Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ARHGEF16	27237	broad.mit.edu	37	1	3390011	3390011	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3390011G>T	uc001akg.3	+	8	1478	c.1230G>T	c.(1228-1230)GCG>GCT	p.A410A	ARHGEF16_uc001aki.2_Silent_p.A122A|ARHGEF16_uc001akj.2_Silent_p.A122A|ARHGEF16_uc009vli.1_Silent_p.A114A|ARHGEF16_uc010nzh.1_Silent_p.A114A	NM_014448	NP_055263	Q5VV41	ARHGG_HUMAN	Rho guanine exchange factor 16	410	DH.|Required for RHOG activation and mediates interaction with EPHA2.				activation of Cdc42 GTPase activity|activation of Rac GTPase activity|apoptosis|cell chemotaxis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|small GTPase mediated signal transduction	cytosol	PDZ domain binding|receptor tyrosine kinase binding|Rho GTPase binding|Rho guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		GGCGGCCGGCGTGCGGGGGCC	0.662													6	30	---	---	---	---	PASS
CASZ1	54897	broad.mit.edu	37	1	10715789	10715789	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10715789G>A	uc001aro.2	-	9	1902	c.1582C>T	c.(1582-1584)CGT>TGT	p.R528C	CASZ1_uc001arp.1_Missense_Mutation_p.R528C|CASZ1_uc009vmx.2_Missense_Mutation_p.R552C	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a	528					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GGGCTGAAACGCATGAAGCCG	0.607													6	46	---	---	---	---	PASS
FBLIM1	54751	broad.mit.edu	37	1	16101265	16101265	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16101265G>T	uc001axd.1	+	8	1307	c.864G>T	c.(862-864)GAG>GAT	p.E288D	FBLIM1_uc001axe.1_Missense_Mutation_p.E288D|FBLIM1_uc001axf.2_RNA|FBLIM1_uc001axg.1_Missense_Mutation_p.E288D|FBLIM1_uc001axh.1_Missense_Mutation_p.E191D|FBLIM1_uc001axi.1_Missense_Mutation_p.E191D	NM_017556	NP_060026	Q8WUP2	FBLI1_HUMAN	filamin-binding LIM protein-1 isoform a	288	PLEKHC1-binding.|LIM zinc-binding 2.				cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytoskeleton|cytosol|focal adhesion|intracellular membrane-bounded organelle	zinc ion binding			skin(1)	1		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)		GCCAGAACGAGGTGTACTGCC	0.632													8	108	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16892844	16892844	+	Intron	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16892844G>T	uc009vos.1	-						uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TGTTTTCCCTGGACCTGGCAT	0.418													14	628	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16907280	16907280	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16907280G>T	uc009vos.1	-	16	2439	c.1551C>A	c.(1549-1551)TCC>TCA	p.S517S	NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Silent_p.S246S	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	517	NBPF 2.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CATCATGAGAGGATTCTCTGT	0.453													15	740	---	---	---	---	PASS
PADI1	29943	broad.mit.edu	37	1	17566199	17566199	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17566199G>T	uc001bah.1	+	14	1645	c.1553G>T	c.(1552-1554)GGG>GTG	p.G518V	PADI1_uc010oco.1_Missense_Mutation_p.G75V|PADI1_uc010ocp.1_Missense_Mutation_p.G75V|PADI1_uc010ocq.1_5'UTR|PADI1_uc009vpb.1_5'UTR	NM_013358	NP_037490	Q9ULC6	PADI1_HUMAN	peptidylarginine deiminase type I	518					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity				0		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	CTTCTTGCAGGGTTAAAACAC	0.522													6	62	---	---	---	---	PASS
ACTL8	81569	broad.mit.edu	37	1	18152822	18152822	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18152822C>A	uc001bat.2	+	3	1125	c.909C>A	c.(907-909)CTC>CTA	p.L303L		NM_030812	NP_110439	Q9H568	ACTL8_HUMAN	actin-like 8	303						cytoplasm|cytoskeleton				ovary(4)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		GCAACACCCTCTATCCCGGGT	0.612											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	51	---	---	---	---	PASS
KIF17	57576	broad.mit.edu	37	1	21009181	21009181	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21009181C>T	uc001bdr.3	-	11	2546	c.2428G>A	c.(2428-2430)GCC>ACC	p.A810T	KIF17_uc001bdp.3_Missense_Mutation_p.A88T|KIF17_uc001bdq.3_Missense_Mutation_p.A88T|KIF17_uc009vpx.2_Missense_Mutation_p.A180T|KIF17_uc001bds.3_Missense_Mutation_p.A810T	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	810	Potential.				microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TTGCTCTTGGCCCGCACTTCC	0.637													6	79	---	---	---	---	PASS
USP48	84196	broad.mit.edu	37	1	22079485	22079485	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22079485C>A	uc001bfb.2	-	4	778	c.540G>T	c.(538-540)CAG>CAT	p.Q180H	USP48_uc010odq.1_Missense_Mutation_p.Q180H|USP48_uc009vqc.2_Missense_Mutation_p.Q180H|USP48_uc001bfc.2_Missense_Mutation_p.Q180H|USP48_uc001bfe.1_Missense_Mutation_p.Q180H|USP48_uc001bff.2_Missense_Mutation_p.Q180H	NM_032236	NP_115612	Q86UV5	UBP48_HUMAN	ubiquitin specific protease 48 isoform a	180					ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		CAGTTCTTACCTGCTGTTGTC	0.353													9	24	---	---	---	---	PASS
KPNA6	23633	broad.mit.edu	37	1	32631696	32631696	+	Intron	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32631696G>T	uc001bug.2	+						KPNA6_uc001buh.2_Intron|KPNA6_uc010ogx.1_Intron|KPNA6_uc010ogy.1_Intron|KPNA6_uc009vtz.2_Intron	NM_012316	NP_036448	O60684	IMA7_HUMAN	karyopherin alpha 6						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CTGTGCTTTTGGTGTTCTAGG	0.289													5	88	---	---	---	---	PASS
S100PBP	64766	broad.mit.edu	37	1	33291859	33291859	+	Silent	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33291859C>T	uc001bvz.2	+	3	436	c.159C>T	c.(157-159)TAC>TAT	p.Y53Y	S100PBP_uc001bwa.1_Silent_p.Y53Y|S100PBP_uc001bwb.1_Silent_p.Y53Y|S100PBP_uc001bwc.2_Silent_p.Y53Y|S100PBP_uc001bwd.2_RNA	NM_022753	NP_073590	Q96BU1	S1PBP_HUMAN	S100P binding protein isoform a	53						nucleus	calcium-dependent protein binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				ATGTAAATTACACAGAGGAAG	0.473													7	58	---	---	---	---	PASS
THRAP3	9967	broad.mit.edu	37	1	36755023	36755023	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36755023C>A	uc001cae.3	+	5	1627	c.1403C>A	c.(1402-1404)TCA>TAA	p.S468*	THRAP3_uc001caf.3_Nonsense_Mutation_p.S468*|THRAP3_uc001cag.1_Nonsense_Mutation_p.S468*	NM_005119	NP_005110	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	468					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ATP binding|ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(5)|lung(3)|breast(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GAGGAGAAGTCAGGCAAATGG	0.453			T	USP6	aneurysmal bone cysts								14	61	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39801599	39801599	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39801599C>A	uc010oiu.1	+	1	4790	c.4659C>A	c.(4657-4659)CAC>CAA	p.H1553Q	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3118					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AAGGATTGCACTACCAGGAAT	0.468													4	72	---	---	---	---	PASS
HIVEP3	59269	broad.mit.edu	37	1	42048104	42048104	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42048104C>G	uc001cgz.3	-	4	3578	c.2365G>C	c.(2365-2367)GAG>CAG	p.E789Q	HIVEP3_uc001cha.3_Missense_Mutation_p.E789Q|HIVEP3_uc001cgy.2_RNA	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer	789	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN (By similarity).				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GTTCTCCTCTCCTTCCCTGAT	0.542													11	43	---	---	---	---	PASS
TIE1	7075	broad.mit.edu	37	1	43782880	43782880	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43782880C>T	uc001ciu.2	+	15	2499	c.2420C>T	c.(2419-2421)ACC>ATC	p.T807I	TIE1_uc010oke.1_Missense_Mutation_p.T762I|TIE1_uc009vwq.2_Missense_Mutation_p.T763I|TIE1_uc010okg.1_Missense_Mutation_p.T452I	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	807	Cytoplasmic (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGCGAGGAGACCATCCTGCAG	0.607													5	48	---	---	---	---	PASS
STIL	6491	broad.mit.edu	37	1	47717149	47717149	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47717149G>T	uc001crc.1	-	17	3678	c.3523C>A	c.(3523-3525)CAT>AAT	p.H1175N	TAL1_uc001crb.1_Intron|STIL_uc010omn.1_Missense_Mutation_p.H1129N|STIL_uc010omo.1_Missense_Mutation_p.H1158N|STIL_uc001crd.1_Missense_Mutation_p.H1176N|STIL_uc001cre.1_Missense_Mutation_p.H1175N	NM_003035	NP_003026	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus isoform 2	1175					cell proliferation|multicellular organismal development	centrosome|cytosol				lung(2)|skin(1)	3		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				ATTATTTCATGGTCATTCTTA	0.383													6	91	---	---	---	---	PASS
LRP8	7804	broad.mit.edu	37	1	53728158	53728158	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53728158C>A	uc001cvi.1	-	11	1876	c.1734G>T	c.(1732-1734)CTG>CTT	p.L578L	LRP8_uc001cvh.1_Silent_p.L131L|LRP8_uc001cvk.1_Silent_p.L408L|LRP8_uc001cvj.1_Silent_p.L578L|LRP8_uc001cvl.1_Silent_p.L449L|LRP8_uc001cvm.1_Silent_p.L163L	NM_004631	NP_004622	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein	578	LDL-receptor class B 3.|Extracellular (Potential).				cytokine-mediated signaling pathway|endocytosis|lipid metabolic process|platelet activation|proteolysis	caveola	calcium ion binding|very-low-density lipoprotein particle receptor activity				0						TGTCTGACACCAGTGTTTGCC	0.512													10	236	---	---	---	---	PASS
C8B	732	broad.mit.edu	37	1	57409428	57409428	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57409428A>T	uc001cyp.2	-	8	1242	c.1175T>A	c.(1174-1176)GTC>GAC	p.V392D	C8B_uc010oon.1_Missense_Mutation_p.V330D|C8B_uc010ooo.1_Missense_Mutation_p.V340D	NM_000066	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	392	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex				central_nervous_system(2)|large_intestine(1)|ovary(1)	4						ACTGACGTAGACCTCTTCAAT	0.408													13	85	---	---	---	---	PASS
PHGDH	26227	broad.mit.edu	37	1	120263815	120263815	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120263815G>C	uc001ehz.2	+	2	388	c.161G>C	c.(160-162)CGC>CCC	p.R54P	PHGDH_uc009whl.2_5'UTR|PHGDH_uc009whm.2_5'UTR|PHGDH_uc001eia.2_Missense_Mutation_p.R54P|PHGDH_uc009whn.2_Missense_Mutation_p.R54P|PHGDH_uc001eib.2_Missense_Mutation_p.R20P	NM_006623	NP_006614	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	54					brain development|L-serine biosynthetic process		electron carrier activity|NAD binding|phosphoglycerate dehydrogenase activity			ovary(1)	1	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)	NADH(DB00157)	CTTATTGTTCGCTCTGCCACC	0.522													22	81	---	---	---	---	PASS
ANKRD35	148741	broad.mit.edu	37	1	145561622	145561622	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145561622G>T	uc001eob.1	+	10	1418	c.1310G>T	c.(1309-1311)AGG>ATG	p.R437M	NBPF10_uc001emp.3_Intron|ANKRD35_uc010oyx.1_Missense_Mutation_p.R280M	NM_144698	NP_653299	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	437										ovary(4)|skin(1)	5	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GAGACCATCAGGAAAGCCACA	0.572													6	85	---	---	---	---	PASS
RPTN	126638	broad.mit.edu	37	1	152128552	152128552	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152128552G>T	uc001ezs.1	-	3	1088	c.1023C>A	c.(1021-1023)TCC>TCA	p.S341S		NM_001122965	NP_001116437	Q6XPR3	RPTN_HUMAN	repetin	341	Gln-rich.					proteinaceous extracellular matrix	calcium ion binding				0						GACCATAGTGGGAACTCTGAC	0.498													12	476	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152285911	152285911	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152285911C>G	uc001ezu.1	-	3	1487	c.1451G>C	c.(1450-1452)CGG>CCG	p.R484P	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	484	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGTCCCGGTCCGTCCATGGGC	0.607									Ichthyosis				37	201	---	---	---	---	PASS
LCE3D	84648	broad.mit.edu	37	1	152552178	152552178	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152552178C>A	uc001fab.2	-	2	292	c.235G>T	c.(235-237)GGC>TGC	p.G79C		NM_032563	NP_115952	Q9BYE3	LCE3D_HUMAN	late cornified envelope 3D	79					keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0323)|Kidney(5;0.0378)		GAGCCCCCGCCTTGCTGACCA	0.647													9	49	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155448861	155448861	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155448861C>A	uc009wqq.2	-	3	4280	c.3800G>T	c.(3799-3801)AGG>ATG	p.R1267M	ASH1L_uc001fkt.2_Missense_Mutation_p.R1267M|ASH1L_uc009wqr.1_Missense_Mutation_p.R1267M	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	1267					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TCGTTTCTGCCTTTTCATCTT	0.408													27	108	---	---	---	---	PASS
KIRREL	55243	broad.mit.edu	37	1	158057651	158057651	+	Splice_Site	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158057651G>C	uc001frn.3	+	6	1171	c.767_splice	c.e6+1	p.R256_splice	KIRREL_uc010pib.1_Splice_Site_p.R156_splice|KIRREL_uc009wsq.2_Splice_Site_p.R92_splice|KIRREL_uc001fro.3_Splice_Site_p.R54_splice	NM_018240	NP_060710	Q96J84	KIRR1_HUMAN	kin of IRRE like precursor							integral to membrane				ovary(1)	1	all_hematologic(112;0.0378)					TGGGCTACAGGTGAGGGGGTC	0.587											OREG0013906	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	23	---	---	---	---	PASS
MNDA	4332	broad.mit.edu	37	1	158815425	158815425	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158815425C>T	uc001fsz.1	+	5	819	c.619C>T	c.(619-621)CCC>TCC	p.P207S		NM_002432	NP_002423	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	207	HIN-200.				B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(2)|skin(2)	4	all_hematologic(112;0.0378)					AAGAAATGTTCCCCAAAACGA	0.443													6	40	---	---	---	---	PASS
MYOC	4653	broad.mit.edu	37	1	171621186	171621186	+	Missense_Mutation	SNP	C	A	A	rs144579767		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171621186C>A	uc001ghu.2	-	1	588	c.566G>T	c.(565-567)CGA>CTA	p.R189L	MYOC_uc010pmk.1_Missense_Mutation_p.R131L	NM_000261	NP_000252	Q99972	MYOC_HUMAN	myocilin precursor	189			R -> Q.		anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity			lung(1)	1	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					AGCAGTGTCTCGGGTCTGGGG	0.567													52	164	---	---	---	---	PASS
MRPS14	63931	broad.mit.edu	37	1	174987652	174987652	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174987652G>T	uc001gkk.2	-	2	123	c.106C>A	c.(106-108)CGC>AGC	p.R36S	MRPS14_uc009wwr.2_Missense_Mutation_p.R21S	NM_022100	NP_071383	O60783	RT14_HUMAN	mitochondrial ribosomal protein S14	36					translation	mitochondrial ribosome	protein binding|structural constituent of ribosome				0						TTCACATCGCGCCACATTCTC	0.443													4	61	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175053048	175053048	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175053048C>G	uc001gkl.1	+	5	1324	c.1211C>G	c.(1210-1212)CCC>CGC	p.P404R	TNN_uc010pmx.1_Missense_Mutation_p.P404R	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	404	Fibronectin type-III 2.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		AGCAGTGACCCCAAGAGCCGA	0.542													9	37	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176679108	176679108	+	Intron	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176679108T>C	uc001gkz.2	+						PAPPA2_uc009www.2_Intron	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1						cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						TCACACAATATTTCTTGGCAG	0.403													9	22	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	177001635	177001635	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177001635G>T	uc001glc.2	-	3	1034	c.822C>A	c.(820-822)TCC>TCA	p.S274S	ASTN1_uc001glb.1_Silent_p.S274S|ASTN1_uc001gld.1_Silent_p.S274S|ASTN1_uc009wwx.1_Silent_p.S274S|ASTN1_uc001gle.3_RNA	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	274					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						AGCCCTGCAGGGAGTCGAGGG	0.587													6	75	---	---	---	---	PASS
LAMC1	3915	broad.mit.edu	37	1	182993066	182993066	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182993066C>A	uc001gpy.3	+	1	472	c.215C>A	c.(214-216)CCG>CAG	p.P72Q	LAMC1_uc001gpx.2_Missense_Mutation_p.P72Q	NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	72	Laminin N-terminal.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGTGGGACTCCGCCCGAGGAA	0.687											OREG0014040	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	18	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186147831	186147831	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186147831C>A	uc001grq.1	+	104	16456	c.16227C>A	c.(16225-16227)TCC>TCA	p.S5409S	HMCN1_uc001grs.1_Intron	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	5409					response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CATCTCTCTCCAGGACTAGAA	0.438													6	100	---	---	---	---	PASS
CFHR4	10877	broad.mit.edu	37	1	196871656	196871656	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196871656G>T	uc001gto.2	+	2	236	c.167G>T	c.(166-168)TGT>TTT	p.C56F	CFHR4_uc009wyy.2_Missense_Mutation_p.C55F|CFHR4_uc001gtp.2_Missense_Mutation_p.C56F	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	56	Sushi 1.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						TCCTATTACTGTGATCAAAAT	0.403													4	43	---	---	---	---	PASS
PIK3C2B	5287	broad.mit.edu	37	1	204433648	204433648	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204433648C>A	uc001haw.2	-	5	1598	c.1119G>T	c.(1117-1119)GGG>GGT	p.G373G	PIK3C2B_uc010pqv.1_Silent_p.G373G|PIK3C2B_uc001hax.1_Silent_p.G373G|PIK3C2B_uc009xbd.1_RNA	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	373					cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			TGACCTCATCCCCGAGGTGCT	0.527													16	77	---	---	---	---	PASS
MAPKAPK2	9261	broad.mit.edu	37	1	206905409	206905409	+	Intron	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206905409C>A	uc001hem.1	+						MAPKAPK2_uc001hel.1_Missense_Mutation_p.D362E	NM_032960	NP_116584	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated						activation of MAPK activity|hormone biosynthetic process|innate immune response|leukotriene biosynthetic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|prostanoid metabolic process|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|signal transducer activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			AGAACAGCGACCAGGCCACTT	0.537													8	114	---	---	---	---	PASS
CR2	1380	broad.mit.edu	37	1	207643415	207643415	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207643415C>A	uc001hfw.2	+	6	1287	c.1193C>A	c.(1192-1194)ACA>AAA	p.T398K	CR2_uc001hfv.2_Missense_Mutation_p.T398K|CR2_uc009xch.2_Missense_Mutation_p.T398K|CR2_uc009xci.1_5'Flank	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	398	Sushi 6.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						GCCCAAGGCACATGGGAGCCA	0.458													8	28	---	---	---	---	PASS
TATDN3	128387	broad.mit.edu	37	1	212988413	212988413	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212988413G>T	uc001hjo.2	+	10	834	c.740G>T	c.(739-741)GGG>GTG	p.G247V	TATDN3_uc010ptj.1_3'UTR|TATDN3_uc010ptk.1_Missense_Mutation_p.G254V|TATDN3_uc001hjp.2_Missense_Mutation_p.G246V|TATDN3_uc010ptl.1_Missense_Mutation_p.G226V|TATDN3_uc010ptm.1_Missense_Mutation_p.G194V	NM_001042552	NP_001036017	Q17R31	TATD3_HUMAN	TatD DNase domain containing 3 isoform 1	247						nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00699)|all cancers(67;0.0118)|GBM - Glioblastoma multiforme(131;0.0801)|Epithelial(68;0.104)		CAGGTGAAAGGGATCTCAGTG	0.423													7	98	---	---	---	---	PASS
AIDA	64853	broad.mit.edu	37	1	222867612	222867612	+	Intron	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222867612G>A	uc001hnn.2	-						AIDA_uc001hno.2_Intron|AIDA_uc010pus.1_Intron	NM_022831	NP_073742	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated						dorsal/ventral pattern formation|negative regulation of JNK cascade|negative regulation of JUN kinase activity|regulation of protein homodimerization activity						0						TTTTCTGCAGGGGAATAAAAA	0.299													19	80	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237666802	237666802	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237666802C>A	uc001hyl.1	+	22	2730	c.2610C>A	c.(2608-2610)AGC>AGA	p.S870R		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	870	Cytoplasmic (By similarity).|1.|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGGATACCAGCCAGGTACCAA	0.418													18	66	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237670108	237670108	+	Silent	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237670108T>C	uc001hyl.1	+	23	2832	c.2712T>C	c.(2710-2712)TAT>TAC	p.Y904Y		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	904	Cytoplasmic (By similarity).|1.|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCTGGCAGTATGGTCCGGTAT	0.373													14	48	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237813369	237813369	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237813369A>T	uc001hyl.1	+	50	7825	c.7705A>T	c.(7705-7707)ATA>TTA	p.I2569L		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2569	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCGGGATTCCATAGAAGTTTG	0.398													16	86	---	---	---	---	PASS
OR2G3	81469	broad.mit.edu	37	1	247768907	247768907	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247768907G>T	uc010pyz.1	+	1	20	c.20G>T	c.(19-21)AGT>ATT	p.S7I		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	7	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GGCAATGAGAGTTCCCTAATG	0.463													5	27	---	---	---	---	PASS
TRIM58	25893	broad.mit.edu	37	1	248039414	248039414	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248039414G>T	uc001ido.2	+	6	1132	c.1084G>T	c.(1084-1086)GTC>TTC	p.V362F	OR2W3_uc001idp.1_Intron	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58	362	B30.2/SPRY.					intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGGTTTAGGGGTCTGTCAAGA	0.552													6	26	---	---	---	---	PASS
YIPF4	84272	broad.mit.edu	37	2	32526505	32526505	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32526505G>C	uc002rok.2	+	5	805	c.538G>C	c.(538-540)GTA>CTA	p.V180L		NM_032312	NP_115688	Q9BSR8	YIPF4_HUMAN	Yip1 domain family, member 4	180	Helical; (Potential).					endoplasmic reticulum|integral to membrane	protein binding				0	Acute lymphoblastic leukemia(172;0.155)					TCCTCTCATTGTAATAGCCCC	0.318													18	57	---	---	---	---	PASS
TTC27	55622	broad.mit.edu	37	2	32855589	32855589	+	Splice_Site	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32855589G>T	uc002rom.2	+	2	320	c.89_splice	c.e2-1	p.E30_splice	TTC27_uc010ymx.1_Splice_Site	NM_017735	NP_060205	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27								protein binding			central_nervous_system(1)	1						TTATATTACAGAGAGTGGATC	0.303													8	36	---	---	---	---	PASS
C2orf61	285051	broad.mit.edu	37	2	47378423	47378423	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47378423G>C	uc002rvs.2	-	3	500	c.373C>G	c.(373-375)CCC>GCC	p.P125A	C2orf61_uc010fbd.2_RNA|C2orf61_uc010yog.1_Missense_Mutation_p.P125A	NM_173649	NP_775920	Q8N801	CB061_HUMAN	hypothetical protein LOC285051 isoform 2	125								p.0?(2)			0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			AGTGTGCTGGGGCTTGGCCGT	0.453													8	57	---	---	---	---	PASS
LRRTM1	347730	broad.mit.edu	37	2	80529786	80529786	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80529786G>A	uc002sok.1	-	2	1429	c.1159C>T	c.(1159-1161)CCT>TCT	p.P387S	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	387	Lumenal (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						GAGCTGGCAGGGGGCCCCAGA	0.726										HNSCC(69;0.2)			7	11	---	---	---	---	PASS
EIF2AK3	9451	broad.mit.edu	37	2	88874860	88874860	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88874860G>T	uc002stc.3	-	13	2343	c.2141C>A	c.(2140-2142)CCT>CAT	p.P714H		NM_004836	NP_004827	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha	714	Cytoplasmic (Potential).|Protein kinase.				activation of caspase activity|bone mineralization|calcium-mediated signaling|chondrocyte development|endocrine pancreas development|endoplasmic reticulum organization|endoplasmic reticulum unfolded protein response|ER overload response|insulin secretion|insulin-like growth factor receptor signaling pathway|negative regulation of myelination|negative regulation of translational initiation in response to stress|protein autophosphorylation|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|identical protein binding			ovary(3)	3						TTGTGGTGAAGGAGCTATGAT	0.453													7	117	---	---	---	---	PASS
BUB1	699	broad.mit.edu	37	2	111398613	111398613	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111398613G>T	uc002tgc.2	-	23	3065	c.2953C>A	c.(2953-2955)CAG>AAG	p.Q985K	BUB1_uc010yxh.1_Missense_Mutation_p.Q965K|BUB1_uc010fkb.2_Missense_Mutation_p.Q928K	NM_004336	NP_004327	O43683	BUB1_HUMAN	budding uninhibited by benzimidazoles 1	985	Protein kinase.				apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		TTTTATACCTGGTAGTTCCAT	0.368													5	49	---	---	---	---	PASS
INHBB	3625	broad.mit.edu	37	2	121106938	121106938	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121106938T>G	uc002tmn.2	+	2	758	c.712T>G	c.(712-714)TTG>GTG	p.L238V		NM_002193	NP_002184	P09529	INHBB_HUMAN	inhibin beta B subunit preproprotein	238					activin receptor signaling pathway|cellular response to insulin stimulus|cellular response to starvation|defense response|fat cell differentiation|growth|negative regulation of follicle-stimulating hormone secretion|negative regulation of hepatocyte growth factor biosynthetic process|negative regulation of insulin secretion|ovarian follicle development|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation	extracellular region|perinuclear region of cytoplasm	cytokine activity|growth factor activity|hormone activity|host cell surface receptor binding|protein homodimerization activity			pancreas(2)|skin(1)	3		Prostate(154;0.122)				CATCCAGGCCTTGTTTGAGCG	0.647													7	82	---	---	---	---	PASS
GLI2	2736	broad.mit.edu	37	2	121742113	121742113	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121742113C>A	uc010flp.2	+	11	1780	c.1750C>A	c.(1750-1752)CAT>AAT	p.H584N	GLI2_uc002tmq.1_Missense_Mutation_p.H256N|GLI2_uc002tmr.1_Missense_Mutation_p.H239N|GLI2_uc002tmt.3_Missense_Mutation_p.H256N|GLI2_uc002tmu.3_Missense_Mutation_p.H239N|GLI2_uc002tmw.1_Missense_Mutation_p.H567N	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	584	C2H2-type 5.				axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				TCTCCGGAAGCATGTGAAAAC	0.572													20	199	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152362088	152362088	+	Intron	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152362088C>A	uc010fnx.2	-						NEB_uc002txr.2_Intron|RIF1_uc002txp.2_Intron|NEB_uc002txq.2_5'Flank|NEB_uc010zca.1_Intron|NEB_uc010zcb.1_Intron|NEB_uc002txt.3_Intron	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		ACTTCACCTGCAGATTTAAAA	0.398													5	61	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155158018	155158018	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155158018G>T	uc002tyr.3	+	9	1639	c.1072G>T	c.(1072-1074)GGT>TGT	p.G358C	GALNT13_uc002tyt.3_Missense_Mutation_p.G358C|GALNT13_uc010foc.1_Missense_Mutation_p.G177C|GALNT13_uc010fod.2_Missense_Mutation_p.G111C	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	358	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						TGGTGGCACTGGTCATGTCAT	0.438													7	85	---	---	---	---	PASS
GPD2	2820	broad.mit.edu	37	2	157425354	157425354	+	Silent	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157425354C>T	uc002tzf.3	+	10	1543	c.1183C>T	c.(1183-1185)CTG>TTG	p.L395L	GPD2_uc010zch.1_Silent_p.L168L|GPD2_uc002tzd.3_Silent_p.L395L|GPD2_uc002tze.1_RNA	NM_001083112	NP_001076581	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2,	395					cellular lipid metabolic process	glycerol-3-phosphate dehydrogenase complex|mitochondrial inner membrane	calcium ion binding|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity			ovary(1)	1						AGGGGATGTCCTGGCAGCATG	0.398													8	34	---	---	---	---	PASS
ACVR1C	130399	broad.mit.edu	37	2	158412595	158412595	+	Intron	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158412595G>T	uc002tzk.3	-						ACVR1C_uc002tzl.3_Intron|ACVR1C_uc010fof.2_Intron|ACVR1C_uc010foe.2_Intron	NM_145259	NP_660302	Q8NER5	ACV1C_HUMAN	activin A receptor, type IC isoform 1						apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7						AATGGACAATGGTAACATACC	0.343													4	28	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168096359	168096359	+	Intron	SNP	T	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168096359T>A	uc002udx.2	+						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Intron|XIRP2_uc010fpq.2_Intron|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GTCTGTGTGCTTTCAGGAGGC	0.358													11	60	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168097247	168097247	+	Splice_Site	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168097247G>A	uc002udx.2	+	6	1060	c.1042_splice	c.e6+1	p.V348_splice	XIRP2_uc010fpn.2_Splice_Site_p.V381_splice|XIRP2_uc010fpo.2_Splice_Site_p.V348_splice|XIRP2_uc010fpp.2_Splice_Site_p.V348_splice|XIRP2_uc002udy.2_Splice_Site_p.V173_splice|XIRP2_uc010fpq.2_Splice_Site_p.V126_splice|XIRP2_uc010fpr.2_Splice_Site_p.V126_splice	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						CAAGAAACTGGTAAGAGTCTG	0.373													5	48	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170030452	170030452	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170030452G>T	uc002ues.2	-	56	11204	c.10991C>A	c.(10990-10992)TCG>TAG	p.S3664*		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3664	LDL-receptor class A 29.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	GGGCTCATCCGAGTGGTCTCC	0.577													5	69	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179590382	179590382	+	Intron	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179590382C>A	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGTTCTGAACAGGAAAAGAT	0.433													4	20	---	---	---	---	PASS
FAM171B	165215	broad.mit.edu	37	2	187627554	187627554	+	3'UTR	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187627554C>T	uc002ups.2	+	8					FAM171B_uc002upr.1_3'UTR|FAM171B_uc002upt.2_3'UTR	NM_177454	NP_803237	Q6P995	F171B_HUMAN	KIAA1946							integral to membrane	DNA binding			ovary(6)|breast(3)|central_nervous_system(1)	10						AAATTAACTCCAATGGGGATT	0.433													6	29	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215884427	215884427	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215884427C>A	uc002vew.2	-	12	1601	c.1381G>T	c.(1381-1383)GGG>TGG	p.G461W	ABCA12_uc002vev.2_Missense_Mutation_p.G143W|ABCA12_uc010zjn.1_5'UTR	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	461					cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CACAGGCTCCCAAAGCTCATA	0.458													4	19	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225750385	225750385	+	Intron	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225750385C>A	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002vod.1_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GATGTCTACTCACCTGCACCA	0.269													4	14	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227890527	227890527	+	Intron	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227890527C>A	uc010zlt.1	-							NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor						axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CCTCTGGGACCTAGAGGGATC	0.383													11	70	---	---	---	---	PASS
HJURP	55355	broad.mit.edu	37	2	234762542	234762542	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234762542G>C	uc002vvg.2	-	2	198	c.132C>G	c.(130-132)TTC>TTG	p.F44L	HJURP_uc010znd.1_Missense_Mutation_p.F37L|HJURP_uc010zne.1_Missense_Mutation_p.F37L	NM_018410	NP_060880	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	44					cell cycle|CenH3-containing nucleosome assembly at centromere|centromeric core chromatin assembly|chromosome segregation|regulation of DNA binding|regulation of protein complex assembly	condensed chromosome kinetochore|cytoplasm|nucleolus|nucleoplasm	DNA binding|histone binding			ovary(1)	1		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		GGGTGTCCTCGAAGGGCTGGT	0.642													4	69	---	---	---	---	PASS
FARP2	9855	broad.mit.edu	37	2	242373648	242373648	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242373648G>T	uc002wbi.1	+	10	1060	c.943G>T	c.(943-945)GAG>TAG	p.E315*	FARP2_uc010zoq.1_Nonsense_Mutation_p.E315*|FARP2_uc010zor.1_Nonsense_Mutation_p.E315*	NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	315	FERM.				axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GATTTGTGTGGAGTATCACAC	0.428													6	74	---	---	---	---	PASS
EDEM1	9695	broad.mit.edu	37	3	5249922	5249922	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5249922G>T	uc003bqi.2	+	8	1615	c.1483G>T	c.(1483-1485)GTG>TTG	p.V495L	EDEM1_uc011asz.1_Missense_Mutation_p.V273L|EDEM1_uc003bqh.2_Missense_Mutation_p.V495L	NM_014674	NP_055489	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like	495	Lumenal (Potential).				ER-associated protein catabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	integral to endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			ovary(2)|breast(1)	3				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		ACCAGAGTTAGTGGAATCCAC	0.463													17	37	---	---	---	---	PASS
SH3BP5	9467	broad.mit.edu	37	3	15301308	15301308	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15301308G>T	uc003bzp.1	-	6	818	c.629C>A	c.(628-630)CCT>CAT	p.P210H	SH3BP5_uc010hem.1_Intron|SH3BP5_uc003bzq.1_Missense_Mutation_p.P53H|SH3BP5_uc003bzr.1_Missense_Mutation_p.P53H|uc003bzo.1_RNA	NM_004844	NP_004835	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)	210					intracellular signal transduction	mitochondrion	protein kinase inhibitor activity|SH3 domain binding				0						TTCAAAATAAGGCCTGCAGAA	0.448													9	164	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38805039	38805039	+	Silent	SNP	T	G	G	rs150977149	byFrequency	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38805039T>G	uc003ciq.2	-	5	648	c.648A>C	c.(646-648)ACA>ACC	p.T216T		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	216	I.|Helical; Voltage-sensor; Name=S4 of repeat I; (Potential).				sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	GAACTCTGAATGTCCGCAGGC	0.403													11	54	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48664368	48664368	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48664368T>C	uc003cuf.1	-	53	12172	c.12172A>G	c.(12172-12174)ATC>GTC	p.I4058V	SLC26A6_uc003cug.2_Missense_Mutation_p.I651V|SLC26A6_uc003cuh.2_Missense_Mutation_p.I672V|SLC26A6_uc010hke.2_Missense_Mutation_p.I504V|SLC26A6_uc003cuk.2_Missense_Mutation_p.I564V|SLC26A6_uc003cui.2_Missense_Mutation_p.I671V|SLC26A6_uc003cuj.2_Missense_Mutation_p.I653V|SLC26A6_uc011bbp.1_Missense_Mutation_p.I636V	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	Error:Variant_position_missing_in_Q9NYQ7_after_alignment					homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGGTCCAGGATGAGGCTGTGG	0.597													10	50	---	---	---	---	PASS
IQCF2	389123	broad.mit.edu	37	3	51895936	51895936	+	Silent	SNP	A	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51895936A>C	uc003dbt.1	+	2	119	c.81A>C	c.(79-81)ACA>ACC	p.T27T	IQCF1_uc003dbq.3_Intron|IQCF2_uc003dbu.1_RNA	NM_203424	NP_982248	Q8IXL9	IQCF2_HUMAN	IQ motif containing F2	27											0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AATGGAAGACATTGCAGAAGA	0.328													10	43	---	---	---	---	PASS
GNL3	26354	broad.mit.edu	37	3	52724612	52724612	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52724612G>T	uc003dfd.2	+	7	719	c.546G>T	c.(544-546)CTG>CTT	p.L182L	GNL3_uc011beh.1_RNA|GNL3_uc003dfe.2_Silent_p.L170L|GNL3_uc003dff.2_Silent_p.L170L|SNORD19B_uc010hml.1_5'Flank|SNORD69_uc003dfh.1_5'Flank	NM_014366	NP_055181	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3	182					regulation of cell proliferation	nucleolus	GTP binding|protein binding				0				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		TATCAGATCTGGTACCAAAGG	0.254													8	284	---	---	---	---	PASS
CACNA2D3	55799	broad.mit.edu	37	3	54905622	54905622	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54905622G>T	uc003dhf.2	+	18	1731	c.1683G>T	c.(1681-1683)GAG>GAT	p.E561D	CACNA2D3_uc011beu.1_RNA|CACNA2D3_uc003dhg.1_Missense_Mutation_p.E467D|CACNA2D3_uc003dhh.1_RNA|CACNA2D3_uc010hmv.1_Missense_Mutation_p.E295D	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha	561	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		ACCTCTCTGAGGTGGAGTGGG	0.473													6	86	---	---	---	---	PASS
C3orf63	23272	broad.mit.edu	37	3	56661628	56661628	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56661628G>T	uc003did.3	-	19	3930	c.3829C>A	c.(3829-3831)CCA>ACA	p.P1277T	C3orf63_uc003dib.3_Missense_Mutation_p.P396T|C3orf63_uc003dic.3_Missense_Mutation_p.P901T|C3orf63_uc003die.3_Missense_Mutation_p.P1338T	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b	1338										ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)		ACAACCTCTGGGTTTAGAATT	0.353													5	49	---	---	---	---	PASS
DZIP3	9666	broad.mit.edu	37	3	108373066	108373066	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108373066A>T	uc003dxd.2	+	19	2530	c.2108A>T	c.(2107-2109)AAA>ATA	p.K703I	DZIP3_uc003dxf.1_Missense_Mutation_p.K703I|DZIP3_uc011bhm.1_Missense_Mutation_p.K154I|DZIP3_uc003dxg.1_Missense_Mutation_p.K426I	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	703					protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						AGACTTATAAAAGATGATGCA	0.403													11	37	---	---	---	---	PASS
SLC35A5	55032	broad.mit.edu	37	3	112300035	112300035	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112300035G>T	uc003dze.2	+	6	1316	c.1071G>T	c.(1069-1071)CTG>CTT	p.L357L		NM_017945	NP_060415	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	357	Helical; (Potential).					Golgi membrane|integral to membrane	nucleotide-sugar transmembrane transporter activity|sugar:hydrogen symporter activity			ovary(1)	1						GGCCCTCCCTGGAATTTTTCT	0.458													5	31	---	---	---	---	PASS
CCDC80	151887	broad.mit.edu	37	3	112357818	112357818	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112357818T>A	uc003dzf.2	-	2	1153	c.935A>T	c.(934-936)AAA>ATA	p.K312I	CCDC80_uc011bhv.1_Missense_Mutation_p.K312I|CCDC80_uc003dzg.2_Missense_Mutation_p.K312I|CCDC80_uc003dzh.1_Missense_Mutation_p.K312I	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	312										ovary(2)	2						TGGGTCCTCTTTCTTCTTCTC	0.607													21	62	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121206859	121206859	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121206859G>T	uc003eee.3	-	16	5048	c.4919C>A	c.(4918-4920)CCA>CAA	p.P1640Q	POLQ_uc003eed.2_Missense_Mutation_p.P812Q	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	1640					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		TTGCAGTCCTGGACTTAGATC	0.348								DNA_polymerases_(catalytic_subunits)					6	90	---	---	---	---	PASS
SEMA5B	54437	broad.mit.edu	37	3	122641184	122641184	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122641184C>A	uc003efz.1	-	11	1687	c.1383G>T	c.(1381-1383)GAG>GAT	p.E461D	SEMA5B_uc011bju.1_Missense_Mutation_p.E403D|SEMA5B_uc003ega.1_RNA|SEMA5B_uc003egb.1_Missense_Mutation_p.E461D|SEMA5B_uc010hro.1_Missense_Mutation_p.E403D|SEMA5B_uc010hrp.1_RNA	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1	461	Extracellular (Potential).|Sema.				cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)		TGACACAGGGCTCGGGTGTCA	0.637													7	19	---	---	---	---	PASS
MYLK	4638	broad.mit.edu	37	3	123339143	123339143	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123339143G>T	uc003ego.2	-	32	5561	c.5279C>A	c.(5278-5280)TCT>TAT	p.S1760Y	uc003egk.2_Intron|MYLK_uc003egl.2_5'UTR|MYLK_uc003egm.2_5'UTR|MYLK_uc010hrr.2_Missense_Mutation_p.S195Y|MYLK_uc011bjv.1_Missense_Mutation_p.S560Y|MYLK_uc011bjw.1_Missense_Mutation_p.S1760Y|MYLK_uc003egp.2_Missense_Mutation_p.S1691Y|MYLK_uc003egq.2_Missense_Mutation_p.S1709Y|MYLK_uc003egr.2_Missense_Mutation_p.S1640Y|MYLK_uc003egs.2_Missense_Mutation_p.S1584Y	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	1760	Calmodulin-binding.				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CATTGCCATAGAGGACAGTCT	0.522													8	219	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124380707	124380707	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124380707G>T	uc003ehg.2	+	45	6401	c.6274G>T	c.(6274-6276)GAG>TAG	p.E2092*	KALRN_uc003ehi.2_Nonsense_Mutation_p.E433*|KALRN_uc003ehk.2_Nonsense_Mutation_p.E395*|KALRN_uc011bjz.1_Nonsense_Mutation_p.E184*	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	2091	DH 2.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						GAAAGCAGTGGAGTTAATGTG	0.483													13	104	---	---	---	---	PASS
SEC61A1	29927	broad.mit.edu	37	3	127786843	127786843	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127786843G>T	uc003ekb.2	+	11	1369	c.1185G>T	c.(1183-1185)AAG>AAT	p.K395N	RUVBL1_uc003eke.2_Intron|RUVBL1_uc003ekf.2_Intron|SEC61A1_uc003ekc.2_Missense_Mutation_p.K342N|SEC61A1_uc003ekd.2_Missense_Mutation_p.K275N|SEC61A1_uc003ekg.2_Missense_Mutation_p.K89N	NM_013336	NP_037468	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit	395	Cytoplasmic (Potential).				protein targeting to ER	integral to endoplasmic reticulum membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity|protein binding|ribosome binding			ovary(1)	1						AGCAGCTGAAGGAGCAGCAGA	0.567											OREG0015775	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	80	---	---	---	---	PASS
RAB43	339122	broad.mit.edu	37	3	128848948	128848948	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128848948T>G	uc003elo.1	-	11	1045	c.834A>C	c.(832-834)GAA>GAC	p.E278D	ISY1_uc010hsz.1_Missense_Mutation_p.E98D|ISY1_uc003elp.1_Missense_Mutation_p.E278D|ISY1_uc010hta.1_Missense_Mutation_p.E300D	NM_020701	NP_065752	Q86YS6	RAB43_HUMAN	ISY1 splicing factor homolog	Error:Variant_position_missing_in_Q86YS6_after_alignment					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			lung(1)	1						GCCTTCTGGCTTCTTCACTTT	0.552													29	48	---	---	---	---	PASS
MRPL3	11222	broad.mit.edu	37	3	131181652	131181652	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131181652G>T	uc003eoh.2	-	10	1126	c.962C>A	c.(961-963)CCT>CAT	p.P321H	MRPL3_uc011blo.1_Missense_Mutation_p.P216H|MRPL3_uc011blp.1_Missense_Mutation_p.P348H	NM_007208	NP_009139	P09001	RM03_HUMAN	mitochondrial ribosomal protein L3	321					translation	mitochondrial large ribosomal subunit	RNA binding|structural constituent of ribosome				0						ATCTCCATCAGGAAAATATGT	0.413													5	35	---	---	---	---	PASS
SOX14	8403	broad.mit.edu	37	3	137484005	137484005	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137484005G>A	uc003erm.1	+	1	427	c.379G>A	c.(379-381)GCC>ACC	p.A127T		NM_004189	NP_004180	O95416	SOX14_HUMAN	SRY-box 14	127					negative regulation of transcription from RNA polymerase II promoter|nervous system development|transcription, DNA-dependent	nucleus	sequence-specific DNA binding				0						GAAAGCCCGGGCCTTCTTGCC	0.716													5	13	---	---	---	---	PASS
CLRN1	7401	broad.mit.edu	37	3	150644640	150644640	+	3'UTR	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150644640C>T	uc003eyk.1	-	3					CLRN1OS_uc011bny.1_Intron|CLRN1_uc003eyj.2_Silent_p.*121*	NM_174878	NP_777367	P58418	CLRN1_HUMAN	clarin 1 isoform a						equilibrioception|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	integral to membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GTTCCAGGCTCAGCTGTGGCC	0.483													8	61	---	---	---	---	PASS
PHC3	80012	broad.mit.edu	37	3	169835124	169835124	+	Missense_Mutation	SNP	T	A	A	rs138410529	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169835124T>A	uc010hws.1	-	10	2111	c.2047A>T	c.(2047-2049)AGT>TGT	p.S683C	PHC3_uc003fgl.2_Missense_Mutation_p.S695C|PHC3_uc011bpq.1_Missense_Mutation_p.S642C	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3	683					multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			GGAATGCTACTGTGCATAGAT	0.433													23	43	---	---	---	---	PASS
ZNF639	51193	broad.mit.edu	37	3	179051978	179051978	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179051978G>T	uc003fjq.1	+	6	1569	c.1226G>T	c.(1225-1227)GGG>GTG	p.G409V	ZNF639_uc003fjr.1_Missense_Mutation_p.G409V	NM_016331	NP_057415	Q9UID6	ZN639_HUMAN	zinc finger protein 639	409	Interaction with CTNNA2.|C2H2-type 6.				initiation of viral infection|negative regulation by host of viral transcription|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of cell growth|positive regulation of transcription, DNA-dependent	nucleus	protein self-association|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			GATGACTGTGGGAAAGGCTTT	0.328													6	62	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179399655	179399655	+	Intron	SNP	C	A	A	rs114592220	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179399655C>A	uc003fkh.2	+						USP13_uc003fkf.2_Intron	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13						ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			TACTTTTTCTCTTTCTTCTAG	0.443													8	160	---	---	---	---	PASS
FAM53A	152877	broad.mit.edu	37	4	1656817	1656817	+	Missense_Mutation	SNP	C	A	A	rs143343605	byFrequency	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1656817C>A	uc011bve.1	-	4	968	c.770G>T	c.(769-771)CGG>CTG	p.R257L	FAM53A_uc010ibw.2_Missense_Mutation_p.R257L	NM_001013622	NP_001013644	Q6NSI3	FA53A_HUMAN	dorsal neural-tube nuclear protein	257						nucleus					0		all_epithelial(65;0.206)|Breast(71;0.212)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)			TGAGCGGCACCGGAGCAGCCC	0.716													3	14	---	---	---	---	PASS
BEND4	389206	broad.mit.edu	37	4	42145654	42145654	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42145654A>C	uc003gwn.2	-	3	1425	c.845T>G	c.(844-846)CTG>CGG	p.L282R	BEND4_uc003gwm.2_Missense_Mutation_p.L282R|BEND4_uc011byy.1_Missense_Mutation_p.L282R	NM_207406	NP_997289	Q6ZU67	BEND4_HUMAN	BEN domain containing 4 isoform a	282											0						AGAGGTTGACAGAGGATCCAC	0.498													10	24	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	55131190	55131190	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55131190C>A	uc003han.3	+	5	1064	c.733C>A	c.(733-735)CTT>ATT	p.L245I	PDGFRA_uc003haa.2_Intron|PDGFRA_uc003hal.2_3'UTR|PDGFRA_uc010igq.1_Missense_Mutation_p.L139I|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	245	Ig-like C2-type 3.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	GGTGGTTGACCTTCAATGGAC	0.333			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			5	48	---	---	---	---	PASS
SMR3A	26952	broad.mit.edu	37	4	71232555	71232555	+	Silent	SNP	C	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71232555C>G	uc003hfg.1	+	3	330	c.249C>G	c.(247-249)CCC>CCG	p.P83P	SMR3B_uc011cas.1_Intron	NM_012390	NP_036522	Q99954	SMR3A_HUMAN	submaxillary gland androgen regulated protein 3	83	Pro-rich.|Poly-Pro.					extracellular region					0		all_hematologic(202;0.196)				CTCCTCCACCCTATGGTCCAG	0.567													8	38	---	---	---	---	PASS
CDS1	1040	broad.mit.edu	37	4	85525418	85525418	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85525418A>G	uc011ccv.1	+	2	638	c.140A>G	c.(139-141)TAT>TGT	p.Y47C		NM_001263	NP_001254	Q92903	CDS1_HUMAN	CDP-diacylglycerol synthase 1	47					signal transduction|visual perception	endoplasmic reticulum membrane|integral to membrane	diacylglycerol cholinephosphotransferase activity|phosphatidate cytidylyltransferase activity			large_intestine(2)|ovary(1)|breast(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		GATGACAGATATGGAGATTTG	0.348													15	31	---	---	---	---	PASS
PDHA2	5161	broad.mit.edu	37	4	96761394	96761394	+	Missense_Mutation	SNP	C	A	A	rs143281239		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96761394C>A	uc003htr.3	+	1	156	c.93C>A	c.(91-93)GAC>GAA	p.D31E		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	31					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	CCTCAAATGACGCTACATTTG	0.502													5	15	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126242434	126242434	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126242434G>T	uc003ifj.3	+	1	4868	c.4868G>T	c.(4867-4869)GGC>GTC	p.G1623V		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1623	Cadherin 15.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						ATTCTTCAGGGCCTTGATGGA	0.433													16	37	---	---	---	---	PASS
INTU	27152	broad.mit.edu	37	4	128564999	128564999	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128564999G>T	uc003ifk.1	+	2	540	c.470G>T	c.(469-471)CGG>CTG	p.R157L	INTU_uc011cgq.1_RNA	NM_015693	NP_056508	Q9ULD6	PDZD6_HUMAN	PDZ domain containing 6	157										ovary(1)	1						GTCCAACAGCGATACAAAGAT	0.393													4	45	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	165981199	165981199	+	Silent	SNP	T	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165981199T>A	uc011cjl.1	+	1	900	c.900T>A	c.(898-900)CCT>CCA	p.P300P		NM_001105575	NP_001099045			tripartite motif-containing 75																		TTCTAGACCCTGAAACAGCAC	0.343													12	33	---	---	---	---	PASS
ZFP42	132625	broad.mit.edu	37	4	188924324	188924324	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188924324A>T	uc003izg.1	+	3	608	c.363A>T	c.(361-363)GAA>GAT	p.E121D	ZFP42_uc003izh.1_Missense_Mutation_p.E121D|ZFP42_uc003izi.1_Missense_Mutation_p.E121D	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN	zinc finger protein 42	121					female gonad development|male gonad development|meiosis	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		GTTCTTTGGAATACATGAAAA	0.408													26	74	---	---	---	---	PASS
SEMA5A	9037	broad.mit.edu	37	5	9202246	9202246	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9202246G>T	uc003jek.2	-	9	1465	c.753C>A	c.(751-753)GCC>GCA	p.A251A		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	251	Sema.|Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						TGCACACCCGGGCAGCTCTGG	0.502													5	31	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13719032	13719032	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13719032G>T	uc003jfd.2	-	72	12500	c.12458C>A	c.(12457-12459)CCT>CAT	p.P4153H	DNAH5_uc003jfc.2_Missense_Mutation_p.P321H	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4153	AAA 6 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TCCTTGTGGAGGATCGTTGGC	0.453									Kartagener_syndrome				11	39	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13719033	13719033	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13719033G>T	uc003jfd.2	-	72	12499	c.12457C>A	c.(12457-12459)CCT>ACT	p.P4153T	DNAH5_uc003jfc.2_Missense_Mutation_p.P321T	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4153	AAA 6 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CCTTGTGGAGGATCGTTGGCA	0.453									Kartagener_syndrome				10	40	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23523402	23523402	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23523402C>A	uc003jgo.2	+	9	1067	c.885C>A	c.(883-885)ATC>ATA	p.I295I		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	295	SET.			I -> VRRACHF (in Ref. 4; AAF87242).	meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						AAACTCAGATCACCAAGGGGA	0.443										HNSCC(3;0.000094)			14	47	---	---	---	---	PASS
LMBRD2	92255	broad.mit.edu	37	5	36105250	36105250	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36105250T>C	uc003jkb.1	-	17	2362	c.1947A>G	c.(1945-1947)ATA>ATG	p.I649M	uc003jka.1_5'Flank	NM_001007527	NP_001007528	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	649	Cytoplasmic (Potential).					integral to membrane					0	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGAGAAGTTCTATCCGGTCCC	0.408													9	31	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	37024753	37024753	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37024753A>G	uc003jkl.3	+	30	6140	c.5641A>G	c.(5641-5643)ACA>GCA	p.T1881A	NIPBL_uc003jkk.3_Missense_Mutation_p.T1881A	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	1881	HEAT 2.				brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TGAACAACCAACATTTCCAAA	0.313													11	19	---	---	---	---	PASS
GHR	2690	broad.mit.edu	37	5	42695076	42695076	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42695076G>T	uc003jmt.2	+	5	367	c.324G>T	c.(322-324)GGG>GGT	p.G108G	GHR_uc011cpq.1_5'UTR	NM_000163	NP_000154	P10912	GHR_HUMAN	growth hormone receptor precursor	108	Extracellular (Potential).				2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	TTTCTGCTGGGGAAAACAGCT	0.308													4	14	---	---	---	---	PASS
GZMA	3001	broad.mit.edu	37	5	54401310	54401310	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54401310G>A	uc003jpm.2	+	2	116	c.79G>A	c.(79-81)GAA>AAA	p.E27K		NM_006144	NP_006135	P12544	GRAA_HUMAN	granzyme A precursor	27					cleavage of lamin|cytolysis|immune response|negative regulation of DNA binding|negative regulation of endodeoxyribonuclease activity|negative regulation of oxidoreductase activity|positive regulation of apoptosis	extracellular region|immunological synapse|nucleus	protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				AGATGTCTGTGAAAAAATTAT	0.413													9	32	---	---	---	---	PASS
DDX4	54514	broad.mit.edu	37	5	55075836	55075836	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55075836A>G	uc003jqg.3	+	8	513	c.439A>G	c.(439-441)AGA>GGA	p.R147G	DDX4_uc010ivz.2_Missense_Mutation_p.R127G|DDX4_uc003jqh.3_Intron|DDX4_uc003jqj.2_Intron	NM_001136034	NP_001129506	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 isoform	147	Gly-rich.				multicellular organismal development|sperm motility	perinuclear region of cytoplasm|pi-body|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|skin(1)	2		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				GCCATACAGAAGAGGTGGAAG	0.373													4	18	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70806897	70806897	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70806897C>A	uc003kbp.1	+	17	4241	c.3978C>A	c.(3976-3978)ACC>ACA	p.T1326T	BDP1_uc003kbn.1_Silent_p.T1326T|BDP1_uc003kbo.2_Silent_p.T1326T	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	1326	9; approximate.|9 X 55 AA repeats of G-R-R-X-I-S-P-X-E-N- G-X-E-E-V-K-P-X-X-E-M-E-T-D-L-K-X-T-G-R- E-X-X-X-R-E-K-T-X-E-X-X-D-A-X-E-E-I-D-X- D-L-E-E-T.				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TAGAGGAGACCAGTACCTCAA	0.423													6	57	---	---	---	---	PASS
PDE8B	8622	broad.mit.edu	37	5	76646894	76646894	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76646894G>T	uc003kfa.2	+	9	1067	c.1022G>T	c.(1021-1023)TGG>TTG	p.W341L	PDE8B_uc003kfb.2_Missense_Mutation_p.W321L|PDE8B_uc003kfc.2_Missense_Mutation_p.W341L|PDE8B_uc003kfd.2_Missense_Mutation_p.W294L|PDE8B_uc003kfe.2_Intron	NM_003719	NP_003710	O95263	PDE8B_HUMAN	phosphodiesterase 8B isoform 1	341					cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity				0		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)		ATGTAGGAGTGGCAGGGGGTT	0.517													9	20	---	---	---	---	PASS
DDX46	9879	broad.mit.edu	37	5	134153324	134153324	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134153324G>T	uc003kzw.2	+	20	2917	c.2749G>T	c.(2749-2751)GAA>TAA	p.E917*		NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	917					mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGAGAAACAAGAAGAAGAGAG	0.408													7	51	---	---	---	---	PASS
PCDHB11	56125	broad.mit.edu	37	5	140579904	140579904	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140579904C>A	uc003liy.2	+	1	557	c.557C>A	c.(556-558)CCA>CAA	p.P186Q	PCDHB11_uc011daj.1_Intron	NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11 precursor	186	Extracellular (Potential).|Cadherin 2.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGAGTCATTCCAGACAATAGG	0.438													5	51	---	---	---	---	PASS
PCDH12	51294	broad.mit.edu	37	5	141337102	141337102	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141337102C>A	uc003llx.2	-	1	1526	c.315G>T	c.(313-315)CTG>CTT	p.L105L		NM_016580	NP_057664	Q9NPG4	PCD12_HUMAN	protocadherin 12 precursor	105	Cadherin 1.|Extracellular (Potential).				neuron recognition	integral to plasma membrane	calcium ion binding			ovary(3)	3		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAAGGAAACCAGGCAGGGAT	0.587													6	83	---	---	---	---	PASS
ADRB2	154	broad.mit.edu	37	5	148207268	148207268	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148207268G>A	uc003lpr.1	+	1	1113	c.874G>A	c.(874-876)GTT>ATT	p.V292I	SH3TC2_uc003lpp.1_Intron	NM_000024	NP_000015	P07550	ADRB2_HUMAN	adrenergic, beta-2-, receptor, surface	292	Helical; Name=6.|Agonist and antagonist binding.				activation of transmembrane receptor protein tyrosine kinase activity|desensitization of G-protein coupled receptor protein signaling pathway by arrestin|endosome to lysosome transport|positive regulation of MAPKKK cascade|receptor-mediated endocytosis	endosome|integral to plasma membrane|lysosome|receptor complex	beta2-adrenergic receptor activity|norepinephrine binding|potassium channel regulator activity|protein homodimerization activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Alprenolol(DB00866)|Arformoterol(DB01274)|Bambuterol(DB01408)|Bisoprolol(DB00612)|Bitolterol(DB00901)|Bretylium(DB01158)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Isoproterenol(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Metipranolol(DB01214)|Nadolol(DB01203)|Norepinephrine(DB00368)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Terbutaline(DB00871)|Timolol(DB00373)	CTTCTTCATCGTTAACATTGT	0.463													8	65	---	---	---	---	PASS
GFPT2	9945	broad.mit.edu	37	5	179757699	179757699	+	Splice_Site	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179757699C>A	uc003mlw.1	-	6	632	c.534_splice	c.e6+1	p.L178_splice		NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	TTGTAACTCACCAACTGCTGA	0.378													15	74	---	---	---	---	PASS
GFPT2	9945	broad.mit.edu	37	5	179757700	179757700	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179757700C>A	uc003mlw.1	-	6	632	c.534G>T	c.(532-534)TTG>TTT	p.L178F		NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	178	Glutamine amidotransferase type-2.				dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	TGTAACTCACCAACTGCTGAA	0.373													15	74	---	---	---	---	PASS
KAAG1	353219	broad.mit.edu	37	6	24358065	24358065	+	Silent	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24358065G>A	uc003ndz.1	+	1	935	c.198G>A	c.(196-198)GCG>GCA	p.A66A	DCDC2_uc003ndx.2_5'UTR|DCDC2_uc003ndy.2_5'UTR	NM_181337	NP_851854	Q9UBP8	KAAG1_HUMAN	kidney associated antigen 1	66					immune response						0						CCCAGGGCGCGGGATCGCCTC	0.662													6	25	---	---	---	---	PASS
SLC17A1	6568	broad.mit.edu	37	6	25819768	25819768	+	Missense_Mutation	SNP	C	A	A	rs146175657	byFrequency	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25819768C>A	uc003nfh.3	-	5	616	c.500G>T	c.(499-501)CGA>CTA	p.R167L	SLC17A1_uc011djy.1_RNA|SLC17A1_uc010jqb.1_Missense_Mutation_p.R165L|SLC17A1_uc010jqc.1_Missense_Mutation_p.R165L	NM_005074	NP_005065	Q14916	NPT1_HUMAN	solute carrier family 17 (sodium phosphate),	167					sodium ion transport|urate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(3)|pancreas(1)	4						AAGTCGGCCTCGTTCCAGGGG	0.393													4	50	---	---	---	---	PASS
TRIM38	10475	broad.mit.edu	37	6	25967109	25967109	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25967109A>T	uc003nfm.2	+	3	794	c.359A>T	c.(358-360)CAG>CTG	p.Q120L	TRIM38_uc003nfn.2_Missense_Mutation_p.Q120L	NM_006355	NP_006346	O00635	TRI38_HUMAN	tripartite motif-containing 38	120	B box-type.				positive regulation of I-kappaB kinase/NF-kappaB cascade	intracellular	signal transducer activity|zinc ion binding				0						CGGGCACCACAGCACAAAGGG	0.557													12	49	---	---	---	---	PASS
C2	717	broad.mit.edu	37	6	31902047	31902047	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31902047A>G	uc003nyf.2	+	6	1084	c.820A>G	c.(820-822)AAG>GAG	p.K274E	C2_uc003nyc.2_Intron|C2_uc011doo.1_Intron|C2_uc011dop.1_Intron|C2_uc003nye.3_Missense_Mutation_p.K274E|C2_uc010jtk.2_Missense_Mutation_p.K142E|C2_uc011doq.1_Missense_Mutation_p.K245E|C2_uc003nyg.2_Intron|CFB_uc011dor.1_Intron|C2_uc003nyh.1_5'Flank	NM_000063	NP_000054	P06681	CO2_HUMAN	complement component 2 isoform 1 preproprotein	274	VWFA.				complement activation, classical pathway|innate immune response|proteolysis	extracellular space	serine-type endopeptidase activity			ovary(1)|skin(1)	2		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		TCTCATCTTCAAGGAGAGCGC	0.547													38	177	---	---	---	---	PASS
SPDEF	25803	broad.mit.edu	37	6	34507062	34507062	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34507062T>C	uc003ojq.1	-	5	1209	c.794A>G	c.(793-795)TAT>TGT	p.Y265C	SPDEF_uc011dsq.1_Missense_Mutation_p.Y249C	NM_012391	NP_036523	O95238	SPDEF_HUMAN	SAM pointed domain containing ets transcription	265	ETS.				negative regulation of survival gene product expression|negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(3)|ovary(1)|central_nervous_system(1)	5						GAAGCGGCCATAGCTGTGGGG	0.617													15	114	---	---	---	---	PASS
SCUBE3	222663	broad.mit.edu	37	6	35214015	35214015	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35214015C>T	uc003okf.1	+	21	2791	c.2785C>T	c.(2785-2787)CGA>TGA	p.R929*	SCUBE3_uc003okg.1_Nonsense_Mutation_p.R928*|SCUBE3_uc003okh.1_Nonsense_Mutation_p.R816*	NM_152753	NP_689966	Q8IX30	SCUB3_HUMAN	signal peptide, CUB domain, EGF-like 3	929					protein heterooligomerization|protein homooligomerization	cell surface|extracellular region	calcium ion binding|protein binding			skin(1)	1						AGACATTGTGCGAGATGGCCG	0.418													24	151	---	---	---	---	PASS
PI16	221476	broad.mit.edu	37	6	36931007	36931007	+	Silent	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36931007C>T	uc003ona.2	+	5	1217	c.889C>T	c.(889-891)CTG>TTG	p.L297L	PI16_uc003omz.1_Intron|PI16_uc003onb.2_Intron|PI16_uc011dts.1_Silent_p.L68L	NM_153370	NP_699201	Q6UXB8	PI16_HUMAN	protease inhibitor 16 precursor	297	Extracellular (Potential).					extracellular region|integral to membrane	peptidase inhibitor activity				0						AGCTCACAGCCTGCCCTCCTT	0.532													22	65	---	---	---	---	PASS
GLO1	2739	broad.mit.edu	37	6	38649882	38649882	+	Intron	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38649882C>A	uc003ooc.2	-							NM_006708	NP_006699	Q04760	LGUL_HUMAN	glyoxalase I						anti-apoptosis|carbohydrate metabolic process	cytoplasm	lactoylglutathione lyase activity|metal ion binding			ovary(1)	1					Glutathione(DB00143)	TATGACCTTACGTGATACCCC	0.373													4	45	---	---	---	---	PASS
TREML2	79865	broad.mit.edu	37	6	41168703	41168703	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41168703C>A	uc010jxm.1	-	1	223	c.44G>T	c.(43-45)GGT>GTT	p.G15V		NM_024807	NP_079083	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid	15					T cell activation	cell surface|integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					TGAGACGCAACCCTGTGGCCA	0.622													4	7	---	---	---	---	PASS
TREML2	79865	broad.mit.edu	37	6	41168707	41168707	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41168707G>T	uc010jxm.1	-	1	219	c.40C>A	c.(40-42)CAG>AAG	p.Q14K		NM_024807	NP_079083	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid	14					T cell activation	cell surface|integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					ACGCAACCCTGTGGCCACAGC	0.622													4	8	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51774224	51774224	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51774224G>T	uc003pah.1	-	40	6815	c.6539C>A	c.(6538-6540)TCC>TAC	p.S2180Y	PKHD1_uc010jzn.1_Missense_Mutation_p.S205Y|PKHD1_uc003pai.2_Missense_Mutation_p.S2180Y	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2180	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CATATCCCTGGATCCTAGCAT	0.483													13	76	---	---	---	---	PASS
GFRAL	389400	broad.mit.edu	37	6	55264165	55264165	+	Splice_Site	SNP	A	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55264165A>G	uc003pcm.1	+	8	1135	c.1049_splice	c.e8-2	p.G350_splice		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like precursor							integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TTCTTTTTCTAGGAGAAGTAA	0.313													4	14	---	---	---	---	PASS
IBTK	25998	broad.mit.edu	37	6	82909856	82909856	+	Splice_Site	SNP	A	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82909856A>C	uc003pjl.1	-	21	3552	c.3025_splice	c.e21+1	p.G1009_splice	IBTK_uc011dyu.1_Splice_Site|IBTK_uc011dyv.1_Splice_Site_p.E1009_splice|IBTK_uc011dyw.1_Splice_Site_p.G808_splice|IBTK_uc010kbi.1_Splice_Site_p.G703_splice|IBTK_uc003pjm.2_Splice_Site_p.G1009_splice	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase						negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		CTTTCCACGAACCTGTAGATG	0.378													12	42	---	---	---	---	PASS
PRSS35	167681	broad.mit.edu	37	6	84234230	84234230	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84234230C>A	uc003pjz.2	+	2	1233	c.1070C>A	c.(1069-1071)CCA>CAA	p.P357Q	PRSS35_uc010kbm.2_Missense_Mutation_p.P357Q	NM_153362	NP_699193	Q8N3Z0	PRS35_HUMAN	protease, serine, 35 precursor	357	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		CTGAAAGATCCAGACAAAAAG	0.517													18	52	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90471376	90471376	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90471376G>T	uc003pnn.1	-	17	2564	c.2448C>A	c.(2446-2448)TTC>TTA	p.F816L	MDN1_uc003pno.1_Missense_Mutation_p.F234L	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	816					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CTACAAATGCGAACAATAAGG	0.333													4	31	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90499528	90499528	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90499528C>A	uc003pnn.1	-	7	1317	c.1201G>T	c.(1201-1203)GAG>TAG	p.E401*	MDN1_uc003pnp.1_Nonsense_Mutation_p.E401*	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	401					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCAATATCCTCCAGAAGGATC	0.468													5	56	---	---	---	---	PASS
BACH2	60468	broad.mit.edu	37	6	90718521	90718521	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90718521C>G	uc011eab.1	-	6	852	c.43G>C	c.(43-45)GAG>CAG	p.E15Q	BACH2_uc003pnw.2_Missense_Mutation_p.E15Q|BACH2_uc010kch.2_Missense_Mutation_p.E15Q	NM_021813	NP_068585	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper	15						nucleus	protein dimerization activity|sequence-specific DNA binding			ovary(3)|pancreas(1)|lung(1)|skin(1)	6		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		ACTGTGGACTCATACACATAC	0.423													8	54	---	---	---	---	PASS
TRDN	10345	broad.mit.edu	37	6	123786047	123786047	+	Intron	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123786047T>C	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|TRDN_uc010ken.2_Missense_Mutation_p.K292R|uc003pzm.1_Intron	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		AAAAAAGTACTTGCCTTCAAG	0.403													4	7	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129513940	129513940	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129513940G>T	uc003qbn.2	+	12	1829	c.1724G>T	c.(1723-1725)CGG>CTG	p.R575L	LAMA2_uc003qbo.2_Missense_Mutation_p.R575L	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	575	Laminin IV type A 1.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GCGGAGGCCCGGCAAGCCCTG	0.587													4	18	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136597032	136597032	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136597032C>T	uc003qgx.1	-	5	1884	c.1631G>A	c.(1630-1632)CGT>CAT	p.R544H	BCLAF1_uc003qgw.1_Missense_Mutation_p.R371H|BCLAF1_uc003qgy.1_Missense_Mutation_p.R542H|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R542H	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	544					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GACTTCAGGACGGTGAGAATC	0.433													7	67	---	---	---	---	PASS
TNFAIP3	7128	broad.mit.edu	37	6	138200413	138200413	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138200413G>A	uc003qhr.2	+	7	1897	c.1831G>A	c.(1831-1833)GGC>AGC	p.G611S	TNFAIP3_uc003qhs.2_Missense_Mutation_p.G611S	NM_006290	NP_006281	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	611	Interaction with NAF1 (By similarity).|A20-type 4.				anti-apoptosis|apoptosis|B-1 B cell homeostasis|negative regulation of B cell activation|negative regulation of bone resorption|negative regulation of CD40 signaling pathway|negative regulation of endothelial cell apoptosis|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of interleukin-2 production|negative regulation of interleukin-6 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of osteoclast proliferation|negative regulation of protein ubiquitination|negative regulation of smooth muscle cell proliferation|negative regulation of toll-like receptor 2 signaling pathway|negative regulation of toll-like receptor 3 signaling pathway|negative regulation of tumor necrosis factor production|negative regulation of type I interferon production|positive regulation of protein catabolic process|protein K48-linked ubiquitination|protein K63-linked deubiquitination|protein oligomerization|regulation of defense response to virus by host|regulation of germinal center formation|regulation of vascular wound healing|tolerance induction to lipopolysaccharide	centrosome|cytosol|nucleus	caspase inhibitor activity|DNA binding|protease binding|protein self-association|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-protein ligase activity|ubiquitin-specific protease activity|zinc ion binding	p.0?(22)		haematopoietic_and_lymphoid_tissue(133)|lung(3)|ovary(1)	137	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		CAGAAAAGCCGGCTGCGTGTA	0.532			D|N|F		marginal zone B-cell lymphomas|Hodgkin's lymphoma|primary mediastinal B cell lymphoma								13	110	---	---	---	---	PASS
TAB2	23118	broad.mit.edu	37	6	149700403	149700403	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149700403C>A	uc003qmj.2	+	3	1530	c.1352C>A	c.(1351-1353)CCT>CAT	p.P451H	TAB2_uc011eec.1_Missense_Mutation_p.P419H|TAB2_uc010kia.1_Missense_Mutation_p.P451H|TAB2_uc010kib.1_Missense_Mutation_p.P451H|TAB2_uc003qmk.3_RNA	NM_015093	NP_055908	Q9NYJ8	TAB2_HUMAN	mitogen-activated protein kinase kinase kinase 7	451					activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding				0						GCAACCTCTCCTCGAGTGGTA	0.507													6	79	---	---	---	---	PASS
PDE10A	10846	broad.mit.edu	37	6	165809952	165809952	+	Intron	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165809952G>T	uc003qun.2	-						PDE10A_uc011egj.1_Intron|PDE10A_uc011egk.1_Intron|PDE10A_uc003quo.2_Intron	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN	phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)	GATACATCTAGAAGGCAAATC	0.363													7	45	---	---	---	---	PASS
FTSJ2	29960	broad.mit.edu	37	7	2275030	2275030	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2275030C>A	uc003slm.2	-	3	497	c.468G>T	c.(466-468)GCG>GCT	p.A156A	MAD1L1_uc003slh.1_5'Flank|MAD1L1_uc003slf.1_5'Flank|MAD1L1_uc003slg.1_5'Flank|MAD1L1_uc010ksh.1_5'Flank|MAD1L1_uc003sli.1_5'Flank|MAD1L1_uc010ksi.1_5'Flank|MAD1L1_uc010ksj.2_5'Flank|FTSJ2_uc003slk.2_Silent_p.A2A|FTSJ2_uc003sll.2_Silent_p.A2A|FTSJ2_uc003sln.2_RNA|FTSJ2_uc003slo.2_Silent_p.A2A	NM_013393	NP_037525	Q9UI43	RRMJ2_HUMAN	FtsJ homolog 2	156					cell proliferation	mitochondrion|nucleolus	nucleic acid binding|rRNA (uridine-2'-O-)-methyltransferase activity			ovary(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.7e-14)		TGGCATTGGGCGCCATGTCGC	0.592													10	46	---	---	---	---	PASS
STK31	56164	broad.mit.edu	37	7	23793980	23793980	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23793980A>C	uc003sws.3	+	10	1247	c.1180A>C	c.(1180-1182)ATA>CTA	p.I394L	STK31_uc003swt.3_Missense_Mutation_p.I371L|STK31_uc011jze.1_Missense_Mutation_p.I394L|STK31_uc010kuq.2_Missense_Mutation_p.I371L	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a	394							ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						TTCAGATGCTATACAAGTGTT	0.373													16	42	---	---	---	---	PASS
