggggggtca	0.000													4	2	---	---	---	---	
ZNF843	283933	broad.mit.edu	37	16	31455509	31455509	+	5'Flank	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31455509delA	uc010vfm.1	-							NM_001136509	NP_001129981	Q8N446	ZN843_HUMAN	zinc finger protein 843							intracellular	nucleic acid binding|zinc ion binding				0						cttacctcataaggttgctgg	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32428788	32428789	+	IGR	INS	-	C	C	rs150978089	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32428788_32428789insC								HERC2P4 (264914 upstream) : TP53TG3B (256052 downstream)																							cccagttcaagttccctggccg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32542680	32542680	+	IGR	DEL	G	-	-	rs112657463		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32542680delG								HERC2P4 (378806 upstream) : TP53TG3B (142161 downstream)																							tggcctcaatgggcaccaaaa	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32856211	32856212	+	IGR	INS	-	A	A	rs144439153	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32856211_32856212insA								TP53TG3B (167333 upstream) : SLC6A10P (32585 downstream)																							AAATCTTCAAGAAAtttttttt	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33421816	33421817	+	IGR	DEL	GT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33421816_33421817delGT								SLC6A10P (525353 upstream) : MIR1826 (543691 downstream)																							agagagaggggtgtgtgtgtgt	0.163													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33534326	33534326	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33534326delT								SLC6A10P (637863 upstream) : MIR1826 (431182 downstream)																							ggctcacaacttttgatccca	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33895711	33895712	+	IGR	INS	-	TGG	TGG			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33895711_33895712insTGG								SLC6A10P (999248 upstream) : MIR1826 (69796 downstream)																							attccattcaatgattccattc	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33937425	33937426	+	IGR	INS	-	CCTG	CCTG	rs113766265		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33937425_33937426insCCTG								None (None upstream) : MIR1826 (28082 downstream)																							ttctctccctctctccctccct	0.129													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	49246504	49246505	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49246504_49246505insA								N4BP1 (602384 upstream) : CBLN1 (65706 downstream)																							CTTAAAGAATGAAAAAAAAAAT	0.173													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	51528299	51528299	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51528299delT								SALL1 (343116 upstream) : TOX3 (943619 downstream)																							tgtggaactgtgagtcaatta	0.000													4	2	---	---	---	---	
CHD9	80205	broad.mit.edu	37	16	53148835	53148838	+	Intron	DEL	TTGA	-	-	rs71938039		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53148835_53148838delTTGA	uc002egy.2	+						CHD9_uc002egz.1_Intron	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9						cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				GCACAAGTATttgattgattgatt	0.191													4	2	---	---	---	---	
CPNE2	221184	broad.mit.edu	37	16	57174136	57174145	+	Intron	DEL	GCAATGGTGC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57174136_57174145delGCAATGGTGC	uc002eks.1	+						CPNE2_uc010cct.1_Intron|CPNE2_uc010ccu.1_Intron|CPNE2_uc002ekt.1_Intron	NM_152727	NP_689940	Q96FN4	CPNE2_HUMAN	copine II											central_nervous_system(1)|skin(1)	2		all_neural(199;0.224)				aggctggagtgcaatggtgcaatcttggct	0.086													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	62879439	62879440	+	IGR	INS	-	TG	TG	rs138814400	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62879439_62879440insTG								CDH8 (809403 upstream) : None (None downstream)																							gctaattcttttgtgtgtgtgt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	63180559	63180562	+	IGR	DEL	ACAC	-	-	rs71932537		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63180559_63180562delACAC								None (None upstream) : None (None downstream)																							TCTTGCAGATacacacacacacac	0.167													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	67559031	67559031	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67559031delG								AGRP (41315 upstream) : FAM65A (3723 downstream)																							TGTCTGCCTAGGGAGCCCCAA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	73340394	73340394	+	IGR	DEL	T	-	-	rs67065986		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73340394delT								HTA (212724 upstream) : PSMD7 (990287 downstream)																							gatttttgtattttttttggt	0.000													3	3	---	---	---	---	
LOC283922	283922	broad.mit.edu	37	16	74366436	74366436	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74366436delG	uc002fcr.2	-	14	2278	c.932delC	c.(931-933)CCTfs	p.P311fs	LOC283922_uc010vms.1_RNA					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						ggggaggggaggggaggggag	0.498													4	2	---	---	---	---	
ADAMTS18	170692	broad.mit.edu	37	16	77456437	77456438	+	Intron	INS	-	A	A	rs142217194	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77456437_77456438insA	uc002ffc.3	-						ADAMTS18_uc002ffe.1_Intron|ADAMTS18_uc010vni.1_Intron	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						AGaggagagtgaaaaaaaaaga	0.035													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	77556199	77556199	+	IGR	DEL	T	-	-	rs66941465		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77556199delT								ADAMTS18 (87188 upstream) : NUDT7 (200212 downstream)																							CCCTTCTGTATTTTTTTTATT	0.333													3	4	---	---	---	---	
CRISPLD2	83716	broad.mit.edu	37	16	84926663	84926663	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84926663delT	uc010voh.1	+						CRISPLD2_uc010vog.1_Intron|CRISPLD2_uc002fio.2_Intron	NM_031476	NP_113664	Q9H0B8	CRLD2_HUMAN	cysteine-rich secretory protein LCCL domain							extracellular region|transport vesicle					0						GCACAGATGATTGAGCCCTAG	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87212390	87212391	+	Intron	DEL	CT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87212390_87212391delCT	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		ctccctctccctctctctctcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	88708825	88708826	+	IGR	INS	-	G	G	rs138598251	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88708825_88708826insG								IL17C (1944 upstream) : CYBA (872 downstream)																							GGATTGGATGTGGGGTGTGGGG	0.619													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	4063341	4063342	+	IGR	DEL	AT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4063341_4063342delAT								CYB5D2 (2352 upstream) : ANKFY1 (3325 downstream)																							CTATATCCACATGACTCAGCTC	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	9700933	9700933	+	IGR	DEL	C	-	-	rs66931659		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9700933delC								DHRS7C (6332 upstream) : GLP2R (28448 downstream)																							tcaagtgattctcctgcctca	0.000													0	6	---	---	---	---	
GAS7	8522	broad.mit.edu	37	17	10050805	10050805	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10050805delT	uc002gmg.1	-							NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						CTGTAAACGGTTTTTGAGCCC	0.388			T	MLL	AML*								4	2	---	---	---	---	
SHISA6	388336	broad.mit.edu	37	17	11435889	11435890	+	Intron	DEL	CC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11435889_11435890delCC	uc002gna.3	+						SHISA6_uc002gnb.3_Intron|SHISA6_uc010com.2_Intron	NM_207386	NP_997269	Q6ZSJ9	SHSA6_HUMAN	shisa homolog 6							integral to membrane				breast(1)	1						GATCCCACATCCTCCCCTCCAG	0.322													4	2	---	---	---	---	
PIGL	9487	broad.mit.edu	37	17	16154949	16154949	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16154949delA	uc002gpv.2	+						PIGL_uc010vwd.1_Intron	NM_004278	NP_004269	Q9Y2B2	PIGL_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	N-acetylglucosaminylphosphatidylinositol deacetylase activity				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0934)		TAAGACCACTATATGGGGACT	0.388													4	2	---	---	---	---	
ZNF286B	729288	broad.mit.edu	37	17	18563385	18563386	+	3'UTR	INS	-	T	T	rs147806027		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18563385_18563386insT	uc010vyd.1	-	5						NM_001145045	NP_001138517	P0CG31	Z286B_HUMAN	zinc finger protein 286B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						tttcttttttcttttttttttt	0.109													4	3	---	---	---	---	
ZNF286B	729288	broad.mit.edu	37	17	18575373	18575373	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18575373delG	uc010vyd.1	-						FOXO3B_uc010vye.1_RNA	NM_001145045	NP_001138517	P0CG31	Z286B_HUMAN	zinc finger protein 286B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CAGACCACTTGGAGAGCTGGG	0.597													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20522541	20522541	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20522541delA								LGALS9B (151693 upstream) : CCDC144NL (244169 downstream)																							TATTGCCACCAAAATAAAGAC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21233115	21233115	+	IGR	DEL	A	-	-	rs113355841		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21233115delA								MAP2K3 (14566 upstream) : KCNJ12 (46584 downstream)																							atgcccagttaatttttgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21341375	21341376	+	IGR	INS	-	A	A	rs142557330	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21341375_21341376insA								KCNJ12 (18196 upstream) : C17orf51 (90196 downstream)																							TTAGTATATACAAAAAGACTAA	0.411													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25271401	25271402	+	IGR	INS	-	T	T	rs111404685		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25271401_25271402insT								None (None upstream) : WSB1 (349704 downstream)																							cctagcgttgctaggggagcct	0.050													4	3	---	---	---	---	
