Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRAMEF2	65122	broad.mit.edu	37	1	12920019	12920019	+	Silent	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12920019A>T	uc001aum.1	+	3	846	c.759A>T	c.(757-759)GGA>GGT	p.G253G		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	253											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AACTCGAGGGATGGTTAGTCA	0.438													19	58	---	---	---	---	PASS
CASP9	842	broad.mit.edu	37	1	15844829	15844829	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15844829C>A	uc001awn.2	-	2	289	c.194G>T	c.(193-195)CGA>CTA	p.R65L	CASP9_uc001awm.1_Missense_Mutation_p.R65L|CASP9_uc001awo.2_Missense_Mutation_p.R65L|CASP9_uc001awp.2_5'UTR|CASP9_uc009voi.2_5'UTR|CASP9_uc010obm.1_5'UTR|CASP9_uc001awq.2_5'UTR	NM_001229	NP_001220	P55211	CASP9_HUMAN	caspase 9 isoform alpha preproprotein	65	CARD.				activation of caspase activity by cytochrome c|induction of apoptosis by intracellular signals|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol	cysteine-type endopeptidase activity|enzyme activator activity|protein binding			central_nervous_system(1)|kidney(1)	2		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		CTGACTCCCTCGAGTCTCCAG	0.527													4	83	---	---	---	---	PASS
SDC3	9672	broad.mit.edu	37	1	31349950	31349950	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31349950C>A	uc001bse.2	-	3	366	c.319G>T	c.(319-321)GTG>TTG	p.V107L	SDC3_uc001bsd.2_Missense_Mutation_p.V49L	NM_014654	NP_055469	O75056	SDC3_HUMAN	syndecan 3	107	Extracellular (Potential).					integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(586;0.0393)|Colorectal(325;0.0466)|all_neural(195;0.0966)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0197)|READ - Rectum adenocarcinoma(331;0.0649)		GTGGTGGACACCGCCAGGGCT	0.647													5	11	---	---	---	---	PASS
HIVEP3	59269	broad.mit.edu	37	1	42045717	42045717	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42045717T>G	uc001cgz.3	-	4	5965	c.4752A>C	c.(4750-4752)CAA>CAC	p.Q1584H	HIVEP3_uc001cha.3_Missense_Mutation_p.Q1584H|HIVEP3_uc001cgy.2_RNA	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer	1584					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CCGTACCTTCTTGTGACTTGG	0.488													43	31	---	---	---	---	PASS
LEPRE1	64175	broad.mit.edu	37	1	43218306	43218306	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43218306G>A	uc001chv.2	-	9	1488	c.1375C>T	c.(1375-1377)CTC>TTC	p.L459F	LEPRE1_uc001chw.2_Missense_Mutation_p.L459F|LEPRE1_uc001chx.3_Missense_Mutation_p.L459F	NM_022356	NP_071751	Q32P28	P3H1_HUMAN	leprecan 1 isoform 1	459					negative regulation of cell proliferation	endoplasmic reticulum|proteinaceous extracellular matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			ovary(3)|lung(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TTCATGGTGAGACTGATGCCT	0.507													19	30	---	---	---	---	PASS
HECTD3	79654	broad.mit.edu	37	1	45469399	45469399	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45469399C>T	uc009vxk.2	-	20	2541	c.2443G>A	c.(2443-2445)GAC>AAC	p.D815N	HECTD3_uc001cmx.3_Missense_Mutation_p.D164N|HECTD3_uc001cmy.3_Missense_Mutation_p.D425N|HECTD3_uc010olh.1_Missense_Mutation_p.D531N	NM_024602	NP_078878	Q5T447	HECD3_HUMAN	HECT domain containing 3	815	HECT.				proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm	ubiquitin-protein ligase activity				0	Acute lymphoblastic leukemia(166;0.155)					GGCAGCGCGTCTGTGGTCTCG	0.612													11	32	---	---	---	---	PASS
PDZK1IP1	10158	broad.mit.edu	37	1	47653062	47653062	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47653062G>A	uc001cqw.2	-	2	272	c.105C>T	c.(103-105)ATC>ATT	p.I35I		NM_005764	NP_005755	Q13113	PDZ1I_HUMAN	PDZK1 interacting protein 1	35	Helical; (Potential).					integral to membrane					0						CGGCCACCGCGATAAGGCCCT	0.632													9	22	---	---	---	---	PASS
RAB3B	5865	broad.mit.edu	37	1	52442657	52442657	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52442657C>T	uc001cth.2	-	2	258	c.133G>A	c.(133-135)GAC>AAC	p.D45N		NM_002867	NP_002858	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family	45					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(1)	1						GTGAACGTGTCATCAGCATAG	0.502													23	64	---	---	---	---	PASS
ATG4C	84938	broad.mit.edu	37	1	63270862	63270862	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63270862G>C	uc001dat.2	+	3	258	c.96G>C	c.(94-96)AAG>AAC	p.K32N	ATG4C_uc001dau.2_Missense_Mutation_p.K32N	NM_178221	NP_835739	Q96DT6	ATG4C_HUMAN	APG4 autophagy 4 homolog C isoform 8	32					autophagic vacuole assembly|protein targeting to membrane|proteolysis	cytosol|extracellular region	cysteine-type endopeptidase activity			ovary(1)	1						TGAAAACAAAGACGTATTTTA	0.254													3	11	---	---	---	---	PASS
SLC35D1	23169	broad.mit.edu	37	1	67518532	67518532	+	Silent	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67518532G>T	uc001ddk.2	-	3	630	c.246C>A	c.(244-246)GCC>GCA	p.A82A	SLC35D1_uc010oph.1_Silent_p.A3A	NM_015139	NP_055954	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-glucuronic	82	Helical; (Potential).				chondroitin sulfate biosynthetic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	integral to endoplasmic reticulum membrane	UDP-glucuronic acid transmembrane transporter activity|UDP-N-acetylgalactosamine transmembrane transporter activity				0					Lorazepam(DB00186)	CTGCCACTGTGGCCACCATCT	0.433													5	78	---	---	---	---	PASS
PTBP2	58155	broad.mit.edu	37	1	97189161	97189161	+	Intron	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97189161A>G	uc001drq.2	+						PTBP2_uc001drn.2_Intron|PTBP2_uc001dro.2_Intron|PTBP2_uc010otz.1_Intron|PTBP2_uc001drp.2_Intron|PTBP2_uc009wdw.2_Intron|PTBP2_uc001drr.2_Intron|PTBP2_uc010oua.1_Intron|PTBP2_uc001dru.2_Intron|PTBP2_uc001drm.2_Intron	NM_021190	NP_067013	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2								nucleotide binding				0		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		GTAGGAAAATACTATGTTTGA	0.343													19	34	---	---	---	---	PASS
OLFM3	118427	broad.mit.edu	37	1	102270309	102270309	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102270309G>A	uc001duf.2	-	6	993	c.922C>T	c.(922-924)CAG>TAG	p.Q308*	OLFM3_uc001dug.2_Nonsense_Mutation_p.Q288*|OLFM3_uc001duh.2_RNA|OLFM3_uc001dui.2_RNA|OLFM3_uc001duj.2_Nonsense_Mutation_p.Q213*|OLFM3_uc001due.2_RNA	NM_058170	NP_477518	Q96PB7	NOE3_HUMAN	olfactomedin 3	308	Olfactomedin-like.					extracellular region				ovary(2)|skin(1)	3		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		ATATTACTCTGATACTTGTTA	0.423													17	12	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120464395	120464395	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120464395C>A	uc001eik.2	-	29	5507	c.5251G>T	c.(5251-5253)GGT>TGT	p.G1751C		NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	1751	Cytoplasmic (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTTCCAGTACCAATTAGGTTA	0.398			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				4	44	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144921868	144921868	+	Silent	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144921868T>C	uc001elw.3	-	9	1452	c.1161A>G	c.(1159-1161)GAA>GAG	p.E387E	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Silent_p.E453E|PDE4DIP_uc001emc.1_Silent_p.E387E|PDE4DIP_uc001emd.1_Silent_p.E387E|PDE4DIP_uc001emb.1_Silent_p.E550E|PDE4DIP_uc001eme.1_5'UTR|PDE4DIP_uc001emf.1_Silent_p.E174E	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	387	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTTTCTGCTGTTCACTCTCGT	0.438			T	PDGFRB	MPD								34	233	---	---	---	---	PASS
OTUD7B	56957	broad.mit.edu	37	1	149916189	149916189	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149916189C>T	uc001etn.2	-	12	2455	c.2099G>A	c.(2098-2100)CGG>CAG	p.R700Q		NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne	700					negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			CCCAGACGGCCGAGGGATAGT	0.642													21	16	---	---	---	---	PASS
CGN	57530	broad.mit.edu	37	1	151508751	151508751	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151508751A>T	uc009wmw.2	+	19	3380	c.3236A>T	c.(3235-3237)GAG>GTG	p.E1079V	CGN_uc010pde.1_Missense_Mutation_p.E73V	NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin	1073	Potential.					myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CGAAAACTGGAGCGGAAAGTT	0.483													23	69	---	---	---	---	PASS
LCE1C	353133	broad.mit.edu	37	1	152777718	152777718	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152777718G>T	uc001fap.1	-	2	288	c.237C>A	c.(235-237)CAC>CAA	p.H79Q		NM_178351	NP_848128	Q5T751	LCE1C_HUMAN	late cornified envelope 1C	79	Gly-rich.				keratinization						0	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGCGCCTGTGGTGGCTCAGGC	0.706													23	21	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	154026870	154026870	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154026870C>G	uc001fdw.2	-	25	3389	c.3317G>C	c.(3316-3318)GGT>GCT	p.G1106A	NUP210L_uc009woq.2_Missense_Mutation_p.G15A|NUP210L_uc010peh.1_Missense_Mutation_p.G1106A	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	1106						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CTGGGGGCCACCTTCAGACAT	0.448													17	29	---	---	---	---	PASS
ETV3L	440695	broad.mit.edu	37	1	157068929	157068929	+	Intron	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157068929T>C	uc001fqq.1	-							NM_001004341	NP_001004341	Q6ZN32	ETV3L_HUMAN	ets variant 3-like							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Hepatocellular(266;0.158)	Prostate(1639;0.184)				CCGCCTCCTCTCACCTGAGGG	0.572													15	41	---	---	---	---	PASS
OR6N1	128372	broad.mit.edu	37	1	158736433	158736433	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158736433T>C	uc010piq.1	-	1	40	c.40A>G	c.(40-42)ATC>GTC	p.I14V		NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N,	14	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					AAGCCCAAGATGATGAATTCT	0.458													15	19	---	---	---	---	PASS
PYHIN1	149628	broad.mit.edu	37	1	158911763	158911763	+	Intron	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158911763G>C	uc001ftb.2	+						PYHIN1_uc001ftc.2_Intron|PYHIN1_uc001ftd.2_Intron|PYHIN1_uc001fte.2_Intron	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1						cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					TGTATCATGCGCAGAGCCTAA	0.408													14	7	---	---	---	---	PASS
KCNJ10	3766	broad.mit.edu	37	1	160011200	160011200	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160011200G>T	uc001fuw.1	-	2	1273	c.1123C>A	c.(1123-1125)CGC>AGC	p.R375S		NM_002241	NP_002232	P78508	IRK10_HUMAN	potassium inwardly-rectifying channel, subfamily	375	Cytoplasmic (By similarity).					integral to plasma membrane	ATP binding|ATP-activated inward rectifier potassium channel activity			ovary(1)	1	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TTGCTGATGCGCACACTAAGG	0.532													9	5	---	---	---	---	PASS
LMX1A	4009	broad.mit.edu	37	1	165177302	165177302	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165177302G>T	uc001gcy.1	-	6	1036	c.815C>A	c.(814-816)TCT>TAT	p.S272Y	LMX1A_uc001gcz.1_Missense_Mutation_p.S272Y|LMX1A_uc001gcw.1_Translation_Start_Site|LMX1A_uc001gcx.1_Missense_Mutation_p.S23Y	NM_177398	NP_796372	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	272	Gln-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5	all_hematologic(923;0.248)					CAGCTTACCAGAGCTCAGCCT	0.552													7	17	---	---	---	---	PASS
LMX1A	4009	broad.mit.edu	37	1	165177303	165177303	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165177303A>C	uc001gcy.1	-	6	1035	c.814T>G	c.(814-816)TCT>GCT	p.S272A	LMX1A_uc001gcz.1_Missense_Mutation_p.S272A|LMX1A_uc001gcw.1_5'UTR|LMX1A_uc001gcx.1_Missense_Mutation_p.S23A	NM_177398	NP_796372	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	272	Gln-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5	all_hematologic(923;0.248)					AGCTTACCAGAGCTCAGCCTC	0.552													7	17	---	---	---	---	PASS
PRRX1	5396	broad.mit.edu	37	1	170689004	170689004	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170689004C>G	uc001ghf.2	+	2	426	c.379C>G	c.(379-381)CTT>GTT	p.L127V	PRRX1_uc001ghe.2_Missense_Mutation_p.L127V	NM_022716	NP_073207	P54821	PRRX1_HUMAN	paired mesoderm homeobox 1 isoform pmx-1b	127	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GCGAGAAGACCTTGCCCGCCG	0.552													13	39	---	---	---	---	PASS
FMO4	2329	broad.mit.edu	37	1	171310617	171310617	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171310617C>T	uc001gho.2	+	10	1533	c.1316C>T	c.(1315-1317)GCC>GTC	p.A439V		NM_002022	NP_002013	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	439					xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			kidney(2)|skin(1)	3	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					GATATCGCTGCCTGCATAGGC	0.458													8	24	---	---	---	---	PASS
RFWD2	64326	broad.mit.edu	37	1	175958605	175958605	+	Silent	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175958605G>C	uc001gku.1	-	16	1996	c.1740C>G	c.(1738-1740)GTC>GTG	p.V580V	RFWD2_uc001gkv.1_Silent_p.V556V|RFWD2_uc001gkw.1_Silent_p.V340V|RFWD2_uc009wwv.2_Silent_p.V379V|RFWD2_uc001gkt.1_Silent_p.V419V	NM_022457	NP_071902	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2 isoform a	580	WD 4.				DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	centrosome|cytosol|focal adhesion|nuclear speck	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0						CATAGTAGTGGACACAGTGAT	0.328													10	33	---	---	---	---	PASS
C1orf125	126859	broad.mit.edu	37	1	179380413	179380413	+	Intron	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179380413T>A	uc001gmo.2	+						C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmn.1_Intron|C1orf125_uc010pnl.1_Intron|C1orf125_uc001gmp.2_Intron	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1												0						TTAGTTCATCTGGATTCACAA	0.299													17	54	---	---	---	---	PASS
NCF2	4688	broad.mit.edu	37	1	183532587	183532587	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183532587A>C	uc001gqj.3	-	12	1435	c.1160T>G	c.(1159-1161)CTG>CGG	p.L387R	NCF2_uc010pod.1_Missense_Mutation_p.L342R|NCF2_uc010poe.1_Missense_Mutation_p.L306R|NCF2_uc001gqk.3_Missense_Mutation_p.L387R	NM_000433	NP_000424	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	387	OPR.				cellular defense response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex|nucleolus	electron carrier activity|protein C-terminus binding			ovary(3)	3						AGTGTGTTCCAGCCGGAGCTC	0.572													52	127	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186276229	186276229	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186276229A>G	uc001gru.3	+	7	1429	c.1378A>G	c.(1378-1380)ACA>GCA	p.T460A	PRG4_uc001grt.3_Missense_Mutation_p.T419A|PRG4_uc009wyl.2_Missense_Mutation_p.T367A|PRG4_uc009wym.2_Missense_Mutation_p.T326A|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	460	15.|59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CAAGGAGCCTACACCCACCAC	0.657													4	79	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190250825	190250825	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190250825C>A	uc001gse.1	-	3	524	c.292G>T	c.(292-294)GGC>TGC	p.G98C	FAM5C_uc010pot.1_Intron	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	98						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					AGAGGAGAGCCAAGGAAATTT	0.398													9	27	---	---	---	---	PASS
CSRP1	1465	broad.mit.edu	37	1	201458112	201458112	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201458112T>A	uc001gws.2	-	4	473	c.282A>T	c.(280-282)GAA>GAT	p.E94D	CSRP1_uc001gwr.1_RNA|CSRP1_uc010ppr.1_Missense_Mutation_p.E94D|CSRP1_uc010pps.1_Missense_Mutation_p.E94D	NM_004078	NP_004069	P21291	CSRP1_HUMAN	cysteine and glycine-rich protein 1 isoform 1	94						nucleus	zinc ion binding			ovary(1)	1						GGCCAGGGGCTCTGCATGGAG	0.592													6	23	---	---	---	---	PASS
IL19	29949	broad.mit.edu	37	1	207013247	207013247	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207013247G>C	uc001hep.2	+	5	1202	c.263G>C	c.(262-264)AGG>ACG	p.R88T	IL19_uc001heo.2_Missense_Mutation_p.R126T|IL19_uc010prx.1_Missense_Mutation_p.R88T	NM_013371	NP_037503	Q9UHD0	IL19_HUMAN	interleukin 19 isoform 2 precursor	88					apoptosis|immune response|signal transduction	extracellular space	cytokine activity			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(75;0.211)			TACGTGGACAGGGTGTTCAAG	0.468													104	210	---	---	---	---	PASS
C1orf107	27042	broad.mit.edu	37	1	210024662	210024662	+	Missense_Mutation	SNP	C	T	T	rs140967197	byFrequency	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210024662C>T	uc001hhr.1	+	12	2217	c.2141C>T	c.(2140-2142)ACG>ATG	p.T714M	C1orf107_uc009xcu.1_Missense_Mutation_p.T429M	NM_014388	NP_055203	Q68CQ4	DIEXF_HUMAN	digestive-organ expansion factor homolog	714					multicellular organismal development	nucleus					0				OV - Ovarian serous cystadenocarcinoma(81;0.0367)		GAAGAGGCCACGTGGACCTGC	0.498													7	20	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240370853	240370853	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240370853C>T	uc010pyd.1	+	5	2966	c.2741C>T	c.(2740-2742)CCT>CTT	p.P914L	FMN2_uc010pye.1_Missense_Mutation_p.P918L	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	914	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCTCCCCCTCCTCTTCCCGGA	0.662													15	31	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247587725	247587725	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247587725G>C	uc001icr.2	+	5	1118	c.980G>C	c.(979-981)CGG>CCG	p.R327P	NLRP3_uc001ics.2_Missense_Mutation_p.R327P|NLRP3_uc001icu.2_Missense_Mutation_p.R327P|NLRP3_uc001icw.2_Missense_Mutation_p.R327P|NLRP3_uc001icv.2_Missense_Mutation_p.R327P|NLRP3_uc010pyw.1_Missense_Mutation_p.R325P|NLRP3_uc001ict.1_Missense_Mutation_p.R325P	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	327	NACHT.				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	p.R327G(1)		lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AAGGCCGAGCGGGGAGACATT	0.587													19	37	---	---	---	---	PASS
OR14A16	284532	broad.mit.edu	37	1	247978715	247978715	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247978715G>A	uc001idm.1	-	1	317	c.317C>T	c.(316-318)GCA>GTA	p.A106V		NM_001001966	NP_001001966	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A,	106	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CTCTGCAGATGCTGAAGAAAG	0.473													36	76	---	---	---	---	PASS
GRHL1	29841	broad.mit.edu	37	2	10101464	10101464	+	Missense_Mutation	SNP	C	G	G	rs150933141		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10101464C>G	uc002raa.2	+	4	739	c.568C>G	c.(568-570)CTC>GTC	p.L190V	GRHL1_uc002rab.2_RNA|GRHL1_uc002rad.2_Missense_Mutation_p.I26M|GRHL1_uc010yjb.1_Missense_Mutation_p.L39V	NM_198182	NP_937825	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1	190					cellular lipid metabolic process|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding			pancreas(1)|skin(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		CGATCGGAATCTCAATACTGA	0.542													37	100	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32692709	32692709	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32692709G>C	uc010ezu.2	+	27	5607	c.5473G>C	c.(5473-5475)GAG>CAG	p.E1825Q		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	1825					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					ATTAGGAGAAGAGGTGGATGG	0.438													16	61	---	---	---	---	PASS
MAP4K3	8491	broad.mit.edu	37	2	39552894	39552894	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39552894G>T	uc002rro.2	-	11	875	c.784C>A	c.(784-786)CCT>ACT	p.P262T	MAP4K3_uc002rrp.2_Missense_Mutation_p.P262T|MAP4K3_uc010yns.1_5'UTR	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase	262	Protein kinase.				JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				TCAGCAGTAGGTCTTTTTTTC	0.249													13	44	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40656873	40656873	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40656873A>G	uc002rrx.2	-	1	572	c.548T>C	c.(547-549)ATT>ACT	p.I183T	SLC8A1_uc002rry.2_Missense_Mutation_p.I183T|SLC8A1_uc002rrz.2_Missense_Mutation_p.I183T|SLC8A1_uc002rsa.2_Missense_Mutation_p.I183T|SLC8A1_uc002rsd.3_Missense_Mutation_p.I183T|SLC8A1_uc002rsb.1_Missense_Mutation_p.I183T|SLC8A1_uc010fan.1_Missense_Mutation_p.I183T|SLC8A1_uc002rsc.1_Missense_Mutation_p.I183T	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	183	Helical; (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	ACAGAGTGCAATAATGATGAA	0.473													9	21	---	---	---	---	PASS
UGP2	7360	broad.mit.edu	37	2	64109731	64109731	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64109731G>A	uc002scm.2	+	4	693	c.387G>A	c.(385-387)CTG>CTA	p.L129L	UGP2_uc002scl.2_Silent_p.L118L|UGP2_uc010ypx.1_Silent_p.L138L	NM_006759	NP_006750	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2 isoform a	129					glycogen biosynthetic process|phosphorylation|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	metal ion binding|protein binding|UTP:glucose-1-phosphate uridylyltransferase activity				0						CTAAAAGTCTGATTGGTGTGA	0.403													28	59	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73717648	73717648	+	Silent	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73717648A>G	uc002sje.1	+	12	8676	c.8565A>G	c.(8563-8565)CTA>CTG	p.L2855L	ALMS1_uc002sjf.1_Silent_p.L2811L|ALMS1_uc002sjg.2_Silent_p.L2241L|ALMS1_uc002sjh.1_Silent_p.L2241L	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2853					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						GTTCCACCCTAGGAGTAAACA	0.408													30	33	---	---	---	---	PASS
C2orf78	388960	broad.mit.edu	37	2	74041054	74041054	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74041054C>A	uc002sjr.1	+	2	669	c.548C>A	c.(547-549)GCC>GAC	p.A183D		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	183										ovary(2)	2						TCACTATCTGCCAGCCTTGTT	0.433													15	38	---	---	---	---	PASS
C2orf65	130951	broad.mit.edu	37	2	74787292	74787292	+	Silent	SNP	G	T	T	rs146997100	byFrequency	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74787292G>T	uc002smy.2	-	9	1525	c.1408C>A	c.(1408-1410)CGA>AGA	p.R470R	C2orf65_uc010ysa.1_Silent_p.R470R|C2orf65_uc010ffp.2_Silent_p.R119R|C2orf65_uc002smx.2_Silent_p.R226R	NM_138804	NP_620159	Q8TC57	CB065_HUMAN	hypothetical protein LOC130951	470					chromatin assembly|female gamete generation|RNA processing|spermatogenesis	integral to membrane				ovary(1)|pancreas(1)	2						CTCGGAGCTCGGCTCTCCCAG	0.468													3	16	---	---	---	---	PASS
SNRNP200	23020	broad.mit.edu	37	2	96952118	96952118	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96952118G>C	uc002svu.2	-	29	4020	c.3934C>G	c.(3934-3936)CTG>GTG	p.L1312V	SNRNP200_uc002svt.2_5'Flank|SNRNP200_uc010yuj.1_5'Flank|SNRNP200_uc002svv.1_5'Flank|SNRNP200_uc002svw.1_Missense_Mutation_p.L384V	NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	1312						catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						CTGTTTCTCAGAGCAGACACG	0.532													32	90	---	---	---	---	PASS
NMS	129521	broad.mit.edu	37	2	101089247	101089247	+	Intron	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101089247C>T	uc002tan.1	+							NM_001011717	NP_001011717	Q5H8A3	NMS_HUMAN	neuromedin S precursor						neuropeptide signaling pathway|regulation of smooth muscle contraction	extracellular region				ovary(1)	1						TTTATGATTTCTCACAATAGG	0.313													5	5	---	---	---	---	PASS
NPHP1	4867	broad.mit.edu	37	2	110886762	110886762	+	Splice_Site	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110886762C>T	uc002tfn.3	-	18	1975	c.1881_splice	c.e18+1	p.R627_splice	NPHP1_uc002tfm.3_Splice_Site_p.R572_splice|NPHP1_uc002tfl.3_Splice_Site_p.R628_splice|NPHP1_uc002tfo.3_Splice_Site_p.R509_splice|NPHP1_uc010ywx.1_Splice_Site_p.R571_splice|NPHP1_uc010fjv.1_Splice_Site_p.R571_splice	NM_207181	NP_997064	O15259	NPHP1_HUMAN	nephrocystin 1 isoform 2						actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cell-cell junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity			ovary(2)	2						ATGCTACCCACCCTGAGAGCA	0.443													9	9	---	---	---	---	PASS
MERTK	10461	broad.mit.edu	37	2	112786239	112786239	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112786239G>C	uc002thk.1	+	19	2920	c.2798G>C	c.(2797-2799)GGG>GCG	p.G933A	MERTK_uc002thl.1_Missense_Mutation_p.G757A	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor	933	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						ATCCTGAATGGGGGCAGTGAG	0.527													21	45	---	---	---	---	PASS
DDX18	8886	broad.mit.edu	37	2	118582248	118582248	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118582248T>A	uc002tlh.1	+	8	1269	c.1170T>A	c.(1168-1170)GAT>GAA	p.D390E		NM_006773	NP_006764	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	390							ATP binding|ATP-dependent RNA helicase activity|RNA binding			breast(2)|ovary(1)|lung(1)	4						GCGTTGATGATGATAAAGCGA	0.393													30	89	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125261958	125261958	+	Silent	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125261958C>A	uc002tno.2	+	8	1513	c.1149C>A	c.(1147-1149)ACC>ACA	p.T383T	CNTNAP5_uc010flu.2_Silent_p.T384T	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	383	Laminin G-like 2.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGCCCGGCACCCCCCAAATTG	0.532													18	43	---	---	---	---	PASS