HOXA7	3204	broad.mit.edu	37	7	27194745	27194745	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27194745C>A	uc003sys.2	-	2	608	c.476G>T	c.(475-477)CGC>CTC	p.R159L	HOXA6_uc003syq.1_5'Flank|uc003syr.1_3'UTR	NM_006896	NP_008827	P31268	HXA7_HUMAN	homeobox A7	159	Poly-Arg.|Homeobox.				angiogenesis|negative regulation of cell-matrix adhesion|negative regulation of keratinocyte differentiation|negative regulation of leukocyte migration|negative regulation of monocyte differentiation|negative regulation of transcription from RNA polymerase II promoter		sequence-specific DNA binding|transcription factor binding				0						TTCAATGCGGCGGCGCCGCGT	0.602													29	120	---	---	---	---	PASS
FAM188B	84182	broad.mit.edu	37	7	30831048	30831048	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30831048G>T	uc003tbt.2	+	5	1008	c.931G>T	c.(931-933)GAG>TAG	p.E311*	FAM188B_uc010kwe.2_Nonsense_Mutation_p.E282*	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182	311											0						GGATCCCTCCGAGGACACCCC	0.622													4	39	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	32209388	32209388	+	Intron	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32209388C>T	uc003tco.1	-							NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			GAGTTGCAATCCACCAAACCT	0.448													7	39	---	---	---	---	PASS
ADCY1	107	broad.mit.edu	37	7	45725621	45725621	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45725621T>A	uc003tne.3	+	13	2152	c.2134T>A	c.(2134-2136)TCT>ACT	p.S712T		NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1	712					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GGTCCTTTCGTCTGGGGGCCA	0.652													5	25	---	---	---	---	PASS
PKD1L1	168507	broad.mit.edu	37	7	47970696	47970696	+	Intron	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47970696C>A	uc003tny.1	-							NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1						cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						CCTCCTTCACCGTACCTTCTG	0.542													4	19	---	---	---	---	PASS
GRB10	2887	broad.mit.edu	37	7	50800020	50800020	+	5'UTR	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50800020G>T	uc003tpi.2	-	1					GRB10_uc003tpj.2_5'UTR|GRB10_uc003tpk.2_5'UTR|GRB10_uc010kzb.2_Intron|GRB10_uc003tpl.2_Intron|GRB10_uc003tpm.2_Intron|GRB10_uc003tpn.2_Intron	NM_005311	NP_005302	Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10 isoform						insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)					CTAAAGCCATGGGTTCCTTCT	0.483									Russell-Silver_syndrome				14	56	---	---	---	---	PASS
GTF2IRD1	9569	broad.mit.edu	37	7	74016709	74016709	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74016709G>T	uc003uaq.2	+	27	3222	c.2829G>T	c.(2827-2829)ATG>ATT	p.M943I	GTF2IRD1_uc010lbq.2_Missense_Mutation_p.M960I|GTF2IRD1_uc003uap.2_Missense_Mutation_p.M928I|GTF2IRD1_uc003uar.1_3'UTR	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1	943				Missing: Cytoplasmic localization.		nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						CAATGTACATGGTGGACTATG	0.478													5	68	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100680080	100680080	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100680080G>T	uc003uxp.1	+	3	5436	c.5383G>T	c.(5383-5385)GGT>TGT	p.G1795C	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1795	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|28.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AACTGCTGAAGGTACCAGCAT	0.517													11	318	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100685234	100685234	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100685234G>T	uc003uxp.1	+	3	10590	c.10537G>T	c.(10537-10539)GGT>TGT	p.G3513C	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3513	Extracellular (Potential).|Ser-rich.|57.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	p.G3513V(1)		ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ATCAACTGCTGGTGAAGGAAG	0.493													12	418	---	---	---	---	PASS
MKLN1	4289	broad.mit.edu	37	7	131082021	131082021	+	Intron	SNP	T	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131082021T>G	uc011kpm.1	+						MKLN1_uc011kpl.1_Intron|MKLN1_uc010lmh.2_Intron|MKLN1_uc003vqs.2_Intron	NM_013255	NP_037387	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing						signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)					TTTTTCTCCTTAAAGTTCCAC	0.323													3	23	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135277850	135277850	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135277850G>T	uc003vsw.2	+	12	1771	c.1740G>T	c.(1738-1740)CAG>CAT	p.Q580H		NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	580					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						ATAGTGTCCAGTACCGTCACC	0.488													14	70	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146805264	146805264	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146805264C>A	uc003weu.1	+	5	1092	c.576C>A	c.(574-576)GGC>GGA	p.G192G		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	192	Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ACTTTGATGGCCATGTTGTAT	0.358										HNSCC(39;0.1)			5	12	---	---	---	---	PASS
TMEM176B	28959	broad.mit.edu	37	7	150491171	150491171	+	Intron	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150491171G>T	uc003wht.3	-						TMEM176B_uc003whu.3_Intron|TMEM176B_uc003whv.3_Intron|TMEM176B_uc003whw.3_Intron	NM_001101313	NP_001094783	Q3YBM2	T176B_HUMAN	transmembrane protein 176B isoform a						cell differentiation|organ morphogenesis	integral to membrane|nuclear membrane				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGCAAGACAGGATGAGAAACC	0.592													11	56	---	---	---	---	PASS
INTS9	55756	broad.mit.edu	37	8	28651468	28651468	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28651468G>T	uc003xha.2	-	10	1192	c.893C>A	c.(892-894)CCC>CAC	p.P298H	INTS9_uc011lav.1_Missense_Mutation_p.P274H|INTS9_uc011law.1_Missense_Mutation_p.P277H|INTS9_uc011lax.1_Missense_Mutation_p.P191H|INTS9_uc010lvc.2_RNA|INTS9_uc003xhb.2_Missense_Mutation_p.P298H	NM_018250	NP_060720	Q9NV88	INT9_HUMAN	integrator complex subunit 9 isoform 1	298					snRNA processing	integrator complex	protein binding			central_nervous_system(1)|pancreas(1)	2		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		AGGGTAGCAGGGAACCAACAC	0.483													6	65	---	---	---	---	PASS
RB1CC1	9821	broad.mit.edu	37	8	53573532	53573532	+	Silent	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53573532T>C	uc003xre.3	-	11	2139	c.1581A>G	c.(1579-1581)TTA>TTG	p.L527L	RB1CC1_uc003xrf.3_Silent_p.L527L	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1	527					autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				CTGCTTCATATAATCTCTTTC	0.279													6	15	---	---	---	---	PASS
RB1CC1	9821	broad.mit.edu	37	8	53573823	53573823	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53573823C>G	uc003xre.3	-	10	1935	c.1377G>C	c.(1375-1377)ATG>ATC	p.M459I	RB1CC1_uc003xrf.3_Missense_Mutation_p.M459I	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1	459					autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				CAGCATGAAGCATTACAAAGC	0.358													5	22	---	---	---	---	PASS
ARFGEF1	10565	broad.mit.edu	37	8	68204208	68204208	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68204208C>A	uc003xxo.1	-	6	1180	c.790G>T	c.(790-792)GAC>TAC	p.D264Y		NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	264					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			AGGTCAAGGTCCCCTTCGTGT	0.423													13	59	---	---	---	---	PASS
CRISPLD1	83690	broad.mit.edu	37	8	75941732	75941732	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75941732G>T	uc003yan.2	+	14	1806	c.1431G>T	c.(1429-1431)CAG>CAT	p.Q477H	CRISPLD1_uc011lfk.1_Missense_Mutation_p.Q289H|CRISPLD1_uc011lfl.1_Missense_Mutation_p.Q289H	NM_031461	NP_113649	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain	477	LCCL 2.					extracellular region				ovary(1)|central_nervous_system(1)	2	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CTTCTTTTCAGAATGGAATCT	0.373													5	21	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77766784	77766784	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77766784A>C	uc003yav.2	+	10	7879	c.7492A>C	c.(7492-7494)AAC>CAC	p.N2498H	ZFHX4_uc003yau.1_Missense_Mutation_p.N2543H|ZFHX4_uc003yaw.1_Missense_Mutation_p.N2498H	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2498						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATTTGACCCCAACAATCCGCT	0.547										HNSCC(33;0.089)			31	153	---	---	---	---	PASS
PEX2	5828	broad.mit.edu	37	8	77895842	77895842	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77895842C>A	uc003yax.2	-	4	1031	c.573G>T	c.(571-573)ATG>ATT	p.M191I	PEX2_uc003yay.2_Missense_Mutation_p.M191I|PEX2_uc003yaz.2_Missense_Mutation_p.M191I	NM_000318	NP_000309	P28328	PEX2_HUMAN	peroxin 2	191					peroxisome organization	integral to peroxisomal membrane	protein binding|zinc ion binding			ovary(1)	1						GTTCCCTATTCATGTATTCAA	0.388													10	78	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103301779	103301779	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103301779T>C	uc003ykr.1	-	35	4648	c.4615A>G	c.(4615-4617)ATC>GTC	p.I1539V	UBR5_uc003yks.1_Missense_Mutation_p.I1539V	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	1539					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TTCCTGATGATGTAGGATGAC	0.468													8	55	---	---	---	---	PASS
SLC30A8	169026	broad.mit.edu	37	8	118184797	118184797	+	Silent	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118184797G>A	uc003yoh.2	+	8	1217	c.987G>A	c.(985-987)GTG>GTA	p.V329V	SLC30A8_uc010mcz.2_Silent_p.V280V|SLC30A8_uc011lia.1_Silent_p.V280V|SLC30A8_uc003yog.2_Silent_p.V280V	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8	329	Cytoplasmic (Potential).				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			ACAGCCAAGTGGTTCGGAGAG	0.507													12	46	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139190841	139190841	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139190841C>A	uc003yuy.2	-	10	1137	c.966G>T	c.(964-966)CTG>CTT	p.L322L	FAM135B_uc003yux.2_Silent_p.L223L|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	322										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TGACTGTGTCCAGGAACTGGG	0.532										HNSCC(54;0.14)			6	31	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139606266	139606266	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139606266G>T	uc003yvd.2	-	63	5056	c.4609C>A	c.(4609-4611)CCC>ACC	p.P1537T	COL22A1_uc011ljo.1_Missense_Mutation_p.P817T	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1537	Pro-rich.|Gly-rich.|Collagen-like 15.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TCACCTTTGGGACCTATGGGT	0.632										HNSCC(7;0.00092)			6	34	---	---	---	---	PASS
FAM154A	158297	broad.mit.edu	37	9	18928305	18928305	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18928305C>A	uc003zni.1	-	4	1448	c.1170G>T	c.(1168-1170)AAG>AAT	p.K390N	FAM154A_uc010mip.1_Missense_Mutation_p.K198N	NM_153707	NP_714918	Q8IYX7	F154A_HUMAN	hypothetical protein LOC158297	390										pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.53e-16)		ACCAATGAGGCTTACAGCTTT	0.577													5	22	---	---	---	---	PASS
IFNA16	3449	broad.mit.edu	37	9	21217192	21217192	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21217192A>G	uc003zor.1	-	1	119	c.113T>C	c.(112-114)TTG>TCG	p.L38S	IFNA14_uc003zoo.1_Intron	NM_002173	NP_002164	P05015	IFN16_HUMAN	interferon, alpha 16 precursor	38					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding			skin(1)	1				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		CAGGAGTATCAAGGCCCTCCT	0.498													7	25	---	---	---	---	PASS
ZNF782	158431	broad.mit.edu	37	9	99580443	99580443	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99580443T>C	uc004awp.1	-	6	2143	c.1862A>G	c.(1861-1863)AAT>AGT	p.N621S	ZNF782_uc011lup.1_Missense_Mutation_p.N489S	NM_001001662	NP_001001662	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782	621	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Acute lymphoblastic leukemia(62;0.0527)				TCCACATTCATTACATTCATA	0.433													9	22	---	---	---	---	PASS
TMEM38B	55151	broad.mit.edu	37	9	108467943	108467943	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108467943G>T	uc004bcu.1	+	2	295	c.178G>T	c.(178-180)GGT>TGT	p.G60C	TMEM38B_uc010mtn.1_Missense_Mutation_p.G60C	NM_018112	NP_060582	Q9NVV0	TM38B_HUMAN	transmembrane protein 38B	60	Helical; (Potential).					integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity			ovary(1)|skin(1)	2						CCACTGTTTTGGTGGAGGAAT	0.418													6	64	---	---	---	---	PASS
GDI2	2665	broad.mit.edu	37	10	5836916	5836916	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5836916C>A	uc001iil.3	-	4	611	c.320G>T	c.(319-321)GGG>GTG	p.G107V	GDI2_uc001iim.3_Intron|GDI2_uc009xid.2_Missense_Mutation_p.G111V	NM_001494	NP_001485	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2 isoform 1	107					protein transport|small GTPase mediated signal transduction	cell surface|cytosol|membrane	protein binding|Rab GDP-dissociation inhibitor activity				0						GACAAAGCTCCCTTCAGTCAC	0.373													6	70	---	---	---	---	PASS
LYZL2	119180	broad.mit.edu	37	10	30915143	30915143	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30915143C>A	uc001ivk.2	-	3	340	c.327G>T	c.(325-327)ACG>ACT	p.T109T		NM_183058	NP_898881	Q7Z4W2	LYZL2_HUMAN	lysozyme-like 2	63					cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0		Prostate(175;0.151)				CATCCAGGACCGTCTGGGCTG	0.572													6	25	---	---	---	---	PASS
ZEB1	6935	broad.mit.edu	37	10	31809717	31809717	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31809717T>A	uc001ivs.3	+	7	1517	c.1454T>A	c.(1453-1455)CTT>CAT	p.L485H	ZEB1_uc001ivr.3_Missense_Mutation_p.L267H|ZEB1_uc010qee.1_Missense_Mutation_p.L267H|ZEB1_uc010qef.1_Missense_Mutation_p.L267H|ZEB1_uc009xlj.1_Missense_Mutation_p.L411H|ZEB1_uc010qeg.1_Missense_Mutation_p.L344H|ZEB1_uc009xlk.1_Missense_Mutation_p.L267H|ZEB1_uc001ivt.3_Missense_Mutation_p.L267H|ZEB1_uc001ivu.3_Missense_Mutation_p.L486H|ZEB1_uc001ivv.3_Missense_Mutation_p.L465H|ZEB1_uc010qeh.1_Missense_Mutation_p.L418H|ZEB1_uc009xlo.1_Missense_Mutation_p.L468H|ZEB1_uc009xlp.2_Missense_Mutation_p.L469H	NM_030751	NP_110378	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b	485					cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)				CCTAGCCAACTTCAAGTTGTT	0.373													10	51	---	---	---	---	PASS
GDF10	2662	broad.mit.edu	37	10	48429216	48429216	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48429216G>C	uc001jfb.2	-	2	1126	c.670C>G	c.(670-672)CAG>GAG	p.Q224E	GDF10_uc009xnp.2_Missense_Mutation_p.Q223E|GDF10_uc009xnq.1_Missense_Mutation_p.Q224E	NM_004962	NP_004953	P55107	BMP3B_HUMAN	growth differentiation factor 10 precursor	224					growth|skeletal system development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity			lung(1)|central_nervous_system(1)	2						GAATCCAGCTGGGCGGAGAGG	0.697													3	4	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61835767	61835767	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61835767G>T	uc001jky.2	-	37	5064	c.4872C>A	c.(4870-4872)ACC>ACA	p.T1624T	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	1624	Ser-rich.				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TCACTGGAGAGGTTCGAGAGG	0.478													5	44	---	---	---	---	PASS
ZNF365	22891	broad.mit.edu	37	10	64159292	64159292	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64159292G>T	uc001jly.3	+	5	1075	c.1013G>T	c.(1012-1014)CGA>CTA	p.R338L	ZNF365_uc001jmb.3_Intron|ZNF365_uc001jmc.2_Intron|ZNF365_uc001jlz.3_Missense_Mutation_p.R323L|ZNF365_uc001jma.3_RNA	NM_014951	NP_055766	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform A	Error:Variant_position_missing_in_Q70YC4_after_alignment										ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					TGTAGAAGCCGAGGGCACCCG	0.483													4	84	---	---	---	---	PASS
TCF7L2	6934	broad.mit.edu	37	10	114911628	114911628	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114911628G>T	uc001lae.3	+	10	1653	c.1146G>T	c.(1144-1146)CAG>CAT	p.Q382H	TCF7L2_uc001lac.3_Missense_Mutation_p.Q359H|TCF7L2_uc010qrk.1_Missense_Mutation_p.Q359H|TCF7L2_uc010qrl.1_Missense_Mutation_p.Q359H|TCF7L2_uc010qrm.1_Missense_Mutation_p.Q382H|TCF7L2_uc010qrn.1_Missense_Mutation_p.Q325H|TCF7L2_uc001lad.3_Missense_Mutation_p.Q355H|TCF7L2_uc001lag.3_Missense_Mutation_p.Q406H|TCF7L2_uc001laf.3_Missense_Mutation_p.Q359H|TCF7L2_uc010qro.1_Missense_Mutation_p.Q359H|TCF7L2_uc001lah.2_Missense_Mutation_p.Q364H|TCF7L2_uc010qrp.1_Missense_Mutation_p.Q359H|TCF7L2_uc010qrq.1_Missense_Mutation_p.Q355H|TCF7L2_uc010qrr.1_Missense_Mutation_p.Q297H|TCF7L2_uc010qrs.1_Missense_Mutation_p.Q253H|TCF7L2_uc010qrt.1_Missense_Mutation_p.Q253H|TCF7L2_uc010qru.1_Missense_Mutation_p.Q281H|TCF7L2_uc010qrv.1_Missense_Mutation_p.Q199H|TCF7L2_uc010qrw.1_Missense_Mutation_p.Q86H|TCF7L2_uc010qrx.1_Missense_Mutation_p.Q239H	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1	382	Mediates interaction with MAD2L2.|HMG box.				anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		CCATCAACCAGATCCTTGGGC	0.532													8	50	---	---	---	---	PASS
CLRN3	119467	broad.mit.edu	37	10	129676511	129676511	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129676511C>A	uc001lka.1	-	3	746	c.583G>T	c.(583-585)GTA>TTA	p.V195L	CLRN3_uc001ljz.1_Missense_Mutation_p.V127L	NM_152311	NP_689524	Q8NCR9	CLRN3_HUMAN	clarin 3	195	Helical; (Potential).					integral to membrane				skin(1)	1		all_epithelial(44;0.00168)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)|Colorectal(57;0.235)				ATGATGGTTACAGTGACTATA	0.453													18	99	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	134650410	134650410	+	Silent	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134650410T>C	uc010qux.1	-	37	5625	c.5625A>G	c.(5623-5625)CAA>CAG	p.Q1875Q		NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		CGCAGAGATTTTGCCAAGCCT	0.537													10	69	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1016592	1016592	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1016592C>A	uc001lsw.2	-	31	6260	c.6209G>T	c.(6208-6210)GGG>GTG	p.G2070V		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	2070	Ser-rich.|Thr-rich.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTGGCTGGTCCCACTGGTGGT	0.577													9	143	---	---	---	---	PASS
KRTAP5-3	387266	broad.mit.edu	37	11	1629296	1629296	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1629296G>A	uc001ltw.1	-	1	398	c.320C>T	c.(319-321)TCC>TTC	p.S107F		NM_001012708	NP_001012726	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	107	11 X 4 AA repeats of C-C-X-P.					keratin filament				ovary(2)	2		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		GACCCCCTTGGAACCCCCACA	0.662													10	53	---	---	---	---	PASS
OR56B4	196335	broad.mit.edu	37	11	6129132	6129132	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6129132C>A	uc010qzx.1	+	1	124	c.124C>A	c.(124-126)CTC>ATC	p.L42I		NM_001005181	NP_001005181	Q8NH76	O56B4_HUMAN	olfactory receptor, family 56, subfamily B,	42	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.31e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTGCTCTACCTCTTAGCTCT	0.502													6	42	---	---	---	---	PASS
OR2AG2	338755	broad.mit.edu	37	11	6789336	6789336	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6789336G>C	uc001meq.1	-	1	853	c.853C>G	c.(853-855)CTG>GTG	p.L285V		NM_001004490	NP_001004490	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG,	285	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AGTGGATTCAGGGCTGGAGTG	0.502													6	47	---	---	---	---	PASS
STK33	65975	broad.mit.edu	37	11	8414154	8414154	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8414154C>A	uc001mgi.1	-	12	2367	c.1448G>T	c.(1447-1449)GGA>GTA	p.G483V	STK33_uc001mgj.1_Missense_Mutation_p.G483V|STK33_uc001mgk.1_Missense_Mutation_p.G483V|STK33_uc010rbn.1_Missense_Mutation_p.G442V|STK33_uc001mgl.3_Missense_Mutation_p.G296V	NM_030906	NP_112168	Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	483						Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|pancreas(1)|central_nervous_system(1)|skin(1)	7				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		CTCCATTTCTCCCTTGATTTC	0.448													7	89	---	---	---	---	PASS
ASCL3	56676	broad.mit.edu	37	11	8959439	8959439	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8959439G>T	uc001mhd.1	-	2	330	c.270C>A	c.(268-270)TAC>TAA	p.Y90*		NM_020646	NP_065697	Q9NQ33	ASCL3_HUMAN	ASCL3	89					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleolus	DNA binding				0				Epithelial(150;1.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0228)		AGGCTGGCCCGTAGGAGTACT	0.542													18	90	---	---	---	---	PASS
DENND5A	23258	broad.mit.edu	37	11	9191393	9191393	+	Intron	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9191393G>T	uc001mhl.2	-						DENND5A_uc001mhk.2_Intron|DENND5A_uc010rbw.1_Intron|DENND5A_uc010rbx.1_Intron	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1											liver(1)	1						TCATTCTTAAGGTATCTTACC	0.478													6	79	---	---	---	---	PASS
MRGPRX1	259249	broad.mit.edu	37	11	18956275	18956275	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18956275C>A	uc001mpg.2	-	1	275	c.57G>T	c.(55-57)GAG>GAT	p.E19D		NM_147199	NP_671732	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	19	Extracellular (Potential).				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(2)|central_nervous_system(1)	3						AAAGAGTCTCCTCAGTTCCGT	0.527													10	373	---	---	---	---	PASS
TTC17	55761	broad.mit.edu	37	11	43515348	43515348	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43515348G>T	uc001mxi.2	+	24	3334	c.3320G>T	c.(3319-3321)TGG>TTG	p.W1107L	TTC17_uc010rfj.1_Missense_Mutation_p.W1107L|TTC17_uc001mxl.2_Missense_Mutation_p.W163L|TTC17_uc001mxm.2_Missense_Mutation_p.W88L	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	1107	TPR 6.						binding			ovary(5)	5						GCACTGGTGTGGTATGAATCC	0.478													8	178	---	---	---	---	PASS
MADD	8567	broad.mit.edu	37	11	47307069	47307069	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47307069C>A	uc001ner.1	+	14	2670	c.2479C>A	c.(2479-2481)CGG>AGG	p.R827R	MADD_uc001neq.2_Silent_p.R827R|MADD_uc001nev.1_Silent_p.R784R|MADD_uc001nes.1_Silent_p.R784R|MADD_uc001net.1_Silent_p.R827R|MADD_uc009yln.1_Silent_p.R784R|MADD_uc001neu.1_Silent_p.R784R|MADD_uc001nex.2_Silent_p.R827R|MADD_uc001nez.2_Silent_p.R784R|MADD_uc001new.2_Silent_p.R827R	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing	827					activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(4)|central_nervous_system(2)	11				Lung(87;0.182)		GTCAGACTCTCGGGCAAGCTC	0.567													7	204	---	---	---	---	PASS
PTPRJ	5795	broad.mit.edu	37	11	48171051	48171051	+	Intron	SNP	C	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48171051C>G	uc001ngp.3	+							NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J						contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						GTAAGTCTCTCAAATTATGAG	0.318													4	62	---	---	---	---	PASS
OR5AS1	219447	broad.mit.edu	37	11	55798388	55798388	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55798388G>C	uc010riw.1	+	1	494	c.494G>C	c.(493-495)AGG>ACG	p.R165T		NM_001001921	NP_001001921	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|liver(1)|skin(1)	5	Esophageal squamous(21;0.00693)					CTCACATTCAGGCTGTCATTT	0.428													6	65	---	---	---	---	PASS
OR8I2	120586	broad.mit.edu	37	11	55861505	55861505	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55861505C>A	uc010rix.1	+	1	722	c.722C>A	c.(721-723)GCA>GAA	p.A241E		NM_001003750	NP_001003750	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I,	241	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1	Esophageal squamous(21;0.00693)					TCCACCTGCGCATCCCACCTC	0.498													4	29	---	---	---	---	PASS
OR10V1	390201	broad.mit.edu	37	11	59481101	59481101	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59481101T>C	uc001nof.1	-	1	218	c.218A>G	c.(217-219)TAT>TGT	p.Y73C		NM_001005324	NP_001005324	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V,	73	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GGAAGATGTATAGAAGATTTC	0.453													6	36	---	---	---	---	PASS
MS4A7	58475	broad.mit.edu	37	11	60160167	60160167	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60160167G>T	uc001npe.2	+	6	701	c.556G>T	c.(556-558)GTG>TTG	p.V186L	MS4A7_uc001npf.2_Missense_Mutation_p.V186L|MS4A7_uc001npg.2_Missense_Mutation_p.V141L|MS4A7_uc001nph.2_Missense_Mutation_p.V141L|MS4A14_uc001npi.2_Intron	NM_206939	NP_996822	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member	186	Helical; (Potential).					integral to membrane	receptor activity			ovary(1)|central_nervous_system(1)	2						GGGTGTCCTAGTGGTGATGCT	0.512													24	83	---	---	---	---	PASS
DDB1	1642	broad.mit.edu	37	11	61083759	61083759	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61083759G>T	uc001nrc.3	-	12	1634	c.1408C>A	c.(1408-1410)CAG>AAG	p.Q470K	DDB1_uc010rle.1_Intron|DDB1_uc010rlf.1_Missense_Mutation_p.Q470K|DDB1_uc010rlg.1_RNA|DDB1_uc001nrd.2_Missense_Mutation_p.Q470K	NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1	470	Interaction with CDT1.|Interaction with CUL4A.				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4						GTTATCACCTGGATAAGCTGC	0.438								NER					10	295	---	---	---	---	PASS
KDM2A	22992	broad.mit.edu	37	11	66947553	66947553	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66947553G>T	uc001ojw.2	+	3	910	c.46G>T	c.(46-48)GGT>TGT	p.G16C	KDM2A_uc001ojx.2_RNA	NM_012308	NP_036440	Q9Y2K7	KDM2A_HUMAN	F-box and leucine-rich repeat protein 11	16					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			ovary(4)|lung(3)|breast(1)|skin(1)	9						TTCCTAGCGTGGTACCATGCG	0.398													5	54	---	---	---	---	PASS
YAP1	10413	broad.mit.edu	37	11	102056767	102056767	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102056767G>T	uc001pgt.2	+	4	1077	c.707G>T	c.(706-708)TGG>TTG	p.W236L	YAP1_uc001pgs.2_Intron|YAP1_uc001pgu.2_Missense_Mutation_p.W236L|YAP1_uc001pgv.2_Intron|YAP1_uc010ruo.1_Missense_Mutation_p.W58L|YAP1_uc001pgw.2_Missense_Mutation_p.W58L|YAP1_uc010rup.1_5'UTR	NM_001130145	NP_001123617	P46937	YAP1_HUMAN	Yes-associated protein 1, 65kDa isoform 1	236	WW 2.				cell proliferation|cellular response to gamma radiation|contact inhibition|hippo signaling cascade|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		CCTGATGGATGGGAACAAGCC	0.373													5	24	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117307860	117307860	+	Silent	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117307860G>A	uc001prh.1	-	26	4880	c.4878C>T	c.(4876-4878)TTC>TTT	p.F1626F		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1566	Extracellular (Potential).|Fibronectin type-III 6.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CCAGGGTGGCGAACTGGGCTG	0.617													13	58	---	---	---	---	PASS
BCL9L	283149	broad.mit.edu	37	11	118769284	118769284	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118769284C>A	uc001pug.2	-	8	5305	c.4340G>T	c.(4339-4341)AGC>ATC	p.S1447I	BCL9L_uc009zal.2_Missense_Mutation_p.S1442I	NM_182557	NP_872363	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	1447					negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		transcription coactivator activity			ovary(1)|pancreas(1)	2	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GGGCGGCTGGCTGTAGACCTC	0.672													3	9	---	---	---	---	PASS
UBASH3B	84959	broad.mit.edu	37	11	122653771	122653771	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122653771G>T	uc001pyi.3	+	5	972	c.612G>T	c.(610-612)GTG>GTT	p.V204V		NM_032873	NP_116262	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing,	204						cytoplasm|nucleus	protein tyrosine phosphatase activity			central_nervous_system(1)	1		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		AAGTGCATGTGGAACCTCATA	0.463													9	280	---	---	---	---	PASS
GRAMD1B	57476	broad.mit.edu	37	11	123489412	123489412	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123489412T>C	uc001pyx.2	+	18	2242	c.1913T>C	c.(1912-1914)CTG>CCG	p.L638P	GRAMD1B_uc001pyw.2_Missense_Mutation_p.L645P|GRAMD1B_uc010rzw.1_Missense_Mutation_p.L594P|GRAMD1B_uc010rzx.1_Missense_Mutation_p.L598P|GRAMD1B_uc001pyy.2_Missense_Mutation_p.L325P	NM_020716	NP_065767	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	638	Helical; (Potential).					integral to membrane				ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CTGGTGCTGCTGGTCATCCTT	0.522													5	17	---	---	---	---	PASS
OR6M1	390261	broad.mit.edu	37	11	123676931	123676931	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123676931T>C	uc010rzz.1	-	1	127	c.127A>G	c.(127-129)ATC>GTC	p.I43V		NM_001005325	NP_001005325	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M,	43	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		AGGGAGATGATGGTGATGTTT	0.418													10	65	---	---	---	---	PASS
OR8B4	283162	broad.mit.edu	37	11	124294684	124294684	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124294684G>T	uc010sak.1	-	1	84	c.84C>A	c.(82-84)TTC>TTA	p.F28L		NM_001005196	NP_001005196	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B,	28	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AGAATAGAAGGAAAAGAGGGA	0.468													14	48	---	---	---	---	PASS
OR8B8	26493	broad.mit.edu	37	11	124310527	124310527	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124310527C>T	uc010sal.1	-	1	455	c.455G>A	c.(454-456)GGG>GAG	p.G152E		NM_012378	NP_036510	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B,	152	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		CCCAGCAAACCCCATCCCATA	0.522													10	82	---	---	---	---	PASS
KIRREL3	84623	broad.mit.edu	37	11	126333056	126333056	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126333056G>T	uc001qea.2	-	6	1099	c.738C>A	c.(736-738)ATC>ATA	p.I246I	KIRREL3_uc001qeb.2_Silent_p.I246I|KIRREL3_uc001qec.1_Silent_p.I246I	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1	246	Extracellular (Potential).				hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		ACTCACGCTGGATGTCAATGG	0.607													6	21	---	---	---	---	PASS
NTM	50863	broad.mit.edu	37	11	132177606	132177606	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132177606G>T	uc001qgp.2	+	4	1214	c.550G>T	c.(550-552)GAA>TAA	p.E184*	NTM_uc001qgm.2_Nonsense_Mutation_p.E184*|NTM_uc010sch.1_Nonsense_Mutation_p.E175*|NTM_uc010sci.1_Nonsense_Mutation_p.E184*|NTM_uc010scj.1_Nonsense_Mutation_p.E143*|NTM_uc001qgo.2_Nonsense_Mutation_p.E184*|NTM_uc001qgq.2_Nonsense_Mutation_p.E184*|NTM_uc001qgr.2_5'UTR	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1	184	Ig-like C2-type 2.				cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						GAGTGAAGACGAATACTTGGA	0.493													4	57	---	---	---	---	PASS
DCP1B	196513	broad.mit.edu	37	12	2062441	2062441	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2062441T>G	uc001qjx.1	-	7	745	c.665A>C	c.(664-666)GAA>GCA	p.E222A	DCP1B_uc010sdy.1_Missense_Mutation_p.E120A	NM_152640	NP_689853	Q8IZD4	DCP1B_HUMAN	decapping enzyme Dcp1b	222					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	hydrolase activity|protein binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			GTGTTGGGGTTCAGGGTCTAA	0.398													6	46	---	---	---	---	PASS
NDUFA9	4704	broad.mit.edu	37	12	4791398	4791398	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4791398G>T	uc001qnc.2	+	9	838	c.828G>T	c.(826-828)CTG>CTT	p.L276L	NDUFA9_uc010ses.1_Silent_p.L57L	NM_005002	NP_004993	Q16795	NDUA9_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	276					mitochondrial electron transport, NADH to ubiquinone|sodium ion transport	mitochondrial matrix|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	TTTTCCACCTGGTGAAGTACA	0.418													5	54	---	---	---	---	PASS
PRB3	5544	broad.mit.edu	37	12	11420857	11420857	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11420857T>A	uc001qzs.2	-	3	364	c.326A>T	c.(325-327)CAG>CTG	p.Q109L	PRB4_uc001qzf.1_Intron	NM_006249	NP_006240	Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	109	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.|3.					extracellular region	Gram-negative bacterial cell surface binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.201)			ACCTTGGGACTGGTTTCCTCC	0.627													28	160	---	---	---	---	PASS
GUCY2C	2984	broad.mit.edu	37	12	14766078	14766078	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14766078G>T	uc001rcd.2	-	27	3332	c.3195C>A	c.(3193-3195)ACC>ACA	p.T1065T		NM_004963	NP_004954	P25092	GUC2C_HUMAN	guanylate cyclase 2C precursor	1065	Cytoplasmic (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity			ovary(4)|skin(2)	6						CCTTGTCTGTGGTATTCAGCT	0.438													5	73	---	---	---	---	PASS
PTPRO	5800	broad.mit.edu	37	12	15733040	15733040	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15733040C>A	uc001rcv.1	+	21	3162	c.2988C>A	c.(2986-2988)AAC>AAA	p.N996K	PTPRO_uc001rcw.1_Missense_Mutation_p.N968K|PTPRO_uc001rcx.1_Missense_Mutation_p.N185K|PTPRO_uc001rcy.1_Missense_Mutation_p.N185K|PTPRO_uc001rcz.1_Missense_Mutation_p.N157K|PTPRO_uc001rda.1_Missense_Mutation_p.N157K	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	996	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				TCAATGCCAACTATATTCCTG	0.378													6	20	---	---	---	---	PASS
C12orf35	55196	broad.mit.edu	37	12	32138230	32138230	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32138230G>T	uc001rks.2	+	4	4755	c.4341G>T	c.(4339-4341)AAG>AAT	p.K1447N	C12orf35_uc001rkt.2_5'Flank	NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196	1447										ovary(1)|skin(1)	2	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0114)			TAACTCCTAAGGAGTATTTAC	0.353													7	71	---	---	---	---	PASS
PLEKHA9	51054	broad.mit.edu	37	12	45568068	45568068	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45568068G>T	uc001rom.1	-	3	618	c.81C>A	c.(79-81)TCC>TCA	p.S27S	PLEKHA9_uc009zke.2_Silent_p.S27S	NM_015899	NP_056983			pleckstrin homology domain containing, family A												0	Lung SC(27;0.192)|Renal(347;0.236)			GBM - Glioblastoma multiforme(48;0.173)		CCTCAGAATTGGACACACCAG	0.408													7	179	---	---	---	---	PASS
ASB8	140461	broad.mit.edu	37	12	48547277	48547277	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48547277C>A	uc001rrh.2	-	2	172	c.3G>T	c.(1-3)ATG>ATT	p.M1I	ASB8_uc010slr.1_5'UTR	NM_024095	NP_077000	Q9H765	ASB8_HUMAN	ankyrin repeat and SOCS box-containing 8	1					intracellular signal transduction	cytoplasm|nucleus				kidney(1)	1						TACTGGAACTCATCAAGGCTC	0.448													5	51	---	---	---	---	PASS
GRASP	160622	broad.mit.edu	37	12	52404685	52404685	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52404685A>T	uc001rzo.1	+	3	373	c.317A>T	c.(316-318)AAG>ATG	p.K106M	GRASP_uc001rzp.1_Translation_Start_Site	NM_181711	NP_859062	Q7Z6J2	GRASP_HUMAN	GRP1 (general receptor for phosphoinositides	106	PDZ.					cell junction|perinuclear region of cytoplasm|postsynaptic membrane				central_nervous_system(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.0967)		ACGTTGGAGAAGGAGGATAAC	0.532													26	161	---	---	---	---	PASS
DGKA	1606	broad.mit.edu	37	12	56330863	56330863	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56330863G>A	uc001sij.2	+	3	391	c.127G>A	c.(127-129)GTC>ATC	p.V43I	DGKA_uc009zoc.1_Missense_Mutation_p.V43I|DGKA_uc001sih.1_5'UTR|DGKA_uc001sii.1_5'UTR|DGKA_uc009zod.1_Intron|DGKA_uc009zoe.1_Missense_Mutation_p.V43I|DGKA_uc001sik.2_Missense_Mutation_p.V43I|DGKA_uc001sil.2_Missense_Mutation_p.V43I|DGKA_uc001sim.2_Missense_Mutation_p.V43I|DGKA_uc001sin.2_Missense_Mutation_p.V43I|DGKA_uc009zof.2_5'UTR|DGKA_uc001sio.2_5'UTR	NM_001345	NP_001336	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	43					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			ovary(3)|pancreas(1)	4					Vitamin E(DB00163)	GGCTAAATATGTCCAAGGAGA	0.448													27	86	---	---	---	---	PASS
ATP5B	506	broad.mit.edu	37	12	57039026	57039026	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57039026G>T	uc001slr.2	-	2	344	c.239C>A	c.(238-240)CCA>CAA	p.P80Q	SNORD59B_uc001sls.1_5'Flank|SNORD59A_uc001slt.1_5'Flank	NM_001686	NP_001677	P06576	ATPB_HUMAN	mitochondrial ATP synthase beta subunit	80					angiogenesis|ATP hydrolysis coupled proton transport|regulation of intracellular pH|respiratory electron transport chain	cell surface|mitochondrial nucleoid|mitochondrial proton-transporting ATP synthase, catalytic core|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|hydrogen-exporting ATPase activity, phosphorylative mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)	1						TAGAATTGGTGGTAGTCCCTC	0.557													5	72	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57595586	57595586	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57595586G>T	uc001snd.2	+	67	10958	c.10492G>T	c.(10492-10494)GAG>TAG	p.E3498*		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3498	Extracellular (Potential).|LDL-receptor class A 25.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TGGTGTGGACGAGTTCCGCTG	0.632													4	78	---	---	---	---	PASS
DPY19L2	283417	broad.mit.edu	37	12	64061895	64061895	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64061895C>A	uc001srp.1	-	1	460	c.279G>T	c.(277-279)CGG>CGT	p.R93R	DPY19L2_uc009zqk.1_RNA	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2	93					multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		GCACCTTTTCCCGGAGCTGCG	0.607													22	61	---	---	---	---	PASS
DPY19L2	283417	broad.mit.edu	37	12	64061896	64061896	+	Missense_Mutation	SNP	C	T	T	rs111719532		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64061896C>T	uc001srp.1	-	1	459	c.278G>A	c.(277-279)CGG>CAG	p.R93Q	DPY19L2_uc009zqk.1_RNA	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2	93					multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		CACCTTTTCCCGGAGCTGCGC	0.607													20	61	---	---	---	---	PASS
ACTR6	64431	broad.mit.edu	37	12	100617613	100617613	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100617613G>T	uc001thb.1	+	11	1167	c.1111G>T	c.(1111-1113)GAT>TAT	p.D371Y	ACTR6_uc001thc.1_Missense_Mutation_p.D263Y|ACTR6_uc001thd.1_Missense_Mutation_p.D351Y|ACTR6_uc009ztu.1_Intron|ACTR6_uc001the.1_Missense_Mutation_p.D289Y|ACTR6_uc001thf.1_Missense_Mutation_p.D269Y|uc001thg.1_5'Flank	NM_022496	NP_071941	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog	371						cytoplasm|cytoskeleton				ovary(1)	1						AGAGAATGATGATTTTGAAGA	0.328													6	63	---	---	---	---	PASS
CMKLR1	1240	broad.mit.edu	37	12	108686289	108686289	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108686289G>A	uc009zuw.2	-	3	642	c.451C>T	c.(451-453)CGC>TGC	p.R151C	CMKLR1_uc001tmw.2_Missense_Mutation_p.R151C|CMKLR1_uc001tmv.2_Missense_Mutation_p.R149C|CMKLR1_uc009zuv.2_Missense_Mutation_p.R151C	NM_001142345	NP_001135817	Q99788	CML1_HUMAN	chemokine-like receptor 1 isoform a	151	Cytoplasmic (Potential).				chemotaxis|immune response|negative regulation of interleukin-12 production|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage chemotaxis|regulation of calcium-mediated signaling|skeletal system development	integral to plasma membrane	chemokine receptor activity			lung(3)|ovary(1)|pancreas(1)	5						CGAACGCTGCGGTGGTTCTGG	0.572													6	65	---	---	---	---	PASS
NAA25	80018	broad.mit.edu	37	12	112486193	112486193	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112486193C>A	uc001ttm.2	-	16	1803	c.1783G>T	c.(1783-1785)GAG>TAG	p.E595*	NAA25_uc001ttn.3_RNA|NAA25_uc009zvz.1_Nonsense_Mutation_p.E567*|NAA25_uc009zwa.1_Nonsense_Mutation_p.E595*	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN	mitochondrial distribution and morphology 20	595						cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3						GCGATAAACTCTGGGATCTTC	0.373													9	58	---	---	---	---	PASS
PTPN11	5781	broad.mit.edu	37	12	112926888	112926888	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112926888G>T	uc001ttx.2	+	13	1888	c.1508G>T	c.(1507-1509)GGG>GTG	p.G503V		NM_002834	NP_002825	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type	507	Tyrosine-protein phosphatase.		G -> A (in JMML).|G -> R (in patients with growth retardation, pulmonic stenosis and juvenile myelomonocytic leukemia).		axon guidance|cell junction assembly|ephrin receptor signaling pathway|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|platelet activation|regulation of cell adhesion mediated by integrin|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol	non-membrane spanning protein tyrosine phosphatase activity|protein binding	p.G503A(14)|p.G503V(8)|p.G503E(2)|p.G503L(1)|p.G503R(1)		haematopoietic_and_lymphoid_tissue(375)|lung(6)|autonomic_ganglia(2)|soft_tissue(2)|central_nervous_system(2)|large_intestine(1)|skin(1)|ovary(1)|NS(1)|kidney(1)	392						CAGAGGTCAGGGATGGTCCAG	0.468			Mis		JMML|AML|MDS		Noonan Syndrome		Noonan_syndrome				31	174	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117768764	117768764	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117768764A>T	uc001twm.1	-	2	797	c.111T>A	c.(109-111)AGT>AGA	p.S37R		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	37	Interaction with NOSIP (By similarity).|PDZ.				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	CGGGCGGCTTACTGACCCGCT	0.577													8	41	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32900678	32900678	+	Nonsense_Mutation	SNP	G	T	T	rs80358780		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32900678G>T	uc001uub.1	+	7	786	c.559G>T	c.(559-561)GAG>TAG	p.E187*	BRCA2_uc001uua.1_Nonsense_Mutation_p.E64*	NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	187					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding	p.E187K(1)		ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TCTAGGAGCTGAGGTGGATCC	0.378			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			5	66	---	---	---	---	PASS
LCP1	3936	broad.mit.edu	37	13	46730577	46730577	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46730577G>T	uc001vaz.3	-	5	613	c.487C>A	c.(487-489)CTT>ATT	p.L163I	LCP1_uc001vba.3_Missense_Mutation_p.L163I	NM_002298	NP_002289	P13796	PLSL_HUMAN	L-plastin	163	Actin-binding 1.|CH 1.				regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding			lung(4)|ovary(3)	7		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		ATTTACCAAAGGACAATGCCA	0.383			T	BCL6	NHL 								6	92	---	---	---	---	PASS
UTP14C	9724	broad.mit.edu	37	13	52603078	52603078	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52603078G>T	uc001vgb.2	+	2	673	c.138G>T	c.(136-138)CTG>CTT	p.L46L	UTP14C_uc001vga.2_3'UTR|UTP14C_uc001vgc.2_RNA	NM_021645	NP_067677	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	46					cell differentiation|meiosis|multicellular organismal development|rRNA processing|spermatogenesis	nucleolus|small-subunit processome				ovary(3)|large_intestine(1)|breast(1)	5		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		AAAAGCTTCTGGAAGCAATCA	0.453													8	149	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77699588	77699588	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77699588C>T	uc001vkf.2	-	55	7877	c.7786G>A	c.(7786-7788)GGG>AGG	p.G2596R	MYCBP2_uc010aev.2_Missense_Mutation_p.G2000R|MYCBP2_uc001vkg.1_Missense_Mutation_p.G59R	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	2596					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		ACCCATGTCCCTTCAGAATTG	0.443													8	43	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	92346109	92346109	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92346109C>A	uc010tif.1	+	3	1360	c.994C>A	c.(994-996)CTC>ATC	p.L332I		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	332						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				ACAGGCTCACCTCAATGGACA	0.393													5	60	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	102029299	102029299	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102029299G>T	uc001vox.1	-	5	673	c.484C>A	c.(484-486)CTG>ATG	p.L162M	NALCN_uc001voy.2_Translation_Start_Site|NALCN_uc001voz.2_Missense_Mutation_p.L162M|NALCN_uc001vpa.2_Missense_Mutation_p.L162M	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	162	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GTCCTTGGCAGTTCAAATCGG	0.368													5	34	---	---	---	---	PASS
HECTD1	25831	broad.mit.edu	37	14	31585550	31585550	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31585550G>C	uc001wrc.1	-	30	5999	c.5510C>G	c.(5509-5511)ACC>AGC	p.T1837S	HECTD1_uc001wra.1_5'UTR|HECTD1_uc001wrb.1_5'UTR|HECTD1_uc001wrd.1_Missense_Mutation_p.T1305S	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1	1837					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TCTGAAATTGGTGAGTGGTAA	0.408													3	41	---	---	---	---	PASS
SEC23A	10484	broad.mit.edu	37	14	39565184	39565184	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39565184C>A	uc001wup.1	-	2	362	c.139G>T	c.(139-141)GAG>TAG	p.E47*	SEC23A_uc010tqa.1_Intron|SEC23A_uc010tqb.1_Nonsense_Mutation_p.E47*	NM_006364	NP_006355	Q15436	SC23A_HUMAN	SEC23-related protein A	47					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|Golgi membrane|smooth endoplasmic reticulum membrane	protein binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		TCAGGTCTCTCTTTCAGTGGT	0.428													8	72	---	---	---	---	PASS
RPL10L	140801	broad.mit.edu	37	14	47120931	47120931	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47120931G>T	uc001wwg.2	-	1	98	c.9C>A	c.(7-9)CGC>CGA	p.R3R		NM_080746	NP_542784	Q96L21	RL10L_HUMAN	ribosomal protein L10-like protein	3					spermatogenesis|translation	cytosolic large ribosomal subunit|nucleus	structural constituent of ribosome			ovary(1)	1						GAGCTGGACGGCGCCCCATGG	0.557													5	51	---	---	---	---	PASS
ATXN3	4287	broad.mit.edu	37	14	92548666	92548666	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92548666C>A	uc001yac.3	-	8	822	c.753G>T	c.(751-753)AGG>AGT	p.R251S	ATXN3_uc010aug.2_Missense_Mutation_p.R236S|ATXN3_uc001yad.3_Missense_Mutation_p.R196S|ATXN3_uc010auh.2_Missense_Mutation_p.R185S|ATXN3_uc001yae.3_Missense_Mutation_p.R153S|ATXN3_uc010twl.1_RNA	NM_004993	NP_004984	P54252	ATX3_HUMAN	ataxin 3 reference isoform	251	UIM 2.				cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		GCTGAATAGCCCTGCGGAGAT	0.413													12	49	---	---	---	---	PASS
DICER1	23405	broad.mit.edu	37	14	95560326	95560326	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95560326G>T	uc001ydw.2	-	25	5445	c.5263C>A	c.(5263-5265)CAC>AAC	p.H1755N	DICER1_uc010avh.1_Missense_Mutation_p.H653N|DICER1_uc001ydv.2_Missense_Mutation_p.H1745N|DICER1_uc001ydx.2_Missense_Mutation_p.H1755N	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	1755	RNase III 2.				negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		AAGTACTTGTGGTAGTCGTAC	0.507			Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				6	77	---	---	---	---	PASS
CLMN	79789	broad.mit.edu	37	14	95669862	95669862	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95669862C>A	uc001yef.2	-	9	1940	c.1824G>T	c.(1822-1824)AGG>AGT	p.R608S		NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin	608						integral to membrane	actin binding				0				Epithelial(152;0.193)		ATTTAATACTCCTTTTACCTA	0.443													18	46	---	---	---	---	PASS
ATG2B	55102	broad.mit.edu	37	14	96771996	96771996	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96771996G>T	uc001yfi.2	-	31	5028	c.4663C>A	c.(4663-4665)CTT>ATT	p.L1555I		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	1555										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		TGCCAGACAAGAGAGACCTCC	0.408													5	54	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106110271	106110271	+	RNA	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106110271C>T	uc010tyt.1	-	3642		c.60980G>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_RNA					Parts of antibodies, mostly variable regions.												0						GACTGACGGTCCTGCCACAGG	0.627													10	51	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106494206	106494206	+	RNA	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106494206T>C	uc010tyt.1	-	1760		c.34792A>G								Parts of antibodies, mostly variable regions.												0						ACCTGGTTTTTGGAGGTGTCC	0.517													20	57	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106494324	106494324	+	RNA	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106494324G>C	uc010tyt.1	-	1760		c.34674C>G								Parts of antibodies, mostly variable regions.												0						GACGGATCCAGCCCACACCCA	0.562													5	51	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107179269	107179269	+	Intron	SNP	G	A	A	rs150226524	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107179269G>A	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						CCATGGTGGAGAGCAGGATTC	0.527													6	40	---	---	---	---	PASS
TUBGCP5	114791	broad.mit.edu	37	15	22853811	22853811	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22853811G>T	uc001yur.3	+	12	1579	c.1449G>T	c.(1447-1449)GGG>GGT	p.G483G	TUBGCP5_uc001yuq.2_Silent_p.G483G|TUBGCP5_uc010axz.1_Silent_p.G70G	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	483					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		TCGTGCACGGGCACCTGTGGG	0.602													4	18	---	---	---	---	PASS
GABRG3	2567	broad.mit.edu	37	15	27222171	27222171	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27222171G>A	uc001zbg.1	+	2	242	c.76G>A	c.(76-78)GAA>AAA	p.E26K	GABRG3_uc001zbf.2_Missense_Mutation_p.E26K	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma	26	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		GGAAGAGGATGAATATGAAGA	0.428													8	52	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34032134	34032134	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34032134G>T	uc001zhi.2	+	51	7828	c.7758G>T	c.(7756-7758)TTG>TTT	p.L2586F	RYR3_uc010bar.2_Missense_Mutation_p.L2586F	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2586	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CAGCCACGTTGGAGAAACAGA	0.463													10	49	---	---	---	---	PASS
TYRO3	7301	broad.mit.edu	37	15	41856430	41856430	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41856430G>A	uc001zof.1	+	5	853	c.629G>A	c.(628-630)GGC>GAC	p.G210D		NM_006293	NP_006284	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase precursor	210	Ig-like C2-type 2.|Extracellular (Potential).					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			ovary(3)|lung(2)|central_nervous_system(1)	6		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		AACCTAAAAGGCCTGGCCTCT	0.597													12	62	---	---	---	---	PASS
ZFP106	64397	broad.mit.edu	37	15	42742724	42742724	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42742724G>T	uc001zpw.2	-	2	2012	c.1677C>A	c.(1675-1677)ACC>ACA	p.T559T	ZFP106_uc001zpu.2_5'Flank|ZFP106_uc001zpv.2_Intron|ZFP106_uc001zpx.2_Intron|ZFP106_uc010udh.1_Silent_p.T342T|ZFP106_uc001zpy.1_Silent_p.T582T	NM_022473	NP_071918	Q9H2Y7	ZF106_HUMAN	zinc finger protein 106 homolog	559						nucleolus	zinc ion binding			central_nervous_system(2)|ovary(1)	3		all_cancers(109;1.63e-12)|all_epithelial(112;3.97e-11)|Lung NSC(122;2.04e-07)|all_lung(180;8.31e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.6e-07)		CATAGTTCCTGGTACTTTTAG	0.368													6	80	---	---	---	---	PASS
WDR76	79968	broad.mit.edu	37	15	44143306	44143306	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44143306G>T	uc001zti.1	+	9	1077	c.1054G>T	c.(1054-1056)GGA>TGA	p.G352*		NM_024908	NP_079184	Q9H967	WDR76_HUMAN	WD repeat domain 76	352	WD 1.										0		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		all cancers(107;3.78e-21)|GBM - Glioblastoma multiforme(94;5.04e-07)		TAAAGAAGATGGAGTTTATGT	0.433													6	87	---	---	---	---	PASS
CTDSPL2	51496	broad.mit.edu	37	15	44816320	44816320	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44816320G>T	uc001ztr.2	+	13	1765	c.1349G>T	c.(1348-1350)CGA>CTA	p.R450L	CTDSPL2_uc001zts.2_Missense_Mutation_p.R450L|CTDSPL2_uc001ztt.2_Missense_Mutation_p.R450L|CTDSPL2_uc010bdv.2_Missense_Mutation_p.R378L	NM_016396	NP_057480	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,	450							phosphoprotein phosphatase activity				0		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		GAAGATGTTCGACCACACATC	0.388													4	50	---	---	---	---	PASS
DUOX2	50506	broad.mit.edu	37	15	45402882	45402882	+	Silent	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45402882G>A	uc010bea.2	-	8	1112	c.909C>T	c.(907-909)CCC>CCT	p.P303P	DUOX2_uc001zun.2_Silent_p.P303P	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	303	Extracellular (Potential).|Peroxidase-like; mediates peroxidase activity (By similarity).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GCAGGAAGCTGGGCAGCCACT	0.612													6	21	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54306924	54306924	+	Silent	SNP	A	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54306924A>C	uc002ack.2	+	1	1824	c.1824A>C	c.(1822-1824)GGA>GGC	p.G608G		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	608					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		ATTTGAATGGAGGTGTTCAGG	0.512													15	63	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63014652	63014652	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63014652C>T	uc002alb.3	+	23	3092	c.3092C>T	c.(3091-3093)ACC>ATC	p.T1031I		NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1031	Ala-rich.				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						AACCTGGCCACCAGCTTGGCG	0.627													7	25	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63045984	63045984	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63045984G>T	uc002alb.3	+	33	4345	c.4345G>T	c.(4345-4347)GTT>TTT	p.V1449F	TLN2_uc002alc.3_5'UTR	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1449					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						TGCATACTTGGTTGGCATCTC	0.577													6	52	---	---	---	---	PASS
PML	5371	broad.mit.edu	37	15	74326832	74326832	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74326832G>T	uc002awv.2	+	7	1811	c.1671G>T	c.(1669-1671)GTG>GTT	p.V557V	PML_uc002awm.2_Silent_p.V557V|PML_uc002awl.2_Missense_Mutation_p.W423L|PML_uc002awj.1_3'UTR|PML_uc002awk.2_Silent_p.V557V|PML_uc002awn.2_Missense_Mutation_p.W560L|PML_uc002awo.2_Silent_p.V509V|PML_uc002awp.2_Intron|PML_uc002awq.2_Missense_Mutation_p.W560L|PML_uc002awr.2_Silent_p.V557V|PML_uc002aws.2_Silent_p.V509V|PML_uc002awt.2_Missense_Mutation_p.W423L|PML_uc002awu.2_Silent_p.V509V|PML_uc010ule.1_Silent_p.V118V|PML_uc002awx.2_Missense_Mutation_p.W270L|PML_uc002awy.2_5'UTR	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1	557	Interaction with SUMO1 and sumoylated proteins.			VVVI->AAAS: Abolishes SUMO1 binding.	cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5						AACGCGTTGTGGTGATCAGCA	0.582			T	RARA|PAX5	APL|ALL								8	145	---	---	---	---	PASS
TMED3	23423	broad.mit.edu	37	15	79606180	79606180	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79606180C>T	uc002beu.2	+	2	351	c.250C>T	c.(250-252)CAG>TAG	p.Q84*	TMED3_uc010unj.1_Nonsense_Mutation_p.Q84*|TMED3_uc002bev.2_RNA	NM_007364	NP_031390	Q9Y3Q3	TMED3_HUMAN	transmembrane emp24 domain containing 3	84	Lumenal (Potential).|GOLD.				protein transport	ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane				ovary(1)|skin(1)	2						AACGAAGAAGCAGTACGACAG	0.473													20	74	---	---	---	---	PASS
ARNT2	9915	broad.mit.edu	37	15	80872871	80872871	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80872871G>T	uc002bfr.2	+	16	1899	c.1733G>T	c.(1732-1734)CGT>CTT	p.R578L	ARNT2_uc010unm.1_Missense_Mutation_p.R567L|ARNT2_uc002bfs.2_Missense_Mutation_p.R567L	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	aryl hydrocarbon receptor nuclear translocator	578					central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)			ACAGGGAGTCGTCCGCCCTTT	0.562													7	38	---	---	---	---	PASS
ISG20	3669	broad.mit.edu	37	15	89182735	89182735	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89182735G>C	uc002bmv.1	+	2	431	c.138G>C	c.(136-138)GAG>GAC	p.E46D	ISG20_uc002bmu.1_Intron|ISG20_uc002bmw.1_RNA|ISG20_uc010upn.1_RNA	NM_002201	NP_002192	Q96AZ6	ISG20_HUMAN	interferon stimulated exonuclease	46					cell proliferation|DNA catabolic process, exonucleolytic|response to virus|RNA catabolic process|type I interferon-mediated signaling pathway	PML body	3'-5'-exoribonuclease activity|exoribonuclease II activity|metal ion binding|RNA binding|single-stranded DNA specific 3'-5' exodeoxyribonuclease activity				0	Lung NSC(78;0.0554)|all_lung(78;0.103)		BRCA - Breast invasive adenocarcinoma(143;0.12)			TCCGGCCTGAGGGAGAGATCA	0.637													7	46	---	---	---	---	PASS
C15orf51	196968	broad.mit.edu	37	15	100339997	100339997	+	RNA	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100339997G>C	uc010urx.1	-	4		c.930C>G			C15orf51_uc010ury.1_RNA|uc002bvp.2_5'Flank|C15orf51_uc010urz.1_RNA|uc002bvq.2_RNA|uc002bvt.1_5'Flank	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0						GTGTCTTCTCGTTCCCACGCG	0.612													4	43	---	---	---	---	PASS
LRRK1	79705	broad.mit.edu	37	15	101528851	101528851	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101528851C>A	uc002bwr.2	+	5	765	c.446C>A	c.(445-447)CCC>CAC	p.P149H	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bwq.1_Missense_Mutation_p.P149H	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	149					small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCCTGCAGTCCCCAGCGGCTT	0.607													7	130	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2160565	2160565	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2160565G>A	uc002cos.1	-	15	4812	c.4603C>T	c.(4603-4605)CGC>TGC	p.R1535C	PKD1_uc002cot.1_Missense_Mutation_p.R1535C	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	1535	Extracellular (Potential).|PKD 10.				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						GCCTCGCTGCGGCTCACCTCA	0.657													12	18	---	---	---	---	PASS
TMC5	79838	broad.mit.edu	37	16	19481080	19481080	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19481080G>C	uc002dgc.3	+	10	2464	c.1715G>C	c.(1714-1716)TGG>TCG	p.W572S	TMC5_uc010vaq.1_Missense_Mutation_p.W572S|TMC5_uc002dgb.3_Missense_Mutation_p.W572S|TMC5_uc010var.1_Missense_Mutation_p.W572S|TMC5_uc002dgd.1_Missense_Mutation_p.W326S|TMC5_uc002dge.3_Missense_Mutation_p.W326S|TMC5_uc002dgf.3_Missense_Mutation_p.W255S|TMC5_uc002dgg.3_Missense_Mutation_p.W213S	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a	572	Cytoplasmic (Potential).					integral to membrane				skin(1)	1						ATCTTTTGCTGGGACTTCACT	0.448													11	67	---	---	---	---	PASS
TMC5	79838	broad.mit.edu	37	16	19481081	19481081	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19481081G>T	uc002dgc.3	+	10	2465	c.1716G>T	c.(1714-1716)TGG>TGT	p.W572C	TMC5_uc010vaq.1_Missense_Mutation_p.W572C|TMC5_uc002dgb.3_Missense_Mutation_p.W572C|TMC5_uc010var.1_Missense_Mutation_p.W572C|TMC5_uc002dgd.1_Missense_Mutation_p.W326C|TMC5_uc002dge.3_Missense_Mutation_p.W326C|TMC5_uc002dgf.3_Missense_Mutation_p.W255C|TMC5_uc002dgg.3_Missense_Mutation_p.W213C	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a	572	Cytoplasmic (Potential).					integral to membrane				skin(1)	1						TCTTTTGCTGGGACTTCACTG	0.448													13	67	---	---	---	---	PASS
GTF3C1	2975	broad.mit.edu	37	16	27474919	27474919	+	Intron	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27474919G>A	uc002dov.1	-						GTF3C1_uc002dou.2_Intron	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide							transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						GAACCCTGAGGGAAGAGGAAG	0.602													11	47	---	---	---	---	PASS
ATXN2L	11273	broad.mit.edu	37	16	28841356	28841356	+	Silent	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28841356G>C	uc002drc.2	+	8	1179	c.1011G>C	c.(1009-1011)CGG>CGC	p.R337R	uc010vct.1_Intron|ATXN2L_uc010byl.1_Silent_p.R337R|ATXN2L_uc002drb.2_Silent_p.R337R|ATXN2L_uc002dqy.2_Silent_p.R337R|ATXN2L_uc002dra.2_Silent_p.R337R|ATXN2L_uc002dqz.2_Silent_p.R337R|ATXN2L_uc010vdb.1_Silent_p.R337R|ATXN2L_uc002dre.2_Silent_p.R337R|ATXN2L_uc002drf.2_5'UTR	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	337				R -> RG (in Ref. 6; AAB19201).		membrane				upper_aerodigestive_tract(1)|ovary(1)	2						GCTCAGGGCGGGAGAGCCCCA	0.612													4	16	---	---	---	---	PASS
STX1B	112755	broad.mit.edu	37	16	31012876	31012876	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31012876G>T	uc010cad.2	-	2	191	c.79C>A	c.(79-81)CAC>AAC	p.H27N	STX1B_uc010vfd.1_Missense_Mutation_p.H27N	NM_052874	NP_443106	P61266	STX1B_HUMAN	syntaxin 1B	27	Cytoplasmic (Potential).				intracellular protein transport|neurotransmitter transport|synaptic transmission	integral to plasma membrane	extracellular-glutamate-gated ion channel activity|SNAP receptor activity				0						TCCATGAAGTGGTCCCGATCC	0.408													6	36	---	---	---	---	PASS
ATP2A3	489	broad.mit.edu	37	17	3850763	3850763	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3850763C>A	uc002fxb.1	-	8	1168	c.1017G>T	c.(1015-1017)GTG>GTT	p.V339V	ATP2A3_uc002fwx.1_Silent_p.V339V|ATP2A3_uc002fwy.1_Silent_p.V339V|ATP2A3_uc002fwz.1_Silent_p.V339V|ATP2A3_uc002fxa.1_Silent_p.V339V|ATP2A3_uc002fxc.1_Silent_p.V339V|ATP2A3_uc002fxd.1_Silent_p.V339V	NM_174955	NP_777615	Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous isoform b	339	Cytoplasmic (By similarity).				ATP biosynthetic process|platelet activation	integral to membrane|nuclear membrane|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			ovary(3)|breast(1)|central_nervous_system(1)	5				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		CCAGGGTCTCCACGGACGGCA	0.652													5	59	---	---	---	---	PASS
PLD2	5338	broad.mit.edu	37	17	4712418	4712418	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4712418C>T	uc002fzc.2	+	5	508	c.407C>T	c.(406-408)GCC>GTC	p.A136V	PLD2_uc010vsj.1_5'UTR|PLD2_uc002fzd.2_Missense_Mutation_p.A136V	NM_002663	NP_002654	O14939	PLD2_HUMAN	phospholipase D2	136	PX.				cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5					Choline(DB00122)	TATTCTCCAGCCCGAGATGCA	0.582													29	76	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577534	7577534	+	Missense_Mutation	SNP	C	A	A	rs28934571		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577534C>A	uc002gim.2	-	7	941	c.747G>T	c.(745-747)AGG>AGT	p.R249S	TP53_uc002gig.1_Missense_Mutation_p.R249S|TP53_uc002gih.2_Missense_Mutation_p.R249S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R117S|TP53_uc010cng.1_Missense_Mutation_p.R117S|TP53_uc002gii.1_Missense_Mutation_p.R117S|TP53_uc010cnh.1_Missense_Mutation_p.R249S|TP53_uc010cni.1_Missense_Mutation_p.R249S|TP53_uc002gij.2_Missense_Mutation_p.R249S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R156S|TP53_uc002gio.2_Missense_Mutation_p.R117S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	249	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> I (in a sporadic cancer; somatic mutation).|R -> M (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R249S(303)|p.R249M(25)|p.R249G(24)|p.R249W(23)|p.R249T(16)|p.R249K(14)|p.0?(7)|p.R249R(6)|p.R249fs*96(6)|p.M246_P250delMNRRP(2)|p.R249fs*14(2)|p.N247_P250delNRRP(1)|p.R249fs*19(1)|p.R249fs*15(1)|p.R249_I251delRPI(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.R249_T256delRPILTIIT(1)|p.R249_P250>SS(1)|p.P250fs*14(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TGAGGATGGGCCTCCGGTTCA	0.572		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			15	30	---	---	---	---	PASS
CHD3	1107	broad.mit.edu	37	17	7806032	7806032	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7806032C>A	uc002gje.2	+	21	3507	c.3357C>A	c.(3355-3357)ATC>ATA	p.I1119I	CHD3_uc002gjd.2_Silent_p.I1178I|CHD3_uc002gjf.2_Silent_p.I1119I|CHD3_uc002gjh.2_5'Flank	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1119	Helicase C-terminal.				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding			breast(1)	1		Prostate(122;0.202)				AGGAGGCCATCGATCGGTTTA	0.547													4	53	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10298626	10298626	+	Missense_Mutation	SNP	C	G	G	rs61730807	byFrequency	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10298626C>G	uc002gmm.2	-	34	4881	c.4786G>C	c.(4786-4788)GTC>CTC	p.V1596L	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1596	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						GTCTCCACGACTCTAGTGTGG	0.428									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				11	43	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11514974	11514974	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11514974G>T	uc002gne.2	+	4	849	c.781G>T	c.(781-783)GAT>TAT	p.D261Y	DNAH9_uc002gnd.1_Missense_Mutation_p.D261Y	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	261	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CAGGTATGAAGATCTGAAATA	0.458													12	45	---	---	---	---	PASS
FLII	2314	broad.mit.edu	37	17	18149711	18149711	+	Silent	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18149711G>A	uc002gsr.1	-	24	3168	c.3117C>T	c.(3115-3117)ATC>ATT	p.I1039I	FLII_uc002gsq.1_Silent_p.I910I|FLII_uc010cpy.1_Silent_p.I1028I|FLII_uc010vxn.1_Silent_p.I1008I|FLII_uc010vxo.1_Silent_p.I984I	NM_002018	NP_002009	Q13045	FLII_HUMAN	flightless I homolog	1039					multicellular organismal development|muscle contraction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	actin binding			central_nervous_system(1)|skin(1)	2	all_neural(463;0.228)					CCCGGTGGATGATGAACTTCC	0.632													15	106	---	---	---	---	PASS
FBXW10	10517	broad.mit.edu	37	17	18682490	18682490	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18682490T>C	uc002guk.2	+	14	3270	c.3038T>C	c.(3037-3039)GTT>GCT	p.V1013A	FBXW10_uc002guj.2_Missense_Mutation_p.V1012A|FBXW10_uc002gul.2_Missense_Mutation_p.V1022A|FBXW10_uc010cqh.1_Missense_Mutation_p.V960A|FAM18B_uc002gum.2_5'Flank	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10	1013										ovary(1)	1						ACTGGAGTGGTTGATCCAGGA	0.502													9	40	---	---	---	---	PASS
RAB34	83871	broad.mit.edu	37	17	27042864	27042864	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27042864C>A	uc002hce.2	-	4	892	c.268G>T	c.(268-270)GAG>TAG	p.E90*	RAB34_uc002hcg.2_Nonsense_Mutation_p.E90*|RAB34_uc002hcf.2_Nonsense_Mutation_p.E91*|RAB34_uc010was.1_Nonsense_Mutation_p.E147*|RAB34_uc010wat.1_Nonsense_Mutation_p.E147*|RAB34_uc002hch.2_Nonsense_Mutation_p.E90*|RAB34_uc010wau.1_Nonsense_Mutation_p.E68*|RAB34_uc010wav.1_Nonsense_Mutation_p.E148*	NM_031934	NP_114140	Q9BZG1	RAB34_HUMAN	Ras-related protein RAB34 isoform 1	90					protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding				0	Lung NSC(42;0.00431)					CGTTCCATCTCGAAGTCCACT	0.547													5	115	---	---	---	---	PASS
SLFN5	162394	broad.mit.edu	37	17	33592328	33592328	+	Silent	SNP	C	T	T	rs149671075	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33592328C>T	uc002hjf.3	+	5	2214	c.2097C>T	c.(2095-2097)CCC>CCT	p.P699P	SLFN5_uc010wcg.1_3'UTR	NM_144975	NP_659412	Q08AF3	SLFN5_HUMAN	schlafen family member 5	699					cell differentiation		ATP binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		TCCCCCCTCCCTCAGACCAGT	0.493													16	63	---	---	---	---	PASS
TUBG2	27175	broad.mit.edu	37	17	40812318	40812318	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40812318C>A	uc010wgr.1	+	3	570	c.314C>A	c.(313-315)GCC>GAC	p.A105D	TUBG2_uc002iaq.2_5'UTR|TUBG2_uc002iar.2_5'UTR|TUBG2_uc002ias.2_5'UTR|TUBG2_uc002iap.2_5'UTR	NM_016437	NP_057521	Q9NRH3	TBG2_HUMAN	tubulin, gamma 2	105					G2/M transition of mitotic cell cycle|microtubule-based process|protein polymerization	cytosol	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.141)		AACAACTGGGCCAGCGGATTC	0.542													4	44	---	---	---	---	PASS
C17orf57	124989	broad.mit.edu	37	17	45507265	45507265	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45507265A>G	uc002iln.2	+	24	2987	c.2576A>G	c.(2575-2577)GAC>GGC	p.D859G	C17orf57_uc002ilm.2_Missense_Mutation_p.D763G	NM_152347	NP_689560	Q8IY85	CQ057_HUMAN	hypothetical protein LOC124989	859							calcium ion binding			breast(1)|central_nervous_system(1)|skin(1)	3						TTATTGATGGACAAGGACCTT	0.383													3	45	---	---	---	---	PASS
HOXB3	3213	broad.mit.edu	37	17	46629716	46629716	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46629716T>C	uc002inn.2	-	1	521	c.121A>G	c.(121-123)ACG>GCG	p.T41A	HOXB3_uc010wlm.1_5'UTR|HOXB3_uc010dbf.2_Missense_Mutation_p.T41A|HOXB3_uc010dbg.2_Missense_Mutation_p.T41A|HOXB3_uc002ino.2_Missense_Mutation_p.T41A|HOXB3_uc010wlk.1_Intron|HOXB3_uc010wll.1_5'UTR	NM_002146	NP_002137	P14651	HXB3_HUMAN	homeobox B3	41					angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TCCAGGTGCGTGGCGGCCTGA	0.647													3	25	---	---	---	---	PASS
RSAD1	55316	broad.mit.edu	37	17	48560072	48560072	+	Intron	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48560072G>A	uc002iqw.1	+						RSAD1_uc010wmq.1_Intron	NM_018346	NP_060816	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing						porphyrin biosynthetic process	mitochondrion	4 iron, 4 sulfur cluster binding|coproporphyrinogen oxidase activity|metal ion binding				0	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GGCCTGGTGAGTCCCGTGAAC	0.403													12	43	---	---	---	---	PASS
CA10	56934	broad.mit.edu	37	17	50008357	50008357	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50008357C>A	uc002itw.3	-	3	1258	c.272G>T	c.(271-273)GGC>GTC	p.G91V	CA10_uc002itv.3_Missense_Mutation_p.G97V|CA10_uc002itx.3_Missense_Mutation_p.G91V|CA10_uc002ity.3_Missense_Mutation_p.G91V|CA10_uc002itz.2_Missense_Mutation_p.G91V	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	91					brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			TACCTTCCTGCCCCCCGTGTT	0.493													20	117	---	---	---	---	PASS
MED13	9969	broad.mit.edu	37	17	60042580	60042580	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60042580G>T	uc002izo.2	-	20	4708	c.4631C>A	c.(4630-4632)TCC>TAC	p.S1544Y		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1544	Ser-rich.				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						ATTCAAGTTGGAGGATGATGA	0.418													6	72	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62036742	62036742	+	Silent	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62036742G>A	uc002jds.1	-	12	1979	c.1902C>T	c.(1900-1902)CCC>CCT	p.P634P		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	634	II.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	AATACTCGTAGGGGTCCATGG	0.572													8	38	---	---	---	---	PASS
CACNG4	27092	broad.mit.edu	37	17	64961112	64961112	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64961112G>T	uc002jft.1	+	1	100	c.85G>T	c.(85-87)GGC>TGC	p.G29C		NM_014405	NP_055220	Q9UBN1	CCG4_HUMAN	voltage-dependent calcium channel gamma-4	29	Helical; (Potential).				membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane	voltage-gated calcium channel activity			central_nervous_system(1)	1	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			CATCGCCATCGGCACCGACTA	0.557													3	12	---	---	---	---	PASS
ST6GALNAC1	55808	broad.mit.edu	37	17	74622817	74622817	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74622817G>T	uc002jsh.2	-	5	1401	c.1227C>A	c.(1225-1227)TCC>TCA	p.S409S	ST6GALNAC1_uc002jsi.2_Silent_p.S277S|ST6GALNAC1_uc002jsj.2_RNA	NM_018414	NP_060884	Q9NSC7	SIA7A_HUMAN	sialyltransferase 7A	409	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity				0						AGCCGTAGAAGGATGTCCGAG	0.532													11	323	---	---	---	---	PASS
EMILIN2	84034	broad.mit.edu	37	18	2892094	2892094	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2892094C>A	uc002kln.2	+	4	2128	c.1969C>A	c.(1969-1971)CCG>ACG	p.P657T		NM_032048	NP_114437	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2 precursor	657					cell adhesion	collagen	extracellular matrix constituent conferring elasticity|protein binding			skin(2)|ovary(1)	3				READ - Rectum adenocarcinoma(2;0.1)		GGACACCCTGCCGTCCCCCCA	0.552													6	46	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8394468	8394468	+	Intron	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8394468C>T	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				ATCTTTTTCACGACAGGAACG	0.522													7	24	---	---	---	---	PASS
CEP192	55125	broad.mit.edu	37	18	13073110	13073110	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13073110C>A	uc010xac.1	+	30	5622	c.5542C>A	c.(5542-5544)CGA>AGA	p.R1848R	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Silent_p.R1373R|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_Silent_p.R270R|CEP192_uc002krw.2_5'UTR|CEP192_uc002krx.2_5'UTR	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	1848										ovary(4)|pancreas(1)	5						TGCACCTACTCGATTATCTTG	0.383													6	87	---	---	---	---	PASS