GOSR1	9527	broad.mit.edu	37	17	28849612	28849612	+	3'UTR	DEL	A	-	-	rs76806222		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28849612delA	uc002hfe.2	+	9					GOSR1_uc002hfd.2_3'UTR|GOSR1_uc002hff.2_3'UTR	NM_004871	NP_004862	O95249	GOSR1_HUMAN	golgi SNAP receptor complex member 1 isoform 1						intra-Golgi vesicle-mediated transport|protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|SNARE complex	SNAP receptor activity				0						Gtttttaattaaaaaaaaaaa	0.378													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	30731545	30731546	+	IGR	INS	-	AC	AC	rs139814311	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30731545_30731546insAC								ZNF207 (23570 upstream) : PSMD11 (39956 downstream)																							TAAggagggagacatatgatta	0.168													2	5	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	31485293	31485294	+	Intron	INS	-	TGAA	TGAA	rs142254319	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31485293_31485294insTGAA	uc002hhu.2	-						ACCN1_uc002hht.2_Intron	NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	tcagcaaTACTtgaatgaatga	0.188													3	3	---	---	---	---	
CCL2	6347	broad.mit.edu	37	17	32583980	32583980	+	3'UTR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32583980delT	uc002hhy.2	+	3						NM_002982	NP_002973	P13500	CCL2_HUMAN	small inducible cytokine A2 precursor						angiogenesis|anti-apoptosis|apoptotic cell clearance|astrocyte cell migration|cell adhesion|cellular response to interferon-gamma|cellular response to interleukin-1|cellular response to lipopolysaccharide|cellular response to tumor necrosis factor|G-protein signaling, coupled to cyclic nucleotide second messenger|helper T cell extravasation|humoral immune response|inflammatory response|JAK-STAT cascade|macrophage chemotaxis|monocyte chemotaxis|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of T cell activation|viral genome replication	extracellular space	CCR2 chemokine receptor binding|chemokine activity|protein kinase activity|signal transducer activity			pancreas(1)	1	Breast(3;0.00224)	Ovarian(249;0.0694)|Breast(31;0.151)|Lung NSC(157;0.153)		UCEC - Uterine corpus endometrioid carcinoma (308;0.000241)|BRCA - Breast invasive adenocarcinoma(366;0.0103)	Atorvastatin(DB01076)|Danazol(DB01406)|Mimosine(DB01055)|Simvastatin(DB00641)	ATGTTAATTCTTATTTAAGTT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	33112851	33112851	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33112851delC								TMEM132E (146515 upstream) : CCT6B (142089 downstream)																							TAGCATCAATCCTGGCATTGG	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	34980934	34980936	+	IGR	DEL	CTT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34980934_34980936delCTT								MRM1 (15528 upstream) : LHX1 (313563 downstream)																							GTTAGATGAACTTCTTCTTTGTG	0.493													3	3	---	---	---	---	
ACACA	31	broad.mit.edu	37	17	35460658	35460659	+	Intron	DEL	AC	-	-	rs141435886		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35460658_35460659delAC	uc002hnm.2	-						ACACA_uc002hnk.2_Intron|ACACA_uc002hnl.2_Intron|ACACA_uc002hnn.2_Intron|ACACA_uc002hno.2_Intron|ACACA_uc010cuy.2_Intron|ACACA_uc010wdb.1_Intron|ACACA_uc010wdc.1_Intron	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	aaacacacaaacacacacacac	0.025													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	37149651	37149652	+	IGR	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37149651_37149652delTG								FBXO47 (25996 upstream) : PLXDC1 (69904 downstream)																							tgtgtgactctgtgtgtgtgtg	0.025													4	2	---	---	---	---	
STAC2	342667	broad.mit.edu	37	17	37374517	37374519	+	Intron	DEL	GCA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37374517_37374519delGCA	uc002hrs.2	-						STAC2_uc010cvt.2_Intron	NM_198993	NP_945344	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2						intracellular signal transduction		metal ion binding			pancreas(1)	1						GGTAGGGgcggcagcagcagcag	0.512													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	38540471	38540471	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38540471delA								GJD3 (19526 upstream) : TOP2A (4327 downstream)																							AGAAATCATTAAAAAAAAAAT	0.284													4	2	---	---	---	---	
KRT20	54474	broad.mit.edu	37	17	39037480	39037481	+	Intron	DEL	TG	-	-	rs149120741		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39037480_39037481delTG	uc002hvl.2	-							NM_019010	NP_061883	P35900	K1C20_HUMAN	keratin 20						apoptosis|intermediate filament organization	Golgi apparatus|intermediate filament	protein binding|structural constituent of cytoskeleton			large_intestine(1)|kidney(1)|skin(1)	3		Breast(137;0.000301)|Ovarian(249;0.15)				ACATACACACtgtgtgtgtgtg	0.168													4	2	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39710416	39710423	+	Intron	DEL	TGAATGAA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39710416_39710423delTGAATGAA	uc010wfs.1	-							NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		gaagatctgttgaatgaatgaatgaatg	0.159													4	2	---	---	---	---	
CNTNAP1	8506	broad.mit.edu	37	17	40834653	40834654	+	5'UTR	DEL	AG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40834653_40834654delAG	uc002iay.2	+	1					CCR10_uc002iax.3_5'Flank|CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623	P78357	CNTP1_HUMAN	contactin associated protein 1 precursor						axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		aCCAGGAACCagagagagagag	0.327													5	5	---	---	---	---	
DHX8	1659	broad.mit.edu	37	17	41566381	41566382	+	Intron	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41566381_41566382insT	uc002idu.1	+						DHX8_uc010wif.1_Intron|DHX8_uc010wig.1_Intron	NM_004941	NP_004932	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8							catalytic step 2 spliceosome	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|pancreas(1)	4		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		tgttttttttgtttttttttga	0.114													4	2	---	---	---	---	
HDAC5	10014	broad.mit.edu	37	17	42178166	42178167	+	Intron	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42178166_42178167insT	uc002ifd.1	-						HDAC5_uc002ife.1_Intron|HDAC5_uc002iff.1_Intron|HDAC5_uc010czp.1_Intron|HDAC5_uc002ifh.2_Intron	NM_005474	NP_005465	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5 isoform 1						B cell differentiation|cellular response to insulin stimulus|chromatin remodeling|chromatin silencing|inflammatory response|negative regulation of cell migration involved in sprouting angiogenesis|negative regulation of myotube differentiation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding			ovary(1)	1		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		Atttttttttcttttttttgga	0.025													4	2	---	---	---	---	
UBTF	7343	broad.mit.edu	37	17	42284469	42284469	+	3'UTR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42284469delT	uc002igb.2	-	20					UBTF_uc002igc.2_3'UTR|UBTF_uc010czs.2_3'UTR|UBTF_uc002igd.2_3'UTR|UBTF_uc010czt.2_3'UTR	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA						positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CCCCACCGTATTTTTTTTTTT	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	42359598	42359599	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42359598_42359599insA								SLC4A1 (14096 upstream) : RUNDC3A (26328 downstream)																							gactccgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	42724759	42724759	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42724759delA								FZD2 (87852 upstream) : C17orf104 (9223 downstream)																							aagaccctgtaaaaaaaaaaa	0.015													4	2	---	---	---	---	
DCAKD	79877	broad.mit.edu	37	17	43130624	43130625	+	Intron	INS	-	GTTT	GTTT	rs149053776	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43130624_43130625insGTTT	uc010dab.1	-						DCAKD_uc010daa.1_5'Flank|DCAKD_uc002ihy.2_5'Flank	NM_024819	NP_079095	Q8WVC6	DCAKD_HUMAN	dephospho-CoA kinase domain containing						coenzyme A biosynthetic process		ATP binding|dephospho-CoA kinase activity				0		Prostate(33;0.155)				ttttttgtttggtttgtttgtt	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	44355020	44355020	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44355020delT								KIAA1267 (52303 upstream) : ARL17B (8843 downstream)																							tctttctttcttttttttttt	0.164													5	3	---	---	---	---	
CDC27	996	broad.mit.edu	37	17	45237368	45237368	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45237368delT	uc002ild.3	-						CDC27_uc002ile.3_Intron|CDC27_uc002ilf.3_Intron|CDC27_uc010wkp.1_Intron|CDC27_uc010wkq.1_Intron	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						CCTCTGCTTCTTTTTTTTTTT	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	47539439	47539440	+	5'Flank	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47539439_47539440insT	uc002ioy.1	-											Homo sapiens cDNA FLJ40303 fis, clone TESTI2029201.																		tttcttttttcttttttttttt	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48975798	48975799	+	IGR	INS	-	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48975798_48975799insG								TOB1 (30459 upstream) : SPAG9 (63737 downstream)																							ttatgagcaatggggaagatgg	0.005													4	2	---	---	---	---	
SPAG9	9043	broad.mit.edu	37	17	49067393	49067393	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49067393delT	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron|SPAG9_uc002ita.2_Intron|SPAG9_uc002ite.2_Intron	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CATTACAGCAttttttttttt	0.184													4	3	---	---	---	---	
MSI2	124540	broad.mit.edu	37	17	55670817	55670817	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55670817delC	uc002iuz.1	+						MSI2_uc010wnm.1_Intron|MSI2_uc002iva.2_Intron	NM_138962	NP_620412	Q96DH6	MSI2H_HUMAN	musashi 2 isoform a							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		tgtggcagtaccactccattc	0.000			T	HOXA9	CML								4	2	---	---	---	---	
INTS2	57508	broad.mit.edu	37	17	59946936	59946936	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59946936delA	uc002izn.2	-						INTS2_uc002izm.2_Intron	NM_020748	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2						snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding			ovary(1)|lung(1)|pancreas(1)	3						TCATTAGGTTAAAAAAAAAAA	0.328													5	3	---	---	---	---	