PKP4	8502	broad.mit.edu	37	2	159488331	159488331	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159488331C>A	uc002tzv.2	+	8	1480	c.1220C>A	c.(1219-1221)CCC>CAC	p.P407H	PKP4_uc002tzt.1_Missense_Mutation_p.P259H|PKP4_uc002tzu.2_Missense_Mutation_p.P407H|PKP4_uc002tzw.2_Missense_Mutation_p.P407H|PKP4_uc002tzx.2_Missense_Mutation_p.P65H|PKP4_uc002tzy.1_Missense_Mutation_p.P65H|PKP4_uc002tzz.1_Missense_Mutation_p.P405H|PKP4_uc002uaa.2_Missense_Mutation_p.P259H	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a	407					cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						GCCGTGTCTCCCGACTTGCAC	0.502										HNSCC(62;0.18)			6	100	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160304825	160304825	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160304825C>A	uc002uao.2	-	5	782	c.430G>T	c.(430-432)GCC>TCC	p.A144S	BAZ2B_uc002uap.2_Missense_Mutation_p.A142S|BAZ2B_uc002uas.1_Missense_Mutation_p.A81S|BAZ2B_uc002uau.1_Missense_Mutation_p.A142S|BAZ2B_uc002uaq.1_Missense_Mutation_p.A72S|BAZ2B_uc002uat.3_Missense_Mutation_p.A81S|BAZ2B_uc010fop.1_Missense_Mutation_p.A142S	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	144					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						TGATTCTGGGCTGGGGGAGCA	0.438													28	84	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166231463	166231463	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166231463C>T	uc002udc.2	+	22	4531	c.4241C>T	c.(4240-4242)TCT>TTT	p.S1414F	SCN2A_uc002udd.2_Missense_Mutation_p.S1414F|SCN2A_uc002ude.2_Missense_Mutation_p.S1414F	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	1414	III.				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	GGATATCTGTCTCTACTTCAA	0.299													8	24	---	---	---	---	PASS
PPIG	9360	broad.mit.edu	37	2	170493060	170493060	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170493060C>G	uc002uez.2	+	14	1512	c.1292C>G	c.(1291-1293)TCT>TGT	p.S431C	PPIG_uc010fpx.2_Missense_Mutation_p.S416C|PPIG_uc010fpy.2_Missense_Mutation_p.S424C|PPIG_uc002ufb.2_Missense_Mutation_p.S431C|PPIG_uc002ufd.2_Missense_Mutation_p.S428C	NM_004792	NP_004783	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G	431					protein folding|RNA splicing	nuclear matrix|nuclear speck	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|central_nervous_system(1)	3					L-Proline(DB00172)	GACCATAAATCTAACAGCAAA	0.333													8	35	---	---	---	---	PASS
HOXD11	3237	broad.mit.edu	37	2	176973689	176973689	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176973689G>A	uc002uki.2	+	2	836	c.836G>A	c.(835-837)CGC>CAC	p.R279H	HOXD11_uc010fqx.2_RNA	NM_021192	NP_067015	P31277	HXD11_HUMAN	homeobox D11	279	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		TACCAGATCCGCGAACTGGAA	0.522			T	NUP98	AML								34	70	---	---	---	---	PASS
OSBPL6	114880	broad.mit.edu	37	2	179236961	179236961	+	Splice_Site	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179236961G>T	uc002ulx.2	+	14	1773	c.1395_splice	c.e14+1	p.E465_splice	OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Splice_Site_p.E490_splice|OSBPL6_uc010zfe.1_Splice_Site_p.E434_splice|OSBPL6_uc002ulz.2_Intron|OSBPL6_uc002uma.2_Splice_Site_p.E469_splice	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform						lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			CCCTGATGAGGTAAGACTCAT	0.323													19	13	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179437048	179437048	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179437048G>T	uc010zfg.1	-	275	66331	c.66107C>A	c.(66106-66108)CCT>CAT	p.P22036H	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P15731H|TTN_uc010zfi.1_Missense_Mutation_p.P15664H|TTN_uc010zfj.1_Missense_Mutation_p.P15539H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22963							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTTTCAGCAGGCAGCCCAAT	0.453													12	31	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179458090	179458090	+	Silent	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179458090C>A	uc010zfg.1	-	248	51365	c.51141G>T	c.(51139-51141)CTG>CTT	p.L17047L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L10742L|TTN_uc010zfi.1_Silent_p.L10675L|TTN_uc010zfj.1_Silent_p.L10550L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17974							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCTCTTTTCCAGGATGTAGT	0.403													5	84	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179650444	179650444	+	Missense_Mutation	SNP	G	A	A	rs149061352	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179650444G>A	uc010zfg.1	-	15	2620	c.2396C>T	c.(2395-2397)ACG>ATG	p.T799M	TTN_uc010zfh.1_Missense_Mutation_p.T753M|TTN_uc010zfi.1_Missense_Mutation_p.T753M|TTN_uc010zfj.1_Missense_Mutation_p.T753M|TTN_uc002unb.2_Missense_Mutation_p.T799M	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	799							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	p.T753M(1)		ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAATCTTTCCGTTGTTAGATC	0.418													22	58	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189927941	189927941	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189927941C>T	uc002uqk.2	-	27	2101	c.1826G>A	c.(1825-1827)GGG>GAG	p.G609E	COL5A2_uc010frx.2_Missense_Mutation_p.G185E	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	609					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CCCGGGCTGCCCTCTGATTCC	0.527													17	48	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201501692	201501692	+	Missense_Mutation	SNP	G	A	A	rs113582006	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201501692G>A	uc002uvx.2	+	22	2506	c.2405G>A	c.(2404-2406)CGT>CAT	p.R802H	AOX1_uc010zhf.1_Missense_Mutation_p.R358H|AOX1_uc010fsu.2_Missense_Mutation_p.R168H	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	802					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	CATGTAAGGCGTGTTGGTGGA	0.443													20	42	---	---	---	---	PASS
ALS2CR8	79800	broad.mit.edu	37	2	203820411	203820411	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203820411C>T	uc002uzo.2	+	7	852	c.572C>T	c.(571-573)CCC>CTC	p.P191L	ALS2CR8_uc002uzn.2_Missense_Mutation_p.P89L|ALS2CR8_uc002uzm.2_Missense_Mutation_p.P191L|ALS2CR8_uc010zhy.1_Missense_Mutation_p.P191L|ALS2CR8_uc010zhz.1_RNA|ALS2CR8_uc010ftu.1_RNA|ALS2CR8_uc010zia.1_Missense_Mutation_p.P115L|ALS2CR8_uc010zib.1_Missense_Mutation_p.P115L|ALS2CR8_uc010zic.1_Missense_Mutation_p.P103L|ALS2CR8_uc002uzp.2_Missense_Mutation_p.P191L	NM_001104586	NP_001098056	Q8N187	AL2S8_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	191										large_intestine(1)|ovary(1)	2						CTGGAAGAACCCCTTCTGGGG	0.398													7	21	---	---	---	---	PASS
C2orf24	27013	broad.mit.edu	37	2	220037441	220037441	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220037441C>A	uc002vju.3	-	8	1252	c.1100G>T	c.(1099-1101)TGG>TTG	p.W367L	NHEJ1_uc002vjq.3_5'Flank|SLC23A3_uc010zkr.1_5'Flank|SLC23A3_uc010zks.1_5'Flank|SLC23A3_uc010fwb.2_5'Flank|C2orf24_uc002vjv.2_Missense_Mutation_p.W367L	NM_015680	NP_056495	Q9BV87	CNPD1_HUMAN	hypothetical protein LOC27013	367	Pro-rich.				regulation of cyclin-dependent protein kinase activity	integral to membrane	protein kinase binding				0		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGTATGGTACCAGGGGCTGGA	0.602													7	29	---	---	---	---	PASS
ABCB6	10058	broad.mit.edu	37	2	220077986	220077986	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220077986G>A	uc002vkc.1	-	12	2059	c.1782C>T	c.(1780-1782)AAC>AAT	p.N594N	ABCB6_uc010fwe.1_Silent_p.N548N	NM_005689	NP_005680	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B, member 6	594	ABC transporter.				cadmium ion transmembrane transport|cellular iron ion homeostasis|detoxification of cadmium ion|porphyrin biosynthetic process	ATP-binding cassette (ABC) transporter complex|Golgi apparatus|integral to mitochondrial outer membrane|plasma membrane|vacuolar membrane	ATP binding|efflux transmembrane transporter activity|heme binding|heme-transporting ATPase activity			breast(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGAAGTGCACGTTCTCAAACT	0.542													13	39	---	---	---	---	PASS
PTPRN	5798	broad.mit.edu	37	2	220161200	220161200	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220161200C>T	uc002vkz.2	-	17	2438	c.2349G>A	c.(2347-2349)ACG>ACA	p.T783T	PTPRN_uc010zlc.1_Silent_p.T693T|PTPRN_uc002vla.2_Silent_p.T754T|uc010zld.1_5'Flank|MIR153-1_hsa-mir-153-1|MI0000463_5'Flank	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	783	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GCGGGCCCTGCGTGGCTATGT	0.602													16	42	---	---	---	---	PASS
NEU2	4759	broad.mit.edu	37	2	233899524	233899524	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233899524C>A	uc010zmn.1	+	2	900	c.900C>A	c.(898-900)CAC>CAA	p.H300Q		NM_005383	NP_005374	Q9Y3R4	NEUR2_HUMAN	neuraminidase 2	300							exo-alpha-sialidase activity				0		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)		ACCCCACACACTCCTGGCAGA	0.711													6	19	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238289580	238289580	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238289580C>T	uc002vwl.2	-	5	2160	c.1875G>A	c.(1873-1875)AGG>AGA	p.R625R	COL6A3_uc002vwo.2_Silent_p.R419R|COL6A3_uc010znj.1_Silent_p.R218R|COL6A3_uc002vwq.2_Silent_p.R419R|COL6A3_uc002vwr.2_Silent_p.R218R|COL6A3_uc010znk.1_Silent_p.R625R	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	625	Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CAGAGAGGGTCCTGAGAGGTG	0.552													6	17	---	---	---	---	PASS
OR6B2	389090	broad.mit.edu	37	2	240969639	240969639	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240969639C>A	uc002vyr.2	-	2	254	c.208G>T	c.(208-210)GAG>TAG	p.E70*	OR6B2_uc010zoc.1_Nonsense_Mutation_p.E70*	NM_001005853	NP_001005853	Q6IFH4	OR6B2_HUMAN	olfactory receptor, family 6, subfamily B,	70	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)		TACCAGATCTCCAGGAAAGAC	0.552													5	87	---	---	---	---	PASS
AQP12A	375318	broad.mit.edu	37	2	241631490	241631490	+	Splice_Site	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241631490G>C	uc002vzu.2	+	2	193	c.124_splice	c.e2-1	p.M42_splice	AQP12A_uc002vzv.2_Intron	NM_198998	NP_945349	Q8IXF9	AQ12A_HUMAN	aquaporin 12A							integral to membrane	transporter activity				0		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GCTGCCTGGAGATGAGGACGC	0.706													5	10	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48670977	48670977	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48670977C>A	uc003cuf.1	-	37	10297	c.10297G>T	c.(10297-10299)GAG>TAG	p.E3433*	SLC26A6_uc003cug.2_Nonsense_Mutation_p.E18*|SLC26A6_uc003cuh.2_Nonsense_Mutation_p.E39*|SLC26A6_uc010hke.2_5'UTR|SLC26A6_uc003cuk.2_Nonsense_Mutation_p.E39*|SLC26A6_uc003cui.2_Nonsense_Mutation_p.E39*|SLC26A6_uc003cuj.2_Nonsense_Mutation_p.E39*|SLC26A6_uc011bbp.1_Nonsense_Mutation_p.E39*	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	Error:Variant_position_missing_in_Q9NYQ7_after_alignment					homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TCCAAATGCTCCTGGTTCAGC	0.647													21	44	---	---	---	---	PASS
DNAH1	25981	broad.mit.edu	37	3	52430701	52430701	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52430701A>C	uc011bef.1	+	72	11759	c.11498A>C	c.(11497-11499)AAG>ACG	p.K3833T	DNAH1_uc003ddv.2_Missense_Mutation_p.K691T	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3898	AAA 6 (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GAGCGCCATAAGTTTGGGCCC	0.567													27	26	---	---	---	---	PASS
PHF7	51533	broad.mit.edu	37	3	52454461	52454461	+	Intron	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52454461G>T	uc003ddy.2	+						PHF7_uc003ddz.2_Intron	NM_016483	NP_057567	Q9BWX1	PHF7_HUMAN	PHD finger protein 7 isoform 1							nucleus	zinc ion binding			breast(1)	1				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		AGTGAGTGAGGGAAGGGAAAA	0.448													5	59	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52623085	52623085	+	Splice_Site	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52623085C>G	uc003des.2	-	18	2977	c.2965_splice	c.e18+1	p.G989_splice	PBRM1_uc003dex.2_Splice_Site|PBRM1_uc003deq.2_Splice_Site_p.G989_splice|PBRM1_uc003der.2_Splice_Site_p.G957_splice|PBRM1_uc003det.2_Splice_Site_p.G1004_splice|PBRM1_uc003deu.2_Splice_Site_p.G1004_splice|PBRM1_uc003dev.2_Splice_Site|PBRM1_uc003dew.2_Splice_Site_p.G989_splice|PBRM1_uc010hmk.1_Splice_Site_p.E989_splice|PBRM1_uc003dey.2_Splice_Site_p.E989_splice|PBRM1_uc003dez.1_Splice_Site_p.G988_splice|PBRM1_uc003dfb.1_Splice_Site_p.G901_splice|PBRM1_uc003dfa.1_Splice_Site_p.G335_splice	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AACAAACTTACCAGCTGAATC	0.413			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								26	38	---	---	---	---	PASS
CACNA1D	776	broad.mit.edu	37	3	53842704	53842704	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53842704G>A	uc003dgv.3	+	46	5941	c.5778G>A	c.(5776-5778)GAG>GAA	p.E1926E	CACNA1D_uc003dgu.3_Silent_p.E1946E|CACNA1D_uc003dgy.3_Silent_p.E1902E|CACNA1D_uc003dgw.3_Silent_p.E1593E|CACNA1D_uc011bes.1_RNA	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	1926	Cytoplasmic (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	TCAACTTTGAGTGCCTGCGCC	0.602													31	8	---	---	---	---	PASS
FAM116A	201627	broad.mit.edu	37	3	57657985	57657985	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57657985G>A	uc003dja.2	-	3	388	c.317C>T	c.(316-318)TCA>TTA	p.S106L		NM_152678	NP_689891	Q8IWF6	F116A_HUMAN	hypothetical protein LOC201627	106										pancreas(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000621)|KIRC - Kidney renal clear cell carcinoma(284;0.0485)|Kidney(284;0.0607)		ACAGTTACCTGAATTTGAATC	0.259													13	10	---	---	---	---	PASS
PRICKLE2	166336	broad.mit.edu	37	3	64133179	64133179	+	Silent	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64133179G>T	uc003dmf.2	-	7	1573	c.987C>A	c.(985-987)GCC>GCA	p.A329A		NM_198859	NP_942559	Q7Z3G6	PRIC2_HUMAN	prickle-like 2	329						cytoplasm|nuclear membrane	zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		CCTTGGCCCTGGCGTTCTGGA	0.587													5	80	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108780908	108780908	+	Intron	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108780908G>T	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						GGATTCAGCTGGAAGTAGAAG	0.348													51	6	---	---	---	---	PASS
ATP6V1A	523	broad.mit.edu	37	3	113514714	113514714	+	Intron	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113514714T>A	uc003eao.2	+						ATP6V1A_uc011bik.1_Intron	NM_001690	NP_001681	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit A						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			ovary(2)|skin(1)	3						ATATTTTTTTTAAATTTAGAG	0.289													10	18	---	---	---	---	PASS
LSAMP	4045	broad.mit.edu	37	3	116163861	116163861	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116163861C>A	uc003ebt.2	-	1	518	c.18G>T	c.(16-18)CAG>CAT	p.Q6H	LSAMP_uc011bis.1_Missense_Mutation_p.Q6H|LSAMP_uc010hqq.1_RNA	NM_002338	NP_002329	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein	6					cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		TCCGATCCGGCTGAACTCTCC	0.632													4	12	---	---	---	---	PASS
DTX3L	151636	broad.mit.edu	37	3	122288791	122288791	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122288791G>A	uc003efk.2	+	3	1944	c.1855G>A	c.(1855-1857)GTT>ATT	p.V619I	DTX3L_uc010hrj.2_Intron	NM_138287	NP_612144	Q8TDB6	DTX3L_HUMAN	deltex 3-like	619					histone monoubiquitination|response to DNA damage stimulus	cytoplasm|nucleus	histone binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)	4				GBM - Glioblastoma multiforme(114;0.0459)		GGTTTTCACTGTTTCAAGAGA	0.408													36	80	---	---	---	---	PASS
PARP14	54625	broad.mit.edu	37	3	122437429	122437429	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122437429G>C	uc003efq.3	+	14	4490	c.4431G>C	c.(4429-4431)GAG>GAC	p.E1477D	PARP14_uc010hrk.2_RNA|PARP14_uc003efr.2_Missense_Mutation_p.E1194D|PARP14_uc003efs.1_Missense_Mutation_p.E1194D	NM_017554	NP_060024	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1477					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity			ovary(2)|breast(2)|lung(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(114;0.0531)		AGTTGAATGAGCTGCAGAAGA	0.398													74	51	---	---	---	---	PASS
COPB2	9276	broad.mit.edu	37	3	139086994	139086994	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139086994G>A	uc003etf.3	-	13	1668	c.1538C>T	c.(1537-1539)GCC>GTC	p.A513V	COPB2_uc011bmv.1_Missense_Mutation_p.A484V|COPB2_uc010hui.2_Missense_Mutation_p.A484V	NM_004766	NP_004757	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta	513					COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(2)	2						TACCTCAAAGGCATCTTCAAT	0.348													20	36	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140251226	140251226	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140251226T>C	uc003etn.2	+	9	1595	c.1405T>C	c.(1405-1407)TAC>CAC	p.Y469H	CLSTN2_uc003etm.2_Missense_Mutation_p.Y469H	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	469	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GGTAACCTTATACATGGATGG	0.423										HNSCC(16;0.037)			62	7	---	---	---	---	PASS
HLTF	6596	broad.mit.edu	37	3	148789184	148789184	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148789184C>T	uc003ewq.1	-	7	967	c.749G>A	c.(748-750)TGG>TAG	p.W250*	HLTF_uc003ewr.1_Nonsense_Mutation_p.W250*|HLTF_uc003ews.1_Nonsense_Mutation_p.W250*|HLTF_uc010hve.1_Nonsense_Mutation_p.W250*	NM_139048	NP_620636	Q14527	HLTF_HUMAN	helicase-like transcription factor	250					chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TGACACCATCCAAGCTAGAGC	0.368													15	24	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179399768	179399768	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179399768C>T	uc003fkh.2	+	2	352	c.271C>T	c.(271-273)CAC>TAC	p.H91Y	USP13_uc003fkf.2_Missense_Mutation_p.H91Y	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	91					ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			TGTATACATGCACCTGAAAAG	0.443													62	55	---	---	---	---	PASS
TFRC	7037	broad.mit.edu	37	3	195800873	195800873	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195800873C>T	uc003fvz.3	-	4	645	c.362G>A	c.(361-363)CGC>CAC	p.R121H	TFRC_uc003fwa.3_Missense_Mutation_p.R121H|TFRC_uc010hzy.2_Missense_Mutation_p.R40H|TFRC_uc011btr.1_Intron	NM_003234	NP_003225	P02786	TFR1_HUMAN	transferrin receptor	121	Extracellular (Potential).				cellular iron ion homeostasis|endocytosis|interspecies interaction between organisms|proteolysis|transferrin transport|transmembrane transport	coated pit|endosome|integral to plasma membrane|melanosome	peptidase activity|transferrin receptor activity			ovary(3)	3	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)		CCAATATAAGCGACGTGCTGC	0.517			T	BCL6	NHL						OREG0016005	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	42	27	---	---	---	---	PASS
ARAP2	116984	broad.mit.edu	37	4	36115803	36115803	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36115803T>C	uc003gsq.1	-	26	4483	c.4145A>G	c.(4144-4146)AAT>AGT	p.N1382S		NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	1382	Ras-associating.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						TAGCTCTTCATTTTCAATGAC	0.289													38	38	---	---	---	---	PASS
BEND4	389206	broad.mit.edu	37	4	42145670	42145670	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42145670C>T	uc003gwn.2	-	3	1409	c.829G>A	c.(829-831)GCC>ACC	p.A277T	BEND4_uc003gwm.2_Missense_Mutation_p.A277T|BEND4_uc011byy.1_Missense_Mutation_p.A277T	NM_207406	NP_997289	Q6ZU67	BEND4_HUMAN	BEN domain containing 4 isoform a	277											0						TCCACGTCGGCCAGATGGCCA	0.517													16	13	---	---	---	---	PASS
GABRA4	2557	broad.mit.edu	37	4	46930488	46930488	+	Silent	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46930488A>G	uc003gxg.2	-	9	1558	c.1419T>C	c.(1417-1419)GCT>GCC	p.A473A		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	473	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	GACGAGTAGAAGCAGATCCAA	0.478													15	24	---	---	---	---	PASS
AFP	174	broad.mit.edu	37	4	74321007	74321007	+	3'UTR	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74321007G>C	uc003hgz.1	+	14					AFP_uc003hha.1_Intron|AFP_uc011cbg.1_3'UTR	NM_001134	NP_001125	P02771	FETA_HUMAN	alpha-fetoprotein precursor						transport		metal ion binding			ovary(1)	1	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AATTACTTCAGGTAACAAAAC	0.308									Alpha-Fetoprotein_Hereditary_Persistence_of				11	26	---	---	---	---	PASS
HERC6	55008	broad.mit.edu	37	4	89363429	89363429	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89363429G>C	uc011cdi.1	+	23	3069	c.2886G>C	c.(2884-2886)CAG>CAC	p.Q962H	HERC6_uc011cdj.1_Missense_Mutation_p.Q926H|HERC6_uc011cdk.1_RNA|HERC6_uc011cdl.1_RNA	NM_017912	NP_060382	Q8IVU3	HERC6_HUMAN	hect domain and RLD 6 isoform 1	962	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytosol	ubiquitin-protein ligase activity			lung(3)|ovary(1)|kidney(1)	5		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		GAGGCATACAGAAAATGGAAA	0.343													8	9	---	---	---	---	PASS
TNIP3	79931	broad.mit.edu	37	4	122079902	122079902	+	Silent	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122079902C>A	uc010ing.2	-	3	349	c.153G>T	c.(151-153)CTG>CTT	p.L51L	TNIP3_uc010inh.2_Silent_p.L51L|TNIP3_uc011cgj.1_Silent_p.L109L|TNIP3_uc010ini.2_Silent_p.L51L	NM_024873	NP_079149	Q96KP6	TNIP3_HUMAN	TNFAIP3 interacting protein 3	51	Potential.									ovary(1)	1						GGTTAACTTCCAGGAGCTGAA	0.323													20	9	---	---	---	---	PASS
CYP4V2	285440	broad.mit.edu	37	4	187118688	187118688	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187118688A>T	uc003iyw.3	+	5	910	c.606A>T	c.(604-606)GAA>GAT	p.E202D		NM_207352	NP_997235	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily v,	202					response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		ATTTTATAGAAACAGCTATGG	0.383													11	20	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187539652	187539652	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187539652C>T	uc003izf.2	-	10	8276	c.8088G>A	c.(8086-8088)CCG>CCA	p.P2696P		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	2696	Extracellular (Potential).|Cadherin 24.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						GCTGCATTTCCGGTGGAAGGA	0.393										HNSCC(5;0.00058)			38	59	---	---	---	---	PASS
SLC6A19	340024	broad.mit.edu	37	5	1221346	1221346	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1221346T>C	uc003jbw.3	+	11	1675	c.1619T>C	c.(1618-1620)CTG>CCG	p.L540P		NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19	540	Helical; Name=11; (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GTCAGCCCCCTGCTCATGCTG	0.557													8	32	---	---	---	---	PASS
IRX1	79192	broad.mit.edu	37	5	3599450	3599450	+	Silent	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3599450C>A	uc003jde.2	+	2	440	c.388C>A	c.(388-390)CGG>AGG	p.R130R		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	130	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2						GGACCCCGGGCGGCCCAAGAA	0.647													20	20	---	---	---	---	PASS
SRD5A1	6715	broad.mit.edu	37	5	6652125	6652125	+	Intron	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6652125A>T	uc003jdw.2	+						SRD5A1_uc011cml.1_Intron|SRD5A1_uc011cmm.1_Intron	NM_001047	NP_001038	P18405	S5A1_HUMAN	steroid-5-alpha-reductase 1						androgen biosynthetic process|cell differentiation|sex determination|sex differentiation	endoplasmic reticulum membrane|integral to membrane|microsome	3-oxo-5-alpha-steroid 4-dehydrogenase activity|electron carrier activity				0					Dutasteride(DB01126)|Finasteride(DB01216)	CTAATAGGTGAGTGTCCACAG	0.433													7	53	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7707871	7707871	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7707871G>C	uc003jdz.1	+	9	1388	c.1321G>C	c.(1321-1323)GTG>CTG	p.V441L	ADCY2_uc011cmo.1_Missense_Mutation_p.V261L	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	441	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						CGCTTATAAAGTGGAGGAGGG	0.408													22	75	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13862706	13862706	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13862706C>T	uc003jfd.2	-	29	4789	c.4747G>A	c.(4747-4749)GCC>ACC	p.A1583T		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1583	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TCCATGTTGGCGATGATTTCC	0.453									Kartagener_syndrome				9	56	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21752268	21752268	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21752268C>A	uc010iuc.2	-	12	2421	c.1963G>T	c.(1963-1965)GAC>TAC	p.D655Y	CDH12_uc011cno.1_Missense_Mutation_p.D615Y|CDH12_uc003jgk.2_Missense_Mutation_p.D655Y|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	655	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						ATGACGTTGTCTCTGATGTCT	0.453										HNSCC(59;0.17)			35	43	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23521148	23521148	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23521148C>A	uc003jgo.2	+	6	550	c.368C>A	c.(367-369)TCA>TAA	p.S123*		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	123					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						CCCAAGGCGTCATTCAGTAAT	0.398										HNSCC(3;0.000094)			20	36	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33624402	33624402	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33624402C>G	uc003jia.1	-	14	2240	c.2077G>C	c.(2077-2079)GTG>CTG	p.V693L	ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	693	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CCCAGGCACACACCGCAGCGA	0.517										HNSCC(64;0.19)			17	52	---	---	---	---	PASS