DSG3	1830	broad.mit.edu	37	18	29045295	29045295	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29045295G>A	uc002kws.2	+	10	1395	c.1286G>A	c.(1285-1287)CGT>CAT	p.R429H		NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	429	Cadherin 4.|Extracellular (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GTCATGGGACGTAACGATGGT	0.269													9	48	---	---	---	---	PASS
SLC39A6	25800	broad.mit.edu	37	18	33692453	33692453	+	Intron	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33692453G>T	uc010dmy.2	-						SLC39A6_uc002kzj.2_Intron	NM_012319	NP_036451	Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter),							integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity			ovary(1)|pancreas(1)	2						CAATTTATGTGGTTCTCTTAC	0.393													6	87	---	---	---	---	PASS
CNDP1	84735	broad.mit.edu	37	18	72245452	72245452	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72245452G>T	uc002llq.2	+	9	1268	c.1057G>T	c.(1057-1059)GAG>TAG	p.E353*	CNDP1_uc002lls.2_Nonsense_Mutation_p.E156*	NM_032649	NP_116038	Q96KN2	CNDP1_HUMAN	carnosinase 1 precursor	353					proteolysis	extracellular region	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity|tripeptidase activity				0		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		TCATGGGATCGAGGGCGCGTT	0.423													4	58	---	---	---	---	PASS
AP3D1	8943	broad.mit.edu	37	19	2121290	2121290	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2121290C>A	uc002luz.2	-	13	1345	c.1122G>T	c.(1120-1122)ATG>ATT	p.M374I	AP3D1_uc002luy.2_Missense_Mutation_p.M283I|AP3D1_uc002lva.2_Missense_Mutation_p.M374I	NM_003938	NP_003929	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1	374					eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCACGATCTCCATCAGGTTCT	0.562													6	83	---	---	---	---	PASS
PLIN4	729359	broad.mit.edu	37	19	4511796	4511796	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4511796G>T	uc002mar.1	-	3	2134	c.2134C>A	c.(2134-2136)CTA>ATA	p.L712I	PLIN4_uc010dub.1_5'Flank	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12	712	19.|27 X 33 AA approximate tandem repeat.					lipid particle|plasma membrane					0						GTACCAGTTAGGACAGTCTTG	0.592													10	344	---	---	---	---	PASS
ARRDC5	645432	broad.mit.edu	37	19	4891523	4891523	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4891523G>T	uc002mbm.2	-	3	564	c.564C>A	c.(562-564)GTC>GTA	p.V188V		NM_001080523	NP_001073992	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	188					signal transduction						0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		TTTGCAAACAGACAGTGCCCT	0.537													6	32	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9048368	9048368	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9048368G>T	uc002mkp.2	-	5	33467	c.33263C>A	c.(33262-33264)CCA>CAA	p.P11088Q		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11090	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGAAACAGTTGGAGTTGGAAC	0.483													5	70	---	---	---	---	PASS
ELAVL3	1995	broad.mit.edu	37	19	11565633	11565633	+	Missense_Mutation	SNP	G	T	T	rs144639070		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11565633G>T	uc002mry.1	-	7	1192	c.812C>A	c.(811-813)GCG>GAG	p.A271E	ELAVL3_uc002mrx.1_Missense_Mutation_p.A264E	NM_001420	NP_001411	Q14576	ELAV3_HUMAN	ELAV-like protein 3 isoform 1	271					cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)|skin(1)	3						GCCCACGCCCGCCAGGCCGCT	0.577													20	58	---	---	---	---	PASS
ZNF491	126069	broad.mit.edu	37	19	11917126	11917126	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11917126A>T	uc002mso.1	+	3	643	c.358A>T	c.(358-360)AGA>TGA	p.R120*		NM_152356	NP_689569	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	120	C2H2-type 2; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						AAGCATTCGAAGATATATGGT	0.398													16	58	---	---	---	---	PASS
ZNF20	7568	broad.mit.edu	37	19	12244153	12244153	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12244153T>C	uc002mtf.1	-	4	991	c.848A>G	c.(847-849)TAT>TGT	p.Y283C	ZNF20_uc002mte.1_Missense_Mutation_p.Y248C|ZNF20_uc002mtg.1_Missense_Mutation_p.Y283C	NM_021143	NP_066966	P17024	ZNF20_HUMAN	zinc finger protein 20	283	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CTTACACTCATAGGGTTTTTC	0.393													4	54	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	14909978	14909978	+	IGR	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14909978C>A								EMR2 (20625 upstream) : OR7C1 (10 downstream)																							TGGTCCAAGCCTTGCTACTTA	0.438													10	46	---	---	---	---	PASS
CASP14	23581	broad.mit.edu	37	19	15164418	15164418	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15164418C>A	uc010dzv.1	+	3	461	c.153C>A	c.(151-153)ACC>ACA	p.T51T	CASP14_uc002naf.2_Silent_p.T51T	NM_012114	NP_036246	P31944	CASPE_HUMAN	caspase 14 precursor	51					apoptosis|cell differentiation|epidermis development|proteolysis	cytoplasm|nucleus	cysteine-type endopeptidase activity			skin(2)|ovary(1)|lung(1)	4						TCGAAAGCACCATGAAAAGAG	0.552													7	135	---	---	---	---	PASS
CYP4F12	66002	broad.mit.edu	37	19	15794350	15794350	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15794350T>A	uc002nbl.2	+	7	756	c.695T>A	c.(694-696)GTA>GAA	p.V232E		NM_023944	NP_076433			cytochrome P450, family 4, subfamily F,											skin(3)|ovary(2)|central_nervous_system(2)	7	Acute lymphoblastic leukemia(2;0.0367)					AGTGCCCTTGTAGAGAAAAGA	0.547													15	63	---	---	---	---	PASS
OR10H2	26538	broad.mit.edu	37	19	15839195	15839195	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15839195G>T	uc002nbm.2	+	1	362	c.342G>T	c.(340-342)CTG>CTT	p.L114L		NM_013939	NP_039227	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H,	114	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					ACTCCTTCCTGCTCACCGTCA	0.647													5	24	---	---	---	---	PASS
UPF1	5976	broad.mit.edu	37	19	18971121	18971121	+	Intron	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18971121C>A	uc002nkg.2	+						UPF1_uc002nkf.2_Intron|UPF1_uc002nkh.2_5'UTR	NM_002911	NP_002902	Q92900	RENT1_HUMAN	regulator of nonsense transcripts 1						cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2						TCTTTCCCTCCCCTCACAGCG	0.542													8	147	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19338255	19338255	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19338255C>A	uc002nlz.2	+	8	1925	c.1826C>A	c.(1825-1827)GCC>GAC	p.A609D	NCAN_uc010ecc.1_Missense_Mutation_p.A173D	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	609					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			CCCTTGGAGGCCACTGTCTCA	0.652													5	23	---	---	---	---	PASS
ZNF430	80264	broad.mit.edu	37	19	21205610	21205610	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21205610G>T	uc002npj.2	+	2	129	c.19G>T	c.(19-21)GGA>TGA	p.G7*	ZNF430_uc002npk.2_Nonsense_Mutation_p.G7*	NM_025189	NP_079465	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	7					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2						CCTGAAGTCTGGAGTGTATCC	0.443													5	66	---	---	---	---	PASS
ZNF254	9534	broad.mit.edu	37	19	24309473	24309473	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24309473C>T	uc002nru.2	+	4	805	c.671C>T	c.(670-672)ACC>ATC	p.T224I	ZNF254_uc010xrk.1_Missense_Mutation_p.T139I	NM_203282	NP_975011	O75437	ZN254_HUMAN	zinc finger protein 254	224	C2H2-type 1; degenerate.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				TGGTCCTCAACCCTTACTAAT	0.328													5	33	---	---	---	---	PASS
DPY19L3	147991	broad.mit.edu	37	19	32923703	32923703	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32923703C>T	uc002ntg.2	+	4	495	c.319C>T	c.(319-321)CTC>TTC	p.L107F	DPY19L3_uc002nth.1_Missense_Mutation_p.L107F	NM_207325	NP_997208	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3	107						integral to membrane				ovary(4)	4	Esophageal squamous(110;0.162)					GGCTCCAACCCTCGTGCAAGG	0.413													5	34	---	---	---	---	PASS
LGALS13	29124	broad.mit.edu	37	19	40097949	40097949	+	Silent	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40097949C>T	uc002omb.2	+	4	430	c.390C>T	c.(388-390)ATC>ATT	p.I130I		NM_013268	NP_037400	Q9UHV8	PP13_HUMAN	galectin-13	130	Galectin.				lipid catabolic process|phospholipid metabolic process		carboxylesterase activity|lysophospholipase activity|sugar binding			ovary(1)	1	all_cancers(60;1.77e-05)|all_lung(34;5.38e-08)|Lung NSC(34;6.37e-08)|Ovarian(47;0.116)		Epithelial(26;3.28e-26)|OV - Ovarian serous cystadenocarcinoma(5;7.31e-25)|all cancers(26;1.15e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)			CGAGAGATATCTCCCTGACCT	0.468													5	41	---	---	---	---	PASS
ATP1A3	478	broad.mit.edu	37	19	42485885	42485885	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42485885G>T	uc002osg.2	-	10	1445	c.1291C>A	c.(1291-1293)CCT>ACT	p.P431T	ATP1A3_uc010xwf.1_Missense_Mutation_p.P442T|ATP1A3_uc010xwg.1_Missense_Mutation_p.P401T|ATP1A3_uc010xwh.1_Missense_Mutation_p.P444T|ATP1A3_uc002osh.2_Missense_Mutation_p.P431T	NM_152296	NP_689509	P13637	AT1A3_HUMAN	Na+/K+ -ATPase alpha 3 subunit	431	Cytoplasmic (Potential).				ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2						TTGAGCACAGGGATGTTGTCC	0.592													7	33	---	---	---	---	PASS
ZNF284	342909	broad.mit.edu	37	19	44590805	44590805	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44590805G>T	uc002oyg.1	+	5	1390	c.1174G>T	c.(1174-1176)GTC>TTC	p.V392F	ZNF284_uc010ejd.2_RNA	NM_001037813	NP_001032902	Q2VY69	ZN284_HUMAN	zinc finger protein 284	392	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0435)				ACATCAGCGGGTCCACAATGG	0.433													33	94	---	---	---	---	PASS
SYT3	84258	broad.mit.edu	37	19	51133130	51133130	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51133130C>A	uc002pst.2	-	3	1607	c.973G>T	c.(973-975)GAC>TAC	p.D325Y	SYT3_uc002psv.2_Missense_Mutation_p.D325Y|SYT3_uc010ycd.1_Missense_Mutation_p.D325Y	NM_032298	NP_115674	Q9BQG1	SYT3_HUMAN	synaptotagmin III	325	C2 1.|Cytoplasmic (Potential).					cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|breast(1)	3		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GCAGGGAGGTCCAGGGCCTGC	0.587													11	57	---	---	---	---	PASS
LILRB4	11006	broad.mit.edu	37	19	55179385	55179385	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55179385G>T	uc002qgp.2	+	12	1624	c.1262G>T	c.(1261-1263)AGA>ATA	p.R421I	LILRB4_uc002qgq.2_Missense_Mutation_p.R420I|LILRB4_uc002qgr.2_Missense_Mutation_p.R463I|LILRB4_uc010ert.2_Missense_Mutation_p.R462I|LILRB4_uc010eru.2_Missense_Mutation_p.R451I	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor,	421	Cytoplasmic (Potential).					integral to membrane|plasma membrane	antigen binding|receptor activity			ovary(3)	3				GBM - Glioblastoma multiforme(193;0.035)		TTTACCCTCAGACAGAAGGCA	0.622													9	77	---	---	---	---	PASS
FCAR	2204	broad.mit.edu	37	19	55401234	55401234	+	3'UTR	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55401234C>A	uc002qhr.1	+	5					FCAR_uc002qhs.1_RNA|FCAR_uc002qht.1_3'UTR|FCAR_uc010esi.1_3'UTR|FCAR_uc002qhu.1_3'UTR|FCAR_uc002qhv.1_3'UTR|FCAR_uc002qhw.1_3'UTR|FCAR_uc002qhx.1_3'UTR|FCAR_uc002qhy.1_3'UTR|FCAR_uc002qhz.1_3'UTR|FCAR_uc002qia.1_3'UTR	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor						immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		AAGTAAACACCTGGAGGTGAA	0.502													6	98	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57642748	57642748	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57642748G>C	uc002qny.2	+	4	3061	c.2705G>C	c.(2704-2706)AGC>ACC	p.S902T		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	902					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CGGCTACCTAGCACACAGGCA	0.498													11	55	---	---	---	---	PASS
RRBP1	6238	broad.mit.edu	37	20	17610501	17610501	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17610501C>A	uc002wpv.1	-	10	1771	c.1417G>T	c.(1417-1419)GAG>TAG	p.E473*	RRBP1_uc002wpu.2_Nonsense_Mutation_p.E247*|RRBP1_uc002wpw.1_Nonsense_Mutation_p.E473*|RRBP1_uc010gcl.1_Nonsense_Mutation_p.E247*|RRBP1_uc010gcm.1_Silent_p.P58P	NM_001042576	NP_001036041	Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	906	Cytoplasmic (Potential).				protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1						TGGGCCTTCTCGGCATCCGCC	0.711													8	10	---	---	---	---	PASS
RALGAPA2	57186	broad.mit.edu	37	20	20505152	20505152	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20505152C>A	uc002wrz.2	-	30	3941	c.3798G>T	c.(3796-3798)TGG>TGT	p.W1266C	RALGAPA2_uc010gcx.2_Missense_Mutation_p.W970C|RALGAPA2_uc010zsg.1_Missense_Mutation_p.W714C|RALGAPA2_uc002wsa.1_Missense_Mutation_p.W38C	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	1266					activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						ATGCCATGCACCAGTCCAAGA	0.502													12	49	---	---	---	---	PASS
RALGAPA2	57186	broad.mit.edu	37	20	20505153	20505153	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20505153C>A	uc002wrz.2	-	30	3940	c.3797G>T	c.(3796-3798)TGG>TTG	p.W1266L	RALGAPA2_uc010gcx.2_Missense_Mutation_p.W970L|RALGAPA2_uc010zsg.1_Missense_Mutation_p.W714L|RALGAPA2_uc002wsa.1_Missense_Mutation_p.W38L	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	1266					activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						TGCCATGCACCAGTCCAAGAG	0.502													12	46	---	---	---	---	PASS
ASXL1	171023	broad.mit.edu	37	20	30956834	30956834	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30956834G>T	uc002wxs.2	+	3	586	c.160G>T	c.(160-162)GCA>TCA	p.A54S	ASXL1_uc002wxr.1_RNA|ASXL1_uc002wxt.2_RNA|ASXL1_uc010geb.2_5'UTR	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	54					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						TTCCCCTCTCGCATGCCTCAA	0.438			F|N|Mis		MDS|CMML								10	49	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33337933	33337933	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33337933G>T	uc002xav.2	-	10	4636	c.2065C>A	c.(2065-2067)CCA>ACA	p.P689T	NCOA6_uc002xaw.2_Missense_Mutation_p.P689T	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	689	TBP/GTF2A-binding region.|NCOA1-binding region.|Gln-rich.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						ATCATTTGTGGGCCCTGCTGG	0.547													5	56	---	---	---	---	PASS
RBM12	10137	broad.mit.edu	37	20	34241817	34241817	+	Silent	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34241817T>C	uc002xdq.2	-	3	1660	c.1428A>G	c.(1426-1428)GTA>GTG	p.V476V	CPNE1_uc010zvj.1_5'UTR|CPNE1_uc002xde.2_Intron|CPNE1_uc002xdf.2_Intron|CPNE1_uc002xdg.2_Intron|CPNE1_uc010gfi.2_Intron|CPNE1_uc010gfj.2_Intron|CPNE1_uc002xdh.2_Intron|CPNE1_uc002xdi.2_Intron|CPNE1_uc002xdj.2_Intron|CPNE1_uc002xdk.2_Intron|CPNE1_uc002xdl.2_Intron|CPNE1_uc002xdm.2_Intron|CPNE1_uc010gfk.1_Intron|CPNE1_uc002xdn.1_Intron|CPNE1_uc002xdo.1_Intron|CPNE1_uc002xdp.1_Intron|RBM12_uc002xdr.2_Silent_p.V476V|RBM12_uc002xds.2_Silent_p.V476V	NM_152838	NP_690051	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	476	RRM 2.					nucleus	nucleotide binding|protein binding|RNA binding			ovary(3)	3	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			TTCTGAACTCTACAAAGCCTT	0.373											OREG0004044	type=REGULATORY REGION|Gene=CPNE1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	33	107	---	---	---	---	PASS
ACTR5	79913	broad.mit.edu	37	20	37384652	37384652	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37384652C>A	uc002xjd.2	+	5	1171	c.1146C>A	c.(1144-1146)CTC>CTA	p.L382L		NM_024855	NP_079131	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog	382	Potential.				DNA recombination|double-strand break repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent|UV-damage excision repair	cytoplasm|Ino80 complex	ATP binding|protein binding				0		Myeloproliferative disorder(115;0.00878)				AAGTCAACCTCGAGGTGGATG	0.532													4	39	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40735489	40735489	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40735489C>A	uc002xkg.2	-	24	3511	c.3327G>T	c.(3325-3327)GTG>GTT	p.V1109V	PTPRT_uc010ggj.2_Silent_p.V1128V|PTPRT_uc010ggi.2_Silent_p.V312V	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1109	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AGATGTCCACCACCCCTTCAT	0.572													5	58	---	---	---	---	PASS
R3HDML	140902	broad.mit.edu	37	20	42965955	42965955	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42965955G>T	uc002xls.1	+	1	330	c.158G>T	c.(157-159)CGC>CTC	p.R53L		NM_178491	NP_848586	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like precursor	53						extracellular region	peptidase inhibitor activity				0		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			CCCAGGTACCGCCGGAAGCGC	0.597													6	20	---	---	---	---	PASS
SLC12A5	57468	broad.mit.edu	37	20	44664177	44664177	+	Intron	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44664177G>A	uc010zxl.1	+						SLC12A5_uc002xra.2_Intron|SLC12A5_uc010zxm.1_Intron|SLC12A5_uc002xrb.2_Intron	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride						potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CGGTGCAGGTGAGGACCTCGG	0.313													10	37	---	---	---	---	PASS
C20orf43	51507	broad.mit.edu	37	20	55049835	55049835	+	Intron	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55049835G>T	uc002xxt.2	+						C20orf43_uc010zzf.1_Intron|C20orf43_uc002xxu.2_Intron|C20orf43_uc002xxv.2_Intron	NM_016407	NP_057491	Q9BY42	CT043_HUMAN	hypothetical protein LOC51507											ovary(1)	1			Colorectal(105;0.202)			AAGGTAACACGAGTGATTCTG	0.333													6	75	---	---	---	---	PASS
PCK1	5105	broad.mit.edu	37	20	56137948	56137948	+	Silent	SNP	T	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56137948T>A	uc002xyn.3	+	4	766	c.603T>A	c.(601-603)CCT>CCA	p.P201P	PCK1_uc010zzm.1_Intron	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1	201					gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			GCCCTCTGCCTTTACAAAGTA	0.532													7	28	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57769790	57769790	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57769790G>C	uc002yan.2	+	1	3716	c.3716G>C	c.(3715-3717)GGA>GCA	p.G1239A		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1239						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					CCTGGAGAAGGAGGGCCGGCG	0.597													4	10	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57829123	57829123	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57829123C>A	uc002yan.2	+	5	4359	c.4359C>A	c.(4357-4359)TCC>TCA	p.S1453S		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1453						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					TGCTGGCCTCCCAGGATTCAG	0.522													6	63	---	---	---	---	PASS
C20orf11	54994	broad.mit.edu	37	20	61576136	61576136	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61576136G>T	uc002ydy.2	+	5	736	c.559G>T	c.(559-561)GAG>TAG	p.E187*		NM_017896	NP_060366	Q9NWU2	CT011_HUMAN	chromosome 20 open reading frame 11	187						nucleus	protein binding				0	Breast(26;5.68e-08)					TGAAAATCGCGAGTCAACACC	0.418													4	71	---	---	---	---	PASS
COL20A1	57642	broad.mit.edu	37	20	61959481	61959481	+	Splice_Site	SNP	T	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61959481T>A	uc011aau.1	+	33	3713	c.3613_splice	c.e33+2	p.S1205_splice	COL20A1_uc011aav.1_Nonsense_Mutation_p.C1026*	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1						cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					GCCAGGCCTGTGAGTCTGCCA	0.647													3	14	---	---	---	---	PASS
ZNF512B	57473	broad.mit.edu	37	20	62595499	62595499	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62595499C>G	uc002yhl.1	-	8	1459	c.1405G>C	c.(1405-1407)GCC>CCC	p.A469P		NM_020713	NP_065764	Q96KM6	Z512B_HUMAN	zinc finger protein 512B	469					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TTCTTCCGGGCGTCCTCAGGG	0.662													9	36	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47847543	47847543	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47847543C>A	uc002zji.3	+	34	7435	c.7328C>A	c.(7327-7329)CCC>CAC	p.P2443H	PCNT_uc002zjj.2_Missense_Mutation_p.P2325H	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	2443					cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					TAGGAAGTGCCCACCGCGTGC	0.458													6	47	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22735419	22735419	+	RNA	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22735419C>A	uc011aim.1	+	46		c.5215C>A								Parts of antibodies, mostly variable regions.												0						GGGTCCTGGGCCCAGTCTGTG	0.577													7	53	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22735420	22735420	+	RNA	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22735420C>A	uc011aim.1	+	46		c.5216C>A								Parts of antibodies, mostly variable regions.												0						GGTCCTGGGCCCAGTCTGTGC	0.577													6	52	---	---	---	---	PASS
ZNF280B	140883	broad.mit.edu	37	22	22843151	22843151	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22843151C>A	uc002zwc.1	-	4	1349	c.573G>T	c.(571-573)AGG>AGT	p.R191S	LOC96610_uc011aim.1_Intron	NM_080764	NP_542942	Q86YH2	Z280B_HUMAN	zinc finger protein 280B	191					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TAATTCCATCCCTGAGTTTAG	0.383													10	68	---	---	---	---	PASS
CHCHD10	400916	broad.mit.edu	37	22	24108318	24108318	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24108318G>T	uc002zxw.2	-	3	486	c.406C>A	c.(406-408)CAT>AAT	p.H136N		NM_213720	NP_998885	Q8WYQ3	CHC10_HUMAN	coiled-coil-helix-coiled-coil-helix domain	136						mitochondrion					0						CACTCACCATGGTAGTACTTG	0.627													5	29	---	---	---	---	PASS
RFPL1	5988	broad.mit.edu	37	22	29837623	29837623	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29837623C>T	uc003afn.2	+	2	675	c.466C>T	c.(466-468)CGG>TGG	p.R156W	RFPL1S_uc003afm.1_RNA	NM_021026	NP_066306	O75677	RFPL1_HUMAN	ret finger protein-like 1	156	B30.2/SPRY.						zinc ion binding				0						CACACAGAATCGGCAAGACCT	0.552													21	64	---	---	---	---	PASS
PATZ1	23598	broad.mit.edu	37	22	31741322	31741322	+	Silent	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31741322G>A	uc003akq.2	-	1	928	c.267C>T	c.(265-267)GGC>GGT	p.G89G	PATZ1_uc003akp.2_Silent_p.G89G|PATZ1_uc003akr.2_Silent_p.G89G|PATZ1_uc003aks.2_Silent_p.G89G|uc003akt.2_5'Flank	NM_014323	NP_055138	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	89	BTB.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding		EWSR1/PATZ1(2)	soft_tissue(2)	2						CTGCCGTCGCGCCCCCTACAT	0.682													5	9	---	---	---	---	PASS
LARGE	9215	broad.mit.edu	37	22	34000433	34000433	+	Silent	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34000433T>C	uc003and.3	-	6	1182	c.603A>G	c.(601-603)GCA>GCG	p.A201A	LARGE_uc003ane.3_Silent_p.A201A|LARGE_uc010gwp.2_Silent_p.A201A|LARGE_uc011ame.1_Silent_p.A133A|LARGE_uc011amf.1_Silent_p.A201A	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase	201	Lumenal (Potential).				glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				TGAGCTCGTCTGCATTGTAGA	0.547													8	71	---	---	---	---	PASS
TOM1	10043	broad.mit.edu	37	22	35723368	35723368	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35723368G>T	uc003ann.2	+	7	878	c.753G>T	c.(751-753)CTG>CTT	p.L251L	TOM1_uc011ami.1_Silent_p.L218L|TOM1_uc011amj.1_Silent_p.L94L|TOM1_uc003ans.2_Silent_p.L94L|TOM1_uc011amk.1_Silent_p.L213L|TOM1_uc003anp.2_Silent_p.L251L|TOM1_uc011aml.1_Silent_p.L206L|TOM1_uc003ano.2_RNA|TOM1_uc003anq.2_Silent_p.L245L|TOM1_uc003anr.2_Silent_p.L94L	NM_005488	NP_005479	O60784	TOM1_HUMAN	target of myb1 isoform 1	251	GAT.				endocytosis|endosome transport|intracellular protein transport	cytosol|early endosome|membrane	protein binding			ovary(1)	1						CCGCAGACCTGGAGCTGCTGC	0.627													9	20	---	---	---	---	PASS
MB	4151	broad.mit.edu	37	22	36003352	36003352	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36003352G>A	uc003anz.2	-	3	537	c.457C>T	c.(457-459)CAG>TAG	p.Q153*	MB_uc003aoa.2_Nonsense_Mutation_p.Q153*|MB_uc003aob.2_Nonsense_Mutation_p.Q153*	NM_005368	NP_005359	P02144	MYG_HUMAN	myoglobin	153							heme binding|oxygen transporter activity				0						GCCTAGCCCTGGAAGCCCAGC	0.622													6	42	---	---	---	---	PASS
CACNA1I	8911	broad.mit.edu	37	22	40045840	40045840	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40045840C>A	uc003ayc.2	+	10	1902	c.1902C>A	c.(1900-1902)CGC>CGA	p.R634R	CACNA1I_uc003ayd.2_Silent_p.R599R|CACNA1I_uc003aye.2_Silent_p.R549R|CACNA1I_uc003ayf.2_Silent_p.R514R	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,	634	II.|Cytoplasmic (Potential).				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	CCAAGCTGCGCGGCATCGTGG	0.532													8	30	---	---	---	---	PASS
ENTHD1	150350	broad.mit.edu	37	22	40217076	40217076	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40217076G>T	uc003ayg.2	-	5	1005	c.754C>A	c.(754-756)CTA>ATA	p.L252I		NM_152512	NP_689725	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	252										ovary(2)|skin(1)	3	Melanoma(58;0.0749)					GGTGTTGCTAGTAAAGGCAGC	0.398													5	25	---	---	---	---	PASS
RANGAP1	5905	broad.mit.edu	37	22	41647034	41647034	+	Missense_Mutation	SNP	C	A	A	rs139565299		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41647034C>A	uc003azs.2	-	12	2930	c.1460G>T	c.(1459-1461)AGG>ATG	p.R487M	RANGAP1_uc003azt.2_Missense_Mutation_p.R487M|RANGAP1_uc003azu.2_Missense_Mutation_p.R487M|RANGAP1_uc003azr.2_Translation_Start_Site|RANGAP1_uc010gyk.2_Translation_Start_Site|RANGAP1_uc011aoz.1_Missense_Mutation_p.R432M	NM_002883	NP_002874	P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	487					mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity				0						CACTGCCATCCTCACAGTAGC	0.557													6	75	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42609031	42609031	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42609031G>T	uc003bcj.1	-	1	2415	c.2281C>A	c.(2281-2283)CAC>AAC	p.H761N	TCF20_uc003bck.1_Missense_Mutation_p.H761N|TCF20_uc003bnt.2_Missense_Mutation_p.H761N	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	761					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						GGGTGGTGGTGGTAACCCTGA	0.502													5	66	---	---	---	---	PASS
GYG2	8908	broad.mit.edu	37	X	2795308	2795308	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2795308C>A	uc004cqs.1	+	11	1586	c.1304C>A	c.(1303-1305)GCT>GAT	p.A435D	GYG2_uc004cqt.1_Missense_Mutation_p.A404D|GYG2_uc004cqu.1_Missense_Mutation_p.A403D|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Missense_Mutation_p.A395D|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b	435					glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GAACTCCCTGCTGAGGCTCTC	0.547													8	56	---	---	---	---	PASS
NLGN4X	57502	broad.mit.edu	37	X	5821666	5821666	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5821666G>T	uc010ndh.2	-	5	1554	c.1053C>A	c.(1051-1053)GAC>GAA	p.D351E	NLGN4X_uc004crp.2_Missense_Mutation_p.D371E|NLGN4X_uc004crq.2_Missense_Mutation_p.D351E|NLGN4X_uc010ndi.2_Missense_Mutation_p.D388E|NLGN4X_uc004crr.2_Missense_Mutation_p.D351E|NLGN4X_uc010ndj.2_Missense_Mutation_p.D351E	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN	X-linked neuroligin 4 precursor	351	Extracellular (Potential).				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity			skin(2)|large_intestine(1)|ovary(1)	4						TCTGGGGGTCGTCTGGGATGA	0.597													11	62	---	---	---	---	PASS
NHS	4810	broad.mit.edu	37	X	17743832	17743832	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17743832G>T	uc004cxx.2	+	6	1881	c.1543G>T	c.(1543-1545)GGT>TGT	p.G515C	NHS_uc011mix.1_Missense_Mutation_p.G536C|NHS_uc004cxy.2_Missense_Mutation_p.G359C|NHS_uc004cxz.2_Missense_Mutation_p.G338C|NHS_uc004cya.2_Missense_Mutation_p.G238C	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	515						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					GTCTTTTGTGGGTGACCATGA	0.547													7	107	---	---	---	---	PASS
GPR64	10149	broad.mit.edu	37	X	19013118	19013118	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19013118T>A	uc004cyx.2	-	28	2929	c.2765A>T	c.(2764-2766)CAA>CTA	p.Q922L	GPR64_uc004cyy.2_Missense_Mutation_p.Q919L|GPR64_uc004cyz.2_Missense_Mutation_p.Q908L|GPR64_uc004czb.2_Intron|GPR64_uc004czc.2_Missense_Mutation_p.Q906L|GPR64_uc004czd.2_Missense_Mutation_p.Q898L|GPR64_uc004cze.2_Missense_Mutation_p.Q892L|GPR64_uc004czf.2_Missense_Mutation_p.Q884L|GPR64_uc004cza.2_Missense_Mutation_p.Q900L|GPR64_uc004cyw.2_Intron|GPR64_uc010nfj.2_Missense_Mutation_p.Q803L	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64 isoform 1	922	Cytoplasmic (Potential).				neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity				0	Hepatocellular(33;0.183)					GGACACTCCTTGGTTTACAGT	0.423													15	70	---	---	---	---	PASS
GPR64	10149	broad.mit.edu	37	X	19018072	19018072	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19018072G>T	uc004cyx.2	-	25	2401	c.2237C>A	c.(2236-2238)CCA>CAA	p.P746Q	GPR64_uc004cyy.2_Missense_Mutation_p.P743Q|GPR64_uc004cyz.2_Missense_Mutation_p.P732Q|GPR64_uc004czb.2_Missense_Mutation_p.P746Q|GPR64_uc004czc.2_Missense_Mutation_p.P730Q|GPR64_uc004czd.2_Missense_Mutation_p.P722Q|GPR64_uc004cze.2_Missense_Mutation_p.P716Q|GPR64_uc004czf.2_Missense_Mutation_p.P708Q|GPR64_uc004cza.2_Missense_Mutation_p.P724Q|GPR64_uc004cyw.2_Missense_Mutation_p.P730Q|GPR64_uc010nfj.2_Missense_Mutation_p.P627Q	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64 isoform 1	746	Helical; Name=4; (Potential).				neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity				0	Hepatocellular(33;0.183)					AACCACAGCTGGTACCCCTGG	0.328													20	104	---	---	---	---	PASS
PDHA1	5160	broad.mit.edu	37	X	19373469	19373469	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19373469C>A	uc004czg.3	+	7	751	c.606C>A	c.(604-606)GGC>GGA	p.G202G	PDHA1_uc004czh.3_Silent_p.G237G|PDHA1_uc011mjc.1_Silent_p.G206G|PDHA1_uc011mjd.1_Silent_p.G168G|PDHA1_uc010nfk.2_Silent_p.G199G|PDHA1_uc010nfl.2_5'UTR	NM_000284	NP_000275	P08559	ODPA_HUMAN	pyruvate dehydrogenase E1 alpha 1 precursor	202					glycolysis|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	protein binding|pyruvate dehydrogenase (acetyl-transferring) activity			ovary(1)	1	Hepatocellular(33;0.183)				NADH(DB00157)	ACTTCCAGGGCCAGATATTCG	0.438													22	135	---	---	---	---	PASS
TAB3	257397	broad.mit.edu	37	X	30873249	30873249	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30873249G>T	uc004dcj.2	-	6	1196	c.533C>A	c.(532-534)CCA>CAA	p.P178Q	TAB3_uc004dck.2_Missense_Mutation_p.P178Q|TAB3_uc010ngl.2_Missense_Mutation_p.P178Q	NM_152787	NP_690000	Q8N5C8	TAB3_HUMAN	mitogen-activated protein kinase kinase kinase 7	178	Pro-rich.				activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein binding|zinc ion binding			ovary(1)	1						AGGTGGCGGTGGTGGTGAAGG	0.488													19	81	---	---	---	---	PASS
USP9X	8239	broad.mit.edu	37	X	40994071	40994071	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40994071G>T	uc004dfb.2	+	5	1049	c.416G>T	c.(415-417)GGC>GTC	p.G139V	USP9X_uc004dfc.2_Missense_Mutation_p.G139V	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	139					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						GCAGTGAGTGGCTGGAAGTTT	0.393													5	59	---	---	---	---	PASS
WAS	7454	broad.mit.edu	37	X	48545326	48545326	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48545326G>T	uc004dkm.3	+	7	773	c.716G>T	c.(715-717)GGT>GTT	p.G239V		NM_000377	NP_000368	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome protein	239	CRIB.				blood coagulation|defense response|epidermis development|immune response|T cell receptor signaling pathway	actin cytoskeleton|cytosol	identical protein binding|small GTPase regulator activity			ovary(1)	1		all_lung(315;1.27e-10)				GCTGATATTGGTGCACCCAGT	0.542			Mis|N|F|S			lymphoma			Wiskott-Aldrich_syndrome				5	23	---	---	---	---	PASS
AKAP4	8852	broad.mit.edu	37	X	49958015	49958015	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49958015G>T	uc004dow.1	-	5	1473	c.1349C>A	c.(1348-1350)TCT>TAT	p.S450Y	AKAP4_uc004dov.1_Intron|AKAP4_uc010njp.1_Missense_Mutation_p.S272Y|AKAP4_uc004dou.1_Missense_Mutation_p.S441Y	NM_003886	NP_003877	Q5JQC9	AKAP4_HUMAN	A-kinase anchor protein 4 isoform 1	450					cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding			kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8	Ovarian(276;0.236)					AGCTTTTAAAGATGCATATGA	0.448													19	77	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53610791	53610791	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53610791G>T	uc004dsp.2	-	42	5649	c.5247C>A	c.(5245-5247)GGC>GGA	p.G1749G	HUWE1_uc004dsn.2_Silent_p.G574G	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	1749					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						CTTCTGTCAAGCCCTGGATCA	0.498													11	38	---	---	---	---	PASS
KLF8	11279	broad.mit.edu	37	X	56296637	56296637	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56296637C>A	uc004dur.2	+	5	1727	c.781C>A	c.(781-783)CAG>AAG	p.Q261K	KLF8_uc011mop.1_Intron|KLF8_uc010nkh.2_RNA	NM_007250	NP_009181	O95600	KLF8_HUMAN	Kruppel-like factor 8 isoform 1	261					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GGCCCAAATGCAGGGAGAAGA	0.418													13	46	---	---	---	---	PASS
MSN	4478	broad.mit.edu	37	X	64957195	64957195	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64957195C>G	uc004dwf.2	+	10	1444	c.1246C>G	c.(1246-1248)CAG>GAG	p.Q416E		NM_002444	NP_002435	P26038	MOES_HUMAN	moesin	416					leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking	apical plasma membrane|cytoskeleton|extrinsic to membrane|microvillus membrane|nucleolus	cell adhesion molecule binding|receptor binding|structural constituent of cytoskeleton		MSN/ALK(6)	haematopoietic_and_lymphoid_tissue(6)|ovary(3)|lung(1)	10						GACTCAGGAACAGCTGGTAAA	0.517			T	ALK	ALCL								7	23	---	---	---	---	PASS
KIF4A	24137	broad.mit.edu	37	X	69510564	69510564	+	Silent	SNP	C	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69510564C>G	uc004dyg.2	+	3	271	c.144C>G	c.(142-144)TCC>TCG	p.S48S	KIF4A_uc010nkw.2_Silent_p.S48S|PDZD11_uc004dyd.1_5'Flank|PDZD11_uc004dye.1_5'Flank|KIF4A_uc004dyf.1_Silent_p.S48S	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	48	Kinesin-motor.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4						CAGATAAATCCTTCACCTACG	0.453													13	55	---	---	---	---	PASS
MAGEE2	139599	broad.mit.edu	37	X	75003990	75003990	+	Silent	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75003990C>A	uc004ecj.1	-	1	1082	c.897G>T	c.(895-897)CTG>CTT	p.L299L		NM_138703	NP_619648	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	299										ovary(1)|skin(1)	2						AGCCAGCAGTCAGGCTTCTTT	0.468													8	76	---	---	---	---	PASS
BRWD3	254065	broad.mit.edu	37	X	79999630	79999630	+	Silent	SNP	A	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79999630A>G	uc004edt.2	-	8	977	c.714T>C	c.(712-714)GCT>GCC	p.A238A	BRWD3_uc004edo.2_5'UTR|BRWD3_uc004edp.2_Silent_p.A67A|BRWD3_uc004edq.2_5'UTR|BRWD3_uc010nmj.1_5'UTR|BRWD3_uc004edr.2_5'UTR|BRWD3_uc004eds.2_5'UTR|BRWD3_uc004edu.2_5'UTR|BRWD3_uc004edv.2_5'UTR|BRWD3_uc004edw.2_5'UTR|BRWD3_uc004edx.2_5'UTR|BRWD3_uc004edy.2_5'UTR|BRWD3_uc004edz.2_5'UTR|BRWD3_uc004eea.2_5'UTR|BRWD3_uc004eeb.2_Intron	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	238	WD 3.									ovary(4)	4						AGCTGCCTGCAGCAATAAGAG	0.453													8	43	---	---	---	---	PASS
ZNF711	7552	broad.mit.edu	37	X	84502603	84502603	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84502603G>T	uc004eeo.2	+	3	372	c.25G>T	c.(25-27)GGA>TGA	p.G9*	ZNF711_uc004eep.2_Nonsense_Mutation_p.G9*|ZNF711_uc004eeq.2_Nonsense_Mutation_p.G9*	NM_021998	NP_068838	Q9Y462	ZN711_HUMAN	zinc finger protein 711	9					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			ovary(3)|skin(1)	4						TGGAAGTCTTGGATTGCACAC	0.338													6	83	---	---	---	---	PASS
CHM	1121	broad.mit.edu	37	X	85218784	85218784	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85218784C>A	uc004eet.2	-	5	618	c.588G>T	c.(586-588)ATG>ATT	p.M196I	CHM_uc011mqz.1_Missense_Mutation_p.M48I	NM_000390	NP_000381	P24386	RAE1_HUMAN	choroideremia isoform a	196					intracellular protein transport|protein geranylgeranylation|response to stimulus|visual perception	Rab-protein geranylgeranyltransferase complex	GTPase activator activity|Rab geranylgeranyltransferase activity			ovary(1)	1		all_lung(315;5.41e-06)				CATTTTCACTCATGTCTTCTG	0.373													6	37	---	---	---	---	PASS
SYTL4	94121	broad.mit.edu	37	X	99955935	99955935	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99955935C>A	uc004egd.3	-	7	853	c.497G>T	c.(496-498)TGG>TTG	p.W166L	SYTL4_uc010nnc.2_Missense_Mutation_p.W166L|SYTL4_uc004ege.3_Missense_Mutation_p.W166L|SYTL4_uc004egf.3_Missense_Mutation_p.W166L|SYTL4_uc004egg.3_Missense_Mutation_p.W166L	NM_080737	NP_542775	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	166					exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding			ovary(2)	2					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TCTTCCTGGCCAGATGTCACC	0.423													15	71	---	---	---	---	PASS
SERPINA7	6906	broad.mit.edu	37	X	105280734	105280734	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105280734C>G	uc004eme.1	-	1	332	c.316G>C	c.(316-318)GTA>CTA	p.V106L	SERPINA7_uc010npd.2_Missense_Mutation_p.V106L|SERPINA7_uc010npe.1_Missense_Mutation_p.V106L	NM_000354	NP_000345	P05543	THBG_HUMAN	serine (or cysteine) proteinase inhibitor, clade	106					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity				0					Levothyroxine(DB00451)|Liothyronine(DB00279)	TGGATCTCTACCATTGGAGTG	0.478													15	51	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	106846101	106846101	+	IGR	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106846101G>T								CXorf41 (358629 upstream) : PRPS1 (25553 downstream)																							TGTGTGGCCAGCCCCGAGGCC	0.642													5	13	---	---	---	---	PASS
ACSL4	2182	broad.mit.edu	37	X	108926550	108926550	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108926550C>A	uc004eoi.2	-	4	671	c.166G>T	c.(166-168)GGA>TGA	p.G56*	ACSL4_uc004eoj.2_Nonsense_Mutation_p.G15*|ACSL4_uc004eok.2_Nonsense_Mutation_p.G15*|ACSL4_uc010npp.1_Nonsense_Mutation_p.G56*	NM_022977	NP_075266	O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	56	Cytoplasmic (Potential).				fatty acid metabolic process|learning or memory|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			large_intestine(1)|lung(1)|ovary(1)	3					Icosapent(DB00159)|Troglitazone(DB00197)	TATGGACTTCCAGGTTTGTCT	0.408													6	92	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123554415	123554415	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123554415G>T	uc004euj.2	-	24	4771	c.4707C>A	c.(4705-4707)ACC>ACA	p.T1569T	ODZ1_uc011muj.1_Silent_p.T1575T|ODZ1_uc010nqy.2_Silent_p.T1576T	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1569	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						CAGAATTGTAGGTGAAGTTAT	0.493													9	47	---	---	---	---	PASS
OCRL	4952	broad.mit.edu	37	X	128724198	128724198	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128724198G>C	uc004euq.2	+	24	2822	c.2657G>C	c.(2656-2658)CGT>CCT	p.R886P	OCRL_uc004eur.2_Missense_Mutation_p.R878P|OCRL_uc010nrb.2_RNA	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase	886	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						GACCGCCAGCGTGCTATTCAG	0.502													36	161	---	---	---	---	PASS
ZDHHC9	51114	broad.mit.edu	37	X	128957775	128957775	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128957775G>T	uc004euv.2	-	4	736	c.367C>A	c.(367-369)CCG>ACG	p.P123T	ZDHHC9_uc004euw.2_Missense_Mutation_p.P123T|ZDHHC9_uc004eux.1_Missense_Mutation_p.P123T|ZDHHC9_uc004euy.1_Missense_Mutation_p.P50T	NM_001008222	NP_001008223	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC domain containing 9	123	Cytoplasmic (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1						ATACGAGGCGGTGGTCGCTGG	0.488													12	81	---	---	---	---	PASS
MBNL3	55796	broad.mit.edu	37	X	131520851	131520851	+	Intron	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131520851G>T	uc004ewv.3	-						uc004ewr.1_Intron|MBNL3_uc004eww.2_Intron|MBNL3_uc004ews.2_Intron|MBNL3_uc004ewt.2_Intron|MBNL3_uc011muz.1_Intron|MBNL3_uc004ewu.3_Intron|MBNL3_uc004ewx.1_Intron	NM_018388	NP_060858	Q9NUK0	MBNL3_HUMAN	muscleblind-like 3 isoform G						mRNA processing|multicellular organismal development|regulation of RNA splicing|RNA splicing	Golgi apparatus|nucleus	nucleic acid binding|zinc ion binding				0	Acute lymphoblastic leukemia(192;0.000127)					TGTGGGGGGAGAGATGGTACT	0.483													7	49	---	---	---	---	PASS
RBMX	27316	broad.mit.edu	37	X	135961564	135961564	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135961564C>A	uc004fae.1	-	2	233	c.23G>T	c.(22-24)GGA>GTA	p.G8V	RBMX_uc011mwf.1_Missense_Mutation_p.G8V|RBMX_uc004fad.1_Missense_Mutation_p.G8V|RBMX_uc011mwg.1_5'UTR|RBMX_uc004faf.1_5'UTR|RBMX_uc010nsf.1_Intron|RBMX_uc004fag.1_Intron|SNORD61_uc004fah.1_5'Flank	NM_002139	NP_002130	P38159	HNRPG_HUMAN	RNA binding motif protein, X-linked isoform 1	8	RRM.					catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					GAAGAGCTTTCCTGGGCGATC	0.408													21	112	---	---	---	---	PASS
RBMX	27316	broad.mit.edu	37	X	135961565	135961565	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135961565C>A	uc004fae.1	-	2	232	c.22G>T	c.(22-24)GGA>TGA	p.G8*	RBMX_uc011mwf.1_Nonsense_Mutation_p.G8*|RBMX_uc004fad.1_Nonsense_Mutation_p.G8*|RBMX_uc011mwg.1_Translation_Start_Site|RBMX_uc004faf.1_Translation_Start_Site|RBMX_uc010nsf.1_Intron|RBMX_uc004fag.1_Intron|SNORD61_uc004fah.1_5'Flank	NM_002139	NP_002130	P38159	HNRPG_HUMAN	RNA binding motif protein, X-linked isoform 1	8	RRM.					catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					AAGAGCTTTCCTGGGCGATCT	0.408													21	113	---	---	---	---	PASS
MAGEC2	51438	broad.mit.edu	37	X	141291217	141291217	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:141291217C>A	uc004fbu.1	-	3	905	c.557G>T	c.(556-558)CGT>CTT	p.R186L		NM_016249	NP_057333	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	186	MAGE.					cytoplasm|nucleus				breast(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CATGAACTCACGGGCTCTCTT	0.483										HNSCC(46;0.14)			30	201	---	---	---	---	PASS
AFF2	2334	broad.mit.edu	37	X	148037578	148037578	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148037578G>C	uc004fcp.2	+	11	2482	c.2003G>C	c.(2002-2004)AGA>ACA	p.R668T	AFF2_uc004fcq.2_Missense_Mutation_p.R658T|AFF2_uc004fcr.2_Missense_Mutation_p.R629T|AFF2_uc011mxb.1_Missense_Mutation_p.R633T|AFF2_uc004fcs.2_Missense_Mutation_p.R635T|AFF2_uc011mxc.1_Missense_Mutation_p.R309T	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	668					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					GACCCACCAAGAGGCCGCAAC	0.517													34	163	---	---	---	---	PASS
MTM1	4534	broad.mit.edu	37	X	149814185	149814185	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149814185G>T	uc004fef.3	+	9	784	c.708G>T	c.(706-708)AAG>AAT	p.K236N	MTM1_uc011mxx.1_RNA|MTM1_uc011mxy.1_Missense_Mutation_p.K199N|MTM1_uc011mxz.1_Missense_Mutation_p.K121N|MTM1_uc010nte.2_Missense_Mutation_p.K104N	NM_000252	NP_000243	Q13496	MTM1_HUMAN	myotubularin	236	Myotubularin phosphatase.				endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CAGAAAATAAGACGGTCATTG	0.378													9	45	---	---	---	---	PASS
GPR50	9248	broad.mit.edu	37	X	150345263	150345263	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150345263C>A	uc010ntg.1	+	1	205	c.70C>A	c.(70-72)CCA>ACA	p.P24T	uc004fes.1_Intron|GPR50_uc011myc.1_Missense_Mutation_p.P24T	NM_004224	NP_004215	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	24	Extracellular (Potential).				cell-cell signaling	integral to plasma membrane	melatonin receptor activity			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					GCCAGAATACCCACCGGCTCT	0.522													14	70	---	---	---	---	PASS
GPR50	9248	broad.mit.edu	37	X	150349094	150349094	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150349094C>A	uc010ntg.1	+	2	1174	c.1039C>A	c.(1039-1041)CGT>AGT	p.R347S	uc004fes.1_5'Flank|GPR50_uc011myc.1_3'UTR	NM_004224	NP_004215	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	347	Cytoplasmic (Potential).|Pro-rich.				cell-cell signaling	integral to plasma membrane	melatonin receptor activity			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CGACCAAGCTCGTGAACAAGA	0.592													5	85	---	---	---	---	PASS
CNGA2	1260	broad.mit.edu	37	X	150911903	150911903	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150911903C>A	uc004fey.1	+	7	1152	c.928C>A	c.(928-930)CCA>ACA	p.P310T		NM_005140	NP_005131	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	310	Cytoplasmic (Potential).				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CTGGGTTTACCCAAACATCAC	0.493													8	175	---	---	---	---	PASS
CNGA2	1260	broad.mit.edu	37	X	150912080	150912080	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150912080G>T	uc004fey.1	+	7	1329	c.1105G>T	c.(1105-1107)GGA>TGA	p.G369*		NM_005140	NP_005131	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	369	Helical; Name=H5; (Potential).				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CACCATCGTGGGAAATGTGGG	0.512													19	103	---	---	---	---	PASS
MAGEA6	4105	broad.mit.edu	37	X	151870096	151870096	+	Silent	SNP	C	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151870096C>T	uc004ffq.1	+	3	980	c.786C>T	c.(784-786)CCC>CCT	p.P262P	MAGEA6_uc004ffr.1_Silent_p.P262P|MAGEA2_uc010nto.2_Intron	NM_005363	NP_005354	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	262	MAGE.						protein binding				0	Acute lymphoblastic leukemia(192;6.56e-05)					GGCAGGTCCCCGGCAGTGATC	0.527													22	120	---	---	---	---	PASS
PLXNB3	5365	broad.mit.edu	37	X	153043055	153043055	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153043055G>T	uc004fii.2	+	31	5347	c.5173G>T	c.(5173-5175)GTC>TTC	p.V1725F	PLXNB3_uc010nuk.2_Missense_Mutation_p.V1748F|PLXNB3_uc011mzd.1_Missense_Mutation_p.V1364F|SRPK3_uc004fik.2_5'UTR	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1	1725	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CCCCATCGCCGTCAAGTACCT	0.592													5	184	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153588595	153588595	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153588595T>C	uc004fkk.2	-	22	3817	c.3568A>G	c.(3568-3570)AGC>GGC	p.S1190G	FLNA_uc011mzn.1_5'Flank|FLNA_uc010nuu.1_Missense_Mutation_p.S1190G	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1190	Filamin 10.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGCTCCGCGCTGCCCGCGCTC	0.642											OREG0003593	type=REGULATORY REGION|Gene=FLNA|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	5	36	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153588596	153588596	+	Silent	SNP	G	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153588596G>T	uc004fkk.2	-	22	3816	c.3567C>A	c.(3565-3567)GGC>GGA	p.G1189G	FLNA_uc011mzn.1_5'Flank|FLNA_uc010nuu.1_Silent_p.G1189G	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1189	Filamin 10.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCTCCGCGCTGCCCGCGCTCG	0.642											OREG0003593	type=REGULATORY REGION|Gene=FLNA|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	5	36	---	---	---	---	PASS
PLXNA3	55558	broad.mit.edu	37	X	153689015	153689015	+	Silent	SNP	G	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153689015G>A	uc004flm.2	+	2	665	c.492G>A	c.(490-492)AAG>AAA	p.K164K		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	164	Sema.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGCCCAGCAAGCTGTTTGTGG	0.627													26	90	---	---	---	---	PASS
SDF4	51150	broad.mit.edu	37	1	1158442	1158443	+	Intron	DEL	CA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1158442_1158443delCA	uc001adh.3	-						SDF4_uc001adg.2_5'Flank|SDF4_uc001adi.3_Intron|SDF4_uc009vjv.2_Intron|SDF4_uc009vjw.2_Intron|SDF4_uc001adj.1_3'UTR	NM_016176	NP_057260	Q9BRK5	CAB45_HUMAN	stromal cell derived factor 4 isoform 2						cerebellum development|fat cell differentiation|response to ethanol|UV protection|zymogen granule exocytosis	bleb|Golgi lumen|late endosome|soluble fraction	calcium ion binding|calcium ion binding|identical protein binding|protein binding			upper_aerodigestive_tract(1)|large_intestine(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;7.85e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.42e-21)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;4.83e-05)|Kidney(185;0.00252)|BRCA - Breast invasive adenocarcinoma(365;0.00263)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0368)|Lung(427;0.204)		acacaacatgcacacacgtact	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	1318078	1318078	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1318078delC								AURKAIP1 (7260 upstream) : CCNL2 (3013 downstream)																							ATCCAGAGGTCACCACCCCTT	0.493													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	4413593	4413594	+	IGR	INS	-	GT	GT	rs142935566	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4413593_4413594insGT								LOC100133612 (579716 upstream) : LOC284661 (58517 downstream)																							tcctagctttggtgtgtgtgtg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	4434008	4434009	+	IGR	INS	-	CCAT	CCAT	rs139203652	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4434008_4434009insCCAT								LOC100133612 (600131 upstream) : LOC284661 (38102 downstream)																							tatctatttaaccatccatcca	0.025													5	3	---	---	---	---	
UTS2	10911	broad.mit.edu	37	1	7954193	7954193	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7954193delT	uc001aoq.2	-							NM_006786	NP_006777	O95399	UTS2_HUMAN	urotensin 2 isoform b preproprotein						muscle contraction|regulation of blood pressure|synaptic transmission	extracellular space	hormone activity				0	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)		CTCTGAtttcttttttttttt	0.244													2	5	---	---	---	---	
RERE	473	broad.mit.edu	37	1	8576983	8576983	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8576983delT	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc010nzx.1_Intron|RERE_uc001aph.1_Intron	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		acattcgtgattgccaggtgt	0.000													4	2	---	---	---	---	
RBP7	116362	broad.mit.edu	37	1	10066777	10066777	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10066777delG	uc001aqq.2	+						RBP7_uc009vms.2_Intron	NM_052960	NP_443192	Q96R05	RET7_HUMAN	retinol binding protein 7, cellular							cytoplasm	retinal binding|retinol binding|transporter activity				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|BRCA - Breast invasive adenocarcinoma(304;0.000302)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00856)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)	aaaaaaaaaaGTATATACgtg	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	11481047	11481048	+	IGR	INS	-	T	T	rs112510855		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11481047_11481048insT								UBIAD1 (132557 upstream) : PTCHD2 (58247 downstream)																							ttctttctttcttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	11616734	11616735	+	IGR	DEL	GT	-	-	rs112989824		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11616734_11616735delGT								PTCHD2 (19095 upstream) : FBXO2 (91715 downstream)																							aactggaaGAgtgtgtgtgtgt	0.183													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	12113303	12113303	+	IGR	DEL	T	-	-	rs111477990		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12113303delT								MIIP (21197 upstream) : TNFRSF8 (10131 downstream)																							caacaggttcttttttttttt	0.000													4	2	---	---	---	---	
TNFRSF8	943	broad.mit.edu	37	1	12122309	12122310	+	5'Flank	INS	-	CATC	CATC	rs137895661	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12122309_12122310insCATC	uc001atq.2	+						TNFRSF8_uc010obc.1_5'Flank	NM_001243	NP_001234	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily,						cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)		cacctgctgctcatccatccat	0.035													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	16858336	16858337	+	IGR	INS	-	AA	AA			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16858336_16858337insAA								CROCCL2 (39140 upstream) : NBPF1 (32075 downstream)																							ccaccagcaacaaaaaagcaaa	0.000													4	2	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17195763	17195763	+	Intron	DEL	A	-	-	rs68102505		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17195763delA	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GAGGTTGGTCAACGTGGAGTC	0.537													3	3	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17198146	17198147	+	Intron	DEL	AC	-	-	rs67531957		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17198146_17198147delAC	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ACAAGCTCAGACAGCAGGACAA	0.351													3	3	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17199371	17199371	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17199371delG	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GTCTCGCTCCGGTGTACACAG	0.622													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	19340155	19340156	+	IGR	INS	-	G	G	rs144451343	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19340155_19340156insG								IFFO2 (57329 upstream) : UBR4 (58448 downstream)																							ATATTTTTCTTGCAACAACCAT	0.322													5	7	---	---	---	---	
PLA2G2C	391013	broad.mit.edu	37	1	20504143	20504143	+	5'Flank	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20504143delT	uc009vpq.1	-							NM_001105572	NP_001099042			phospholipase A2, group IIC precursor												0		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.14e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.000171)|GBM - Glioblastoma multiforme(114;0.000528)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GTTGGTTTGGTTTTTTTTTTT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	25052922	25052923	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25052922_25052923insA								SRRM1 (53151 upstream) : CLIC4 (18837 downstream)																							agacttcgtctaaaaaaaaaat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	26973035	26973035	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26973035delA								RPS6KA1 (71515 upstream) : ARID1A (49487 downstream)																							tctctactacaaatacgaaaa	0.000													4	2	---	---	---	---	
CD164L2	388611	broad.mit.edu	37	1	27707183	27707183	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27707183delT	uc001boc.2	-							NM_207397	NP_997280	Q6UWJ8	C16L2_HUMAN	CD164 sialomucin-like 2							integral to membrane					0		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GTCAGAGCCCTCAGAGAGGGA	0.562													4	2	---	---	---	---	
OPRD1	4985	broad.mit.edu	37	1	29188426	29188426	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29188426delT	uc001brf.1	+							NM_000911	NP_000902	P41143	OPRD_HUMAN	opioid receptor, delta 1						immune response|protein import into nucleus, translocation	integral to plasma membrane	delta-opioid receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Butorphanol(DB00611)|Codeine(DB00318)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Loperamide(DB00836)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pimozide(DB01100)|Propoxyphene(DB00647)	ttttcttttcttttttttttt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30298459	30298460	+	IGR	INS	-	CACT	CACT	rs139770517	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30298459_30298460insCACT								PTPRU (645144 upstream) : MATN1 (885666 downstream)																							ccatgcacacacacatacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	32235143	32235144	+	IGR	DEL	AC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32235143_32235144delAC								BAI2 (5495 upstream) : SPOCD1 (20881 downstream)																							GTCTGTGTAAACACACACACAC	0.455													5	3	---	---	---	---	
KHDRBS1	10657	broad.mit.edu	37	1	32484360	32484363	+	Intron	DEL	AAAC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32484360_32484363delAAAC	uc001bub.2	+						KHDRBS1_uc001bua.1_Intron|KHDRBS1_uc001buc.1_Intron	NM_006559	NP_006550	Q07666	KHDR1_HUMAN	KH domain containing, RNA binding, signal						cell cycle arrest|cell proliferation|cell surface receptor linked signaling pathway|G2/M transition of mitotic cell cycle|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of RNA export from nucleus|transcription, DNA-dependent	membrane|nucleus	DNA binding|RNA binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				tccgtctcaaaaacaaacaaacaa	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	32813841	32813841	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32813841delT								MARCKSL1 (12007 upstream) : TSSK3 (14021 downstream)																							taatgtcaccttcctgtgaca	0.010													4	2	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34115395	34115395	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34115395delA	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron|CSMD2_uc001bxo.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GATTGAGAGTAAAATGACTGT	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	36872149	36872150	+	IGR	INS	-	CCTT	CCTT	rs142502292	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36872149_36872150insCCTT								LSM10 (8656 upstream) : OSCP1 (11358 downstream)																							ttctttccctcccttccttcct	0.084													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	39150647	39150647	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39150647delA								POU3F1 (638197 upstream) : RRAGC (154368 downstream)																							gaaaaaagcgaaaaaaaaaaa	0.020													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	40058847	40058847	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40058847delT								PABPC4 (16326 upstream) : HEYL (30257 downstream)																							tttctttcccttttttttttt	0.204													3	3	---	---	---	---	
RIMKLA	284716	broad.mit.edu	37	1	42880841	42880842	+	3'UTR	INS	-	CA	CA	rs140509445	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42880841_42880842insCA	uc001chi.2	+	5						NM_173642	NP_775913	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family						protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0						ATAAAAACACTCAAGAACAACG	0.426													3	3	---	---	---	---	
CCDC30	728621	broad.mit.edu	37	1	43008947	43008947	+	Intron	DEL	T	-	-	rs71821218		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43008947delT	uc009vwk.1	+						CCDC30_uc001chm.2_Intron|CCDC30_uc001chn.2_Intron|CCDC30_uc010oju.1_Intron|CCDC30_uc001chp.2_Intron	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30												0						actggccTTCTTTTTTTTTTT	0.065													4	2	---	---	---	---	
PTPRF	5792	broad.mit.edu	37	1	44045735	44045735	+	Intron	DEL	A	-	-	rs144180610		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44045735delA	uc001cjr.2	+						PTPRF_uc001cjs.2_Intron	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				actccatctcaaaaaaaaaaa	0.224													4	2	---	---	---	---	
EIF2B3	8891	broad.mit.edu	37	1	45320762	45320762	+	Intron	DEL	A	-	-	rs111960773		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45320762delA	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					GCTCAGTCTCAAAAAAAAAAA	0.468													3	3	---	---	---	---	
PIK3R3	8503	broad.mit.edu	37	1	46610439	46610439	+	Intron	DEL	A	-	-	rs111473445		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46610439delA	uc010olw.1	-							NM_003629	NP_003620	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3						insulin receptor signaling pathway|platelet activation|T cell costimulation		1-phosphatidylinositol-3-kinase activity|protein binding				0	Acute lymphoblastic leukemia(166;0.155)					actccatctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
TAL1	6886	broad.mit.edu	37	1	47715325	47715325	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47715325delG	uc001crb.1	-									P17542	TAL1_HUMAN	Homo sapiens cDNA, FLJ97467.						basophil differentiation|cell fate commitment|cell proliferation|embryonic hemopoiesis|erythrocyte differentiation|megakaryocyte differentiation|positive regulation of cell division|positive regulation of chromatin assembly or disassembly|positive regulation of erythrocyte differentiation|positive regulation of mitotic cell cycle|positive regulation of protein complex assembly|positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	E-box binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity			lung(1)	1						tcaggagtttgagaccagcct	0.005			T	TRD@|SIL	lymphoblastic leukemia/biphasic								4	2	---	---	---	---	
TTC39A	22996	broad.mit.edu	37	1	51774464	51774465	+	Intron	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51774464_51774465delTG	uc001csl.2	-						TTC39A_uc001csk.2_Intron|TTC39A_uc010ond.1_Intron|TTC39A_uc010one.1_Intron|TTC39A_uc010onf.1_Intron|TTC39A_uc001csn.2_Intron|TTC39A_uc001cso.1_Intron|TTC39A_uc009vyy.1_Intron	NM_001080494	NP_001073963	Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A isoform 2								binding			skin(1)	1						tgtgtgtgtatgtgtgtgtgtg	0.238													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	52372548	52372548	+	IGR	DEL	G	-	-	rs66641300		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52372548delG								NRD1 (27939 upstream) : RAB3B (12289 downstream)																							aggaagggaagggaaggaagg	0.234													3	5	---	---	---	---	
ZFYVE9	9372	broad.mit.edu	37	1	52619905	52619905	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52619905delA	uc001cto.2	+						ZFYVE9_uc001ctn.2_Intron|ZFYVE9_uc001ctp.2_Intron	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3						endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						taatcctgtgaagatcaatca	0.000													4	2	---	---	---	---	
GLIS1	148979	broad.mit.edu	37	1	54012622	54012622	+	Intron	DEL	G	-	-	rs11479550		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54012622delG	uc001cvr.1	-							NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						tcccctgactgggtatggaag	0.000													5	3	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57571073	57571074	+	Intron	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57571073_57571074delTG	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						tgtgtgtgtctgtgtgtgtgtg	0.371													4	2	---	---	---	---	
ROR1	4919	broad.mit.edu	37	1	64535188	64535189	+	Intron	INS	-	TGTG	TGTG	rs143372488	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64535188_64535189insTGTG	uc001dbj.2	+						ROR1_uc001dbi.3_Intron	NM_005012	NP_005003	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1						transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			ovary(6)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|central_nervous_system(1)|skin(1)|kidney(1)	19						CTTGGGTTAAAtgtgtgtgtgt	0.297													4	3	---	---	---	---	
WLS	79971	broad.mit.edu	37	1	68602964	68602965	+	Intron	INS	-	T	T	rs61771346		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68602964_68602965insT	uc001def.1	-						uc001deb.1_Intron|uc001dec.1_Intron|WLS_uc001dee.2_Intron|WLS_uc001deg.1_Intron|WLS_uc009wbf.1_Intron	NM_024911	NP_079187	Q5T9L3	WLS_HUMAN	G protein-coupled receptor 177 isoform 1						multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Wnt receptor signaling pathway	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	signal transducer activity				0						GACAGGAAGAACTGGGGACAGG	0.287													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	71049442	71049442	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71049442delT								CTH (144190 upstream) : PTGER3 (268594 downstream)																							AGCACTTCTATTTTAAGGCTA	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	71640925	71640925	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71640925delT	uc001dfu.1	+											Homo sapiens cDNA clone IMAGE:6592429, partial cds.																		TTTTTTCCACTTTTTTTTTTT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	71822832	71822847	+	IGR	DEL	AATGTTTACATCAACA	-	-	rs67242608		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71822832_71822847delAATGTTTACATCAACA								ZRANB2 (276087 upstream) : NEGR1 (45779 downstream)																							atggaaatgtaatgtttacatcaacaaaagacccac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	74114971	74114972	+	IGR	INS	-	T	T	rs145915387	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74114971_74114972insT								None (None upstream) : LRRIQ3 (376732 downstream)																							ATGGATTGGCCTTTTTTTTTTC	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	75646717	75646717	+	IGR	DEL	A	-	-	rs35183399		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75646717delA								LHX8 (19501 upstream) : SLC44A5 (21099 downstream)																							ggtgcaaaacagcaaatattg	0.000													3	3	---	---	---	---	
FAM73A	374986	broad.mit.edu	37	1	78329892	78329892	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78329892delA	uc001dhx.2	+						FAM73A_uc010ork.1_Intron|FAM73A_uc010orl.1_Intron	NM_198549	NP_940951	Q8NAN2	FA73A_HUMAN	hypothetical protein LOC374986							integral to membrane				ovary(1)	1				Colorectal(170;0.226)		ctaaaaatacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
LPHN2	23266	broad.mit.edu	37	1	81839761	81839762	+	Intron	INS	-	AC	AC	rs148535849	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81839761_81839762insAC	uc001dis.2	+									O95490	LPHN2_HUMAN	SubName: Full=cDNA FLJ41428 fis, clone BRHIP2005236, highly similar to Latrophilin-2;						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TAAATacacatacacacacaca	0.119													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	84899509	84899509	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84899509delA								DNASE2B (18818 upstream) : RPF1 (45411 downstream)																							TACAAAGGCTAAAAAAAAAAA	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	87773721	87773721	+	IGR	DEL	T	-	-	rs67188419		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87773721delT								LOC339524 (138837 upstream) : LMO4 (20430 downstream)																							AGAGTTAGGCTTTTTTTTTTT	0.269													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	95275747	95275747	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95275747delA	uc001dqu.2	-											Homo sapiens cDNA clone IMAGE:4795773.																		actccgtctcaaaaaaaaaaa	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	100288464	100288466	+	IGR	DEL	ACC	-	-	rs79614284		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100288464_100288466delACC								FRRS1 (57115 upstream) : AGL (27174 downstream)																							tacctcctctacctcctctacct	0.059													5	4	---	---	---	---	
MAGI3	260425	broad.mit.edu	37	1	114097740	114097740	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114097740delA	uc001edk.2	+						MAGI3_uc001edh.3_Intron|MAGI3_uc001edi.3_Intron|MAGI3_uc010owm.1_Intron	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3						apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		tgctgcaaggaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SLC22A15	55356	broad.mit.edu	37	1	116518457	116518457	+	5'Flank	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116518457delT	uc001egb.3	+						SLC22A15_uc001ega.2_5'Flank	NM_018420	NP_060890	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15						ion transport	integral to membrane	transmembrane transporter activity			large_intestine(2)	2	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CCTGCCACGCTTTTTTTTTTT	0.453													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	116653027	116653027	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116653027delA								SLC22A15 (40355 upstream) : C1orf161 (1349 downstream)																							AACCTGAGCTAACTTTGAATT	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142585978	142585979	+	IGR	DEL	AT	-	-	rs113516449		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142585978_142585979delAT								None (None upstream) : None (None downstream)																							AGTTAAAAACATAAAATCCAGT	0.396													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142638168	142638168	+	Intron	DEL	C	-	-	rs137978360		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142638168delC	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		TCTGCACCCACACACACAGAC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142672993	142672993	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142672993delC	uc001eiw.1	+						uc001eix.1_Intron|uc001eiz.1_5'Flank					Homo sapiens PNAS-130 mRNA, complete cds.																		CTGctgaccaccccccactaa	0.219													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145048154	145048154	+	Intron	DEL	G	-	-	rs148993604		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145048154delG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						tgcatggctcgggggggtcct	0.000													10	5	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145058201	145058201	+	Intron	DEL	A	-	-	rs11347217		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145058201delA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						AGAGGGAGGGAAAAAAAAATC	0.383													6	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145189953	145189953	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145189953delC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						ttctctttctccttgctcctc	0.035													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	146475318	146475318	+	IGR	DEL	G	-	-	rs5777615		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146475318delG								NBPF10 (51223 upstream) : LOC728989 (15577 downstream)																							GCAGAAGCCTGCTACACAACC	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148683465	148683465	+	IGR	DEL	C	-	-	rs55748150		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148683465delC								PPIAL4E (38672 upstream) : NBPF16 (55977 downstream)																							gaaaaaaaaacccaaaaaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148851476	148851476	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148851476delA								NBPF16 (93165 upstream) : LOC645166 (76810 downstream)																							GATCTTCAGGAGGGAGATGGC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149223042	149223043	+	IGR	INS	-	C	C	rs2871804		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149223042_149223043insC								LOC645166 (269988 upstream) : LOC388692 (56433 downstream)																							ctccgtcaaaaaaaaaaaaaaa	0.178													6	3	---	---	---	---	
LOC728855	728855	broad.mit.edu	37	1	149658174	149658178	+	Intron	DEL	CTGTC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149658174_149658178delCTGTC	uc009wlc.2	+						LOC728855_uc009wld.2_Intron					Homo sapiens mRNA, chromosome 1 specific transcript KIAA0493.												0						gttCTTGACTctgtcctgtcctgtc	0.020													4	2	---	---	---	---	
ANXA9	8416	broad.mit.edu	37	1	150959857	150959858	+	Intron	DEL	CA	-	-	rs34542381		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150959857_150959858delCA	uc001ewa.2	+							NM_003568	NP_003559	O76027	ANXA9_HUMAN	annexin A9						cell-cell adhesion	cell surface|cytosol	acetylcholine receptor activity|calcium ion binding|calcium-dependent phospholipid binding|phosphatidylserine binding|protein homodimerization activity				0	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ctctctctctcacacacacaca	0.050													4	2	---	---	---	---	
ADAR	103	broad.mit.edu	37	1	154568834	154568835	+	Intron	INS	-	CA	CA	rs138069927	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154568834_154568835insCA	uc001ffh.2	-						ADAR_uc001ffj.2_Intron|ADAR_uc001ffi.2_Intron|ADAR_uc001ffk.2_Intron	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a						adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		ttctcctgtctgcctcccgagt	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	155070573	155070574	+	IGR	INS	-	TT	TT			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155070573_155070574insTT								EFNA3 (10567 upstream) : EFNA1 (29775 downstream)																							agattttttgcttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	156116460	156116460	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156116460delC								LMNA (6582 upstream) : SEMA4A (3350 downstream)																							CTCTCAGCTGCCCCAGCCCCT	0.473											OREG0013868	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