TLK2	11011	broad.mit.edu	37	17	60636541	60636542	+	Intron	DEL	CC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60636541_60636542delCC	uc010ddp.2	+						TLK2_uc002izx.3_Intron|TLK2_uc002izz.3_Intron|TLK2_uc002jaa.3_Intron|TLK2_uc010wpd.1_Intron	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						CATTCTTGAACCAGGACGTTGT	0.416													4	2	---	---	---	---	
MARCH10	162333	broad.mit.edu	37	17	60870169	60870170	+	Intron	INS	-	CAC	CAC	rs143960209	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60870169_60870170insCAC	uc010ddr.2	-						MARCH10_uc002jag.3_Intron|MARCH10_uc010dds.2_Intron|MARCH10_uc002jah.2_Intron	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190								ligase activity|zinc ion binding				0						accacctccatcaccaccacca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62728009	62728009	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62728009delT								SMURF2 (69623 upstream) : LOC146880 (17772 downstream)																							aaactgggaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	63056217	63056218	+	IGR	INS	-	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63056217_63056218insG								GNA13 (3297 upstream) : RGS9 (77331 downstream)																							ggagaggattaaaaaaaaaata	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68536461	68536462	+	IGR	DEL	GT	-	-	rs72201003		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68536461_68536462delGT								KCNJ2 (360280 upstream) : None (None downstream)																							TCCGTGCACGgtgtgtgtgtgt	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70372710	70372711	+	IGR	DEL	CA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70372710_70372711delCA								SOX9 (250158 upstream) : SLC39A11 (269375 downstream)																							cacgcgcatgcacacacacaca	0.351													4	2	---	---	---	---	
SDK2	54549	broad.mit.edu	37	17	71516627	71516627	+	Intron	DEL	G	-	-	rs113547486		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71516627delG	uc010dfm.2	-							NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2						cell adhesion	integral to membrane				ovary(2)	2						TGGGAGTAGTGGGGGGGTGCA	0.333													3	3	---	---	---	---	
TNRC6C	57690	broad.mit.edu	37	17	76087408	76087408	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76087408delA	uc002jud.2	+						TNRC6C_uc002juf.2_Intron	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2						gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			actccgtctcaaaaaaaaaaa	0.179													6	3	---	---	---	---	
CCDC40	55036	broad.mit.edu	37	17	78055187	78055190	+	Intron	DEL	AAAT	-	-	rs67130281		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78055187_78055190delAAAT	uc010dht.2	+						CCDC40_uc002jxm.3_Intron|CCDC40_uc002jxn.3_5'Flank	NM_017950	NP_060420	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm				ovary(3)	3	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			ctgtctcaaaaaataaataaataa	0.201													4	2	---	---	---	---	
AATK	9625	broad.mit.edu	37	17	79101944	79101945	+	Intron	DEL	CT	-	-	rs35548893		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79101944_79101945delCT	uc010dia.2	-						MIR657_hsa-mir-657|MI0003681_5'Flank|uc010wuj.1_5'Flank|MIR338_hsa-mir-338|MI0000814_5'Flank	NM_001080395	NP_001073864	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase							integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CCCCGCTGCCCTCTCTCTCTCT	0.579													5	3	---	---	---	---	
CD7	924	broad.mit.edu	37	17	80278257	80278257	+	5'Flank	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80278257delC	uc002kel.1	-						CD7_uc010din.2_5'Flank|CD7_uc002kem.2_5'Flank|CD7_uc010wvk.1_5'Flank	NM_006137	NP_006128	P09564	CD7_HUMAN	CD7 antigen precursor						immune response|T cell activation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|membrane fraction|plasma membrane	receptor activity				0	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			GTGGGTGTGGCCCTCAAAGGC	0.522													4	2	---	---	---	---	
TBCD	6904	broad.mit.edu	37	17	80810453	80810453	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80810453delT	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			tttcctcttcttaggcggaca	0.000													4	2	---	---	---	---	
USP14	9097	broad.mit.edu	37	18	195381	195382	+	Intron	INS	-	GTA	GTA	rs142231784	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:195381_195382insGTA	uc002kkf.1	+						USP14_uc002kkg.1_Intron|USP14_uc010wyr.1_Intron	NM_005151	NP_005142	P54578	UBP14_HUMAN	ubiquitin specific protease 14 isoform a						regulation of chemotaxis|regulation of proteasomal protein catabolic process|ubiquitin-dependent protein catabolic process	cell surface|cytoplasmic membrane-bounded vesicle|plasma membrane|proteasome complex	cysteine-type endopeptidase activity|endopeptidase inhibitor activity|proteasome binding|tRNA guanylyltransferase activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)	2		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				gctaagatgctgTATTTGGTGG	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	576433	576434	+	IGR	DEL	AG	-	-	rs111514244		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:576433_576434delAG								COLEC12 (75704 upstream) : CETN1 (3935 downstream)																							aaagaaagaaagagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	5708030	5708030	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5708030delA								EPB41L3 (77388 upstream) : TMEM200C (182154 downstream)																							TTTGCAGAGCAGGGGCTGAGG	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	6463006	6463009	+	IGR	DEL	CCAT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6463006_6463009delCCAT								L3MBTL4 (48096 upstream) : ARHGAP28 (325484 downstream)																							TTTTCACCTGCCATCTTGCAAGAT	0.289													9	5	---	---	---	---	
LAMA1	284217	broad.mit.edu	37	18	6950023	6950023	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6950023delT	uc002knm.2	-						LAMA1_uc002knk.2_Intron|LAMA1_uc002knl.2_Intron|LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	cccatatagataacattgcta	0.109													4	2	---	---	---	---	
KIAA0802	23255	broad.mit.edu	37	18	8791388	8791388	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8791388delC	uc002knr.2	+						KIAA0802_uc002knq.2_Intron|KIAA0802_uc002kns.2_Intron	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255												0						gctagctccaccaaacaggaa	0.015													4	2	---	---	---	---	
TWSG1	57045	broad.mit.edu	37	18	9368945	9368946	+	Intron	INS	-	A	A	rs79072866		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9368945_9368946insA	uc002knz.2	+						TWSG1_uc002koa.2_Intron	NM_020648	NP_065699	Q9GZX9	TWSG1_HUMAN	twisted gastrulation precursor											ovary(1)|pancreas(1)	2						gactctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10565377	10565377	+	IGR	DEL	T	-	-	rs115448089		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10565377delT								NAPG (12615 upstream) : FAM38B (105483 downstream)																							TTTTTTTTGGTTTTTTTTTTT	0.428													4	2	---	---	---	---	
AFG3L2	10939	broad.mit.edu	37	18	12379767	12379767	+	5'Flank	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12379767delA	uc002kqz.1	-							NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2						cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	catctctactaaaaaaaaaaa	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15390788	15390789	+	IGR	DEL	TT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15390788_15390789delTT								LOC644669 (64870 upstream) : None (None downstream)																							gtgtgcattcttctcagagagt	0.040													4	3	---	---	---	---	
C18orf8	29919	broad.mit.edu	37	18	21092881	21092881	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21092881delC	uc010xax.1	+						C18orf8_uc010xau.1_Intron|C18orf8_uc010xav.1_Intron|C18orf8_uc010xaw.1_Intron|C18orf8_uc002kul.2_Intron	NM_013326	NP_037458	Q96DM3	MIC1_HUMAN	colon cancer-associated protein Mic1											ovary(1)	1	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ttccctgcagccccagcaatc	0.000													4	2	---	---	---	---	
CDH2	1000	broad.mit.edu	37	18	25545273	25545273	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25545273delG	uc002kwg.2	-						CDH2_uc010xbn.1_Intron	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein						adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						ATACGCTGATGGAAAAGCTCC	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	28544001	28544002	+	IGR	DEL	AA	-	-	rs34458339		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28544001_28544002delAA								MIR302F (665075 upstream) : DSC3 (26051 downstream)																							TAGTaaaaggaaaaaaaaaaaa	0.153													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	30078250	30078250	+	IGR	DEL	T	-	-	rs35823204		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30078250delT								FAM59A (27803 upstream) : WBP11P1 (13376 downstream)																							atttgaagaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	32992657	32992658	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32992657_32992658insT								ZNF396 (35356 upstream) : INO80C (40632 downstream)																							GAGGAAGCAAGTTTTTTTTTTT	0.480													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	33380349	33380350	+	IGR	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33380349_33380350delAC								GALNT1 (88552 upstream) : MIR187 (104431 downstream)																							TACTATGTGTacacacacacac	0.050													4	2	---	---	---	---	
KIAA1328	57536	broad.mit.edu	37	18	34722566	34722567	+	Intron	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34722566_34722567delAC	uc002kzz.2	+						KIAA1328_uc002lab.2_Intron|KIAA1328_uc002lac.1_Intron|KIAA1328_uc010dnc.1_Intron	NM_020776	NP_065827	Q86T90	K1328_HUMAN	hypothetical protein LOC57536											central_nervous_system(1)	1				COAD - Colon adenocarcinoma(74;0.195)		ttgaatgtgtacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	35474731	35474731	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35474731delT								CELF4 (328731 upstream) : None (None downstream)																							CTTGAAGGGATTAGGTCAAAG	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	47198737	47198738	+	IGR	DEL	AG	-	-	rs113647034		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47198737_47198738delAG								LIPG (79461 upstream) : ACAA2 (111137 downstream)																							acagacagacagacacacacac	0.173													4	2	---	---	---	---	