ELOVL7	79993	broad.mit.edu	37	5	60062459	60062459	+	Splice_Site	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60062459T>A	uc003jsi.3	-	6	537	c.337_splice	c.e6-1	p.M113_splice	ELOVL7_uc011cqo.1_Splice_Site_p.M26_splice|ELOVL7_uc010iwk.2_Splice_Site_p.M113_splice|ELOVL7_uc003jsj.3_Splice_Site_p.M100_splice	NM_024930	NP_079206	A1L3X0	ELOV7_HUMAN	elongation of very long chain fatty acids-like						fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				ACGTGCCATCTGCAGAAGCAC	0.254													45	2	---	---	---	---	PASS
MAST4	375449	broad.mit.edu	37	5	66461703	66461703	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66461703C>T	uc003jut.1	+	28	6197	c.6129C>T	c.(6127-6129)CTC>CTT	p.L2043L	MAST4_uc003juw.2_Silent_p.L1971L|MAST4_uc003jux.2_Intron	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	2235						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CTCAGTCCCTCGGTGGCTCTA	0.617													13	19	---	---	---	---	PASS
PDE8B	8622	broad.mit.edu	37	5	76640754	76640754	+	Nonsense_Mutation	SNP	C	T	T	rs144671246		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76640754C>T	uc003kfa.2	+	7	919	c.874C>T	c.(874-876)CAG>TAG	p.Q292*	PDE8B_uc003kfb.2_Nonsense_Mutation_p.Q272*|PDE8B_uc003kfc.2_Nonsense_Mutation_p.Q292*|PDE8B_uc003kfd.2_Nonsense_Mutation_p.Q292*|PDE8B_uc003kfe.2_Nonsense_Mutation_p.Q292*	NM_003719	NP_003710	O95263	PDE8B_HUMAN	phosphodiesterase 8B isoform 1	292	PAS.				cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity				0		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)		CCACGTGATTCAGGTATGGAA	0.363													20	23	---	---	---	---	PASS
HSPA9	3313	broad.mit.edu	37	5	137906809	137906809	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137906809C>A	uc003ldf.2	-	4	358	c.250G>T	c.(250-252)GCC>TCC	p.A84S	HSPA9_uc011cyw.1_Missense_Mutation_p.A15S	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor	84					anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GTGGTTCTGGCACCTTCGGCA	0.418													14	27	---	---	---	---	PASS
PURA	5813	broad.mit.edu	37	5	139494223	139494223	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139494223C>T	uc003lfa.2	+	1	516	c.457C>T	c.(457-459)CGC>TGC	p.R153C		NM_005859	NP_005850	Q00577	PURA_HUMAN	purine-rich element binding protein A	153					DNA unwinding involved in replication|DNA-dependent DNA replication initiation	DNA replication factor A complex	double-stranded telomeric DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|single-stranded DNA binding|transcription factor binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCGAGAACCGCAAGTACTA	0.706													4	14	---	---	---	---	PASS
PCDHB9	56127	broad.mit.edu	37	5	140568338	140568338	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140568338A>C	uc003liw.1	+	3	1447	c.1447A>C	c.(1447-1449)AAC>CAC	p.N483H		NM_019119	NP_061992	Q9Y5E1	PCDB9_HUMAN	protocadherin beta 9 precursor	483	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCAGGCACCAACGCCCAGGT	0.647													100	13	---	---	---	---	PASS
FCHSD1	89848	broad.mit.edu	37	5	141026213	141026213	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141026213C>A	uc003llk.2	-	11	1052	c.1001G>T	c.(1000-1002)AGC>ATC	p.S334I	FCHSD1_uc010jgg.2_5'UTR|FCHSD1_uc003llj.2_RNA	NM_033449	NP_258260	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	334									FCHSD1/BRAF(2)	skin(2)|ovary(1)|central_nervous_system(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCAGCTCGGCTGGTCAAGCG	0.602													3	14	---	---	---	---	PASS
ADRB2	154	broad.mit.edu	37	5	148207577	148207577	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148207577C>G	uc003lpr.1	+	1	1422	c.1183C>G	c.(1183-1185)CCT>GCT	p.P395A	SH3TC2_uc003lpp.1_Intron	NM_000024	NP_000015	P07550	ADRB2_HUMAN	adrenergic, beta-2-, receptor, surface	395	Cytoplasmic.				activation of transmembrane receptor protein tyrosine kinase activity|desensitization of G-protein coupled receptor protein signaling pathway by arrestin|endosome to lysosome transport|positive regulation of MAPKKK cascade|receptor-mediated endocytosis	endosome|integral to plasma membrane|lysosome|receptor complex	beta2-adrenergic receptor activity|norepinephrine binding|potassium channel regulator activity|protein homodimerization activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Alprenolol(DB00866)|Arformoterol(DB01274)|Bambuterol(DB01408)|Bisoprolol(DB00612)|Bitolterol(DB00901)|Bretylium(DB01158)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Isoproterenol(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Metipranolol(DB01214)|Nadolol(DB01203)|Norepinephrine(DB00368)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Terbutaline(DB00871)|Timolol(DB00373)	AGGTACTGTGCCTAGCGATAA	0.463													19	46	---	---	---	---	PASS
ARSI	340075	broad.mit.edu	37	5	149676856	149676856	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149676856C>T	uc003lrv.2	-	2	2220	c.1631G>A	c.(1630-1632)CGC>CAC	p.R544H		NM_001012301	NP_001012301	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I precursor	544						endoplasmic reticulum|extracellular region	arylsulfatase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTTTTTCTTGCGACGACCCCG	0.537													64	35	---	---	---	---	PASS
RNF145	153830	broad.mit.edu	37	5	158621750	158621750	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158621750G>A	uc003lxp.2	-	3	580	c.267C>T	c.(265-267)CTC>CTT	p.L89L	RNF145_uc011ddy.1_Silent_p.L103L|RNF145_uc003lxo.1_Silent_p.L117L|RNF145_uc011ddz.1_Silent_p.L106L|RNF145_uc010jiq.1_Silent_p.L119L|RNF145_uc011dea.1_Silent_p.L105L	NM_144726	NP_653327	Q96MT1	RN145_HUMAN	ring finger protein 145	89	Helical; (Potential).					integral to membrane	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGCATAGAGGAGCAGAGCAG	0.348													44	112	---	---	---	---	PASS
STK10	6793	broad.mit.edu	37	5	171488197	171488197	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171488197C>T	uc003mbo.1	-	14	2458	c.2158G>A	c.(2158-2160)GAG>AAG	p.E720K		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	720	Potential.						ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCACAGATCTCCCGCCTGTTG	0.617													42	56	---	---	---	---	PASS
DRD1	1812	broad.mit.edu	37	5	174869482	174869482	+	Silent	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174869482C>A	uc003mcz.2	-	2	1566	c.621G>T	c.(619-621)GTG>GTT	p.V207V		NM_000794	NP_000785	P21728	DRD1_HUMAN	dopamine receptor D1	207	Helical; Name=5; (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|adult walking behavior|cerebral cortex GABAergic interneuron migration|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|mating behavior|positive regulation of cAMP biosynthetic process|positive regulation of cell migration|positive regulation of potassium ion transport|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of synaptic transmission, glutamatergic|prepulse inhibition|response to drug|synapse assembly|visual learning	endoplasmic reticulum membrane|membrane fraction	protein binding			ovary(2)|skin(1)	3	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Carphenazine(DB01038)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Cocaine(DB00907)|Dopamine(DB00988)|Fenoldopam(DB00800)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methylergonovine(DB00353)|Minaprine(DB00805)|Olanzapine(DB00334)|Pegademase bovine(DB00061)|Pergolide(DB01186)|Perphenazine(DB00850)|Prochlorperazine(DB00433)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Triflupromazine(DB00508)|Zuclopenthixol(DB01624)	TCATGATGGCCACAGGGATGT	0.502													64	10	---	---	---	---	PASS
FOXC1	2296	broad.mit.edu	37	6	1611183	1611183	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1611183T>A	uc003mtp.2	+	1	503	c.503T>A	c.(502-504)CTG>CAG	p.L168Q		NM_001453	NP_001444	Q12948	FOXC1_HUMAN	forkhead box C1	168	Fork-head.				anti-apoptosis|artery morphogenesis|blood vessel remodeling|brain development|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|germ cell migration|glycosaminoglycan metabolic process|lacrimal gland development|lymphangiogenesis|metanephros development|negative regulation of mitotic cell cycle|neural crest cell fate commitment|Notch signaling pathway|odontogenesis of dentine-containing tooth|ossification|ovarian follicle development|paraxial mesodermal cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|regulation of blood vessel size|regulation of organ growth|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|ureteric bud development|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	nuclear heterochromatin|transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		GGCAGCTTCCTGCGGCGGCGG	0.547													49	26	---	---	---	---	PASS
CAGE1	285782	broad.mit.edu	37	6	7373571	7373571	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7373571A>C	uc003mxi.2	-	4	1794	c.1073T>G	c.(1072-1074)CTT>CGT	p.L358R	CAGE1_uc003mxh.2_RNA|CAGE1_uc003mxj.2_Missense_Mutation_p.L249R|CAGE1_uc003mxk.1_Missense_Mutation_p.L249R	NM_205864	NP_995586	Q8TC20	CAGE1_HUMAN	cancer antigen 1	494	Potential.										0	Ovarian(93;0.0418)					TTCCTTTTCAAGTTTCTGGAA	0.383													8	29	---	---	---	---	PASS
CCDC90A	63933	broad.mit.edu	37	6	13802567	13802567	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13802567G>A	uc003nbd.2	-	3	675	c.547C>T	c.(547-549)CAA>TAA	p.Q183*	CCDC90A_uc010jpf.2_RNA	NM_001031713	NP_001026883	Q96AQ8	CC90A_HUMAN	coiled-coil domain containing 90A precursor	183						integral to membrane|mitochondrion					0	Breast(50;0.0027)|Ovarian(93;0.0964)	all_hematologic(90;0.117)				TCTGCTTGTTGAGTAGCAAAC	0.438													22	84	---	---	---	---	PASS
KIF13A	63971	broad.mit.edu	37	6	17828467	17828467	+	Intron	SNP	T	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17828467T>G	uc003ncg.3	-						KIF13A_uc003ncf.2_Intron|KIF13A_uc003nch.3_Intron|KIF13A_uc003nci.3_Intron|KIF13A_uc003ncj.2_Intron	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TTTACTTTTCTTACCTTGCAT	0.403													16	2	---	---	---	---	PASS
SCAND3	114821	broad.mit.edu	37	6	28543271	28543271	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28543271G>T	uc003nlo.2	-	3	1829	c.1211C>A	c.(1210-1212)ACT>AAT	p.T404N		NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN	SCAN domain containing 3	404	Integrase catalytic.				DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CCGCAAAAAAGTTAACTTTGT	0.368													12	55	---	---	---	---	PASS
ZNF311	282890	broad.mit.edu	37	6	28963923	28963923	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28963923T>C	uc003nlu.2	-	7	1369	c.856A>G	c.(856-858)ACC>GCC	p.T286A	ZNF311_uc011dlk.1_Missense_Mutation_p.T194A|ZNF311_uc003nlv.2_Missense_Mutation_p.T194A	NM_001010877	NP_001010877	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	286	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding				0						TGATTTCTGGTCTTGAATGCT	0.438													11	62	---	---	---	---	PASS
HLA-E	3133	broad.mit.edu	37	6	30459173	30459173	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30459173C>T	uc003nqg.2	+	4	908	c.870C>T	c.(868-870)CCC>CCT	p.P290P	HLA-E_uc011dmg.1_RNA|HLA-E_uc011dmh.1_Silent_p.P331P	NM_005516	NP_005507	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	290	Ig-like C1-type.|Alpha-3.|Extracellular (Potential).				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			central_nervous_system(4)|ovary(1)	5						TACCCGAGCCCGTCACCCTGA	0.617													12	74	---	---	---	---	PASS
FGD2	221472	broad.mit.edu	37	6	36976741	36976741	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36976741C>G	uc010jwp.1	+	2	371	c.200C>G	c.(199-201)ACA>AGA	p.T67R	FGD2_uc003onf.2_Missense_Mutation_p.T67R|FGD2_uc011dtu.1_Missense_Mutation_p.T67R|FGD2_uc003ong.2_5'UTR|FGD2_uc011dtv.1_5'UTR	NM_173558	NP_775829	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	67					actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|early endosome membrane|Golgi apparatus|lamellipodium|nucleus|ruffle membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			upper_aerodigestive_tract(1)|lung(1)|pancreas(1)	3						GAGCCCAGGACAGTCAGCAGG	0.627													15	62	---	---	---	---	PASS
UBR2	23304	broad.mit.edu	37	6	42603239	42603239	+	Silent	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42603239A>G	uc011dur.1	+	14	1629	c.1629A>G	c.(1627-1629)AAA>AAG	p.K543K	UBR2_uc011dus.1_Silent_p.K188K|UBR2_uc010jxv.1_Silent_p.K47K|UBR2_uc003osh.2_RNA	NM_015255	NP_056070	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin	543					cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding			ovary(3)|pancreas(1)	4	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TACAAATGAAATTAACACATG	0.433													12	60	---	---	---	---	PASS
KIAA0240	23506	broad.mit.edu	37	6	42796618	42796618	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42796618G>T	uc003osn.1	+	6	698	c.547G>T	c.(547-549)GGT>TGT	p.G183C	KIAA0240_uc003osm.1_Missense_Mutation_p.G183C|KIAA0240_uc011duw.1_Missense_Mutation_p.G183C|KIAA0240_uc003oso.1_Missense_Mutation_p.G183C|KIAA0240_uc003osp.1_Missense_Mutation_p.G183C	NM_015349	NP_056164	Q6AI39	K0240_HUMAN	hypothetical protein LOC23506	183										ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)			CAATACAGTGGGTGTACAACA	0.453													6	104	---	---	---	---	PASS
MEA1	4201	broad.mit.edu	37	6	42981026	42981026	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42981026C>G	uc003otk.2	-	2	197	c.130G>C	c.(130-132)GAA>CAA	p.E44Q	MEA1_uc010jyc.1_Missense_Mutation_p.E31Q|KLHDC3_uc003otl.2_5'Flank|KLHDC3_uc003otm.2_5'Flank|KLHDC3_uc010jyf.2_5'Flank|KLHDC3_uc003otn.2_5'Flank	NM_014623	NP_055438	Q16626	MEA1_HUMAN	male-enhanced antigen	44					cell differentiation|male gonad development|spermatogenesis		protein binding			central_nervous_system(1)|skin(1)	2			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CCAGTGCCTTCTGAAGGGCCC	0.602													38	88	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51900450	51900450	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51900450G>C	uc003pah.1	-	28	3443	c.3167C>G	c.(3166-3168)TCG>TGG	p.S1056W	PKHD1_uc003pai.2_Missense_Mutation_p.S1056W	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1056	IPT/TIG 5.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GATGGCACACGAGTAAGATCC	0.448													21	87	---	---	---	---	PASS
KLHL31	401265	broad.mit.edu	37	6	53517046	53517046	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53517046C>G	uc003pcb.3	-	3	1396	c.1255G>C	c.(1255-1257)GGG>CGG	p.G419R	uc003pcc.1_Silent_p.P146P	NM_001003760	NP_001003760	Q9H511	KLH31_HUMAN	kelch repeat and BTB (POZ) domain containing 1	419	Kelch 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent					ovary(1)	1	Lung NSC(77;0.0158)					TACACGAGCCCGTTGAACACG	0.612													19	62	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56495034	56495034	+	Intron	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56495034G>C	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Intron|DST_uc003pdc.3_Intron|DST_uc003pdd.3_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCAAAAGTGAGTCTCATACCT	0.299													27	19	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75899527	75899527	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75899527G>C	uc003phs.2	-	6	565	c.399C>G	c.(397-399)TGC>TGG	p.C133W	COL12A1_uc003pht.2_Intron|COL12A1_uc003phu.1_5'Flank	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	133					cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						CACTGACAGAGCATTCTGAAA	0.348													5	58	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90382276	90382276	+	Silent	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90382276T>C	uc003pnn.1	-	81	13736	c.13620A>G	c.(13618-13620)CAA>CAG	p.Q4540Q		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	4540					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CATAATCTTCTTGTGGGCTTG	0.373													3	49	---	---	---	---	PASS
RTN4IP1	84816	broad.mit.edu	37	6	107035607	107035607	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107035607T>A	uc003prj.2	-	7	1414	c.937A>T	c.(937-939)ATA>TTA	p.I313L	RTN4IP1_uc010kdd.2_Intron|RTN4IP1_uc003prk.2_Missense_Mutation_p.I213L	NM_032730	NP_116119	Q8WWV3	RT4I1_HUMAN	reticulon 4 interacting protein 1 precursor	313						mitochondrion	oxidoreductase activity|zinc ion binding				0	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)		CCATCTGCTATGCCCAATCGG	0.502													47	39	---	---	---	---	PASS
C6orf203	51250	broad.mit.edu	37	6	107361441	107361441	+	Intron	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107361441A>G	uc003prq.2	+						C6orf203_uc011eaj.1_Intron|C6orf203_uc010kde.2_Intron	NM_016487	NP_057571	Q9P0P8	CF203_HUMAN	hypothetical protein LOC51250 isoform a												0	Breast(9;0.00124)|all_epithelial(6;0.0729)	all_cancers(87;0.00461)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|Colorectal(196;0.171)|all_epithelial(87;0.23)	BRCA - Breast invasive adenocarcinoma(8;0.000395)|all cancers(7;0.00065)|Epithelial(6;0.000834)|OV - Ovarian serous cystadenocarcinoma(5;0.244)	BRCA - Breast invasive adenocarcinoma(108;0.117)		GAAAGTGAGTATGATACGCAT	0.358													26	14	---	---	---	---	PASS
SLC35F1	222553	broad.mit.edu	37	6	118635213	118635213	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118635213C>G	uc003pxx.3	+	8	1226	c.1025C>G	c.(1024-1026)TCT>TGT	p.S342C	SLC35F1_uc003pxy.1_Missense_Mutation_p.S147C	NM_001029858	NP_001025029	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	342	Helical; (Potential).				transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)		TATCTCCTGTCTTTCTTCACC	0.473													22	44	---	---	---	---	PASS
TAAR2	9287	broad.mit.edu	37	6	132938493	132938493	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132938493C>A	uc003qdl.1	-	2	852	c.852G>T	c.(850-852)TTG>TTT	p.L284F	TAAR2_uc010kfr.1_Missense_Mutation_p.L239F	NM_001033080	NP_001028252	Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2 isoform 1	284	Helical; Name=6; (Potential).					plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		AAAAGGGATCCAATAAAATTG	0.328													4	40	---	---	---	---	PASS
ARID1B	57492	broad.mit.edu	37	6	157527589	157527589	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157527589G>A	uc003qqn.2	+	20	5412	c.5260G>A	c.(5260-5262)GCA>ACA	p.A1754T	ARID1B_uc003qqo.2_Missense_Mutation_p.A1714T|ARID1B_uc003qqp.2_Missense_Mutation_p.A1701T	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1759					chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GGACGCCGCTGCAGACCCAAA	0.507													20	47	---	---	---	---	PASS
SNX9	51429	broad.mit.edu	37	6	158357063	158357063	+	Silent	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158357063G>T	uc003qqv.1	+	14	1607	c.1434G>T	c.(1432-1434)GTG>GTT	p.V478V		NM_016224	NP_057308	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	478	BAR.				cell communication|intracellular protein transport|lipid tube assembly|positive regulation of GTPase activity|positive regulation of protein oligomerization|receptor-mediated endocytosis	clathrin-coated vesicle|cytoplasmic vesicle membrane|extrinsic to internal side of plasma membrane|ruffle|trans-Golgi network	1-phosphatidylinositol binding|protein homodimerization activity|ubiquitin protein ligase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		CCAGTCTCGTGGCAGAACAGG	0.348													7	25	---	---	---	---	PASS
RSPH3	83861	broad.mit.edu	37	6	159414882	159414882	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159414882T>A	uc003qrx.2	-	2	809	c.619A>T	c.(619-621)ACA>TCA	p.T207S	RSPH3_uc010kju.2_Missense_Mutation_p.T207S|RSPH3_uc003qry.1_Missense_Mutation_p.T207S	NM_031924	NP_114130	Q86UC2	RSPH3_HUMAN	radial spoke 3 homolog	207										ovary(1)|skin(1)	2		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)		AGTGGCCCTGTCTGGAGTGCA	0.274													33	17	---	---	---	---	PASS
PARK2	5071	broad.mit.edu	37	6	161990421	161990421	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161990421T>C	uc003qtx.3	-	8	1033	c.899A>G	c.(898-900)GAG>GGG	p.E300G	PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Missense_Mutation_p.E109G|PARK2_uc003qtw.3_Missense_Mutation_p.E109G|PARK2_uc003qty.3_Missense_Mutation_p.E272G|PARK2_uc003qtz.3_Missense_Mutation_p.E151G|PARK2_uc010kke.1_Missense_Mutation_p.E319G|PARK2_uc011egf.1_5'UTR	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1	300					aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		GTGATGGAGCTCTTTAATCAA	0.428													14	25	---	---	---	---	PASS
GPER	2852	broad.mit.edu	37	7	1131471	1131471	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1131471C>A	uc010ksd.1	+	2	496	c.107C>A	c.(106-108)CCG>CAG	p.P36Q	C7orf50_uc003sju.2_Intron|C7orf50_uc011jvt.1_Intron|C7orf50_uc011jvu.1_Intron|GPER_uc003sjz.1_Missense_Mutation_p.P36Q|GPER_uc003ska.1_Missense_Mutation_p.P36Q|GPER_uc003skb.2_Missense_Mutation_p.P36Q	NM_001098201	NP_001091671	Q99527	GPER_HUMAN	G protein-coupled receptor 30	36	Extracellular (Potential).			Missing (in Ref. 7; AAB02736).		endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;2.32e-16)		CTGTCCCACCCGCTCCTGGGC	0.672													3	16	---	---	---	---	PASS
TMEM106B	54664	broad.mit.edu	37	7	12254526	12254526	+	Silent	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12254526G>T	uc011jxk.1	+	3	490	c.90G>T	c.(88-90)CTG>CTT	p.L30L	TMEM106B_uc003ssh.2_Silent_p.L30L	NM_018374	NP_060844	Q9NUM4	T106B_HUMAN	transmembrane protein 106B	30						integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (126;0.185)		GGAATGGACTGGTTAATAGTG	0.388													4	41	---	---	---	---	PASS
BBS9	27241	broad.mit.edu	37	7	33380528	33380528	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33380528G>A	uc003tdn.1	+	11	1731	c.1218G>A	c.(1216-1218)GAG>GAA	p.E406E	BBS9_uc003tdo.1_Silent_p.E406E|BBS9_uc003tdp.1_Silent_p.E406E|BBS9_uc003tdq.1_Silent_p.E406E|BBS9_uc010kwn.1_RNA|BBS9_uc011kao.1_Silent_p.E284E	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2	406					fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			CCATGACTGAGAGAGAAGATG	0.313									Bardet-Biedl_syndrome				3	24	---	---	---	---	PASS
BBS9	27241	broad.mit.edu	37	7	33380529	33380529	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33380529A>G	uc003tdn.1	+	11	1732	c.1219A>G	c.(1219-1221)AGA>GGA	p.R407G	BBS9_uc003tdo.1_Missense_Mutation_p.R407G|BBS9_uc003tdp.1_Missense_Mutation_p.R407G|BBS9_uc003tdq.1_Missense_Mutation_p.R407G|BBS9_uc010kwn.1_RNA|BBS9_uc011kao.1_Missense_Mutation_p.R285G	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2	407					fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			CATGACTGAGAGAGAAGATGA	0.313									Bardet-Biedl_syndrome				3	24	---	---	---	---	PASS
GRM3	2913	broad.mit.edu	37	7	86468590	86468590	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86468590G>T	uc003uid.2	+	4	2859	c.1760G>T	c.(1759-1761)GGT>GTT	p.G587V	GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Missense_Mutation_p.G459V|GRM3_uc010leh.2_Missense_Mutation_p.G179V	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	587	Helical; Name=1; (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	GCCTGTCTGGGTTTTATGTGT	0.493													8	23	---	---	---	---	PASS
NRCAM	4897	broad.mit.edu	37	7	107866828	107866828	+	Intron	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107866828G>A	uc003vfb.2	-						NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Intron|NRCAM_uc003vfd.2_Intron|NRCAM_uc003vfe.2_Intron	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A						angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						AAAGGCTGGAGAAAGGCAGAG	0.413													42	10	---	---	---	---	PASS
CTTNBP2	83992	broad.mit.edu	37	7	117431717	117431717	+	Silent	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117431717T>C	uc003vjf.2	-	4	1625	c.1533A>G	c.(1531-1533)GGA>GGG	p.G511G		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	511	Pro-rich.									ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TTGGGGGCACTCCAGGCCTTG	0.537													32	35	---	---	---	---	PASS