RHBG	57127	broad.mit.edu	37	1	156349903	156349904	+	Intron	INS	-	T	T	rs67037881		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156349903_156349904insT	uc010pho.1	+						RHBG_uc010phm.1_Intron|RHBG_uc010phn.1_Intron|RHBG_uc001fos.2_Intron|RHBG_uc009wrz.2_Intron|RHBG_uc001for.2_Intron	NM_020407	NP_065140	Q9H310	RHBG_HUMAN	Rhesus blood group, B glycoprotein						transepithelial ammonium transport	anchored to plasma membrane|basolateral plasma membrane|cytoplasmic vesicle membrane|integral to plasma membrane|spectrin-associated cytoskeleton	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			ovary(2)	2	Hepatocellular(266;0.158)					ctttctttttcttttttttttt	0.183													4	2	---	---	---	---	
PEAR1	375033	broad.mit.edu	37	1	156880830	156880833	+	Intron	DEL	TTTC	-	-	rs67268796		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156880830_156880833delTTTC	uc001fqj.1	+						PEAR1_uc001fqk.1_Intron	NM_001080471	NP_001073940	Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1							integral to membrane				ovary(2)|central_nervous_system(1)	3	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TTGATTTCTTtttctttctttctt	0.176													4	3	---	---	---	---	
ARHGEF11	9826	broad.mit.edu	37	1	156938798	156938798	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156938798delT	uc001fqo.2	-						ARHGEF11_uc001fqn.2_Intron	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11						actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCTCAAAGGCTTGCCACAGTT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	162390718	162390719	+	IGR	INS	-	A	A	rs60309349		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162390718_162390719insA								SH2D1B (8790 upstream) : UHMK1 (76245 downstream)																							aacaaacaaacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CD247	919	broad.mit.edu	37	1	167436384	167436384	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167436384delT	uc001gei.3	-						CD247_uc001gej.3_Intron|CD247_uc001gek.2_Intron	NM_198053	NP_932170	P20963	CD3Z_HUMAN	T-cell receptor zeta chain isoform 1 precursor						interspecies interaction between organisms|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytoplasm|integral to membrane	protein homodimerization activity|transmembrane receptor activity				0			LUSC - Lung squamous cell carcinoma(543;0.236)			cCCTTTATCCTTTTCAGTCCC	0.234													4	2	---	---	---	---	
ABL2	27	broad.mit.edu	37	1	179151280	179151280	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179151280delT	uc001gmj.3	-						ABL2_uc010pnf.1_Intron|ABL2_uc010png.1_Intron|ABL2_uc010pnh.1_Intron|ABL2_uc009wxe.2_Intron	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b						axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	aagtcctctcttccctcctta	0.000			T	ETV6	AML								4	2	---	---	---	---	
SOAT1	6646	broad.mit.edu	37	1	179298850	179298850	+	Intron	DEL	A	-	-	rs72463047		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179298850delA	uc001gml.2	+						SOAT1_uc010pni.1_Intron|SOAT1_uc001gmm.2_Intron|SOAT1_uc010pnj.1_Intron|SOAT1_uc010pnk.1_Intron	NM_003101	NP_003092	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			central_nervous_system(1)|skin(1)	2					Ezetimibe(DB00973)|Hesperetin(DB01094)	acttcatctcaaaaaaaaaaa	0.159													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	180481120	180481120	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180481120delT								ACBD6 (9098 upstream) : XPR1 (120026 downstream)																							AAATAttttcttttttttttt	0.030													3	3	---	---	---	---	
TEDDM1	127670	broad.mit.edu	37	1	182368631	182368631	+	3'UTR	DEL	A	-	-	rs36049878		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182368631delA	uc001gpe.2	-	1						NM_172000	NP_741997	Q5T9Z0	TEDM1_HUMAN	putative membrane protein HE9							integral to membrane				ovary(2)	2						actctgtctcaaaaaaaaaaa	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	187181094	187181095	+	IGR	INS	-	TTT	TTT	rs36001568		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187181094_187181095insTTT								PLA2G4A (222989 upstream) : None (None downstream)																							CCATGGCACACttttttttttt	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	187452540	187452540	+	IGR	DEL	T	-	-	rs67059201		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187452540delT								PLA2G4A (494435 upstream) : None (None downstream)																							TTAGttttgcttttttttttt	0.229													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	191129756	191129761	+	IGR	DEL	GAAGAG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191129756_191129761delGAAGAG								FAM5C (682997 upstream) : RGS18 (997831 downstream)																							agaagaagaagaagaggaagaggaag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	201611822	201611823	+	IGR	INS	-	C	C	rs140534624	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201611822_201611823insC								RPS10P7 (112220 upstream) : NAV1 (5627 downstream)																							cttccctttcttctctctcttt	0.000													5	3	---	---	---	---	
NAV1	89796	broad.mit.edu	37	1	201623909	201623909	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201623909delC	uc001gwu.2	+							NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1						cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						caaaattaatcccactatagc	0.119													4	2	---	---	---	---	
PIK3C2B	5287	broad.mit.edu	37	1	204431486	204431488	+	Intron	DEL	TGG	-	-	rs61761705		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204431486_204431488delTGG	uc001haw.2	-						PIK3C2B_uc010pqv.1_Intron|PIK3C2B_uc001hax.1_Intron|PIK3C2B_uc009xbd.1_Intron	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta						cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			CCTTCCCTGCTGGTATTTACTGA	0.502													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	205572771	205572771	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205572771delG								MFSD4 (726 upstream) : ELK4 (12464 downstream)																							cacagggtgaggggtaatgta	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	205672010	205672011	+	IGR	INS	-	AA	AA	rs77423660		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205672010_205672011insAA								ELK4 (22380 upstream) : NUCKS1 (9936 downstream)																							aattctgtctcaaaaaaaaaaa	0.149													3	3	---	---	---	---	
C1orf97	84791	broad.mit.edu	37	1	211595838	211595838	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211595838delA	uc001hil.3	+							NR_026761				Homo sapiens cDNA FLJ27347 fis, clone TST03991.												0						ccctgtctctaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	213775226	213775226	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213775226delT								RPS6KC1 (328419 upstream) : PROX1 (386060 downstream)																							TCttccttccttttttccttc	0.134													4	2	---	---	---	---	
SLC30A10	55532	broad.mit.edu	37	1	220107805	220107806	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220107805_220107806insA	uc001hlu.1	-									Q6XR72	ZNT10_HUMAN	Synthetic construct DNA, clone: pF1KB7405, Homo sapiens SLC30A10 gene for solute carrier family 30, member 10, without stop codon, in Flexi system.						zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		gactccatctcaaaaaaaaaaa	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	221264314	221264314	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221264314delT								HLX (205916 upstream) : LOC400804 (238956 downstream)																							TTGTTttttgttttttttttt	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223282469	223282470	+	IGR	INS	-	TG	TG	rs150223765	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223282469_223282470insTG								DISP1 (103134 upstream) : TLR5 (1114 downstream)																							AATAGCgtgtatgtgtgtgtgt	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223708897	223708897	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223708897delG								C1orf65 (140085 upstream) : CAPN8 (6075 downstream)																							CTGAGAAGCTGATTCTCTTTG	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	226971102	226971103	+	IGR	DEL	CA	-	-	rs148321812		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226971102_226971103delCA								ITPKB (44226 upstream) : PSEN2 (87170 downstream)																							tgtgagacatcagattcctgag	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229904931	229904931	+	IGR	DEL	G	-	-	rs11303025		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229904931delG								URB2 (108985 upstream) : GALNT2 (288605 downstream)																							cacttggaccggggggggtga	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230854340	230854341	+	IGR	INS	-	A	A	rs34395363		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230854340_230854341insA								AGT (4004 upstream) : CAPN9 (28789 downstream)																							atattcactttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	232753676	232753679	+	IGR	DEL	ACTC	-	-	rs144188512		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232753676_232753679delACTC								SIPA1L2 (102433 upstream) : KIAA1383 (186959 downstream)																							tgtgcaacttactctgaaatgcat	0.000													3	3	---	---	---	---	
SLC35F3	148641	broad.mit.edu	37	1	234411349	234411350	+	Intron	DEL	AC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234411349_234411350delAC	uc001hwa.1	+						SLC35F3_uc001hvy.1_Intron	NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			agacagacagacacacacacac	0.228													4	2	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237214517	237214517	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237214517delC	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ccctttctctccccccccttc	0.065													4	2	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237886196	237886197	+	Intron	DEL	CT	-	-	rs146977948		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237886196_237886197delCT	uc001hyl.1	+						RYR2_uc010pxz.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ctggaatctactctcagcaaat	0.015													3	3	---	---	---	---	
PLD5	200150	broad.mit.edu	37	1	242676728	242676729	+	Intron	INS	-	A	A	rs151230717	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242676728_242676729insA	uc001hzn.1	-						PLD5_uc001hzo.1_Intron			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			attgagggcagagatagacagc	0.010													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242952005	242952005	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242952005delC								PLD5 (264007 upstream) : CEP170 (335726 downstream)																							AGAACATCCACACATTAACAT	0.338													4	2	---	---	---	---	
PPPDE1	51029	broad.mit.edu	37	1	244849568	244849569	+	Intron	INS	-	TG	TG	rs72146207		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244849568_244849569insTG	uc001iao.2	+						PPPDE1_uc001iap.2_Intron	NM_016076	NP_057160	Q9BSY9	PPDE1_HUMAN	PPPDE peptidase domain containing 1											breast(3)	3						gtgtgtgtgtatgtgtgtgtgt	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	583087	583089	+	IGR	DEL	GCC	-	-	rs112624843		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:583087_583089delGCC								FAM150B (294779 upstream) : TMEM18 (84886 downstream)																							CCAGGCGGCGGCCGCCAGCGTGT	0.616													4	2	---	---	---	---	
SNTG2	54221	broad.mit.edu	37	2	1019770	1019770	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1019770delG	uc002qwq.2	+						SNTG2_uc002qwp.2_Intron|SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GAGGGGAAGTGGCTGCGGTAG	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2936738	2936739	+	Intron	DEL	TA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2936738_2936739delTA	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																		cgtgtgtgcctatgtgtgtgtg	0.267													3	4	---	---	---	---	
TSSC1	7260	broad.mit.edu	37	2	3273410	3273413	+	Intron	DEL	CACT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3273410_3273413delCACT	uc002qxj.2	-						TSSC1_uc002qxi.2_Intron	NM_003310	NP_003301	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		tcaatcatcacactcaatcatcac	0.000													5	3	---	---	---	---	
RNASEH1	246243	broad.mit.edu	37	2	3600837	3600838	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3600837_3600838insA	uc002qxt.2	-						RNASEH1_uc002qxs.2_Intron	NM_002936	NP_002927	O60930	RNH1_HUMAN	ribonuclease H1						RNA catabolic process	cytoplasm	magnesium ion binding|ribonuclease H activity|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)		gactctgtctcaaaaaaaaaaa	0.163													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6223576	6223577	+	IGR	INS	-	T	T	rs111751558		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6223576_6223577insT								LOC400940 (95212 upstream) : CMPK2 (756926 downstream)																							tatttattccattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8049763	8049764	+	IGR	DEL	GA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8049763_8049764delGA								RNF144A (865456 upstream) : LOC339788 (12794 downstream)																							atggtgacaggagagagagaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	10417126	10417126	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10417126delA								C2orf48 (65270 upstream) : HPCAL1 (25914 downstream)																							GAGAGTCGTTAAAGTCAGGTC	0.582													4	2	---	---	---	---	
HPCAL1	3241	broad.mit.edu	37	2	10501387	10501388	+	Intron	DEL	AG	-	-	rs71693368		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10501387_10501388delAG	uc002raj.2	+						HPCAL1_uc002rak.2_Intron|HPCAL1_uc002ral.2_Intron|HPCAL1_uc010exe.2_Intron	NM_002149	NP_002140	P37235	HPCL1_HUMAN	hippocalcin-like 1								calcium ion binding			pancreas(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)		GGTGGATCCCagagagagagag	0.505													4	2	---	---	---	---	
ROCK2	9475	broad.mit.edu	37	2	11436258	11436259	+	Intron	DEL	TT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11436258_11436259delTT	uc002rbd.1	-							NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein						axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		GAGGAACAACTTTTCCTATAAA	0.337													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	13599589	13599589	+	IGR	DEL	A	-	-	rs111740453		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13599589delA								TRIB2 (716733 upstream) : None (None downstream)																							TGAATGCCATACAGTGAGAAG	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16126151	16126152	+	IGR	DEL	TC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16126151_16126152delTC								MYCN (39023 upstream) : FAM49A (607749 downstream)																							tctgtgtgtgtctgtatgtgtg	0.094													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	23029308	23029308	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23029308delA								None (None upstream) : KLHL29 (726147 downstream)																							gggctgcctcaaaaggtccct	0.000													4	2	---	---	---	---	
HADHB	3032	broad.mit.edu	37	2	26506091	26506091	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26506091delA	uc002rgz.2	+						HADHB_uc010ykv.1_Intron|HADHB_uc010ykw.1_Intron|HADHB_uc002rha.2_Intron|HADHB_uc010ykx.1_Intron	NM_000183	NP_000174	P55084	ECHB_HUMAN	mitochondrial trifunctional protein, beta						fatty acid beta-oxidation	mitochondrial nucleoid	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acyltransferase activity|enoyl-CoA hydratase activity|protein binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGTTTTTTTAAAAAAAATAA	0.144													4	2	---	---	---	---	
SPAST	6683	broad.mit.edu	37	2	32366013	32366013	+	Intron	DEL	T	-	-	rs67771063		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32366013delT	uc002roc.2	+						SPAST_uc002rod.2_Intron	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1						cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GTTGTTGTTGttttttttttt	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	36189640	36189641	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36189640_36189641insA								None (None upstream) : CRIM1 (393756 downstream)																							cctgggcaacGAAAAACAAAAA	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	42634317	42634318	+	IGR	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42634317_42634318insT								COX7A2L (38167 upstream) : KCNG3 (34841 downstream)																							TCTGCTTGATCttttttttttt	0.153													4	2	---	---	---	---	
MTA3	57504	broad.mit.edu	37	2	42731806	42731806	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42731806delT	uc002rso.1	+							NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						TTAAGCTTGCttttttttttt	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	44360864	44360864	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44360864delA								LRPPRC (137720 upstream) : PPM1B (35136 downstream)																							actccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TTC7A	57217	broad.mit.edu	37	2	47200217	47200218	+	Intron	INS	-	T	T	rs140659089	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47200217_47200218insT	uc002rvo.2	+						TTC7A_uc002rvm.2_Intron|TTC7A_uc002rvn.1_Intron|TTC7A_uc010fbb.2_Intron|TTC7A_uc010fbc.2_Intron|TTC7A_uc002rvp.2_Intron	NM_020458	NP_065191	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A								binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			CAACTGTATGCTTTTCAATTAA	0.465													2	4	---	---	---	---	
CCDC88A	55704	broad.mit.edu	37	2	55566486	55566488	+	Intron	DEL	AAC	-	-	rs72447857		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55566486_55566488delAAC	uc002ryv.2	-						CCDC88A_uc010yoz.1_Intron|CCDC88A_uc010ypa.1_Intron|CCDC88A_uc010ypb.1_Intron	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1						activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						aaattttcATAACAAGTTAAAAT	0.153													3	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	58757885	58757885	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58757885delA	uc002rzy.2	+											Homo sapiens cDNA FLJ30838 fis, clone FEBRA2002399.																		ctcttcaaagaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60580155	60580156	+	IGR	DEL	AC	-	-	rs147505191		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60580155_60580156delAC								None (None upstream) : BCL11A (98147 downstream)																							CATTACAGCAacacacacacac	0.460													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	68034870	68034872	+	IGR	DEL	CCC	-	-	rs72223787	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68034870_68034872delCCC								ETAA1 (397337 upstream) : C1D (234461 downstream)																							TTTtcctcctccccctcctcctc	0.005													5	3	---	---	---	---	
SNRNP27	11017	broad.mit.edu	37	2	70119317	70119318	+	5'Flank	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70119317_70119318insT	uc002sfw.2	+						SNRNP27_uc002sfv.2_5'Flank|SNRNP27_uc002sfx.2_5'Flank	NM_006857	NP_006848	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa						mRNA processing|RNA splicing	nucleus	nucleic acid binding				0						Cttcttctttcttttttttttt	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	70566299	70566300	+	IGR	INS	-	T	T	rs140187388	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70566299_70566300insT								FAM136A (37079 upstream) : TGFA (108119 downstream)																							aattattacactttttttgtca	0.203													2	4	---	---	---	---	
EXOC6B	23233	broad.mit.edu	37	2	72703778	72703779	+	Intron	INS	-	CTT	CTT	rs143002973	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72703778_72703779insCTT	uc010fep.2	-						EXOC6B_uc002sij.2_Intron	NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						cttttcttttcctttttttagt	0.193													2	4	---	---	---	---	
EXOC6B	23233	broad.mit.edu	37	2	72893637	72893639	+	Intron	DEL	GTG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72893637_72893639delGTG	uc010fep.2	-						EXOC6B_uc002sij.2_Intron	NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						attcaatatagtggtggaagtct	0.000													3	3	---	---	---	---	
EXOC6B	23233	broad.mit.edu	37	2	72960286	72960286	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72960286delC	uc010fep.2	-						EXOC6B_uc002sij.2_Intron	NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						AAAAAACAAACATTTAGACAA	0.313													4	2	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	80303707	80303708	+	Intron	INS	-	T	T	rs76829909		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80303707_80303708insT	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						ctgcacttggcTTTTTTTTTTT	0.203													4	2	---	---	---	---	
KCMF1	56888	broad.mit.edu	37	2	85241848	85241849	+	Intron	DEL	GT	-	-	rs72066261		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85241848_85241849delGT	uc002sox.3	+							NM_020122	NP_064507	Q9P0J7	KCMF1_HUMAN	potassium channel modulatory factor 1							intracellular	ligase activity|zinc ion binding			ovary(2)	2						gcgtgcgtgcgtgtgtgtgtgt	0.030													4	3	---	---	---	---	
REEP1	65055	broad.mit.edu	37	2	86474679	86474681	+	Intron	DEL	TTT	-	-	rs71377066		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86474679_86474681delTTT	uc002srh.3	-						REEP1_uc010ytg.1_Intron|REEP1_uc010yth.1_Intron|REEP1_uc010yti.1_Intron	NM_022912	NP_075063	Q9H902	REEP1_HUMAN	receptor accessory protein 1 isoform 2						cell death|protein insertion into membrane	integral to membrane|mitochondrial membrane	olfactory receptor binding				0						AAGAACTTCCTTttgttgttgtt	0.020													4	2	---	---	---	---	
VPS24	51652	broad.mit.edu	37	2	86748316	86748317	+	Intron	DEL	CT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86748316_86748317delCT	uc002srj.2	-						VPS24_uc002srk.2_Intron|VPS24_uc002srl.2_Intron|VPS24_uc010ytl.1_Intron	NM_016079	NP_057163	Q9Y3E7	CHMP3_HUMAN	vacuolar protein sorting 24 isoform 1						cell cycle|cell division|cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein binding			central_nervous_system(1)	1						cctttgctgactctctttttgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90449728	90449730	+	Intron	DEL	TTT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90449728_90449730delTTT	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		CAGCCGAGGCTTTTTATCCTACG	0.685													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91774995	91774996	+	IGR	INS	-	TGAG	TGAG	rs78472690		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91774995_91774996insTGAG								None (None upstream) : LOC654342 (30196 downstream)																							CAGATAGTGACTGTTATTTATC	0.149													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91780939	91780939	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91780939delT								None (None upstream) : LOC654342 (24253 downstream)																							ctctTTCTTCTTTTTTCTACT	0.209													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92076875	92076875	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92076875delT								GGT8P (106722 upstream) : FKSG73 (52284 downstream)																							ttttaaattgtttatagagat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96527714	96527714	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96527714delA	uc002sva.1	-						uc002suz.1_Intron|uc002svb.1_Intron					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		atttcatagcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
MAP4K4	9448	broad.mit.edu	37	2	102474874	102474875	+	Intron	DEL	CA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102474874_102474875delCA	uc002tbg.2	+						MAP4K4_uc002tbc.2_Intron|MAP4K4_uc002tbd.2_Intron|MAP4K4_uc002tbe.2_Intron|MAP4K4_uc002tbf.2_Intron|MAP4K4_uc010yvy.1_Intron|MAP4K4_uc002tbh.2_Intron|MAP4K4_uc002tbi.2_Intron|MAP4K4_uc010yvz.1_Intron|MAP4K4_uc002tbk.2_Intron|MAP4K4_uc002tbj.1_Intron	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase						intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						CTCTGTCTGTCACACACACACA	0.450													4	2	---	---	---	---	
MFSD9	84804	broad.mit.edu	37	2	103343084	103343085	+	Intron	DEL	CA	-	-	rs112803412		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103343084_103343085delCA	uc002tcb.2	-						MFSD9_uc010fja.2_Intron	NM_032718	NP_116107	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane|plasma membrane	transporter activity			ovary(2)|breast(2)	4						ctcgcgcacgcacacacacaca	0.361													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	108354066	108354067	+	IGR	INS	-	A	A	rs112282653		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108354066_108354067insA								ST6GAL2 (850503 upstream) : LOC729121 (85453 downstream)																							tggccattatgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
EDAR	10913	broad.mit.edu	37	2	109582341	109582341	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109582341delC	uc002teq.3	-						EDAR_uc010fjn.2_Intron|EDAR_uc010yws.1_Intron	NM_022336	NP_071731	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor precursor						apoptosis|cell differentiation	integral to membrane	protein binding|transmembrane receptor activity			skin(1)	1						TCCCCCCTCTCCCCCCAGGCA	0.473													4	2	---	---	---	---	
IL1F8	27177	broad.mit.edu	37	2	113780071	113780071	+	3'UTR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113780071delT	uc002tiq.1	-	6						NM_014438	NP_055253	Q9NZH7	IL36B_HUMAN	interleukin 1 family, member 8 isoform 1						immune response	extracellular space	cytokine activity|interleukin-1 receptor binding			ovary(1)	1						GACTCCGACCTTCTCtagctt	0.179													4	2	---	---	---	---	
GLI2	2736	broad.mit.edu	37	2	121640364	121640364	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121640364delT	uc010flp.2	+						GLI2_uc010yyu.1_Intron|GLI2_uc002tmp.1_Intron|GLI2_uc010fln.1_Intron|GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc002tmv.1_Intron|GLI2_uc010flo.1_Intron|GLI2_uc002tmw.1_Intron	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				TAAGTGGGTCTTTTTTTTTTC	0.294													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	121787755	121787755	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121787755delT								GLI2 (37527 upstream) : TFCP2L1 (186411 downstream)																							ttggcatctattttttttttc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	121856537	121856538	+	IGR	INS	-	AA	AA	rs142391943	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121856537_121856538insAA								GLI2 (106309 upstream) : TFCP2L1 (117628 downstream)																							TGACTCTATTCAGAGGCTTTCT	0.525													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	121888413	121888414	+	IGR	INS	-	TC	TC	rs148000742	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121888413_121888414insTC								GLI2 (138185 upstream) : TFCP2L1 (85752 downstream)																							gtgtgtgtgtgtgtgtctgtgt	0.168													3	3	---	---	---	---	
CLASP1	23332	broad.mit.edu	37	2	122243609	122243609	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122243609delG	uc002tnc.2	-						CLASP1_uc010yyw.1_Intron|CLASP1_uc002tnb.2_Intron|CLASP1_uc010yyx.1_Intron|CLASP1_uc010yyy.1_Intron|CLASP1_uc010yyz.1_Intron|CLASP1_uc010yza.1_Intron|CLASP1_uc010yzb.1_Intron|CLASP1_uc010yzc.1_Intron|CLASP1_uc002tng.1_Intron	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1						axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					ggaaagtgaagtgcattctaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	123001933	123001934	+	IGR	INS	-	A	A	rs141009616	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:123001933_123001934insA								TSN (476507 upstream) : None (None downstream)																							ACACATGCACCGGGGGATGGGT	0.480													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129996542	129996542	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129996542delG								HS6ST1 (920371 upstream) : LOC389033 (683893 downstream)																							caccacgcctggctaattttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	131009759	131009760	+	IGR	INS	-	CCG	CCG	rs138344915	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131009759_131009760insCCG								TUBA3E (53725 upstream) : CCDC115 (86056 downstream)																							GGGATGGCGCACCAGAACTTCA	0.653													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	131144697	131144698	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131144697_131144698insA								PTPN18 (11716 upstream) : CFC1B (134138 downstream)																							CATTTAAAAAGAAAAAAAAAAA	0.208													4	2	---	---	---	---	
PLEKHB2	55041	broad.mit.edu	37	2	131948915	131948915	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131948915delC	uc002tsh.2	+									Q96CS7	PKHB2_HUMAN	SubName: Full=Putative uncharacterized protein PLEKHB2;							membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.0828)		GCACACTTTACCTGTCCTTAG	0.358													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133022246	133022247	+	IGR	INS	-	T	T	rs146127817		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133022246_133022247insT								NCRNA00164 (6704 upstream) : GPR39 (151900 downstream)																							GATAGCCTTTCTTTGTTTTCAC	0.307													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133030215	133030216	+	IGR	INS	-	A	A	rs80280761	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133030215_133030216insA								NCRNA00164 (14673 upstream) : GPR39 (143931 downstream)																							aagaaaagaagaaaaaaaaaaa	0.218													2	4	---	---	---	---	
TMEM163	81615	broad.mit.edu	37	2	135418457	135418458	+	Intron	INS	-	GTA	GTA	rs10657064		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135418457_135418458insGTA	uc002ttx.2	-						TMEM163_uc002tty.2_Intron	NM_030923	NP_112185	Q8TC26	TM163_HUMAN	transmembrane protein 163							integral to membrane					0				BRCA - Breast invasive adenocarcinoma(221;0.154)		TCTGAGGAAAGGTTTCACTTtg	0.228													1	5	---	---	---	---	
THSD7B	80731	broad.mit.edu	37	2	137655023	137655024	+	Intron	INS	-	C	C	rs148656771	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137655023_137655024insC	uc010zbj.1	+											Homo sapiens mRNA for KIAA1679 protein, partial cds.											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		gtttgttccttccagtgggttc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	147795460	147795460	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147795460delT								PABPC1P2 (446903 upstream) : ACVR2A (806626 downstream)																							gaaggttagcttatttttATT	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	152000581	152000581	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152000581delA								RND3 (656401 upstream) : RBM43 (104148 downstream)																							ccctgtctttaaaaaataaag	0.000													4	2	---	---	---	---	
WDSUB1	151525	broad.mit.edu	37	2	160123814	160123814	+	Intron	DEL	T	-	-	rs34190249		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160123814delT	uc002uaj.3	-						WDSUB1_uc002uak.3_Intron|WDSUB1_uc002ual.3_Intron|WDSUB1_uc002uam.3_Intron|WDSUB1_uc010foo.2_Intron	NM_152528	NP_689741	Q8N9V3	WSDU1_HUMAN	WD repeat, sterile alpha motif and U-box domain							ubiquitin ligase complex	ubiquitin-protein ligase activity				0						tttttctttcttttttttttt	0.189													2	4	---	---	---	---	
SLC38A11	151258	broad.mit.edu	37	2	165763781	165763782	+	Intron	DEL	TT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165763781_165763782delTT	uc002ucv.1	-						SLC38A11_uc002ucu.1_Intron|SLC38A11_uc002ucw.1_Intron	NM_173512	NP_775783	Q08AI6	S38AB_HUMAN	solute carrier family 38, member 11						amino acid transport|sodium ion transport	integral to membrane				ovary(1)	1						TTCttttctctttttttttttt	0.193													4	2	---	---	---	---	
RAPGEF4	11069	broad.mit.edu	37	2	173638372	173638372	+	Intron	DEL	G	-	-	rs145739180	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173638372delG	uc002uhv.3	+						RAPGEF4_uc002uhu.2_Intron|RAPGEF4_uc010fqn.2_Intron	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			GCCCCACACTGCCCCCCCCGC	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	176875680	176875680	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176875680delG								KIAA1715 (8166 upstream) : EVX2 (69157 downstream)																							TGATGAAAGAGGAAAAACTGA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	192798237	192798237	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192798237delG								SDPR (86256 upstream) : TMEFF2 (16512 downstream)																							cccatgggaaggtggaacagt	0.179													4	2	---	---	---	---	
CASP10	843	broad.mit.edu	37	2	202058811	202058816	+	Intron	DEL	TGTGTG	-	-	rs10548083		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202058811_202058816delTGTGTG	uc002uxl.1	+						CASP10_uc002uxi.1_Intron|CASP10_uc010zhn.1_Intron|CASP10_uc002uxj.1_Intron|CASP10_uc002uxk.1_Intron|CASP10_uc010fta.1_Intron|CASP10_uc002uxm.1_Intron|CASP10_uc010ftb.1_Intron	NM_032974	NP_116756	Q92851	CASPA_HUMAN	caspase 10 isoform b preproprotein						apoptosis|induction of apoptosis by extracellular signals|proteolysis	cytosol|plasma membrane	cysteine-type endopeptidase activity|identical protein binding|protein binding			skin(3)|ovary(1)|pancreas(1)|breast(1)	6						TTTATTTTCTtgtgtgtgtgtgtgtg	0.238													4	2	---	---	---	---	
CREB1	1385	broad.mit.edu	37	2	208442484	208442484	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208442484delT	uc002vcc.2	+						CREB1_uc002vcd.2_Intron	NM_134442	NP_604391	P16220	CREB1_HUMAN	cAMP responsive element binding protein 1						activation of phospholipase C activity|axon guidance|innate immune response|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway		protein dimerization activity|transcription cofactor activity		EWSR1/CREB1(42)	soft_tissue(42)|breast(1)|central_nervous_system(1)	44				LUSC - Lung squamous cell carcinoma(261;0.0768)|Epithelial(149;0.127)|Lung(261;0.145)	Adenosine monophosphate(DB00131)|Bromocriptine(DB01200)|Naloxone(DB01183)	TTGCATTGAATTTTTTTTTTC	0.308			T	EWSR1	clear cell sarcoma|angiomatoid fibrous histiocytoma								4	2	---	---	---	---	
PLEKHM3	389072	broad.mit.edu	37	2	208698218	208698219	+	Intron	INS	-	T	T	rs11395288		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208698218_208698219insT	uc002vcl.2	-							NM_001080475	NP_001073944	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M,						intracellular signal transduction		metal ion binding			ovary(1)	1						GGGTTTTTCTGTTTTTTTTTTT	0.297													3	3	---	---	---	---	
TNS1	7145	broad.mit.edu	37	2	218817192	218817193	+	Intron	DEL	CA	-	-	rs35174417		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218817192_218817193delCA	uc010fvk.1	-						TNS1_uc002vgv.1_Intron	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TCTCCCGCGCcacacacacaca	0.421													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	219854429	219854432	+	IGR	DEL	TTTG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219854429_219854432delTTTG								FEV (4050 upstream) : CRYBA2 (480 downstream)																							tgttgttgtttttgtttgtttgtt	0.162													3	4	---	---	---	---	
SPEG	10290	broad.mit.edu	37	2	220302855	220302855	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220302855delG	uc010fwg.2	+						SPEG_uc002vlm.2_Intron	NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus						muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AACTGGGGGTGGTGGTGCTGA	0.443													4	2	---	---	---	---	
SPEG	10290	broad.mit.edu	37	2	220340958	220340959	+	Intron	INS	-	TTAC	TTAC	rs141868732	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220340958_220340959insTTAC	uc010fwg.2	+							NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus						muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GTATTTGGGGGTTGTTTGTTCA	0.307											OREG0015225	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
CUL3	8452	broad.mit.edu	37	2	225414580	225414581	+	Intron	DEL	CA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225414580_225414581delCA	uc002vny.2	-						CUL3_uc010zls.1_Intron|CUL3_uc010fwy.1_Intron	NM_003590	NP_003581	Q13618	CUL3_HUMAN	cullin 3						cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TATATGCGTGcacacacacaca	0.252													3	3	---	---	---	---	
SPATA3	130560	broad.mit.edu	37	2	231869725	231869726	+	Intron	INS	-	CAT	CAT	rs142539373	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231869725_231869726insCAT	uc010zmd.1	+						SPATA3_uc002vri.3_Intron|SPATA3_uc002vrk.2_Intron	NM_139073	NP_620712	Q8NHX4	SPTA3_HUMAN	testis and spermatogenesis cell apoptosis						apoptosis|spermatogenesis						0						atcatcaccaccatcatcacca	0.069													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235058715	235058718	+	IGR	DEL	ACAC	-	-	rs72071131		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235058715_235058718delACAC								SPP2 (72939 upstream) : ARL4C (342970 downstream)																							ACAGGATCGTacacacacacacac	0.328													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235487425	235487426	+	IGR	DEL	AC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235487425_235487426delAC								ARL4C (81732 upstream) : SH3BP4 (373202 downstream)																							tcatgcacatacacacacacac	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235976854	235976855	+	IGR	INS	-	G	G	rs138080955	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235976854_235976855insG								SH3BP4 (12498 upstream) : AGAP1 (425881 downstream)																							aatgaggcacaggggggttaag	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	236117356	236117357	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236117356_236117357insA								SH3BP4 (153000 upstream) : AGAP1 (285379 downstream)																							gagactccgtcaaaaaaaaaaa	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239203888	239203889	+	IGR	INS	-	CTTCTC	CTTCTC			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239203888_239203889insCTTCTC								PER2 (5145 upstream) : TRAF3IP1 (25296 downstream)																							ttcttgttcttcttctccttct	0.124													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241586284	241586290	+	IGR	DEL	GTCGGCG	-	-	rs71885942		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241586284_241586290delGTCGGCG								GPR35 (15609 upstream) : AQP12B (29546 downstream)																							AGACCACGCTGTCGGCGGAGGGTGAAG	0.657													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	242124465	242124466	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242124465_242124466insA								PPP1R7 (2026 upstream) : ANO7 (3458 downstream)																							tggcagagtgcactatgtggaa	0.000													4	2	---	---	---	---	
DTYMK	1841	broad.mit.edu	37	2	242618195	242618196	+	Intron	INS	-	TT	TT	rs147266149		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242618195_242618196insTT	uc002wbz.1	-						DTYMK_uc010zpa.1_Intron|DTYMK_uc010zpb.1_Intron|DTYMK_uc002wca.1_Intron|DTYMK_uc002wcb.1_5'Flank	NM_012145	NP_036277	P23919	KTHY_HUMAN	deoxythymidylate kinase (thymidylate kinase)						cell cycle|cell proliferation|nucleobase, nucleoside and nucleotide interconversion	cytosol	ATP binding|nucleoside phosphate kinase activity|thymidylate kinase activity				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.6e-33)|all cancers(36;3.57e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.23e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		TATTGTGGCTCGTTTAATTTTT	0.386													1	6	---	---	---	---	
CNTN4	152330	broad.mit.edu	37	3	2775833	2775833	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2775833delC	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron|CNTN4_uc003bpd.1_Intron	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		cagccttgatccccccagatc	0.005													4	2	---	---	---	---	
SRGAP3	9901	broad.mit.edu	37	3	9061999	9061999	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9061999delT	uc003brf.1	-						SRGAP3_uc003brg.1_Intron|SRGAP3_uc003bri.1_Intron	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		AATCTCAACCTTTTTTTTTTC	0.348			T	RAF1	pilocytic astrocytoma								4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	10195133	10195133	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10195133delA								VHL (1389 upstream) : IRAK2 (11430 downstream)																							ccaaaaaaacaaaaaaaaaaC	0.154													4	2	---	---	---	---	
ATP2B2	491	broad.mit.edu	37	3	10427117	10427117	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10427117delA	uc003bvt.2	-						ATP2B2_uc003bvv.2_Intron|ATP2B2_uc003bvw.2_Intron|ATP2B2_uc010hdo.2_Intron	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1						ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						CTCTATTCTTAAAAAAAAAAA	0.438													4	2	---	---	---	---	
GRIP2	80852	broad.mit.edu	37	3	14580232	14580234	+	Intron	DEL	GAG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14580232_14580234delGAG	uc011avi.1	-						GRIP2_uc011avh.1_Intron|GRIP2_uc003byv.1_Intron	NM_001080423	NP_001073892	Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission	cytosol|plasma membrane	protein binding			pancreas(1)	1						AAATGTCAGAGAGGTCAGGAAGG	0.542													5	4	---	---	---	---	
COLQ	8292	broad.mit.edu	37	3	15516093	15516095	+	Intron	DEL	GTG	-	-	rs35460824		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15516093_15516095delGTG	uc003bzx.2	-						COLQ_uc003bzv.2_Intron|COLQ_uc003bzz.2_Intron|COLQ_uc010heo.2_Intron|COLQ_uc003cac.1_Intron|COLQ_uc003cae.1_Intron|COLQ_uc003cad.1_Intron	NM_005677	NP_005668	Q9Y215	COLQ_HUMAN	acetylcholinesterase collagen-like tail subunit						acetylcholine catabolic process in synaptic cleft|asymmetric protein localization	basal lamina|cell junction|collagen|extracellular space|synaptic cleft					0						AGAAGGTTGTGTGGTGGTGAAAG	0.463													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	18873125	18873125	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18873125delT								SATB1 (392873 upstream) : KCNH8 (316892 downstream)																							GCTATGCTCCTTTTTATCAAG	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	36095859	36095859	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36095859delT								ARPP21 (259872 upstream) : STAC (326238 downstream)																							cccccctttattataatctta	0.000													4	2	---	---	---	---	
LIMD1	8994	broad.mit.edu	37	3	45654008	45654010	+	Intron	DEL	AGG	-	-	rs139445986		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45654008_45654010delAGG	uc003coq.2	+							NM_014240	NP_055055	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1						cytoplasmic mRNA processing body assembly|gene silencing by miRNA|multicellular organismal development|negative regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasmic mRNA processing body|nucleus|RNA-induced silencing complex	protein binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		acttcttgataggaggagtgtct	0.074													3	4	---	---	---	---	
DOCK3	1795	broad.mit.edu	37	3	51092773	51092773	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51092773delT	uc011bds.1	+							NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CTGCAGAGGCTTGCATCTTAC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	52467002	52467002	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52467002delT								PHF7 (9346 upstream) : SEMA3G (266 downstream)																							TTTGCCAGTGTTTTTTTTTTT	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	55459294	55459294	+	IGR	DEL	T	-	-	rs144516051		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55459294delT								CACNA2D3 (350712 upstream) : WNT5A (40450 downstream)																							TTCTCTCTCCTTTTTTTCCTT	0.189													4	2	---	---	---	---	
ERC2	26059	broad.mit.edu	37	3	56421679	56421679	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56421679delA	uc003dhr.1	-							NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		GAGATTTTATAACCTCTCTAG	0.423													4	2	---	---	---	---	
PTPRG	5793	broad.mit.edu	37	3	61806851	61806851	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61806851delT	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		tcttgttttcttttttttttt	0.119													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	65326468	65326468	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65326468delA								ADAMTS9 (653103 upstream) : MAGI1 (13439 downstream)																							aggaattactaatagatcaga	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	66862048	66862049	+	IGR	DEL	GA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66862048_66862049delGA								LRIG1 (311203 upstream) : KBTBD8 (186678 downstream)																							AATATACCTTGACACCATCTAT	0.223													4	2	---	---	---	---	
FAM19A1	407738	broad.mit.edu	37	3	68573830	68573831	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68573830_68573831insT	uc003dnd.2	+						FAM19A1_uc003dne.2_Intron|FAM19A1_uc003dng.2_Intron	NM_213609	NP_998774	Q7Z5A9	F19A1_HUMAN	family with sequence similarity 19 (chemokine							endoplasmic reticulum|extracellular region				ovary(1)	1		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)		ttttgtttttgtttttttttga	0.178													4	3	---	---	---	---	
ZNF717	100131827	broad.mit.edu	37	3	75761328	75761328	+	Intron	DEL	A	-	-	rs146502045		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75761328delA	uc003dpw.3	-									C9JSV9	C9JSV9_HUMAN	Homo sapiens cDNA FLJ41782 fis, clone IMR322018192, weakly  similar to ZINC FINGER PROTEIN 90.						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						tttaggcaagaaaaaagggga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	89568228	89568231	+	IGR	DEL	TTCC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89568228_89568231delTTCC								EPHA3 (36946 upstream) : None (None downstream)																							ccttccttttttccttccttcctt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	94252836	94252837	+	IGR	DEL	AA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94252836_94252837delAA								NSUN3 (407206 upstream) : LOC255025 (404270 downstream)																							actctgtctcaaaaaaagaaaa	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	103322343	103322344	+	IGR	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103322343_103322344insT								None (None upstream) : None (None downstream)																							cagtagcctgagtttaagagct	0.000													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	108517194	108517195	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108517194_108517195insA								RETNLB (41064 upstream) : TRAT1 (24436 downstream)																							ctaaaaataccaaaaaaaaaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	108971231	108971232	+	IGR	DEL	TT	-	-	rs111906018		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108971231_108971232delTT								C3orf66 (67124 upstream) : DPPA2 (41404 downstream)																							AACAAAACACtttttttttttt	0.149													3	4	---	---	---	---	
C3orf52	79669	broad.mit.edu	37	3	111838204	111838205	+	Intron	DEL	AA	-	-	rs149713442		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111838204_111838205delAA	uc011bht.1	+						C3orf52_uc003dyr.1_Intron	NM_024616	NP_078892	Q5BVD1	TTMP_HUMAN	TPA-induced transmembrane protein							endoplasmic reticulum membrane|integral to membrane					0						cctgggtgacaagagtgaaact	0.139													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	117415178	117415187	+	IGR	DEL	GTGTGTGTGA	-	-	rs67325399		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117415178_117415187delGTGTGTGTGA								LOC285194 (979293 upstream) : None (None downstream)																							gtgcctgtgtgtgtgtgtgagtgtgtgtgt	0.281													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	118404018	118404018	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118404018delT	uc011biu.1	-											Homo sapiens clone HA_003061 mRNA sequence.																		cccagcctcctttgtggctat	0.000													4	2	---	---	---	---	
B4GALT4	8702	broad.mit.edu	37	3	118936141	118936142	+	Intron	INS	-	T	T	rs143499855	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118936141_118936142insT	uc003ecg.2	-						B4GALT4_uc003ece.1_Intron|B4GALT4_uc003ecf.2_Intron|B4GALT4_uc003ech.2_Intron|B4GALT4_uc003eci.2_Intron|B4GALT4_uc011biy.1_Intron	NM_212543	NP_997708	O60513	B4GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-						membrane lipid metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	metal ion binding|N-acetyllactosamine synthase activity				0				GBM - Glioblastoma multiforme(114;0.222)	N-Acetyl-D-glucosamine(DB00141)	CACGTACCCTCTGTCCAGTTCC	0.490													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	119009903	119009904	+	IGR	INS	-	A	A	rs111369156		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119009903_119009904insA								B4GALT4 (50151 upstream) : ARHGAP31 (3316 downstream)																							agaaaaattggaaaaaaaaaaa	0.277													2	4	---	---	---	---	
TMEM39A	55254	broad.mit.edu	37	3	119171498	119171498	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119171498delT	uc003eck.1	-						TMEM39A_uc003ecl.1_Intron	NM_018266	NP_060736	Q9NV64	TM39A_HUMAN	transmembrane protein 39A							integral to membrane				ovary(1)|breast(1)	2				GBM - Glioblastoma multiforme(114;0.244)		CCCTTACAGATTATGGGAATA	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	122069985	122069985	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122069985delT								CSTA (9172 upstream) : CCDC58 (8452 downstream)																							GCTTTCTTTCttttttttttt	0.040													4	3	---	---	---	---	
ADCY5	111	broad.mit.edu	37	3	123024485	123024485	+	Intron	DEL	T	-	-	rs10709804		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123024485delT	uc003egh.1	-						ADCY5_uc003egg.1_Intron|ADCY5_uc003egi.1_Intron	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5						activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		gtcttgtgtcttctgccagcc	0.129													4	3	---	---	---	---	
MUC13	56667	broad.mit.edu	37	3	124640001	124640002	+	Intron	INS	-	T	T	rs140184451	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124640001_124640002insT	uc003ehq.1	-							NM_033049	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, epithelial transmembrane							extracellular region|integral to membrane|plasma membrane					0						TCTCTACTTCCttttttttttc	0.158													4	2	---	---	---	---	
OSBPL11	114885	broad.mit.edu	37	3	125265745	125265746	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125265745_125265746insA	uc003eic.2	-							NM_022776	NP_073613	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11						lipid transport		lipid binding			ovary(3)|breast(1)|kidney(1)	5						aaacaaatgacaaaaaaaaaaa	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	125453579	125453580	+	IGR	INS	-	TT	TT			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125453579_125453580insTT								OSBPL11 (139198 upstream) : MIR548I1 (55667 downstream)																							GATTTGTTGTCTTTTTTTTTTT	0.441													3	3	---	---	---	---	
EEFSEC	60678	broad.mit.edu	37	3	127965074	127965075	+	Intron	DEL	CA	-	-	rs68085104		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127965074_127965075delCA	uc003eki.2	+						EEFSEC_uc003ekj.2_Intron	NM_021937	NP_068756	P57772	SELB_HUMAN	eukaryotic elongation factor,							cytoplasm|nucleus	GTP binding|GTPase activity|translation elongation factor activity			ovary(1)	1						AGCGTGcacgcacacacacaca	0.386													6	3	---	---	---	---	
GATA2	2624	broad.mit.edu	37	3	128209609	128209609	+	5'Flank	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128209609delC	uc003ekm.3	-						GATA2_uc003ekn.3_5'Flank|GATA2_uc003eko.2_Intron|uc003ekp.2_Intron	NM_001145661	NP_001139133	P23769	GATA2_HUMAN	GATA binding protein 2 isoform 1						blood coagulation|negative regulation of fat cell differentiation|negative regulation of fat cell proliferation|negative regulation of neural precursor cell proliferation|negative regulation of Notch signaling pathway|phagocytosis|positive regulation of angiogenesis|positive regulation of phagocytosis|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	C2H2 zinc finger domain binding|chromatin binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(13)|lung(1)|skin(1)	15				GBM - Glioblastoma multiforme(114;0.173)		GTCAACGCAGCCCCCAGAATC	0.602			Mis		AML(CML blast transformation)								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	128762611	128762611	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128762611delC								CCDC48 (3028 upstream) : GP9 (17034 downstream)																							agtcaattctccaaaaagaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	133216712	133216712	+	IGR	DEL	T	-	-	rs113847875		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133216712delT								BFSP2 (22656 upstream) : CDV3 (75722 downstream)																							GATTAAAAAATTTTTTTTCTg	0.010													2	4	---	---	---	---	
KY	339855	broad.mit.edu	37	3	134358633	134358633	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134358633delA	uc010hty.2	-						KY_uc011blw.1_Intron|KY_uc011blx.1_Intron|KY_uc003eqs.1_Intron	NM_178554	NP_848649	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase							cytoskeleton|Z disc	peptidase activity			ovary(2)	2						acaaaaaacgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
PPP2R3A	5523	broad.mit.edu	37	3	135730062	135730063	+	Intron	INS	-	T	T	rs144834122	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135730062_135730063insT	uc003eqv.1	+						PPP2R3A_uc011blz.1_Intron	NM_002718	NP_002709	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'',						protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7						cccctctactgtttttttttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	138484522	138484522	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138484522delA								PIK3CB (6337 upstream) : FOXL2 (178545 downstream)																							ccctctcttcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
NMNAT3	349565	broad.mit.edu	37	3	139339802	139339802	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139339802delT	uc003etj.2	-						NMNAT3_uc003etk.2_Intron|NMNAT3_uc003etl.2_Intron|NMNAT3_uc010hul.2_Intron	NM_178177	NP_835471	Q96T66	NMNA3_HUMAN	nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	cytosol|mitochondrion	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity				0						tgcttggctatttttttttcc	0.000													4	2	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	139831193	139831194	+	Intron	DEL	GT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139831193_139831194delGT	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						AATATTAAAAgtgtgtgtgtgt	0.287										HNSCC(16;0.037)			5	3	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	140139744	140139744	+	Intron	DEL	C	-	-	rs11338320		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140139744delC	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						AGTCCTATTGCGCAGCTAGGT	0.517										HNSCC(16;0.037)			5	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	140917053	140917053	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140917053delA								SPSB4 (49601 upstream) : ACPL2 (33629 downstream)																							aaatactggcaaaccaaatcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	140947521	140947521	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140947521delT								SPSB4 (80069 upstream) : ACPL2 (3161 downstream)																							ATTTGTACAATTTTTGCTCAA	0.428													4	2	---	---	---	---	
RASA2	5922	broad.mit.edu	37	3	141206544	141206544	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141206544delC	uc003etz.1	+						RASA2_uc010huq.1_Intron|RASA2_uc003eua.1_Intron	NM_006506	NP_006497	Q15283	RASA2_HUMAN	RAS p21 protein activator 2						intracellular signal transduction|negative regulation of Ras protein signal transduction	intracellular membrane-bounded organelle|intrinsic to internal side of plasma membrane|perinuclear region of cytoplasm	metal ion binding|Ras GTPase activator activity			ovary(2)|lung(2)|breast(1)|skin(1)	6						GTGGGGCTGGCCCGAGGGGAG	0.726													4	2	---	---	---	---	
SLC9A9	285195	broad.mit.edu	37	3	143102301	143102302	+	Intron	INS	-	GAG	GAG	rs148390237	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143102301_143102302insGAG	uc003evn.2	-							NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						ccatttgatcagagaagtatga	0.000													4	2	---	---	---	---	
SLC9A9	285195	broad.mit.edu	37	3	143142309	143142309	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143142309delT	uc003evn.2	-							NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						aaacatctcattgcaccaatt	0.000													4	2	---	---	---	---	
SLC9A9	285195	broad.mit.edu	37	3	143484067	143484068	+	Intron	DEL	GA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143484067_143484068delGA	uc003evn.2	-						SLC9A9_uc011bnk.1_Intron	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						tctctttcttgacagggtttcc	0.000													4	2	---	---	---	---	
RNF13	11342	broad.mit.edu	37	3	149627739	149627740	+	Intron	INS	-	A	A	rs148663510		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149627739_149627740insA	uc003exn.3	+						RNF13_uc003exp.3_Intron|RNF13_uc010hvh.2_Intron	NM_007282	NP_009213	O43567	RNF13_HUMAN	ring finger protein 13						protein autoubiquitination	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane|nuclear inner membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AAAAAGAGAAGAAAAAAAAAAA	0.366													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	155829897	155829897	+	IGR	DEL	T	-	-	rs28406457		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155829897delT								GMPS (174379 upstream) : KCNAB1 (8440 downstream)																							AAATGCTGtgttttttttttt	0.159													6	3	---	---	---	---	
KCNAB1	7881	broad.mit.edu	37	3	155904050	155904050	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155904050delT	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Intron	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			AACCTGCCTATTTTTTTTCTG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	165974552	165974553	+	IGR	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165974552_165974553delTG								BCHE (419299 upstream) : ZBBX (983528 downstream)																							atttgttgtctgtgataaaatt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	166522560	166522560	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166522560delA								BCHE (967307 upstream) : ZBBX (435521 downstream)																							CTGTGGCATTAAAACAAGTCT	0.234													4	2	---	---	---	---	
SKIL	6498	broad.mit.edu	37	3	170097272	170097273	+	Intron	INS	-	CT	CT	rs145510642	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170097272_170097273insCT	uc003fgu.2	+						SKIL_uc011bps.1_Intron|SKIL_uc003fgv.2_Intron|SKIL_uc003fgw.2_Intron	NM_005414	NP_005405	P12757	SKIL_HUMAN	SKI-like isoform 1						cell cycle arrest|negative regulation of cell differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of axonogenesis|protein heterotrimerization|protein homotrimerization|regulation of apoptosis|regulation of apoptosis|response to antibiotic|response to growth factor stimulus|skeletal muscle tissue development	cytoplasm|PML body	chromatin binding|nucleotide binding|protein complex binding|protein domain specific binding|SMAD binding|transcription corepressor activity|transcription repressor activity			ovary(2)|skin(1)	3	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			TCTTGCCCCCCCTTTTAAGTAT	0.396													4	2	---	---	---	---	
CLDN11	5010	broad.mit.edu	37	3	170142733	170142736	+	Intron	DEL	GCGT	-	-	rs150427966		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170142733_170142736delGCGT	uc003fgx.2	+						CLDN11_uc011bpt.1_Intron|CLDN11_uc003fgy.2_Intron	NM_005602	NP_005593	O75508	CLD11_HUMAN	claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			gtgtgtgcgcgcgtgtgtgtgtgt	0.368													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	171602377	171602377	+	IGR	DEL	T	-	-	rs5854452		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171602377delT								TMEM212 (25269 upstream) : FNDC3B (155041 downstream)																							gaaccactccttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	177086341	177086344	+	IGR	DEL	TGTT	-	-	rs72151483		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177086341_177086344delTGTT								TBL1XR1 (171293 upstream) : None (None downstream)																							tttgtttgtctgtttgtttgtttg	0.025													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	177605924	177605925	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177605924_177605925insA	uc003fiz.1	+											Homo sapiens cDNA FLJ31690 fis, clone NT2RI2005621.																		actaaaaatacaaaaaaaatta	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	185735015	185735015	+	IGR	DEL	A	-	-	rs112848898		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185735015delA								TRA2B (79091 upstream) : ETV5 (29093 downstream)																							aaacaaaaagaaaaaaaaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	185843824	185843825	+	IGR	INS	-	G	G	rs138762864	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185843824_185843825insG								ETV5 (16923 upstream) : DGKG (21166 downstream)																							atgtgtggtgtgggggtgtgtg	0.000													3	4	---	---	---	---	
ST6GAL1	6480	broad.mit.edu	37	3	186652780	186652780	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186652780delA	uc003frb.2	+						ST6GAL1_uc003frc.2_Intron	NM_173216	NP_775323	P15907	SIAT1_HUMAN	ST6 beta-galactosamide						humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			central_nervous_system(1)	1	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		ggtctcgatcAAAAATTTTAT	0.000													4	2	---	---	---	---	
ST6GAL1	6480	broad.mit.edu	37	3	186717859	186717859	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186717859delC	uc003frb.2	+						ST6GAL1_uc003frc.2_Intron	NM_173216	NP_775323	P15907	SIAT1_HUMAN	ST6 beta-galactosamide						humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			central_nervous_system(1)	1	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		cagcattcttcctgccttggc	0.075													1	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	187696817	187696818	+	IGR	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187696817_187696818insT								BCL6 (233342 upstream) : LPP (174901 downstream)																							TGAACACGGCCTGAATGGGGAG	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194237203	194237203	+	Intron	DEL	T	-	-	rs63067360		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194237203delT	uc003fua.1	+											Homo sapiens cDNA FLJ34208 fis, clone FCBBF3020232.																		TGCTTGGTTATTTTTTTTTTT	0.045													2	4	---	---	---	---	
UBXN7	26043	broad.mit.edu	37	3	196137692	196137693	+	Intron	INS	-	A	A	rs78559743		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196137692_196137693insA	uc003fwm.3	-						UBXN7_uc003fwn.3_Intron|UBXN7_uc010iae.2_Intron|UBXN7_uc010iaf.2_Intron	NM_015562	NP_056377	O94888	UBXN7_HUMAN	UBX domain containing 7								protein binding			ovary(2)|pancreas(1)	3						gactccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
BDH1	622	broad.mit.edu	37	3	197237468	197237468	+	3'UTR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197237468delG	uc003fxr.2	-	8					BDH1_uc003fxs.2_3'UTR|BDH1_uc003fxt.2_3'UTR|BDH1_uc003fxu.2_3'UTR	NM_203314	NP_976059	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1						cellular lipid metabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	3-hydroxybutyrate dehydrogenase activity			ovary(1)	1	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)	NADH(DB00157)	CTGCAGAACAGGGgtgtgtgt	0.284											OREG0016016	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
GAK	2580	broad.mit.edu	37	4	863528	863529	+	Intron	INS	-	CA	CA	rs138892904	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:863528_863529insCA	uc003gbm.3	-						GAK_uc003gbn.3_Intron|GAK_uc010ibk.1_Intron|GAK_uc010ibi.2_5'Flank|GAK_uc010ibj.2_Intron|GAK_uc003gbl.3_Intron	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase						cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		acacatgaatgcacacagtaca	0.040													3	3	---	---	---	---	
FGFRL1	53834	broad.mit.edu	37	4	1019055	1019056	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1019055_1019056delCA	uc003gce.2	+	7	1596_1597	c.1435_1436delCA	c.(1435-1437)CACfs	p.H479fs	FGFRL1_uc003gcf.2_Frame_Shift_Del_p.H479fs|FGFRL1_uc003gcg.2_Frame_Shift_Del_p.H479fs|FGFRL1_uc010ibo.2_Frame_Shift_Del_p.H479fs	NM_021923	NP_068742	Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	479	His-rich.|Cytoplasmic (Potential).				regulation of cell growth	integral to membrane|plasma membrane	fibroblast growth factor receptor activity|heparin binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			cacagacatccacacacacaca	0.460													4	2	---	---	---	---	
KIAA1530	57654	broad.mit.edu	37	4	1366721	1366722	+	Intron	INS	-	C	C	rs144700445	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1366721_1366722insC	uc003gde.3	+						KIAA1530_uc010ibv.2_Intron	NM_020894	NP_065945	Q2YD98	K1530_HUMAN	hypothetical protein LOC57654												0			OV - Ovarian serous cystadenocarcinoma(23;0.0138)			GTTTTGCTCCACCCCCTGCCCC	0.584													3	4	---	---	---	---	
DOK7	285489	broad.mit.edu	37	4	3478456	3478456	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3478456delG	uc003ghd.2	+						DOK7_uc003ghe.2_Intron	NM_173660	NP_775931	Q18PE1	DOK7_HUMAN	downstream of tyrosine kinase 7 isoform 1						positive regulation of protein tyrosine kinase activity	cell junction|synapse	insulin receptor binding|protein kinase binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GAACCTCAGTGTGGAGTGTCG	0.642													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3589447	3589448	+	Intron	INS	-	GA	GA	rs144006715		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3589447_3589448insGA	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																		CACTCCCAGATGAGACTTCCTG	0.550													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3628364	3628365	+	IGR	INS	-	C	C	rs144368206	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3628364_3628365insC								LRPAP1 (94140 upstream) : ADRA2C (139710 downstream)																							cctcagagccacgtgcttcctg	0.193													4	2	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7678529	7678530	+	Intron	DEL	TG	-	-	rs60830443		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7678529_7678530delTG	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						TCTGCctttctgtctctctctc	0.163													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	15235942	15235943	+	IGR	DEL	CT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15235942_15235943delCT								CPEB2 (164168 upstream) : C1QTNF7 (105617 downstream)																							CGctcgctcactctctctctct	0.327													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	18840594	18840594	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18840594delA								LCORL (817209 upstream) : None (None downstream)																							TAGGGTTAGGAAAAAAAAAAC	0.239													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	24631573	24631576	+	IGR	DEL	AAAC	-	-	rs71639844		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24631573_24631576delAAAC								DHX15 (45389 upstream) : SOD3 (165509 downstream)																							actctgtTAAaaacaaacaaacaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	25642191	25642191	+	IGR	DEL	T	-	-	rs33989726		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25642191delT								ANAPC4 (222072 upstream) : SLC34A2 (15244 downstream)																							CAAATGGGTGTTTTTTTGTTA	0.189													5	3	---	---	---	---	
PCDH7	5099	broad.mit.edu	37	4	31018406	31018407	+	Intron	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31018406_31018407delTG	uc011bxx.1	+						PCDH7_uc011bxw.1_Intron	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor						homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						TAAGGGCTATtgtgtgtgtgtg	0.173													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	31367096	31367097	+	IGR	INS	-	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31367096_31367097insC								PCDH7 (218675 upstream) : None (None downstream)																							agcaagcaagaccccccccgcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	34752626	34752627	+	IGR	DEL	AA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:34752626_34752627delAA								None (None upstream) : None (None downstream)																							ctaaagatacaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TBC1D1	23216	broad.mit.edu	37	4	38080727	38080728	+	Intron	INS	-	T	T	rs145262624	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38080727_38080728insT	uc003gtb.2	+						TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron|TBC1D1_uc011byf.1_Intron	NM_015173	NP_055988	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							nucleus	Rab GTPase activator activity			ovary(1)	1						GGCTCCCACGGTGGAGGGGTTG	0.520													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	44075100	44075100	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44075100delG								None (None upstream) : KCTD8 (100822 downstream)																							gggaatgaatggatgggaaaa	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49261389	49261389	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49261389delA								CWH43 (197296 upstream) : None (None downstream)																							attttgtctcaaaaaaaaaaa	0.000													8	5	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54506444	54506444	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54506444delG	uc003haa.2	+						LNX1_uc003hah.3_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	TGGCAGTGGTGGAAAAGCAGA	0.463			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	72757742	72757742	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72757742delC								GC (87984 upstream) : NPFFR2 (139779 downstream)																							cagtggatctccaggcacagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	75848859	75848862	+	IGR	DEL	AGGA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75848859_75848862delAGGA								BTC (128977 upstream) : PARM1 (9436 downstream)																							gaaagacggtaggaaggaaggaag	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	76921919	76921922	+	IGR	DEL	TAAA	-	-	rs75082460		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76921919_76921922delTAAA								SDAD1 (9806 upstream) : CXCL9 (701 downstream)																							CCTGGACCCTTAAATAATTCATTC	0.412													5	5	---	---	---	---	
AFF1	4299	broad.mit.edu	37	4	87970730	87970730	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87970730delT	uc003hqj.3	+						AFF1_uc003hqh.1_Intron|AFF1_uc011ccy.1_Intron|AFF1_uc011ccz.1_Intron|AFF1_uc003hqk.3_Intron|AFF1_uc011cda.1_Intron	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia							nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AAGAATGGGGTTTTTTTTTTG	0.378													5	3	---	---	---	---	
PAPSS1	9061	broad.mit.edu	37	4	108603095	108603096	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108603095_108603096insT	uc003hyk.2	-						PAPSS1_uc011cfh.1_Intron	NM_005443	NP_005434	O43252	PAPS1_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process|skeletal system development|sulfate assimilation|xenobiotic metabolic process	cytosol	adenylylsulfate kinase activity|ATP binding|sulfate adenylyltransferase (ATP) activity			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)		TAACACCACCATTTTTTTTTGG	0.381													6	3	---	---	---	---	