MRO	83876	broad.mit.edu	37	18	48350831	48350832	+	Intron	INS	-	TC	TC	rs113158819		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48350831_48350832insTC	uc002lex.3	-						MRO_uc010dpc.2_Intron	NM_031939	NP_114145	Q9BYG7	MSTRO_HUMAN	maestro isoform a							nucleolus	binding				0		Colorectal(6;0.0596)		Colorectal(21;0.082)		ttttctttcttttttttttttt	0.005													2	6	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	50859439	50859440	+	Intron	INS	-	A	A	rs77875703		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50859439_50859440insA	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		gaacctgtctcaaaaaaaaaaa	0.139													4	2	---	---	---	---	
CCBE1	147372	broad.mit.edu	37	18	57140975	57140975	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57140975delT	uc002lib.2	-							NM_133459	NP_597716	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1						lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)				cactatttcctcccccactac	0.075													5	3	---	---	---	---	
CCBE1	147372	broad.mit.edu	37	18	57198280	57198280	+	Intron	DEL	A	-	-	rs5825345		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57198280delA	uc002lib.2	-							NM_133459	NP_597716	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1						lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)				TTGCTAAAGTAAAATACCAAA	0.368													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	57790180	57790181	+	IGR	INS	-	TG	TG	rs141249896	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57790180_57790181insTG								PMAIP1 (218642 upstream) : MC4R (248383 downstream)																							TCTTGTGTTACtgtgtgtgtgt	0.366													4	2	---	---	---	---	
CDH20	28316	broad.mit.edu	37	18	59127827	59127828	+	Intron	INS	-	G	G	rs142952977	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59127827_59127828insG	uc002lif.2	+							NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)				AAAACAGTCCTGGAAGTCATAC	0.450													0	6	---	---	---	---	
ZCCHC2	54877	broad.mit.edu	37	18	60246961	60246961	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60246961delT	uc002lio.2	+						uc002lir.1_5'Flank	NM_017742		Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2						cell communication	cytoplasm	nucleic acid binding|phosphatidylinositol binding|zinc ion binding			lung(1)|prostate(1)	2						tagtcttttcttttttttttg	0.045													4	2	---	---	---	---	
PHLPP1	23239	broad.mit.edu	37	18	60394849	60394849	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60394849delA	uc002lis.2	+							NM_194449	NP_919431	O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein						apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity				0						accctgtctcaaaaaaaaaaa	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	66004818	66004818	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66004818delA								DSEL (820851 upstream) : TMX3 (336109 downstream)																							tgggaggctgaggcagaagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	69613313	69613313	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:69613313delT								None (None upstream) : CBLN2 (590602 downstream)																							CCTTTATCACTTTTTTTTTAG	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	73368016	73368016	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73368016delA								C18orf62 (228427 upstream) : ZNF516 (703603 downstream)																							TTTAGTCAACAAACGGAATAA	0.358													5	4	---	---	---	---	
LOC284276	284276	broad.mit.edu	37	18	74255856	74255857	+	Intron	INS	-	T	T	rs36086727		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74255856_74255857insT	uc002lmg.2	+							NR_015417				Homo sapiens cDNA FLJ36617 fis, clone TRACH2016481.												0						TGATGTGCAGAttttttttttt	0.248													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75699810	75699810	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75699810delA								GALR1 (717716 upstream) : None (None downstream)																							CTCGTCATACAAAAAAAAAAA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77313648	77313665	+	IGR	DEL	TCTCCTGCCCCCACATCG	-	-	rs72343115		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77313648_77313665delTCTCCTGCCCCCACATCG								NFATC1 (24326 upstream) : CTDP1 (126136 downstream)																							CCCCACGCCATCTCCTGCCCCCACATCGTCTCCTGCCC	0.674													4	3	---	---	---	---	
TXNL4A	10907	broad.mit.edu	37	18	77742703	77742703	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77742703delA	uc002lnp.2	-						TXNL4A_uc002lnr.2_Intron|TXNL4A_uc002lnq.2_Intron|TXNL4A_uc010drf.2_Intron|TXNL4A_uc010drg.2_Intron	NM_006701	NP_006692	P83876	TXN4A_HUMAN	thioredoxin-like 4A						cell division|mitosis|spliceosome assembly	nucleoplasm|spliceosomal complex	protein binding				0		all_cancers(4;1.15e-12)|all_epithelial(4;8.61e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0646)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;7.36e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0249)		GACAACTTTCAAAAGCCGTGG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	525152	525153	+	IGR	INS	-	CG	CG	rs72373320		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:525152_525153insCG								C19orf20 (5499 upstream) : CDC34 (6580 downstream)																							CAGCCCTTCACCGCCCCCGGCT	0.688													4	5	---	---	---	---	
ITGB1BP3	27231	broad.mit.edu	37	19	3938848	3938849	+	Intron	INS	-	TG	TG	rs59201914		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3938848_3938849insTG	uc002lyz.3	+						ITGB1BP3_uc010xia.1_Intron	NM_170678	NP_733778	Q9NPI5	NRK2_HUMAN	integrin beta 1 binding protein 3						pyridine nucleotide biosynthetic process		ATP binding|metal ion binding|protein binding|ribosylnicotinamide kinase activity			skin(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00463)|STAD - Stomach adenocarcinoma(1328;0.18)		ttttgttttgtttttttttttt	0.208													4	2	---	---	---	---	
RANBP3	8498	broad.mit.edu	37	19	5939774	5939775	+	Intron	INS	-	CT	CT	rs145477051	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5939774_5939775insCT	uc002mdw.2	-						RANBP3_uc002mdx.2_Intron|RANBP3_uc002mdy.2_Intron|RANBP3_uc002mdz.2_Intron|RANBP3_uc010duq.2_Intron|RANBP3_uc002mea.2_Intron|RANBP3_uc010xix.1_Intron	NM_007322	NP_015561	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3 isoform RANBP3-d						intracellular transport|protein transport	cytoplasm|nucleus	Ran GTPase binding			breast(1)	1						AAACCCCAAGACTCTTTACAGC	0.584													3	5	---	---	---	---	
EVI5L	115704	broad.mit.edu	37	19	7922379	7922380	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7922379_7922380insA	uc002min.2	+						EVI5L_uc010xjz.1_Intron|EVI5L_uc002mio.1_3'UTR	NM_145245	NP_660288	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like isoform							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1						acaacacatgcacacacacaca	0.475													4	2	---	---	---	---	
FBN3	84467	broad.mit.edu	37	19	8147272	8147280	+	Intron	DEL	TTCTCTTTT	-	-	rs113391366		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8147272_8147280delTTCTCTTTT	uc002mjf.2	-						FBN3_uc002mje.2_Intron	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						ctcttctttcttctcttttttctctttct	0.019													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8439839	8439839	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8439839delA	uc002mjt.3	-											Homo sapiens, clone IMAGE:4863312, mRNA.																		GTGTTTTGTTAAAAAAAAAAA	0.080													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8805267	8805267	+	IGR	DEL	C	-	-	rs35073967		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8805267delC								ADAMTS10 (129679 upstream) : ACTL9 (2484 downstream)																							cagagaCACACACGCTGGTTT	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9673728	9673729	+	5'Flank	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9673728_9673729insA	uc010xko.1	-											Homo sapiens cDNA FLJ34771 fis, clone NT2NE2003150.																		gaccatgtctcaaaaaaaaaaa	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9857289	9857290	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9857289_9857290insT								ZNF562 (71513 upstream) : ZNF846 (5526 downstream)																							cctcatggccattttttttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	12237828	12237832	+	IGR	DEL	TGTTA	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12237828_12237832delTGTTA								ZNF788 (12337 upstream) : ZNF20 (4971 downstream)																							tatgttatgttgttatgttatgtta	0.127													4	2	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13322530	13322531	+	Intron	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13322530_13322531delTG	uc010dze.2	-						CACNA1A_uc010xnd.1_Intron|CACNA1A_uc002mwx.3_Intron|CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc002mwv.3_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	atgttgagcatgtgtgtgtgtg	0.243													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14688332	14688332	+	IGR	DEL	T	-	-	rs112163218		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14688332delT								NDUFB7 (5446 upstream) : CLEC17A (5564 downstream)																							AGGGGACCTGttttttttttt	0.264													4	2	---	---	---	---	
JAK3	3718	broad.mit.edu	37	19	17947088	17947088	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17947088delT	uc002nhn.3	-						JAK3_uc010ebh.2_Intron|JAK3_uc002nho.2_Intron	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3						B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						TGTATCTCACttttttttttc	0.244		2	Mis		acute megakaryocytic leukemia|								4	2	---	---	---	---	