PTPRZ1	5803	broad.mit.edu	37	7	121650911	121650911	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121650911C>T	uc003vjy.2	+	12	2206	c.1811C>T	c.(1810-1812)TCC>TTC	p.S604F	PTPRZ1_uc003vjz.2_Missense_Mutation_p.S604F|PTPRZ1_uc011knt.1_Missense_Mutation_p.S54F	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	604	Extracellular (Potential).				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						GAGAACATATCCCAAGGGTAT	0.413													21	3	---	---	---	---	PASS
PTPRZ1	5803	broad.mit.edu	37	7	121674395	121674395	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121674395C>A	uc003vjy.2	+	17	5642	c.5247C>A	c.(5245-5247)GAC>GAA	p.D1749E	PTPRZ1_uc003vjz.2_Missense_Mutation_p.D882E|PTPRZ1_uc011knt.1_Missense_Mutation_p.D339E	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	1749	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						ACCACCCAGACAACAAGCACA	0.353													18	5	---	---	---	---	PASS
BRAF	673	broad.mit.edu	37	7	140534646	140534646	+	Silent	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140534646T>C	uc003vwc.3	-	3	328	c.267A>G	c.(265-267)CTA>CTG	p.L89L		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	89					activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	GGAGTGCATCTAGCTTGCTGG	0.363		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				38	8	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142139721	142139721	+	Intron	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142139721C>G	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krv.1_5'Flank|uc003vyt.3_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		TGAGGACTCACCTGTCCCTAG	0.368													41	7	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142334748	142334748	+	Intron	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142334748G>T	uc011krp.1	+						uc011krr.1_Intron|uc003vzp.2_Missense_Mutation_p.S57I|uc003vzq.2_Missense_Mutation_p.S58I					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		CCGAAACAGAGTCTCATGCTG	0.502											OREG0018395	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	46	11	---	---	---	---	PASS
TPK1	27010	broad.mit.edu	37	7	144320288	144320288	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144320288G>T	uc003weq.2	-	6	428	c.325C>A	c.(325-327)CAA>AAA	p.Q109K	TPK1_uc003weo.2_Missense_Mutation_p.Q104K|TPK1_uc003wep.2_RNA|TPK1_uc003wer.2_Missense_Mutation_p.Q109K|TPK1_uc003wes.2_RNA	NM_022445	NP_071890	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1 isoform a	109					thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)	ATCTTCTTTTGGAGCATTTTA	0.318													5	86	---	---	---	---	PASS
PRKAG2	51422	broad.mit.edu	37	7	151478529	151478529	+	Intron	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151478529C>A	uc003wkk.2	-						PRKAG2_uc003wkj.2_Intron|PRKAG2_uc010lqe.1_Intron|PRKAG2_uc003wkm.1_Intron	NM_016203	NP_057287	Q9UGJ0	AAKG2_HUMAN	AMP-activated protein kinase gamma2 subunit						ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)		TGCAGAAAAACAGACGAATGG	0.617													3	2	---	---	---	---	PASS
NEIL2	252969	broad.mit.edu	37	8	11637323	11637323	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11637323G>T	uc003wug.2	+	3	1030	c.355G>T	c.(355-357)GAG>TAG	p.E119*	NEIL2_uc003wue.2_Nonsense_Mutation_p.E119*|NEIL2_uc003wuf.2_Nonsense_Mutation_p.E58*|NEIL2_uc011kxd.1_Intron	NM_145043	NP_659480	Q969S2	NEIL2_HUMAN	nei like 2 isoform a	119					base-excision repair|nucleotide-excision repair	nucleus	damaged DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|hydrolase activity, hydrolyzing N-glycosyl compounds|zinc ion binding				0	all_epithelial(15;0.103)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.166)		TGAGTATTTGGAGAGAGACGC	0.587								BER_DNA_glycosylases					4	32	---	---	---	---	PASS
PSD3	23362	broad.mit.edu	37	8	18725364	18725364	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18725364C>T	uc003wza.2	-	4	1557	c.1454G>A	c.(1453-1455)CGC>CAC	p.R485H		NM_015310	NP_056125	Q9NYI0	PSD3_HUMAN	ADP-ribosylation factor guanine nucleotide	485					regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		TTCTTTAATGCGCTGTTGTAT	0.463													37	51	---	---	---	---	PASS
PIWIL2	55124	broad.mit.edu	37	8	22212891	22212891	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22212891G>T	uc003xbn.2	+	23	2943	c.2795G>T	c.(2794-2796)TGG>TTG	p.W932L	PIWIL2_uc011kzf.1_Missense_Mutation_p.W896L|PIWIL2_uc010ltv.2_Missense_Mutation_p.W932L|PIWIL2_uc003xbo.2_Missense_Mutation_p.W86L	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2	932	Piwi.				DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		CACATGTACTGGAATTGGCCT	0.463													4	26	---	---	---	---	PASS
DDHD2	23259	broad.mit.edu	37	8	38095096	38095096	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38095096A>G	uc003xlb.2	+	4	829	c.452A>G	c.(451-453)AAG>AGG	p.K151R	DDHD2_uc003xla.2_Missense_Mutation_p.K151R|DDHD2_uc003xlc.2_Missense_Mutation_p.K151R|DDHD2_uc011lbl.1_Silent_p.K3K	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1	151					lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			GAATGGAAAAAGAAACTGGAA	0.323													6	8	---	---	---	---	PASS
HOOK3	84376	broad.mit.edu	37	8	42805523	42805523	+	Intron	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42805523G>C	uc003xpr.2	+						HOOK3_uc010lxq.1_Intron	NM_032410	NP_115786	Q86VS8	HOOK3_HUMAN	golgi-associated microtubule-binding protein						cytoplasmic microtubule organization|early endosome to late endosome transport|endosome organization|endosome to lysosome transport|Golgi localization|interkinetic nuclear migration|lysosome organization|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome|protein transport	cis-Golgi network|FHF complex|microtubule|pericentriolar material	identical protein binding|microtubule binding			ovary(1)|breast(1)	2	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			GATTGTTCTTGTTTTCAGAGT	0.368			T	RET	papillary thyroid								19	41	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52366225	52366225	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52366225C>T	uc003xqu.3	-	10	1204	c.1103G>A	c.(1102-1104)GGA>GAA	p.G368E		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	368	Ig-like C2-type 2.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CAGCTCCAATCCATTGTCCCT	0.512													15	30	---	---	---	---	PASS
LYN	4067	broad.mit.edu	37	8	56879273	56879273	+	Splice_Site	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56879273G>T	uc003xsk.3	+	9	1073	c.791_splice	c.e9-1	p.G264_splice	LYN_uc003xsl.3_Splice_Site_p.G243_splice	NM_002350	NP_002341	P07948	LYN_HUMAN	Yamaguchi sarcoma viral (v-yes-1) oncogene						erythrocyte differentiation|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of cellular component movement|positive regulation of stress-activated protein kinase signaling cascade|positive regulation of tyrosine phosphorylation of STAT protein|response to DNA damage stimulus|T cell costimulation	cytosol|Golgi apparatus|membrane raft|nucleus|perinuclear region of cytoplasm	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|receptor signaling protein tyrosine kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)			TTTCTTCCTAGGTTACTATAA	0.323													4	36	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61741222	61741222	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61741222G>A	uc003xue.2	+	14	3856	c.3379G>A	c.(3379-3381)GAA>AAA	p.E1127K		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1127	Helicase ATP-binding.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GTTACCTCAGGAACACAAAGT	0.448													9	18	---	---	---	---	PASS
GGH	8836	broad.mit.edu	37	8	63936743	63936743	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63936743G>C	uc003xuw.2	-	6	785	c.502C>G	c.(502-504)CAA>GAA	p.Q168E		NM_003878	NP_003869	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase precursor	168	Gamma-glutamyl hydrolase.				glutamine metabolic process	extracellular space|lysosome|melanosome	gamma-glutamyl-peptidase activity				0	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|L-Glutamic Acid(DB00142)	CTGTGCAATTGACCTGAAATA	0.373													9	23	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87755766	87755766	+	Silent	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87755766G>C	uc003ydx.2	-	1	136	c.90C>G	c.(88-90)GGC>GGG	p.G30G		NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	30	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						TTGGGTGAGAGCCTTCTTCAT	0.413													20	33	---	---	---	---	PASS
SLC26A7	115111	broad.mit.edu	37	8	92364054	92364054	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92364054C>T	uc003yex.2	+	11	1435	c.1157C>T	c.(1156-1158)TCT>TTT	p.S386F	SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Missense_Mutation_p.S386F|SLC26A7_uc003yfa.2_Missense_Mutation_p.S386F	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a	386	Helical; (Potential).					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			TGTCTAATATCTTGCATTTTC	0.363													15	47	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100523350	100523350	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100523350G>C	uc003yiv.2	+	29	4429	c.4318G>C	c.(4318-4320)GAT>CAT	p.D1440H	VPS13B_uc003yiw.2_Missense_Mutation_p.D1415H|VPS13B_uc003yix.1_Missense_Mutation_p.D910H	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	1440					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAAACTTCTAGATGGCACTCA	0.348													51	5	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103297515	103297515	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103297515T>C	uc003ykr.1	-	40	5569	c.5536A>G	c.(5536-5538)ATG>GTG	p.M1846V	UBR5_uc003yks.1_Missense_Mutation_p.M1846V	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	1846					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			GTAGAATCCATAATACTGACC	0.378													34	23	---	---	---	---	PASS
DCAF13	25879	broad.mit.edu	37	8	104427542	104427542	+	Silent	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104427542A>T	uc003yln.2	+	1	601	c.324A>T	c.(322-324)CCA>CCT	p.P108P	SLC25A32_uc003yll.2_5'Flank|SLC25A32_uc011lhr.1_5'Flank|DCAF13_uc003ylm.1_5'UTR|DCAF13_uc003ylo.2_5'UTR	NM_015420	NP_056235	Q9NV06	DCA13_HUMAN	WD repeats and SOF1 domain containing	Error:Variant_position_missing_in_Q9NV06_after_alignment					rRNA processing	CUL4 RING ubiquitin ligase complex|nucleolus|ribonucleoprotein complex				breast(1)	1						CAGTTGAGCCAGCAGGCCGCC	0.637													15	25	---	---	---	---	PASS
TRPS1	7227	broad.mit.edu	37	8	116616594	116616594	+	Silent	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116616594C>A	uc003ynz.2	-	3	2022	c.1563G>T	c.(1561-1563)ACG>ACT	p.T521T	TRPS1_uc011lhy.1_Silent_p.T525T|TRPS1_uc003yny.2_Silent_p.T534T|TRPS1_uc010mcy.2_Silent_p.T521T	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	521					negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			AATTATAGCTCGTTACCATAT	0.458									Langer-Giedion_syndrome				5	62	---	---	---	---	PASS
ZHX2	22882	broad.mit.edu	37	8	123964395	123964395	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123964395C>T	uc003ypk.1	+	3	1212	c.645C>T	c.(643-645)ACC>ACT	p.T215T		NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	215	Required for homodimerization.					cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			TGGAAGGGACCGCCCGCCTGG	0.582													27	75	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	134145777	134145777	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134145777C>A	uc003ytw.2	+	47	8102	c.8061C>A	c.(8059-8061)GAC>GAA	p.D2687E	TG_uc010mdw.2_Missense_Mutation_p.D1446E|TG_uc011ljb.1_Missense_Mutation_p.D1056E|TG_uc011ljc.1_Missense_Mutation_p.D820E	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2687					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CCTGGCCTGACTTTGTACCCC	0.507													16	41	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	134146939	134146939	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134146939G>A	uc003ytw.2	+	48	8249	c.8208G>A	c.(8206-8208)CAG>CAA	p.Q2736Q	TG_uc010mdw.2_Silent_p.Q1495Q|TG_uc011ljb.1_Silent_p.Q1105Q|TG_uc011ljc.1_Silent_p.Q869Q	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2736					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AGGGCGGGCAGTCAGCAGAGA	0.537													40	22	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139729117	139729117	+	Intron	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139729117A>G	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TTCTCCCTGAAAATGCAATAA	0.403										HNSCC(7;0.00092)			15	14	---	---	---	---	PASS
LY6K	54742	broad.mit.edu	37	8	143784501	143784501	+	Intron	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143784501C>A	uc011ljv.1	+						LY6K_uc011ljw.1_3'UTR|LY6K_uc011ljx.1_Intron	NM_017527	NP_059997	Q17RY6	LY6K_HUMAN	lymphocyte antigen 6 complex, locus K isoform 1							anchored to membrane|cytoplasm|extracellular region|nucleolus|plasma membrane				central_nervous_system(1)	1	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GTCTTTATTTCCTATTAGAAA	0.532													6	18	---	---	---	---	PASS
RECQL4	9401	broad.mit.edu	37	8	145742508	145742508	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145742508G>A	uc003zdj.2	-	4	312	c.280C>T	c.(280-282)CCA>TCA	p.P94S	LRRC14_uc003zdk.1_5'Flank|LRRC14_uc003zdl.1_5'Flank	NM_004260	NP_004251	O94761	RECQ4_HUMAN	RecQ protein-like 4	94					DNA duplex unwinding|DNA recombination|DNA repair	cytoplasm|nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|DNA strand annealing activity|zinc ion binding			breast(2)|lung(1)|skin(1)	4	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CTCCGCCCTGGCGTAGACTGT	0.672			N|F|S			osteosarcoma|skin basal and sqamous cell		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	RAPADILINO_syndrome|Rothmund-Thomson_syndrome|Baller-Gerold_syndrome				8	9	---	---	---	---	PASS
NDUFB6	4712	broad.mit.edu	37	9	32573013	32573013	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32573013G>C	uc003zre.1	-	1	170	c.46C>G	c.(46-48)CGA>GGA	p.R16G	NDUFB6_uc003zrf.1_Missense_Mutation_p.R16G	NM_002493	NP_002484	O95139	NDUB6_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	16					mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00199)	NADH(DB00157)	CTCAGCTCTCGCAGCTGCTGC	0.602											OREG0019131	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	17	---	---	---	---	PASS
C9orf131	138724	broad.mit.edu	37	9	35045209	35045209	+	Silent	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35045209C>A	uc003zvw.2	+	2	2612	c.2583C>A	c.(2581-2583)TCC>TCA	p.S861S	C9orf131_uc003zvu.2_Silent_p.S813S|C9orf131_uc003zvv.2_Silent_p.S788S|C9orf131_uc003zvx.2_Silent_p.S826S	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	861											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			TCCAGTCCTCCCACTGTCATC	0.552													8	234	---	---	---	---	PASS
DAPK1	1612	broad.mit.edu	37	9	90313662	90313662	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90313662G>A	uc004apc.2	+	23	2841	c.2703G>A	c.(2701-2703)GAG>GAA	p.E901E	DAPK1_uc004apd.2_Silent_p.E901E|DAPK1_uc011ltg.1_Silent_p.E835E|DAPK1_uc011lth.1_Silent_p.E638E	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	901	ANK 9.				apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						CTGGAGGCGAGTTTGGATATG	0.562									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				16	24	---	---	---	---	PASS
TSTD2	158427	broad.mit.edu	37	9	100364999	100364999	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100364999G>A	uc004axn.2	-	10	1791	c.1303C>T	c.(1303-1305)CCC>TCC	p.P435S	TSTD2_uc004axo.2_Missense_Mutation_p.P209S	NM_139246	NP_640339	Q5T7W7	TSTD2_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like	435										ovary(2)	2						CGGCACTGGGGAGTAGAGCAG	0.507													15	36	---	---	---	---	PASS
KIAA1958	158405	broad.mit.edu	37	9	115337069	115337069	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115337069A>T	uc004bgf.1	+	2	884	c.709A>T	c.(709-711)AAG>TAG	p.K237*	KIAA1958_uc011lwx.1_Nonsense_Mutation_p.K237*	NM_133465	NP_597722	Q8N8K9	K1958_HUMAN	hypothetical protein LOC158405	237										skin(1)	1						GGCAAAACCCAAGCCTCAGAC	0.512													20	93	---	---	---	---	PASS
ZNF618	114991	broad.mit.edu	37	9	116811778	116811778	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116811778C>T	uc004bid.2	+	15	2295	c.2196C>T	c.(2194-2196)CTC>CTT	p.L732L	ZNF618_uc004bic.2_Silent_p.L639L|ZNF618_uc011lxi.1_Silent_p.L699L|ZNF618_uc011lxj.1_Silent_p.L700L|ZNF618_uc010mvb.2_Silent_p.L322L	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	732					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGCACCTGCTCAGCAACCTGG	0.597													9	17	---	---	---	---	PASS
ZNF618	114991	broad.mit.edu	37	9	116811801	116811801	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116811801C>T	uc004bid.2	+	15	2318	c.2219C>T	c.(2218-2220)ACG>ATG	p.T740M	ZNF618_uc004bic.2_Missense_Mutation_p.T647M|ZNF618_uc011lxi.1_Missense_Mutation_p.T707M|ZNF618_uc011lxj.1_Missense_Mutation_p.T708M|ZNF618_uc010mvb.2_Missense_Mutation_p.T330M	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	740					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GCCATCCTGACGCCGGTGAAG	0.612													7	21	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117808912	117808912	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117808912G>C	uc004bjj.3	-	17	5264	c.4902C>G	c.(4900-4902)GAC>GAG	p.D1634E	TNC_uc010mvf.2_Intron	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	1634	Fibronectin type-III 12.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						GACGGAAACCGTCTGGGGTGG	0.478													19	37	---	---	---	---	PASS
ABL1	25	broad.mit.edu	37	9	133760965	133760965	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133760965G>A	uc004bzw.2	+	11	3291	c.3288G>A	c.(3286-3288)GAG>GAA	p.E1096E	ABL1_uc004bzv.2_Silent_p.E1115E	NM_005157	NP_005148	P00519	ABL1_HUMAN	c-abl oncogene 1, receptor tyrosine kinase	1096	Nuclear export signal (By similarity).|F-actin-binding.				actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)	ATCTCCGGGAGCTTCAGATCT	0.527			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								11	19	---	---	---	---	PASS
CACNA1B	774	broad.mit.edu	37	9	140907687	140907687	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140907687C>A	uc004cog.2	+	18	2412	c.2267C>A	c.(2266-2268)GCC>GAC	p.A756D	CACNA1B_uc011mfd.1_Missense_Mutation_p.A287E	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	756	Cytoplasmic (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	TCCATCGCCGCGTAAGGCTCC	0.607													14	14	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25877958	25877958	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25877958G>A	uc001isj.2	+	8	1836	c.1776G>A	c.(1774-1776)TGG>TGA	p.W592*		NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	592	Helical; Name=5; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						TCCTCTTGTGGGGTGTTTATC	0.393													7	15	---	---	---	---	PASS
SVIL	6840	broad.mit.edu	37	10	29754670	29754670	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29754670C>T	uc001iut.1	-	34	6740	c.5987G>A	c.(5986-5988)AGT>AAT	p.S1996N	LOC387647_uc001iuo.1_Intron|LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|SVIL_uc010qdw.1_Missense_Mutation_p.S910N|SVIL_uc001iuu.1_Missense_Mutation_p.S1570N	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	1996					cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				GAAGTTAAAACTTCCAGGATC	0.363													3	6	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73494018	73494018	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73494018C>G	uc001jrx.3	+	32	4503	c.4126C>G	c.(4126-4128)CTG>GTG	p.L1376V	C10orf105_uc001jsb.1_Intron|CDH23_uc001jsc.1_Missense_Mutation_p.L184V	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	1376	Cadherin 13.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						AGTCCAGGGCCTGGTGGACCG	0.597													8	11	---	---	---	---	PASS
GSTO1	9446	broad.mit.edu	37	10	106022748	106022748	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106022748G>C	uc001kya.2	+	4	387	c.378G>C	c.(376-378)TTG>TTC	p.L126F		NM_004832	NP_004823	P78417	GSTO1_HUMAN	glutathione-S-transferase omega 1	126	GST C-terminal.				xenobiotic metabolic process	cytosol	glutathione transferase activity|monodehydroascorbate reductase (NADH) activity				0		Colorectal(252;0.102)|Breast(234;0.122)		Epithelial(162;8.07e-10)|all cancers(201;2.72e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0147)	Glutathione(DB00143)	TGCCATCCTTGGTAGGAAGCT	0.373													15	13	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108448089	108448089	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108448089C>T	uc001kym.2	-	10	1429	c.1421G>A	c.(1420-1422)GGG>GAG	p.G474E	SORCS1_uc001kyl.2_Missense_Mutation_p.G474E|SORCS1_uc009xxs.2_Missense_Mutation_p.G474E|SORCS1_uc001kyn.1_Missense_Mutation_p.G474E|SORCS1_uc001kyo.2_Missense_Mutation_p.G474E	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	474	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TCCCTTTATCCCTGCTACCTG	0.398													5	14	---	---	---	---	PASS
C10orf96	374355	broad.mit.edu	37	10	118101585	118101585	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118101585A>T	uc001lck.2	+	5	571	c.320A>T	c.(319-321)AAA>ATA	p.K107I		NM_198515	NP_940917	P0C7W6	CJ096_HUMAN	hypothetical protein LOC374355	107										ovary(2)	2		Lung NSC(174;0.204)|all_lung(145;0.248)		all cancers(201;0.014)		GAGGAAGACAAATTTATTAAG	0.249													10	18	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1099773	1099773	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1099773G>A	uc001lsx.1	+	43	14483	c.14456G>A	c.(14455-14457)GGA>GAA	p.G4819E		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4819	VWFC 1.					inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GGCTGTGTGGGACCTGACAAT	0.572													31	61	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1263589	1263589	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1263589A>G	uc009ycr.1	+	47	7684	c.7558A>G	c.(7558-7560)AGC>GGC	p.S2520G	MUC5B_uc001ltb.2_Missense_Mutation_p.S1830G	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	1827	7 X Cys-rich subdomain repeats.|Thr-rich.|Cys-rich subdomain 3.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGCACCAAAGAGCATAGAGTG	0.597													25	17	---	---	---	---	PASS
CHRNA10	57053	broad.mit.edu	37	11	3691059	3691059	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3691059G>A	uc001lyf.2	-	2	246	c.174C>T	c.(172-174)ACC>ACT	p.T58T	CHRNA10_uc010qxt.1_5'UTR|CHRNA10_uc010qxu.1_5'UTR	NM_020402	NP_065135	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10	58	Extracellular (Potential).				elevation of cytosolic calcium ion concentration|regulation of cell proliferation|synaptic transmission, cholinergic	cell junction|postsynaptic membrane	calcium channel activity|receptor activity|receptor binding			ovary(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Procaine(DB00721)|Trimethaphan(DB01116)	TCACCTCCAGGGTCACATTCA	0.552													15	48	---	---	---	---	PASS
OR52K2	119774	broad.mit.edu	37	11	4471324	4471324	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4471324C>G	uc001lyz.1	+	1	755	c.755C>G	c.(754-756)GCC>GGC	p.A252G		NM_001005172	NP_001005172	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K,	252	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCCATCTTAGCCTTCTACACA	0.493													34	99	---	---	---	---	PASS
OR51T1	401665	broad.mit.edu	37	11	4903114	4903114	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4903114G>A	uc010qyp.1	+	1	66	c.66G>A	c.(64-66)CAG>CAA	p.Q22Q		NM_001004759	NP_001004759	Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T,	Error:Variant_position_missing_in_Q8NGJ9_after_alignment					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCATAGTTCAGTGTCTTCAAC	0.308													24	18	---	---	---	---	PASS
NLRP10	338322	broad.mit.edu	37	11	7981729	7981729	+	Missense_Mutation	SNP	G	C	C	rs77351963		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7981729G>C	uc001mfv.1	-	2	1447	c.1430C>G	c.(1429-1431)TCT>TGT	p.S477C		NM_176821	NP_789791	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	477	NACHT.						ATP binding			lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CACCAGGTAAGACATGGCATG	0.517													30	62	---	---	---	---	PASS
SBF2	81846	broad.mit.edu	37	11	9875089	9875089	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9875089G>T	uc001mib.2	-	20	2672	c.2534C>A	c.(2533-2535)CCA>CAA	p.P845Q	SBF2_uc001mif.3_Missense_Mutation_p.P601Q|uc001mig.2_Intron	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2	845					myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		GTGATTACCTGGTATCATGCA	0.388													4	47	---	---	---	---	PASS
USP47	55031	broad.mit.edu	37	11	11977671	11977671	+	Silent	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11977671A>G	uc001mjs.2	+	28	4780	c.4017A>G	c.(4015-4017)GCA>GCG	p.A1339A	USP47_uc001mjr.2_Silent_p.A1271A|USP47_uc009ygi.2_Silent_p.A141A	NM_017944	NP_060414	Q96K76	UBP47_HUMAN	ubiquitin specific protease 47	1359					base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding			ovary(1)|skin(1)	2				Epithelial(150;0.000339)		AAGAGAAAGCACTAAAAATAT	0.383													30	51	---	---	---	---	PASS