RRH	10692	broad.mit.edu	37	4	110756943	110756944	+	Intron	INS	-	T	T	rs71595523		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110756943_110756944insT	uc003hzv.2	+							NM_006583	NP_006574	O14718	OPSX_HUMAN	peropsin						phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00109)		gcttaaatgtctttttttTTTT	0.158													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	136437381	136437384	+	IGR	DEL	TCTC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:136437381_136437384delTCTC								None (None upstream) : None (None downstream)																							CTACCTGGTGtctctctctctctc	0.245													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	140164716	140164716	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140164716delT								ELF2 (66344 upstream) : C4orf49 (22601 downstream)																							ATGGACATGCTTTAGGCATTA	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	144160290	144160290	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144160290delT								USP38 (17150 upstream) : GAB1 (97693 downstream)																							atgaaaaaaCttttttttttt	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	147064114	147064114	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147064114delA								ZNF827 (204507 upstream) : LSM6 (32721 downstream)																							TACACATCTTAACCTCCCCCA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	153615772	153615772	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153615772delC								TMEM154 (14581 upstream) : TIGD4 (74736 downstream)																							CCTTCCCACTCCCCTGGCCCC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	160571972	160571972	+	IGR	DEL	G	-	-	rs71589254		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160571972delG								RAPGEF2 (290673 upstream) : None (None downstream)																							catgagatctggttgtttaac	0.000													4	2	---	---	---	---	
GALNTL6	442117	broad.mit.edu	37	4	173709338	173709341	+	Intron	DEL	AAAC	-	-	rs71594008		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173709338_173709341delAAAC	uc003isv.2	+							NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN	N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4						ctctacaaaaaaacaaacaaacaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	176547550	176547551	+	IGR	INS	-	G	G	rs139159077	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176547550_176547551insG								ADAM29 (648220 upstream) : GPM6A (6538 downstream)																							aaatttagaaaggtgggaggaa	0.000													1	6	---	---	---	---	
GPM6A	2823	broad.mit.edu	37	4	176630451	176630452	+	Intron	DEL	TC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176630451_176630452delTC	uc003iuf.2	-						GPM6A_uc011ckj.1_Intron|GPM6A_uc003iug.2_Intron|GPM6A_uc003iuh.2_Intron	NM_201591	NP_963885	P51674	GPM6A_HUMAN	glycoprotein M6A isoform 2							cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		tctctctctgtctctctctctc	0.084													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	184335272	184335272	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184335272delG								WWC2 (93345 upstream) : CDKN2AIP (30517 downstream)																							tgatgtcattggtctgatcgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	184475594	184475595	+	IGR	DEL	GT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184475594_184475595delGT								ING2 (43345 upstream) : RWDD4A (85194 downstream)																							GCGTGAGTGGGTGTGTGTGTGG	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190597276	190597277	+	IGR	INS	-	A	A	rs149616832		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190597276_190597277insA								None (None upstream) : FRG1 (264697 downstream)																							TGATTTTTAAGAAAAAAATCTA	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190604439	190604440	+	IGR	INS	-	CA	CA	rs147961780		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190604439_190604440insCA								None (None upstream) : FRG1 (257534 downstream)																							TTACCTTCACTCACAGagtttc	0.223													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190892040	190892041	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190892040_190892041insA								FRG1 (7682 upstream) : TUBB4Q (11638 downstream)																							TCTGCCTGCTGCTGGCTTTCCT	0.436													6	4	---	---	---	---	
AHRR	57491	broad.mit.edu	37	5	379661	379662	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:379661_379662insA	uc003jav.2	+						AHRR_uc003jaw.2_Intron|AHRR_uc010isy.2_Intron|AHRR_uc010isz.2_Intron	NM_020731	NP_065782	A9YTQ3	AHRR_HUMAN	arylhydrocarbon receptor repressor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			attttaatactggaatcttgtt	0.000													4	2	---	---	---	---	
CEP72	55722	broad.mit.edu	37	5	649472	649472	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:649472delG	uc003jbf.2	+							NM_018140	NP_060610	Q9P209	CEP72_HUMAN	centrosomal protein 72 kDa						G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			TGTGAGGCGTGGACTGTGAGG	0.597													11	5	---	---	---	---	
LPCAT1	79888	broad.mit.edu	37	5	1496532	1496533	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1496532_1496533insA	uc003jcm.2	-							NM_024830	NP_079106	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1						phospholipid biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		TTATTTTCCACAAAAAAAAAAA	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2145572	2145573	+	IGR	INS	-	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2145572_2145573insC								IRX4 (262692 upstream) : IRX2 (600708 downstream)																							CCTAATCACTTCCAGATCCTCC	0.510													4	3	---	---	---	---	
LOC340094	340094	broad.mit.edu	37	5	5057794	5057795	+	RNA	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5057794_5057795insT	uc003jdg.2	+	3		c.428_429insT			LOC340094_uc003jdh.2_RNA	NR_026994				Homo sapiens hypothetical protein LOC340094, mRNA (cDNA clone IMAGE:5295461).												0						TCCAACACATATTTTTTTTGAA	0.361													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	5811687	5811688	+	IGR	INS	-	TG	TG	rs149542834	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5811687_5811688insTG								KIAA0947 (321350 upstream) : FLJ33360 (498866 downstream)																							CCgtgtgtgtctgtgtgtgtgt	0.381													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6869737	6869740	+	IGR	DEL	GTGA	-	-	rs148674841		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6869737_6869740delGTGA								PAPD7 (112576 upstream) : ADCY2 (526603 downstream)																							cagcatgggtgtgagtgtgtgcac	0.034													3	3	---	---	---	---	
RICTOR	253260	broad.mit.edu	37	5	38998645	38998646	+	Intron	DEL	AA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38998645_38998646delAA	uc003jlp.2	-						RICTOR_uc003jlo.2_Intron|RICTOR_uc010ivf.2_Intron|RICTOR_uc003jlq.1_Intron|RICTOR_uc011cpk.1_Intron	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR						actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					ggcacggtttaaaacaaacaaa	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	40906107	40906107	+	IGR	DEL	T	-	-	rs11293283		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40906107delT								CARD6 (50653 upstream) : C7 (3492 downstream)																							TTGTCtttccttttttttttt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	55225268	55225269	+	IGR	INS	-	GTCC	GTCC	rs141331600	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55225268_55225269insGTCC								IL31RA (6591 upstream) : IL6ST (11426 downstream)																							TTCCTGATACTGTCCACAAACA	0.599													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	56195094	56195094	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56195094delT								MAP3K1 (3118 upstream) : C5orf35 (10009 downstream)																							ATATGTAGCATTCAAATATGT	0.333													4	2	---	---	---	---	
C5orf44	80006	broad.mit.edu	37	5	64931971	64931972	+	Intron	INS	-	T	T	rs71760261		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64931971_64931972insT	uc003jtz.3	+						C5orf44_uc003jua.3_Intron|C5orf44_uc003juc.3_Intron|C5orf44_uc010iwv.2_Intron	NM_024941	NP_079217	A5PLN9	CE044_HUMAN	hypothetical protein LOC80006 isoform 2											ovary(1)	1						atacaTTTACCttttttttttt	0.020													4	4	---	---	---	---	
MCCC2	64087	broad.mit.edu	37	5	70934712	70934714	+	Intron	DEL	CAG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70934712_70934714delCAG	uc003kbs.3	+						MCCC2_uc010iyv.1_Intron|MCCC2_uc003kbt.3_Intron	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)						leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	ccgtgggctacagagtggatgtt	0.000													4	2	---	---	---	---	
RASGRF2	5924	broad.mit.edu	37	5	80317379	80317380	+	Intron	DEL	GT	-	-	rs34148067		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80317379_80317380delGT	uc003kha.1	+						RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		Ttgtgcgagcgtgtgtgtgtgt	0.401													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	81562586	81562587	+	IGR	DEL	GA	-	-	rs146568437		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81562586_81562587delGA								ATG10 (11375 upstream) : RPS23 (6554 downstream)																							aacaatgcatgagagatgcagt	0.000													2	4	---	---	---	---	
RGMB	285704	broad.mit.edu	37	5	98106505	98106506	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98106505_98106506insA	uc003knc.2	+						RGMB_uc003knb.2_Intron|uc003knd.2_RNA|uc003kne.2_RNA	NM_001012761	NP_001012779	Q6NW40	RGMB_HUMAN	RGM domain family, member B						axon guidance|BMP signaling pathway|cell adhesion|positive regulation of transcription, DNA-dependent	anchored to plasma membrane|ER-Golgi intermediate compartment|membrane raft	identical protein binding				0		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		ctcttgctctgaaaAAAAAAAT	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	102138827	102138828	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102138827_102138828insA								SLCO6A1 (304107 upstream) : PAM (62699 downstream)																							attctgtgtccaaaaaaaaaga	0.000													4	2	---	---	---	---	
AQPEP	206338	broad.mit.edu	37	5	115297051	115297052	+	5'Flank	INS	-	CGCG	CGCG	rs151167755	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115297051_115297052insCGCG	uc003kro.2	+						AQPEP_uc003krp.2_5'Flank|uc003krn.1_3'UTR	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin						proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0						acacacacacacacacGCGCGC	0.381													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	129724592	129724593	+	IGR	DEL	GT	-	-	rs112347170		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129724592_129724593delGT								CHSY3 (202266 upstream) : HINT1 (770282 downstream)																							TTGGAAAATCgtgtgtgtgtgt	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	140654744	140654745	+	IGR	DEL	AA	-	-	rs112292048		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140654744_140654745delAA								PCDHB15 (26945 upstream) : SLC25A2 (27452 downstream)																							ggaaagaaagaaaaagaaagaa	0.000													4	2	---	---	---	---	
PCDHGC5	56097	broad.mit.edu	37	5	140876456	140876456	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140876456delA	uc003lla.1	+						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc003lky.1_Intron	NM_018929	NP_061752	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			agtaacacttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	145091387	145091388	+	IGR	INS	-	T	T	rs147380990	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145091387_145091388insT								None (None upstream) : PRELID2 (47194 downstream)																							CAGAGGCAGGGTAGCACAGTGG	0.599													3	3	---	---	---	---	
MIR143	406935	broad.mit.edu	37	5	148807554	148807555	+	5'Flank	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148807554_148807555insA	hsa-mir-143|MI0000459	+						LOC728264_uc003lqq.2_RNA|LOC728264_uc003lqs.2_RNA|LOC728264_uc003lqp.2_RNA|MIR145_hsa-mir-145|MI0000461_5'Flank																	0						gactctgtctcaaaaaaaaaaa	0.248													5	3	---	---	---	---	
C5orf41	153222	broad.mit.edu	37	5	172544383	172544383	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172544383delA	uc003mch.2	+						C5orf41_uc011dfd.1_Intron	NM_153607	NP_705835	Q8IUR6	CE041_HUMAN	luman-recruiting factor								protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Renal(175;0.000159)|Lung NSC(126;0.00223)|all_lung(126;0.00391)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			actctgtctcaaaaaaaaaaa	0.075													4	2	---	---	---	---	
HRH2	3274	broad.mit.edu	37	5	175084936	175084937	+	5'Flank	DEL	GA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175084936_175084937delGA	uc003mdc.3	+							NM_001131055	NP_001124527	P25021	HRH2_HUMAN	histamine receptor H2 isoform 1						G-protein signaling, coupled to cyclic nucleotide second messenger|immune response	integral to plasma membrane	histamine receptor activity			ovary(1)	1	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Nizatidine(DB00585)|Ranitidine(DB00863)	TGTGCGCGCTgagagagagaga	0.307													4	3	---	---	---	---	
KIAA1191	57179	broad.mit.edu	37	5	175781942	175781942	+	Intron	DEL	G	-	-	rs146079081		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175781942delG	uc003mdw.2	-						KIAA1191_uc003mdx.2_Intron|KIAA1191_uc003mdy.2_Intron|KIAA1191_uc003mea.2_Intron|KIAA1191_uc003mdz.2_Intron	NM_020444	NP_065177	Q96A73	K1191_HUMAN	hypothetical protein LOC57179 isoform a								protein binding			ovary(1)	1	all_cancers(89;0.00575)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.101)		aagacttaaaggataccagtt	0.070													2	4	---	---	---	---	
ADAMTS2	9509	broad.mit.edu	37	5	178629392	178629393	+	Intron	DEL	CT	-	-	rs35102483		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178629392_178629393delCT	uc003mjw.2	-						ADAMTS2_uc011dgm.1_Intron	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		gcaccagcccctgagctgtaga	0.000													2	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	179829564	179829564	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179829564delT								GFPT2 (49249 upstream) : CNOT6 (91853 downstream)																							atgtgtcttataaggatgctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	3207732	3207733	+	IGR	DEL	GT	-	-	rs111358979		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3207732_3207733delGT								TUBB2A (49949 upstream) : TUBB2B (16763 downstream)																							gcttgggtgcgtgtgtgtgtgt	0.144													4	2	---	---	---	---	
SLC22A23	63027	broad.mit.edu	37	6	3423854	3423854	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3423854delA	uc003mvm.3	-						SLC22A23_uc003mvn.3_Intron|SLC22A23_uc003mvo.3_Intron|SLC22A23_uc003mvp.1_Intron|SLC22A23_uc010jnn.2_Intron|SLC22A23_uc010jno.2_Intron	NM_015482	NP_056297	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23 isoform a						ion transport	integral to membrane	transmembrane transporter activity			ovary(1)	1	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				gggagggaggaaggaaggAAC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	5856776	5856779	+	IGR	DEL	CCGT	-	-	rs77933716	byFrequency	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5856776_5856779delCCGT								FARS2 (84960 upstream) : NRN1 (141456 downstream)																							CGAGGCACACCCGTCTCTCTCTCC	0.382													4	2	---	---	---	---	
TXNDC5	81567	broad.mit.edu	37	6	7926209	7926209	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7926209delT	uc003mxw.2	-							NM_001145549	NP_001139021	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 isoform 3						anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)					aataccgtgcttttccaatgg	0.000													4	2	---	---	---	---	
C6orf105	84830	broad.mit.edu	37	6	11781495	11781495	+	5'Flank	DEL	T	-	-	rs112859704		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11781495delT	uc003nab.2	-						C6orf105_uc011dip.1_5'Flank	NM_032744	NP_116133	Q96IZ2	CF105_HUMAN	hypothetical protein LOC84830 isoform 2							integral to membrane					0	Ovarian(93;0.0848)|Breast(50;0.0871)	all_hematologic(90;0.135)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.193)			TGAGTGCCCCttttttttttt	0.224													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14284564	14284565	+	IGR	INS	-	TG	TG	rs140187306	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14284564_14284565insTG								CD83 (147418 upstream) : JARID2 (961169 downstream)																							ATTTCAAGGGTtgtgtgtgtgt	0.272													6	4	---	---	---	---	
KIF13A	63971	broad.mit.edu	37	6	17827747	17827747	+	Intron	DEL	T	-	-	rs35848228		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17827747delT	uc003ncg.3	-						KIF13A_uc003ncf.2_Intron|KIF13A_uc003nch.3_Intron|KIF13A_uc003nci.3_Intron|KIF13A_uc003ncj.2_Intron	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			tctctctacattttttttttt	0.000													4	2	---	---	---	---	
CDKAL1	54901	broad.mit.edu	37	6	20731557	20731557	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20731557delA	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			ggcagcagggaaaaagtgtta	0.000													4	2	---	---	---	---	
LRRC16A	55604	broad.mit.edu	37	6	25307108	25307108	+	Intron	DEL	T	-	-	rs35585232		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25307108delT	uc011djw.1	+						LRRC16A_uc010jpx.2_Intron|LRRC16A_uc010jpy.2_Intron	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						GTGCCTTGGCttttttttttt	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	26761283	26761284	+	IGR	DEL	TG	-	-	rs34195881		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26761283_26761284delTG								ZNF322A (101320 upstream) : GUSBL1 (77982 downstream)																							tgagtgtatatgtgtttgtatg	0.252													4	2	---	---	---	---	
GABBR1	2550	broad.mit.edu	37	6	29584477	29584478	+	Intron	DEL	AG	-	-	rs28383951		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29584477_29584478delAG	uc003nmt.3	-						GABBR1_uc003nmp.3_Intron|GABBR1_uc003nms.3_Intron|GABBR1_uc003nmu.3_Intron|GABBR1_uc011dlr.1_Intron|GABBR1_uc011dls.1_Intron	NM_001470	NP_001461	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor 1						gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(5)|liver(1)|skin(1)	7					Baclofen(DB00181)|Progabide(DB00837)	aaaaaaaaaaagttagccagac	0.000													4	3	---	---	---	---	
BAT2	7916	broad.mit.edu	37	6	31589265	31589266	+	Intron	DEL	TT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31589265_31589266delTT	uc003nvb.3	+						BAT2_uc011dnv.1_Intron|BAT2_uc003nvc.3_Intron|SNORA38_uc003nvd.2_5'Flank	NM_080686	NP_542417	P48634	PRC2A_HUMAN	HLA-B associated transcript-2							cytoplasm|nucleus	protein binding				0						GTCTACATCCTTTTTTTTTTTG	0.406													4	2	---	---	---	---	
C6orf27	80737	broad.mit.edu	37	6	31736618	31736619	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31736618_31736619insA	uc011dog.1	-						C6orf27_uc003nxd.2_Intron	NM_025258	NP_079534	Q9Y334	G7C_HUMAN	G7c protein precursor							extracellular region				ovary(3)	3						gactccatctcaaaaaaaaaaa	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	33719296	33719297	+	IGR	DEL	TT	-	-	rs36009611		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33719296_33719297delTT								IP6K3 (4534 upstream) : LEMD2 (19694 downstream)																							tgtgtgtgtgtTTGGCCCCGGG	0.460													3	3	---	---	---	---	
GRM4	2914	broad.mit.edu	37	6	34065216	34065229	+	Intron	DEL	GTGTGTGTGTGTGC	-	-	rs112067680		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34065216_34065229delGTGTGTGTGTGTGC	uc003oir.3	-						GRM4_uc011dsn.1_Intron|GRM4_uc010jvh.2_Intron|GRM4_uc010jvi.2_Intron|GRM4_uc010jvk.1_Intron|GRM4_uc011dsl.1_Intron|GRM4_uc003oiq.2_Intron|GRM4_uc011dsm.1_Intron	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor						activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	ctgtgtgtgtgtgtgtgtgtgtgcgcgcgcatgt	0.318													4	3	---	---	---	---	
TULP1	7287	broad.mit.edu	37	6	35476459	35476459	+	Intron	DEL	T	-	-	rs147717133		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35476459delT	uc003okv.3	-						TULP1_uc003okw.3_Intron	NM_003322	NP_003313	O00294	TULP1_HUMAN	tubby like protein 1						dendrite development|eye photoreceptor cell development|phagocytosis|photoreceptor cell maintenance|positive regulation of phagocytosis	cell junction|cytoplasm|extracellular region|photoreceptor inner segment|photoreceptor outer segment|synapse	actin filament binding|phosphatidylinositol-4,5-bisphosphate binding			ovary(2)|central_nervous_system(1)	3						agatgcatactggtaagcttg	0.119													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	35734408	35734408	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35734408delG								C6orf81 (17720 upstream) : C6orf126 (9984 downstream)																							gaaaagaaaagaaaagaaaaa	0.129													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	37676325	37676325	+	IGR	DEL	A	-	-	rs147296173		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37676325delA								MDGA1 (10559 upstream) : ZFAND3 (110982 downstream)																							atgtgacttcaaaaaaaaaaa	0.184													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	37685196	37685198	+	IGR	DEL	AAG	-	-	rs72137763		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37685196_37685198delAAG								MDGA1 (19430 upstream) : ZFAND3 (102109 downstream)																							agatgaagacaagaagagagcta	0.049													4	4	---	---	---	---	
BTBD9	114781	broad.mit.edu	37	6	38396133	38396134	+	Intron	DEL	TA	-	-	rs139263390		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38396133_38396134delTA	uc003ooa.3	-						BTBD9_uc003ony.3_Intron|BTBD9_uc010jwv.2_Intron|BTBD9_uc010jww.2_Intron|BTBD9_uc010jwx.2_Intron	NM_052893	NP_443125	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9 isoform a						cell adhesion						0						TACACAACTCTATGTTAGCATG	0.381													2	5	---	---	---	---	
TDRG1	732253	broad.mit.edu	37	6	40347103	40347104	+	RNA	INS	-	C	C	rs148319526	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40347103_40347104insC	uc003opg.2	+	2		c.557_558insC				NR_024015				Homo sapiens cDNA clone IMAGE:5297318.												0						GAACTGGGAAGCCCCCCCACCC	0.515													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	40603835	40603836	+	IGR	INS	-	AGAG	AGAG	rs138117155	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40603835_40603836insAGAG								LRFN2 (48709 upstream) : UNC5CL (390936 downstream)																							cacacacacacaGAGAGTTGAG	0.386													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	48567266	48567267	+	IGR	DEL	CC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48567266_48567267delCC								C6orf138 (488323 upstream) : MUT (831727 downstream)																							ttgaatccttcccatgcttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	52093023	52093023	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52093023delT								IL17A (37587 upstream) : IL17F (8461 downstream)																							agaattatggtttgccttttc	0.000													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57291450	57291451	+	Intron	INS	-	CTCA	CTCA	rs147993020	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57291450_57291451insCTCA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		caagttgtatttgcattgccgt	0.005													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57336763	57336772	+	Intron	DEL	TTTTTTTTTG	-	-	rs66673983		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57336763_57336772delTTTTTTTTTG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTTTTTTTTTTTTTTTTTTGGAGAACTGTT	0.324													4	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57406654	57406655	+	Intron	INS	-	T	T	rs112281124		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57406654_57406655insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AAAAAGGAAAGTATTATTAAGG	0.307													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57408104	57408118	+	Intron	DEL	TTTAAAAAGCTTATC	-	-	rs71839638	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57408104_57408118delTTTAAAAAGCTTATC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTTAGCACTGTTTAAAAAGCTTATCTTTTCTTCCA	0.353													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57444073	57444073	+	Intron	DEL	A	-	-	rs33922243		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57444073delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		agattaatggaaaagttacaa	0.000													8	8	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57453658	57453658	+	Intron	DEL	A	-	-	rs112358066		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57453658delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		attctttatgaaggggaatat	0.000													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57503445	57503445	+	Intron	DEL	C	-	-	rs11343070		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57503445delC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		aagagcttcacaaaatgagtt	0.080													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57539715	57539715	+	IGR	DEL	T	-	-	rs66713931		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57539715delT								PRIM2 (26340 upstream) : GUSBL2 (706444 downstream)																							TACTTCTCACttttttttttt	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57563533	57563534	+	IGR	INS	-	TC	TC	rs149258860		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57563533_57563534insTC								PRIM2 (50158 upstream) : GUSBL2 (682625 downstream)																							cttggttctcttctccttaatc	0.050													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57564637	57564638	+	IGR	INS	-	G	G	rs145275344		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57564637_57564638insG								PRIM2 (51262 upstream) : GUSBL2 (681521 downstream)																							CACTGTGTTGAGGGACTGTTTA	0.356													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	67805550	67805550	+	IGR	DEL	A	-	-	rs34681520		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:67805550delA								None (None upstream) : None (None downstream)																							agtcaaagacaggggtgacag	0.000													5	4	---	---	---	---	
TMEM30A	55754	broad.mit.edu	37	6	75995155	75995156	+	5'Flank	INS	-	CTT	CTT	rs146206354	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75995155_75995156insCTT	uc003phw.2	-						TMEM30A_uc003phx.2_5'Flank|uc010kbd.1_Intron	NM_018247	NP_060717	Q9NV96	CC50A_HUMAN	transmembrane protein 30A isoform 1							integral to membrane					0						TTACATTTCCCCTTTTCTGTGT	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	88436016	88436017	+	IGR	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88436016_88436017insT								AKIRIN2 (24031 upstream) : SPACA1 (321490 downstream)																							aaccaaaaatcttttttttttt	0.000													3	6	---	---	---	---	
BACH2	60468	broad.mit.edu	37	6	90954918	90954919	+	Intron	DEL	AA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90954918_90954919delAA	uc011eab.1	-						BACH2_uc003pnw.2_Intron|BACH2_uc010kch.2_Intron	NM_021813	NP_068585	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper							nucleus	protein dimerization activity|sequence-specific DNA binding			ovary(3)|pancreas(1)|lung(1)|skin(1)	6		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		attctgtcttaaaaaaaaaaaa	0.109													4	2	---	---	---	---	
C6orf167	253714	broad.mit.edu	37	6	97660918	97660919	+	Intron	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97660918_97660919delTG	uc003ppb.2	-						C6orf167_uc011eaf.1_Intron	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714						double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		ATGAGCACATtgtgtgtgtgtg	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	102720976	102720976	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102720976delC								GRIK2 (203019 upstream) : None (None downstream)																							CAACAGCAGTCCCTTAATTCA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	104110473	104110480	+	IGR	DEL	TTGGTTGG	-	-	rs67110281		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104110473_104110480delTTGGTTGG								None (None upstream) : None (None downstream)																							gtttgattgattggttggttggttggtt	0.000													2	5	---	---	---	---	
PREP	5550	broad.mit.edu	37	6	105777031	105777031	+	Intron	DEL	T	-	-	rs11345908		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105777031delT	uc003prc.2	-							NM_002726	NP_002717	P48147	PPCE_HUMAN	prolyl endopeptidase						proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	CACTTTTACAttttttttttt	0.169													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	106952824	106952824	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106952824delA								ATG5 (179129 upstream) : AIM1 (6906 downstream)																							GGAAGTTATTAAAAAAAAAAA	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	107386019	107386019	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107386019delA								C6orf203 (13475 upstream) : BEND3 (366 downstream)																							ATCCAAAGTGAAAAAAAAAAA	0.333													4	2	---	---	---	---	
SOBP	55084	broad.mit.edu	37	6	107940196	107940196	+	Intron	DEL	G	-	-	rs116152586	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107940196delG	uc003prx.2	+							NM_018013	NP_060483	A7XYQ1	SOBP_HUMAN	sine oculis binding protein homolog								metal ion binding			ovary(1)	1		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		GAGCAGGGGCGGGGGAGCACT	0.517													5	3	---	---	---	---	
TRAF3IP2	10758	broad.mit.edu	37	6	111884910	111884910	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111884910delG	uc011ebc.1	-						TRAF3IP2_uc011ebb.1_Intron|TRAF3IP2_uc003pvd.2_Intron|TRAF3IP2_uc003pvg.2_Intron|TRAF3IP2_uc003pvf.2_Intron	NM_147686	NP_679211	O43734	CIKS_HUMAN	TRAF3 interacting protein 2 isoform 2						intracellular signal transduction|positive regulation of I-kappaB kinase/NF-kappaB cascade	intracellular				ovary(2)|central_nervous_system(1)	3		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		gcaaatgtctggaggtgtgaa	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	113982140	113982140	+	IGR	DEL	T	-	-	rs149686471		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:113982140delT								None (None upstream) : MARCKS (196387 downstream)																							TCCTTCCttcttttttttttt	0.090													4	3	---	---	---	---	
HS3ST5	222537	broad.mit.edu	37	6	114653867	114653868	+	Intron	DEL	CT	-	-	rs13215162		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114653867_114653868delCT	uc003pwh.3	-						uc003pwf.2_Intron	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		ATGATCTGTACTACCAAACAGA	0.441													4	2	---	---	---	---	
GOPC	57120	broad.mit.edu	37	6	117789025	117789025	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117789025delT	uc003pxq.1	-							NM_001017408	NP_001017408	Q9HD26	GOPC_HUMAN	golgi associated PDZ and coiled-coil motif						apical protein localization|cytoplasmic sequestering of CFTR protein|ER to Golgi vesicle-mediated transport|Golgi to plasma membrane transport|protein homooligomerization|protein transport	cell junction|dendrite|Golgi membrane|postsynaptic density|postsynaptic membrane|trans-Golgi network transport vesicle	cystic fibrosis transmembrane conductance regulator binding			ovary(1)	1		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)		TTTCAATTTCTTTTTTTTTTC	0.224			O	ROS1	glioblastoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134701170	134701171	+	IGR	INS	-	T	T	rs72153971		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134701170_134701171insT								SGK1 (61974 upstream) : ALDH8A1 (537358 downstream)																							cttcttttttgttttttttttt	0.208													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	139674308	139674309	+	IGR	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139674308_139674309insT								TXLNB (61100 upstream) : CITED2 (19088 downstream)																							taatttttgtatttttttgtag	0.000													4	2	---	---	---	---	
LOC153910	153910	broad.mit.edu	37	6	142887197	142887197	+	Intron	DEL	A	-	-	rs72394571		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142887197delA	uc003qjc.1	-						LOC153910_uc010khg.1_Intron	NR_027312				Homo sapiens cDNA FLJ31371 fis, clone NB9N42000196.												0						agtccctgtcaaaaaaaaaag	0.179													4	2	---	---	---	---	
LATS1	9113	broad.mit.edu	37	6	150037185	150037186	+	Intron	DEL	TT	-	-	rs74332287		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150037185_150037186delTT	uc003qmu.1	-						LATS1_uc010kif.1_Intron|LATS1_uc003qmw.2_Intron|LATS1_uc010kig.1_Intron	NM_004690	NP_004681	O95835	LATS1_HUMAN	LATS homolog 1						cell division|cytoplasmic sequestering of protein|G2/M transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|positive regulation of peptidyl-serine phosphorylation|regulation of actin filament polymerization|sister chromatid segregation	microtubule organizing center|spindle pole	ATP binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		CAGATCGCCATTTTTTTTTTTT	0.163													4	2	---	---	---	---	
PCMT1	5110	broad.mit.edu	37	6	150092136	150092137	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150092136_150092137insA	uc003qne.2	+						PCMT1_uc003qna.2_Intron|PCMT1_uc003qnb.2_Intron|PCMT1_uc011eeg.1_Intron|PCMT1_uc003qnc.2_Intron|PCMT1_uc003qnd.2_Intron|PCMT1_uc003qnf.2_Intron	NM_005389	NP_005380			protein-L-isoaspartate (D-aspartate)											ovary(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		ctctgtctcagaaaaaaaaaaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	150340147	150340147	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150340147delT								RAET1K (13867 upstream) : RAET1L (1120 downstream)																							AGCTTGGACCTACCTCTTTCC	0.567													4	2	---	---	---	---	
PLEKHG1	57480	broad.mit.edu	37	6	150932948	150932948	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150932948delA	uc003qny.1	+						PLEKHG1_uc011eel.1_Intron	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		actccatctcaaaaaaaaaaa	0.109													4	2	---	---	---	---	
AKAP12	9590	broad.mit.edu	37	6	151570121	151570122	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151570121_151570122insA	uc011eep.1	+						AKAP12_uc003qoe.2_Intron	NM_005100	NP_005091	Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12 isoform 1						G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding			large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		gactctgtctcaaaaaaaaaaa	0.193													6	4	---	---	---	---	
AKAP12	9590	broad.mit.edu	37	6	151627127	151627127	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151627127delG	uc011eep.1	+						AKAP12_uc003qoe.2_Intron	NM_005100	NP_005091	Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12 isoform 1						G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding			large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		ACTGCCTGGTGGTGGATTGGT	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	153101925	153101933	+	IGR	DEL	GTGTTCCCC	-	-	rs58632883		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153101925_153101933delGTGTTCCCC								VIP (21027 upstream) : FBXO5 (189727 downstream)																							tgtgttccctgtgttccccatgagacaag	0.048													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	158111657	158111657	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158111657delT								ZDHHC14 (16681 upstream) : SNX9 (132637 downstream)																							AGTTTATGGATTTTTTTTTTT	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	160287101	160287101	+	IGR	DEL	T	-	-	rs71795689		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160287101delT								PNLDC1 (45366 upstream) : MAS1 (40873 downstream)																							acaatgcgtgttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164364831	164364831	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164364831delC								QKI (369939 upstream) : None (None downstream)																							GAAAAGTTGGCCACACAAATA	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	168811600	168811600	+	IGR	DEL	C	-	-	rs5881789		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168811600delC								DACT2 (91198 upstream) : SMOC2 (30431 downstream)																							CACCTCCCGGCCCCCCACCTC	0.662													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	168830223	168830224	+	IGR	DEL	GT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168830223_168830224delGT								DACT2 (109821 upstream) : SMOC2 (11807 downstream)																							TATGTGTGTAgtgtgtgtgtgt	0.040													4	2	---	---	---	---	
THBS2	7058	broad.mit.edu	37	6	169636313	169636316	+	Intron	DEL	CACT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169636313_169636316delCACT	uc003qwt.2	-							NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor						cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		ACACCATCCACACTCACTCCCCAT	0.270													3	3	---	---	---	---	
TBP	6908	broad.mit.edu	37	6	170877542	170877544	+	Intron	DEL	TTG	-	-	rs72413985		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170877542_170877544delTTG	uc003qxt.2	+						TBP_uc003qxu.2_Intron|TBP_uc011ehf.1_Intron	NM_003194	NP_003185	P20226	TBP_HUMAN	TATA box binding protein						cell death|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription from RNA polymerase III promoter|viral reproduction	transcription factor TFIIA complex|transcription factor TFIID complex	repressing transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		ACAttcttttttgttgttgttgt	0.148													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	171021141	171021143	+	IGR	DEL	ACA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:171021141_171021143delACA								PDCD2 (127393 upstream) : None (None downstream)																							caccgagaacacaacatcacaca	0.084													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	444880	444883	+	IGR	DEL	ACAG	-	-	rs36134285		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:444880_444883delACAG								FAM20C (144169 upstream) : PDGFA (92016 downstream)																							cgacacatcaacagacaatgagtc	0.123													3	7	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	945285	945286	+	Intron	INS	-	A	A	rs141647614	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:945285_945286insA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						aaggagaaagggaaaggagaaa	0.000													4	2	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	954866	954867	+	Intron	INS	-	CCTGCACACCTCG	CCTGCACACCTCG	rs141733912	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:954866_954867insCCTGCACACCTCG	uc003sjo.3	-						ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						CTGCACTCACACCTGCACACCT	0.634													6	3	---	---	---	---	
MAD1L1	8379	broad.mit.edu	37	7	2037617	2037618	+	Intron	INS	-	ACA	ACA	rs72557555		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2037617_2037618insACA	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		ATCCTCCCACCAAATTCGAAGT	0.520													4	2	---	---	---	---	
IQCE	23288	broad.mit.edu	37	7	2616892	2616892	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2616892delG	uc003smo.3	+						IQCE_uc010ksm.1_Intron|IQCE_uc003sml.1_Intron|IQCE_uc011jvy.1_Intron|IQCE_uc011jvz.1_Intron|IQCE_uc003smk.3_Intron|IQCE_uc003smn.3_Intron	NM_152558	NP_689771	Q6IPM2	IQCE_HUMAN	IQ motif containing E isoform 1												0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		ctgtgtacgtggggacgtgtg	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	3116378	3116379	+	IGR	DEL	TG	-	-	rs66982715		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3116378_3116379delTG								CARD11 (32799 upstream) : SDK1 (224701 downstream)																							tacatatgtatgtgtgtgtgtg	0.252													5	3	---	---	---	---	
SDK1	221935	broad.mit.edu	37	7	4123324	4123324	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4123324delC	uc003smx.2	+						SDK1_uc010kso.2_Intron	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ttcacttcttccctccctcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	4430811	4430811	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4430811delA								SDK1 (122182 upstream) : FOXK1 (252577 downstream)																							agaccctgtcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
FOXK1	221937	broad.mit.edu	37	7	4765646	4765647	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4765646_4765647insT	uc003snc.1	+						FOXK1_uc003sna.1_Intron|FOXK1_uc003snb.1_Intron	NM_001037165	NP_001032242	P85037	FOXK1_HUMAN	forkhead box K1						cell differentiation|embryo development|muscle organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			upper_aerodigestive_tract(1)|skin(1)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		ACAAACAGAACTTTTTTTTTTT	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	5175150	5175150	+	5'Flank	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5175150delA	uc003snu.1	-						uc010ksu.1_5'Flank|uc011jwf.1_Intron					SubName: Full=cDNA FLJ60262, weakly similar to Zinc finger protein 81;																		ctgtaatcccaacactttggg	0.124													4	4	---	---	---	---	
TNRC18	84629	broad.mit.edu	37	7	5414952	5414953	+	Intron	INS	-	AAAC	AAAC	rs147714765	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5414952_5414953insAAAC	uc003soi.3	-							NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18								DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		aaaaacaacaaaaacaaacaaa	0.124													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	5841472	5841472	+	IGR	DEL	T	-	-	rs11311682		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5841472delT								RNF216 (20180 upstream) : ZNF815 (21319 downstream)																							AATAAtttccttttttttttt	0.189													2	4	---	---	---	---	
COL28A1	340267	broad.mit.edu	37	7	7483518	7483518	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7483518delC	uc003src.1	-						COL28A1_uc011jxe.1_Intron|COL28A1_uc003srd.2_Intron	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor						cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		AATTTATCAGCCAATTTCCAA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	11238289	11238292	+	IGR	DEL	TTCT	-	-	rs62438691	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11238289_11238292delTTCT								PHF14 (29048 upstream) : THSD7A (175881 downstream)																							ccttccctccttctttccttccct	0.127													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	22032522	22032522	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22032522delC								CDCA7L (46980 upstream) : RAPGEF5 (125387 downstream)																							aaagaaccctcccagactaag	0.114													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	23999716	23999716	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23999716delG								STK31 (55351 upstream) : NPY (324093 downstream)																							AAGTCAGCCTGGACTTTCTGT	0.333													4	2	---	---	---	---	
JAZF1	221895	broad.mit.edu	37	7	27944537	27944538	+	Intron	DEL	AG	-	-	rs35366304		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27944537_27944538delAG	uc003szn.2	-						JAZF1_uc003szm.2_Intron	NM_175061	NP_778231	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131						TACTGCATTAAGAGAGACGTTA	0.198			T	SUZ12	endometrial stromal tumours								3	3	---	---	---	---	
JAZF1	221895	broad.mit.edu	37	7	28052209	28052209	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28052209delG	uc003szn.2	-							NM_175061	NP_778231	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131						AAGACAGATAGGAGGGAAGAG	0.493			T	SUZ12	endometrial stromal tumours								4	2	---	---	---	---	
STARD3NL	83930	broad.mit.edu	37	7	38232695	38232695	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38232695delC	uc003tfr.2	+						STARD3NL_uc003tfs.2_Intron|STARD3NL_uc003tft.2_Intron	NM_032016	NP_114405	O95772	MENTO_HUMAN	MLN64 N-terminal homolog							integral to membrane|late endosome membrane				ovary(1)	1						GAAGAGTTGTCCTACAAAATT	0.363													4	2	---	---	---	---	
VPS41	27072	broad.mit.edu	37	7	38943115	38943115	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38943115delG	uc003tgy.2	-						VPS41_uc003tgz.2_Intron|VPS41_uc010kxn.2_Intron	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1						Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						CTGTGTTGCAGGAAAAAAAAG	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	39515851	39515854	+	IGR	DEL	TGAA	-	-	rs113385723		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39515851_39515854delTGAA								POU6F2 (11461 upstream) : C7orf36 (90155 downstream)																							atttgttgCCtgaatgaatgaatg	0.054													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	41576069	41576070	+	IGR	INS	-	T	T	rs138105012	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41576069_41576070insT								C7orf10 (675712 upstream) : INHBA (152533 downstream)																							TGTCAAAGGCGTAAGTGAGAAG	0.441													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	42929114	42929115	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42929114_42929115insA								GLI3 (652496 upstream) : C7orf25 (19759 downstream)																							ACAAGTCCAAGAAAAAAAAAAA	0.213													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	45442947	45442947	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45442947delA								RAMP3 (219100 upstream) : ADCY1 (170792 downstream)																							ggtgtgtgctaccacacctgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	49369581	49369581	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49369581delT								CDC14C (402532 upstream) : VWC2 (443676 downstream)																							ttttcttttcttttttttttt	0.000													4	2	---	---	---	---	
ZPBP	11055	broad.mit.edu	37	7	50080251	50080251	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50080251delA	uc003tou.2	-						ZPBP_uc011kci.1_Intron|ZPBP_uc010kyw.2_Intron	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein isoform 1						binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)					cagtcttcgcaacctgcagac	0.000													4	2	---	---	---	---	
DKFZp434L192	222029	broad.mit.edu	37	7	56562695	56562695	+	5'Flank	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56562695delC	uc011kde.1	+							NR_026929				Homo sapiens mRNA; cDNA DKFZp434L192 (from clone DKFZp434L192).												0						TCCCCTGGCACCCTCCATGCC	0.597													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57006860	57006860	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57006860delA								DKFZp434L192 (441883 upstream) : ZNF479 (180468 downstream)																							TTGGGTCAGGAAAAAAAAAAT	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57705406	57705407	+	IGR	INS	-	ATTCCG	ATTCCG	rs139928141	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57705406_57705407insATTCCG								ZNF716 (172141 upstream) : None (None downstream)																							ATCCTTGCCACGTCCCATCCTC	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65839332	65839333	+	IGR	DEL	CA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65839332_65839333delCA								TPST1 (13895 upstream) : NCRNA00174 (1699 downstream)																							TTcacacacgcacacacacaca	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67239129	67239130	+	IGR	DEL	TC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67239129_67239130delTC								STAG3L4 (452617 upstream) : None (None downstream)																							GCTCCTTCTTTCTACATGGTGC	0.406													4	2	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	70110929	70110929	+	Intron	DEL	T	-	-	rs11323206		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70110929delT	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GATGTGCGACTTTTTTTTCTT	0.413													5	3	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71247903	71247904	+	3'UTR	DEL	TT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71247903_71247904delTT	uc003twa.3	-	6					CALN1_uc003twb.3_3'UTR|CALN1_uc003twc.3_3'UTR	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				aatttttgtatttttttttttt	0.000													4	2	---	---	---	---	
RFC2	5982	broad.mit.edu	37	7	73328898	73328898	+	Intron	DEL	T	-	-	rs112817231		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73328898delT	uc011kfa.1	-							NM_181471		P35250	RFC2_HUMAN	replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2						acctggctaattttttttttt	0.000													3	5	---	---	---	---	
ELN	2006	broad.mit.edu	37	7	73464936	73464939	+	Intron	DEL	CATT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73464936_73464939delCATT	uc003tzw.2	+						RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_Intron|ELN_uc011kfe.1_Intron|ELN_uc003tzn.2_Intron|ELN_uc003tzz.2_Intron|ELN_uc003tzo.2_Intron|ELN_uc003tzp.2_Intron|ELN_uc003tzq.2_Intron|ELN_uc003tzr.2_Intron|ELN_uc003tzs.2_Intron|ELN_uc003tzt.2_Intron|ELN_uc003tzu.2_Intron|ELN_uc003tzv.2_Intron|ELN_uc003tzx.2_Intron|ELN_uc011kff.1_Intron|ELN_uc003tzy.2_Intron	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor						blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	ttcacccatgcattcattcattca	0.010			T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						4	2	---	---	---	---	
STYXL1	51657	broad.mit.edu	37	7	75635171	75635177	+	Intron	DEL	GAGGAGA	-	-	rs13246169		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75635171_75635177delGAGGAGA	uc003uej.3	-						STYXL1_uc003uef.2_5'Flank|STYXL1_uc011kgf.1_Intron|STYXL1_uc011kgg.1_Intron|STYXL1_uc003ueh.2_Intron|STYXL1_uc003uek.3_Intron|STYXL1_uc003uel.2_Intron|STYXL1_uc003uem.2_Intron|STYXL1_uc010ldg.1_Intron|STYXL1_uc010ldh.1_Intron|STYXL1_uc003uen.1_Intron	NM_016086	NP_057170	Q9Y6J8	STYL1_HUMAN	map kinase phosphatase-like protein MK-STYX						intracellular signal transduction|protein dephosphorylation	intracellular	protein binding|protein tyrosine/serine/threonine phosphatase activity				0						gaagagagaggaggagagaggaggaag	0.130													4	3	---	---	---	---	
SRRM3	222183	broad.mit.edu	37	7	75886034	75886035	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75886034_75886035insT	uc010ldi.2	+							NM_001110199	NP_001103669			serine/arginine repetitive matrix 3												0						gcttctttttcttttttttttt	0.000													4	2	---	---	---	---	
AKAP9	10142	broad.mit.edu	37	7	91663314	91663314	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91663314delA	uc003ulg.2	+						AKAP9_uc003ule.2_Intron|AKAP9_uc003ulf.2_Intron|AKAP9_uc003uli.2_Intron	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2						G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			tactatgaagaaaaaaagcag	0.000			T	BRAF	papillary thyroid								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	93031971	93031974	+	IGR	DEL	CGCA	-	-	rs60959428		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93031971_93031974delCGCA								CCDC132 (43634 upstream) : CALCR (21825 downstream)																							cgcgcgcgcgcgcacgcacgtgca	0.034													3	4	---	---	---	---	
BAIAP2L1	55971	broad.mit.edu	37	7	97960147	97960148	+	Intron	DEL	CT	-	-	rs141771288		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97960147_97960148delCT	uc003upj.2	-							NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			gaggggtgccctctctgttaag	0.000													2	4	---	---	---	---	
PILRA	29992	broad.mit.edu	37	7	99989974	99989974	+	Intron	DEL	G	-	-	rs75014492		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99989974delG	uc003uuo.1	+						PILRA_uc011kjo.1_Intron|PILRA_uc003uup.1_Intron|PILRA_uc003uuq.1_Intron	NM_013439	NP_038467	Q9UKJ1	PILRA_HUMAN	paired immunoglobulin-like type 2 receptor alpha						interspecies interaction between organisms	extracellular region|integral to membrane|plasma membrane	protein binding|receptor activity			skin(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					gcatggggttggggctgcctg	0.060													4	2	---	---	---	---	
CUX1	1523	broad.mit.edu	37	7	101601651	101601653	+	Intron	DEL	GCA	-	-	rs10564479		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101601651_101601653delGCA	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						GCCTGAagctgcagcagcagcag	0.483													4	2	---	---	---	---	
RASA4	10156	broad.mit.edu	37	7	102274496	102274496	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102274496delA	uc011klb.1	-						UPK3BL_uc003uzy.2_Intron|RASA4_uc011kld.1_Intron	NM_006989	NP_008920	O43374	RASL2_HUMAN	RAS p21 protein activator 4 isoform 1						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytosol|intrinsic to internal side of plasma membrane	metal ion binding|Ras GTPase activator activity				0						ctaaaaaaggaaaaaaaaaaa	0.179													4	2	---	---	---	---	
SLC26A3	1811	broad.mit.edu	37	7	107418805	107418806	+	Intron	INS	-	T	T	rs3076032		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107418805_107418806insT	uc003ver.2	-						SLC26A3_uc003ves.2_Intron	NM_000111	NP_000102	P40879	S26A3_HUMAN	solute carrier family 26, member 3						excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4						TTTAAAAAGACTTTTTTTTTTT	0.337													8	4	---	---	---	---	
LAMB4	22798	broad.mit.edu	37	7	107765262	107765262	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107765262delT	uc010ljo.1	-						LAMB4_uc003vey.2_Intron	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor						cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						TCCCAGTCCCTGCACATGCAC	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	109134099	109134100	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109134099_109134100insA								C7orf66 (609462 upstream) : EIF3IP1 (465184 downstream)																							CAACACTAGTGGTAGTCAAGGT	0.223													4	2	---	---	---	---	
CADPS2	93664	broad.mit.edu	37	7	122265810	122265811	+	Intron	DEL	TC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122265810_122265811delTC	uc010lkp.2	-						CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						acgcaatcaatctctctctCTC	0.064													4	2	---	---	---	---	
POT1	25913	broad.mit.edu	37	7	124514787	124514788	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124514787_124514788insA	uc003vlm.2	-						POT1_uc011koe.1_Intron|POT1_uc003vlk.2_Intron|POT1_uc003vll.2_Intron|POT1_uc003vlo.2_Intron|POT1_uc003vln.2_Intron	NM_015450	NP_056265	Q9NUX5	POTE1_HUMAN	protection of telomeres 1 isoform 1						DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity			central_nervous_system(1)	1						agatctgcctcaaaaaaaaaaa	0.104													4	2	---	---	---	---	
TNPO3	23534	broad.mit.edu	37	7	128617654	128617654	+	Intron	DEL	T	-	-	rs138043942		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128617654delT	uc003vol.1	-						TNPO3_uc010llx.1_Intron|TNPO3_uc003vom.1_Intron|TNPO3_uc010lly.1_Intron|TNPO3_uc010llz.1_Intron	NM_012470	NP_036602	Q9Y5L0	TNPO3_HUMAN	transportin 3						splicing factor protein import into nucleus	cytoplasm|nucleus	protein binding|receptor activity			ovary(2)|skin(2)|lung(1)	5						ttcttttttcttttttttttt	0.209													4	3	---	---	---	---	
ZC3HC1	51530	broad.mit.edu	37	7	129675368	129675368	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129675368delT	uc003vpi.2	-						ZC3HC1_uc003vph.2_Intron|ZC3HC1_uc010lma.2_Intron	NM_016478	NP_057562	Q86WB0	NIPA_HUMAN	zinc finger, C3HC type 1						cell division|mitosis	nucleus	protein kinase binding|zinc ion binding				0	Melanoma(18;0.0435)					ATATCAGCACtttttttttta	0.124													4	2	---	---	---	---	
CPA4	51200	broad.mit.edu	37	7	129948691	129948691	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129948691delT	uc003vpr.2	+						CPA4_uc011kpd.1_Intron|CPA4_uc011kpe.1_Intron	NM_016352	NP_057436	Q9UI42	CBPA4_HUMAN	carboxypeptidase A4 preproprotein						histone acetylation|proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)	1	Melanoma(18;0.0435)					tagcccagccttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	134080395	134080396	+	IGR	DEL	GT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134080395_134080396delGT								SLC35B4 (78568 upstream) : AKR1B1 (46711 downstream)																							taatggtgtggtgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	135019249	135019249	+	IGR	DEL	G	-	-	rs67344360		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135019249delG								STRA8 (76007 upstream) : CNOT4 (27304 downstream)																							ttttttttttgttttgagaca	0.219													4	3	---	---	---	---	
ATP6V0A4	50617	broad.mit.edu	37	7	138457784	138457784	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138457784delC	uc003vuf.2	-						ATP6V0A4_uc003vug.2_Intron|ATP6V0A4_uc003vuh.2_Intron	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit						cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						CACACTTTTTCCCCCCAGGTC	0.507													4	2	---	---	---	---	
DENND2A	27147	broad.mit.edu	37	7	140311563	140311563	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140311563delC	uc010lnk.2	-						DENND2A_uc003vvw.2_Intron|DENND2A_uc003vvx.2_Intron	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A											ovary(3)|breast(1)	4	Melanoma(164;0.00956)					ccagagcgggcaaattcacag	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	149578672	149578673	+	RNA	INS	-	G	G	rs147389970	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149578672_149578673insG	uc003wgt.1	+	1		c.109_110insG								Homo sapiens cDNA clone IMAGE:40014135.																		GCTGGCTGGGCGGTGGGGCGGA	0.604													3	7	---	---	---	---	
ABCB8	11194	broad.mit.edu	37	7	150736377	150736377	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150736377delC	uc003wil.3	+						ABCB8_uc010lpw.1_Intron|ABCB8_uc010lpx.2_Intron|ABCB8_uc011kvd.1_Intron|ABCB8_uc003wim.3_Intron|ABCB8_uc003wik.3_Intron	NM_007188	NP_009119	Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B, member 8							ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCTGGTGCCTCCCCCGGCTGC	0.592													1	7	---	---	---	---	
CRYGN	155051	broad.mit.edu	37	7	151140603	151140603	+	5'Flank	DEL	A	-	-	rs149527582		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151140603delA	uc003wkg.2	-									Q8WXF5	CRGN_HUMAN	Homo sapiens gammaN-crystallin variant (CRYGN) mRNA, complete cds.												0			OV - Ovarian serous cystadenocarcinoma(82;0.00358)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		caacaaactgaaaaaaaaata	0.000													1	6	---	---	---	---	
GALNTL5	168391	broad.mit.edu	37	7	151686244	151686244	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151686244delT	uc003wkp.2	+						GALNTL5_uc003wkq.2_Intron|GALNTL5_uc003wkr.2_Intron|GALNTL5_uc003wks.2_Intron|GALNTL5_uc010lqf.2_Intron	NM_145292	NP_660335	Q7Z4T8	GLTL5_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		attttttctcttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	153219238	153219238	+	IGR	DEL	A	-	-	rs79558871		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153219238delA								ACTR3B (666775 upstream) : DPP6 (365181 downstream)																							acaaacaaacaaaaaaaaaGT	0.179													2	5	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	153710543	153710544	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153710543_153710544insT	uc003wli.2	+							NM_001039350	NP_001034439	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 3						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GGtttcttttcttttttttttt	0.257													4	2	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	153907921	153907922	+	Intron	INS	-	AA	AA	rs138211838	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153907921_153907922insAA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GTGCAAAAAGGAAAAAAAAAGA	0.307													4	3	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	154550084	154550084	+	Intron	DEL	T	-	-	rs72407677		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154550084delT	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GAAATACAGAttttttttttt	0.224													4	2	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	154570725	154570726	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154570725_154570726insA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			ccaccagcaccccaccatcacc	0.000													5	4	---	---	---	---	
RBM33	155435	broad.mit.edu	37	7	155534924	155534924	+	Intron	DEL	T	-	-	rs72456061		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155534924delT	uc010lqk.1	+						RBM33_uc011kvv.1_Intron	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33								nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		CACCTGGGTCTTTTTTTTTTT	0.308													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	157259834	157259834	+	IGR	DEL	C	-	-	rs66907508		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157259834delC								DNAJB6 (49702 upstream) : PTPRN2 (71917 downstream)																							CCCGTGGATTCCAGTTGCTTT	0.522													2	6	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158323235	158323235	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158323235delG	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		AGAGCAAGGCGGGGGGGGTTC	0.582													4	2	---	---	---	---	
WDR60	55112	broad.mit.edu	37	7	158721468	158721471	+	Intron	DEL	AGTC	-	-	rs143463800		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158721468_158721471delAGTC	uc003woe.3	+						WDR60_uc010lqv.2_Intron|WDR60_uc010lqw.2_Intron	NM_018051	NP_060521	Q8WVS4	WDR60_HUMAN	WD repeat domain 60											ovary(2)|breast(1)|central_nervous_system(1)	4	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		AGACCCACATAGTCAGTCTCAGCA	0.583													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	280454	280454	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:280454delA								ZNF596 (83122 upstream) : FBXO25 (76354 downstream)																							aaacaacaacaaaaaagataa	0.000													4	2	---	---	---	---	
MYOM2	9172	broad.mit.edu	37	8	2033648	2033649	+	Intron	DEL	CC	-	-	rs67333717		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2033648_2033649delCC	uc003wpx.3	+						MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2						muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CTCTGCGTGGCCCCCCACTGTT	0.594													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2243105	2243118	+	IGR	DEL	ATGGGGAACCCCCG	-	-	rs139575205		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2243105_2243118delATGGGGAACCCCCG								MYOM2 (149726 upstream) : CSMD1 (549758 downstream)																							GTGAGTGAGCATGGGGAACCCCCGATGTCTCTGG	0.421													4	2	---	---	---	---	
TNKS	8658	broad.mit.edu	37	8	9411035	9411038	+	5'Flank	DEL	TTTG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9411035_9411038delTTTG	uc003wss.2	+						TNKS_uc011kwv.1_5'Flank	NM_003747	NP_003738	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related						mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)		TTTtttgttttttgtttgtttgtt	0.196													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	11489532	11489533	+	IGR	INS	-	GTGA	GTGA			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11489532_11489533insGTGA								BLK (67425 upstream) : GATA4 (44935 downstream)																							CAATGTTACCtgtgtgtgtgtg	0.238													4	2	---	---	---	---	
FAM66D	100132923	broad.mit.edu	37	8	12415163	12415163	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12415163delA	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0						caacagagacaaaaaaaaatg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	17706728	17706728	+	IGR	DEL	T	-	-	rs111272980		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17706728delT								MTUS1 (48302 upstream) : FGL1 (15174 downstream)																							TAACTTGAGCttttttttttg	0.184													3	3	---	---	---	---	
PCM1	5108	broad.mit.edu	37	8	17871605	17871605	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17871605delA	uc003wyi.3	+						PCM1_uc011kyh.1_Intron|PCM1_uc003wyj.3_Intron|PCM1_uc011kyi.1_Intron|PCM1_uc011kyj.1_Intron|PCM1_uc003wyk.3_Intron|PCM1_uc011kyk.1_Intron	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1						centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		CTTTAAAGCTAAAAAAAAAAA	0.284			T	RET|JAK2	papillary thyroid|CML|MPD								3	3	---	---	---	---	
SCARA5	286133	broad.mit.edu	37	8	27807931	27807931	+	Intron	DEL	G	-	-	rs71536305		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27807931delG	uc003xgj.2	-						SCARA5_uc010luz.2_Intron|SCARA5_uc003xgk.2_Intron|SCARA5_uc003xgl.2_Intron	NM_173833	NP_776194	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5						cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity			central_nervous_system(1)|skin(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		GCCCGTGCTTGGGGGGCATCC	0.622													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	28521891	28521894	+	IGR	DEL	TTTG	-	-	rs71549683		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28521891_28521894delTTTG								FZD3 (99932 upstream) : EXTL3 (37259 downstream)																							TCTTTCCATCtttgtttgtttgtt	0.123													3	4	---	---	---	---	
NRG1	3084	broad.mit.edu	37	8	32618044	32618044	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32618044delT	uc003xiv.2	+						NRG1_uc011lbf.1_3'UTR|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc011lbg.1_Intron|NRG1_uc011lbh.1_Intron|NRG1_uc003xja.2_Intron	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CAGTTACCTGTTCTAGGAGTG	0.483													6	3	---	---	---	---	
RNF122	79845	broad.mit.edu	37	8	33406739	33406740	+	Intron	INS	-	A	A	rs71899502		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33406739_33406740insA	uc003xjo.1	-							NM_024787	NP_079063	Q9H9V4	RN122_HUMAN	ring finger protein 122							endoplasmic reticulum|Golgi apparatus|integral to membrane	zinc ion binding				0				KIRC - Kidney renal clear cell carcinoma(67;0.0966)|Kidney(114;0.116)		aactccaactcaaaaaaaaaag	0.238													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	35072119	35072119	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35072119delT								None (None upstream) : UNC5D (20856 downstream)																							ataaggcgtcttttttttttt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	36958299	36958300	+	IGR	DEL	AC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36958299_36958300delAC								KCNU1 (164658 upstream) : ZNF703 (595001 downstream)																							acacatacatacacacacacac	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	40861415	40861415	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40861415delC								ZMAT4 (106072 upstream) : SFRP1 (258064 downstream)																							TTGTGGCCAACCCAGATGTAG	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	41771522	41771523	+	IGR	INS	-	T	T	rs140975602	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41771522_41771523insT								ANK1 (17242 upstream) : MYST3 (15475 downstream)																							ttgatttcgcctttggccattg	0.000													4	3	---	---	---	---	
IKBKB	3551	broad.mit.edu	37	8	42142100	42142100	+	Intron	DEL	A	-	-	rs67644428		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42142100delA	uc003xow.1	+						IKBKB_uc003xov.2_Intron|IKBKB_uc010lxh.1_Intron|IKBKB_uc011lco.1_Intron|IKBKB_uc010lxj.1_Intron|IKBKB_uc003xox.1_Intron|IKBKB_uc011lcp.1_Intron|IKBKB_uc011lcq.1_Intron|IKBKB_uc010lxi.1_Intron|IKBKB_uc011lcr.1_Intron	NM_001556	NP_001547	O14920	IKKB_HUMAN	inhibitor of nuclear factor kappa B kinase beta						anti-apoptosis|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|membrane raft	ATP binding|identical protein binding|IkappaB kinase activity			breast(3)|ovary(2)|lung(1)|skin(1)	7	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Arsenic trioxide(DB01169)|Auranofin(DB00995)	actccgtctcaaaaaaaaaaa	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	43290133	43290133	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43290133delT								POTEA (71805 upstream) : None (None downstream)																							aaggcaacacttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	43367983	43367983	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43367983delA								POTEA (149655 upstream) : None (None downstream)																							CTTGGGAAGTAATTCTCAAAG	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	46923165	46923165	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:46923165delT								None (None upstream) : BEYLA (829343 downstream)																							gtgggccctgtgggtgagaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	47536164	47536164	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47536164delC								None (None upstream) : BEYLA (216344 downstream)																							TACCCTTTTTCAGGTCTCTGC	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	55452614	55452614	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55452614delT								SOX17 (79159 upstream) : RP1 (76013 downstream)																							tccatctgcctttttttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	55470289	55470290	+	IGR	INS	-	TGAGTGTGGGTGTG	TGAGTGTGGGTGTG	rs137981381	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55470289_55470290insTGAGTGTGGGTGTG								SOX17 (96834 upstream) : RP1 (58337 downstream)																							gtcccagtgcatgagtgtgggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	55738293	55738294	+	IGR	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55738293_55738294insT								RP1 (55762 upstream) : XKR4 (276723 downstream)																							ggatatgtttatttttctttag	0.030													4	2	---	---	---	---	
TMEM68	137695	broad.mit.edu	37	8	56661142	56661143	+	Intron	DEL	GA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56661142_56661143delGA	uc003xsg.1	-						TMEM68_uc003xsh.1_Intron	NM_152417	NP_689630	Q96MH6	TMM68_HUMAN	transmembrane protein 68							integral to membrane	acyltransferase activity			skin(1)	1			Epithelial(17;0.000361)|all cancers(17;0.00326)			ggaagggggggagagagagaga	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	58291436	58291436	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58291436delA								C8orf71 (94148 upstream) : FAM110B (615677 downstream)																							tttagataggaaaaaaaaaaa	0.005													4	4	---	---	---	---	
TOX	9760	broad.mit.edu	37	8	59888632	59888632	+	Intron	DEL	A	-	-	rs35969706		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59888632delA	uc003xtw.1	-							NM_014729	NP_055544	O94900	TOX_HUMAN	thymus high mobility group box protein TOX							nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				tccgtctaataaaaaaaaaaa	0.000													4	2	---	---	---	---	
DNAJC5B	85479	broad.mit.edu	37	8	66964201	66964201	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66964201delT	uc003xvs.1	+						DNAJC5B_uc003xvt.1_Intron	NM_033105	NP_149096	Q9UF47	DNJ5B_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5						protein folding	membrane	heat shock protein binding|unfolded protein binding				0		Lung NSC(129;0.114)|all_lung(136;0.188)	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)			ATTGCTGTCAttttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	67318444	67318445	+	IGR	DEL	AG	-	-	rs34785789		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67318444_67318445delAG								CRH (227746 upstream) : RRS1 (22818 downstream)																							CAATGGGAGAAGAGAGAGAGAG	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	69753623	69753624	+	IGR	DEL	GT	-	-	rs34634691		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69753623_69753624delGT								C8orf34 (22367 upstream) : SULF1 (625235 downstream)																							TCCCCTGCCCgtgtgtgtgtgt	0.391													4	2	---	---	---	---	
C8orf84	157869	broad.mit.edu	37	8	73997666	73997666	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73997666delA	uc003xzf.2	-							NM_153225	NP_694957	Q8IVN8	RPESP_HUMAN	RPE-spondin precursor						immune response	extracellular region	polysaccharide binding|scavenger receptor activity				0						gaATATGGTGAAAAAAAAAAA	0.244													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	74198452	74198452	+	IGR	DEL	T	-	-	rs11355251		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74198452delT								C8orf84 (192945 upstream) : RPL7 (4423 downstream)																							AGGAAGCACATATAGGGCAAA	0.473													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	74284582	74284582	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74284582delT								RDH10 (47068 upstream) : STAU2 (48024 downstream)																							tatgttttcatttttcactgg	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81138740	81138741	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81138740_81138741insA								TPD52 (54904 upstream) : ZBTB10 (259113 downstream)																							ccatctctaccaaaaaaaaaaa	0.188													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81273640	81273642	+	IGR	DEL	AAA	-	-	rs3061857		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81273640_81273642delAAA								TPD52 (189804 upstream) : ZBTB10 (124212 downstream)																							actctgtctcaaaaaaaaaaaaa	0.034													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	95311841	95311842	+	IGR	INS	-	GA	GA			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95311841_95311842insGA								GEM (37284 upstream) : RAD54B (72347 downstream)																							cggcgtgtccggagtttgttcc	0.000													4	2	---	---	---	---	