IL12RB1	3594	broad.mit.edu	37	19	18192658	18192661	+	Intron	DEL	ATGG	-	-	rs113563981		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18192658_18192661delATGG	uc002nhw.1	-						IL12RB1_uc010xqb.1_Intron|IL12RB1_uc002nhx.1_Intron|IL12RB1_uc002nhy.2_Intron	NM_005535	NP_005526	P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1 isoform 1						cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1						aaaagaaaaaatggatggatggat	0.113													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24594668	24594668	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24594668delT								LOC100101266 (248419 upstream) : None (None downstream)																							gatactgcagtttttcagcac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28022765	28022765	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28022765delA								None (None upstream) : LOC148189 (258637 downstream)																							atctatggtgaaaaaggaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30267161	30267163	+	IGR	DEL	GGT	-	-	rs72320781		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30267161_30267163delGGT								C19orf12 (60709 upstream) : CCNE1 (35738 downstream)																							CAGAACACCAGGTGGTATGgctg	0.320													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31121308	31121309	+	IGR	DEL	GT	-	-	rs148135862		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31121308_31121309delGT								ZNF536 (72343 upstream) : DKFZp566F0947 (519474 downstream)																							GAAGTATCCCgtgtgtgtgtgt	0.302													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32022049	32022050	+	IGR	INS	-	CT	CT			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32022049_32022050insCT								TSHZ3 (181859 upstream) : ZNF507 (814464 downstream)																							ATCTATTACCACTCCCTGCTGG	0.579													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	33026678	33026679	+	IGR	INS	-	TG	TG	rs143776561	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33026678_33026679insTG								DPY19L3 (51442 upstream) : PDCD5 (45425 downstream)																							CACAGAACTTTtgtgtgtgtgt	0.203													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	33051482	33051483	+	IGR	INS	-	CGCACA	CGCACA	rs139701046	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33051482_33051483insCGCACA								DPY19L3 (76246 upstream) : PDCD5 (20621 downstream)																							acgcgcgcgcgcacacacacac	0.040													4	2	---	---	---	---	
GPATCH1	55094	broad.mit.edu	37	19	33592934	33592934	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33592934delA	uc002nug.1	+							NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1							catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					actctgtctcaaaaaaaaaaa	0.010													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	35308737	35308737	+	5'Flank	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35308737delT	uc002nwa.1	-						uc002nwb.1_5'Flank|uc002nwc.2_5'Flank|uc002nwd.1_5'Flank|uc002nwe.2_5'Flank|uc002nwf.1_5'Flank|uc002nwg.2_5'Flank|uc002nwh.1_5'Flank|uc002nwi.2_5'Flank|uc002nwj.2_Intron					DQ571149																		ACATTCACAATTTTTTTTTTG	0.274													4	2	---	---	---	---	
MAG	4099	broad.mit.edu	37	19	35783548	35783549	+	Intron	DEL	GT	-	-	rs72483562		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35783548_35783549delGT	uc002nyy.1	+						MAG_uc002nyx.1_Intron|MAG_uc010eds.1_Intron|MAG_uc002nyz.1_Intron	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a						blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CACATAGCAGgtgtgtgtgtgt	0.460													6	3	---	---	---	---	
ZNF565	147929	broad.mit.edu	37	19	36692215	36692216	+	Intron	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36692215_36692216insA	uc002odn.2	-						ZNF565_uc010ees.2_Intron|ZNF565_uc002odo.2_Intron|ZNF565_uc002odp.1_Intron	NM_152477	NP_689690	Q8N9K5	ZN565_HUMAN	zinc finger protein 565						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			aaaaacgaaacaaaacaaaaaC	0.173													4	2	---	---	---	---	
ZNF569	148266	broad.mit.edu	37	19	37935690	37935691	+	Intron	INS	-	C	C			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37935690_37935691insC	uc002ogi.2	-						ZNF569_uc002ogh.2_Intron|ZNF569_uc002ogj.2_Intron	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			caactctatttcccctgaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	38358468	38358471	+	IGR	DEL	AGAA	-	-	rs10580976		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38358468_38358471delAGAA								ZNF573 (50528 upstream) : WDR87 (17001 downstream)																							agagagagacagaaagaaagaaag	0.201													4	2	---	---	---	---	
EIF3K	27335	broad.mit.edu	37	19	39112740	39112740	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39112740delT	uc002oiz.1	+						EIF3K_uc010xuh.1_Intron|EIF3K_uc010xui.1_Intron	NM_013234	NP_037366	Q9UBQ5	EIF3K_HUMAN	eukaryotic translation initiation factor 3,						regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex|nucleus	protein binding|ribosome binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			ctttctttccttttttttttt	0.030													4	2	---	---	---	---	
PLD3	23646	broad.mit.edu	37	19	40874557	40874557	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40874557delC	uc002onm.3	+						PLD3_uc002onj.3_Intron|PLD3_uc002onk.3_Intron|PLD3_uc002onl.3_Intron|PLD3_uc002onn.2_Intron	NM_001031696	NP_001026866	Q8IV08	PLD3_HUMAN	phospholipase D3						lipid catabolic process	endoplasmic reticulum membrane|integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity|protein binding			skin(2)|ovary(1)	3			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			cacctgtaatcccagcacttt	0.100													4	2	---	---	---	---	
BCKDHA	593	broad.mit.edu	37	19	41914527	41914527	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41914527delT	uc002oqq.2	+						CYP2F1_uc010xvw.1_Intron|BCKDHA_uc002oqm.3_Intron|BCKDHA_uc002oqp.1_Intron|BCKDHA_uc002oqr.2_Intron|BCKDHA_uc010xvz.1_Intron	NM_000709	NP_000700	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|alpha-ketoacid dehydrogenase activity|carboxy-lyase activity|metal ion binding|protein binding				0						ccctctgagcttttttttttg	0.204													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	45198392	45198392	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45198392delT								CEACAM19 (10767 upstream) : CEACAM16 (3966 downstream)																							GCCTAGGTGCtttttttttct	0.139													4	2	---	---	---	---	
VASP	7408	broad.mit.edu	37	19	46017645	46017649	+	Intron	DEL	TTTGT	-	-	rs112823792		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46017645_46017649delTTTGT	uc002pcg.2	+						VASP_uc010eki.2_Intron	NM_003370	NP_003361	P50552	VASP_HUMAN	vasodilator-stimulated phosphoprotein						axon guidance|cell junction assembly|T cell receptor signaling pathway	actin cytoskeleton|cytosol|filopodium membrane|focal adhesion|lamellipodium membrane	actin binding|profilin binding|SH3 domain binding				0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)		tttttgttagtttgttttgtttttt	0.000													4	2	---	---	---	---	
OPA3	80207	broad.mit.edu	37	19	46072293	46072293	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46072293delA	uc002pck.3	-						OPA3_uc002pcj.3_Intron|OPA3_uc010xxk.1_Intron	NM_025136	NP_079412	Q9H6K4	OPA3_HUMAN	OPA3 protein isoform b						response to stimulus|visual perception	mitochondrion					0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00778)|GBM - Glioblastoma multiforme(486;0.0976)|Epithelial(262;0.242)		TCAGCCTCCTAATGGACTGAA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	46977866	46977866	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46977866delG								PNMAL1 (3046 upstream) : PNMAL2 (16582 downstream)																							ggctgggcgcggtggctcacg	0.000													4	2	---	---	---	---	
VRK3	51231	broad.mit.edu	37	19	50491932	50491935	+	Intron	DEL	TCTC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50491932_50491935delTCTC	uc002prg.2	-						VRK3_uc002prh.1_Intron|VRK3_uc002pri.1_Intron|VRK3_uc010ens.2_Intron|VRK3_uc010ybl.1_Intron|VRK3_uc010ybm.1_Intron|VRK3_uc002prj.1_Intron|VRK3_uc002prk.1_Intron|VRK3_uc010ent.1_Intron|VRK3_uc002prl.2_Intron	NM_016440	NP_057524	Q8IV63	VRK3_HUMAN	vaccinia related kinase 3 isoform 1							nucleus	ATP binding|protein kinase activity			stomach(1)|skin(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		GCTGACTCATTCTCTCTCTCACTC	0.417													4	3	---	---	---	---	
KLK6	5653	broad.mit.edu	37	19	51463048	51463049	+	Intron	INS	-	GAG	GAG			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51463048_51463049insGAG	uc002pui.2	-						KLK6_uc010eoj.2_Intron|KLK6_uc002puh.2_Intron|KLK6_uc002puj.2_Intron|KLK6_uc010ycn.1_Intron|KLK6_uc002pul.2_Intron|KLK6_uc002pum.2_Intron	NM_001012964	NP_001012982	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6 isoform A						amyloid precursor protein metabolic process|central nervous system development|collagen catabolic process|hormone metabolic process|myelination|positive regulation of G-protein coupled receptor protein signaling pathway|protein autoprocessing|proteolysis|regulation of cell differentiation|tissue regeneration	endoplasmic reticulum|extracellular region|microsome|mitochondrion|nucleolus	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		gaagaggaggaggaagaggaga	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	52215031	52215032	+	IGR	INS	-	A	A	rs151212161	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52215031_52215032insA								NCRNA00085 (6589 upstream) : HAS1 (1333 downstream)																							aaggaagtcacaaaaaaaagca	0.000													2	5	---	---	---	---	
ZNF480	147657	broad.mit.edu	37	19	52811560	52811561	+	Intron	INS	-	T	T	rs146136889		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52811560_52811561insT	uc010ydl.1	+						ZNF480_uc002pyv.2_Intron|ZNF480_uc010ydm.1_Intron|ZNF480_uc010epn.2_Intron|uc002pyw.1_Intron	NM_144684	NP_653285	Q8WV37	ZN480_HUMAN	zinc finger protein 480						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		tttttttcttcttttttttttt	0.188													3	4	---	---	---	---	
ZNF415	55786	broad.mit.edu	37	19	53624638	53624638	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53624638delA	uc002qax.2	-						ZNF415_uc002qat.2_Intron|ZNF415_uc002qaw.2_Intron|ZNF415_uc010yds.1_Intron|ZNF415_uc010ydt.1_Intron|ZNF415_uc002qau.2_Intron|ZNF415_uc002qav.2_Intron|ZNF415_uc002qba.2_Intron|ZNF415_uc002qay.2_Intron|ZNF415_uc002qaz.2_Intron	NR_028343		Q09FC8	ZN415_HUMAN	RecName: Full=Zinc finger protein 415;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.0191)		actccgtctcaaaaaaaaaaa	0.025													3	3	---	---	---	---	
ZNF813	126017	broad.mit.edu	37	19	53980690	53980693	+	Intron	DEL	GGTT	-	-	rs74182475		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53980690_53980693delGGTT	uc002qbu.2	+							NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN	zinc finger protein 813						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		aacccacgtgggttgtcctcagcc	0.108													4	2	---	---	---	---	