NELL1	4745	broad.mit.edu	37	11	21596535	21596535	+	Silent	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21596535T>C	uc001mqe.2	+	20	2553	c.2400T>C	c.(2398-2400)TGT>TGC	p.C800C	NELL1_uc001mqf.2_Silent_p.C753C|NELL1_uc009yid.2_Silent_p.C828C|NELL1_uc010rdo.1_Silent_p.C743C|NELL1_uc010rdp.1_Silent_p.C513C|NELL1_uc001mqh.2_Silent_p.C345C	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	800	VWFC 5.				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						GAGTCTGTTGTTCTGTGGATT	0.358													11	19	---	---	---	---	PASS
MPPED2	744	broad.mit.edu	37	11	30439059	30439059	+	Intron	SNP	A	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30439059A>C	uc001msr.2	-						MPPED2_uc001msq.3_Intron|MPPED2_uc009yji.2_Intron	NM_001584	NP_001575	Q15777	MPPD2_HUMAN	metallophosphoesterase domain containing 2						nervous system development		hydrolase activity|metal ion binding			skin(1)	1						CCTTTGCTTCACTTACCTAGA	0.428													18	22	---	---	---	---	PASS
QSER1	79832	broad.mit.edu	37	11	32955081	32955081	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32955081A>C	uc001mty.2	+	4	2157	c.1890A>C	c.(1888-1890)AAA>AAC	p.K630N	QSER1_uc001mtz.1_Missense_Mutation_p.K391N|QSER1_uc001mua.2_Missense_Mutation_p.K135N	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	630										ovary(3)|central_nervous_system(2)|skin(1)	6	Breast(20;0.158)					AAGCATCAAAAAAAGAAGAAA	0.373													17	43	---	---	---	---	PASS
C11orf41	25758	broad.mit.edu	37	11	33565884	33565884	+	Silent	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33565884T>A	uc001mup.3	+	1	2008	c.1884T>A	c.(1882-1884)GGT>GGA	p.G628G	C11orf41_uc001mun.1_Silent_p.G628G	NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						integral to membrane				ovary(2)	2						AATGGACAGGTGCAGCCACTA	0.507													14	20	---	---	---	---	PASS
RAG2	5897	broad.mit.edu	37	11	36615574	36615574	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36615574C>G	uc001mwv.3	-	2	333	c.145G>C	c.(145-147)GAT>CAT	p.D49H	C11orf74_uc010rfd.1_5'Flank|C11orf74_uc001mww.1_5'Flank|C11orf74_uc001mwx.1_5'Flank|C11orf74_uc001mwy.1_5'Flank|C11orf74_uc001mwz.1_5'Flank|C11orf74_uc010rfe.1_5'Flank	NM_000536	NP_000527	P55895	RAG2_HUMAN	recombination activating gene 2	49					chromatin modification|pre-B cell allelic exclusion|somatic diversification of immunoglobulins|T cell differentiation in thymus|V(D)J recombination	nucleus	chromatin binding|DNA binding|endonuclease activity|methylated histone residue binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|zinc ion binding			skin(3)|ovary(1)|pancreas(1)	5	all_lung(20;0.226)	all_hematologic(20;0.00756)				TGCTTTACATCCAGATGGAAA	0.458									Familial_Hemophagocytic_Lymphohistiocytosis				16	36	---	---	---	---	PASS
OR4S1	256148	broad.mit.edu	37	11	48328449	48328449	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48328449C>T	uc010rhu.1	+	1	675	c.675C>T	c.(673-675)AGC>AGT	p.S225S		NM_001004725	NP_001004725	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S,	225	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						ACCTAAGAAGCCAGTCATCTG	0.458													66	30	---	---	---	---	PASS
OR4A16	81327	broad.mit.edu	37	11	55111277	55111277	+	Missense_Mutation	SNP	G	T	T	rs141072345		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55111277G>T	uc010rie.1	+	1	601	c.601G>T	c.(601-603)GGT>TGT	p.G201C		NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A,	201	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(2)|pancreas(1)	3						GGTTGCCAATGGTGGAATAAT	0.428													19	81	---	---	---	---	PASS
OR4A16	81327	broad.mit.edu	37	11	55111278	55111278	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55111278G>T	uc010rie.1	+	1	602	c.602G>T	c.(601-603)GGT>GTT	p.G201V		NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A,	201	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(2)|pancreas(1)	3						GTTGCCAATGGTGGAATAATT	0.433													19	80	---	---	---	---	PASS
OR4C15	81309	broad.mit.edu	37	11	55322667	55322667	+	Silent	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55322667T>A	uc010rig.1	+	1	885	c.885T>A	c.(883-885)TCT>TCA	p.S295S		NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C,	241	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CCTGTGGATCTCACATTGCTG	0.428										HNSCC(20;0.049)			37	78	---	---	---	---	PASS
GIF	2694	broad.mit.edu	37	11	59597030	59597030	+	Intron	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59597030C>A	uc001noi.2	-							NM_005142	NP_005133	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)						cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding			ovary(1)|liver(1)	2						TGGAAATAAGCAGAGAATAAC	0.458													8	19	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62259292	62259292	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62259292C>T	uc001ntk.1	-	5	654	c.354G>A	c.(352-354)CAG>CAA	p.Q118Q		NM_024060	NP_076965	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 2	Error:Variant_position_missing_in_Q09666_after_alignment					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				GTGCTGATGGCTGTGGTGTGT	0.453													4	14	---	---	---	---	PASS
TUT1	64852	broad.mit.edu	37	11	62349016	62349016	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62349016G>A	uc001nto.2	-	3	583	c.545C>T	c.(544-546)CCC>CTC	p.P182L		NM_022830	NP_073741	Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6	144					mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2						GTGACTGTCGGGGGCCGCTCC	0.652													28	10	---	---	---	---	PASS
TUT1	64852	broad.mit.edu	37	11	62349017	62349017	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62349017G>A	uc001nto.2	-	3	582	c.544C>T	c.(544-546)CCC>TCC	p.P182S		NM_022830	NP_073741	Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6	144					mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2						TGACTGTCGGGGGCCGCTCCT	0.647													28	10	---	---	---	---	PASS
NXF1	10482	broad.mit.edu	37	11	62568576	62568576	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62568576G>C	uc001nvf.1	-	9	1032	c.896C>G	c.(895-897)TCT>TGT	p.S299C	NXF1_uc001nvg.1_Missense_Mutation_p.S299C|NXF1_uc009yog.1_Missense_Mutation_p.S342C|NXF1_uc010rmh.1_Missense_Mutation_p.S162C	NM_006362	NP_006353	Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1 isoform 1	299	LRR 2.|Interaction with THOC4.				gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding			skin(3)	3						TTCATTTCCAGAAAGGTTTAG	0.458													19	12	---	---	---	---	PASS
KCNK4	50801	broad.mit.edu	37	11	64064613	64064613	+	Silent	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64064613C>A	uc001nzj.1	+	4	659	c.336C>A	c.(334-336)CGC>CGA	p.R112R	KCNK4_uc009ypl.1_Missense_Mutation_p.A85E|KCNK4_uc001nzk.1_Missense_Mutation_p.A46E|KCNK4_uc010rnk.1_5'UTR|KCNK4_uc001nzl.1_Missense_Mutation_p.A46E|KCNK4_uc001nzm.3_RNA|KCNK4_uc001nzn.1_Silent_p.R112R|KCNK4_uc001nzo.2_Silent_p.R112R|KCNK4_uc001nzp.1_5'UTR	NM_033310	NP_201567	Q9NYG8	KCNK4_HUMAN	TRAAK	112						integral to membrane	potassium channel activity|voltage-gated ion channel activity				0						TGGCCCTGCGCACAGATGCCG	0.652													15	11	---	---	---	---	PASS
FCHSD2	9873	broad.mit.edu	37	11	72598570	72598570	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72598570C>A	uc009ytl.2	-	12	1312	c.1091G>T	c.(1090-1092)CGA>CTA	p.R364L	FCHSD2_uc010rrg.1_Missense_Mutation_p.R228L|FCHSD2_uc001oth.3_Missense_Mutation_p.R308L|FCHSD2_uc001oti.2_Missense_Mutation_p.R323L	NM_014824	NP_055639	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2	364	Potential.						protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			TAGCTCTGCTCGGCTTTGTTC	0.383													26	72	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85437446	85437446	+	Intron	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85437446C>T	uc010rth.1	-						SYTL2_uc010rtg.1_Intron|SYTL2_uc010rti.1_Intron|SYTL2_uc010rtj.1_Intron|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Silent_p.L18L|SYTL2_uc001pbb.2_Silent_p.L18L|SYTL2_uc001pbc.2_Silent_p.L18L|SYTL2_uc010rtf.1_Intron	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		AAAACTTTCTCAAATTCTCAA	0.353													10	31	---	---	---	---	PASS
CCDC83	220047	broad.mit.edu	37	11	85576208	85576208	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85576208C>A	uc001pbh.1	+	2	554	c.42C>A	c.(40-42)GAC>GAA	p.D14E	CCDC83_uc001pbg.1_Missense_Mutation_p.D14E	NM_173556	NP_775827	Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	14										skin(1)	1		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				ATACACATGACGGGCCACCAA	0.368													50	160	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88780921	88780921	+	Silent	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88780921G>C	uc001pcq.2	-	1	320	c.120C>G	c.(118-120)CTC>CTG	p.L40L	GRM5_uc009yvm.2_Silent_p.L40L|GRM5_uc009yvn.1_Silent_p.L40L	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	40	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	GAACAGAAAAGAGAGCTCCAA	0.517													11	20	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92087130	92087130	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92087130G>T	uc001pdj.3	+	1	1869	c.1852G>T	c.(1852-1854)GGA>TGA	p.G618*		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	618	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AATCATTTCTGGAAATGAACT	0.363										TCGA Ovarian(4;0.039)			11	13	---	---	---	---	PASS
PANX1	24145	broad.mit.edu	37	11	93911564	93911564	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93911564G>A	uc001per.2	+	3	736	c.351G>A	c.(349-351)GCG>GCA	p.A117A	PANX1_uc001peq.2_Silent_p.A117A	NM_015368	NP_056183	Q96RD7	PANX1_HUMAN	pannexin 1	117	Helical; (Potential).				positive regulation of interleukin-1 beta secretion|protein hexamerization|synaptic transmission	bleb|endoplasmic reticulum membrane|gap junction|integral to membrane	calcium channel activity|gap junction hemi-channel activity|leak channel activity|receptor binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TGCTCTTTGCGATCCTCCTGT	0.473													27	14	---	---	---	---	PASS
AASDHPPT	60496	broad.mit.edu	37	11	105948587	105948587	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105948587G>A	uc001pjc.1	+	1	296	c.150G>A	c.(148-150)CAG>CAA	p.Q50Q	KBTBD3_uc001pja.2_5'Flank|KBTBD3_uc001pjb.2_5'Flank|KBTBD3_uc009yxm.2_5'Flank|AASDHPPT_uc010rvn.1_RNA	NM_015423	NP_056238	Q9NRN7	ADPPT_HUMAN	aminoadipate-semialdehyde	50					macromolecule biosynthetic process|pantothenate metabolic process	cytosol	holo-[acyl-carrier-protein] synthase activity|magnesium ion binding|protein binding				0		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)		GCATTGGCCAGTTCGTCTTTG	0.607													12	24	---	---	---	---	PASS
GUCY1A2	2977	broad.mit.edu	37	11	106617374	106617374	+	Intron	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106617374A>G	uc001pjg.1	-						GUCY1A2_uc010rvo.1_Intron|GUCY1A2_uc009yxn.1_Intron	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2						intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)		CTGGGGCTTGAAAAGTCACAC	0.393													9	20	---	---	---	---	PASS
CUL5	8065	broad.mit.edu	37	11	107959295	107959295	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107959295T>A	uc001pjv.2	+	12	1887	c.1220T>A	c.(1219-1221)CTG>CAG	p.L407Q	CUL5_uc001pju.2_RNA	NM_003478	NP_003469	Q93034	CUL5_HUMAN	Vasopressin-activated calcium-mobilizing	407					cell cycle arrest|cell proliferation|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process|viral reproduction	cullin-RING ubiquitin ligase complex|cytosol	calcium channel activity|receptor activity|ubiquitin protein ligase binding			ovary(1)	1		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		TGCCCTGAGCTGCTTGCCAAT	0.333													13	38	---	---	---	---	PASS
RNF214	257160	broad.mit.edu	37	11	117150919	117150919	+	Silent	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117150919G>T	uc001pqt.2	+	8	1134	c.1089G>T	c.(1087-1089)CTG>CTT	p.L363L	RNF214_uc001pqu.2_Silent_p.L363L|RNF214_uc010rxf.1_Silent_p.L208L	NM_207343	NP_997226	Q8ND24	RN214_HUMAN	ring finger protein 214	363	Potential.						zinc ion binding				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		AAGAGTTACTGGTACTGAAAC	0.358													7	156	---	---	---	---	PASS
IL10RA	3587	broad.mit.edu	37	11	117869931	117869931	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117869931C>T	uc001prv.2	+	7	1389	c.1312C>T	c.(1312-1314)CCA>TCA	p.P438S	IL10RA_uc010rxl.1_Missense_Mutation_p.P418S|IL10RA_uc010rxm.1_Missense_Mutation_p.P418S|IL10RA_uc010rxn.1_Missense_Mutation_p.P289S|IL10RA_uc001prw.2_Missense_Mutation_p.P289S	NM_001558	NP_001549	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha precursor	438	Cytoplasmic (Potential).					integral to membrane|plasma membrane	interleukin-10 receptor activity			ovary(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		GGAAGAAGACCCAGCTGCTGT	0.607													21	42	---	---	---	---	PASS
BCL9L	283149	broad.mit.edu	37	11	118772641	118772641	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118772641G>C	uc001pug.2	-	6	2776	c.1811C>G	c.(1810-1812)CCA>CGA	p.P604R	BCL9L_uc009zal.2_Missense_Mutation_p.P599R	NM_182557	NP_872363	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	604					negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		transcription coactivator activity			ovary(1)|pancreas(1)	2	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		CTGGTTGCCTGGGAAACGGGG	0.632													7	11	---	---	---	---	PASS
OR4D5	219875	broad.mit.edu	37	11	123810819	123810819	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123810819C>G	uc001pzk.1	+	1	496	c.496C>G	c.(496-498)CTG>GTG	p.L166V		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	166	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GACTATCCAGCTGCCATTCTG	0.478													13	27	---	---	---	---	PASS
OR8B2	26595	broad.mit.edu	37	11	124252313	124252313	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124252313C>T	uc010sai.1	-	1	927	c.927G>A	c.(925-927)AGG>AGA	p.R309R		NM_001005468	NP_001005468	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B,	309	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		ATATATTTCTCCTCTGAATTT	0.343													6	34	---	---	---	---	PASS
CACNA2D4	93589	broad.mit.edu	37	12	1963192	1963192	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1963192C>A	uc001qjp.2	-	23	2402	c.2171G>T	c.(2170-2172)CGG>CTG	p.R724L	CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Missense_Mutation_p.R588L|CACNA2D4_uc009zdr.1_RNA	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4	724	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CAGCACCTCCCGGACCAGCTC	0.587													3	15	---	---	---	---	PASS
NCAPD2	9918	broad.mit.edu	37	12	6619410	6619410	+	Intron	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6619410G>A	uc001qoo.2	+						NCAPD2_uc009zen.1_Intron|NCAPD2_uc010sfd.1_Intron|SCARNA10_uc009zeo.1_RNA	NM_014865	NP_055680	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2						cell division|mitotic chromosome condensation	condensin core heterodimer|cytoplasm	histone binding			ovary(2)|lung(1)|breast(1)|kidney(1)	5						TATCAAGGCTGTTGTGATTCA	0.388													31	82	---	---	---	---	PASS
ENO2	2026	broad.mit.edu	37	12	7025668	7025668	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7025668T>C	uc001qru.1	+	3	395	c.173T>C	c.(172-174)TTA>TCA	p.L58S	ENO2_uc009zfi.1_Missense_Mutation_p.L58S|ENO2_uc010sfq.1_Missense_Mutation_p.L58S|ENO2_uc001qrv.1_Missense_Mutation_p.L58S	NM_001975	NP_001966	P09104	ENOG_HUMAN	enolase 2	58					gluconeogenesis|glycolysis	phosphopyruvate hydratase complex|plasma membrane	magnesium ion binding|phosphopyruvate hydratase activity				0						CAGCGTTACTTAGGCAAAGGT	0.572													11	20	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	9007400	9007400	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9007400A>T	uc001quz.3	+	22	2835	c.2737A>T	c.(2737-2739)ACA>TCA	p.T913S	A2ML1_uc001qva.1_Missense_Mutation_p.T493S|A2ML1_uc010sgm.1_Missense_Mutation_p.T413S	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor	757						extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						GGTGGAGAAGACACACAGCTC	0.463													11	28	---	---	---	---	PASS
PHC1	1911	broad.mit.edu	37	12	9083501	9083501	+	Silent	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9083501C>G	uc001qvd.2	+	7	1239	c.1083C>G	c.(1081-1083)CCC>CCG	p.P361P	PHC1_uc001qvc.1_Silent_p.P316P|PHC1_uc010sgn.1_Silent_p.P361P|PHC1_uc001qve.2_Silent_p.P361P	NM_004426	NP_004417	P78364	PHC1_HUMAN	polyhomeotic 1-like	361					multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						CACCTGCGCCCAGCCAGACAC	0.423													4	11	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9227227	9227227	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9227227T>A	uc001qvk.1	-	29	3798	c.3685A>T	c.(3685-3687)ACC>TCC	p.T1229S	A2M_uc001qvj.1_Missense_Mutation_p.T271S|A2M_uc009zgk.1_Missense_Mutation_p.T1079S	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	1229					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	GTTGCAGAGGTCAGGTCCTCC	0.547													5	14	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9309771	9309771	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9309771C>G	uc001qvl.2	-	28	3579	c.3550G>C	c.(3550-3552)GAC>CAC	p.D1184H	PZP_uc009zgl.2_Missense_Mutation_p.D970H	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						gtgCTCTCACCTTCTTTCACA	0.229													14	17	---	---	---	---	PASS
PRB4	5545	broad.mit.edu	37	12	11150480	11150480	+	Intron	SNP	A	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11150480A>C	uc001qzf.1	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRH1_uc001qzj.2_Intron|TAS2R20_uc001qzm.2_5'Flank	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1						ATCATGTCTAAACAAAAAAGC	0.328										HNSCC(22;0.051)			8	17	---	---	---	---	PASS
TMTC1	83857	broad.mit.edu	37	12	29709822	29709822	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29709822G>T	uc001rjb.2	-	10	1794	c.1320C>A	c.(1318-1320)AAC>AAA	p.N440K	TMTC1_uc001riz.2_Missense_Mutation_p.N197K|TMTC1_uc001rja.2_Missense_Mutation_p.N284K|TMTC1_uc001rjc.1_Missense_Mutation_p.N502K	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	548	TPR 3.					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					AAAGAGCCCGGTTATGCTGTG	0.502													20	50	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43822241	43822241	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43822241C>T	uc010skx.1	-	26	3748	c.3748G>A	c.(3748-3750)GTT>ATT	p.V1250I	ADAMTS20_uc001rno.1_Missense_Mutation_p.V368I|ADAMTS20_uc001rnp.1_Missense_Mutation_p.V404I	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1250	TSP type-1 8.					proteinaceous extracellular matrix	zinc ion binding	p.P1250P(1)|p.P1250T(1)		central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		AAAGGGCGAACTTCAGGATCA	0.478													9	43	---	---	---	---	PASS
TROAP	10024	broad.mit.edu	37	12	49724003	49724003	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49724003G>A	uc001rtx.3	+	13	1542	c.1375G>A	c.(1375-1377)GGA>AGA	p.G459R	TROAP_uc009zlh.2_Missense_Mutation_p.G459R|TROAP_uc001rty.2_Missense_Mutation_p.G167R	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1	459					cell adhesion	cytoplasm				ovary(1)	1						CCCTCTTAATGGAGGCTCTTC	0.542													29	94	---	---	---	---	PASS
KCNH3	23416	broad.mit.edu	37	12	49936562	49936562	+	Silent	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49936562G>T	uc001ruh.1	+	4	779	c.519G>T	c.(517-519)GTG>GTT	p.V173V	KCNH3_uc010smj.1_Silent_p.V113V	NM_012284	NP_036416	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H	173	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	two-component sensor activity|voltage-gated potassium channel activity				0						GCCGGGCCGTGCTCTACCACC	0.652													5	6	---	---	---	---	PASS
DIP2B	57609	broad.mit.edu	37	12	51090901	51090901	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51090901C>A	uc001rwv.2	+	17	2147	c.1991C>A	c.(1990-1992)CCT>CAT	p.P664H	DIP2B_uc009zlt.2_Missense_Mutation_p.P94H	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B	664						nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						GGACTGAAGCCTGAGGCCATC	0.493													5	57	---	---	---	---	PASS
CD63	967	broad.mit.edu	37	12	56119959	56119959	+	Silent	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56119959A>G	uc001shm.2	-	5	609	c.513T>C	c.(511-513)ATT>ATC	p.I171I	CD63_uc009znz.2_Silent_p.I148I|CD63_uc001shn.2_Silent_p.I171I|CD63_uc001sho.2_Silent_p.I171I|CD63_uc001shp.2_Silent_p.I171I	NM_001780	NP_001771	P08962	CD63_HUMAN	CD63 antigen isoform A	171	Extracellular (Potential).				platelet activation|platelet degranulation	integral to plasma membrane|late endosome membrane|lysosomal membrane|platelet dense granule membrane					0						CAGTAACATTAATGCAGCAGG	0.502													24	37	---	---	---	---	PASS
DTX3	196403	broad.mit.edu	37	12	58000741	58000741	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58000741A>T	uc001sow.1	+	5	432	c.95A>T	c.(94-96)GAG>GTG	p.E32V	DTX3_uc001sov.1_Missense_Mutation_p.E25V|DTX3_uc001sox.1_Missense_Mutation_p.E25V|DTX3_uc001soy.1_Missense_Mutation_p.E25V	NM_178502	NP_848597	Q8N9I9	DTX3_HUMAN	deltex homolog 3	32					Notch signaling pathway	cytoplasm	zinc ion binding			breast(1)|central_nervous_system(1)	2	Melanoma(17;0.122)					CTGAGCAAAGAGACCCCAGCC	0.592													61	85	---	---	---	---	PASS
AGAP2	116986	broad.mit.edu	37	12	58129142	58129142	+	Intron	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58129142G>A	uc001spq.2	-						AGAP2_uc001spp.2_Intron|AGAP2_uc001spr.2_Intron	NM_001122772	NP_001116244	Q99490	AGAP2_HUMAN	centaurin, gamma 1 isoform PIKE-L						axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding			central_nervous_system(3)|breast(2)	5						AAGGGGACTGGGTTACCTACC	0.458													12	18	---	---	---	---	PASS
TSPAN31	6302	broad.mit.edu	37	12	58140912	58140912	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58140912G>T	uc001spt.2	+	5	710	c.556G>T	c.(556-558)GAG>TAG	p.E186*	TSPAN31_uc009zqb.2_Nonsense_Mutation_p.E102*|TSPAN31_uc010ssa.1_Nonsense_Mutation_p.E108*	NM_005981	NP_005972	Q12999	TSN31_HUMAN	sarcoma amplified sequence	186	Helical; (Potential).				positive regulation of cell proliferation	integral to plasma membrane|membrane fraction					0	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			TAGCTTTACAGAGGTAACATT	0.438													8	124	---	---	---	---	PASS
CPSF6	11052	broad.mit.edu	37	12	69650536	69650536	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69650536C>A	uc001sut.3	+	4	544	c.434C>A	c.(433-435)CCT>CAT	p.P145H	CPSF6_uc001suu.3_Missense_Mutation_p.P145H|CPSF6_uc010stk.1_5'Flank	NM_007007	NP_008938	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6,	145	RRM.|Necessary for interaction with NUDT21/CPSF5.				mRNA polyadenylation|protein tetramerization	mRNA cleavage factor complex|paraspeckles|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding				0	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			GATCTGTTACCTAAAAGAGAA	0.383													6	96	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	72666957	72666957	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72666957G>C	uc001sxa.2	+	1	429	c.399G>C	c.(397-399)TGG>TGC	p.W133C	LOC283392_uc010stv.1_5'UTR	NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	133	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						GGGAGCCGTGGGAGCCGTGGA	0.706													6	13	---	---	---	---	PASS
ACSS3	79611	broad.mit.edu	37	12	81472035	81472035	+	Missense_Mutation	SNP	C	T	T	rs12824208		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81472035C>T	uc001szl.1	+	1	227	c.136C>T	c.(136-138)CTC>TTC	p.L46F	ACSS3_uc001szm.1_Missense_Mutation_p.L46F	NM_024560	NP_078836	Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	46						mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						GCGGGGCGGTCTCGGGGGCCG	0.741													6	4	---	---	---	---	PASS
VEZT	55591	broad.mit.edu	37	12	95656866	95656866	+	Intron	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95656866C>A	uc001tdz.2	+						VEZT_uc009zsy.1_Intron|VEZT_uc001tdr.2_Intron|VEZT_uc001tds.2_Intron|VEZT_uc001tdt.2_Intron|VEZT_uc009zsz.1_Intron|VEZT_uc001tdv.2_Intron|VEZT_uc001tdw.1_Intron|VEZT_uc009zta.1_Intron	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane							acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						TGGTACTGTCCAGAAAACACC	0.423													7	228	---	---	---	---	PASS
METAP2	10988	broad.mit.edu	37	12	95907481	95907481	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95907481T>C	uc001tec.2	+	11	1372	c.1238T>C	c.(1237-1239)CTT>CCT	p.L413P	METAP2_uc010suv.1_Missense_Mutation_p.L390P|METAP2_uc009ztd.2_Missense_Mutation_p.L377P|METAP2_uc001ted.2_Missense_Mutation_p.L412P|METAP2_uc001tef.2_Missense_Mutation_p.L390P|METAP2_uc001tee.2_RNA	NM_006838	NP_006829	P50579	AMPM2_HUMAN	methionyl aminopeptidase 2	413					N-terminal protein amino acid modification|peptidyl-methionine modification|protein processing|proteolysis	cytoplasm	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0					L-Methionine(DB00134)	TTTGGAACCCTTGCCTTCTGC	0.413													28	83	---	---	---	---	PASS