RAD54B	25788	broad.mit.edu	37	8	95472483	95472483	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95472483delG	uc003ygk.2	-						RAD54B_uc003ygl.1_Intron|RAD54B_uc003ygn.1_Intron	NM_012415	NP_036547	O95073	FSBP_HUMAN	RAD54 homolog B						double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			cagagtccttgagctcaggag	0.000								Direct_reversal_of_damage|Homologous_recombination					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	98550997	98550998	+	IGR	INS	-	G	G	rs146346551	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98550997_98550998insG								TSPYL5 (260821 upstream) : MTDH (105409 downstream)																							aggagttccttggggatggaca	0.104													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	98619987	98619988	+	IGR	INS	-	A	A	rs78617232		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98619987_98619988insA								TSPYL5 (329811 upstream) : MTDH (36419 downstream)																							tctcaattattaaaaaaaaaaa	0.040													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	102690554	102690554	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102690554delG								GRHL2 (8604 upstream) : NCALD (8217 downstream)																							ggtgacggaagaacctggaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	103654417	103654418	+	IGR	DEL	AC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103654417_103654418delAC								ODF1 (81172 upstream) : KLF10 (6587 downstream)																							CACCCCCCCGACACACACACAC	0.431													3	3	---	---	---	---	
DPYS	1807	broad.mit.edu	37	8	105479565	105479566	+	5'Flank	INS	-	CC	CC	rs143901757	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105479565_105479566insCC	uc003yly.3	-							NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase						protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CCTTGGTTGGGGGTGTGTTTGT	0.436													7	4	---	---	---	---	
ZFPM2	23414	broad.mit.edu	37	8	106598231	106598232	+	Intron	DEL	GT	-	-	rs111347329		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106598231_106598232delGT	uc003ymd.2	+							NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GGGGGAAGGGgtgtgtgtgtgt	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	123432551	123432552	+	IGR	DEL	CA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123432551_123432552delCA								HAS2AS (775618 upstream) : ZHX2 (361349 downstream)																							tgtgtgtgtgcatgtgtgtgtg	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	123686350	123686350	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123686350delT								None (None upstream) : ZHX2 (107551 downstream)																							GTCTTTCTTGTGACTTTCTTC	0.428											OREG0018951	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	124467662	124467663	+	IGR	DEL	TT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124467662_124467663delTT								WDYHV1 (13402 upstream) : FBXO32 (47696 downstream)																							TGCCCAGAAAtttttttttttt	0.243													4	2	---	---	---	---	
MTSS1	9788	broad.mit.edu	37	8	125631914	125631914	+	Intron	DEL	T	-	-	rs113074770		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125631914delT	uc003yrk.2	-						MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566	O43312	MTSS1_HUMAN	metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CTTTTCAGACTTTTTTTTTTA	0.289													3	4	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131331052	131331052	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131331052delA	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						TCTCAGAAATAAGACATTGTC	0.308													4	2	---	---	---	---	
KCNQ3	3786	broad.mit.edu	37	8	133410287	133410287	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133410287delA	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GTAGCAAGGGAAACCAGTGGT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	136815160	136815165	+	IGR	DEL	CCCTTC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136815160_136815165delCCCTTC								KHDRBS3 (155314 upstream) : None (None downstream)																							CTGCAcctttcccttccccttcccct	0.209													5	4	---	---	---	---	
DENND3	22898	broad.mit.edu	37	8	142166485	142166485	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142166485delG	uc003yvy.2	+						DENND3_uc010mep.2_Intron|DENND3_uc003yvz.1_5'Flank	NM_014957	NP_055772	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3											ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			caccgcacctggccATGAATA	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	142299088	142299088	+	IGR	DEL	A	-	-	rs33955089		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142299088delA								SLC45A4 (34863 upstream) : LOC731779 (51560 downstream)																							CGTGGGTGGGAAAAGAGGTCC	0.358													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	142934749	142934750	+	IGR	DEL	AC	-	-	rs146127423		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142934749_142934750delAC								MIR1302-7 (67075 upstream) : NCRNA00051 (344967 downstream)																							acacactcaaacacacacacat	0.015													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143086543	143086544	+	IGR	DEL	CA	-	-	rs34799507		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143086543_143086544delCA								MIR1302-7 (218869 upstream) : NCRNA00051 (193173 downstream)																							TGCGCGCGCGcacacacacaca	0.312													5	3	---	---	---	---	
PLEC	5339	broad.mit.edu	37	8	145003563	145003563	+	Intron	DEL	G	-	-	rs140068101		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145003563delG	uc003zaf.1	-						PLEC_uc003zab.1_Intron|PLEC_uc003zac.1_Intron|PLEC_uc003zad.2_Intron|PLEC_uc003zae.1_Intron|PLEC_uc003zag.1_Intron|PLEC_uc003zah.2_Intron|PLEC_uc003zaj.2_Intron	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1						cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						gggactggatggggggggacg	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	145709090	145709091	+	IGR	INS	-	T	T	rs11392862		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145709090_145709091insT								FOXH1 (7372 upstream) : PPP1R16A (6326 downstream)																							cgcccggtctcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	145988636	145988637	+	IGR	DEL	CA	-	-	rs142679993		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145988636_145988637delCA								ZNF251 (7666 upstream) : ZNF34 (9866 downstream)																							tcgtggagtgcacagtctgctg	0.050													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	102842	102842	+	RNA	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102842delG	uc003zfy.2	-	1		c.100delC								Homo sapiens chromosome 2 mRNA sequence.																		GTCAGCACGTGGCACTCAGCT	0.388													4	2	---	---	---	---	
KANK1	23189	broad.mit.edu	37	9	744223	744223	+	Intron	DEL	T	-	-	rs77625141		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:744223delT	uc003zgl.1	+						KANK1_uc003zgn.1_Intron|KANK1_uc003zgs.1_Intron|KANK1_uc010mgx.1_Intron|KANK1_uc010mgy.1_Intron|KANK1_uc003zgt.1_Intron	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TATCCCCATCTTCTGCTTCCC	0.289													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	5315409	5315409	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5315409delA								RLN2 (10829 upstream) : RLN1 (19560 downstream)																							aatgagaaggaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ADAMTSL1	92949	broad.mit.edu	37	9	18730594	18730594	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18730594delT	uc003zne.3	+							NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		TTTTATCTAGTTATCTTTATC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	23046638	23046639	+	IGR	INS	-	CAA	CAA	rs150464181	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23046638_23046639insCAA								DMRTA1 (594166 upstream) : ELAVL2 (643466 downstream)																							caaacagaaagcaacaacaaca	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	25740339	25740340	+	IGR	DEL	GT	-	-	rs72058764		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25740339_25740340delGT								TUSC1 (61483 upstream) : None (None downstream)																							CTCCTAGATCgtgtgtgtgtgt	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	36185408	36185409	+	IGR	DEL	TA	-	-	rs144276662		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36185408_36185409delTA								CCIN (14079 upstream) : CLTA (5483 downstream)																							CATGCatgtgtatatatatgtg	0.015													4	2	---	---	---	---	
SHB	6461	broad.mit.edu	37	9	38053099	38053100	+	Intron	INS	-	CT	CT	rs148355606	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38053099_38053100insCT	uc004aax.2	-							NM_003028	NP_003019	Q15464	SHB_HUMAN	Src homology 2 domain containing adaptor protein						angiogenesis|apoptosis|cell differentiation|signal transduction	cytoplasm|plasma membrane	SH3/SH2 adaptor activity			central_nervous_system(2)|skin(1)	3		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)		AGAGCTGACCCGTCACTGTCCC	0.297													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66458837	66458838	+	5'Flank	INS	-	T	T	rs3068055		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66458837_66458838insT	uc010mng.1	-						uc004aeb.2_5'Flank|uc004aec.2_Intron					Homo sapiens cDNA, FLJ98602.																		agcagtgaggatttttttttac	0.000													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66458978	66458979	+	5'Flank	INS	-	T	T	rs112694853		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66458978_66458979insT	uc010mng.1	-						uc004aeb.2_5'Flank|uc004aec.2_Intron					Homo sapiens cDNA, FLJ98602.																		aaaagtcagtattctttttttt	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66473119	66473119	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66473119delT								FAM74A4 (978733 upstream) : LOC442421 (23351 downstream)																							caaaaaggaataaaaaataaa	0.000													4	2	---	---	---	---	
LOC442421	442421	broad.mit.edu	37	9	66494064	66494064	+	5'Flank	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66494064delC	uc004aed.1	+											Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0						GCAGCTGCTGCCTGCACACAG	0.672													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68439199	68439199	+	IGR	DEL	C	-	-	rs63623362		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68439199delC								FAM27B (645010 upstream) : MIR1299 (563040 downstream)																							TGTGAAGGTACAAAGTGATAT	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68475556	68475557	+	IGR	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68475556_68475557delTG								FAM27B (681367 upstream) : MIR1299 (526682 downstream)																							AATCCCCAATtgtcttagtcaa	0.173													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69798351	69798352	+	IGR	INS	-	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69798351_69798352insC								LOC100133920 (133402 upstream) : FOXD4L5 (377357 downstream)																							aagaatgaggacccagcgcggt	0.000													3	3	---	---	---	---	
FOXD4L3	286380	broad.mit.edu	37	9	70919875	70919876	+	3'UTR	DEL	AA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70919875_70919876delAA	uc004agm.1	+	1						NM_199135	NP_954586	Q6VB84	FX4L3_HUMAN	forkhead box D4-like 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		GGAACTTTTTAAAACCTACGTT	0.267													4	2	---	---	---	---	
FAM189A2	9413	broad.mit.edu	37	9	71955551	71955552	+	Intron	DEL	GC	-	-	rs59942020		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71955551_71955552delGC	uc010mon.1	+						FAM189A2_uc004ahg.2_Intron	NM_001127608	NP_001121080	Q15884	F1892_HUMAN	chromosome 9 open reading frame 61 precursor							integral to membrane					0						atgtgtgtgtgcgtgcatgtgt	0.074													2	4	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77485849	77485849	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77485849delA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajn.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						actccgtctcaaaaaaaaaga	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	78184304	78184306	+	IGR	DEL	AGA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78184304_78184306delAGA								OSTF1 (422191 upstream) : PCSK5 (321254 downstream)																							agaaacagctagaagctcagttg	0.172													4	2	---	---	---	---	
GNA14	9630	broad.mit.edu	37	9	80184500	80184500	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80184500delA	uc004aku.2	-							NM_004297	NP_004288	O95837	GNA14_HUMAN	G alpha 14						activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(2)	2						AGTGAGTTCCACCAACAGGGG	0.363													4	2	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94550824	94550825	+	Intron	DEL	AA	-	-	rs112992938		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94550824_94550825delAA	uc004arj.1	-						ROR2_uc004ari.1_Intron|ROR2_uc004ark.2_Intron	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						agtgttggggaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	96688879	96688880	+	IGR	INS	-	A	A	rs56019937		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96688879_96688880insA								PHF2 (247012 upstream) : BARX1 (25031 downstream)																							accctgtctggaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	101625768	101625769	+	IGR	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101625768_101625769delTG								GALNT12 (13410 upstream) : COL15A1 (80369 downstream)																							tgtgtgtgtctgtgtgtgtgtg	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110974953	110974953	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110974953delA								KLF4 (722906 upstream) : ACTL7B (641918 downstream)																							AGATGGGATTAAAAATTGGAA	0.408													4	2	---	---	---	---	
PRPF4	9128	broad.mit.edu	37	9	116049339	116049339	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116049339delA	uc004bgx.2	+						PRPF4_uc004bgy.2_Intron	NM_004697	NP_004688	O43172	PRP4_HUMAN	PRP4 pre-mRNA processing factor 4 homolog							Cajal body|nuclear speck|spliceosomal complex|U4/U6 snRNP	protein binding			ovary(2)|pancreas(1)	3						ttgaaagaacaaaaaaaaaaa	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	120529464	120529465	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120529464_120529465insA								TLR4 (49700 upstream) : None (None downstream)																							tagcaaatggcaaaaaaaatgg	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	121441397	121441398	+	IGR	INS	-	C	C	rs143502084	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121441397_121441398insC								TLR4 (961633 upstream) : DBC1 (487510 downstream)																							ggagagggagagggagagggag	0.114													4	2	---	---	---	---	
CEP110	11064	broad.mit.edu	37	9	123924715	123924715	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123924715delT	uc004bkx.1	+						CEP110_uc004blb.1_Intron|CEP110_uc010mvp.1_Intron	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa						cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						TCCTTCTAGCTTTTTTTTTTT	0.209													5	3	---	---	---	---	
DENND1A	57706	broad.mit.edu	37	9	126286768	126286768	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126286768delG	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						agtgagtggtggccaacacag	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	126804067	126804068	+	IGR	DEL	GT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126804067_126804068delGT								LHX2 (8625 upstream) : NEK6 (215818 downstream)																							gtgatcagcggtgtgtgtgtgt	0.059											OREG0019471	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	4	---	---	---	---	
SCAI	286205	broad.mit.edu	37	9	127786907	127786907	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127786907delA	uc004bpe.2	-						SCAI_uc004bpd.2_Intron|SCAI_uc010mwu.2_Intron	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2						negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						AGCCTTGTCCAACCTGCTAGG	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	131937343	131937343	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131937343delA								PPP2R4 (26120 upstream) : IER5L (488 downstream)																							AACTCAACTTaaaaaaaaaaa	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132106612	132106612	+	RNA	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132106612delA	uc004bxu.2	+	1		c.918delA								Homo sapiens cDNA clone IMAGE:6277875, partial cds.																		AGCGGCATTGAAAAAACCCTC	0.343													4	2	---	---	---	---	
C9orf78	51759	broad.mit.edu	37	9	132594369	132594370	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132594369_132594370insA	uc004byp.2	-						C9orf78_uc004byo.2_Intron|C9orf78_uc004byq.1_Intron	NM_016520	NP_057604	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78												0		Ovarian(14;0.00556)				TTACAGTTGGCAAAAAAAAAAA	0.342													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	134159346	134159347	+	IGR	INS	-	AAACACGA	AAACACGA	rs150591575	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134159346_134159347insAAACACGA								FAM78A (7440 upstream) : PPAPDC3 (5734 downstream)																							ctcaaaaaaacaaacaagaaaa	0.054													3	4	---	---	---	---	
C9orf98	158067	broad.mit.edu	37	9	135619805	135619805	+	Intron	DEL	A	-	-	rs35007270		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135619805delA	uc004cbu.1	-						C9orf98_uc010mzx.1_Intron|C9orf98_uc004cbv.1_Intron	NM_152572	NP_689785	Q96MA6	KAD8_HUMAN	putative adenylate kinase-like protein C9orf98							cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)		GACACGTGCCAAAAAAAAAAA	0.393													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	137190242	137190242	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137190242delT								RNU6ATAC (160556 upstream) : RXRA (18702 downstream)																							tttctttttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	137514189	137514189	+	IGR	DEL	T	-	-	rs35603257		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137514189delT								RXRA (181758 upstream) : COL5A1 (19463 downstream)																							CAGGTACTTCTTCCTACGCAA	0.303													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138088255	138088256	+	IGR	INS	-	CT	CT			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138088255_138088256insCT								OLFM1 (75224 upstream) : KIAA0649 (283392 downstream)																							tcccatttcccttcccatttcc	0.069													4	2	---	---	---	---	
CAMSAP1	157922	broad.mit.edu	37	9	138717615	138717615	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138717615delC	uc004cgr.3	-						CAMSAP1_uc004cgq.3_Intron|CAMSAP1_uc010nbg.2_Intron	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein							cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		CTGGGGAGATCACAGGGGACA	0.562													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138866149	138866150	+	IGR	INS	-	TGTT	TGTT	rs149131942	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138866149_138866150insTGTT								UBAC1 (12923 upstream) : NACC2 (37055 downstream)																							GGgtttgtttgtgtttgtttgt	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	139673486	139673495	+	IGR	DEL	CCTCCCCAGG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139673486_139673495delCCTCCCCAGG								LCN15 (14521 upstream) : TMEM141 (12282 downstream)																							aacactggctcctccccaggcctccagctc	0.000													4	2	---	---	---	---	
C9orf167	54863	broad.mit.edu	37	9	140339513	140339514	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140339513_140339514insA	uc011mew.1	+									Q9NXH8	CI167_HUMAN	Homo sapiens cDNA FLJ20385 fis, clone KAIA4085.						chaperone mediated protein folding requiring cofactor	integral to membrane	ATP binding|nucleoside-triphosphatase activity			pancreas(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.137)	OV - Ovarian serous cystadenocarcinoma(145;9.07e-05)|Epithelial(140;0.000728)		gagactctaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140549668	140549668	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140549668delT	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		catttcaccatttttcggcca	0.000													4	2	---	---	---	---	
GTPBP4	23560	broad.mit.edu	37	10	1061586	1061592	+	Intron	DEL	CTGAGCA	-	-	rs72135483		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1061586_1061592delCTGAGCA	uc001ift.2	+						GTPBP4_uc001ifu.2_Intron|GTPBP4_uc010qad.1_Intron|GTPBP4_uc010qae.1_Intron	NM_012341	NP_036473	Q9BZE4	NOG1_HUMAN	G protein-binding protein CRFG						negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of DNA replication|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		gtcctgagcgctgagcactgagcctgg	0.101													6	3	---	---	---	---	
ADARB2	105	broad.mit.edu	37	10	1601409	1601409	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1601409delG	uc009xhq.2	-							NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		ctgcttttatggaaatacaca	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3098979	3098979	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3098979delT								None (None upstream) : PFKP (10773 downstream)																							actctccctctTtgtgtgtgt	0.189													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3769140	3769140	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3769140delT	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																		ttatggtttcttttttttttg	0.000													3	4	---	---	---	---	
FBXO18	84893	broad.mit.edu	37	10	5950569	5950570	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5950569_5950570insT	uc001iis.2	+						FBXO18_uc001iir.2_Intron|FBXO18_uc009xig.2_Intron|FBXO18_uc001iit.2_Intron	NM_178150	NP_835363	Q8NFZ0	FBX18_HUMAN	F-box only protein, helicase, 18 isoform 2						DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(2)|skin(1)	3						ttttttctttcttttttttttt	0.173													4	2	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7358846	7358847	+	Intron	DEL	AC	-	-	rs147186024		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7358846_7358847delAC	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron|SFMBT2_uc001ijo.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						Ccacacataaacacacacacac	0.322													4	2	---	---	---	---	
TAF3	83860	broad.mit.edu	37	10	7899381	7899381	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7899381delG	uc010qbd.1	+							NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140						maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1						AAAGTTCTCTGGAGCTGGAGG	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8405668	8405668	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8405668delA								GATA3 (288506 upstream) : None (None downstream)																							agctaggcccaaaaggatggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	10336109	10336110	+	IGR	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10336109_10336110delTG								None (None upstream) : SFTA1P (490292 downstream)																							taggtgcatatgtgtgtgtgtg	0.045													4	2	---	---	---	---	
SEC61A2	55176	broad.mit.edu	37	10	12187048	12187048	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12187048delA	uc001ile.2	+						SEC61A2_uc010qbq.1_Intron|SEC61A2_uc001ilf.3_Intron|SEC61A2_uc001ilh.3_Intron|SEC61A2_uc001ilg.3_Intron	NM_018144	NP_060614	Q9H9S3	S61A2_HUMAN	Sec61 alpha form 2 isoform a							endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1		Renal(717;0.228)				accctgtctcaaaaaaaaaag	0.000													4	2	---	---	---	---	
CAMK1D	57118	broad.mit.edu	37	10	12546108	12546109	+	Intron	DEL	GT	-	-	rs11257838	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12546108_12546109delGT	uc001ilo.2	+						CAMK1D_uc001iln.2_Intron	NM_153498	NP_705718	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)		AATAAGATGGgtgtgtgtgtgt	0.262													5	5	---	---	---	---	
FRMD4A	55691	broad.mit.edu	37	10	13906578	13906578	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13906578delT	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						tctttctttcttttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	16585216	16585216	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16585216delC								C1QL3 (21212 upstream) : RSU1 (47403 downstream)																							GGGAAGAGTGCTTTGTTTGAG	0.493													4	2	---	---	---	---	
SLC39A12	221074	broad.mit.edu	37	10	18285188	18285188	+	Intron	DEL	T	-	-	rs67526209		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18285188delT	uc001ipo.2	+						SLC39A12_uc001ipn.2_Intron|SLC39A12_uc001ipp.2_Intron|SLC39A12_uc010qck.1_Intron	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						TTTTCTATGATTTTTTTCTTC	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	20956774	20956775	+	IGR	DEL	TG	-	-	rs142768750		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20956774_20956775delTG								PLXDC2 (387659 upstream) : NEBL (112130 downstream)																							AGGAGCCAGCtgtgtgtgtgtg	0.248													3	3	---	---	---	---	
ARMC3	219681	broad.mit.edu	37	10	23293366	23293366	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23293366delA	uc001irm.3	+						ARMC3_uc010qcv.1_Intron|ARMC3_uc010qcw.1_Intron	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3								binding				0						aaggaaaaggaaaaaaaaaat	0.000													4	2	---	---	---	---	
PRTFDC1	56952	broad.mit.edu	37	10	25158147	25158147	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25158147delT	uc001ise.1	-						PRTFDC1_uc010qdd.1_Intron|PRTFDC1_uc001isf.1_Intron|PRTFDC1_uc009xkm.1_Intron	NM_020200	NP_064585	Q9NRG1	PRDC1_HUMAN	phosphoribosyl transferase domain containing 1						adenine salvage|central nervous system neuron development|cerebral cortex neuron differentiation|cytolysis|dendrite morphogenesis|GMP salvage|grooming behavior|hypoxanthine metabolic process|IMP salvage|lymphocyte proliferation|positive regulation of dopamine metabolic process|purine ribonucleoside salvage|response to amphetamine|striatum development	cytosol	hypoxanthine phosphoribosyltransferase activity|magnesium ion binding|nucleotide binding|protein homodimerization activity			ovary(1)	1						GGCCTTTATCTTTTTTTTTTT	0.313													4	2	---	---	---	---	
YME1L1	10730	broad.mit.edu	37	10	27421036	27421036	+	Intron	DEL	T	-	-	rs113682414		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27421036delT	uc001iti.2	-						YME1L1_uc001itj.2_Intron|YME1L1_uc010qdl.1_Intron|YME1L1_uc009xkv.2_Intron	NM_139312	NP_647473	Q96TA2	YMEL1_HUMAN	YME1-like 1 isoform 1						protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity			ovary(1)	1						tctgGAtttctttttttttct	0.005													2	5	---	---	---	---	
ACBD5	91452	broad.mit.edu	37	10	27507518	27507518	+	Intron	DEL	T	-	-	rs67947235		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27507518delT	uc010qdp.1	-						ACBD5_uc010qdm.1_Intron|ACBD5_uc010qdn.1_Intron|ACBD5_uc010qdo.1_Intron|ACBD5_uc001ito.2_Intron|ACBD5_uc001itp.2_Intron|ACBD5_uc001itq.2_Intron|ACBD5_uc001itr.1_Intron	NM_145698	NP_663736	Q5T8D3	ACBD5_HUMAN	acyl-Coenzyme A binding domain containing 5						transport	integral to membrane|peroxisomal membrane	fatty-acyl-CoA binding				0						AGTTACACAGttttttttttt	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	28660089	28660089	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28660089delT								MPP7 (68094 upstream) : WAC (161338 downstream)																							tgtacctgccttttctgactt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	32392748	32392749	+	IGR	INS	-	A	A	rs147636236	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32392748_32392749insA								KIF5B (47377 upstream) : EPC1 (165110 downstream)																							aaaaaacaagcaacaatgtgga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34107748	34107749	+	IGR	INS	-	ATTGCT	ATTGCT			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34107748_34107749insATTGCT								NRP1 (483742 upstream) : PARD3 (292349 downstream)																							agatgttgaggcaagaggattg	0.094													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34266775	34266776	+	IGR	INS	-	T	T	rs112406615		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34266775_34266776insT								NRP1 (642769 upstream) : PARD3 (133322 downstream)																							AAACATGTAAGTTTTTTTTTTT	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	36189536	36189537	+	IGR	DEL	GT	-	-	rs72228039		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36189536_36189537delGT								FZD8 (259174 upstream) : None (None downstream)																							CTCCAAAGACgtgtgtgtgtgt	0.421													5	3	---	---	---	---	
LOC84856	84856	broad.mit.edu	37	10	42990170	42990170	+	RNA	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42990170delG	uc001izy.2	+	5		c.1691delG			LOC84856_uc009xmf.2_RNA|LOC84856_uc001izz.1_RNA	NR_026827				Homo sapiens cDNA FLJ33470 fis, clone BRAMY2002044.												0						taccacgtttggttTCAAATG	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	46989395	46989411	+	IGR	DEL	AACAGGGGGACTACAGA	-	-	rs72031633		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46989395_46989411delAACAGGGGGACTACAGA								SYT15 (18794 upstream) : GPRIN2 (4135 downstream)																							cagccttgggaacagggggactacagaaacatgccac	0.000													3	4	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47036053	47036054	+	Intron	INS	-	CA	CA	rs138001329		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47036053_47036054insCA	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						acatatatattcacacacacac	0.129													6	4	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47047087	47047088	+	Intron	INS	-	A	A	rs142033998		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47047087_47047088insA	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						cattggttgttaaaactcagcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52705911	52705911	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52705911delT								A1CF (60476 upstream) : PRKG1 (45034 downstream)																							GATAACAATCTTTTTTCTTTT	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	58971218	58971218	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58971218delA								ZWINT (850184 upstream) : IPMK (984400 downstream)																							ccagtaaaataaaaaacaagt	0.000													4	2	---	---	---	---	
JMJD1C	221037	broad.mit.edu	37	10	65210682	65210683	+	Intron	DEL	AA	-	-	rs140633678		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65210682_65210683delAA	uc001jmn.2	-						JMJD1C_uc001jmr.1_Intron	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a						blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					acacacacagaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CCAR1	55749	broad.mit.edu	37	10	70507478	70507479	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70507478_70507479insT	uc001joo.2	+						CCAR1_uc001jol.1_Intron|CCAR1_uc001jom.1_Intron|CCAR1_uc009xpx.1_Intron|CCAR1_uc001jon.1_Intron|CCAR1_uc010qiz.1_Intron|CCAR1_uc010qja.1_Intron|CCAR1_uc010qjb.1_Intron	NM_018237	NP_060707	Q8IX12	CCAR1_HUMAN	cell-cycle and apoptosis regulatory protein 1						apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding			ovary(6)|large_intestine(1)	7						ATGTGGAAGTATTTTTTTTTCT	0.282													3	4	---	---	---	---	
DNAJB12	54788	broad.mit.edu	37	10	74101482	74101482	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74101482delG	uc010qjv.1	-						DNAJB12_uc001jsz.2_Intron|DNAJB12_uc001jta.2_Intron	NM_017626	NP_060096	Q9NXW2	DJB12_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 12						protein folding	endoplasmic reticulum|integral to membrane	heat shock protein binding|unfolded protein binding				0						ctcccaccttggcctcccaaa	0.000													4	2	---	---	---	---	
ECD	11319	broad.mit.edu	37	10	74920042	74920042	+	Intron	DEL	A	-	-	rs113122458		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74920042delA	uc001jtn.2	-						ECD_uc009xqx.2_Intron|ECD_uc009xqy.2_Intron|ECD_uc001jto.2_Intron	NM_007265	NP_009196	O95905	SGT1_HUMAN	suppressor of S. cerevisiae gcr2 isoform 1						regulation of glycolysis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	transcription coactivator activity			pancreas(1)	1	Prostate(51;0.0119)					agactgtctcaaaaaaaaaaa	0.124													2	4	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	79385137	79385137	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79385137delA	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	agactctgccaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86341377	86341377	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86341377delA								FAM190B (63101 upstream) : None (None downstream)																							ccccagtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
BMPR1A	657	broad.mit.edu	37	10	88606477	88606478	+	Intron	DEL	AA	-	-	rs10887659	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88606477_88606478delAA	uc001kdy.2	+							NM_004329	NP_004320	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA						BMP signaling pathway|immune response|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	integral to membrane|plasma membrane	ATP binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta receptor activity			lung(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	8						ACACACACACAAAAAAAATTAA	0.272			Mis|N|F			gastrointestinal polyps			Hereditary_Mixed_Polyposis_syndrome_type_2|Juvenile_Polyposis				4	5	---	---	---	---	
AGAP11	119385	broad.mit.edu	37	10	88763594	88763594	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88763594delA	uc001kee.2	+						AGAP11_uc001kef.2_Intron	NM_133447	NP_597704	Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0						cccccccgccaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	91435030	91435030	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91435030delT								PANK1 (29815 upstream) : FLJ37201 (16027 downstream)																							TTGAATTGAAttttttttttg	0.025													4	2	---	---	---	---	
PI4K2A	55361	broad.mit.edu	37	10	99385098	99385098	+	Intron	DEL	T	-	-	rs77400570		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99385098delT	uc010qoy.1	+						MORN4_uc001kob.3_Intron|MORN4_uc001koc.3_Intron|MORN4_uc001kod.3_Intron|MORN4_uc001koe.2_Intron|MORN4_uc009xvv.1_Intron	NM_018425	NP_060895	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha						phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		taagtatctctaaatctcagt	0.070													4	2	---	---	---	---	
WNT8B	7479	broad.mit.edu	37	10	102222447	102222448	+	5'Flank	INS	-	TG	TG	rs141269816	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102222447_102222448insTG	uc001krb.2	+							NM_003393	NP_003384	Q93098	WNT8B_HUMAN	wingless-type MMTV integration site family,						anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|determination of dorsal identity|endoderm development|eye development|gastrulation|hypothalamus development|negative regulation of anterior neural cell fate commitment of the neural plate by Wnt receptor signaling pathway|otic placode formation|positive regulation of gene expression|response to estradiol stimulus|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			ovary(1)|breast(1)|large_intestine(1)|skin(1)	4		Colorectal(252;0.117)		Epithelial(162;1.87e-10)|all cancers(201;1.64e-08)		tgtgtgtgtgttgtgtgtgtgt	0.396													3	5	---	---	---	---	
SORCS3	22986	broad.mit.edu	37	10	106418630	106418631	+	Intron	INS	-	T	T	rs72148731		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106418630_106418631insT	uc001kyi.1	+							NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		ttttgtttttgttttttttttg	0.223													4	2	---	---	---	---	
SORCS1	114815	broad.mit.edu	37	10	108432894	108432895	+	Intron	INS	-	T	T	rs72369490		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108432894_108432895insT	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		gaagagggtacttttttttttt	0.005													5	6	---	---	---	---	
SORCS1	114815	broad.mit.edu	37	10	108791359	108791360	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108791359_108791360insT	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TTGTATCTCTCttttttttttt	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	115287190	115287190	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115287190delT								TCF7L2 (359756 upstream) : HABP2 (25588 downstream)																							TACGCAGCCCTGATGTTGTGT	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	115563900	115563901	+	IGR	INS	-	CT	CT	rs147881792	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115563900_115563901insCT								C10orf81 (20713 upstream) : DCLRE1A (30583 downstream)																							TGCAAGCTAAACTCTGTAAATT	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	122429249	122429250	+	IGR	INS	-	T	T	rs113177205		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122429249_122429250insT								PPAPDC1A (79882 upstream) : WDR11 (181445 downstream)																							GGTAATTTTGCTTTTTTTTTTT	0.277													3	3	---	---	---	---	
LHPP	64077	broad.mit.edu	37	10	126195632	126195633	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126195632_126195633insA	uc001lhs.1	+						LHPP_uc001lht.1_Intron|LHPP_uc009yai.1_Intron	NM_022126	NP_071409	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic						protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		TTCAGGTGTAGGGGTAGACAGG	0.579													3	5	---	---	---	---	
LHPP	64077	broad.mit.edu	37	10	126268006	126268006	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126268006delA	uc001lhs.1	+						LHPP_uc001lht.1_Intron|LHPP_uc009yai.1_Intron	NM_022126	NP_071409	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic						protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		GTTGGCCAGGAAGGAGGCCAG	0.303													4	2	---	---	---	---	
C10orf137	26098	broad.mit.edu	37	10	127432233	127432233	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127432233delG	uc001liq.1	+						C10orf137_uc001lin.2_Intron|C10orf137_uc001lio.1_Intron|C10orf137_uc001lip.1_Intron|C10orf137_uc001lis.1_Intron	NM_015608	NP_056423	Q3B7T1	EDRF1_HUMAN	erythroid differentiation-related factor 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding			ovary(5)|large_intestine(3)|lung(2)	10		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ATGGGAGACTGGGGAAATAAG	0.438													4	2	---	---	---	---	
ADAM12	8038	broad.mit.edu	37	10	127940096	127940107	+	Intron	DEL	GGATGGATAGAT	-	-	rs148035377	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127940096_127940107delGGATGGATAGAT	uc001ljk.2	-						ADAM12_uc010qul.1_Intron|ADAM12_uc001ljm.2_Intron|ADAM12_uc001ljn.2_Intron|ADAM12_uc001ljl.3_Intron	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1						cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		gggatggacaggatggatagatggatggatag	0.000													4	3	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128784591	128784592	+	Intron	INS	-	AA	AA	rs147558545	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128784591_128784592insAA	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		AATCGTGAGCCAGTCAGGGTTC	0.545													2	5	---	---	---	---	
PTPRE	5791	broad.mit.edu	37	10	129865464	129865465	+	Intron	DEL	AT	-	-	rs57935068		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129865464_129865465delAT	uc001lkb.2	+						PTPRE_uc009yat.2_Intron|PTPRE_uc010qup.1_Intron|PTPRE_uc009yau.2_Intron|PTPRE_uc001lkd.2_Intron|PTPRE_uc010quq.1_Intron	NM_006504	NP_006495	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E						negative regulation of insulin receptor signaling pathway|protein phosphorylation	cytoplasm|integral to membrane|intermediate filament cytoskeleton|nucleus|plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(1)	1		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)				gtgcacacacatacacccacac	0.050													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130079803	130079804	+	Intron	DEL	CT	-	-	rs144484520		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130079803_130079804delCT	uc001lkg.1	+											Homo sapiens cDNA FLJ42232 fis, clone THYMU3000224.																		cagacacacactctcacacagg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130406853	130406853	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130406853delT								MKI67 (482385 upstream) : MGMT (858601 downstream)																							CTCCGCCCCATTGGGTCCCAA	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130964270	130964270	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130964270delA								None (None upstream) : MGMT (301184 downstream)																							ggagggagggaaggaaggaag	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134876774	134876775	+	IGR	DEL	AC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134876774_134876775delAC								C10orf93 (120710 upstream) : GPR123 (7658 downstream)																							AGCTGGGCGAACACACACACAC	0.589													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135461246	135461247	+	IGR	INS	-	G	G	rs140694261		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135461246_135461247insG								FRG2B (20947 upstream) : LOC653544 (29032 downstream)																							atttattgcaaaaaaaaagaat	0.000													9	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135468451	135468452	+	IGR	INS	-	C	C	rs147271835		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135468451_135468452insC								FRG2B (28152 upstream) : LOC653544 (21827 downstream)																							TAGTAACTAAACCAATCCATTC	0.441													5	3	---	---	---	---	
SCGB1C1	147199	broad.mit.edu	37	11	191892	191898	+	5'Flank	DEL	ACCCCTA	-	-	rs61495142		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:191892_191898delACCCCTA	uc001loa.1	+							NM_145651	NP_663626	Q8TD33	SG1C1_HUMAN	secretoglobin, family 1C, member 1 precursor							extracellular region	binding			skin(1)	1		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		cctaacccctacccctaacccctaacc	0.019													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	783508	783508	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:783508delT								PDDC1 (6021 upstream) : CEND1 (3602 downstream)																							TGGGCATCCCTGAGAATTTGT	0.328											OREG0020663	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
MUC5B	727897	broad.mit.edu	37	11	1238817	1238818	+	Intron	INS	-	A	A	rs139870786	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1238817_1238818insA	uc009ycr.1	+							NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ggaccaaacttacggagagagt	0.000													4	7	---	---	---	---	
LOC338651	338651	broad.mit.edu	37	11	1604473	1604474	+	Intron	INS	-	TTTG	TTTG	rs144903071	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1604473_1604474insTTTG	uc009ycx.1	+						LOC338651_uc001ltt.1_Intron	NR_021489				SubName: Full=cDNA FLJ30579 fis, clone BRAWH2006989, weakly similar to DNA-DIRECTED RNA POLYMERASE II LARGEST SUBUNIT;          EC=2.7.7.6;												0						TTCTGGCtttttttgtttgttt	0.045													3	3	---	---	---	---	
INS-IGF2	723961	broad.mit.edu	37	11	2182532	2182532	+	5'Flank	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2182532delG	uc001lvm.2	-						INS-IGF2_uc001lvi.2_5'Flank|INS_uc001lvn.1_5'Flank|INS_uc001lvo.1_5'Flank|INS_uc009ydg.1_5'Flank	NM_001042376	NP_001035835	Q1WM24	Q1WM24_HUMAN	insulin- insulin-like growth factor 2						glucose metabolic process	extracellular region	hormone activity				0		all_epithelial(84;0.00018)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.0832)|Lung(200;0.156)		GGCCTGGGGTGGGGGGGTCGG	0.647											OREG0003768	type=REGULATORY REGION|Gene=INS|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	2	---	---	---	---	
NUP98	4928	broad.mit.edu	37	11	3810731	3810731	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3810731delC	uc001lyh.2	-						NUP98_uc001lyi.2_Intron|NUP98_uc001lyj.1_Intron|NUP98_uc001lyk.1_Intron|NUP98_uc010qxv.1_Intron	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1						carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		TTACCTATTTCTTTTTTTTTT	0.154			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	9629889	9629889	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9629889delC								WEE1 (18578 upstream) : SWAP70 (55739 downstream)																							gatcctcccacctcagactcc	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11268622	11268623	+	IGR	INS	-	TC	TC			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11268622_11268623insTC								ZBED5 (389002 upstream) : GALNTL4 (23798 downstream)																							ctctccgtgtgtctctctcccc	0.025													4	2	---	---	---	---	
GALNTL4	374378	broad.mit.edu	37	11	11614075	11614075	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11614075delC	uc001mjo.2	-							NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)		CCTCACCTTACCCCCACACAC	0.498													4	2	---	---	---	---	
INSC	387755	broad.mit.edu	37	11	15229062	15229062	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15229062delG	uc001mly.2	+						INSC_uc001mlz.2_Intron|INSC_uc001mma.2_Intron|INSC_uc010rcs.1_Intron|INSC_uc001mmb.2_Intron|INSC_uc001mmc.2_Intron	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a						cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						CTCATTTCCTGGGGCAGCTTC	0.527													4	2	---	---	---	---	
ANO5	203859	broad.mit.edu	37	11	22213409	22213410	+	5'Flank	INS	-	T	T	rs142559519	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22213409_22213410insT	uc001mqi.2	+						ANO5_uc001mqj.2_5'Flank	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a							chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						ATTTTCTTTTCTTTTTTTTTTC	0.262													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45413462	45413462	+	IGR	DEL	C	-	-	rs72414426		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45413462delC								SYT13 (105578 upstream) : CHST1 (256965 downstream)																							CATTCTTAGTCCCCCGTTCAG	0.517													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	47451026	47451029	+	IGR	DEL	TTTG	-	-	rs112882397		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47451026_47451029delTTTG								PSMC3 (3002 upstream) : RAPSN (8286 downstream)																							Attctttgtttttgtttgtttgtt	0.240													3	4	---	---	---	---	
PTPRJ	5795	broad.mit.edu	37	11	48178550	48178550	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48178550delT	uc001ngp.3	+							NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J						contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						AAAGATAAGAttttttttttt	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48847327	48847327	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48847327delA								OR4A47 (336055 upstream) : FOLH1 (320861 downstream)																							cacagagttgaaactttcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	49897733	49897733	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49897733delT								LOC440040 (65766 upstream) : OR4C13 (76242 downstream)																							TAGTCATATCTTCCTGTATGG	0.333													17	11	---	---	---	---	
PGA5	5222	broad.mit.edu	37	11	61008190	61008196	+	5'Flank	DEL	AAGAAAG	-	-	rs10548966		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61008190_61008196delAAGAAAG	uc001nqz.2	+							NM_014224	NP_055039	P00790	PEPA_HUMAN	pepsinogen 5, group I precursor						digestion|proteolysis	extracellular region	aspartic-type endopeptidase activity			skin(1)	1						aaaagaaagaaagaaagaaagaaagag	0.116													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	61428752	61428752	+	IGR	DEL	C	-	-	rs144135492		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61428752delC								RPLP0P2 (21831 upstream) : DAGLA (19158 downstream)																							agtgcaatggcccatgcctat	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	61876400	61876401	+	IGR	INS	-	A	A	rs34975139		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61876400_61876401insA								FTH1 (141268 upstream) : INCENP (15044 downstream)																							aactccatctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	61940804	61940804	+	IGR	DEL	A	-	-	rs11315572		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61940804delA								INCENP (20169 upstream) : SCGB1D1 (16906 downstream)																							GAATTCTGTTAAAAAAAAAAA	0.383													3	3	---	---	---	---	
MARK2	2011	broad.mit.edu	37	11	63607677	63607679	+	Intron	DEL	CTT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63607677_63607679delCTT	uc001nxw.2	+						MARK2_uc001nxx.2_Intron|MARK2_uc001nxy.2_Intron|MARK2_uc001nxv.3_Intron	NM_001039469	NP_001034558	Q7KZI7	MARK2_HUMAN	MAP/microtubule affinity-regulating kinase 2						cell differentiation|establishment or maintenance of epithelial cell apical/basal polarity|intracellular protein kinase cascade|multicellular organismal development|response to oxidative stress	plasma membrane	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						ATCACTTTCCCTTCTTTGCTCCA	0.527													5	4	---	---	---	---	
NRXN2	9379	broad.mit.edu	37	11	64478764	64478764	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64478764delG	uc001oar.2	-						NRXN2_uc001oas.2_Intron	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor						cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						ACACACAACCGCTGAGTGGCC	0.632													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	66230881	66230882	+	IGR	INS	-	TCT	TCT	rs149326815	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66230881_66230882insTCT								MRPL11 (24571 upstream) : PELI3 (3454 downstream)																							ttgtttttttctcttcttaatt	0.064													2	4	---	---	---	---	
C11orf24	53838	broad.mit.edu	37	11	68032106	68032107	+	Intron	INS	-	CACCCACA	CACCCACA			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68032106_68032107insCACCCACA	uc001onr.3	-						C11orf24_uc001ons.2_Intron	NM_022338	NP_071733	Q96F05	CK024_HUMAN	hypothetical protein LOC53838 precursor							integral to membrane					0						atccatccacccactcatccat	0.000													4	2	---	---	---	---	
CPT1A	1374	broad.mit.edu	37	11	68575841	68575842	+	Intron	INS	-	T	T	rs34991663		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68575841_68575842insT	uc001oog.3	-						CPT1A_uc001oof.3_Intron|CPT1A_uc009ysj.2_Intron	NM_001876	NP_001867	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A liver isoform						carnitine shuttle|fatty acid beta-oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			skin(2)	2	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		L-Carnitine(DB00583)|Perhexiline(DB01074)	TGAAATTCAGCttttttttttt	0.139													6	3	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69986642	69986642	+	Intron	DEL	A	-	-	rs75827005		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69986642delA	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						tgtctcaaggaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	71038471	71038472	+	IGR	INS	-	T	T	rs138067592	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71038471_71038472insT								SHANK2 (102663 upstream) : DHCR7 (106987 downstream)																							GAACAGACAGGTTTGAATCCCT	0.599													6	4	---	---	---	---	
PDE2A	5138	broad.mit.edu	37	11	72335041	72335042	+	Intron	INS	-	T	T	rs113010435		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72335041_72335042insT	uc010rrc.1	-						PDE2A_uc001oso.2_Intron|PDE2A_uc010rra.1_Intron|PDE2A_uc001osn.2_Intron|PDE2A_uc010rrb.1_Intron|PDE2A_uc010rrd.1_Intron	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	caatctttttcttttttttttt	0.089													1	5	---	---	---	---	
WNT11	7481	broad.mit.edu	37	11	75923222	75923223	+	5'Flank	INS	-	G	G	rs146244495	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75923222_75923223insG	uc001oxf.1	-							NM_004626	NP_004617	O96014	WNT11_HUMAN	wingless-type MMTV integration site family,						adrenal gland development|anterior/posterior pattern formation|artery morphogenesis|axis specification|bone mineralization|cellular response to retinoic acid|cloacal septation|embryonic skeletal system development|endoderm development|lung-associated mesenchyme development|mesonephric duct development|negative regulation of apoptosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cartilage development|negative regulation of cell growth|negative regulation of cell migration|negative regulation of transcription, DNA-dependent|neuroendocrine cell differentiation|neuron differentiation|osteoblast differentiation|outflow tract morphogenesis|palate development|positive regulation of cell migration|positive regulation of protein kinase C signaling cascade|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor-beta2 production|protein localization at cell surface|protein phosphorylation|tight junction assembly|ureteric bud morphogenesis|ventricular septum morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|protein kinase activator activity|Ras GTPase activator activity|transcription regulatory region DNA binding			lung(1)|skin(1)	2						GGAAAGACAGTGGGCTTGGGGC	0.559													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	79213862	79213863	+	IGR	INS	-	GCT	GCT	rs148645808	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79213862_79213863insGCT								ODZ4 (62167 upstream) : None (None downstream)																							AGTGATGGGTGGCTGGTAGGAC	0.292													4	3	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	85334355	85334355	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85334355delT	uc001pak.2	-							NM_001142699	NP_001136171	Q15700	DLG2_HUMAN	chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				AATAGGACAAttttttttttt	0.144													4	3	---	---	---	---	
CCDC67	159989	broad.mit.edu	37	11	93064330	93064331	+	Intron	INS	-	CC	CC	rs139801069	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93064330_93064331insCC	uc001pdq.2	+						CCDC67_uc001pdo.1_Intron|CCDC67_uc001pdp.2_Intron	NM_181645	NP_857596	Q05D60	CCD67_HUMAN	coiled-coil domain containing 67											ovary(1)	1		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				CTCCGCTCTGTCTCTCTTAATT	0.416													4	3	---	---	---	---	
ARHGAP42	143872	broad.mit.edu	37	11	100770463	100770465	+	Intron	DEL	TTG	-	-	rs1237675		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100770463_100770465delTTG	uc001pge.2	+							NM_152432	NP_689645	A6NI28	RHG42_HUMAN	Rho-type GTPase-activating protein FLJ32810						filopodium assembly|signal transduction	intracellular	cytoskeletal adaptor activity|GTPase activator activity|SH3 domain binding				0						gtttttttttttgtttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	101487169	101487169	+	IGR	DEL	A	-	-	rs11301917		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101487169delA								TRPC6 (32510 upstream) : ANGPTL5 (274237 downstream)																							GCAAGGTCACAAAAAAGGGAT	0.373													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	103717088	103717089	+	IGR	INS	-	CTCTCTCC	CTCTCTCC			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103717088_103717089insCTCTCTCC								DYNC2H1 (366497 upstream) : PDGFD (60826 downstream)																							tccctccctctctctctttctt	0.005													3	3	---	---	---	---	
GRIA4	2893	broad.mit.edu	37	11	105481598	105481599	+	Intron	DEL	TT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105481598_105481599delTT	uc001pix.2	+						GRIA4_uc001piu.1_Intron|GRIA4_uc001piw.2_Intron|GRIA4_uc001piv.2_5'UTR|GRIA4_uc009yxk.1_5'UTR|GRIA4_uc001pit.2_Intron	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform						glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	ctttcttttctttttttttttt	0.337													5	5	---	---	---	---	
EXPH5	23086	broad.mit.edu	37	11	108443134	108443134	+	Intron	DEL	T	-	-	rs68049107		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108443134delT	uc001pkk.2	-							NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a						intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		tcactttctgttttcctagtt	0.224													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	108839872	108839872	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108839872delA								DDX10 (28226 upstream) : C11orf87 (453003 downstream)																							aaccttgagcaaattactcaa	0.065													4	2	---	---	---	---	
HTR3A	3359	broad.mit.edu	37	11	113843051	113843051	+	5'Flank	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113843051delT	uc010rxb.1	+						HTR3A_uc010rxa.1_5'Flank|HTR3A_uc009yyx.2_5'Flank	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A						digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	cgcctcctccttctctttctt	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115796468	115796469	+	IGR	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115796468_115796469delTG								CADM1 (421227 upstream) : BUD13 (822419 downstream)																							ATGTGTTGGATGTGTGTGTGTG	0.480													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115831766	115831767	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115831766_115831767insA								CADM1 (456525 upstream) : BUD13 (787121 downstream)																							AACAGAAAAAGAAAAAAAAAAC	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	116477075	116477075	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116477075delC								None (None upstream) : BUD13 (141813 downstream)																							CCCCTGGCTGCCCCAGTCTGT	0.507													4	2	---	---	---	---	
DSCAML1	57453	broad.mit.edu	37	11	117372281	117372281	+	Intron	DEL	G	-	-	rs7928478	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117372281delG	uc001prh.1	-							NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GAGGGCCTCTGGGATGGCTGG	0.637													4	2	---	---	---	---	
MLL	4297	broad.mit.edu	37	11	118324117	118324119	+	Intron	DEL	TTT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118324117_118324119delTTT	uc001pta.2	+						MLL_uc001ptb.2_Intron|MLL_uc001psz.1_Intron	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		ccttcttggatttttttttttaa	0.000			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								4	2	---	---	---	---	
POU2F3	25833	broad.mit.edu	37	11	120175048	120175049	+	Intron	INS	-	AAAAAAG	AAAAAAG	rs73006676		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120175048_120175049insAAAAAAG	uc001pxc.2	+						POU2F3_uc010rzk.1_Intron|POU2F3_uc010rzl.1_Intron|POU2F3_uc001pxe.1_5'Flank	NM_014352	NP_055167	Q9UKI9	PO2F3_HUMAN	POU transcription factor						negative regulation by host of viral transcription	cytoplasm	sequence-specific DNA binding			ovary(1)|skin(1)	2		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)		tcaaaaaaaaaaagaagaagaa	0.134													4	2	---	---	---	---	
TECTA	7007	broad.mit.edu	37	11	121048728	121048728	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121048728delA	uc010rzo.1	+							NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor						cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		gctgttttttaagcccgtcgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	121519792	121519792	+	IGR	DEL	T	-	-	rs138502378		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121519792delT								SORL1 (15321 upstream) : LOC399959 (440019 downstream)																							gtacaagtgcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	126027095	126027096	+	IGR	INS	-	T	T	rs113435555		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126027095_126027096insT								CDON (93908 upstream) : RPUSD4 (44894 downstream)																							CAtctttcatcttttttttttt	0.020													3	3	---	---	---	---	
FLI1	2313	broad.mit.edu	37	11	128560850	128560851	+	5'Flank	INS	-	AA	AA			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128560850_128560851insAA	uc010sbu.1	+						FLI1_uc010sbt.1_Intron|FLI1_uc010sbv.1_5'Flank|FLI1_uc009zci.2_5'Flank	NM_002017	NP_002008	Q01543	FLI1_HUMAN	Friend leukemia virus integration 1						hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/FLI1(2266)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		GGTAAGCCAGGAAAGAGGGTGT	0.520			T	EWSR1	Ewing sarcoma								4	2	---	---	---	---	
OPCML	4978	broad.mit.edu	37	11	133010658	133010659	+	Intron	INS	-	GAA	GAA	rs138549636	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133010658_133010659insGAA	uc001qgu.2	-							NM_001012393	NP_001012393	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		aagaagacgacgaagaagaaga	0.000													4	3	---	---	---	---	
IQSEC3	440073	broad.mit.edu	37	12	238771	238772	+	Intron	INS	-	A	A	rs139945848	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:238771_238772insA	uc001qhu.1	+						IQSEC3_uc001qht.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		AGCCCTTTAGGAATAGAGGGCC	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	4979932	4979932	+	IGR	DEL	T	-	-	rs75450073		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4979932delT								KCNA6 (19655 upstream) : KCNA1 (39141 downstream)																							ctgggaagtattttttttttc	0.000													4	2	---	---	---	---	
TNFRSF1A	7132	broad.mit.edu	37	12	6452814	6452820	+	5'Flank	DEL	CTGCTGA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6452814_6452820delCTGCTGA	uc001qnu.2	-						TNFRSF1A_uc010sey.1_5'Flank|TNFRSF1A_uc010sez.1_5'Flank|TNFRSF1A_uc009zek.2_5'Flank|TNFRSF1A_uc010sfa.1_5'Flank	NM_001065	NP_001056	P19438	TNR1A_HUMAN	tumor necrosis factor receptor 1 precursor						apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|inflammatory response|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of inflammatory response|positive regulation of transcription from RNA polymerase II promoter|prostaglandin metabolic process	extracellular region|integral to plasma membrane|membrane raft	tumor necrosis factor receptor activity			lung(2)|skin(1)	3						GGGCCTGCAGCTGCTGAGGCTGCTAGA	0.527													5	3	---	---	---	---	
COPS7A	50813	broad.mit.edu	37	12	6832858	6832858	+	5'Flank	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6832858delT	uc001qqj.2	+						COPS7A_uc009zex.2_5'Flank|COPS7A_uc001qqk.2_5'Flank|COPS7A_uc001qql.2_5'Flank|COPS7A_uc001qqh.2_5'Flank|COPS7A_uc001qqi.2_5'Flank|COPS7A_uc001qqm.2_5'Flank|COPS7A_uc001qqn.3_5'Flank|COPS7A_uc001qqo.2_5'Flank	NM_001164094	NP_001157566	Q9UBW8	CSN7A_HUMAN	COP9 complex subunit 7a						cullin deneddylation	cytoplasm|signalosome				ovary(1)	1						CCTCATCCCGTTTTTTTCCCT	0.463													3	4	---	---	---	---	
APOBEC1	339	broad.mit.edu	37	12	7802403	7802404	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7802403_7802404insT	uc001qtb.2	-						APOBEC1_uc001qtc.2_Intron|APOBEC1_uc010sgf.1_Intron	NM_001644	NP_001635	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme						cytidine to uridine editing|DNA demethylation|lipid metabolic process|mRNA modification|mRNA processing|negative regulation of methylation-dependent chromatin silencing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0						ACTAtttcttcttttttttttt	0.104													4	2	---	---	---	---	
PZP	5858	broad.mit.edu	37	12	9347996	9347997	+	Intron	DEL	TC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9347996_9347997delTC	uc001qvl.2	-						PZP_uc009zgl.2_Intron	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						ccctggcccttccctttcccct	0.114													4	2	---	---	---	---	
LRP6	4040	broad.mit.edu	37	12	12317063	12317063	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12317063delA	uc001rah.3	-						BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Intron	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein						cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				gacaccgtttaaaaaaaaaaa	0.179													5	3	---	---	---	---	
CASC1	55259	broad.mit.edu	37	12	25317360	25317360	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25317360delT	uc001rgl.2	-						CASC1_uc001rgk.2_Intron|CASC1_uc001rgm.3_Intron|CASC1_uc001rgj.2_Intron|CASC1_uc010sje.1_Intron|CASC1_uc010sjf.1_Intron|CASC1_uc010sjg.1_Intron|CASC1_uc010sjh.1_Intron	NM_001082973	NP_001076442	Q6TDU7	CASC1_HUMAN	cancer susceptibility candidate 1 isoform b											ovary(2)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)			ctccattcccttcttctccct	0.000													3	4	---	---	---	---	
TMTC1	83857	broad.mit.edu	37	12	29803947	29803947	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29803947delG	uc001rjb.2	-						TMTC1_uc001rja.2_Intron|TMTC1_uc001rjc.1_Intron	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat							integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					catccagtgtgtttgattttc	0.119													4	2	---	---	---	---	
AMN1	196394	broad.mit.edu	37	12	31850997	31850998	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31850997_31850998insT	uc001rkq.3	-						AMN1_uc001rko.3_Intron|AMN1_uc010skc.1_Intron|AMN1_uc001rkp.3_Intron|AMN1_uc009zjs.2_Intron|AMN1_uc009zjt.1_Intron	NM_001113402	NP_001106873	Q8IY45	AMN1_HUMAN	antagonist of mitotic exit network 1 homolog												0	all_cancers(9;7.41e-12)|all_epithelial(9;1.18e-11)|all_lung(12;1.14e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.162)		OV - Ovarian serous cystadenocarcinoma(6;0.0014)			agtgttagcccttttcaaagta	0.059													4	2	---	---	---	---	
BICD1	636	broad.mit.edu	37	12	32380596	32380596	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32380596delT	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			GGACTGTGGATTGGGGTAGCC	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	32804517	32804520	+	IGR	DEL	ACAC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32804517_32804520delACAC								FGD4 (5535 upstream) : DNM1L (27617 downstream)																							ttataaacagacacacacacacac	0.029													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	33065083	33065084	+	IGR	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33065083_33065084insT								PKP2 (15303 upstream) : SYT10 (463264 downstream)																							ttgttgtcctgttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34322873	34322873	+	IGR	DEL	G	-	-	rs78094311		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34322873delG								ALG10 (141639 upstream) : None (None downstream)																							acagtcatttgttggactggg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34470228	34470228	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34470228delC								ALG10 (288994 upstream) : None (None downstream)																							tatgccaggacccccgggccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	37991301	37991301	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:37991301delT								None (None upstream) : ALG10B (719256 downstream)																							tatcttcacataaaaactaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	38484846	38484846	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38484846delC								None (None upstream) : ALG10B (225711 downstream)																							tggcatcatgctacccgactt	0.104													4	2	---	---	---	---	
PPHLN1	51535	broad.mit.edu	37	12	42635164	42635165	+	Intron	INS	-	A	A	rs149816234	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42635164_42635165insA	uc001rmy.2	+							NM_201439	NP_958847	Q8NEY8	PPHLN_HUMAN	periphilin 1 isoform 3						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		GTGTTTCTCTTAAAAAAAAATC	0.436													4	2	---	---	---	---	
PRICKLE1	144165	broad.mit.edu	37	12	42866030	42866030	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42866030delA	uc010skv.1	-						PRICKLE1_uc001rnl.2_Intron|PRICKLE1_uc010skw.1_Intron|PRICKLE1_uc001rnm.2_Intron|PRICKLE1_uc009zka.2_Intron	NM_001144881	NP_001138353	Q96MT3	PRIC1_HUMAN	prickle homolog 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein import into nucleus	cytosol|nuclear membrane	zinc ion binding			ovary(3)|skin(1)	4	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		TATGACCTTCAAAAGTAAAAC	0.368													4	2	---	---	---	---	
DHH	50846	broad.mit.edu	37	12	49484450	49484451	+	Intron	INS	-	TATG	TATG	rs35343506		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49484450_49484451insTATG	uc001rtf.2	-							NM_021044	NP_066382	O43323	DHH_HUMAN	desert hedgehog preproprotein						cell-cell signaling|proteolysis	extracellular space|plasma membrane	calcium ion binding|peptidase activity|zinc ion binding			lung(1)|breast(1)	2						cttctcttttctatgtatgtat	0.173													3	3	---	---	---	---	
KRT73	319101	broad.mit.edu	37	12	53005734	53005734	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53005734delC	uc001sas.2	-							NM_175068	NP_778238	Q86Y46	K2C73_HUMAN	keratin 73							keratin filament	structural molecule activity			large_intestine(2)|ovary(2)|skin(2)	6				BRCA - Breast invasive adenocarcinoma(357;0.189)		ccataggtctccccacactgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	53067684	53067686	+	IGR	DEL	TCA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53067684_53067686delTCA								KRT2 (21725 upstream) : KRT1 (834 downstream)																							CAATGTTACGtcatcatcatcat	0.148													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	54285959	54285966	+	IGR	DEL	AAACAAAC	-	-	rs137994110		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54285959_54285966delAAACAAAC								CALCOCO1 (164652 upstream) : HOXC13 (46610 downstream)																							TGTACATGAAaaacaaacaaacaaacaa	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	54564783	54564784	+	IGR	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54564783_54564784insT								LOC400043 (38164 upstream) : SMUG1 (8999 downstream)																							ttctttctttcttttttttttt	0.045													3	3	---	---	---	---	
MON2	23041	broad.mit.edu	37	12	62865426	62865426	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62865426delC	uc001sre.2	+						MON2_uc009zqj.2_Intron|MON2_uc010ssl.1_Intron|MON2_uc010ssm.1_Intron|MON2_uc010ssn.1_Intron|MON2_uc001srd.1_Intron	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog						Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		atgaaatgggccaggaagagt	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	82349872	82349872	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82349872delT								PPFIA2 (196763 upstream) : CCDC59 (396218 downstream)																							gtatgtagccttttcaggttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	92938115	92938115	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92938115delT								CLLU1 (60659 upstream) : C12orf74 (158725 downstream)																							TTAGGAGAGGTTTTTTTTTTA	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	97842303	97842303	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97842303delT								NEDD1 (494842 upstream) : RMST (16496 downstream)																							atttattacatttttttacac	0.080													3	3	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101702513	101702513	+	Intron	DEL	T	-	-	rs34029914		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101702513delT	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						GCTCTCTATGttttttttttt	0.080													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	105375500	105375500	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105375500delT								SLC41A2 (53028 upstream) : C12orf45 (4598 downstream)																							tatggcaccattttttttttg	0.000													4	2	---	---	---	---	
TRPV4	59341	broad.mit.edu	37	12	110236958	110236959	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110236958_110236959insT	uc001tpj.1	-						TRPV4_uc001tpg.1_Intron|TRPV4_uc001tph.1_Intron|TRPV4_uc001tpi.1_Intron|TRPV4_uc001tpk.1_Intron|TRPV4_uc001tpl.1_Intron	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,						actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						TGATGGAAttcttttttttttt	0.267													6	3	---	---	---	---	
ANKRD13A	88455	broad.mit.edu	37	12	110447276	110447276	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110447276delT	uc001tpx.2	+						ANKRD13A_uc009zvl.1_Intron|ANKRD13A_uc009zvm.1_Intron|ANKRD13A_uc010sxw.1_Intron	NM_033121	NP_149112	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13												0						gtcttctctcttttttccctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	120757797	120757797	+	IGR	DEL	T	-	-	rs71771935		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120757797delT								SIRT4 (6753 upstream) : PLA2G1B (2118 downstream)																							GGTGAAtttcttttttttttt	0.144													4	2	---	---	---	---	