MIR525	574470	broad.mit.edu	37	19	54198734	54198735	+	5'Flank	DEL	TT	-	-	rs34243808		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54198734_54198735delTT	hsa-mir-525|MI0003152	+						MIR523_hsa-mir-523|MI0003153_5'Flank																	0						aacggtcctctttttttttttt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	55001944	55001945	+	IGR	DEL	TC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55001944_55001945delTC								CDC42EP5 (17522 upstream) : LAIR2 (7155 downstream)																							tttccttctttctctctttctc	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	131954	131955	+	IGR	INS	-	CT	CT	rs138166957		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:131954_131955insCT								DEFB126 (5563 upstream) : DEFB127 (6231 downstream)																							tacaccacacacacacacacaa	0.000													4	5	---	---	---	---	
NRSN2	80023	broad.mit.edu	37	20	329128	329129	+	Intron	INS	-	GTGT	GTGT	rs71931589		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:329128_329129insGTGT	uc002wdi.3	+						NRSN2_uc002wdj.2_5'Flank|NRSN2_uc002wdl.2_5'Flank	NM_024958	NP_079234	Q9GZP1	NRSN2_HUMAN	neurensin 2							integral to membrane|plasma membrane|transport vesicle					0		all_cancers(10;0.0834)				AACCTCCAACCgtgtgtgtgtg	0.371													4	4	---	---	---	---	
FKBP1A	2280	broad.mit.edu	37	20	1347896	1347896	+	Intron	DEL	A	-	-	rs111958500		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1347896delA	uc010gac.2	-						uc002wew.2_Intron|uc002wex.2_Intron			P62942	FKB1A_HUMAN	Homo sapiens FKBP12-Exip2 mRNA for FK506 binding protein12, complete cds.						'de novo' protein folding|beta-amyloid formation|fibril organization|heart trabecula formation|negative regulation of protein phosphatase type 2B activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein binding|positive regulation of protein ubiquitination|protein maturation by protein folding|protein refolding|regulation of activin receptor signaling pathway|regulation of immune response|regulation of ryanodine-sensitive calcium-release channel activity|SMAD protein complex assembly|T cell activation|ventricular cardiac muscle tissue morphogenesis	axon|cytosol|sarcoplasmic reticulum membrane|terminal cisterna	activin binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity|signal transducer activity|SMAD binding|type I transforming growth factor beta receptor binding				0					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)	ccatctcgggaaaaaaaaaaa	0.030													4	4	---	---	---	---	
PTPRA	5786	broad.mit.edu	37	20	2989927	2989927	+	Intron	DEL	T	-	-	rs66596063		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2989927delT	uc010zqd.1	+						PTPRA_uc002whj.2_Intron|PTPRA_uc002whk.2_Intron|PTPRA_uc002whl.2_Intron|PTPRA_uc002whm.2_Intron|PTPRA_uc002whn.2_Intron|PTPRA_uc002who.2_Intron	NM_002836	NP_002827	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A						axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1						AGTTGTGTGATTTTTTTTTTC	0.478													2	4	---	---	---	---	
RASSF2	9770	broad.mit.edu	37	20	4767703	4767704	+	Intron	INS	-	A	A	rs112411943		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4767703_4767704insA	uc002wld.2	-						RASSF2_uc002wlc.2_Intron|RASSF2_uc002wle.2_Intron|RASSF2_uc002wlf.2_Intron|RASSF2_uc010gbh.2_RNA	NM_170774	NP_739580	P50749	RASF2_HUMAN	Ras association domain family 2						cell cycle|signal transduction	nucleus	protein binding			ovary(3)|lung(2)|large_intestine(1)	6						gactccatcccaaaaaaaaaaa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	5373026	5373026	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5373026delG								PROKR2 (75648 upstream) : LOC149837 (106192 downstream)																							TCCAGTGCCTGGTTACATTTA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	13656049	13656049	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13656049delA								TASP1 (36466 upstream) : ESF1 (38921 downstream)																							agaaagaaagaaaaaaagaga	0.000													4	5	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	14559643	14559643	+	Intron	DEL	A	-	-	rs11087097		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14559643delA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002wox.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				GCACTTCTTTAAAGCTGCTGC	0.303													4	2	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15686074	15686074	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15686074delT	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				CCCCAAAGCAtttttttttta	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	16242721	16242722	+	IGR	INS	-	T	T	rs146234500	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16242721_16242722insT								MACROD2 (208882 upstream) : KIF16B (10027 downstream)																							CTGATAAGCCCTGTGACAGTGC	0.460													2	5	---	---	---	---	
BFSP1	631	broad.mit.edu	37	20	17491622	17491625	+	Intron	DEL	TTGT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17491622_17491625delTTGT	uc002wpo.2	-						BFSP1_uc002wpp.2_Intron|BFSP1_uc010zrn.1_Intron|BFSP1_uc010zro.1_Intron	NM_001195	NP_001186	Q12934	BFSP1_HUMAN	filensin isoform 1							cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens			central_nervous_system(1)	1						TTTTTGCTTCTTGtttgtttgttt	0.196													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19738854	19738868	+	IGR	DEL	TCCTCCTCTTCCTCC	-	-	rs36233368	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19738854_19738868delTCCTCCTCTTCCTCC								SLC24A3 (35314 upstream) : RIN2 (131342 downstream)																							ttctcccccttcctcctcttcctcctcctcctctt	0.419													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19815719	19815720	+	IGR	INS	-	AGAA	AGAA	rs145019731		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19815719_19815720insAGAA								SLC24A3 (112179 upstream) : RIN2 (54490 downstream)																							aaaagagaaagagaaagaaaga	0.000													4	2	---	---	---	---	
NINL	22981	broad.mit.edu	37	20	25523679	25523680	+	Intron	INS	-	G	G	rs146973901		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25523679_25523680insG	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc010gdo.1_Intron|NINL_uc010ztf.1_5'Flank	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						ccgtcttcaaaaaaaaaaaaaa	0.035													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26202319	26202319	+	IGR	DEL	C	-	-	rs74486893		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26202319delC								MIR663 (13405 upstream) : None (None downstream)																							attacagaatctttatatctg	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26264313	26264313	+	IGR	DEL	T	-	-	rs62199939		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26264313delT								MIR663 (75399 upstream) : None (None downstream)																							aacttctttgtgatgtttgca	0.000													5	3	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29649883	29649887	+	Intron	DEL	CTTAT	-	-	rs139376591		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29649883_29649887delCTTAT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						tggccagttgcttatcttcttttga	0.000													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29826773	29826782	+	IGR	DEL	TAATTTACTC	-	-	rs112718288		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29826773_29826782delTAATTTACTC								FRG1B (172865 upstream) : DEFB115 (18685 downstream)																							gacttgaatgtaatttactcgaatggaatg	0.014													4	2	---	---	---	---	
C20orf112	140688	broad.mit.edu	37	20	31064001	31064002	+	Intron	INS	-	ACAC	ACAC	rs71338439		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31064001_31064002insACAC	uc002wxu.3	-						C20orf112_uc010gec.2_Intron|C20orf112_uc002wxv.3_Intron|C20orf112_uc002wxw.1_Intron	NM_080616	NP_542183	Q96MY1	CT112_HUMAN	hypothetical protein LOC140688												0						CACCCGGAGGGacacacacaca	0.455													4	2	---	---	---	---	
FAM83C	128876	broad.mit.edu	37	20	33873735	33873736	+	3'UTR	INS	-	TG	TG	rs150669491	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33873735_33873736insTG	uc010zux.1	-	5					EIF6_uc002xbv.1_5'Flank|EIF6_uc002xbx.1_5'Flank|EIF6_uc002xbz.1_5'Flank|EIF6_uc002xby.1_5'Flank|FAM83C_uc002xcb.1_3'UTR	NM_178468	NP_848563	Q9BQN1	FA83C_HUMAN	hypothetical protein LOC128876											ovary(2)	2			BRCA - Breast invasive adenocarcinoma(18;0.00252)			gataatgatgatgtgtgtgtgt	0.079													2	4	---	---	---	---	
DLGAP4	22839	broad.mit.edu	37	20	35116985	35116985	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35116985delT	uc002xff.2	+						DLGAP4_uc010zvp.1_Intron|DLGAP4_uc002xfg.2_Intron|DLGAP4_uc002xfh.2_Intron	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a						cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				tgttgaaagattttttttttt	0.000													3	3	---	---	---	---	
C20orf117	140710	broad.mit.edu	37	20	35423173	35423173	+	Intron	DEL	T	-	-	rs79620367		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35423173delT	uc002xgd.1	-						C20orf117_uc002xge.1_Intron	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2												0		Myeloproliferative disorder(115;0.00874)				CTGCAttttcttttttttttt	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	35613674	35613674	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35613674delG								SAMHD1 (33498 upstream) : RBL1 (11398 downstream)																							tgtcattaaaggaacaaagcc	0.000													1	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36082807	36082807	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36082807delT								SRC (48988 upstream) : BLCAP (63013 downstream)																							cccacaggccttacccagtct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37327002	37327003	+	IGR	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37327002_37327003delTG								ADIG (109898 upstream) : SLC32A1 (26102 downstream)																							AGGCCACCTCTGTGTGTGTGTG	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	41824319	41824322	+	IGR	DEL	CTGA	-	-	rs148589686		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41824319_41824322delCTGA								PTPRT (5762 upstream) : SFRS6 (262182 downstream)																							GTTTTCACTTCTGACTGACACCTG	0.505													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	43487796	43487797	+	IGR	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43487796_43487797delTG								RIMS4 (48884 upstream) : YWHAB (26547 downstream)																							tgtgtgtgtatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	44374842	44374842	+	IGR	DEL	T	-	-	rs75273200		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44374842delT								SPINT4 (20507 upstream) : WFDC3 (28005 downstream)																							AGTATTGTAAttttttttttt	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	54670573	54670574	+	IGR	DEL	AC	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54670573_54670574delAC								CBLN4 (90561 upstream) : MC3R (153214 downstream)																							acatacacaaacacacacacac	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55731948	55731948	+	IGR	DEL	T	-	-	rs79865819		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55731948delT								TFAP2C (517612 upstream) : BMP7 (11861 downstream)																							ttaaggacaattttttttttt	0.085													2	4	---	---	---	---	