AMDHD1	144193	broad.mit.edu	37	12	96348760	96348760	+	Intron	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96348760G>A	uc001tel.1	+						AMDHD1_uc009zth.1_Intron	NM_152435	NP_689648	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1						histidine catabolic process to glutamate and formamide	cytosol	imidazolonepropionase activity|metal ion binding			central_nervous_system(1)	1						GAAGGTAACTGCAACAAATCA	0.348													10	53	---	---	---	---	PASS
ALDH1L2	160428	broad.mit.edu	37	12	105459074	105459074	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105459074G>T	uc001tlc.2	-	6	884	c.757C>A	c.(757-759)CCT>ACT	p.P253T	ALDH1L2_uc009zuo.2_5'UTR|ALDH1L2_uc009zup.2_RNA	NM_001034173	NP_001029345	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	253					10-formyltetrahydrofolate catabolic process|biosynthetic process	mitochondrion	acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity|phosphopantetheine binding			skin(1)	1						CAAGCTCCAGGGACTTTATCA	0.463													5	78	---	---	---	---	PASS
KDM2B	84678	broad.mit.edu	37	12	121877660	121877660	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121877660C>T	uc001uat.2	-	22	3933	c.3829G>A	c.(3829-3831)GAC>AAC	p.D1277N	KDM2B_uc001uaq.2_Missense_Mutation_p.D717N|KDM2B_uc010szy.1_Missense_Mutation_p.D717N|KDM2B_uc001uar.2_Missense_Mutation_p.D868N|KDM2B_uc001uas.2_Missense_Mutation_p.D1208N|KDM2B_uc001uau.2_Intron|KDM2B_uc001uao.2_Missense_Mutation_p.D525N|KDM2B_uc010szx.1_Missense_Mutation_p.D525N|KDM2B_uc001uap.2_RNA	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform	1277	LRR 5.				embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						CCTGACTCACCAGACAGGTTG	0.547													8	12	---	---	---	---	PASS
VPS33A	65082	broad.mit.edu	37	12	122746006	122746006	+	Intron	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122746006G>C	uc001ucd.2	-						VPS33A_uc001ucc.2_Intron|VPS33A_uc001uce.2_Intron	NM_022916	NP_075067	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33A						lysosome localization|melanosome localization|platelet formation|protein transport|regulation of developmental pigmentation|vesicle docking involved in exocytosis	early endosome|late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			skin(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		TGCAAAGGAAGCAACATTTGT	0.269													13	43	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	129566492	129566492	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129566492C>G	uc009zyl.1	-	7	2063	c.1735G>C	c.(1735-1737)GTC>CTC	p.V579L	TMEM132D_uc001uia.2_Missense_Mutation_p.V117L	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	579	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TGCGTCAGGACCCGCACCATG	0.647													5	23	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	129822210	129822210	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129822210T>C	uc009zyl.1	-	4	1596	c.1268A>G	c.(1267-1269)AAG>AGG	p.K423R		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	423	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AATCAAGTCCTTTGGGCTCAC	0.612													33	131	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23928867	23928867	+	Silent	SNP	G	T	T	rs144468379	byFrequency	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23928867G>T	uc001uon.2	-	8	2473	c.1884C>A	c.(1882-1884)CCC>CCA	p.P628P	SACS_uc001uoo.2_Silent_p.P481P|SACS_uc001uop.1_Silent_p.P415P|SACS_uc001uoq.1_Silent_p.P481P	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	628					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GCACCCACGCGGGCGTCACCT	0.562													3	15	---	---	---	---	PASS
C13orf15	28984	broad.mit.edu	37	13	42032568	42032568	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42032568C>G	uc001uyi.2	+	2	499	c.197C>G	c.(196-198)GCC>GGC	p.A66G		NM_014059	NP_054778	Q9H4X1	RGC32_HUMAN	response gene to complement 32	66	Ser/Thr-rich.				cell cycle|regulation of cyclin-dependent protein kinase activity	microtubule organizing center|nucleus					0		Lung NSC(96;7.5e-06)|Prostate(109;0.0181)|Breast(139;0.0204)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;8.62e-09)|Epithelial(112;8.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000504)|GBM - Glioblastoma multiforme(144;0.000909)|BRCA - Breast invasive adenocarcinoma(63;0.0679)		CGCAGCAGCGCCAGTGTCAGC	0.682													5	0	---	---	---	---	PASS
RB1	5925	broad.mit.edu	37	13	49030452	49030452	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49030452A>T	uc001vcb.2	+	19	2093	c.1927A>T	c.(1927-1929)AAA>TAA	p.K643*		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	643	Pocket; binds T and E1A.|Domain B.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(6)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GAAGCCATTGAAATCTACCTC	0.284		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			13	7	---	---	---	---	PASS
RCBTB2	1102	broad.mit.edu	37	13	49096059	49096059	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49096059G>T	uc001vch.2	-	4	388	c.17C>A	c.(16-18)CCT>CAT	p.P6H	RCBTB2_uc010tgg.1_Intron|RCBTB2_uc001vci.2_Intron|RCBTB2_uc010tgh.1_Intron|RCBTB2_uc001vcj.2_Intron|RCBTB2_uc010acv.1_Intron|RCBTB2_uc010tgi.1_Intron	NM_001268	NP_001259	O95199	RCBT2_HUMAN	regulator of chromosome condensation and BTB	6							Ran guanyl-nucleotide exchange factor activity			ovary(2)|lung(2)|skin(1)	5		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		AGAGAAAAGAGGAAGTTCTTC	0.443													5	56	---	---	---	---	PASS
TDRD3	81550	broad.mit.edu	37	13	61083927	61083927	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61083927G>T	uc001via.2	+	9	1398	c.610G>T	c.(610-612)GAA>TAA	p.E204*	TDRD3_uc010aef.2_Nonsense_Mutation_p.E29*|TDRD3_uc001vhz.3_Nonsense_Mutation_p.E204*|TDRD3_uc010aeg.2_Nonsense_Mutation_p.E297*|TDRD3_uc001vib.3_Nonsense_Mutation_p.E203*	NM_030794	NP_110421	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3 isoform 2	204	UBA.				chromatin modification	cytoplasm|nucleus	chromatin binding|methylated histone residue binding|nucleic acid binding|transcription coactivator activity			upper_aerodigestive_tract(1)|skin(1)	2		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		GCACATAACGGAAATGGGCTT	0.413													37	12	---	---	---	---	PASS
UGGT2	55757	broad.mit.edu	37	13	96513122	96513122	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96513122C>T	uc001vmt.2	-	32	3830	c.3660G>A	c.(3658-3660)TTG>TTA	p.L1220L		NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	1220	Glucosyltransferase.				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						TTTCTTTATGCAAGCTTACTG	0.264													4	6	---	---	---	---	PASS
SLC10A2	6555	broad.mit.edu	37	13	103703676	103703676	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103703676G>T	uc001vpy.3	-	4	1289	c.692C>A	c.(691-693)ACA>AAA	p.T231K		NM_000452	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid	231	Helical; (Potential).				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity			ovary(3)|skin(1)	4	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					AGGAAATATTGTTCCTATAAT	0.478													31	2	---	---	---	---	PASS
OR4N5	390437	broad.mit.edu	37	14	20612464	20612464	+	Silent	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20612464C>A	uc010tla.1	+	1	570	c.570C>A	c.(568-570)ACC>ACA	p.T190T		NM_001004724	NP_001004724	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N,	190	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		TGGCCTGCACCAATACCTTTG	0.532													15	25	---	---	---	---	PASS
CTSG	1511	broad.mit.edu	37	14	25042980	25042980	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25042980C>T	uc001wpq.2	-	5	668	c.631G>A	c.(631-633)GCC>ACC	p.A211T		NM_001911	NP_001902	P08311	CATG_HUMAN	cathepsin G preproprotein	211	Peptidase S1.				immune response|proteolysis	cell surface|extracellular space|plasma membrane|stored secretory granule	heparin binding|serine-type endopeptidase activity			ovary(2)	2				GBM - Glioblastoma multiforme(265;0.0269)		ATGCCGTGGGCCACATTGTTA	0.572													22	32	---	---	---	---	PASS
BAZ1A	11177	broad.mit.edu	37	14	35264907	35264907	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35264907G>T	uc001wsk.2	-	10	1761	c.1193C>A	c.(1192-1194)CCT>CAT	p.P398H	BAZ1A_uc001wsl.2_Missense_Mutation_p.P398H	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	398					chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		ATCTTCTCTAGGTTTACTCCA	0.323													5	50	---	---	---	---	PASS
RPL10L	140801	broad.mit.edu	37	14	47120763	47120763	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47120763C>A	uc001wwg.2	-	1	266	c.177G>T	c.(175-177)CAG>CAT	p.Q59H		NM_080746	NP_542784	Q96L21	RL10L_HUMAN	ribosomal protein L10-like protein	59					spermatogenesis|translation	cytosolic large ribosomal subunit|nucleus	structural constituent of ribosome			ovary(1)	1						CAGAAGACAGCTGCTCATATT	0.512													20	24	---	---	---	---	PASS
RTN1	6252	broad.mit.edu	37	14	60213061	60213061	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60213061A>G	uc001xen.1	-	2	589	c.380T>C	c.(379-381)CTT>CCT	p.L127P		NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A	127					neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		TTCCTTCTGAAGAATTCCAGT	0.488													11	16	---	---	---	---	PASS
RTN1	6252	broad.mit.edu	37	14	60213190	60213190	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60213190C>T	uc001xen.1	-	2	460	c.251G>A	c.(250-252)GGT>GAT	p.G84D		NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A	84					neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		ACTGGAAACACCTGCCACACC	0.517													12	9	---	---	---	---	PASS
KCNH5	27133	broad.mit.edu	37	14	63416964	63416964	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63416964T>C	uc001xfx.2	-	7	1307	c.1256A>G	c.(1255-1257)TAC>TGC	p.Y419C	KCNH5_uc001xfy.2_Missense_Mutation_p.Y419C|KCNH5_uc001xfz.1_Missense_Mutation_p.Y361C|KCNH5_uc001xga.2_Missense_Mutation_p.Y361C	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	419	Extracellular (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		AGAGGACACGTACAATGAATC	0.478													11	23	---	---	---	---	PASS
RAD51L1	5890	broad.mit.edu	37	14	68292250	68292250	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68292250C>G	uc001xkf.1	+	3	218	c.154C>G	c.(154-156)CTT>GTT	p.L52V	RAD51L1_uc010aqq.2_Missense_Mutation_p.L52V|RAD51L1_uc001xkd.2_Missense_Mutation_p.L52V|RAD51L1_uc010aqr.2_5'UTR|RAD51L1_uc001xke.2_Missense_Mutation_p.L52V|RAD51L1_uc010aqs.1_Missense_Mutation_p.L52V|RAD51L1_uc001xkg.1_Missense_Mutation_p.L52V	NM_133509	NP_598193	O15315	RA51B_HUMAN	RAD51-like 1 isoform 3	52					blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)		TGTCCATGAACTTCTATGTAT	0.363			T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					18	23	---	---	---	---	PASS
PSEN1	5663	broad.mit.edu	37	14	73659572	73659572	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73659572G>A	uc001xnr.2	+	7	1053	c.769G>A	c.(769-771)GAT>AAT	p.D257N	PSEN1_uc001xnv.2_Missense_Mutation_p.D253N|PSEN1_uc010ark.2_Missense_Mutation_p.D253N|PSEN1_uc001xnt.1_RNA|PSEN1_uc001xnu.2_RNA	NM_000021	NP_000012	P49768	PSN1_HUMAN	presenilin 1 isoform I-467	257	Helical; (Potential).	Probable.		D->E: Abolishes gamma-secretase activity. Reduces production of amyloid beta in APP processing. Accumulation of full-length PS1. Loss of binding of transition state analog gamma-secretase inhibitor.|D->A: Loss of endoproteolytic cleavage; reduces production of amyloid beta in APP processing and of NICD in NOTCH1 processing.	amyloid precursor protein catabolic process|anti-apoptosis|beta-amyloid metabolic process|cell-cell adhesion|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|smooth endoplasmic reticulum calcium ion homeostasis	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|gamma-secretase complex|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum|smooth endoplasmic reticulum|Z disc	aspartic-type endopeptidase activity|beta-catenin binding|cadherin binding|calcium channel activity|PDZ domain binding			breast(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		TTCAGTATATGGTAAAACCCA	0.423													19	32	---	---	---	---	PASS
YLPM1	56252	broad.mit.edu	37	14	75264286	75264286	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75264286T>G	uc001xqj.3	+	5	2410	c.2286T>G	c.(2284-2286)TTT>TTG	p.F762L	YLPM1_uc001xql.3_RNA	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	567					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CTTGTAGATTTGATGGTCCTC	0.408													6	1	---	---	---	---	PASS
EML5	161436	broad.mit.edu	37	14	89087225	89087225	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89087225A>G	uc001xxg.2	-	39	5434	c.5248T>C	c.(5248-5250)TGT>CGT	p.C1750R	EML5_uc001xxf.2_Missense_Mutation_p.C537R|EML5_uc001xxd.2_5'Flank|EML5_uc001xxe.2_Missense_Mutation_p.C99R	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	1742	WD 26.					cytoplasm|microtubule				ovary(3)	3						GGGCTGTAACACACAGTACGA	0.343													9	11	---	---	---	---	PASS
SERPINA10	51156	broad.mit.edu	37	14	94752583	94752583	+	Silent	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94752583A>G	uc001yct.2	-	4	1471	c.1005T>C	c.(1003-1005)GTT>GTC	p.V335V	SERPINA10_uc001ycu.3_Silent_p.V335V	NM_016186	NP_057270	Q9UK55	ZPI_HUMAN	serine (or cysteine) proteinase inhibitor, clade	335					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		TCGGAAAGAAAACTTCCATGT	0.408													10	21	---	---	---	---	PASS
SERPINA4	5267	broad.mit.edu	37	14	95030166	95030166	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95030166A>C	uc001ydk.2	+	2	413	c.347A>C	c.(346-348)GAT>GCT	p.D116A	SERPINA4_uc010avd.2_Missense_Mutation_p.D153A|SERPINA4_uc001ydl.2_Missense_Mutation_p.D116A	NM_006215	NP_006206	P29622	KAIN_HUMAN	serine (or cysteine) proteinase inhibitor, clade	116					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity			ovary(3)|skin(1)	4				COAD - Colon adenocarcinoma(157;0.211)		TCTGAGTCCGATGTCCATAGG	0.637													8	28	---	---	---	---	PASS
C14orf73	91828	broad.mit.edu	37	14	103574849	103574849	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103574849C>T	uc001ymk.2	+	10	2047	c.1971C>T	c.(1969-1971)GAC>GAT	p.D657D		NM_001077594	NP_001071062	Q17RC7	EX3L4_HUMAN	hypothetical protein LOC91828	657											0		Melanoma(154;0.155)	Epithelial(46;0.221)			GCTACCCCGACATCAGGTGTG	0.597													37	61	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105406088	105406088	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105406088C>T	uc010axc.1	-	7	15820	c.15700G>A	c.(15700-15702)GAG>AAG	p.E5234K	AHNAK2_uc001ypx.2_Missense_Mutation_p.E5134K	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5234						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ACAAGGAACTCTTTGACTTTA	0.552													19	217	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105410247	105410247	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105410247C>G	uc010axc.1	-	7	11661	c.11541G>C	c.(11539-11541)AAG>AAC	p.K3847N	AHNAK2_uc001ypx.2_Missense_Mutation_p.K3747N	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3847						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGTCAGTGGTCTTGAGGTCCC	0.637													7	151	---	---	---	---	PASS
TJP1	7082	broad.mit.edu	37	15	30024886	30024886	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30024886G>A	uc001zcr.2	-	14	2345	c.1870C>T	c.(1870-1872)CAG>TAG	p.Q624*	TJP1_uc010azl.2_Nonsense_Mutation_p.Q612*|TJP1_uc001zcq.2_Nonsense_Mutation_p.Q628*|TJP1_uc001zcs.2_Nonsense_Mutation_p.Q624*	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	624	Guanylate kinase-like.				cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TGAACAGGCTGAGCGGACAAA	0.433													36	9	---	---	---	---	PASS
SPINT1	6692	broad.mit.edu	37	15	41145767	41145767	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41145767C>A	uc001zna.2	+	4	888	c.684C>A	c.(682-684)GAC>GAA	p.D228E	SPINT1_uc001znb.2_Missense_Mutation_p.D228E|SPINT1_uc001znc.2_Missense_Mutation_p.D228E|SPINT1_uc010ucs.1_Missense_Mutation_p.D228E	NM_181642	NP_857593	O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	228						extracellular region|membrane fraction	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		CTAGCTCAGACCACCCAGAGG	0.592													11	10	---	---	---	---	PASS
TP53BP1	7158	broad.mit.edu	37	15	43769871	43769871	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43769871C>A	uc001zrs.2	-	8	1008	c.860G>T	c.(859-861)AGT>ATT	p.S287I	TP53BP1_uc010udp.1_Missense_Mutation_p.S287I|TP53BP1_uc001zrq.3_Missense_Mutation_p.S292I|TP53BP1_uc001zrr.3_Missense_Mutation_p.S292I|TP53BP1_uc010udq.1_Missense_Mutation_p.S292I	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	287					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CTGCAGTCCACTTTCCATAAG	0.438								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					28	28	---	---	---	---	PASS
SEMA7A	8482	broad.mit.edu	37	15	74704328	74704328	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74704328C>T	uc002axv.2	-	11	1360	c.1320G>A	c.(1318-1320)GTG>GTA	p.V440V	SEMA7A_uc010ulk.1_Silent_p.V275V|SEMA7A_uc010ull.1_Silent_p.V426V	NM_003612	NP_003603	O75326	SEM7A_HUMAN	semaphorin 7A isoform 1 preproprotein	440	Sema.				axon guidance|immune response|inflammatory response|integrin-mediated signaling pathway|positive regulation of axon extension|positive regulation of ERK1 and ERK2 cascade|positive regulation of macrophage cytokine production|regulation of inflammatory response	anchored to membrane|external side of plasma membrane	receptor activity			breast(1)|central_nervous_system(1)	2						CCCCCGGTTCCACCACCTTGT	0.637													9	38	---	---	---	---	PASS
MAN2C1	4123	broad.mit.edu	37	15	75656914	75656914	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75656914T>A	uc002baf.2	-	5	532	c.515A>T	c.(514-516)CAG>CTG	p.Q172L	MAN2C1_uc002bag.2_Missense_Mutation_p.Q172L|MAN2C1_uc002bah.2_Missense_Mutation_p.Q172L|MAN2C1_uc010bkk.2_Missense_Mutation_p.Q172L|MAN2C1_uc010umi.1_Intron|MAN2C1_uc010umj.1_RNA|MAN2C1_uc010umk.1_RNA	NM_006715	NP_006706	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	172					mannose metabolic process		alpha-mannosidase activity|carbohydrate binding|protein binding|zinc ion binding				0						CCGGCTCAGCTGGAACATCTT	0.592													11	13	---	---	---	---	PASS
FBXO22	26263	broad.mit.edu	37	15	76205551	76205551	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76205551G>A	uc002bbk.2	+	3	392	c.287G>A	c.(286-288)CGC>CAC	p.R96H	FBXO22_uc002bbj.1_Missense_Mutation_p.R96H|FBXO22_uc002bbl.2_5'UTR	NM_147188	NP_671717	Q8NEZ5	FBX22_HUMAN	F-box only protein 22 isoform a	96					ubiquitin-dependent protein catabolic process		ubiquitin-protein ligase activity				0						CAGAATGTTCGCATCTTACCA	0.338													14	40	---	---	---	---	PASS
TMED3	23423	broad.mit.edu	37	15	79606172	79606172	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79606172C>T	uc002beu.2	+	2	343	c.242C>T	c.(241-243)ACG>ATG	p.T81M	TMED3_uc010unj.1_Missense_Mutation_p.T81M|TMED3_uc002bev.2_RNA	NM_007364	NP_031390	Q9Y3Q3	TMED3_HUMAN	transmembrane emp24 domain containing 3	81	Lumenal (Potential).|GOLD.				protein transport	ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane				ovary(1)|skin(1)	2						TACAGAGAAACGAAGAAGCAG	0.478													26	70	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86198831	86198831	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86198831G>A	uc002blv.1	+	11	4728	c.4558G>A	c.(4558-4560)GGT>AGT	p.G1520S	AKAP13_uc002blt.1_Missense_Mutation_p.G1520S|AKAP13_uc002blu.1_Missense_Mutation_p.G1520S|AKAP13_uc010bnf.1_Missense_Mutation_p.G160S|AKAP13_uc002blw.1_Missense_Mutation_p.G5S|AKAP13_uc010bne.1_Missense_Mutation_p.G173S	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	1520					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						GGGAGCTGAGGGTCGAGAAAG	0.527													6	54	---	---	---	---	PASS
PCSK6	5046	broad.mit.edu	37	15	101872090	101872090	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101872090C>T	uc002bwy.2	-	15	2319	c.2005G>A	c.(2005-2007)GTG>ATG	p.V669M	PCSK6_uc010bpd.2_Missense_Mutation_p.V465M|PCSK6_uc010bpe.2_Missense_Mutation_p.V669M|PCSK6_uc002bxa.2_Missense_Mutation_p.V669M|PCSK6_uc002bxb.2_Missense_Mutation_p.V669M	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	669					glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGAACTTCCACCTGGGAGGGT	0.572													5	18	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1397822	1397822	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1397822G>T	uc002clk.1	+	31	3130	c.3130G>T	c.(3130-3132)GGC>TGC	p.G1044C	BAIAP3_uc002clj.2_Missense_Mutation_p.G1026C|BAIAP3_uc010uuz.1_Missense_Mutation_p.G1009C|BAIAP3_uc010uva.1_Missense_Mutation_p.G981C|BAIAP3_uc010uvc.1_Missense_Mutation_p.G973C	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	1044	C2 2.				G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				GGACGCCAACGGTGAGTTGCA	0.677													3	14	---	---	---	---	PASS
GLIS2	84662	broad.mit.edu	37	16	4385313	4385313	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4385313G>T	uc002cwc.1	+	5	751	c.694G>T	c.(694-696)GAG>TAG	p.E232*		NM_032575	NP_115964	Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	232					cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development	cytoplasm|nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|transcription regulatory region DNA binding|zinc ion binding				0						ACACACCAACGAGAAGCCACA	0.642													3	31	---	---	---	---	PASS
PPL	5493	broad.mit.edu	37	16	4934563	4934563	+	Silent	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4934563G>T	uc002cyd.1	-	22	4183	c.4093C>A	c.(4093-4095)CGG>AGG	p.R1365R		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	1365	Potential.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						GCCTCGGCCCGCAGGCCTGGC	0.672													6	120	---	---	---	---	PASS
PDILT	204474	broad.mit.edu	37	16	20381015	20381015	+	Intron	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20381015C>A	uc002dhc.1	-							NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis						cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						AAAGGATCTGCCAAAGAAAAC	0.498													17	44	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20565107	20565107	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20565107C>T	uc002dhj.3	-	6	942	c.732G>A	c.(730-732)ATG>ATA	p.M244I	ACSM2B_uc002dhk.3_Missense_Mutation_p.M244I|ACSM2B_uc010bwf.1_Missense_Mutation_p.M244I	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	244					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						ACCCAGCATCCATCTTGGCCT	0.517													23	46	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30735282	30735282	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30735282C>A	uc002dze.1	+	25	4922	c.4537C>A	c.(4537-4539)CCA>ACA	p.P1513T	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.P1308T|SRCAP_uc010bzz.1_Missense_Mutation_p.P1083T	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	1513	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			GGCCACAGCTCCATCCCTGTC	0.582													14	42	---	---	---	---	PASS
SETD1A	9739	broad.mit.edu	37	16	30990990	30990990	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30990990C>T	uc002ead.1	+	14	4569	c.3883C>T	c.(3883-3885)CAC>TAC	p.H1295Y		NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	1295					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						CCTGCTCAGCCACATCCTCCT	0.721													8	10	---	---	---	---	PASS
ITGAX	3687	broad.mit.edu	37	16	31382733	31382733	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31382733G>A	uc002ebu.1	+	16	1987	c.1920G>A	c.(1918-1920)CGG>CGA	p.R640R	ITGAX_uc002ebt.2_Silent_p.R640R	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	640	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TTGAGTGTCGGGAGCAGGTGG	0.592													5	24	---	---	---	---	PASS
N4BP1	9683	broad.mit.edu	37	16	48594834	48594834	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48594834C>A	uc002efp.2	-	2	1957	c.1720G>T	c.(1720-1722)GTT>TTT	p.V574F		NM_153029	NP_694574	O75113	N4BP1_HUMAN	Nedd4 binding protein 1	574					negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body					0		all_cancers(37;0.179)|all_lung(18;0.11)				GCATCAGTAACCGAAGGTAAC	0.453													74	51	---	---	---	---	PASS
SLC9A5	6553	broad.mit.edu	37	16	67293564	67293564	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67293564T>G	uc002esm.2	+	11	1778	c.1715T>G	c.(1714-1716)CTG>CGG	p.L572R	SLC9A5_uc010cee.2_Missense_Mutation_p.L277R|SLC9A5_uc010vji.1_Missense_Mutation_p.L76R|uc002esn.1_5'Flank	NM_004594	NP_004585	Q14940	SL9A5_HUMAN	solute carrier family 9 (sodium/hydrogen	572					regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			ovary(1)|pancreas(1)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		ACCAACCTGCTGTGAGTCCTT	0.552													9	27	---	---	---	---	PASS