TMEM120B	144404	broad.mit.edu	37	12	122174234	122174234	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122174234delT	uc001ubc.3	+						TMEM120B_uc009zxh.2_Intron	NM_001080825	NP_001074294	A0PK00	T120B_HUMAN	transmembrane protein 120B							integral to membrane					0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		ttgtttggtgttttttttttt	0.000													3	4	---	---	---	---	
KNTC1	9735	broad.mit.edu	37	12	123107166	123107166	+	Intron	DEL	A	-	-	rs75934693		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123107166delA	uc001ucv.2	+						KNTC1_uc010taf.1_Intron|GPR81_uc001ucw.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TAAGTTAATTAAAAAAAAAAA	0.209													4	2	---	---	---	---	
NCOR2	9612	broad.mit.edu	37	12	124924041	124924042	+	Intron	INS	-	GA	GA	rs115499437	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124924041_124924042insGA	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron|NCOR2_uc001ugk.1_Intron	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		AGAGAAAGAGGGAAACAGAGAC	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	129223469	129223469	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129223469delA								TMEM132C (31006 upstream) : SLC15A4 (54270 downstream)																							CACATAGAGCAAGGGTTGCAA	0.269													4	2	---	---	---	---	
RIMBP2	23504	broad.mit.edu	37	12	131166079	131166079	+	Intron	DEL	T	-	-	rs10708660		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131166079delT	uc001uim.2	-									O15034	RIMB2_HUMAN	RecName: Full=RIMS-binding protein 2;          Short=RIM-BP2;							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		tttttgtTGATTTTTTTTAAA	0.149													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131880290	131880292	+	IGR	DEL	TGG	-	-	rs143849573		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131880290_131880292delTGG								LOC116437 (182815 upstream) : SFRS8 (315343 downstream)																							gtgatggtgatggtgatgatggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131940751	131940752	+	IGR	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131940751_131940752delTG								LOC116437 (243276 upstream) : SFRS8 (254883 downstream)																							tgtgtgtatatgtgtgtgtgtg	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	23744760	23744763	+	IGR	DEL	TTAA	-	-	rs3842655		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23744760_23744763delTTAA								None (None upstream) : SGCG (10297 downstream)																							AGCCTCAACGTTAATTGTCTTGCC	0.471													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	25189271	25189271	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25189271delG								LOC374491 (17461 upstream) : ATP12A (65424 downstream)																							ATCAGCACACGGGAAGCTGCA	0.522													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31270778	31270780	+	IGR	DEL	AGG	-	-	rs149322606		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31270778_31270780delAGG								USPL1 (37092 upstream) : ALOX5AP (16835 downstream)																							GCCAATGTCAAGGAGAAGAAAAG	0.478													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	34914669	34914669	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34914669delT								RFC3 (373975 upstream) : NBEA (601787 downstream)																							agaaaacaggtttatttggct	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	40913675	40913675	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40913675delT								COG6 (547873 upstream) : LOC646982 (7598 downstream)																							gaaaattaACTAGCAAGTTCA	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	45279421	45279421	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45279421delA								TSC22D1 (128720 upstream) : NUFIP1 (233963 downstream)																							tttgggcaagaaaaaaaaaat	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	45504817	45504818	+	IGR	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45504817_45504818insT								TSC22D1 (354116 upstream) : NUFIP1 (8566 downstream)																							tcctattcttcttttttttttt	0.000													4	2	---	---	---	---	
RCBTB1	55213	broad.mit.edu	37	13	50157523	50157524	+	Intron	DEL	TG	-	-	rs35325157		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50157523_50157524delTG	uc001vde.1	-							NM_018191	NP_060661	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and						cell cycle|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(1)	1		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		CTTTtgtgtatgtgtgtgtgtg	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	73625838	73625838	+	IGR	DEL	T	-	-	rs67808849		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73625838delT								PIBF1 (35249 upstream) : KLF5 (3276 downstream)																							cttgtatttcttttttttttt	0.144													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	79178074	79178075	+	Intron	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79178074_79178075delTG	uc001vku.1	+						POU4F1_uc001vkv.2_5'Flank					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																		CGCCCCTCTAtgtgtgtgtgtg	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	82512790	82512791	+	IGR	INS	-	A	A	rs78106820		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82512790_82512791insA								None (None upstream) : None (None downstream)																							CTTGCCTTAAGAAAAAAAAAAA	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	95333566	95333569	+	IGR	DEL	GTGT	-	-	rs72063172		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95333566_95333569delGTGT								GPR180 (51622 upstream) : SOX21 (28313 downstream)																							tttgtttttggtgtgtgtgtgtgt	0.196													4	2	---	---	---	---	
CLDN10	9071	broad.mit.edu	37	13	96130403	96130404	+	Intron	INS	-	A	A	rs142155173	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96130403_96130404insA	uc001vmg.2	+						CLDN10_uc010tii.1_Intron	NM_182848	NP_878268	P78369	CLD10_HUMAN	claudin 10 isoform a						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			aactaaaatagaaaaaaaaaat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	104987647	104987648	+	IGR	INS	-	G	G	rs147579374	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104987647_104987648insG								None (None upstream) : None (None downstream)																							ttgggattatagcatgagccac	0.173													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	107036879	107036879	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107036879delT								DAOA (893497 upstream) : EFNB2 (105219 downstream)																							TCAGCCACCCTATGGGTCTAA	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19098294	19098294	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19098294delA								None (None upstream) : OR11H12 (279300 downstream)																							aagaacaagcaaaaaaaaagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19123481	19123482	+	IGR	INS	-	A	A	rs145083530		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19123481_19123482insA								None (None upstream) : OR11H12 (254112 downstream)																							gctcttgtttcaaaaaaaaaaa	0.124													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19893642	19893642	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19893642delA	uc001vvq.1	-						uc001vvr.1_Intron|uc010ahe.1_Intron|uc001vvs.1_Intron|uc001vvt.2_5'Flank					Homo sapiens cDNA FLJ12852 fis, clone NT2RP2003445.																		GCCCGCCACCACCCCCCCCCC	0.607													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20833436	20833436	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20833436delT								PARP2 (7374 upstream) : TEP1 (390 downstream)																							cttttttttcttttttttttt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22860339	22860340	+	Intron	INS	-	TC	TC	rs149355718	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22860339_22860340insTC	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TGGGGGAGCCACCGGAACCCCC	0.465											OREG0022577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
SLC7A7	9056	broad.mit.edu	37	14	23289192	23289192	+	5'Flank	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23289192delC	uc001wgu.3	-						SLC7A7_uc001wgv.3_5'Flank	NM_001126106	NP_001119578	Q9UM01	YLAT1_HUMAN	solute carrier family 7 member 7						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity			ovary(1)|breast(1)	2	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		CTCAGCCTCACCCCCCCCTTC	0.552													4	2	---	---	---	---	
HOMEZ	57594	broad.mit.edu	37	14	23753355	23753355	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23753355delT	uc001wja.2	-						HOMEZ_uc001wjb.2_Intron	NM_020834	NP_065885	Q8IX15	HOMEZ_HUMAN	homeodomain leucine zipper protein							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		ACATTCACACTTACACAATAA	0.274													4	2	---	---	---	---	
TM9SF1	10548	broad.mit.edu	37	14	24666654	24666654	+	5'Flank	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24666654delT	uc001wnb.1	-						TM9SF1_uc010toa.1_5'Flank|TM9SF1_uc001wna.1_5'Flank|TM9SF1_uc010tob.1_Intron|TM9SF1_uc001wnc.2_5'Flank	NM_006405	NP_006396	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1 isoform a						autophagy	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane|lysosomal membrane				ovary(1)	1				GBM - Glioblastoma multiforme(265;0.0183)		GTCATCAGCattttttttttt	0.134													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	25730402	25730403	+	IGR	DEL	AC	-	-	rs71449245		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25730402_25730403delAC								STXBP6 (211231 upstream) : None (None downstream)																							ccccatctcaacacacacacac	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	30709286	30709287	+	IGR	DEL	AG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30709286_30709287delAG								PRKD1 (312387 upstream) : G2E3 (319042 downstream)																							acatacacacagagagagagag	0.356													4	2	---	---	---	---	
SNX6	58533	broad.mit.edu	37	14	35083642	35083643	+	Intron	INS	-	A	A	rs77673238		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35083642_35083643insA	uc001wsf.1	-						SNX6_uc001wse.1_Intron|SNX6_uc010tpm.1_Intron|SNX6_uc010amm.1_Intron	NM_152233	NP_689419	Q9UNH7	SNX6_HUMAN	sorting nexin 6 isoform b						cell communication|intracellular protein transport|negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent|negative regulation of transforming growth factor beta receptor signaling pathway|retrograde transport, endosome to Golgi	cytoplasmic vesicle membrane|early endosome membrane|nucleus	phosphatidylinositol binding|protein homodimerization activity				0	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		gaccctgtctcaaaaaaaaaaa	0.178													4	3	---	---	---	---	
MDGA2	161357	broad.mit.edu	37	14	48145196	48145198	+	5'Flank	DEL	AGG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:48145196_48145198delAGG	uc001wwj.3	-							NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						aaagaggagaaggaggaggagga	0.557													6	3	---	---	---	---	
GPR135	64582	broad.mit.edu	37	14	59913472	59913473	+	Intron	INS	-	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59913472_59913473insC	uc001xed.2	-							NM_022571		Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135							integral to membrane|plasma membrane	G-protein coupled receptor activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.134)		cttctaaacctttaaaactccc	0.000													4	2	---	---	---	---	
PRKCH	5583	broad.mit.edu	37	14	61781106	61781106	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61781106delA	uc010tsa.1	+						uc001xfm.2_Intron	NM_006255	NP_006246	P24723	KPCL_HUMAN	protein kinase C, eta						intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		GTGAGATGTCAAAAAATAAAT	0.299													4	2	---	---	---	---	
NUMB	8650	broad.mit.edu	37	14	73881897	73881900	+	Intron	DEL	TGCT	-	-	rs142060834		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73881897_73881900delTGCT	uc001xny.1	-						NUMB_uc001xoa.1_Intron|NUMB_uc001xnz.1_Intron|NUMB_uc001xob.1_Intron|NUMB_uc001xod.1_Intron|NUMB_uc001xoc.1_Intron|NUMB_uc010ars.1_Intron|NUMB_uc001xof.1_Intron|NUMB_uc001xog.2_Intron|NUMB_uc001xoh.1_Intron	NM_001005743	NP_001005743	P49757	NUMB_HUMAN	numb homolog isoform 1						axon guidance|lateral ventricle development|neuroblast division in subventricular zone|positive regulation of neurogenesis	integral to plasma membrane				ovary(2)|central_nervous_system(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		CAGACTGTAGTGCTTGCTTCTCAT	0.338													3	4	---	---	---	---	
ACOT4	122970	broad.mit.edu	37	14	74061140	74061147	+	Intron	DEL	GGCTCAGC	-	-	rs111682390		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74061140_74061147delGGCTCAGC	uc001xoo.2	+							NM_152331	NP_689544	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4						acyl-CoA metabolic process|dicarboxylic acid metabolic process|long-chain fatty acid metabolic process|saturated monocarboxylic acid metabolic process|short-chain fatty acid metabolic process|succinyl-CoA metabolic process|unsaturated monocarboxylic acid metabolic process|very long-chain fatty acid metabolic process	peroxisome	carboxylesterase activity|palmitoyl-CoA hydrolase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00331)		TGGGATCTGTGGCTCAGCGGCTCAGCGG	0.442													4	2	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	78999075	78999077	+	Intron	DEL	TTC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78999075_78999077delTTC	uc001xun.2	+						NRXN3_uc001xum.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TATCTTCGCTTTCTTCTTCTTTT	0.355													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	86294020	86294029	+	IGR	DEL	TTTTTTTTTT	-	-	rs11625415		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86294020_86294029delTTTTTTTTTT								FLRT2 (199751 upstream) : None (None downstream)																							TTTGTTGTTGtttttttttttttttttttt	0.157													4	2	---	---	---	---	
ITPK1	3705	broad.mit.edu	37	14	93481087	93481089	+	Intron	DEL	GCT	-	-	rs75336150		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93481087_93481089delGCT	uc001ybg.2	-						ITPK1_uc001ybe.2_Intron|ITPK1_uc001ybf.2_Intron|ITPK1_uc001ybh.2_Intron	NM_014216	NP_055031	Q13572	ITPK1_HUMAN	inositol 1,3,4-triphosphate 5/6 kinase isoform						blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		TTGTCCTGCAGCTGCTTCTTCCT	0.571													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	93642114	93642114	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93642114delA								ITPK1 (59851 upstream) : MOAP1 (6429 downstream)																							acaaaaaaacaaaaaaaaaca	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95494077	95494077	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95494077delA								GSC (257578 upstream) : DICER1 (58488 downstream)																							CCCCTGGTACAGTAACAGGGC	0.507													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	96069499	96069508	+	IGR	DEL	TGTGTGTGTG	-	-	rs72320165		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96069499_96069508delTGTGTGTGTG								GLRX5 (58444 upstream) : TCL6 (47327 downstream)																							tgtgtgtgtatgtgtgtgtgtgtgtgtgtg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	96380486	96380486	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96380486delA	uc001yfe.2	+											Homo sapiens cDNA FLJ12965 fis, clone NT2RP2005741.																		CTGGAAACCTAGTCAAAAACT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99497521	99497522	+	IGR	INS	-	AC	AC	rs144397357	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99497521_99497522insAC								C14orf177 (313424 upstream) : BCL11B (138105 downstream)																							cacatgcacagacacacacaca	0.282													5	4	---	---	---	---	
WDR25	79446	broad.mit.edu	37	14	100944452	100944453	+	Intron	INS	-	AAAC	AAAC	rs141134731	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100944452_100944453insAAAC	uc010avx.2	+						WDR25_uc001yhm.2_Intron|WDR25_uc001yhn.2_Intron|WDR25_uc010avy.2_Intron|WDR25_uc001yho.2_Intron	NM_001161476	NP_001154948	Q64LD2	WDR25_HUMAN	WD repeat domain 25												0		Melanoma(154;0.212)				aaacaaaacaaaaacaaacaaa	0.109													3	3	---	---	---	---	
CDC42BPB	9578	broad.mit.edu	37	14	103425181	103425181	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103425181delT	uc001ymi.1	-						CDC42BPB_uc001ymj.1_Intron	NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta						actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		TAGTGTGGGAttttttttttt	0.224													4	2	---	---	---	---	
KIAA0284	283638	broad.mit.edu	37	14	105344203	105344203	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105344203delG	uc010axb.2	+						INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Intron|KIAA0284_uc001yps.2_5'Flank	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1							cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)		CCCCCCCCCCGCCACCTGTTT	0.672													6	3	---	---	---	---	
BRF1	2972	broad.mit.edu	37	14	105710843	105710844	+	Intron	INS	-	GGA	GGA	rs146094520	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105710843_105710844insGGA	uc001yqp.2	-						BRF1_uc010tyo.1_Intron|BRF1_uc010typ.1_Intron|BRF1_uc001yql.2_Intron|BRF1_uc001yqo.2_Intron|BRF1_uc010axg.1_Intron|BRF1_uc001yqn.2_Intron|BRF1_uc010axh.1_Intron|BRF1_uc010axj.1_Intron	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1						positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		GTGACTAGGGTGGAGGAGGAAG	0.386													6	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106782097	106782100	+	Intron	DEL	AATA	-	-	rs34137573		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106782097_106782100delAATA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						ccaaataatgaataaacaaattac	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20419255	20419256	+	IGR	INS	-	T	T	rs148196428	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20419255_20419256insT								None (None upstream) : GOLGA6L6 (317838 downstream)																							GAGATGCATTATTTTTCTTTTT	0.351													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20515617	20515618	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20515617_20515618insA								None (None upstream) : GOLGA6L6 (221476 downstream)																							gagatgaaatgatgagatgaaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20545294	20545295	+	IGR	DEL	AG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20545294_20545295delAG								None (None upstream) : GOLGA6L6 (191799 downstream)																							tttttgagacagagtcttgctc	0.020													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22490714	22490715	+	IGR	DEL	TC	-	-	rs28582454	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22490714_22490715delTC								OR4N3P (76329 upstream) : MIR1268 (22514 downstream)																							TCCTGGTGAGTCACACAACGAG	0.495													13	6	---	---	---	---	
MIR1268	100302233	broad.mit.edu	37	15	22513592	22513593	+	5'Flank	INS	-	T	T	rs140352542		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22513592_22513593insT	hsa-mir-1268|MI0006405	-																							0						gcccagctaaattttttttttt	0.015													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22542979	22542979	+	IGR	DEL	T	-	-	rs77180746		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22542979delT								MIR1268 (29699 upstream) : GOLGA8DP (159306 downstream)																							ctgttccccctggaggctcta	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22771818	22771818	+	IGR	DEL	C	-	-	rs79456162		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22771818delC								GOLGA6L1 (25816 upstream) : TUBGCP5 (61577 downstream)																							ACCTCTCCAGCCTCCTCACCC	0.488													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	25800733	25800734	+	IGR	INS	-	G	G	rs147502968	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25800733_25800734insG								UBE3A (116605 upstream) : ATP10A (123128 downstream)																							tgctaggctctgttgaccctgg	0.119													0	7	---	---	---	---	
GABRG3	2567	broad.mit.edu	37	15	27339144	27339144	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27339144delC	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		AGTCCTCCTGCCATTGTTCTG	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	27925227	27925227	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27925227delA								GABRG3 (147093 upstream) : OCA2 (74798 downstream)																							CCCGCTCATCAAAGACCAAAA	0.498													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	32508736	32508736	+	Intron	DEL	A	-	-	rs141891898		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32508736delA	uc001zfv.1	-											Homo sapiens cDNA FLJ43588 fis, clone SKNSH2009991.																		TTGCCAGTTTAAAAAAAAATT	0.388													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	39800658	39800659	+	IGR	INS	-	CA	CA	rs147152883	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39800658_39800659insCA								C15orf54 (253610 upstream) : THBS1 (72621 downstream)																							TCATTCTCTCTcacacacacac	0.322													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	40722929	40722930	+	IGR	INS	-	CTTT	CTTT	rs151243148	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40722929_40722930insCTTT								IVD (9417 upstream) : BAHD1 (8990 downstream)																							ACTGCCAGTGCACCCCACAGTG	0.312													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45523473	45523473	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45523473delA								SHF (30100 upstream) : SLC28A2 (20955 downstream)																							GCAAATAAAGAATGAAGATTC	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45983936	45983937	+	IGR	INS	-	TTC	TTC	rs143256853	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45983936_45983937insTTC								SQRDL (458 upstream) : None (None downstream)																							tgcgtctgaggttctatccagt	0.000													3	3	---	---	---	---	
TCF12	6938	broad.mit.edu	37	15	57414381	57414382	+	Intron	INS	-	T	T	rs34824462		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57414381_57414382insT	uc002aec.2	+						TCF12_uc010ugm.1_Intron|TCF12_uc010ugn.1_Intron|TCF12_uc002aea.2_Intron|TCF12_uc010bfs.2_Intron|TCF12_uc002aeb.2_Intron|TCF12_uc002aed.2_Intron	NM_207038	NP_996921	Q99081	HTF4_HUMAN	transcription factor 12 isoform b						immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(2)|lung(1)	8		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		GTCTTGCTTGATTTTTTTTTTT	0.351			T	TEC	extraskeletal myxoid chondrosarcoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	57865314	57865315	+	IGR	DEL	TG	-	-	rs35147581		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57865314_57865315delTG								CGNL1 (22394 upstream) : GCOM1 (18799 downstream)																							aaaaaaAGACTGTTTCTGTGCT	0.223													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	59987867	59987867	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59987867delT								BNIP2 (6225 upstream) : FOXB1 (308554 downstream)																							ggcgtggtggtgcgtgcctgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	62041789	62041789	+	IGR	DEL	A	-	-	rs11345108		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62041789delA								RORA (520287 upstream) : VPS13C (102803 downstream)																							TAACATTCAGAAAAAAAAATG	0.289													5	3	---	---	---	---	
IGDCC4	57722	broad.mit.edu	37	15	65693918	65693929	+	Intron	DEL	GGATGGGGACGG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65693918_65693929delGGATGGGGACGG	uc002aou.1	-							NM_020962	NP_066013	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member							integral to membrane|plasma membrane				ovary(1)|pancreas(1)|skin(1)	3						AGAAGGAACAGGATGGGGACGGGGTGGGAGTG	0.557											OREG0023196	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	5	---	---	---	---	
MEGF11	84465	broad.mit.edu	37	15	66446636	66446637	+	Intron	INS	-	CGCT	CGCT	rs143966792	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66446636_66446637insCGCT	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1						CCCCAACCTCGCGCTCGCCCAC	0.520													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	67155912	67155912	+	RNA	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67155912delA	uc002aqh.1	+	1		c.3272delA			uc002aqi.2_5'Flank					Homo sapiens mRNA; cDNA DKFZp686F0429 (from clone DKFZp686F0429).																		agatgtggctaaaatgccacc	0.025											OREG0023212	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
CORO2B	10391	broad.mit.edu	37	15	68914887	68914887	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68914887delG	uc002arj.3	+							NM_006091	NP_006082	Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B						actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding			ovary(3)|skin(2)|large_intestine(1)	6						cttcagcaatggggaactcac	0.100													4	2	---	---	---	---	
C15orf50	414926	broad.mit.edu	37	15	70125440	70125443	+	5'Flank	DEL	CACA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70125440_70125443delCACA	uc002asj.2	+							NR_026764				Homo sapiens chromosome 15 open reading frame 50, mRNA (cDNA clone IMAGE:4837541).												0						cgcacacgtgcacacacacacaca	0.000													3	3	---	---	---	---	
GRAMD2	196996	broad.mit.edu	37	15	72486481	72486481	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72486481delA	uc002atq.2	-						GRAMD2_uc010bis.2_Intron	NM_001012642	NP_001012660	Q8IUY3	GRAM2_HUMAN	GRAM domain containing 2							integral to membrane					0						CACAGTGGCCAAGGCCGACCT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	72676399	72676400	+	IGR	INS	-	T	T	rs113522246		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72676399_72676400insT								C15orf34 (5270 upstream) : TMEM202 (14268 downstream)																							ttctttctctcttttttttttt	0.243													4	2	---	---	---	---	
NPTN	27020	broad.mit.edu	37	15	73875639	73875639	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73875639delG	uc002avs.2	-						NPTN_uc010bjc.2_Intron|NPTN_uc002avt.2_Intron|NPTN_uc002avr.2_Intron|NPTN_uc010ula.1_Intron	NM_012428	NP_036560	Q9Y639	NPTN_HUMAN	neuroplastin isoform b precursor						elevation of cytosolic calcium ion concentration|homophilic cell adhesion|long-term synaptic potentiation|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of long-term neuronal synaptic plasticity|positive regulation of neuron projection development|positive regulation of protein phosphorylation	integral to membrane|plasma membrane|presynaptic membrane	cell adhesion molecule binding|type 1 fibroblast growth factor receptor binding				0						ATGCTCAACAGGGCACCatgg	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	76054081	76054081	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76054081delG								DNM1P35 (21579 upstream) : UBE2Q2 (81541 downstream)																							TGCACACCCTGGGGGAGGCAG	0.642													4	2	---	---	---	---	
TMED3	23423	broad.mit.edu	37	15	79662451	79662451	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79662451delG	uc010unj.1	+							NM_007364	NP_031390	Q9Y3Q3	TMED3_HUMAN	transmembrane emp24 domain containing 3						protein transport	ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane				ovary(1)|skin(1)	2						ttttttttttgagacagagtc	0.000													4	2	---	---	---	---	
ARNT2	9915	broad.mit.edu	37	15	80803863	80803863	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80803863delA	uc002bfr.2	+						ARNT2_uc010unm.1_Intron|ARNT2_uc002bfs.2_Intron	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	aryl hydrocarbon receptor nuclear translocator						central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)			cttaaaaactaaaaaaaaaaa	0.000													4	2	---	---	---	---	
HOMER2	9455	broad.mit.edu	37	15	83583896	83583896	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83583896delA	uc002bjg.2	-						HOMER2_uc002bjh.2_Intron|HOMER2_uc002bjj.2_Intron|HOMER2_uc002bji.2_Intron	NM_199330	NP_955362	Q9NSB8	HOME2_HUMAN	homer 2 isoform 2						metabotropic glutamate receptor signaling pathway	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane					0						tttttaattgaaaaaaaaaaa	0.025													3	4	---	---	---	---	
SEC11A	23478	broad.mit.edu	37	15	85226615	85226616	+	Intron	INS	-	AAAC	AAAC	rs145231030	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85226615_85226616insAAAC	uc002blb.1	-						SEC11A_uc002blc.1_Intron	NM_014300	NP_055115	P67812	SC11A_HUMAN	SEC11-like 1						energy reserve metabolic process|regulation of insulin secretion|signal peptide processing	endoplasmic reticulum membrane|integral to membrane|microsome	protein binding|serine-type peptidase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(143;0.199)			ATTTGCTGGCAaaacaaacaaa	0.312													4	3	---	---	---	---	
PDE8A	5151	broad.mit.edu	37	15	85637094	85637094	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85637094delT	uc002blh.2	+						PDE8A_uc002bli.2_Intron|PDE8A_uc010bnc.2_Intron|PDE8A_uc010bnd.2_Intron|PDE8A_uc002blj.2_Intron|PDE8A_uc002blk.2_Intron	NM_002605	NP_002596	O60658	PDE8A_HUMAN	phosphodiesterase 8A isoform 1						cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)			TTTAGAGATCttttttttttt	0.189													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	90298155	90298156	+	IGR	INS	-	C	C	rs148662551	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90298155_90298156insC								MESP1 (3615 upstream) : MESP2 (5666 downstream)																							TGGCCTCCAAGATCTCTGGAAT	0.460													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92932656	92932659	+	IGR	DEL	AAAC	-	-	rs146849568	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92932656_92932659delAAAC								SLCO3A1 (216991 upstream) : ST8SIA2 (4481 downstream)																							ACTCCCAGCaaaacaaacaaacaa	0.412													4	3	---	---	---	---	
FAM174B	400451	broad.mit.edu	37	15	93178152	93178153	+	Intron	INS	-	T	T	rs145675983	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93178152_93178153insT	uc010boe.2	-						FAM174B_uc002bsl.3_Intron	NM_207446	NP_997329	Q3ZCQ3	F174B_HUMAN	hypothetical protein LOC400451							integral to membrane					0						tgggacatcagtttttttcctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	94749251	94749251	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94749251delG								None (None upstream) : MCTP2 (25550 downstream)																							AAGAGAGTCTGAGGTGTGACC	0.244													4	2	---	---	---	---	
TELO2	9894	broad.mit.edu	37	16	1557813	1557814	+	Intron	DEL	GT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1557813_1557814delGT	uc002cly.2	+							NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog							chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)				tcggcccggggtgtgtgtgtgt	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	3002025	3002025	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3002025delG								FLYWCH1 (817 upstream) : KREMEN2 (12192 downstream)																							gtgtcggccaggatggtcttg	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5183725	5183725	+	IGR	DEL	T	-	-	rs71402596		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5183725delT								FAM86A (35936 upstream) : A2BP1 (885407 downstream)																							TGTTAGTTCGTTTTTTTTTCC	0.279													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5472235	5472247	+	Intron	DEL	AGGGAGGAGGAGC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5472235_5472247delAGGGAGGAGGAGC	uc002cyq.1	+											Homo sapiens cDNA clone IMAGE:5244947, **** WARNING: chimeric clone ****.																		ggagagggagagggaggaggagcagggagaggg	0.061													4	3	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	7267906	7267907	+	Intron	DEL	CA	-	-	rs151222592		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7267906_7267907delCA	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		tatgtgtgtgcatgtgtgtgtg	0.074													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	8698605	8698606	+	IGR	INS	-	GTGTGT	GTGTGT	rs149536452	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8698605_8698606insGTGTGT								TMEM114 (76379 upstream) : C16orf68 (16921 downstream)																							GCTTTGGAGAGgtgtgtgtgtg	0.317													3	3	---	---	---	---	
ZC3H7A	29066	broad.mit.edu	37	16	11873983	11873984	+	Intron	INS	-	T	T	rs71406291		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11873983_11873984insT	uc002dbk.2	-						ZC3H7A_uc002dbl.2_Intron|ZC3H7A_uc002dbm.1_Intron	NM_014153	NP_054872	Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A							nucleus	nucleic acid binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						tttttcttttcttttttttttt	0.114													2	4	---	---	---	---	
NPIP	9284	broad.mit.edu	37	16	15040379	15040379	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15040379delT	uc002dcy.3	+						NPIP_uc002dcx.3_Intron	NM_006985	NP_008916	Q9UND3	NPIP_HUMAN	nuclear pore complex interacting protein						mRNA transport|protein transport|transmembrane transport	nuclear membrane|nuclear pore					0						acacccagGCttttttttttt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	15058207	15058207	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15058207delA								NPIP (12277 upstream) : PDXDC1 (10392 downstream)																							ctccatctccaaaaaaaaaaa	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	17974002	17974002	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17974002delT								XYLT1 (409264 upstream) : NOMO2 (537181 downstream)																							Cctccttgtctctgtttgggc	0.174													4	2	---	---	---	---	
VWA3A	146177	broad.mit.edu	37	16	22111396	22111397	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22111396_22111397insA	uc010vbq.1	+						VWA3A_uc010bxc.2_Intron	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A							extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		aactccgtctcaaaaaaaaaaa	0.233													4	2	---	---	---	---	
TNRC6A	27327	broad.mit.edu	37	16	24741818	24741818	+	Intron	DEL	A	-	-	rs115981479		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24741818delA	uc002dmm.2	+							NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A						negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		TTCTTTCTTTAAAAAAAAAAA	0.408													4	2	---	---	---	---	
TNRC6A	27327	broad.mit.edu	37	16	24812020	24812020	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24812020delA	uc002dmm.2	+						TNRC6A_uc010bxs.2_Intron|TNRC6A_uc002dmn.2_Intron|TNRC6A_uc002dmo.2_Intron	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A						negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		gagtcctgggaaaaggcattc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	25696694	25696695	+	IGR	INS	-	TC	TC	rs147222617	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25696694_25696695insTC								ZKSCAN2 (427839 upstream) : HS3ST4 (6652 downstream)																							gcattctgtattctctctctct	0.000													4	2	---	---	---	---	
GSG1L	146395	broad.mit.edu	37	16	27933322	27933323	+	Intron	DEL	TT	-	-	rs150921998		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27933322_27933323delTT	uc002doz.2	-						GSG1L_uc010bya.1_Intron	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN	GSG1-like isoform 1							integral to membrane				ovary(1)	1						gtttgttgtctttttttttttt	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	31176570	31176571	+	IGR	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31176570_31176571delTG								PRSS36 (15155 upstream) : FUS (14882 downstream)																							tgtgtgtgtatgtgtgtgtgtg	0.302													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32320426	32320427	+	Intron	DEL	CG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32320426_32320427delCG	uc002edb.2	-											Homo sapiens similar to protein phosphatase 2A 48 kDa regulatory subunit isoform 1; serine/threonine protein phosphatase 2A, 48kDa regulatory subunit; PP2A, subunit B, PR48 isoform; PP2A B subunit PR48; NY-REN-8 antigen, mRNA (cDNA clone IMAGE:5272051).																		agacgaacctcgctatgtttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32818857	32818858	+	IGR	INS	-	ATT	ATT			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32818857_32818858insATT								TP53TG3B (129979 upstream) : SLC6A10P (69939 downstream)																							catttcatttcatttcatcatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32843772	32843773	+	IGR	INS	-	T	T	rs145188849	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32843772_32843773insT								TP53TG3B (154894 upstream) : SLC6A10P (45024 downstream)																							TCACACCTGTGTTTTTTTCCAC	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33040268	33040268	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33040268delG								SLC6A10P (143805 upstream) : MIR1826 (925240 downstream)																							GCAGTAAAAAGCCGCGGCGCC	0.637													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33574019	33574020	+	IGR	DEL	CT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33574019_33574020delCT								SLC6A10P (677556 upstream) : MIR1826 (391488 downstream)																							tggtccagccctctcatcttgt	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33939709	33939710	+	IGR	DEL	TC	-	-	rs148354161		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33939709_33939710delTC								None (None upstream) : MIR1826 (25798 downstream)																							GCCGTGATAGTCTCACACACGC	0.421													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33968149	33968153	+	IGR	DEL	TTTTC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33968149_33968153delTTTTC								MIR1826 (2557 upstream) : UBE2MP1 (435649 downstream)																							cctgaacctgttttcttttctacaa	0.176													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33978278	33978278	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33978278delG								MIR1826 (12686 upstream) : UBE2MP1 (425524 downstream)																							aacgctttgaggcctattgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33983914	33983914	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33983914delG								MIR1826 (18322 upstream) : UBE2MP1 (419888 downstream)																							acatcacaaagaagtttctca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33987177	33987179	+	IGR	DEL	CTT	-	-	rs113791407		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33987177_33987179delCTT								MIR1826 (21585 upstream) : UBE2MP1 (416623 downstream)																							tctcagaaagcttctgtctagtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46435678	46435680	+	IGR	DEL	ATC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46435678_46435680delATC								None (None upstream) : ANKRD26P1 (67569 downstream)																							atcaaatggaatcatcatcgaat	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	48026321	48026321	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48026321delT								PHKB (290888 upstream) : ABCC12 (90563 downstream)																							ATGTTTTCTCTTTTTTTTTTC	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	51841791	51841791	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51841791delT								SALL1 (656608 upstream) : TOX3 (630127 downstream)																							tttctctctcttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55338758	55338759	+	IGR	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55338758_55338759delTG								IRX5 (370365 upstream) : IRX6 (19712 downstream)																							GTTCTGAATTTGTGAGCTGTAA	0.342													4	2	---	---	---	---	
CES1	1066	broad.mit.edu	37	16	55851562	55851563	+	Intron	DEL	GT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55851562_55851563delGT	uc002eim.2	-						CES1_uc010ccf.2_5'Flank|CES1_uc002eil.2_Intron|CES1_uc002ein.2_Intron	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor						response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)	CTAGCCAGGAgtgtgtgtgtgt	0.252													4	2	---	---	---	---	
CCDC135	84229	broad.mit.edu	37	16	57729047	57729047	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57729047delA	uc002emi.2	+						CCDC135_uc002emj.2_Intron|CCDC135_uc002emk.2_Intron	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135							cytoplasm				central_nervous_system(1)	1						TGTAGGGAATAAAGTGCTGTG	0.557													4	2	---	---	---	---	
ZDHHC1	29800	broad.mit.edu	37	16	67436532	67436533	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67436532_67436533insT	uc010vjm.1	-							NM_013304	NP_037436	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1							integral to membrane	DNA binding|zinc ion binding				0		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		aaaacatggaattttttttttt	0.000													4	2	---	---	---	---	
TMCO7	79613	broad.mit.edu	37	16	69056606	69056607	+	Intron	INS	-	A	A	rs141293512	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69056606_69056607insA	uc002ewi.3	+							NM_024562	NP_078838	Q9C0B7	TMCO7_HUMAN	transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)		gaccctgtctcaaaaaaaaaat	0.104													4	2	---	---	---	---	
PDPR	55066	broad.mit.edu	37	16	70156811	70156812	+	Intron	INS	-	T	T	rs142153363	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70156811_70156812insT	uc002eyf.1	+						CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Intron	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory						glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		gcagtggatAGttttttttttg	0.005													6	3	---	---	---	---	
HYDIN	54768	broad.mit.edu	37	16	71036582	71036583	+	Intron	INS	-	T	T	rs11427002		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71036582_71036583insT	uc002ezr.2	-							NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a											ovary(1)|skin(1)	2		Ovarian(137;0.0654)				tttggaattaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	71574478	71574478	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71574478delA								CHST4 (2065 upstream) : TAT (26276 downstream)																							actctgtcttaaaaaaaaaaa	0.194													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	71625400	71625400	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71625400delG								TAT (14402 upstream) : MARVELD3 (34670 downstream)																							agaacgtgcagggatgtcaga	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	72643868	72643868	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72643868delG								PMFBP1 (437519 upstream) : ZFHX3 (172920 downstream)																							CAAAGTAATTGGAACTCACAA	0.343													4	2	---	---	---	---	
LOC283922	283922	broad.mit.edu	37	16	74378976	74378976	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74378976delT	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						ACCTCTTGAAttttttttttt	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	74405769	74405769	+	IGR	DEL	T	-	-	rs151124263		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74405769delT								LOC283922 (3616 upstream) : CLEC18B (36762 downstream)																							Cttctctctcttttttttttt	0.015													4	2	---	---	---	---	
WDR59	79726	broad.mit.edu	37	16	75015273	75015274	+	Intron	INS	-	A	A	rs144982026	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75015273_75015274insA	uc002fdh.1	-						WDR59_uc002fdi.2_Intron|WDR59_uc002fdj.2_Intron	NM_030581	NP_085058	Q6PJI9	WDR59_HUMAN	WD repeat domain 59											ovary(1)|breast(1)	2						gactctgtctcaaaaaaaaaac	0.000													5	3	---	---	---	---	
WWOX	51741	broad.mit.edu	37	16	78343942	78343943	+	Intron	INS	-	TCC	TCC	rs144899432	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78343942_78343943insTCC	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		TTATCTTCccttcctcctcctt	0.168													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	81133968	81133968	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81133968delT								GCSH (3988 upstream) : PKD1L2 (516 downstream)																							ctttcttttcttttttttttt	0.000													4	2	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81496752	81496753	+	Intron	DEL	CA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81496752_81496753delCA	uc002fgp.2	+							NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						ACTTCACCTTCAGCAATGGTAA	0.455													4	2	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81614551	81614552	+	Intron	INS	-	CAGCCGTCTGA	CAGCCGTCTGA	rs147806065	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81614551_81614552insCAGCCGTCTGA	uc002fgp.2	+						CMIP_uc002fgq.1_Intron	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						cccctctcttccagccccctga	0.000													3	3	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81712859	81712860	+	Intron	DEL	TG	-	-	rs71701140		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81712859_81712860delTG	uc002fgp.2	+						CMIP_uc002fgq.1_Intron|CMIP_uc010vnq.1_Intron|CMIP_uc002fgr.1_Intron	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						TCTGTAGGGAtgtgtgtgtgtg	0.480													4	2	---	---	---	---	
COTL1	23406	broad.mit.edu	37	16	84612282	84612283	+	Intron	DEL	CA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84612282_84612283delCA	uc002fid.2	-						COTL1_uc002fie.2_Intron|COTL1_uc010chk.2_Intron|COTL1_uc002fif.1_5'Flank	NM_021149	NP_066972	Q14019	COTL1_HUMAN	coactosin-like 1							cytoplasm|cytoskeleton	actin binding|enzyme binding			skin(1)	1						cacaagtgtgcacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	84982727	84982728	+	IGR	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84982727_84982728delTG								CRISPLD2 (39611 upstream) : ZDHHC7 (25339 downstream)																							tgtctgtgtctgtgtgtgtgtg	0.089													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85553350	85553352	+	IGR	DEL	CAG	-	-	rs113778878		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85553350_85553352delCAG								FAM92B (407236 upstream) : KIAA0182 (91677 downstream)																							tcaccaccatcagcatcaccatc	0.148													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87244403	87244404	+	Intron	DEL	AG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87244403_87244404delAG	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		agggaggtgcagagagagagag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87270383	87270383	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87270383delG	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		cacgtggccaggggcagtgca	0.214													4	2	---	---	---	---	
TUBB3	10381	broad.mit.edu	37	16	89996502	89996505	+	Intron	DEL	TTCC	-	-	rs113176575		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89996502_89996505delTTCC	uc002fph.1	+						TUBB3_uc002fpf.2_Intron|TUBB3_uc010ciz.1_Intron|TUBB3_uc010cja.1_Intron|TUBB3_uc002fpg.1_Intron|TUBB3_uc002fpi.1_Intron|TUBB3_uc002fpj.1_5'Flank|TUBB3_uc010cjb.1_5'Flank	NM_006086	NP_006077	Q13509	TBB3_HUMAN	tubulin, beta, 4						'de novo' posttranslational protein folding|axon guidance|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(2)|pancreas(1)	3		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		tcttccttcattccttccttcctt	0.044													5	3	---	---	---	---	
C17orf97	400566	broad.mit.edu	37	17	260081	260081	+	5'Flank	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:260081delG	uc002frh.2	+							NM_001013672	NP_001013694	Q6ZQX7	CQ097_HUMAN	hypothetical protein LOC400566											ovary(1)	1						CGCGGTCCGTGGGGCACCGGG	0.687													4	2	---	---	---	---	
SLC13A5	284111	broad.mit.edu	37	17	6606106	6606114	+	Intron	DEL	CAGGGGTGC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6606106_6606114delCAGGGGTGC	uc002gdj.2	-						SLC13A5_uc010vtf.1_Intron|SLC13A5_uc010clq.2_Intron|SLC13A5_uc002gdk.2_Intron|SLC13A5_uc002gdl.1_Intron	NM_177550	NP_808218	Q86YT5	S13A5_HUMAN	solute carrier family 13, member 5 isoform a							integral to membrane	citrate transmembrane transporter activity				0						TGTGTGGGCACAGGGGTGCCAGGACACAG	0.612													4	2	---	---	---	---	
MYH10	4628	broad.mit.edu	37	17	8511531	8511531	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8511531delA	uc002gll.2	-						MYH10_uc002glm.2_Intron|MYH10_uc010cnx.2_Intron	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle						actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						TGGATGAAATAAGCATTTCAG	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	8630706	8630706	+	IGR	DEL	T	-	-	rs35978875		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8630706delT								MYH10 (96670 upstream) : CCDC42 (2541 downstream)																							cgccctcccctggaacctcct	0.000													2	4	---	---	---	---	
PIK3R6	146850	broad.mit.edu	37	17	8742211	8742212	+	Intron	DEL	AC	-	-	rs150972032		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8742211_8742212delAC	uc002glq.1	-						PIK3R6_uc002glr.1_Intron|PIK3R6_uc002gls.1_Intron	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6						platelet activation	cytosol					0						GGCAGGTGGGACACACCAGTGG	0.594													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	9669678	9669681	+	IGR	DEL	CTCT	-	-	rs72084350		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9669678_9669681delCTCT								USP43 (36677 upstream) : DHRS7C (5075 downstream)																							tccttccttcctctctctctctct	0.108													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	13146358	13146358	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13146358delT								ELAC2 (224999 upstream) : HS3ST3A1 (252648 downstream)																							tccttccttctttgcttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	17260925	17260926	+	IGR	INS	-	TCTT	TCTT			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17260925_17260926insTCTT								NT5M (9950 upstream) : MED9 (119374 downstream)																							ccCACATAGACtctttctttct	0.020													7	4	---	---	---	---	
PEMT	10400	broad.mit.edu	37	17	17494346	17494346	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17494346delA	uc002grl.2	-						PEMT_uc010vwx.1_Intron	NM_148172	NP_680477	Q9UBM1	PEMT_HUMAN	phosphatidylethanolamine N-methyltransferase						cell proliferation|phosphatidylcholine biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrial membrane	phosphatidylethanolamine N-methyltransferase activity				0				Colorectal(2;0.0157)|READ - Rectum adenocarcinoma(2;0.0891)		GCCTCTGGGCAAAAGCTGGCC	0.647													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	19310367	19310372	+	IGR	DEL	TGTGTG	-	-	rs36209397		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19310367_19310372delTGTGTG								MFAP4 (19864 upstream) : RNF112 (4151 downstream)																							cctgactaattgtgtgtgtgtgtgtg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	19629339	19629340	+	IGR	INS	-	TT	TT	rs113435154		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19629339_19629340insTT								SLC47A2 (7047 upstream) : ALDH3A1 (11960 downstream)																							taagatggtaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	19639469	19639470	+	IGR	INS	-	A	A	rs139066699	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19639469_19639470insA								SLC47A2 (17177 upstream) : ALDH3A1 (1830 downstream)																							attgagactccagttcacagtt	0.010													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20648273	20648274	+	IGR	DEL	TT	-	-	rs36007188		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20648273_20648274delTT								LGALS9B (277425 upstream) : CCDC144NL (118436 downstream)																							AACACTAGACTTTTTTTTTTTT	0.317													5	3	---	---	---	---	
CCDC144NL	339184	broad.mit.edu	37	17	20768966	20768967	+	Intron	INS	-	CT	CT			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20768966_20768967insCT	uc002gyf.2	-						uc002gyg.1_5'Flank|uc002gyh.1_5'Flank	NM_001004306	NP_001004306	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family,												0						TGCTACCAATATTTTGTGATGC	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21225034	21225035	+	IGR	INS	-	AG	AG	rs77521218		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21225034_21225035insAG								MAP2K3 (6485 upstream) : KCNJ12 (54664 downstream)																							TGGTTCCCCACAGTCTGAGGTC	0.505													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21231002	21231003	+	IGR	INS	-	T	T	rs4021739		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21231002_21231003insT								MAP2K3 (12453 upstream) : KCNJ12 (48696 downstream)																							cactgggctaattttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21250019	21250028	+	IGR	DEL	CCTTAGGCCC	-	-	rs67030450		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21250019_21250028delCCTTAGGCCC								MAP2K3 (31470 upstream) : KCNJ12 (29671 downstream)																							tgggatttaaccttaggccccctcccccca	0.324													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21524370	21524371	+	IGR	INS	-	T	T	rs138882004	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21524370_21524371insT								C17orf51 (46639 upstream) : FAM27L (300999 downstream)																							attttgtgtacttgtacaaaca	0.114													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21551333	21551333	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21551333delT								C17orf51 (73602 upstream) : FAM27L (274037 downstream)																							TCCGAGGCAGTTTTATGGCAA	0.587													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	22255563	22255564	+	IGR	INS	-	A	A	rs150837195		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22255563_22255564insA								FLJ36000 (342493 upstream) : None (None downstream)																							cgcacagaactaaacagaagca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25293258	25293258	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25293258delA								None (None upstream) : WSB1 (327848 downstream)																							tgaaatgaagaaatgatatga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25299747	25299747	+	IGR	DEL	T	-	-	rs111243274		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25299747delT								None (None upstream) : WSB1 (321359 downstream)																							agaatttgaatttttttgtga	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25375129	25375130	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25375129_25375130insA								None (None upstream) : WSB1 (245976 downstream)																							TCTTGCCTAAGAAAAAAAACAA	0.376													4	2	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	31665022	31665022	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31665022delA	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	AAGGGCAAAGAAGGTGGAAGT	0.507													4	2	---	---	---	---	
ACACA	31	broad.mit.edu	37	17	35540740	35540740	+	Intron	DEL	A	-	-	rs11415930		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35540740delA	uc002hnm.2	-						ACACA_uc002hnk.2_Intron|ACACA_uc002hnl.2_Intron|ACACA_uc002hnn.2_Intron|ACACA_uc002hno.2_Intron|ACACA_uc010cuy.2_Intron	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	tctcaaaaggaaaaaaaaaaa	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	41024825	41024825	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41024825delG								LOC90586 (3462 upstream) : LOC388387 (1866 downstream)																							GCCGCAATCTGTAGGCACTCA	0.318													4	2	---	---	---	---	
PLEKHM1	9842	broad.mit.edu	37	17	43523385	43523386	+	Intron	INS	-	C	C	rs149182889	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43523385_43523386insC	uc002ija.2	-						PLEKHM1_uc010wjm.1_Intron|PLEKHM1_uc002ijb.2_Intron|PLEKHM1_uc010wjn.1_Intron	NM_014798	NP_055613	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M						intracellular signal transduction	cytoplasm	metal ion binding				0	Renal(3;0.0405)					AGCCCCTATTTCCCCCCACTGA	0.584													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	45563258	45563259	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45563258_45563259insA	uc002ilp.1	-						uc002ilq.2_Intron					Homo sapiens cDNA clone IMAGE:5266250, containing frame-shift errors.																		gactcagtctcaaaaaaaaaag	0.000													4	2	---	---	---	---	
SKAP1	8631	broad.mit.edu	37	17	46317543	46317544	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46317543_46317544insA	uc002ini.1	-						SKAP1_uc002inj.1_Intron|SKAP1_uc010dbd.1_Intron|SKAP1_uc010dbe.1_Intron	NM_003726	NP_003717	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1 isoform						positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0						AGGGAGAAGGGAAAAAAAAAAG	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	52836708	52836709	+	IGR	INS	-	T	T	rs140211903		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52836708_52836709insT								KIF2B (934135 upstream) : TOM1L1 (141343 downstream)																							TTTCAGCTCAAttttttttttt	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	57545608	57545608	+	IGR	DEL	T	-	-	rs66893136		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57545608delT								YPEL2 (66513 upstream) : DHX40 (97278 downstream)																							GGATCAGTGCttttttttttt	0.249													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	58630705	58630705	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58630705delC								APPBP2 (27125 upstream) : PPM1D (46849 downstream)																							tgtgaggccacccaagcagcc	0.000													4	2	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	59407152	59407153	+	Intron	INS	-	CACCCTTAC	CACCCTTAC	rs144341168	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59407152_59407153insCACCCTTAC	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron|BCAS3_uc002izb.3_Intron|BCAS3_uc002izc.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			TCCTCGGCGCTCACCTCCTCCA	0.554													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	59631926	59631927	+	IGR	INS	-	TG	TG	rs140802984	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59631926_59631927insTG								TBX4 (69457 upstream) : NACA2 (35867 downstream)																							GCTCTATCCCCtgtgtgtgtgt	0.173													5	3	---	---	---	---	
EFCAB3	146779	broad.mit.edu	37	17	60490127	60490127	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60490127delA	uc002izu.1	+						EFCAB3_uc010wpc.1_Intron	NM_173503	NP_775774	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3 isoform b								calcium ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			ACTCTGTCTCAAAAAAAAAaa	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62067574	62067575	+	IGR	DEL	CA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62067574_62067575delCA								SCN4A (17296 upstream) : C17orf72 (8136 downstream)																							acacccactccacacacacaca	0.203													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62662531	62662532	+	IGR	INS	-	TTG	TTG	rs145734455	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62662531_62662532insTTG								SMURF2 (4145 upstream) : LOC146880 (83249 downstream)																							CTTTTGGGGTTttgttgttgtt	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	63425856	63425857	+	IGR	INS	-	GAA	GAA	rs148931695	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63425856_63425857insGAA								RGS9 (202037 upstream) : AXIN2 (98828 downstream)																							GAGAGAATCTTGAAGAGGAAGG	0.302													3	4	---	---	---	---	
ARSG	22901	broad.mit.edu	37	17	66297871	66297872	+	Intron	DEL	CT	-	-	rs146328147		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66297871_66297872delCT	uc002jhc.2	+						ARSG_uc002jhb.1_Intron	NM_014960	NP_055775	Q96EG1	ARSG_HUMAN	Arylsulfatase G precursor						sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			tcctctctgactctaatccctg	0.000													5	4	---	---	---	---	
ABCA6	23460	broad.mit.edu	37	17	67081660	67081661	+	Intron	INS	-	A	A	rs35438104		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67081660_67081661insA	uc002jhw.1	-							NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6						transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					TATCCAAAGGCaaaaaaaaaaa	0.277													3	4	---	---	---	---	
MAP2K6	5608	broad.mit.edu	37	17	67500424	67500425	+	Intron	DEL	TT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67500424_67500425delTT	uc002jij.2	+						MAP2K6_uc002jii.2_Intron|MAP2K6_uc002jik.2_5'Flank	NM_002758	NP_002749	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6						activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|pancreas(1)	5	Breast(10;6.05e-10)					tttttttttctttttttttttg	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70476217	70476217	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70476217delA	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																		tccttatgggaaaaagggtct	0.055													4	2	---	---	---	---	
SLC39A11	201266	broad.mit.edu	37	17	70911734	70911734	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70911734delA	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						TCCCACTCCCAATCCCAACCG	0.413													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	71739830	71739832	+	IGR	DEL	TCC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71739830_71739832delTCC								SDK2 (99603 upstream) : C17orf54 (5577 downstream)																							TGTTTCTGCTTCCTCTCCCTTCT	0.246													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72095153	72095154	+	IGR	DEL	CA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72095153_72095154delCA								C17orf54 (270477 upstream) : RPL38 (104641 downstream)																							cacacatttgcacacacacacG	0.248													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72397303	72397304	+	IGR	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72397303_72397304insT								GPR142 (28542 upstream) : GPRC5C (30363 downstream)																							ccttcttcttcttttttttttt	0.010													4	2	---	---	---	---	
CD300LF	146722	broad.mit.edu	37	17	72705882	72705882	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72705882delT	uc002jlg.2	-						RAB37_uc002jlc.2_Intron|RAB37_uc010dfu.2_Intron|RAB37_uc002jld.2_Intron|CD300LF_uc002jlh.2_Intron|CD300LF_uc002jli.2_Intron|CD300LF_uc010wra.1_Intron	NM_139018	NP_620587	Q8TDQ1	CLM1_HUMAN	NK inhibitory receptor precursor							integral to membrane|plasma membrane	receptor activity			upper_aerodigestive_tract(1)	1						caggctagtattttttttttt	0.000													4	2	---	---	---	---	
RAB37	326624	broad.mit.edu	37	17	72729592	72729593	+	Intron	INS	-	GTG	GTG			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72729592_72729593insGTG	uc010dfu.2	+						RAB37_uc002jlc.2_Intron|RAB37_uc002jld.2_Intron	NM_175738	NP_783865	Q96AX2	RAB37_HUMAN	RAB37, member RAS oncogene family isoform 3						protein transport|small GTPase mediated signal transduction	ER-Golgi intermediate compartment	GTP binding			ovary(1)	1						atgtgaggtgtgtgtgatttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	73409813	73409816	+	IGR	DEL	TCTT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73409813_73409816delTCTT								GRB2 (8023 upstream) : KIAA0195 (42848 downstream)																							ttcttctttctctttctttctttc	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	74031470	74031470	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74031470delC								EVPL (7963 upstream) : SRP68 (3721 downstream)																							GTGCTCCTGACCCTCACCCAG	0.448													4	2	---	---	---	---	
ST6GALNAC2	10610	broad.mit.edu	37	17	74573656	74573657	+	Intron	DEL	TT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74573656_74573657delTT	uc002jsg.3	-							NM_006456	NP_006447	Q9UJ37	SIA7B_HUMAN	sialyltransferase 7B						protein glycosylation	integral to Golgi membrane	sialyltransferase activity				0						ggcctctgtatttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75121514	75121514	+	IGR	DEL	T	-	-	rs73376348	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75121514delT								C17orf86 (30447 upstream) : SEC14L1 (15491 downstream)																							AAGTTGCAGGTTTTTTTTTTT	0.328													4	3	---	---	---	---	
TBC1D16	125058	broad.mit.edu	37	17	77958504	77958504	+	Intron	DEL	A	-	-	rs10528420		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77958504delA	uc002jxj.2	-							NM_019020	NP_061893	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16							intracellular	Rab GTPase activator activity				0	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			CAGTAAAGGCAAAAAAAAAAA	0.269													4	2	---	---	---	---	
NPTX1	4884	broad.mit.edu	37	17	78440699	78440700	+	3'UTR	INS	-	A	A	rs72505943		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78440699_78440700insA	uc002jyp.1	-	5					uc002jyo.1_5'Flank	NM_002522	NP_002513	Q15818	NPTX1_HUMAN	neuronal pentraxin I precursor						central nervous system development|synaptic transmission|transport	transport vesicle	metal ion binding				0	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			GCAAGAAAATGAAAAAAAAAAA	0.386													5	5	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78637201	78637204	+	Intron	DEL	TCTT	-	-	rs149587794		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78637201_78637204delTCTT	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						AAAAATCATCTCTTTCTTTGCAAA	0.324													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	79837167	79837169	+	IGR	DEL	GTC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79837167_79837169delGTC								ARHGDIA (7929 upstream) : THOC4 (8542 downstream)																							cgaatgtcctgtcaatctgagag	0.000													5	3	---	---	---	---	
ENOSF1	55556	broad.mit.edu	37	18	701461	701461	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:701461delA	uc002kku.3	-						ENOSF1_uc002kkt.3_Intron|ENOSF1_uc010dke.2_Intron|ENOSF1_uc010dkf.2_Intron|ENOSF1_uc002kkv.3_Intron|ENOSF1_uc002kkw.3_Intron|ENOSF1_uc002kkx.3_Intron|ENOSF1_uc010wyt.1_Intron	NM_017512	NP_059982	Q7L5Y1	ENOF1_HUMAN	enolase superfamily 1 isoform rTS beta						cellular amino acid catabolic process	mitochondrion	isomerase activity|metal ion binding			ovary(1)	1						ataaagtcttaaaaaAAAAAA	0.000													4	2	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	4049913	4049916	+	Intron	DEL	TCCA	-	-	rs71881844		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4049913_4049916delTCCA	uc010wyz.1	-						uc002kmm.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				catccaacggtccatccatccatc	0.025													3	3	---	---	---	---	
EPB41L3	23136	broad.mit.edu	37	18	5433333	5433334	+	Intron	DEL	AA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5433333_5433334delAA	uc002kmt.1	-						EPB41L3_uc010wzh.1_Intron|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc010dks.1_Intron	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3						cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						AGTAGGGCTTAAAAGACAAGCA	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	8553020	8553020	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8553020delC								PTPRM (146162 upstream) : RAB12 (56415 downstream)																							gtgtcacacacaaaaaaaaaa	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11968420	11968421	+	IGR	DEL	TG	-	-	rs142719291		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11968420_11968421delTG								MPPE1 (59779 upstream) : IMPA2 (12636 downstream)																							tgtgtgcgtatgtgtgtgtgtg	0.282													4	2	---	---	---	---	
C18orf1	753	broad.mit.edu	37	18	13359871	13359871	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13359871delT	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		TGCTTTGCCCTCAGATGACGC	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	14139616	14139617	+	IGR	INS	-	A	A	rs71366099		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14139616_14139617insA								ZNF519 (7187 upstream) : LOC284233 (197805 downstream)																							gaccctgtctcaaaaaaaaaaa	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15390602	15390604	+	IGR	DEL	GTG	-	-	rs58894375		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15390602_15390604delGTG								LOC644669 (64684 upstream) : None (None downstream)																							aaacttcttcgtgatgtgtgcat	0.000													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15404526	15404526	+	IGR	DEL	A	-	-	rs138925969		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15404526delA								LOC644669 (78608 upstream) : None (None downstream)																							ctgcaagtggaactttggagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	20031331	20031332	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20031331_20031332insA								CTAGE1 (33453 upstream) : RBBP8 (481963 downstream)																							tacaaagccgtaaaaaaaaaaa	0.005													4	3	---	---	---	---	
PSMA8	143471	broad.mit.edu	37	18	23759261	23759261	+	Intron	DEL	T	-	-	rs36120364		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23759261delT	uc002kvq.2	+						PSMA8_uc002kvo.2_Intron|PSMA8_uc002kvp.2_Intron|PSMA8_uc002kvr.2_Intron	NM_144662	NP_653263	Q8TAA3	PSA7L_HUMAN	proteasome alpha 8 subunit isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	threonine-type endopeptidase activity			skin(1)	1	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)			GTTTTTTGTGTtttttttttt	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	29179687	29179687	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29179687delA								TTR (703 upstream) : B4GALT6 (22523 downstream)																							atggtttggcaggaggctatg	0.000													4	2	---	---	---	---	
CELF4	56853	broad.mit.edu	37	18	34942636	34942640	+	Intron	DEL	CTGCC	-	-	rs143497806		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34942636_34942640delCTGCC	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron|CELF4_uc002lai.2_Intron	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						CACCCGCTGGCTGCCCTGCCCTGCC	0.644													3	3	---	---	---	---	
LOC647946	647946	broad.mit.edu	37	18	37253041	37253041	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37253041delA	uc010xcj.1	-						LOC647946_uc002lal.1_Intron	NR_024391				Homo sapiens cDNA FLJ33284 fis, clone ASTRO2009458.												0						actccatctcaaaaaaaaaaC	0.159													4	2	---	---	---	---	
SETBP1	26040	broad.mit.edu	37	18	42644399	42644399	+	3'UTR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42644399delT	uc010dni.2	+	6						NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		ACTTGCTGCCTTTTTTTTTTC	0.353									Schinzel-Giedion_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	52274770	52274770	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52274770delC								C18orf26 (8046 upstream) : RAB27B (221070 downstream)																							gctgagctcactggcttttag	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	57862407	57862408	+	IGR	DEL	TC	-	-	rs146289113		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57862407_57862408delTC								PMAIP1 (290869 upstream) : MC4R (176156 downstream)																							TGGAGTttcttctctcagagtc	0.163													2	4	---	---	---	---	
ZNF407	55628	broad.mit.edu	37	18	72384398	72384401	+	Intron	DEL	TGTC	-	-	rs71803457		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72384398_72384401delTGTC	uc002llw.2	+						ZNF407_uc010xfc.1_Intron|ZNF407_uc010dqu.1_Intron	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GAGCACTGTTTGTCTGTTCATTGG	0.402													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	72836123	72836124	+	IGR	DEL	GA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72836123_72836124delGA								ZNF407 (58495 upstream) : ZADH2 (73155 downstream)																							TTACACCAGGGAGATAGAGGGT	0.475													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	73811669	73811669	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73811669delG								C18orf62 (672080 upstream) : ZNF516 (259950 downstream)																							acagtacttagaggcagagtg	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75122827	75122829	+	IGR	DEL	AGT	-	-	rs139762429		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75122827_75122829delAGT								GALR1 (140733 upstream) : None (None downstream)																							caacctggggagtttaaaacccc	0.138													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75916153	75916153	+	IGR	DEL	A	-	-	rs138291517	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75916153delA								GALR1 (934059 upstream) : SALL3 (824122 downstream)																							TGGCACATACAAAAAAAAAAT	0.363													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76716100	76716100	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76716100delA								None (None upstream) : SALL3 (24175 downstream)																							AATTCTAACTAATTCCAATAC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	246001	246001	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:246001delA								FLJ45445 (43792 upstream) : PPAP2C (35045 downstream)																							ccctaaccctaaACCAcatga	0.010													4	2	---	---	---	---	