GNASAS	149775	broad.mit.edu	37	20	57405356	57405356	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57405356delT	uc002xzs.1	-							NR_002785				Homo sapiens GNAS1 antisense transcript RNA.												0						accaccaccatcaccaccacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57652960	57652960	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57652960delA								SLMO2 (35059 upstream) : ZNF831 (113115 downstream)																							gagaaaaaggagggcaaggag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58614866	58614866	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58614866delC								CDH26 (6037 upstream) : C20orf197 (16114 downstream)																							AATCCCCTTTCCAGAAGTAAG	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10588349	10588349	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10588349delT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		acaaatgttcttttttttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10602653	10602654	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10602653_10602654insA								None (None upstream) : TPTE (304089 downstream)																							acctgtggcagaaaaaaaaaac	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10786132	10786133	+	IGR	INS	-	AAATG	AAATG			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10786132_10786133insAAATG								None (None upstream) : TPTE (120610 downstream)																							ggaattgaattaaatgaaatgg	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10894925	10894926	+	IGR	INS	-	CCTT	CCTT	rs142337572	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10894925_10894926insCCTT								None (None upstream) : TPTE (11817 downstream)																							cctccccccaccctttctccct	0.000													4	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11048361	11048361	+	Intron	DEL	A	-	-	rs71293628		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11048361delA	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGGGGAAGAGAAAAAAACAGG	0.408													3	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11061063	11061066	+	Intron	DEL	TGGC	-	-	rs143743126		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11061063_11061066delTGGC	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		gtaggcatggtggctggcatgcac	0.000													6	6	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11067810	11067810	+	Intron	DEL	G	-	-	rs7275378	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11067810delG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAGTGGGAAAGAATTTAAAAG	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11184024	11184025	+	IGR	INS	-	AAT	AAT	rs149209886	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11184024_11184025insAAT								BAGE (85087 upstream) : None (None downstream)																							aaagtgaagaaaaagactttct	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14362623	14362623	+	IGR	DEL	T	-	-	rs151299636		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14362623delT								None (None upstream) : C21orf99 (47864 downstream)																							tgtgaggatatttccttttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	28695558	28695558	+	IGR	DEL	T	-	-	rs239711	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28695558delT								ADAMTS5 (356119 upstream) : NCRNA00113 (399140 downstream)																							TTATCAAGGGTGGACCAATTA	0.328													4	2	---	---	---	---	
FAM165B	54065	broad.mit.edu	37	21	35771960	35771961	+	Intron	INS	-	TT	TT	rs146329890	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35771960_35771961insTT	uc002ytv.2	+						FAM165B_uc002ytw.2_Intron			P58511	F165B_HUMAN	Homo sapiens cDNA FLJ25151 fis, clone CBR07718.							integral to membrane					0						CGTGCCACCCCTTTGCCCACCA	0.569													4	3	---	---	---	---	
TRAPPC10	7109	broad.mit.edu	37	21	45511482	45511482	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45511482delG	uc002zea.2	+						TRAPPC10_uc010gpo.2_Intron|TRAPPC10_uc011afa.1_Intron|TRAPPC10_uc011afb.1_Intron	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10						vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						caccacgtctggctaattttt	0.000													4	2	---	---	---	---	
PCBP3	54039	broad.mit.edu	37	21	47164184	47164184	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47164184delC	uc010gqb.2	+							NM_020528	NP_065389	P57721	PCBP3_HUMAN	poly(rC) binding protein 3 isoform 1						mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		tcccagctcaccgcagccttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16423014	16423015	+	IGR	DEL	TG	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16423014_16423015delTG								POTEH (135077 upstream) : OR11H1 (25811 downstream)																							tgtgtgtgtatgtgtgtgtgtg	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17375815	17375816	+	IGR	INS	-	A	A	rs145883088		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17375815_17375816insA								HSFYL1 (65590 upstream) : GAB4 (67013 downstream)																							acgcagaagctaaaaaaaaagt	0.000													4	4	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22965861	22965862	+	Intron	DEL	AC	-	-	rs71760364	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22965861_22965862delAC	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						atatacacatacacacacacac	0.040													3	3	---	---	---	---	
SLC2A11	66035	broad.mit.edu	37	22	24213596	24213596	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24213596delA	uc002zyn.3	+						SLC2A11_uc002zyl.1_Intron|SLC2A11_uc002zym.3_Intron|SLC2A11_uc002zyo.3_Intron|SLC2A11_uc011ajc.1_Intron|SLC2A11_uc011ajd.1_Intron|SLC2A11_uc002zyp.3_Intron	NM_001024938	NP_001020109	Q9BYW1	GTR11_HUMAN	glucose transporter protein 10 isoform c							integral to membrane|plasma membrane	sugar transmembrane transporter activity			ovary(1)	1						actccatctcaaaaaaaaaaa	0.045													4	2	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	32927982	32927982	+	Intron	DEL	T	-	-	rs34233779		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32927982delT	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron|SYN3_uc011amc.1_5'Flank	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						TGAACACAGATTTTTTTTTTT	0.458													6	3	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33239069	33239069	+	Intron	DEL	T	-	-	rs35707018		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33239069delT	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron|TIMP3_uc003anb.2_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						GGACCTCCCATTTTTTTTTTT	0.308													4	2	---	---	---	---	
APOL2	23780	broad.mit.edu	37	22	36625428	36625428	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36625428delA	uc003aoz.2	-						APOL2_uc011amm.1_Intron|APOL2_uc003apa.2_Intron	NM_030882	NP_112092	Q9BQE5	APOL2_HUMAN	apolipoprotein L2						acute-phase response|cholesterol metabolic process|lipid transport|lipoprotein metabolic process|maternal process involved in female pregnancy|multicellular organismal development	endoplasmic reticulum membrane|extracellular region	high-density lipoprotein particle binding|lipid binding|receptor binding				0						aatcctgaataaaggcttcat	0.010													2	4	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36704317	36704317	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36704317delT	uc003apg.2	-						MYH9_uc003aph.1_Intron	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						tgttttaagattttttttttt	0.164			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				4	2	---	---	---	---	
ARFGAP3	26286	broad.mit.edu	37	22	43239850	43239850	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43239850delA	uc003bdd.2	-						ARFGAP3_uc010gzf.2_Intron|ARFGAP3_uc011apu.1_Intron	NM_014570	NP_055385	Q9NP61	ARFG3_HUMAN	ADP-ribosylation factor GTPase activating						intracellular protein transport|protein secretion|regulation of ARF GTPase activity|vesicle-mediated transport	cytosol|Golgi membrane	ARF GTPase activator activity|protein transporter activity|zinc ion binding			breast(1)	1						AATGGAGGTGAAAAGGGGCAG	0.483													4	2	---	---	---	---	
MPPED1	758	broad.mit.edu	37	22	43895661	43895663	+	Intron	DEL	GGT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43895661_43895663delGGT	uc011apv.1	+						MPPED1_uc011apw.1_Intron|MPPED1_uc011apx.1_Intron|MPPED1_uc011apy.1_Intron|MPPED1_uc011apz.1_Intron	NM_001044370	NP_001037835	O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1								hydrolase activity				0		all_neural(38;0.0244)|Ovarian(80;0.0694)				tgatggtggaggtggtggtggtg	0.000													4	5	---	---	---	---	
NUP50	10762	broad.mit.edu	37	22	45570845	45570845	+	Intron	DEL	T	-	-	rs71707262		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45570845delT	uc003bfr.2	+						NUP50_uc003bfs.2_Intron|NUP50_uc011aqn.1_Intron|NUP50_uc003bft.2_Intron|NUP50_uc011aqo.1_5'Flank	NM_007172	NP_009103	Q9UKX7	NUP50_HUMAN	nucleoporin 50kDa isoform b						carbohydrate metabolic process|glucose transport|intracellular transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore|nucleoplasm	protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		TCCAGTTTAATTTTTTTTTTT	0.338													4	2	---	---	---	---	