GFOD2	81577	broad.mit.edu	37	16	67709916	67709916	+	Silent	SNP	C	A	A	rs147858714	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67709916C>A	uc002eub.2	-	3	595	c.300G>T	c.(298-300)TCG>TCT	p.S100S	GFOD2_uc002eua.1_RNA|GFOD2_uc002euc.2_5'UTR	NM_030819	NP_110446	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain	100						proteinaceous extracellular matrix	binding|oxidoreductase activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		AGGCATCCACCGATGTTGCTG	0.502													4	18	---	---	---	---	PASS
SMPD3	55512	broad.mit.edu	37	16	68405203	68405203	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68405203G>T	uc002ewa.2	-	3	1304	c.882C>A	c.(880-882)AGC>AGA	p.S294R	SMPD3_uc010cfe.2_Missense_Mutation_p.S294R|SMPD3_uc010vlh.1_Missense_Mutation_p.S294R	NM_018667	NP_061137	Q9NY59	NSMA2_HUMAN	neutral sphingomyelin phosphodiesterase 3	294	Lumenal (Potential).				cell cycle|multicellular organismal development|sphingomyelin catabolic process	Golgi membrane|integral to membrane|plasma membrane	metal ion binding|sphingomyelin phosphodiesterase activity			skin(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	AGGCCGAGGGGCTGCCCAGGC	0.697													5	15	---	---	---	---	PASS
KARS	3735	broad.mit.edu	37	16	75678327	75678327	+	Intron	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75678327G>A	uc002feq.2	-						KARS_uc002fer.2_5'UTR|KARS_uc002fes.2_5'UTR|KARS_uc010cha.1_Intron	NM_005548	NP_005539	Q15046	SYK_HUMAN	lysyl-tRNA synthetase isoform 2						interspecies interaction between organisms|lysyl-tRNA aminoacylation|tRNA processing	cytosol|extracellular region|mitochondrial matrix|nucleus|plasma membrane|soluble fraction	ATP binding|lysine-tRNA ligase activity|metal ion binding|tRNA binding			ovary(2)	2					L-Lysine(DB00123)	GCGTCAACATGGCAGAGCACC	0.537													4	22	---	---	---	---	PASS
CDH13	1012	broad.mit.edu	37	16	83251007	83251007	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83251007G>A	uc002fgx.2	+	5	661	c.541G>A	c.(541-543)GAT>AAT	p.D181N	CDH13_uc010vns.1_Missense_Mutation_p.D228N|CDH13_uc010vnt.1_5'UTR|CDH13_uc010vnu.1_Missense_Mutation_p.D142N	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein	181	Cadherin 1.				adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		AAAGGGAGTGGATCAAGAGCC	0.463													15	76	---	---	---	---	PASS
KCNG4	93107	broad.mit.edu	37	16	84256194	84256194	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84256194C>T	uc010voc.1	-	3	1310	c.1189G>A	c.(1189-1191)GGG>AGG	p.G397R		NM_172347	NP_758857	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G,	397						voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(3)	3						AGCACCCGCCCGGACTCCTTC	0.642													5	32	---	---	---	---	PASS
TM4SF5	9032	broad.mit.edu	37	17	4675353	4675353	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4675353C>G	uc002fyw.1	+	1	167	c.136C>G	c.(136-138)CAA>GAA	p.Q46E		NM_003963	NP_003954	O14894	T4S5_HUMAN	transmembrane 4 superfamily member 5	46	Extracellular (Potential).					integral to plasma membrane				ovary(1)	1						TCTCAGCTTGCAAGTCTGGCT	0.622													19	23	---	---	---	---	PASS
GP1BA	2811	broad.mit.edu	37	17	4836260	4836260	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4836260C>A	uc010vsq.1	+	2	436	c.361C>A	c.(361-363)CTG>ATG	p.L121M	uc002fzn.1_RNA	NM_000173	NP_000164	P07359	GP1BA_HUMAN	platelet glycoprotein Ib alpha polypeptide	121											0						TCTCACCGTCCTGGACGTCTC	0.602													21	20	---	---	---	---	PASS
CHRNB1	1140	broad.mit.edu	37	17	7359243	7359243	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7359243C>A	uc002ghb.2	+	10	1389	c.1348C>A	c.(1348-1350)CAG>AAG	p.Q450K	CHRNB1_uc010vty.1_Missense_Mutation_p.Q378K	NM_000747	NP_000738	P11230	ACHB_HUMAN	nicotinic acetylcholine receptor beta 1 subunit	450	Cytoplasmic (Potential).		Missing (in CMS-ACHRD; impairs AChR assembly by disrupting a specific interaction between beta and delta subunits).		behavioral response to nicotine|muscle contraction|muscle fiber development|neuromuscular synaptic transmission|postsynaptic membrane organization|regulation of membrane potential|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine binding|receptor activity			ovary(2)	2		Prostate(122;0.157)				GCTGCAGGAACAGGAGGACCA	0.612													3	22	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7576853	7576853	+	Missense_Mutation	SNP	C	G	G	rs11575996		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7576853C>G	uc002gim.2	-	9	1187	c.993G>C	c.(991-993)CAG>CAC	p.Q331H	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.Q331H|TP53_uc010cne.1_RNA|TP53_uc010cnf.1_Missense_Mutation_p.Q199H|TP53_uc010cng.1_Missense_Mutation_p.Q199H|TP53_uc002gii.1_Missense_Mutation_p.Q199H|TP53_uc010cnh.1_Missense_Mutation_p.Q331H|TP53_uc010cni.1_Missense_Mutation_p.Q331H|TP53_uc002gij.2_Missense_Mutation_p.Q331H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	331	Oligomerization.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.|Interaction with HIPK2.		Q -> R (in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> H (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Q331*(14)|p.0?(7)|p.Q331P(3)|p.Q331fs*6(1)|p.I332fs*49(1)|p.?(1)|p.Q331Q(1)|p.Q331R(1)|p.Q331H(1)|p.Q331fs*14(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GACTTAGTACCTGAAGGGTGA	0.453		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			31	3	---	---	---	---	PASS
DHRS7C	201140	broad.mit.edu	37	17	9674965	9674965	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9674965T>A	uc010vvb.1	-	6	779	c.779A>T	c.(778-780)GAG>GTG	p.E260V	DHRS7C_uc010cof.2_Missense_Mutation_p.E259V	NM_001105571	NP_001099041	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	260						extracellular region	binding|oxidoreductase activity				0						CATCACCTCCTCCGCCACCTC	0.627													13	0	---	---	---	---	PASS
LIG3	3980	broad.mit.edu	37	17	33326404	33326404	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33326404G>A	uc002hik.1	+	15	2300	c.2192G>A	c.(2191-2193)GGA>GAA	p.G731E	LIG3_uc002hij.2_Missense_Mutation_p.G731E	NM_013975	NP_039269	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent isoform alpha	731					base-excision repair|cell division|DNA ligation involved in DNA repair|DNA replication|reciprocal meiotic recombination|spermatogenesis	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|protein binding|zinc ion binding			skin(3)|lung(2)|ovary(2)|large_intestine(1)|pancreas(1)	9		Ovarian(249;0.17)			Bleomycin(DB00290)	AAGTGTGCAGGAGGCCATGAT	0.577								Other_BER_factors					9	31	---	---	---	---	PASS
PIGW	284098	broad.mit.edu	37	17	34893620	34893620	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34893620G>T	uc002hmy.1	+	2	713	c.670G>T	c.(670-672)GGC>TGC	p.G224C	MYO19_uc002hmw.2_5'Flank|MYO19_uc010cuu.2_5'Flank|MYO19_uc010wcy.1_5'Flank|MYO19_uc010wcz.1_5'Flank|MYO19_uc010wda.1_5'Flank|MYO19_uc002hmx.2_5'Flank|PIGW_uc002hmz.1_Missense_Mutation_p.G224C	NM_178517	NP_848612	Q7Z7B1	PIGW_HUMAN	phosphatidylinositol glycan, class W	224					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	O-acyltransferase activity				0		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AAAATCAATAGGCTATCAGGA	0.353													12	37	---	---	---	---	PASS
RAPGEFL1	51195	broad.mit.edu	37	17	38340578	38340578	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38340578G>A	uc010cwu.1	+	3	584	c.94G>A	c.(94-96)GAG>AAG	p.E32K		NM_016339	NP_057423	Q9UHV5	RPGFL_HUMAN	Rap guanine nucleotide exchange factor	238					G-protein coupled receptor protein signaling pathway|nervous system development|small GTPase mediated signal transduction	intracellular|membrane fraction	guanyl-nucleotide exchange factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3						TCAAGAGGAAGAGGGGGCCGG	0.597													22	45	---	---	---	---	PASS
TOP2A	7153	broad.mit.edu	37	17	38573130	38573130	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38573130C>T	uc002huq.2	-	2	165	c.39G>A	c.(37-39)ATG>ATA	p.M13I		NM_001067	NP_001058	P11388	TOP2A_HUMAN	DNA topoisomerase II, alpha isozyme	13					apoptotic chromosome condensation|DNA ligation|DNA repair|DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|phosphatidylinositol-mediated signaling|positive regulation of apoptosis|positive regulation of retroviral genome replication|resolution of meiotic recombination intermediates|sister chromatid segregation	cytoplasm|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|drug binding|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity|ubiquitin binding			ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Gatifloxacin(DB01044)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	TGTTGACTTGCATATTTTCAT	0.308													36	19	---	---	---	---	PASS
ATP6V0A1	535	broad.mit.edu	37	17	40635067	40635067	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40635067C>T	uc002hzr.2	+	9	895	c.728C>T	c.(727-729)TCA>TTA	p.S243L	ATP6V0A1_uc002hzq.2_Missense_Mutation_p.S243L|ATP6V0A1_uc002hzs.2_Missense_Mutation_p.S250L|ATP6V0A1_uc010wgj.1_Missense_Mutation_p.S200L|ATP6V0A1_uc010wgk.1_Missense_Mutation_p.S200L|ATP6V0A1_uc010cyg.2_Intron|ATP6V0A1_uc010wgl.1_Missense_Mutation_p.S102L	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	243	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		TTCCGAGCCTCACTCTATCCC	0.418													9	28	---	---	---	---	PASS
ATP6V0A1	535	broad.mit.edu	37	17	40673107	40673107	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40673107A>G	uc002hzr.2	+	22	2650	c.2483A>G	c.(2482-2484)GAG>GGG	p.E828G	ATP6V0A1_uc002hzq.2_Missense_Mutation_p.E822G|ATP6V0A1_uc002hzs.2_Missense_Mutation_p.E829G|ATP6V0A1_uc010wgj.1_Missense_Mutation_p.E785G|ATP6V0A1_uc010wgk.1_Missense_Mutation_p.E779G|ATP6V0A1_uc010cyg.2_Missense_Mutation_p.E474G|ATP6V0A1_uc010wgl.1_Missense_Mutation_p.E687G|ATP6V0A1_uc002hzt.2_Missense_Mutation_p.E112G|ATP6V0A1_uc002hzu.2_Missense_Mutation_p.S113G	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	828	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		TTCTCCTTCGAGCATATTCGG	0.512													66	48	---	---	---	---	PASS
PSME3	10197	broad.mit.edu	37	17	40990190	40990190	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40990190G>A	uc002ibr.2	+	6	599	c.373G>A	c.(373-375)GAG>AAG	p.E125K	PSME3_uc002ibp.2_Missense_Mutation_p.E64K|PSME3_uc002ibq.2_Missense_Mutation_p.E125K|PSME3_uc002ibs.2_Missense_Mutation_p.E136K|PSME3_uc010whd.1_Intron	NM_005789	NP_005780	P61289	PSME3_HUMAN	proteasome activator subunit 3 isoform 1	125					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of proteasomal protein catabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome activator complex	endopeptidase activator activity|identical protein binding|MDM2 binding|p53 binding				0		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		AGTGAAACCTGAGATCCGGCT	0.512													17	41	---	---	---	---	PASS
AARSD1	80755	broad.mit.edu	37	17	41108544	41108544	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41108544C>T	uc002icc.2	-	5	426	c.423G>A	c.(421-423)CTG>CTA	p.L141L	AARSD1_uc002icd.2_Silent_p.L254L|AARSD1_uc002ice.2_Silent_p.L224L|AARSD1_uc002icf.2_Silent_p.L315L|AARSD1_uc010whg.1_Silent_p.L315L|AARSD1_uc010cyu.1_Silent_p.L141L	NM_025267	NP_079543	Q9BTE6	AASD1_HUMAN	alanyl-tRNA synthetase domain containing 1	141					alanyl-tRNA aminoacylation	cytoplasm	alanine-tRNA ligase activity|ATP binding|metal ion binding|nucleic acid binding				0		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		AGGGGGTGTCCAGCTCAATCG	0.393													9	32	---	---	---	---	PASS
OSBPL7	114881	broad.mit.edu	37	17	45894009	45894009	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45894009C>A	uc002ilx.1	-	10	1051	c.848G>T	c.(847-849)CGG>CTG	p.R283L	OSBPL7_uc002ilw.1_5'UTR	NM_145798	NP_665741	Q9BZF2	OSBL7_HUMAN	oxysterol-binding protein-like protein 7	283					lipid transport		lipid binding				0						CGAGGAGTCCCGAGACTCCAG	0.647													3	15	---	---	---	---	PASS
PRAC	84366	broad.mit.edu	37	17	46799684	46799684	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46799684T>C	uc002iny.2	-	1	199	c.71A>G	c.(70-72)AAT>AGT	p.N24S	C17orf93_uc002inz.1_5'Flank	NM_032391	NP_115767	Q96KF2	PRAC_HUMAN	prostate cancer susceptibility candidate	24						nucleus					0						GTTTACCTTATTAGAGAGAAA	0.542													21	40	---	---	---	---	PASS
TEX14	56155	broad.mit.edu	37	17	56661932	56661932	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56661932C>T	uc010dcz.1	-	19	3236	c.3118G>A	c.(3118-3120)GAG>AAG	p.E1040K	TEX14_uc002iwr.1_Missense_Mutation_p.E1034K|TEX14_uc002iws.1_Missense_Mutation_p.E1034K|TEX14_uc010dda.1_Missense_Mutation_p.E814K	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a	1040						cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TCTGGTTGCTCCTTTTGTCTG	0.433													16	34	---	---	---	---	PASS
KCNJ2	3759	broad.mit.edu	37	17	68171453	68171453	+	Silent	SNP	T	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68171453T>G	uc010dfg.2	+	2	674	c.273T>G	c.(271-273)GCT>GCG	p.A91A	KCNJ2_uc002jir.2_Silent_p.A91A	NM_000891	NP_000882	P63252	IRK2_HUMAN	potassium inwardly-rectifying channel J2	91	Helical; Name=M1; (By similarity).				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity|protein binding				0	Breast(10;1.64e-08)					TCTGCCTGGCTTTCGTCCTGT	0.532													15	58	---	---	---	---	PASS
KCNJ2	3759	broad.mit.edu	37	17	68171795	68171795	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68171795C>G	uc010dfg.2	+	2	1016	c.615C>G	c.(613-615)GAC>GAG	p.D205E	KCNJ2_uc002jir.2_Missense_Mutation_p.D205E	NM_000891	NP_000882	P63252	IRK2_HUMAN	potassium inwardly-rectifying channel J2	205	Cytoplasmic (By similarity).				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity|protein binding				0	Breast(10;1.64e-08)					CCATGAGAGACGGCAAGCTGT	0.488													21	61	---	---	---	---	PASS
KIAA0195	9772	broad.mit.edu	37	17	73487781	73487781	+	Silent	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73487781C>A	uc002jnz.3	+	14	1671	c.1396C>A	c.(1396-1398)CGA>AGA	p.R466R	KIAA0195_uc010wsa.1_Silent_p.R476R|KIAA0195_uc010wsb.1_Silent_p.R122R	NM_014738	NP_055553	Q12767	K0195_HUMAN	hypothetical protein LOC9772	466					ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism			ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCCCCATGAACGAGACGCCCT	0.642													18	77	---	---	---	---	PASS
C17orf56	146705	broad.mit.edu	37	17	79207224	79207224	+	Intron	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79207224C>T	uc002jzu.1	-						C17orf56_uc002jzr.1_5'Flank|C17orf56_uc002jzs.1_Intron|C17orf56_uc002jzt.1_Intron|C17orf56_uc002jzv.1_Intron|uc002jzw.1_RNA	NM_144679	NP_653280	Q96N21	CQ056_HUMAN	hypothetical protein LOC146705							integral to membrane					0	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CAGGCCCTCCCCACTCACCCG	0.682													5	29	---	---	---	---	PASS
FASN	2194	broad.mit.edu	37	17	80039490	80039490	+	Silent	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80039490C>A	uc002kdu.2	-	37	6510	c.6393G>T	c.(6391-6393)GTG>GTT	p.V2131V	FASN_uc002kdv.1_RNA	NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase	2131	Acyl carrier.				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	GGATGTGTGCCACGGCCTCCA	0.642													4	35	---	---	---	---	PASS
TEX19	400629	broad.mit.edu	37	17	80320050	80320050	+	Silent	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80320050G>A	uc002keq.2	+	2	333	c.24G>A	c.(22-24)CGG>CGA	p.R8R		NM_207459	NP_997342	Q8NA77	TEX19_HUMAN	testis expressed 19	8						nucleus					0						TCAGCATGCGGTATGAGGAAG	0.582													79	37	---	---	---	---	PASS
THOC1	9984	broad.mit.edu	37	18	215489	215489	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:215489T>C	uc002kkj.3	-	20	1658	c.1618A>G	c.(1618-1620)ATA>GTA	p.I540V	THOC1_uc002kkk.3_RNA|THOC1_uc002kkh.3_Missense_Mutation_p.I164V	NM_005131	NP_005122	Q96FV9	THOC1_HUMAN	THO complex 1	540					apoptosis|intronless viral mRNA export from host nucleus|mRNA processing|regulation of transcription elongation, DNA-dependent|RNA splicing|signal transduction|transcription, DNA-dependent	cytoplasm|nuclear matrix|nuclear speck|THO complex part of transcription export complex	DNA binding|protein binding|RNA binding			ovary(1)	1		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				CCTGTTTTTATTTCTTCAGAA	0.343													22	6	---	---	---	---	PASS
SMCHD1	23347	broad.mit.edu	37	18	2688397	2688397	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2688397A>T	uc002klm.3	+	6	833	c.644A>T	c.(643-645)CAT>CTT	p.H215L		NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible	215					chromosome organization		ATP binding				0						TTTAGTGATCATTCAGGATAT	0.348													28	25	---	---	---	---	PASS
SMCHD1	23347	broad.mit.edu	37	18	2747616	2747616	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2747616A>G	uc002klm.3	+	30	4087	c.3898A>G	c.(3898-3900)ATA>GTA	p.I1300V	SMCHD1_uc002klk.3_RNA|SMCHD1_uc002kll.3_RNA	NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible	1300					chromosome organization		ATP binding				0						ACATGTTAAAATAAGTCTTAC	0.323													3	16	---	---	---	---	PASS
KIAA0802	23255	broad.mit.edu	37	18	8783967	8783967	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8783967A>C	uc002knr.2	+	6	999	c.857A>C	c.(856-858)GAG>GCG	p.E286A	KIAA0802_uc002knq.2_Missense_Mutation_p.E286A|KIAA0802_uc010dkw.1_Missense_Mutation_p.E124A	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255	637	Potential.										0						GAGGAAGCGGAGTTGCTCCGG	0.617													56	40	---	---	---	---	PASS
GNAL	2774	broad.mit.edu	37	18	11864603	11864603	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11864603C>G	uc010dkz.2	+	8	864	c.618C>G	c.(616-618)TTC>TTG	p.F206L	GNAL_uc002kqc.2_Missense_Mutation_p.F283L|GNAL_uc002kqd.2_Missense_Mutation_p.F206L|GNAL_uc010wzt.1_5'UTR	NM_001142339	NP_001135811	P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein),	206					activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						AAGTAAACTTCCAGTGAGTAT	0.493													35	87	---	---	---	---	PASS
NEDD4L	23327	broad.mit.edu	37	18	56009014	56009014	+	Silent	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56009014A>G	uc002lgy.2	+	15	1636	c.1362A>G	c.(1360-1362)TTA>TTG	p.L454L	NEDD4L_uc002lgz.2_Silent_p.L390L|NEDD4L_uc002lgx.2_Silent_p.L434L|NEDD4L_uc010xee.1_Silent_p.L333L|NEDD4L_uc002lhc.2_Silent_p.L446L|NEDD4L_uc002lhd.2_Silent_p.L333L|NEDD4L_uc002lhb.2_Silent_p.L313L|NEDD4L_uc002lhe.2_Silent_p.L426L|NEDD4L_uc002lhf.2_Silent_p.L313L|NEDD4L_uc002lhg.2_Silent_p.L333L|NEDD4L_uc002lhh.2_Intron|NEDD4L_uc010dpm.1_Intron	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally	454					cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						CAGTAACTTTATCTGCCCCGC	0.527													14	13	---	---	---	---	PASS
CDH20	28316	broad.mit.edu	37	18	59217223	59217223	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59217223G>A	uc010dps.1	+	10	1673	c.1661G>A	c.(1660-1662)CGG>CAG	p.R554Q	CDH20_uc002lif.2_Missense_Mutation_p.R548Q	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein	554	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)				AACACAGCACGGATTCTAACC	0.532													10	28	---	---	---	---	PASS
TMPRSS9	360200	broad.mit.edu	37	19	2422218	2422218	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2422218G>T	uc010xgx.1	+	13	2419	c.2419G>T	c.(2419-2421)GAG>TAG	p.E807*		NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	807	Extracellular (Potential).				proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGACGCCCCGGAGGCCACCAC	0.632													21	71	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9058439	9058439	+	Silent	SNP	A	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9058439A>C	uc002mkp.2	-	3	29211	c.29007T>G	c.(29005-29007)TCT>TCG	p.S9669S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9671	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ATGTAGCCAGAGAATAACCTG	0.478													26	23	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10599944	10599944	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10599944C>A	uc002moq.1	-	5	1788	c.1632G>T	c.(1630-1632)TGG>TGT	p.W544C	KEAP1_uc002mop.1_Intron|KEAP1_uc002mor.1_Missense_Mutation_p.W544C	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	544	Kelch 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			CTACGAAAGTCCACGTCTCTG	0.602													33	4	---	---	---	---	PASS
OR7A17	26333	broad.mit.edu	37	19	14991871	14991871	+	Silent	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14991871G>T	uc010xob.1	-	1	297	c.297C>A	c.(295-297)ACC>ACA	p.T99T		NM_030901	NP_112163	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A,	99	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Ovarian(108;0.203)					AGCACATCTGGGTGATGCAGC	0.468													71	31	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17017851	17017851	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17017851C>A	uc002nfb.2	-	30	4111	c.4079G>T	c.(4078-4080)TGT>TTT	p.C1360F		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1313						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						AGTCAGGGCACAGCTATAAGG	0.652													15	0	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38935234	38935234	+	Missense_Mutation	SNP	C	A	A	rs150038701		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38935234C>A	uc002oit.2	+	7	678	c.548C>A	c.(547-549)ACC>AAC	p.T183N	RYR1_uc002oiu.2_Missense_Mutation_p.T183N	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	183	Cytoplasmic.|MIR 2.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CACCTGTCGACCGCCAGTGGG	0.622													3	9	---	---	---	---	PASS
HNRNPL	3191	broad.mit.edu	37	19	39330801	39330801	+	Missense_Mutation	SNP	C	G	G	rs115791874	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39330801C>G	uc010xul.1	-	8	1179	c.1168G>C	c.(1168-1170)GAT>CAT	p.D390H	HNRNPL_uc010ege.1_Missense_Mutation_p.D46H|HNRNPL_uc002ojj.1_Missense_Mutation_p.D46H|HNRNPL_uc002ojo.1_5'Flank|HNRNPL_uc002ojk.2_Missense_Mutation_p.D46H|HNRNPL_uc002ojl.2_Missense_Mutation_p.D46H|HNRNPL_uc010xum.1_Missense_Mutation_p.D257H|HNRNPL_uc002ojp.1_Missense_Mutation_p.D46H|HNRNPL_uc010xun.1_Missense_Mutation_p.W97C	NM_001533	NP_001524	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	390	RRM 3.				nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			TTAGATTGATCCAAGCCATAG	0.597													3	53	---	---	---	---	PASS
SUPT5H	6829	broad.mit.edu	37	19	39960853	39960853	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39960853G>C	uc002olo.3	+	17	1648	c.1469G>C	c.(1468-1470)GGC>GCC	p.G490A	SUPT5H_uc002olp.3_Missense_Mutation_p.G490A|SUPT5H_uc002olq.3_Missense_Mutation_p.G486A|SUPT5H_uc002oln.3_Missense_Mutation_p.G490A|SUPT5H_uc002olr.3_Missense_Mutation_p.G490A|SUPT5H_uc002ols.1_Missense_Mutation_p.G113A|SUPT5H_uc010egp.1_5'Flank	NM_001111020	NP_001104490	O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog isoform a	490	KOW 3.				cell cycle|chromatin remodeling|mRNA capping|negative regulation of transcription elongation, DNA-dependent|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription elongation from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|response to organic substance|retroviral genome replication|transcription elongation from RNA polymerase II promoter	nucleoplasm	enzyme binding|protein heterodimerization activity			ovary(3)|pancreas(1)	4	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GGCGACACAGGCCTCATTGTG	0.552													10	138	---	---	---	---	PASS
TIMM50	92609	broad.mit.edu	37	19	39978732	39978732	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39978732G>T	uc002olu.1	+	9	1170	c.1037G>T	c.(1036-1038)CGA>CTA	p.R346L	TIMM50_uc002olt.1_RNA|TIMM50_uc002olv.1_Missense_Mutation_p.R45L	NM_001001563	NP_001001563	Q3ZCQ8	TIM50_HUMAN	translocase of inner mitochondrial membrane 50	243	Mitochondrial intermembrane (Potential).|FCP1 homology.				mitochondrial membrane organization|protein transport|release of cytochrome c from mitochondria|transmembrane transport	integral to membrane|mitochondrial inner membrane presequence translocase complex|nuclear speck	interleukin-2 receptor binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|ribonucleoprotein binding|RNA binding			ovary(1)	1	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GACCCAGCTCGAGTAGTAGTT	0.552													5	141	---	---	---	---	PASS
BCAM	4059	broad.mit.edu	37	19	45321844	45321844	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45321844G>A	uc002ozu.2	+	9	1188	c.1144G>A	c.(1144-1146)GTG>ATG	p.V382M	BCAM_uc002ozt.1_Missense_Mutation_p.V382M	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1	382	Extracellular (Potential).|Ig-like C2-type 2.				cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CAGTGCAGTCGTGAACTGCTC	0.642													15	3	---	---	---	---	PASS
PNMAL2	57469	broad.mit.edu	37	19	46998324	46998324	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46998324C>T	uc002pes.2	-	1	846	c.399G>A	c.(397-399)TCG>TCA	p.S133S	uc002peu.1_Silent_p.S145S	NM_020709	NP_065760	Q9ULN7	PNML2_HUMAN	PNMA-like 2	133										central_nervous_system(1)	1		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		CCTGCGTCTCCGAAGCGGGAG	0.701													22	26	---	---	---	---	PASS