GZMM	3004	broad.mit.edu	37	19	544707	544714	+	Intron	DEL	TCCCTCCC	-	-	rs111264758		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:544707_544714delTCCCTCCC	uc002low.1	+							NM_005317	NP_005308	P51124	GRAM_HUMAN	granzyme M precursor						apoptosis|cytolysis|innate immune response|proteolysis	extracellular region	serine-type endopeptidase activity				0		all_cancers(10;1.94e-35)|all_epithelial(18;5.94e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGTCCATCAtccctccctccctccctc	0.240													4	5	---	---	---	---	
NFIC	4782	broad.mit.edu	37	19	3449366	3449366	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3449366delA	uc010xhi.1	+						NFIC_uc002lxo.2_Intron|NFIC_uc010xhh.1_Intron|NFIC_uc002lxp.2_Intron|NFIC_uc010xhj.1_Intron	NM_205843	NP_995315	P08651	NFIC_HUMAN	nuclear factor I/C isoform 2						DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		CCTGTATAACAAAAGGCTGCA	0.577													4	2	---	---	---	---	
ANKRD24	170961	broad.mit.edu	37	19	4199809	4199810	+	Intron	INS	-	A	A	rs140961038	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4199809_4199810insA	uc010dtt.1	+						ANKRD24_uc002lzs.2_Intron|ANKRD24_uc002lzt.2_Intron	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GAGCCCCTGTCGGGGGCGTGGG	0.708													3	6	---	---	---	---	
UHRF1	29128	broad.mit.edu	37	19	4918435	4918436	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4918435_4918436insT	uc002mbo.2	+						UHRF1_uc010xik.1_Intron|UHRF1_uc010duf.2_Intron|UHRF1_uc002mbp.2_Intron	NM_001048201	NP_001041666	Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains						cell cycle|cell proliferation|DNA repair|regulation of transcription from RNA polymerase II promoter	nucleus	acid-amino acid ligase activity|methyl-CpG binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		tgcctggccTGttttttttttt	0.005													4	2	---	---	---	---	
CLPP	8192	broad.mit.edu	37	19	6364420	6364421	+	Intron	DEL	GG	-	-	rs113114685	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6364420_6364421delGG	uc002mem.1	+						CLPP_uc002men.1_5'Flank	NM_006012	NP_006003	Q16740	CLPP_HUMAN	caseinolytic peptidase, ATP-dependent,						proteolysis	mitochondrial matrix	ATP binding|protein binding|serine-type endopeptidase activity			ovary(1)	1						GGAAAGGGTCGGGGGGAGCTGG	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	6650863	6650864	+	IGR	INS	-	AT	AT	rs72528583	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6650863_6650864insAT								CD70 (59700 upstream) : TNFSF14 (13702 downstream)																							ccaagaaagaggtgataatggg	0.030													1	6	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153066	7153066	+	Intron	DEL	A	-	-	rs113402674		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153066delA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	acacccccccacacacacaca	0.050													4	2	---	---	---	---	
C19orf45	374877	broad.mit.edu	37	19	7559957	7559964	+	5'Flank	DEL	TCCCTCCT	-	-	rs72004408		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7559957_7559964delTCCCTCCT	uc002mgm.2	+							NM_198534	NP_940936	Q8NA69	CS045_HUMAN	hypothetical protein LOC374877												0						cttctctccctccctccttccctccttc	0.072													4	4	---	---	---	---	
STXBP2	6813	broad.mit.edu	37	19	7705440	7705441	+	Intron	INS	-	TG	TG	rs148185188	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7705440_7705441insTG	uc002mha.3	+						STXBP2_uc002mhb.3_Intron|STXBP2_uc010dvj.2_Intron|STXBP2_uc010xjr.1_Intron|STXBP2_uc010dvk.2_Intron|STXBP2_uc002mhc.3_Intron|STXBP2_uc010dvl.1_Frame_Shift_Ins_p.L185fs	NM_006949	NP_008880	Q15833	STXB2_HUMAN	syntaxin binding protein 2 isoform a						leukocyte mediated cytotoxicity|neutrophil degranulation|protein transport|regulation of mast cell degranulation|vesicle docking involved in exocytosis	azurophil granule|cytolytic granule|cytosol|specific granule|tertiary granule	syntaxin-3 binding			central_nervous_system(1)	1						gtgcgtgcatctgtgtgtgtgc	0.228													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8415883	8415884	+	IGR	DEL	TT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8415883_8415884delTT								KANK3 (7737 upstream) : ANGPTL4 (13127 downstream)																							GGGgtgtgtgtttgtgtgtgtg	0.158													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	10137715	10137718	+	IGR	DEL	TCTC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10137715_10137718delTCTC								RDH8 (4762 upstream) : C3P1 (14314 downstream)																							ctgacatggttctctctctttttt	0.010													4	2	---	---	---	---	
FDX1L	112812	broad.mit.edu	37	19	10425247	10425247	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10425247delA	uc002mny.1	-						FDX1L_uc002mnx.1_Intron	NM_001031734	NP_001026904	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like precursor						electron transport chain|transport	mitochondrial matrix	2 iron, 2 sulfur cluster binding|electron carrier activity|metal ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)			ccgtctcttgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
LDLR	3949	broad.mit.edu	37	19	11217510	11217513	+	Intron	DEL	CTTC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11217510_11217513delCTTC	uc002mqk.3	+						LDLR_uc010xlk.1_Intron|LDLR_uc010xll.1_Intron|LDLR_uc010xlm.1_Intron|LDLR_uc010xln.1_Intron|LDLR_uc010xlo.1_Intron	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor						cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)	cagagcctcaCttccttttgtttt	0.127													4	3	---	---	---	---	
MAST1	22983	broad.mit.edu	37	19	12954915	12954915	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12954915delC	uc002mvm.2	+						MAST1_uc002mvk.2_Intron|MAST1_uc002mvl.2_Intron	NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase						cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						CCACTCAGAGCCCAATGCTCT	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13100088	13100088	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13100088delG								DAND5 (14521 upstream) : NFIX (6496 downstream)																							atggaaggctggggggtgtgt	0.129													4	3	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13341625	13341625	+	Intron	DEL	A	-	-	rs75014801		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13341625delA	uc010dze.2	-						CACNA1A_uc010xnd.1_Intron|CACNA1A_uc002mwx.3_Intron|CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc002mwv.3_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	catttcaaagaaaaaaaaaaa	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14351006	14351006	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14351006delT								LPHN1 (34009 upstream) : CD97 (141207 downstream)																							gctcagctaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14417316	14417318	+	IGR	DEL	CCC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14417316_14417318delCCC								LPHN1 (100319 upstream) : CD97 (74895 downstream)																							gacttgaactcccagctaaagcg	0.000													4	2	---	---	---	---	
CYP4F22	126410	broad.mit.edu	37	19	15636983	15636983	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15636983delA	uc002nbh.3	+							NM_173483	NP_775754	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F,							endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen			ovary(1)|pancreas(1)	2						ctctctaaggaaaaaaaaaag	0.189													4	2	---	---	---	---	
EPS15L1	58513	broad.mit.edu	37	19	16486278	16486279	+	Intron	DEL	TG	-	-	rs144847796		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16486278_16486279delTG	uc002ndz.1	-						EPS15L1_uc002ndx.2_Intron|EPS15L1_uc002ndy.2_Intron|EPS15L1_uc010xpe.1_Intron|EPS15L1_uc010xpf.1_Intron|EPS15L1_uc002nea.1_Intron|EPS15L1_uc010eah.1_Intron	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway						endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5						TATGCATATAtgtgtgtgtgtg	0.426													4	3	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17741963	17741964	+	Intron	INS	-	CTCC	CTCC			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17741963_17741964insCTCC	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						GCTCTTGTtttctccctccctc	0.104													3	5	---	---	---	---	
KIAA0892	23383	broad.mit.edu	37	19	19442310	19442311	+	Intron	INS	-	A	A	rs146505458		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19442310_19442311insA	uc002nmk.3	+							NM_015329	NP_056144	Q9Y6X3	SCC4_HUMAN	hypothetical protein LOC23383 precursor						cell division|maintenance of mitotic sister chromatid cohesion	chromatin|nucleoplasm|SMC loading complex	protein N-terminus binding				0						aactccgtctcaaaaaaaaaaa	0.153													4	4	---	---	---	---	
ZNF98	148198	broad.mit.edu	37	19	22583761	22583761	+	Intron	DEL	C	-	-	rs2957849		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22583761delC	uc002nqt.2	-							NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				tctcaaaaaacaaaacaaaac	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	23216585	23216585	+	IGR	DEL	A	-	-	rs140438646		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23216585delA								ZNF99 (263801 upstream) : ZNF91 (304834 downstream)																							actctatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24064604	24064605	+	IGR	INS	-	AGGAGA	AGGAGA	rs142865008	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24064604_24064605insAGGAGA								RPSAP58 (53687 upstream) : ZNF254 (151642 downstream)																							aggtgaaggagaggaggagaaa	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29911029	29911030	+	Intron	INS	-	CACA	CACA	rs141764199	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29911029_29911030insCACA	uc002nse.1	-											Homo sapiens cDNA FLJ37474 fis, clone BRAWH2012619.																		CGcataagcatcacacacacac	0.238													4	2	---	---	---	---	
C19orf12	83636	broad.mit.edu	37	19	30203842	30203843	+	Intron	DEL	GG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30203842_30203843delGG	uc002nsk.2	-						C19orf12_uc002nsj.2_Intron|C19orf12_uc002nsl.2_Intron|C19orf12_uc002nsm.2_Intron	NM_031448	NP_113636	Q9NSK7	CS012_HUMAN	hypothetical protein LOC83636 isoform 2							integral to membrane					0	Ovarian(5;0.000567)|Breast(6;0.0203)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0435)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.183)			GGCAGGCAGAGGAAGTCACTGT	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30692041	30692041	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30692041delA								C19orf2 (185430 upstream) : ZNF536 (171287 downstream)																							acactgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ZNF536	9745	broad.mit.edu	37	19	30882613	30882614	+	Intron	DEL	AG	-	-	rs10546135		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30882613_30882614delAG	uc002nsu.1	+						ZNF536_uc010edd.1_Intron	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					ACCAAGAGAAAGAGAGAAAAAG	0.376													3	3	---	---	---	---	
CHST8	64377	broad.mit.edu	37	19	34213121	34213121	+	Intron	DEL	G	-	-	rs148419142		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34213121delG	uc002nus.3	+						CHST8_uc002nut.3_Intron|CHST8_uc002nuu.2_Intron	NM_001127895	NP_001121367	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0)						carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)					tagaCAGTCTGGATGAGCtga	0.040													3	5	---	---	---	---	
MAG	4099	broad.mit.edu	37	19	35819647	35819648	+	Intron	INS	-	G	G	rs143856980	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35819647_35819648insG	uc002nyz.1	+						CD22_uc010edt.2_5'Flank|CD22_uc010xst.1_5'Flank|CD22_uc010edu.2_5'Flank|CD22_uc010edv.2_5'Flank	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a						blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCTCAACCCTTGGGGGCTTCAG	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	35917601	35917602	+	IGR	INS	-	A	A	rs113904690		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35917601_35917602insA								FFAR3 (66214 upstream) : FFAR2 (21601 downstream)																							gacccggtctcaaaaaaaaaaa	0.050													4	2	---	---	---	---	
YIF1B	90522	broad.mit.edu	37	19	38801927	38801927	+	Intron	DEL	A	-	-	rs75929446		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38801927delA	uc002ohz.2	-						YIF1B_uc002ohw.2_5'Flank|YIF1B_uc002ohx.2_Intron|YIF1B_uc010xtx.1_Intron|YIF1B_uc010xty.1_Intron|YIF1B_uc002oia.2_Intron|YIF1B_uc002ohy.2_Intron|YIF1B_uc002oib.2_Intron	NM_001039672	NP_001034761	Q5BJH7	YIF1B_HUMAN	Yip1 interacting factor homolog B isoform 5							integral to membrane					0	all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			accctgtctcaaaaaaaaaaa	0.005													4	2	---	---	---	---	
MAP4K1	11184	broad.mit.edu	37	19	39095430	39095430	+	Intron	DEL	A	-	-	rs112047872		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39095430delA	uc002oix.1	-						MAP4K1_uc002oiw.1_Intron|MAP4K1_uc002oiy.1_Intron|MAP4K1_uc010xug.1_Intron	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			actctgtctcaaaaaaaaaaa	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	39127966	39127966	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39127966delT								EIF3K (371 upstream) : ACTN4 (10361 downstream)																							actgtgcctctttttttttta	0.184													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	39240949	39240950	+	IGR	INS	-	C	C	rs141726695	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39240949_39240950insC								CAPN12 (5835 upstream) : LGALS7 (20658 downstream)																							gttaatttacacaaactccaag	0.000													6	4	---	---	---	---	
DYRK1B	9149	broad.mit.edu	37	19	40322778	40322779	+	Intron	INS	-	G	G	rs142559296	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40322778_40322779insG	uc002omj.2	-						DYRK1B_uc002omi.2_Intron|DYRK1B_uc002omk.2_Intron|DYRK1B_uc002oml.2_Intron	NM_004714	NP_004705	Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation						positive regulation of transcription, DNA-dependent	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|transcription coactivator activity			ovary(4)|stomach(1)|central_nervous_system(1)|skin(1)	7	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			GGTAGCCAGGTGGGGGGGGATG	0.495													5	4	---	---	---	---	
ADCK4	79934	broad.mit.edu	37	19	41202569	41202570	+	Intron	INS	-	A	A	rs79647090		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41202569_41202570insA	uc002oor.2	-						ADCK4_uc002oop.1_Intron|ADCK4_uc002ooq.1_Intron	NM_024876	NP_079152	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4 isoform a							integral to membrane	protein serine/threonine kinase activity				0			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			gactccgtctcaaaaaaaaaaa	0.000													5	3	---	---	---	---	
CNFN	84518	broad.mit.edu	37	19	42896177	42896177	+	5'Flank	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42896177delC	uc002otp.3	-						CNFN_uc002otq.3_5'Flank	NM_032488	NP_115877	Q9BYD5	CNFN_HUMAN	cornifelin						keratinization	cornified envelope|cytoplasm					0		Prostate(69;0.00899)				GTCCTAACATCCCTGTCTCCT	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	44179647	44179648	+	IGR	DEL	AC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44179647_44179648delAC								PLAUR (5145 upstream) : IRGC (40566 downstream)																							ccctcAAGTGACACACACACAC	0.287													3	3	---	---	---	---	
PVRL2	5819	broad.mit.edu	37	19	45368085	45368085	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45368085delA	uc002ozw.1	+						PVRL2_uc002ozv.2_Intron	NM_001042724	NP_001036189	Q92692	PVRL2_HUMAN	poliovirus receptor related 2 isoform delta						adherens junction organization|adhesion to symbiont|cell junction assembly|homophilic cell adhesion|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|susceptibility to natural killer cell mediated cytotoxicity|susceptibility to T cell mediated cytotoxicity|viral envelope fusion with host membrane|virion attachment, binding of host cell surface coreceptor	cell surface|integral to membrane|zonula adherens	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		actccgtctcaaaaaaaaaaa	0.204													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	45700757	45700758	+	IGR	INS	-	A	A	rs35735109		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45700757_45700758insA								BLOC1S3 (15700 upstream) : EXOC3L2 (15121 downstream)																							caacaaccaccaaaaaaaaaga	0.010													3	4	---	---	---	---	
PPP5C	5536	broad.mit.edu	37	19	46875624	46875625	+	Intron	INS	-	T	T	rs146338746	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46875624_46875625insT	uc002pem.2	+						PPP5C_uc010xya.1_Intron|PPP5C_uc002pen.2_Intron	NM_006247	NP_006238	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit						mitosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein dephosphorylation|transcription, DNA-dependent	Golgi apparatus|nucleus	metal ion binding|protein binding|protein serine/threonine phosphatase activity|signal transducer activity			lung(1)|pancreas(1)	2		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		tacctggctagctttttgttgt	0.000													4	2	---	---	---	---	
SLC8A2	6543	broad.mit.edu	37	19	47969845	47969846	+	Intron	DEL	AG	-	-	rs71334206		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47969845_47969846delAG	uc002pgx.2	-						SLC8A2_uc010xyq.1_Intron|SLC8A2_uc010xyr.1_Intron|SLC8A2_uc010ele.2_5'Flank	NM_015063	NP_055878	Q9UPR5	NAC2_HUMAN	solute carrier family 8 member 2 precursor						cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(1)	4		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		agagacccacagagagagagag	0.183													4	4	---	---	---	---	
RUVBL2	10856	broad.mit.edu	37	19	49508898	49508898	+	Intron	DEL	T	-	-	rs72426010		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49508898delT	uc002plr.1	+						RUVBL2_uc002plq.1_Intron|RUVBL2_uc010yab.1_Intron|RUVBL2_uc002pls.1_Intron|RUVBL2_uc010emn.1_Intron|RUVBL2_uc010yac.1_Intron	NM_006666	NP_006657	Q9Y230	RUVB2_HUMAN	RuvB-like 2						cellular response to UV|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|protein folding|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|membrane|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|ATP-dependent DNA helicase activity|damaged DNA binding|identical protein binding|unfolded protein binding				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		Ctcttcttcattttttttttt	0.134													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	50594735	50594735	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50594735delA								FLJ26850 (24686 upstream) : SNAR-A4 (26242 downstream)																							tctgaaaaagaaaaaaaaaaa	0.025													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	51256428	51256428	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51256428delA								CLEC11A (27449 upstream) : GPR32 (17430 downstream)																							atctcaaaagaaaaaaaaaaa	0.219													4	2	---	---	---	---	
HAS1	3036	broad.mit.edu	37	19	52230150	52230151	+	5'Flank	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52230150_52230151insT	uc002pxo.1	-						HAS1_uc002pxp.1_5'Flank	NM_001523	NP_001514	Q92839	HAS1_HUMAN	hyaluronan synthase 1						cell adhesion	integral to plasma membrane	hyaluronan synthase activity|protein binding			ovary(1)|pancreas(1)	2		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		gagtccaggccccatcccctcc	0.000													4	3	---	---	---	---	
ZNF765	91661	broad.mit.edu	37	19	53914545	53914546	+	3'UTR	INS	-	T	T	rs34326774		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53914545_53914546insT	uc010ydx.1	+	6					ZNF765_uc002qbm.2_3'UTR|ZNF765_uc002qbn.2_Intron	NM_001040185	NP_001035275	Q7L2R6	ZN765_HUMAN	zinc finger protein 765						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)		ACTGATAGGGAttttttttttt	0.109													4	2	---	---	---	---	
ZNF331	55422	broad.mit.edu	37	19	54041077	54041078	+	Intron	DEL	GT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54041077_54041078delGT	uc002qbx.1	+						ZNF331_uc002qby.1_Intron|ZNF331_uc002qbz.1_Intron|ZNF331_uc002qca.1_5'Flank|ZNF331_uc010eqr.1_5'Flank|ZNF331_uc002qcb.1_5'Flank	NM_018555	NP_061025	Q9NQX6	ZN331_HUMAN	zinc finger protein 331						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)	6				GBM - Glioblastoma multiforme(134;0.00555)		ACACGTGTCAGTGTGTCCGCGT	0.653			T	?	follicular thyroid adenoma								4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54891455	54891455	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54891455delC								LAIR1 (9291 upstream) : TTYH1 (35180 downstream)																							AGGAAGGATGCCCCTCAGGAG	0.557													4	2	---	---	---	---	
KIR3DX1	90011	broad.mit.edu	37	19	55051232	55051233	+	Intron	INS	-	T	T	rs146184445	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55051232_55051233insT	uc010erm.2	+						KIR3DX1_uc010yfa.1_Intron|KIR3DX1_uc010yfb.1_Intron|KIR3DX1_uc010yfc.1_Intron|KIR3DX1_uc010yfd.1_Intron					Homo sapiens killer cell immunoglobulin-like receptor, three domains, X1, mRNA (cDNA clone IMAGE:4849085).											ovary(1)	1				GBM - Glioblastoma multiforme(193;0.099)		gttttgttttgtttttttttca	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	56075046	56075047	+	IGR	DEL	CT	-	-	rs74201697		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56075046_56075047delCT								SBK2 (27385 upstream) : ZNF579 (13845 downstream)																							gtgtctcttcctctctctctct	0.000													4	3	---	---	---	---	
U2AF2	11338	broad.mit.edu	37	19	56181818	56181818	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56181818delG	uc002qlu.2	+						U2AF2_uc002qlt.2_Intron	NM_007279	NP_009210	P26368	U2AF2_HUMAN	U2 (RNU2) small nuclear RNA auxiliary factor 2						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	nucleoplasm|spliceosomal complex	enzyme binding|nucleotide binding|RNA binding			ovary(1)	1		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		ctgctgtcccgtgCACCCTGC	0.358													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	931723	931723	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:931723delA								ANGPT4 (34763 upstream) : RSPO4 (7375 downstream)																							tgcatgagagaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	3704135	3704136	+	IGR	INS	-	A	A	rs150076321		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3704135_3704136insA								SIGLEC1 (16360 upstream) : HSPA12B (9220 downstream)																							gactccgtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8112027	8112028	+	5'Flank	INS	-	A	A	rs113374963		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8112027_8112028insA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc010gbv.1_5'Flank|PLCB1_uc002wmz.1_5'Flank|PLCB1_uc002wna.2_5'Flank	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						ctctcCTTAATAAAAAAAAAAA	0.015													4	2	---	---	---	---	
PAK7	57144	broad.mit.edu	37	20	9616235	9616235	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9616235delT	uc002wnl.2	-						PAK7_uc002wnk.2_Intron|PAK7_uc002wnj.2_Intron|PAK7_uc010gby.1_Intron	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	p21-activated kinase 7								ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)			aatatatccctttccaaggtc	0.179													4	2	---	---	---	---	
C20orf94	128710	broad.mit.edu	37	20	10519177	10519178	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10519177_10519178insT	uc010zre.1	+							NM_001009608	NP_001009608	Q5VYV7	CT094_HUMAN	hypothetical protein LOC128710								protein binding				0						AGCCCTTCATCttttttttttt	0.059													4	2	---	---	---	---	
KIF16B	55614	broad.mit.edu	37	20	16538208	16538208	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16538208delA	uc002wpg.1	-						KIF16B_uc010gch.1_Intron|KIF16B_uc010gci.1_Intron|KIF16B_uc010gcj.1_Intron	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23						cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						gaggactattaaagtcatgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23493480	23493480	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23493480delG								CST8 (16825 upstream) : CSTT (6303 downstream)																							GTGGGAGGTTGGGGGGTGCCT	0.647													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23871443	23871444	+	IGR	INS	-	CAT	CAT	rs145024431	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23871443_23871444insCAT								CST5 (11063 upstream) : GGTLC1 (94247 downstream)																							CCcatgatcaccatcatcatca	0.035													4	2	---	---	---	---	
FAM182B	728882	broad.mit.edu	37	20	25756137	25756137	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25756137delC	uc010zth.1	-						FAM182B_uc002wvd.1_Intron|FAM182B_uc002wve.2_Intron|FAM182B_uc010zti.1_Intron	NR_027061				Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0						TTTTTTTTAACCACTGGCAAT	0.308													3	4	---	---	---	---	
FAM182B	728882	broad.mit.edu	37	20	25826898	25826898	+	Intron	DEL	C	-	-	rs77661715		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25826898delC	uc002wvd.1	-						FAM182B_uc002wve.2_Intron					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0						GTTCTTATTTCTATTGCATCT	0.532													10	5	---	---	---	---	
FAM182B	728882	broad.mit.edu	37	20	25831101	25831102	+	Intron	INS	-	C	C	rs147373877	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25831101_25831102insC	uc002wvd.1	-						FAM182B_uc002wve.2_Intron					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0						GAGCAGGACTGTTGTGCTTGCT	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26252278	26252279	+	IGR	INS	-	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26252278_26252279insC								MIR663 (63364 upstream) : None (None downstream)																							TCttttttttttcttgagataa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	30237596	30237597	+	IGR	INS	-	A	A	rs139494924	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30237596_30237597insA								COX4I2 (4796 upstream) : BCL2L1 (14666 downstream)																							tctgtttcaggaaaaaaaaaGT	0.208													3	4	---	---	---	---	
TM9SF4	9777	broad.mit.edu	37	20	30719284	30719285	+	Intron	INS	-	GTGTGT	GTGTGT	rs145621877	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30719284_30719285insGTGTGT	uc002wxj.2	+						TM9SF4_uc010ztr.1_Intron|TM9SF4_uc010zts.1_Intron|TM9SF4_uc002wxk.2_Intron	NM_014742	NP_055557	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4							integral to membrane				central_nervous_system(1)|pancreas(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GAGTCATCAGAgtgtgtgtgtg	0.317													3	3	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32376228	32376229	+	Intron	INS	-	A	A	rs140349924	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32376228_32376229insA	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron|ZNF341_uc002wzz.2_5'UTR	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						ggctctgtctcaaaaaaaataa	0.000													2	4	---	---	---	---	
DLGAP4	22839	broad.mit.edu	37	20	35059548	35059557	+	Intron	DEL	CAGGGTCCTC	-	-	rs148076124		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35059548_35059557delCAGGGTCCTC	uc002xff.2	+						DLGAP4_uc010zvp.1_Intron	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a						cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				agggccagcacagggtcctcccgtgggagg	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36160835	36160835	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36160835delT								BLCAP (4532 upstream) : CTNNBL1 (161599 downstream)																							tgattttttcttttttttttt	0.000													4	2	---	---	---	---	
CTNNBL1	56259	broad.mit.edu	37	20	36354386	36354386	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36354386delA	uc010zvw.1	+						CTNNBL1_uc010zvv.1_Intron	NM_030877	NP_110517	Q8WYA6	CTBL1_HUMAN	beta catenin-like 1						apoptosis|positive regulation of apoptosis|somatic diversification of immunoglobulins	nucleus	enzyme binding			ovary(2)	2		Myeloproliferative disorder(115;0.00878)				gctccgtctcaaaaaaagaaa	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36602458	36602458	+	IGR	DEL	T	-	-	rs11358322		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36602458delT								VSTM2L (28713 upstream) : KIAA0406 (8967 downstream)																							gcccagctgattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37268764	37268765	+	IGR	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37268764_37268765insT								ADIG (51660 upstream) : SLC32A1 (84340 downstream)																							tcttcctcttcttcctcttctt	0.173													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37751234	37751234	+	IGR	DEL	T	-	-	rs75483987		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37751234delT								DHX35 (82871 upstream) : LOC339568 (91190 downstream)																							TCCCTTCCTATTTTTTTTTTT	0.458													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	39232547	39232547	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39232547delG								None (None upstream) : MAFB (81972 downstream)																							TGACCAAGCTGCAGAcattta	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	39335032	39335032	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39335032delT								MAFB (17156 upstream) : TOP1 (322430 downstream)																							TCCTTGTCTATTAACTATTCC	0.398													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	42287067	42287068	+	IGR	INS	-	TT	TT	rs11484481		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42287067_42287068insTT								IFT52 (11206 upstream) : MYBL2 (8641 downstream)																							AACTTCTAGAGttttttttttt	0.208													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	42414668	42414669	+	IGR	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42414668_42414669insT								GTSF1L (59026 upstream) : TOX2 (128823 downstream)																							CTGCATATATCttttttttttt	0.045													3	3	---	---	---	---	
SLC12A5	57468	broad.mit.edu	37	20	44648605	44648606	+	5'Flank	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44648605_44648606insT	uc010zxl.1	+							NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride						potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	actatcattacttttttttttt	0.000													4	2	---	---	---	---	
SLC2A10	81031	broad.mit.edu	37	20	45339516	45339517	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45339516_45339517insT	uc002xsl.2	+							NM_030777	NP_110404	O95528	GTR10_HUMAN	solute carrier family 2 member 10							endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity|sugar:hydrogen symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				attatcttttcttttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46749572	46749573	+	IGR	DEL	CT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46749572_46749573delCT								SULF2 (334212 upstream) : LOC284749 (239081 downstream)																							CATCCTGTAACTCTCTCTCTCT	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46824514	46824514	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46824514delC								SULF2 (409154 upstream) : LOC284749 (164140 downstream)																							tgtggagtttccatgctgcgc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	47015220	47015220	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47015220delT								LOC284749 (15839 upstream) : PREX1 (225573 downstream)																							CAAACGTccctttcagaagag	0.234													4	2	---	---	---	---	
PREX1	57580	broad.mit.edu	37	20	47366851	47366852	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47366851_47366852insT	uc002xtw.1	-							NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,						actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			ccaaaagtctgttctctacaca	0.000													4	2	---	---	---	---	
TMEM189	387521	broad.mit.edu	37	20	48741399	48741400	+	3'UTR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48741399_48741400insA	uc002xvg.2	-	6					TMEM189-UBE2V1_uc002xvf.2_Intron|TMEM189_uc010zyq.1_RNA|TMEM189_uc010gif.2_3'UTR|TMEM189_uc010zyp.1_3'UTR	NM_199129	NP_954580	A5PLL7	TM189_HUMAN	transmembrane protein 189 isoform 1							endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(9;3.02e-07)			AGGGGCCGAGGAAAAAAAAAAA	0.550													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	48875029	48875030	+	IGR	INS	-	TA	TA	rs11474325		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48875029_48875030insTA								CEBPB (65817 upstream) : PTPN1 (251861 downstream)																							gtgtgtgtctgtgtgtgtgtgt	0.450													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	51435481	51435482	+	IGR	INS	-	AA	AA	rs11472726		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51435481_51435482insAA								ZFP64 (626957 upstream) : TSHZ2 (153395 downstream)																							GGCGAAAATACAAAAAAAAAAA	0.411													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	52345061	52345062	+	IGR	DEL	GT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52345061_52345062delGT								ZNF217 (134260 upstream) : SUMO1P1 (145980 downstream)																							TTGTATTGGGgtgtgtgtgtgt	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55162531	55162533	+	IGR	DEL	AGG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55162531_55162533delAGG								C20orf107 (50957 upstream) : TFAP2C (41825 downstream)																							ggggaggattaggaggaggagga	0.369													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55324336	55324338	+	IGR	DEL	TTC	-	-	rs11467745		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55324336_55324338delTTC								TFAP2C (110000 upstream) : BMP7 (419471 downstream)																							TGTTAAAGAGTTCTTCTACAAGC	0.453													1	5	---	---	---	---	
PMEPA1	56937	broad.mit.edu	37	20	56263404	56263405	+	Intron	INS	-	GTGGGGTGGA	GTGGGGTGGA	rs138892284	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56263404_56263405insGTGGGGTGGA	uc002xyq.2	-						PMEPA1_uc002xyr.2_Intron|PMEPA1_uc002xys.2_Intron|PMEPA1_uc002xyt.2_Intron	NM_020182	NP_064567	Q969W9	PMEPA_HUMAN	transmembrane prostate androgen-induced protein						androgen receptor signaling pathway	integral to membrane|plasma membrane	WW domain binding			pancreas(1)	1						gacacttctttgtggggtgggc	0.139													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57304742	57304743	+	IGR	DEL	AC	-	-	rs148641078		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57304742_57304743delAC								NPEPL1 (13375 upstream) : MIR296 (87927 downstream)																							tcagctacatacacacacacac	0.000													4	2	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	59950943	59950945	+	Intron	DEL	TGG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59950943_59950945delTGG	uc002ybn.1	+							NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			gtggtggtgatggtgtggtttgt	0.020													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	60538360	60538360	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60538360delC								MIR1257 (9642 upstream) : TAF4 (11495 downstream)																							CCAAACCACACCCACCGCCGG	0.657													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	62881188	62881188	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62881188delT								MYT1 (7584 upstream) : PCMTD2 (5860 downstream)																							gcccggctaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	62947578	62947578	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62947578delT								PCMTD2 (40000 upstream) : None (None downstream)																							tttaaatttattttttttttG	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9843638	9843638	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9843638delA								None (None upstream) : None (None downstream)																							AAATGCATGCACTTTCAAATG	0.194													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9846116	9846117	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9846116_9846117insA								None (None upstream) : None (None downstream)																							gacgcaggagcaaaaaaatgac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10620753	10620754	+	IGR	INS	-	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10620753_10620754insG								None (None upstream) : TPTE (285989 downstream)																							ctctcactcttgctctctttcc	0.158													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11084479	11084479	+	Intron	DEL	A	-	-	rs112755619		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11084479delA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGGGGGTCATAAAACCAGAAA	0.269													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14343426	14343427	+	IGR	INS	-	A	A	rs150026790		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14343426_14343427insA								None (None upstream) : C21orf99 (67060 downstream)																							tgccctgtgataaagtatgacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	24491072	24491073	+	IGR	DEL	AT	-	-	rs77984492		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24491072_24491073delAT								None (None upstream) : None (None downstream)																							GTACACAAACATAGCATTACAT	0.252													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40746878	40746878	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40746878delT								HMGN1 (25608 upstream) : WRB (5335 downstream)																							cctccccccctttttttttga	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	45269720	45269720	+	IGR	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45269720delG								LOC284837 (37272 upstream) : AGPAT3 (15396 downstream)																							GACCATAGCTGGGAAATGGCA	0.413													4	2	---	---	---	---	
COL18A1	80781	broad.mit.edu	37	21	46917164	46917165	+	Intron	INS	-	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46917164_46917165insC	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Intron	NM_130444	NP_569711	P39060	COIA1_HUMAN	alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CCTTGGCCCTTCCTGCGGGCCC	0.644													4	2	---	---	---	---	
PCBP3	54039	broad.mit.edu	37	21	47242475	47242475	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47242475delC	uc010gqb.2	+							NM_020528	NP_065389	P57721	PCBP3_HUMAN	poly(rC) binding protein 3 isoform 1						mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		AAGGGGTGGACCTGGCATGGG	0.577													4	2	---	---	---	---	
PCBP3	54039	broad.mit.edu	37	21	47360538	47360538	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47360538delC	uc002zhq.1	+						PCBP3_uc002zhp.1_Intron|PCBP3_uc002zhs.1_Intron|PCBP3_uc002zhr.1_Intron|PCBP3_uc002zht.1_Intron	NM_020528	NP_065389	P57721	PCBP3_HUMAN	poly(rC) binding protein 3 isoform 1						mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		CAGGACTCTGCAGGCCGCTTC	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17388691	17388691	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17388691delT								HSFYL1 (78466 upstream) : GAB4 (54138 downstream)																							AGACCCATTCTTTTTATTATT	0.244													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	19648389	19648390	+	IGR	INS	-	AC	AC	rs144694600	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19648389_19648390insAC								LOC150185 (94027 upstream) : SEPT5 (53597 downstream)																							catgtcattaaacacacacaca	0.015													5	4	---	---	---	---	
TXNRD2	10587	broad.mit.edu	37	22	19910074	19910074	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19910074delT	uc011ahc.1	-						TXNRD2_uc002zql.1_Intron|TXNRD2_uc002zqm.1_Intron|TXNRD2_uc002zqn.1_Intron|TXNRD2_uc002zqo.1_Intron|TXNRD2_uc002zqp.1_Intron|TXNRD2_uc002zqr.1_Intron|TXNRD2_uc010grv.1_Intron|TXNRD2_uc002zqj.1_Intron|TXNRD2_uc002zqs.2_Intron	NM_006440	NP_006431	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2 precursor						cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)					TTTGGGTCCCTTTTTACCTAC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20745206	20745207	+	IGR	INS	-	AT	AT	rs28374383		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20745206_20745207insAT								RIMBP3 (283420 upstream) : ZNF74 (3272 downstream)																							GAGGCACACACACACATACACA	0.292													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	21978683	21978683	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21978683delA								UBE2L3 (360 upstream) : YDJC (3695 downstream)																							CTGCGGTCCCAAGAGGTCACA	0.542											OREG0026340	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
PPM1F	9647	broad.mit.edu	37	22	22278054	22278054	+	Intron	DEL	T	-	-	rs75904175		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22278054delT	uc002zvp.1	-						PPM1F_uc011aik.1_Intron	NM_014634	NP_055449	P49593	PPM1F_HUMAN	protein phosphatase 1F						apoptosis|protein dephosphorylation	protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			ovary(2)|large_intestine(1)|breast(1)|kidney(1)	5	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		GAGCTCCCCCtttttttcttt	0.299													2	5	---	---	---	---	
PIWIL3	440822	broad.mit.edu	37	22	25168693	25168693	+	Intron	DEL	G	-	-	rs67559281		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25168693delG	uc003abd.1	-						PIWIL3_uc011ajx.1_Intron|PIWIL3_uc011ajy.1_Intron|PIWIL3_uc010gut.1_Intron	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3						cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						GTGCTTAGGTGGGTGCACAGC	0.502											OREG0026416	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	5	---	---	---	---	
ASPHD2	57168	broad.mit.edu	37	22	26839376	26839377	+	3'UTR	INS	-	T	T	rs35706917		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26839376_26839377insT	uc003acg.2	+	4						NM_020437	NP_065170	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2						peptidyl-amino acid modification	integral to endoplasmic reticulum membrane	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity			ovary(1)	1						ATTTCCTTAGATTTTTTTTTTT	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	28070609	28070610	+	IGR	INS	-	TC	TC	rs138116710	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28070609_28070610insTC								MIAT (955660 upstream) : MN1 (73656 downstream)																							cccttttcccttctcttttcct	0.069													4	3	---	---	---	---	
MN1	4330	broad.mit.edu	37	22	28198874	28198875	+	5'Flank	INS	-	GT	GT	rs139090764	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28198874_28198875insGT	uc003adj.2	-							NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1								binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						tttgtgcatgcgtgtgtgtgtg	0.317			T	ETV6	AML|meningioma								3	3	---	---	---	---	
HSCB	150274	broad.mit.edu	37	22	29145132	29145133	+	Intron	INS	-	A	A	rs5844822		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29145132_29145133insA	uc003aea.2	+							NM_172002	NP_741999	Q8IWL3	HSC20_HUMAN	J-type co-chaperone HSC20 precursor						iron-sulfur cluster assembly|protein folding	mitochondrion	chaperone binding|heat shock protein binding|metal ion binding			kidney(1)	1						acgtctcaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
KREMEN1	83999	broad.mit.edu	37	22	29516070	29516071	+	Intron	INS	-	AC	AC			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29516070_29516071insAC	uc011akm.1	+						KREMEN1_uc003ael.2_Intron|KREMEN1_uc011akn.1_Intron	NM_032045	NP_114434	Q96MU8	KREM1_HUMAN	kringle-containing transmembrane protein 1						cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5						tgatgaaggaaatggaggaggg	0.000													2	5	---	---	---	---	
EWSR1	2130	broad.mit.edu	37	22	29678750	29678750	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29678750delT	uc003aet.2	+						EWSR1_uc003aes.3_Intron|EWSR1_uc003aev.2_Intron|EWSR1_uc003aew.2_Intron|EWSR1_uc003aex.2_Intron|EWSR1_uc003aey.2_Intron	NM_005243	NP_005234	Q01844	EWS_HUMAN	Ewing sarcoma breakpoint region 1 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding		EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254						ttcttttttcttttttttttt	0.199			T	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1	Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma								5	5	---	---	---	---	
TCN2	6948	broad.mit.edu	37	22	31016130	31016131	+	Intron	INS	-	T	T	rs57929617		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31016130_31016131insT	uc003aip.1	+						TCN2_uc003aiq.1_Intron|TCN2_uc003air.1_Intron	NM_000355	NP_000346	P20062	TCO2_HUMAN	transcobalamin II precursor						cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular space	cobalamin binding			central_nervous_system(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	gatgacaaaacTTTTTTTTTTT	0.015													4	2	---	---	---	---	
LIMK2	3985	broad.mit.edu	37	22	31665051	31665052	+	Intron	INS	-	G	G	rs148740009		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31665051_31665052insG	uc003akh.2	+						LIMK2_uc003akg.2_Intron|LIMK2_uc003aki.2_Intron|LIMK2_uc003akj.2_Intron|LIMK2_uc003akk.2_Intron|LIMK2_uc011aln.1_Intron	NM_005569	NP_005560	P53671	LIMK2_HUMAN	LIM domain kinase 2 isoform 2a							mitochondrion|nucleus	ATP binding|protein serine/threonine kinase activity|zinc ion binding			ovary(2)	2						tttttttgtttttttttCCTGT	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34450522	34450522	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34450522delT								LARGE (131938 upstream) : None (None downstream)																							tttctttctcttttttttttt	0.000													4	2	---	---	---	---	
APOL3	80833	broad.mit.edu	37	22	36555015	36555016	+	Intron	DEL	GT	-	-	rs113377904		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36555015_36555016delGT	uc003aot.2	-						APOL3_uc003aoq.2_Intron|APOL3_uc003aor.2_Intron|APOL3_uc003aos.2_Intron|APOL3_uc003aou.2_Intron|APOL3_uc003aov.2_Intron	NM_145640	NP_663615	O95236	APOL3_HUMAN	apolipoprotein L3 isoform 1						inflammatory response|lipoprotein metabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|extracellular region	lipid binding|lipid transporter activity|signal transducer activity				0						gtgagtgtgcgtgtgtgtgtgt	0.327													4	3	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36691448	36691449	+	Intron	DEL	GT	-	-	rs111330544		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36691448_36691449delGT	uc003apg.2	-							NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						GAGGGCCACGgtgtgtgtgtgt	0.550			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				3	3	---	---	---	---	
CACNG2	10369	broad.mit.edu	37	22	37049824	37049824	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37049824delA	uc003aps.1	-							NM_006078	NP_006069	Q9Y698	CCG2_HUMAN	voltage-dependent calcium channel gamma-2						membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0						TGGGACCTTCAGGACCAGGAG	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39959354	39959355	+	IGR	INS	-	GTGA	GTGA	rs67579743		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39959354_39959355insGTGA								RPS19BP1 (30494 upstream) : CACNA1I (7403 downstream)																							attgtgtgtatgtgtgtctgtg	0.040													8	4	---	---	---	---	
GRAP2	9402	broad.mit.edu	37	22	40305407	40305407	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40305407delT	uc003ayh.1	+						GRAP2_uc003ayi.2_Intron|GRAP2_uc011aom.1_Intron|GRAP2_uc011aon.1_Intron	NM_004810	NP_004801	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2						cell-cell signaling|Ras protein signal transduction|T cell costimulation|T cell receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						GTAAGGGAGATTTATGATACA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	41049318	41049319	+	IGR	INS	-	T	T	rs140040860	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41049318_41049319insT								MKL1 (16628 upstream) : MCHR1 (25863 downstream)																							gctgagctgggctcaggtctag	0.099													4	2	---	---	---	---	
MCHR1	2847	broad.mit.edu	37	22	41076596	41076597	+	Intron	DEL	AT	-	-	rs150446007		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41076596_41076597delAT	uc003ayz.2	+						MCHR1_uc003aza.2_Intron	NM_005297	NP_005288	Q99705	MCHR1_HUMAN	G protein-coupled receptor 24						elevation of cytosolic calcium ion concentration|feeding behavior|generation of precursor metabolites and energy|inhibition of adenylate cyclase activity by G-protein signaling pathway	integral to plasma membrane|nonmotile primary cilium	neuropeptide receptor activity				0						acacacacacatacacagacac	0.376													4	4	---	---	---	---	
WBP2NL	164684	broad.mit.edu	37	22	42413128	42413129	+	Intron	DEL	TC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42413128_42413129delTC	uc011ape.1	+						WBP2NL_uc003bbt.2_Intron|WBP2NL_uc011apk.1_Intron|WBP2NL_uc003bbu.2_Intron|WBP2NL_uc003bbv.1_5'Flank	NM_152613	NP_689826	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like						egg activation|male pronucleus assembly|meiosis	perinuclear theca	WW domain binding			ovary(2)	2						ATGCTACCCATCTCTCTCTCTC	0.272													4	2	---	---	---	---	
A4GALT	53947	broad.mit.edu	37	22	43111844	43111847	+	Intron	DEL	TTTG	-	-	rs6002925		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43111844_43111847delTTTG	uc003bdb.2	-						A4GALT_uc010gzd.2_Intron	NM_017436	NP_059132	Q9NPC4	A4GAT_HUMAN	alpha 1,4-galactosyltransferase						glycosphingolipid biosynthetic process|plasma membrane organization	Golgi stack|integral to Golgi membrane|membrane fraction	lactosylceramide 4-alpha-galactosyltransferase activity			central_nervous_system(2)	2						AAtctttttttttgttttttttga	0.020													4	2	---	---	---	---	
SCUBE1	80274	broad.mit.edu	37	22	43614769	43614770	+	Intron	DEL	AA	-	-	rs74884446		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43614769_43614770delAA	uc003bdt.1	-							NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1						adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				TCTGTCACTCAAAGACTCTTGG	0.446													8	7	---	---	---	---	
SCUBE1	80274	broad.mit.edu	37	22	43735734	43735735	+	Intron	INS	-	T	T	rs140821632	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43735734_43735735insT	uc003bdt.1	-						SCUBE1_uc003bdu.1_Intron	NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1						adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				TCCTCATTCTACCCCCCACAAG	0.579													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	43923400	43923400	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43923400delA								MPPED1 (20601 upstream) : EFCAB6 (1254 downstream)																							AGATGGAAACAAAGGTGACCC	0.602													4	2	---	---	---	---	
SAMM50	25813	broad.mit.edu	37	22	44363406	44363406	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44363406delC	uc003bej.2	+						SAMM50_uc011aqd.1_Intron	NM_015380	NP_056195	Q9Y512	SAM50_HUMAN	sorting and assembly machinery component 50						protein import into mitochondrial outer membrane	integral to membrane|integral to membrane of membrane fraction|mitochondrial sorting and assembly machinery complex	protein binding			skin(1)	1		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				tgaaatgtctccagggtctgt	0.000													4	2	---	---	---	---	
LDOC1L	84247	broad.mit.edu	37	22	44891428	44891430	+	3'UTR	DEL	AGG	-	-	rs5845652		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44891428_44891430delAGG	uc003beu.1	-	2						NM_032287	NP_115663	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like											ovary(1)	1		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		GTCCTTCAGAAGGAGGACATGCA	0.532													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	45049014	45049014	+	IGR	DEL	G	-	-	rs66823382		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45049014delG								NCRNA00207 (80685 upstream) : PRR5 (15579 downstream)																							tgaagaaggtgaagatgaaag	0.015													4	2	---	---	---	---	
C22orf9	23313	broad.mit.edu	37	22	45604195	45604196	+	Intron	INS	-	C	C	rs113980203		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45604195_45604196insC	uc003bfx.1	-						C22orf9_uc010gzw.1_5'Flank|C22orf9_uc003bfv.1_Intron|C22orf9_uc003bfw.1_Intron|C22orf9_uc010gzx.2_Intron	NM_001009880	NP_001009880	Q6ICG6	K0930_HUMAN	hypothetical protein LOC23313 isoform b								protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|READ - Rectum adenocarcinoma(1;0.000617)|Colorectal(1;0.0024)		aacaggcagaaccaCCGACTCC	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48195361	48195362	+	Intron	INS	-	A	A	rs145095303	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48195361_48195362insA	uc003bik.1	+											Homo sapiens cDNA FLJ35788 fis, clone TESTI2005683.																		aaactatgaacaactgtatgcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49339205	49339208	+	IGR	DEL	GTAT	-	-	rs4465880	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49339205_49339208delGTAT								FAM19A5 (191463 upstream) : C22orf34 (468968 downstream)																							GAATGAGTGAGTATCTGTGATTGG	0.456													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	50346330	50346331	+	IGR	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50346330_50346331delTG								CRELD2 (25144 upstream) : PIM3 (7812 downstream)																							tgtgtgtggttgtgtgtgtgtg	0.322													4	2	---	---	---	---	
TTLL8	164714	broad.mit.edu	37	22	50467769	50467770	+	Intron	INS	-	C	C			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50467769_50467770insC	uc011ark.1	-							NM_001080447	NP_001073916			tubulin tyrosine ligase-like family, member 8											ovary(2)	2		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)		CCTCGTAAAGACCCCATCACAC	0.554													4	2	---	---	---	---	
MOV10L1	54456	broad.mit.edu	37	22	50573450	50573451	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50573450_50573451insT	uc003bjj.2	+						MOV10L1_uc003bjk.3_Intron|MOV10L1_uc011arp.1_Intron|MOV10L1_uc011arq.1_Intron|MOV10L1_uc010hao.1_Intron	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1						germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		tcttttctttcttttttttttg	0.139													4	2	---	---	---	---	
PLCXD1	55344	broad.mit.edu	37	X	201326	201327	+	Intron	DEL	CA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:201326_201327delCA	uc004cpc.2	+						PLCXD1_uc011mgx.1_Intron	NM_018390	NP_060860	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X						intracellular signal transduction|lipid metabolic process		phospholipase C activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				tgcacatctgcacacacacatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	981273	981273	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:981273delC								SHOX (361128 upstream) : CRLF2 (333614 downstream)																							aaactctataccccccccaaa	0.000													2	6	---	---	---	---	
ASMTL	8623	broad.mit.edu	37	X	1543842	1543845	+	Intron	DEL	TCCA	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1543842_1543845delTCCA	uc004cpx.1	-						ASMTL_uc011mhe.1_Intron|ASMTL_uc004cpy.1_Intron|ASMTL_uc011mhf.1_Intron	NM_004192	NP_004183	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like						melatonin biosynthetic process	cytoplasm	acetylserotonin O-methyltransferase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				aatccatctgtccatccatccatc	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2126219	2126219	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2126219delA								ASMT (364246 upstream) : DHRSX (11338 downstream)																							ccatctgaagaaaaaaaaaaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2135349	2135350	+	IGR	DEL	AC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2135349_2135350delAC								ASMT (373376 upstream) : DHRSX (2207 downstream)																							acagaagaagacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	3482552	3482553	+	IGR	INS	-	A	A	rs34737922		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3482552_3482553insA								MXRA5 (217868 upstream) : PRKX (39860 downstream)																							gctcctgATGTAAaaaaaaaaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	3740982	3740985	+	Intron	DEL	GTGT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3740982_3740985delGTGT	uc004crj.2	-						uc011mhk.1_Intron					Homo sapiens similar to Serine/threonine-protein kinase PRKX (Protein kinase PKX1), mRNA (cDNA clone IMAGE:4124593), partial cds.																		GGAACACTCAGTGTGTGTGTGGCA	0.392													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	3888724	3888725	+	IGR	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3888724_3888725insA								PRKX (257063 upstream) : None (None downstream)																							gtccctaagccagggaccaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	4138202	4138204	+	IGR	DEL	ATT	-	-	rs10573573		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:4138202_4138204delATT								PRKX (506541 upstream) : None (None downstream)																							ATTTTGGAACATTAACGGCTGAA	0.340													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	6451611	6451614	+	IGR	DEL	CCCT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6451611_6451614delCCCT								NLGN4X (304905 upstream) : VCX3A (46 downstream)																							acctcttcccccctccctccctcc	0.181													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	6554965	6554965	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6554965delT								VCX3A (101806 upstream) : HDHD1A (411996 downstream)																							CATAAACTCATTTTGACATTC	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	6693546	6693547	+	IGR	DEL	AC	-	-	rs58738229	by1000genomes	TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6693546_6693547delAC								VCX3A (240387 upstream) : HDHD1A (273414 downstream)																							acacacacatacacacacacac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	8715652	8715654	+	IGR	DEL	TTG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8715652_8715654delTTG								KAL1 (15425 upstream) : FAM9A (43185 downstream)																							CTGAGTTttattgttgttgttgt	0.099													4	2	---	---	---	---	
NHS	4810	broad.mit.edu	37	X	17546131	17546131	+	Intron	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17546131delC	uc004cxx.2	+						NHS_uc011mix.1_Intron	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1							nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					CCTTTCTGCTCCCAACCCCAC	0.433													4	2	---	---	---	---	
MAP7D2	256714	broad.mit.edu	37	X	20073724	20073724	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20073724delA	uc004czr.1	-						MAP7D2_uc004czq.1_Intron|MAP7D2_uc011mji.1_Intron|MAP7D2_uc010nfo.1_Intron|MAP7D2_uc011mjj.1_Intron|MAP7D2_uc004czs.1_Intron	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2											ovary(2)|breast(1)	3						CATTGCTAGGAAAAAAAAATT	0.423													6	3	---	---	---	---	
SMS	6611	broad.mit.edu	37	X	21957041	21957041	+	5'Flank	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21957041delT	uc004dag.2	+						SMS_uc011mjq.1_5'Flank|SMS_uc004daf.1_5'Flank	NM_004595	NP_004586	P52788	SPSY_HUMAN	spermine synthase						methionine metabolic process|spermine biosynthetic process	cytosol	spermidine synthase activity|spermine synthase activity			ovary(1)	1					Spermine(DB00127)	gtagttgggattacaggtgtg	0.000													4	2	---	---	---	---	
PRDX4	10549	broad.mit.edu	37	X	23702003	23702004	+	Intron	INS	-	A	A	rs34374279		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23702003_23702004insA	uc004dam.2	+							NM_006406	NP_006397	Q13162	PRDX4_HUMAN	peroxiredoxin 4						cell redox homeostasis|I-kappaB phosphorylation		thioredoxin peroxidase activity			upper_aerodigestive_tract(1)	1						tactaaaatacaaaaaaaaaaa	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	25128561	25128562	+	IGR	INS	-	AA	AA			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:25128561_25128562insAA								ARX (94496 upstream) : None (None downstream)																							catgcccagctgtttctatttt	0.000													0	6	---	---	---	---	
IL1RAPL1	11141	broad.mit.edu	37	X	29697015	29697015	+	Intron	DEL	G	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29697015delG	uc004dby.2	+							NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1						innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						CAAAAAGCCAGGAAGTTGCTT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	31046894	31046896	+	IGR	DEL	TCC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31046894_31046896delTCC								TAB3 (53693 upstream) : FTHL17 (42462 downstream)																							ctcctcctcttcctcctcctcct	0.020													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	31081528	31081528	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31081528delC								TAB3 (88327 upstream) : FTHL17 (7830 downstream)																							GACACTTTGGCCAACAAGGGG	0.418													4	2	---	---	---	---	
DMD	1756	broad.mit.edu	37	X	31195897	31195898	+	Intron	INS	-	A	A			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31195897_31195898insA	uc004dda.1	-						DMD_uc004dcq.1_Intron|DMD_uc004dcr.1_Intron|DMD_uc004dcs.1_Intron|DMD_uc004dct.1_Intron|DMD_uc004dcu.1_Intron|DMD_uc004dcv.1_Intron|DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc004dcm.1_Intron|DMD_uc004dcn.1_Intron|DMD_uc004dco.1_Intron|DMD_uc004dcp.1_Intron|DMD_uc011mkb.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATCAAGAAAAGAAAAAAAAAAA	0.312													5	3	---	---	---	---	
DMD	1756	broad.mit.edu	37	X	31238452	31238452	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31238452delT	uc004dda.1	-						DMD_uc004dcq.1_Intron|DMD_uc004dcr.1_Intron|DMD_uc004dcs.1_Intron|DMD_uc004dct.1_Intron|DMD_uc004dcu.1_Intron|DMD_uc004dcv.1_Intron|DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc004dcm.1_Intron|DMD_uc004dcn.1_Intron|DMD_uc004dco.1_Intron|DMD_uc004dcp.1_Intron|DMD_uc011mkb.1_Intron|DMD_uc010ngm.2_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				tttggttcacttttgaactca	0.000													4	2	---	---	---	---	
DMD	1756	broad.mit.edu	37	X	32588528	32588531	+	Intron	DEL	CAAG	-	-	rs145102206		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32588528_32588531delCAAG	uc004dda.1	-						DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCTTTGTTCACAAGCAAGGTGACA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48290024	48290025	+	IGR	INS	-	AATC	AATC	rs111347561		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48290024_48290025insAATC								SSX4 (37239 upstream) : SLC38A5 (26903 downstream)																							acatgtgtgttaggctcagaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48474178	48474178	+	IGR	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48474178delT								WDR13 (10604 upstream) : WAS (68008 downstream)																							cttcttcttcttttttttttt	0.189													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	62630549	62630550	+	IGR	DEL	AG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62630549_62630550delAG								SPIN4 (59331 upstream) : LOC92249 (15889 downstream)																							aaagaggcaaagagagagagga	0.000													5	3	---	---	---	---	
ZC4H2	55906	broad.mit.edu	37	X	64148773	64148773	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64148773delT	uc004dvu.2	-						ZC4H2_uc004dvv.2_Intron|ZC4H2_uc011mov.1_Intron|ZC4H2_uc011mow.1_Intron|ZC4H2_uc004dvw.1_Intron	NM_018684	NP_061154	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing								metal ion binding|protein binding			ovary(1)	1						tttctccttcttttttttttt	0.000													3	3	---	---	---	---	
ATRX	546	broad.mit.edu	37	X	77028948	77028948	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77028948delA	uc004ecp.3	-						ATRX_uc004ecq.3_Intron|ATRX_uc004eco.3_Intron|ATRX_uc004ecr.2_Intron|ATRX_uc010nlx.1_Intron|ATRX_uc010nly.1_Intron	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1						DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	CATGAGAAGCAAAATCggcca	0.169			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						4	2	---	---	---	---	
ATP7A	538	broad.mit.edu	37	X	77239829	77239829	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77239829delT	uc004ecx.3	+						ATP7A_uc004ecw.2_Intron	NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide						ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						cataagtACCttttttttttt	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	84390581	84390582	+	IGR	DEL	TG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84390581_84390582delTG								SATL1 (26607 upstream) : ZNF711 (108415 downstream)																							AGATAAATCTTGTGTGTGTGTG	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	90031512	90031512	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90031512delC								TGIF2LX (853632 upstream) : PABPC5 (658085 downstream)																							gacttaccctccactgtgaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	100165575	100165575	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100165575delA								NOX1 (36241 upstream) : XKRX (2856 downstream)																							attccgtcttaaaaaaaaaaa	0.234													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	100847465	100847465	+	IGR	DEL	T	-	-	rs35353324		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100847465delT								ARMCX1 (37792 upstream) : ARMCX6 (22649 downstream)																							tgcctggccCttttttttttt	0.005													3	3	---	---	---	---	
ACSL4	2182	broad.mit.edu	37	X	108944448	108944449	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108944448_108944449insT	uc004eoi.2	-						ACSL4_uc004eoj.2_Intron|ACSL4_uc004eok.2_Intron|ACSL4_uc010npp.1_Intron	NM_022977	NP_075266	O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4						fatty acid metabolic process|learning or memory|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			large_intestine(1)|lung(1)|ovary(1)	3					Icosapent(DB00159)|Troglitazone(DB00197)	ACACACATACAttttttttttt	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	113241191	113241191	+	IGR	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:113241191delA								None (None upstream) : HTR2C (577360 downstream)																							ggatccagggaaaggcataga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	117272986	117272987	+	IGR	DEL	TG	-	-	rs66741040		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117272986_117272987delTG								KLHL13 (22198 upstream) : WDR44 (207055 downstream)																							CAGACTCTTTtgtgtgtgtgtg	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	118154432	118154433	+	IGR	INS	-	TG	TG			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118154432_118154433insTG								LONRF3 (2485 upstream) : KIAA1210 (58166 downstream)																							tttctttcttttgtgtgtgtgt	0.000													4	3	---	---	---	---	
SEPT6	23157	broad.mit.edu	37	X	118811097	118811097	+	Intron	DEL	C	-	-	rs111528750		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118811097delC	uc004erv.2	-						SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Intron|SEPT6_uc004ert.2_Intron|SEPT6_uc004eru.2_Intron|SEPT6_uc004erw.2_5'Flank|SEPT6_uc011mtv.1_Intron|SEPT6_uc011mtw.1_Intron	NM_015129	NP_055944	Q14141	SEPT6_HUMAN	septin 6 isoform B						cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4						CACTGTGGCTCCCTATGGCTA	0.517													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	120389167	120389168	+	IGR	DEL	GT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:120389167_120389168delGT								GLUD2 (205373 upstream) : None (None downstream)																							gtatatttgcgtgtgtgtgtgt	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	122711813	122711814	+	IGR	INS	-	G	G			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122711813_122711814insG								MIR220A (15758 upstream) : THOC2 (22599 downstream)																							cagggcaatcaggtaagagaaa	0.000													4	2	---	---	---	---	
STAG2	10735	broad.mit.edu	37	X	123093831	123093831	+	5'Flank	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123093831delT	uc004etz.3	+						STAG2_uc004eua.2_5'Flank|STAG2_uc004eub.2_5'Flank|STAG2_uc004euc.2_5'Flank|STAG2_uc004eud.2_5'Flank|STAG2_uc004eue.2_5'Flank	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b						cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						ACTTGGGTTCTTTTGGTGGGA	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	124950046	124950047	+	IGR	DEL	GT	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:124950046_124950047delGT								ODZ1 (852380 upstream) : DCAF12L2 (348467 downstream)																							TGgtgtgtgagtgtgtgtgtgt	0.282													4	2	---	---	---	---	
ZDHHC9	51114	broad.mit.edu	37	X	128978175	128978176	+	5'Flank	DEL	CG	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128978175_128978176delCG	uc004euv.2	-						ZDHHC9_uc004euw.2_5'Flank|ZDHHC9_uc004eux.1_5'Flank|ZDHHC9_uc004euy.1_5'Flank	NM_001008222	NP_001008223	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC domain containing 9							endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1						CCTacacacacgcgcgcgcgcg	0.366													4	2	---	---	---	---	
ELF4	2000	broad.mit.edu	37	X	129226982	129226982	+	Intron	DEL	A	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129226982delA	uc004evd.3	-						ELF4_uc004eve.3_Intron	NM_001421	NP_001412	Q99607	ELF4_HUMAN	E74-like factor 4						natural killer cell proliferation|NK T cell proliferation|positive regulation of transcription from RNA polymerase II promoter	PML body	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						gaatactgttaaaaaaaaaaa	0.000			T	ERG	AML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	145228632	145228632	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:145228632delC								MIR891A (119242 upstream) : CXorf51 (662670 downstream)																							ATCATCTGTTCATCATCTATT	0.279													4	2	---	---	---	---	
MAMLD1	10046	broad.mit.edu	37	X	149537427	149537427	+	Intron	DEL	T	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149537427delT	uc011mxu.1	+						MAMLD1_uc011mxt.1_Intron			Q13495	MAMD1_HUMAN	RecName: Full=Mastermind-like domain-containing protein 1;          Short=Protein CG1; AltName: Full=F18;						male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(192;6.56e-05)					AAGATTCTGATTTTTTTTTTT	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	150495225	150495225	+	IGR	DEL	C	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150495225delC								GPR50 (145295 upstream) : VMA21 (70480 downstream)																							TTGGAGCTCTCCTAGGTCCAG	0.428													4	2	---	---	---	---	
F8	2157	broad.mit.edu	37	X	154237356	154237357	+	Intron	INS	-	T	T			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154237356_154237357insT	uc004fmt.2	-						F8_uc011mzx.1_Intron	NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor						acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	agtaacaTTAAttttttttttt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9941533	9941533	+	IGR	DEL	T	-	-	rs111836903		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9941533delT								TTTY22 (290679 upstream) : None (None downstream)																							TATAATTCCCTTCTTTTAACC	0.289													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9960883	9960883	+	IGR	DEL	A	-	-	rs146746526		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9960883delA								TTTY22 (310029 upstream) : None (None downstream)																							TTGGCTAAACAAGATGTTTGC	0.473													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13705259	13705263	+	IGR	DEL	ATCAG	-	-	rs138301584		TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13705259_13705263delATCAG								None (None upstream) : None (None downstream)																							atggaatggaatcagatggaacaga	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58976680	58976689	+	IGR	DEL	TGCATTCTGC	-	-			TCGA-66-2734-01	TCGA-66-2734-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58976680_58976689delTGCATTCTGC								None (None upstream) : None (None downstream)																							tctattccattgcattctgctgaattccat	0.019													5	3	---	---	---	---	