UPK3A	7380	broad.mit.edu	37	22	45681511	45681512	+	Intron	INS	-	AGGGTGTTTTTACT	AGGGTGTTTTTACT	rs151261418	by1000genomes	TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45681511_45681512insAGGGTGTTTTTACT	uc003bfy.2	+						UPK3A_uc010gzy.2_Intron	NM_006953	NP_008884	O75631	UPK3A_HUMAN	uroplakin 3A precursor						epithelial cell differentiation	endoplasmic reticulum membrane|integral to membrane					0		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CATGTGGGGGGAGGGCCCAGGT	0.624													4	2	---	---	---	---	
CERK	64781	broad.mit.edu	37	22	47087342	47087342	+	Intron	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47087342delA	uc003bia.2	-						CERK_uc010hae.2_Intron	NM_022766	NP_073603	Q8TCT0	CERK1_HUMAN	ceramide kinase						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|ceramide metabolic process	integral to membrane of membrane fraction|membrane|nucleus	ATP binding|ceramide kinase activity|diacylglycerol kinase activity|magnesium ion binding			skin(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TTGTGAAATTAAAAAAAAAAA	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	50935508	50935509	+	IGR	INS	-	AA	AA	rs34676318		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50935508_50935509insAA								MIOX (6758 upstream) : LMF2 (5867 downstream)																							gactccgtctcaaaaaaaaaaa	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	442201	442202	+	IGR	INS	-	AGAG	AGAG			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:442201_442202insAGAG								PPP2R3B (94574 upstream) : SHOX (142877 downstream)																							aggaaggagacggaggaaggag	0.000													9	5	---	---	---	---	
CSF2RA	1438	broad.mit.edu	37	X	1410194	1410194	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1410194delC	uc010nct.2	+						CSF2RA_uc011mhb.1_Intron|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Intron|CSF2RA_uc004cpo.2_Intron|CSF2RA_uc010ncu.2_Intron|CSF2RA_uc011mhc.1_Intron|CSF2RA_uc004cpp.2_Intron|CSF2RA_uc010ncv.2_Intron|CSF2RA_uc004cpr.2_Intron	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain							extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ttccttccttccctccctccc	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2132327	2132328	+	IGR	INS	-	G	G			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2132327_2132328insG								ASMT (370354 upstream) : DHRSX (5229 downstream)																							aaggaagggaaggaggaaggaa	0.000													4	2	---	---	---	---	
DHRSX	207063	broad.mit.edu	37	X	2149948	2149950	+	Intron	DEL	TCT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2149948_2149950delTCT	uc004cqf.3	-							NM_145177	NP_660160	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				ctttctcttatcttcttcttttc	0.000													3	4	---	---	---	---	
DHRSX	207063	broad.mit.edu	37	X	2186333	2186333	+	Intron	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2186333delC	uc004cqf.3	-							NM_145177	NP_660160	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TTAGAGCAGACCAGTTTGCTT	0.313													4	2	---	---	---	---	
XG	7499	broad.mit.edu	37	X	2693559	2693559	+	Intron	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2693559delG	uc011mhg.1	+						XG_uc010ndb.2_Intron|XG_uc004cqp.2_Intron	NM_175569	NP_780778	P55808	XG_HUMAN	XG glycoprotein isoform 1 precursor							integral to membrane|plasma membrane				ovary(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				gtttctttttgggggaacgaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	3305710	3305711	+	IGR	INS	-	TG	TG	rs67106152		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3305710_3305711insTG								MXRA5 (41026 upstream) : PRKX (216702 downstream)																							atgtgtgtgtatgtgtgtgtat	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	4348055	4348055	+	IGR	DEL	C	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:4348055delC								PRKX (716394 upstream) : None (None downstream)																							gccttggtctcccaaagtact	0.000													4	2	---	---	---	---	
WWC3	55841	broad.mit.edu	37	X	10033358	10033359	+	Intron	DEL	GT	-	-	rs35144812		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10033358_10033359delGT	uc004csx.3	+						WWC3_uc010nds.2_Intron	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3											ovary(4)	4						CAAGCACACCgtgtgtgtgtgt	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	25143461	25143462	+	IGR	DEL	GT	-	-	rs12837340		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:25143461_25143462delGT								ARX (109396 upstream) : None (None downstream)																							AAAGAGTAGGgtgtgtgtgtgt	0.208													2	4	---	---	---	---	
SYTL5	94122	broad.mit.edu	37	X	37913837	37913838	+	Intron	DEL	GT	-	-	rs71844138		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37913837_37913838delGT	uc004ddu.2	+						SYTL5_uc004ddv.2_Intron|SYTL5_uc004ddx.2_Intron	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1						intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						GGGCTCTGGGgtgtgtgtgtgt	0.243													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	58536609	58536610	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:58536609_58536610insT								ZXDA (599542 upstream) : None (None downstream)																							aatatcttcacataaaaactac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61795772	61795773	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61795772_61795773insT								None (None upstream) : SPIN4 (771335 downstream)																							ggcctatggtgaaaaggaaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61847720	61847720	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61847720delT								None (None upstream) : SPIN4 (719388 downstream)																							tgaaacactctttttgtagaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61851896	61851896	+	IGR	DEL	A	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61851896delA								None (None upstream) : SPIN4 (715212 downstream)																							gtggaaaaggaaatatcttcc	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	62238081	62238081	+	IGR	DEL	C	-	-	rs34891285		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62238081delC								None (None upstream) : SPIN4 (329027 downstream)																							ctgggaggcaccccccccccc	0.000													4	2	---	---	---	---	
PIN4	5303	broad.mit.edu	37	X	71401279	71401279	+	5'Flank	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71401279delG	uc004eam.2	+						PIN4_uc004eao.1_5'Flank	NM_006223	NP_006214	Q9Y237	PIN4_HUMAN	protein (peptidyl-prolyl cis/trans isomerase)						protein folding|rRNA processing	cytoplasm|mitochondrial matrix|mitochondrial matrix|nucleolus|nucleolus|preribosome|spindle|spindle	bent DNA binding|DNA binding|double-stranded DNA binding|peptidyl-prolyl cis-trans isomerase activity				0	Renal(35;0.156)					TGAGGGGAACGGGGGAGCTTC	0.642													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	75704790	75704790	+	IGR	DEL	T	-	-	rs146135929		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75704790delT								MAGEE1 (53046 upstream) : MIR384 (434908 downstream)																							gtttttgatgttttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	95726409	95726409	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:95726409delT								LOC643486 (133508 upstream) : DIAPH2 (213253 downstream)																							TAATATGAGCttttttttttt	0.189													4	2	---	---	---	---	
TMEM164	84187	broad.mit.edu	37	X	109258779	109258780	+	Intron	DEL	GT	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109258779_109258780delGT	uc004eom.2	+						TMEM164_uc004eol.2_Intron|TMEM164_uc010npq.2_Intron	NM_032227	NP_115603	Q5U3C3	TM164_HUMAN	transmembrane protein 164 isoform b							integral to membrane				large_intestine(1)|lung(1)|skin(1)	3						AGGAACTTGAgtgtgtgtgtgt	0.361													4	2	---	---	---	---	
TRPC5	7224	broad.mit.edu	37	X	111094738	111094739	+	Intron	INS	-	GTGT	GTGT	rs71830332		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111094738_111094739insGTGT	uc004epl.1	-						TRPC5_uc004epm.1_Intron	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,						axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						GTATTAAGGTGgtgtgtgtgtg	0.317													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	118838964	118838965	+	IGR	INS	-	A	A			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118838964_118838965insA								SEPT6 (11631 upstream) : ANKRD58 (53611 downstream)																							aaccctatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	119017394	119017394	+	IGR	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119017394delT								NDUFA1 (6766 upstream) : AKAP14 (12542 downstream)																							TACTCTAGAAttttttttttt	0.214													4	2	---	---	---	---	
UTP14A	10813	broad.mit.edu	37	X	129057940	129057940	+	Intron	DEL	T	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129057940delT	uc004euz.2	+						UTP14A_uc011mup.1_Intron|UTP14A_uc011muq.1_Intron	NM_006649	NP_006640	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,						rRNA processing	nucleolus|small-subunit processome	protein binding			ovary(2)	2						aatATGCTACttttttttttt	0.030													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	135544129	135544129	+	IGR	DEL	G	-	-			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135544129delG								GPR112 (45082 upstream) : BRS3 (25996 downstream)																							tttgttttgcggggggggacg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10019375	10019376	+	IGR	INS	-	CT	CT	rs33969087		TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10019375_10019376insCT								TTTY22 (368521 upstream) : None (None downstream)																							tgaacacccccgtcagaagttt	0.015													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13402059	13402060	+	IGR	INS	-	T	T			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13402059_13402060insT								None (None upstream) : None (None downstream)																							agaggccttcgttttttcctct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13447881	13447882	+	IGR	INS	-	ATTCCATTGC	ATTCCATTGC			TCGA-66-2727-01	TCGA-66-2727-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13447881_13447882insATTCCATTGC								None (None upstream) : None (None downstream)																							cattgcatactattccattgca	0.020													7	4	---	---	---	---	