EHD2	30846	broad.mit.edu	37	19	48221846	48221846	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48221846A>T	uc002phj.3	+	3	735	c.485A>T	c.(484-486)AAG>ATG	p.K162M	EHD2_uc010xyu.1_Missense_Mutation_p.K26M	NM_014601	NP_055416	Q9NZN4	EHD2_HUMAN	EH-domain containing 2	162					blood coagulation|endocytic recycling	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding			ovary(1)|skin(1)	2		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		TCGGGTGCCAAGCAGAGAGTG	0.383													15	0	---	---	---	---	PASS
GRIN2D	2906	broad.mit.edu	37	19	48922942	48922942	+	Silent	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48922942C>G	uc002pjc.3	+	9	2050	c.1962C>G	c.(1960-1962)ACC>ACG	p.T654T	GRIN2D_uc010elx.2_5'UTR	NM_000836	NP_000827	O15399	NMDE4_HUMAN	N-methyl-D-aspartate receptor subunit 2D	654	Cytoplasmic (Potential).					cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|protein binding			ovary(3)|breast(3)	6		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Orphenadrine(DB01173)	GGGGAACCACCAGCAAAATCA	0.592													5	130	---	---	---	---	PASS
TEAD2	8463	broad.mit.edu	37	19	49845759	49845759	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49845759T>G	uc002pnj.2	-	11	1257	c.1166A>C	c.(1165-1167)AAG>ACG	p.K389T	uc002pnb.1_5'Flank|TEAD2_uc002png.2_Missense_Mutation_p.K392T|TEAD2_uc002pnh.2_Missense_Mutation_p.K393T|TEAD2_uc002pni.2_Missense_Mutation_p.K392T|TEAD2_uc010yao.1_Missense_Mutation_p.K261T|TEAD2_uc010emw.2_Missense_Mutation_p.K392T	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2	389	Transcriptional activation (Potential).				hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		CTGCCGCAACTTGTGCAAGAA	0.607													31	15	---	---	---	---	PASS
FPR3	2359	broad.mit.edu	37	19	52327627	52327627	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52327627G>C	uc002pxt.1	+	2	810	c.626G>C	c.(625-627)GGC>GCC	p.G209A		NM_002030	NP_002021	P25089	FPR3_HUMAN	formyl peptide receptor-like 2	209	Helical; Name=5; (Potential).				cellular component movement|chemotaxis	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(4)|breast(1)|skin(1)	6						TTCATTATTGGCTTCAGCGTG	0.458													36	5	---	---	---	---	PASS
ZNF320	162967	broad.mit.edu	37	19	53384241	53384241	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53384241T>G	uc002qag.2	-	4	1329	c.1138A>C	c.(1138-1140)ACT>CCT	p.T380P	ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Missense_Mutation_p.T326P|ZNF320_uc002qai.2_Missense_Mutation_p.T380P	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320	380					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		CTCTCTCCAGTATGAACTCTC	0.403													29	41	---	---	---	---	PASS
LILRA5	353514	broad.mit.edu	37	19	54818729	54818729	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54818729T>C	uc002qfe.2	-	7	989	c.869A>G	c.(868-870)CAG>CGG	p.Q290R	LILRA5_uc002qff.2_Missense_Mutation_p.Q278R	NM_021250	NP_067073	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor subfamily	290	Cytoplasmic (Potential).				innate immune response	extracellular region|integral to membrane	receptor activity			upper_aerodigestive_tract(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGGCTTCTCTGGCTGTGCCA	0.522													22	42	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55144596	55144596	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55144596C>A	uc002qgj.2	+	8	1428	c.1088C>A	c.(1087-1089)GCT>GAT	p.A363D	LILRB1_uc010erp.1_Intron|LILRB1_uc002qgl.2_Missense_Mutation_p.A363D|LILRB1_uc002qgk.2_Missense_Mutation_p.A363D|LILRB1_uc002qgm.2_Missense_Mutation_p.A363D|LILRB1_uc010erq.2_Missense_Mutation_p.A363D|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	363	Ig-like C2-type 4.|Extracellular (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		GAGGGGGCAGCTGATGACCCA	0.577										HNSCC(37;0.09)			33	41	---	---	---	---	PASS
ZNF416	55659	broad.mit.edu	37	19	58087182	58087182	+	Silent	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58087182T>A	uc002qpf.2	-	3	363	c.192A>T	c.(190-192)ATA>ATT	p.I64I	ZNF547_uc002qpm.3_Intron	NM_017879	NP_060349	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	64	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		CCAGCGCAGTTATAAGTGCAA	0.557													71	39	---	---	---	---	PASS
ZSCAN22	342945	broad.mit.edu	37	19	58850392	58850392	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58850392C>G	uc002qsc.2	+	3	1323	c.1176C>G	c.(1174-1176)AGC>AGG	p.S392R	ZSCAN22_uc010yhz.1_3'UTR	NM_181846	NP_862829	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	392	C2H2-type 5.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		TCAGCCAGAGCACGCACCTGA	0.642													35	33	---	---	---	---	PASS
C20orf46	55321	broad.mit.edu	37	20	1161744	1161744	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1161744C>T	uc010gaa.1	-	3	738	c.519G>A	c.(517-519)CTG>CTA	p.L173L	C20orf46_uc002weq.1_Silent_p.L173L	NM_018354	NP_060824	Q9NUR3	CT046_HUMAN	hypothetical protein LOC55321	173						integral to membrane	protein binding			ovary(1)	1						TGCACCTGTCCAGGTGGGAGC	0.642													9	15	---	---	---	---	PASS
CPXM1	56265	broad.mit.edu	37	20	2779185	2779185	+	Splice_Site	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2779185T>A	uc002wgu.2	-	3	405	c.341_splice	c.e3-1	p.G114_splice	CPXM1_uc010gas.2_Splice_Site_p.G114_splice	NM_019609	NP_062555	Q96SM3	CPXM1_HUMAN	carboxypeptidase X, member 1 precursor						cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding			ovary(2)|skin(2)	4						GAGGACAGCCTGGGGCGGGGA	0.622													11	22	---	---	---	---	PASS
PLCB1	23236	broad.mit.edu	37	20	8713943	8713943	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8713943A>T	uc002wnb.2	+	19	1950	c.1947A>T	c.(1945-1947)AGA>AGT	p.R649S	PLCB1_uc010zrb.1_Missense_Mutation_p.R548S|PLCB1_uc002wna.2_Missense_Mutation_p.R649S|PLCB1_uc002wnc.1_Missense_Mutation_p.R548S|PLCB1_uc002wnd.1_Missense_Mutation_p.R226S	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1	649	PI-PLC Y-box.				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						GTGGCTACAGATTGAAGCCAG	0.408													27	38	---	---	---	---	PASS
RBBP9	10741	broad.mit.edu	37	20	18476527	18476527	+	Intron	SNP	A	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18476527A>G	uc002wqy.2	-							NM_006606	NP_006597	O75884	RBBP9_HUMAN	retinoblastoma binding protein 9							cytoplasm|nucleus	hydrolase activity			haematopoietic_and_lymphoid_tissue(1)	1						CCAGGTATCTATGATATGAGG	0.353													10	28	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20079442	20079442	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20079442T>A	uc002wru.2	+	8	919	c.843T>A	c.(841-843)AGT>AGA	p.S281R	C20orf26_uc010gcw.1_Missense_Mutation_p.S235R|C20orf26_uc010zse.1_Missense_Mutation_p.S281R|C20orf26_uc010zsf.1_Missense_Mutation_p.S281R	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	281										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		AAGACCTAAGTGTCCGAAGAA	0.468													16	25	---	---	---	---	PASS
NFS1	9054	broad.mit.edu	37	20	34285673	34285673	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34285673C>T	uc002xdw.1	-	3	321	c.257G>A	c.(256-258)GGG>GAG	p.G86E	NFS1_uc002xdt.1_Missense_Mutation_p.G26E|NFS1_uc002xdu.1_Missense_Mutation_p.G26E|NFS1_uc002xdv.1_RNA|NFS1_uc010zvk.1_5'UTR|NFS1_uc010zvl.1_Missense_Mutation_p.G86E|NFS1_uc002xdx.2_Missense_Mutation_p.G86E|ROMO1_uc002xdy.2_5'Flank|ROMO1_uc010gfm.2_5'Flank	NM_021100	NP_066923	Q9Y697	NFS1_HUMAN	NFS1 nitrogen fixation 1 precursor	86					cysteine metabolic process|iron incorporation into metallo-sulfur cluster|Mo-molybdopterin cofactor biosynthetic process|protein complex assembly|water-soluble vitamin metabolic process	cytosol|mitochondrial matrix|nucleus	cysteine desulfurase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	GTGTGGGTTCCCATAGTAGTT	0.517													8	30	---	---	---	---	PASS
MYL9	10398	broad.mit.edu	37	20	35177601	35177601	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35177601C>T	uc002xfl.1	+	4	562	c.468C>T	c.(466-468)TAC>TAT	p.Y156Y	uc002xfk.3_Intron|MYL9_uc002xfm.1_Silent_p.Y102Y	NM_006097	NP_006088	P24844	MYL9_HUMAN	myosin regulatory light chain 9 isoform a	156	EF-hand 3.				axon guidance|muscle contraction|regulation of muscle contraction	cytosol|muscle myosin complex	calcium ion binding|structural constituent of muscle				0	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				ACTTCAACTACGTGGAGTTCA	0.602													16	38	---	---	---	---	PASS
DHX35	60625	broad.mit.edu	37	20	37657130	37657130	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37657130C>G	uc002xjh.2	+	19	1882	c.1871C>G	c.(1870-1872)ACT>AGT	p.T624S	DHX35_uc010zwa.1_Missense_Mutation_p.T469S|DHX35_uc010zwb.1_Missense_Mutation_p.T469S|DHX35_uc010zwc.1_Missense_Mutation_p.T593S	NM_021931	NP_068750	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	624						catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				TTTCATTCTACTGGAGCTTAT	0.468													22	50	---	---	---	---	PASS
PLCG1	5335	broad.mit.edu	37	20	39802790	39802790	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39802790C>T	uc002xjp.1	+	31	3790	c.3669C>T	c.(3667-3669)TTC>TTT	p.F1223F	PLCG1_uc002xjo.1_Silent_p.F1224F|PLCG1_uc010zwe.1_Silent_p.F889F	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b	1223					activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				TCAGTCCCTTCAGTGGTACGT	0.607													37	29	---	---	---	---	PASS
TFAP2C	7022	broad.mit.edu	37	20	55206856	55206856	+	Intron	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55206856C>T	uc002xya.2	+						TFAP2C_uc010zzi.1_Intron	NM_003222	NP_003213	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma						cell-cell signaling|male gonad development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Colorectal(105;0.229)			TCCTCTCTCCCCCAGAATGTC	0.572													21	30	---	---	---	---	PASS
ZBP1	81030	broad.mit.edu	37	20	56185336	56185336	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56185336C>T	uc002xyo.2	-	7	1243	c.962G>A	c.(961-963)AGA>AAA	p.R321K	ZBP1_uc010gjm.2_Missense_Mutation_p.R320K|ZBP1_uc002xyp.2_Missense_Mutation_p.R246K	NM_030776	NP_110403	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1 isoform a	321						cytoplasm|nucleus	double-stranded RNA adenosine deaminase activity|left-handed Z-DNA binding|RNA binding			ovary(2)	2	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			CATGTGGATTCTCTGGGCGGC	0.582													108	78	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57415527	57415527	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57415527G>C	uc002xzt.2	+	1	733	c.366G>C	c.(364-366)GAG>GAC	p.E122D	GNASAS_uc002xzs.1_Intron|GNAS_uc002xzu.3_5'Flank|GNAS_uc010gjq.2_5'Flank	NM_016592	NP_057676	P63092	GNAS2_HUMAN	GNAS complex locus NESP55	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			TCGAGTCCGAGACCGACTTCG	0.637			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			15	43	---	---	---	---	PASS
HSPA13	6782	broad.mit.edu	37	21	15750739	15750739	+	Intron	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15750739A>T	uc002yjt.2	-						HSPA13_uc011abx.1_Intron	NM_006948	NP_008879	P48723	HSP13_HUMAN	heat shock protein 70kDa family member 13							endoplasmic reticulum|microsome	ATP binding			kidney(1)	1						AAAACCTGTGAATAGGATTTG	0.264													8	12	---	---	---	---	PASS
ERG	2078	broad.mit.edu	37	21	39795353	39795353	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39795353G>A	uc010gnw.2	-	5	683	c.388C>T	c.(388-390)CGC>TGC	p.R130C	ERG_uc002yxa.2_Missense_Mutation_p.R123C|ERG_uc011aek.1_Missense_Mutation_p.R31C|ERG_uc010gnv.2_Missense_Mutation_p.R31C|ERG_uc010gnx.2_Missense_Mutation_p.R130C|ERG_uc011ael.1_Missense_Mutation_p.R130C|ERG_uc002yxb.2_Missense_Mutation_p.R130C|ERG_uc011aem.1_Missense_Mutation_p.R123C|ERG_uc002yxc.3_Missense_Mutation_p.R130C	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4	130	PNT.				cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				ATAACTCTGCGCTCGTTCGTG	0.602													9	17	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	41551009	41551009	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41551009G>C	uc002yyq.1	-	15	3244	c.2792C>G	c.(2791-2793)TCT>TGT	p.S931C	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	931	Extracellular (Potential).|Fibronectin type-III 1.				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TCTCTGAGCAGAATCCCAGGA	0.433													33	4	---	---	---	---	PASS
BACE2	25825	broad.mit.edu	37	21	42609440	42609440	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42609440G>T	uc002yyw.2	+	3	865	c.402G>T	c.(400-402)AGG>AGT	p.R134S	BACE2_uc002yyx.2_Missense_Mutation_p.R134S|BACE2_uc002yyy.2_Missense_Mutation_p.R134S	NM_012105	NP_036237	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2 isoform A	134	Extracellular (Potential).				membrane protein ectodomain proteolysis|negative regulation of amyloid precursor protein biosynthetic process|peptide hormone processing	cell surface|endoplasmic reticulum|endosome|Golgi apparatus|integral to membrane	aspartic-type endopeptidase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				CTTTCTCCAGGTCTAGCACAT	0.328													18	2	---	---	---	---	PASS
COL6A1	1291	broad.mit.edu	37	21	47422159	47422159	+	Silent	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47422159G>C	uc002zhu.1	+	32	2196	c.2094G>C	c.(2092-2094)GCG>GCC	p.A698A	COL6A1_uc010gqd.1_Silent_p.A29A|COL6A1_uc002zhv.1_Silent_p.A29A|COL6A1_uc002zhw.1_5'Flank	NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor	698	VWFA 2.|C-terminal globular domain.				axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	AGTGGATGGCGGGCGGCACCT	0.701													3	6	---	---	---	---	PASS
USP18	11274	broad.mit.edu	37	22	18650014	18650014	+	Intron	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18650014G>T	uc002zny.2	+							NM_017414	NP_059110	Q9UMW8	UBP18_HUMAN	ubiquitin specific protease 18						regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway|ubiquitin-dependent protein catabolic process	cytosol|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			breast(1)	1						CCTTTTCTCTGTGGCCAGTGT	0.468													15	34	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23055659	23055659	+	RNA	SNP	G	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23055659G>C	uc011aim.1	+	153		c.9374G>C								Parts of antibodies, mostly variable regions.												0						TTACTGTCAGGTGTGGGATAG	0.582													17	14	---	---	---	---	PASS
SLC5A1	6523	broad.mit.edu	37	22	32487724	32487724	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32487724G>T	uc003amc.2	+	11	1487	c.1255G>T	c.(1255-1257)GAG>TAG	p.E419*	SLC5A1_uc011alz.1_Nonsense_Mutation_p.E292*	NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	419	Cytoplasmic (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						GAGAGCATCTGAGAAAGAGCT	0.532													33	28	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	38422097	38422097	+	IGR	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38422097C>T								POLR2F (37756 upstream) : PICK1 (31165 downstream)																							GAGGACTCCCCTCAGGTGCCC	0.607													12	30	---	---	---	---	PASS
UPK3A	7380	broad.mit.edu	37	22	45689169	45689169	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45689169G>T	uc003bfy.2	+	5	685	c.679G>T	c.(679-681)GCT>TCT	p.A227S	UPK3A_uc010gzy.2_Missense_Mutation_p.A106S	NM_006953	NP_008884	O75631	UPK3A_HUMAN	uroplakin 3A precursor	227	Helical; (Potential).				epithelial cell differentiation	endoplasmic reticulum membrane|integral to membrane					0		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		TGTGGGTTTTGCTGGCGCCAT	0.602													12	14	---	---	---	---	PASS
CELSR1	9620	broad.mit.edu	37	22	46785336	46785336	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46785336T>A	uc003bhw.1	-	18	6406	c.6406A>T	c.(6406-6408)AGG>TGG	p.R2136W	CELSR1_uc011arc.1_Missense_Mutation_p.R457W	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	2136	Extracellular (Potential).				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CGCAGCGCCCTCACCAGCTGC	0.632													4	15	---	---	---	---	PASS
TMEM27	57393	broad.mit.edu	37	X	15677138	15677138	+	Splice_Site	SNP	C	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15677138C>G	uc004cxc.1	-	3	459	c.203_splice	c.e3+1	p.E68_splice		NM_020665	NP_065716	Q9HBJ8	TMM27_HUMAN	transmembrane protein 27 precursor						proteolysis	integral to membrane	metallopeptidase activity|peptidyl-dipeptidase activity			ovary(1)	1	Hepatocellular(33;0.183)					TATTTGCTTACTCTGTTGCTT	0.318													6	8	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34148516	34148516	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34148516T>A	uc004ddg.2	-	1	1913	c.1880A>T	c.(1879-1881)AAT>ATT	p.N627I		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	627										ovary(4)|central_nervous_system(1)	5						GTCAAACAGATTCCTGATGGA	0.443													26	36	---	---	---	---	PASS
FAM47B	170062	broad.mit.edu	37	X	34962426	34962426	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34962426A>C	uc004ddi.1	+	1	1496	c.1478A>C	c.(1477-1479)GAT>GCT	p.D493A		NM_152631	NP_689844	Q8NA70	FA47B_HUMAN	hypothetical protein LOC170062	493										ovary(3)|breast(1)	4						AGAACAACCGATCAAGACCAA	0.458													30	47	---	---	---	---	PASS
USP11	8237	broad.mit.edu	37	X	47102051	47102051	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47102051C>T	uc004dhp.2	+	12	1644	c.1644C>T	c.(1642-1644)CAC>CAT	p.H548H	USP11_uc004dhq.2_Silent_p.H275H	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	548					protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						TCTTCAGTCACCGCTTCTATA	0.552													22	0	---	---	---	---	PASS
SSX5	6758	broad.mit.edu	37	X	48054489	48054489	+	Intron	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48054489G>T	uc004dja.1	-						SSX5_uc004diz.1_Missense_Mutation_p.P49Q	NM_175723	NP_783729	O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding				0						GCTGCTGGCTGGCTCTCTTCC	0.527													12	18	---	---	---	---	PASS
MIR223	407008	broad.mit.edu	37	X	65238772	65238772	+	RNA	SNP	G	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65238772G>A	hsa-mir-223|MI0000300	+			c.61G>A			uc004dwg.1_RNA|uc011mox.1_RNA																	0						CACTCCATGTGGTAGAGTGTC	0.537													5	6	---	---	---	---	PASS
STARD8	9754	broad.mit.edu	37	X	67938340	67938340	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67938340C>T	uc004dxa.2	+	5	1716	c.1344C>T	c.(1342-1344)TCC>TCT	p.S448S	STARD8_uc004dxb.2_Silent_p.S528S|STARD8_uc004dxc.3_Silent_p.S448S	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	448					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						TGGCCTCCTCCAGCGAACTTG	0.592													7	8	---	---	---	---	PASS
PCDH19	57526	broad.mit.edu	37	X	99551290	99551290	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99551290C>T	uc010nmz.2	-	6	5108	c.3432G>A	c.(3430-3432)AAG>AAA	p.K1144K	PCDH19_uc004efw.3_Silent_p.K1096K|PCDH19_uc004efx.3_Silent_p.K1097K	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	1144	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						GAACGATATCCTTCAGACGCT	0.493													48	2	---	---	---	---	PASS
CXorf57	55086	broad.mit.edu	37	X	105855370	105855370	+	Silent	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105855370G>T	uc004emi.3	+	1	211	c.60G>T	c.(58-60)CCG>CCT	p.P20P	CXorf57_uc004emj.3_Silent_p.P20P|CXorf57_uc004emh.2_Silent_p.P20P	NM_018015	NP_060485	Q6NSI4	CX057_HUMAN	hypothetical protein LOC55086	20										ovary(1)|lung(1)|breast(1)	3						TAGATTGGCCGAACCCTGAGA	0.572													27	3	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106111678	106111678	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106111678A>T	uc004emo.2	+	18	2949	c.2784A>T	c.(2782-2784)GAA>GAT	p.E928D	MORC4_uc004emp.3_Intron	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	928						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						TTTCCAAGGAAGAATTACTTT	0.323													4	1	---	---	---	---	PASS
GUCY2F	2986	broad.mit.edu	37	X	108684580	108684580	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108684580C>A	uc004eod.3	-	7	1977	c.1701G>T	c.(1699-1701)GAG>GAT	p.E567D	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	567	Protein kinase.|Cytoplasmic (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8						AATATCTTACCTCATAAATCG	0.403													5	73	---	---	---	---	PASS
AGTR2	186	broad.mit.edu	37	X	115304403	115304403	+	Silent	SNP	C	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115304403C>T	uc004eqh.3	+	3	1077	c.870C>T	c.(868-870)TGC>TGT	p.C290C		NM_000686	NP_000677	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	290	Extracellular (Potential).				behavior|blood vessel remodeling|brain development|G-protein signaling, coupled to cGMP nucleotide second messenger|intracellular protein kinase cascade|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of heart rate|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of nitric-oxide synthase activity|positive regulation of phosphoprotein phosphatase activity|positive regulation of vasodilation|regulation of systemic arterial blood pressure by circulatory renin-angiotensin		angiotensin type II receptor activity|receptor antagonist activity			ovary(2)|lung(1)	3						TTAATAGCTGCGAAGTTATAG	0.483													38	50	---	---	---	---	PASS
MAGEA4	4103	broad.mit.edu	37	X	151092292	151092292	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151092292G>T	uc004fez.2	+	3	312	c.156G>T	c.(154-156)GAG>GAT	p.E52D	MAGEA4_uc004ffa.2_Missense_Mutation_p.E52D|MAGEA4_uc004ffb.2_Missense_Mutation_p.E52D|MAGEA4_uc004ffc.2_Missense_Mutation_p.E52D|MAGEA4_uc004ffd.2_Missense_Mutation_p.E52D	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	52							protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GCACCCTGGAGGAAGTGCCTG	0.617													5	44	---	---	---	---	PASS
GABRA3	2556	broad.mit.edu	37	X	151358288	151358288	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151358288G>T	uc010ntk.1	-	9	1297	c.1057C>A	c.(1057-1059)CTG>ATG	p.L353M		NM_000808	NP_000799	P34903	GBRA3_HUMAN	gamma-aminobutyric acid A receptor, alpha 3	353	Helical; (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)				Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	AATTCAATCAGTGCAGAAAAT	0.478													19	27	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153581949	153581949	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153581949C>A	uc004fkk.2	-	36	6082	c.5833G>T	c.(5833-5835)GGC>TGC	p.G1945C	FLNA_uc004fki.2_Translation_Start_Site|FLNA_uc011mzn.1_Intron|FLNA_uc010nuu.1_Missense_Mutation_p.G1937C	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1945	Filamin 17.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AAGGGGCTGCCTGGGACGTGC	0.607													5	34	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	135000	135000	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:135000delG	uc010nxt.1	-											Homo sapiens cDNA FLJ43258 fis, clone HHDPC1000001.																		AGAGGCTGCCGGAAGGGAAAA	0.468													4	2	---	---	---	---	
C1orf86	199990	broad.mit.edu	37	1	2127145	2127145	+	5'Flank	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2127145delG	uc001aiy.2	-						C1orf86_uc001aiv.1_5'Flank|C1orf86_uc001aiw.1_5'Flank|C1orf86_uc001aix.1_Intron	NM_182533	NP_872339	Q6NZ36	CA086_HUMAN	hypothetical protein LOC199990 isoform 2												0	all_cancers(77;0.000134)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.09e-37)|OV - Ovarian serous cystadenocarcinoma(86;1.5e-23)|GBM - Glioblastoma multiforme(42;1.61e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.0134)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		GCCCGGCCCTGAACCCAGGCC	0.682													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	2942499	2942500	+	IGR	INS	-	G	G	rs141913407		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2942499_2942500insG								ACTRT2 (3034 upstream) : FLJ42875 (33683 downstream)																							gacatggtggtgtgatcatgat	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	4973315	4973315	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4973315delG								AJAP1 (129465 upstream) : NPHP4 (949555 downstream)																							TTTCTGCAATGGGCCTCTTTT	0.433													4	2	---	---	---	---	
KCNAB2	8514	broad.mit.edu	37	1	6077467	6077468	+	Intron	DEL	TG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6077467_6077468delTG	uc009vlv.1	+							NM_003636	NP_003627	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane|juxtaparanode region of axon	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity				0	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		catacctggctgtgtgtgtgtg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	9283352	9283360	+	IGR	DEL	TCATCTTCT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9283352_9283360delTCATCTTCT								MIR34A (71516 upstream) : H6PD (11503 downstream)																							ttcttcttcgtcatcttcttcatcttctt	0.000													5	4	---	---	---	---	
PEX14	5195	broad.mit.edu	37	1	10564780	10564780	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10564780delT	uc001arn.2	+						PEX14_uc001arm.1_Intron|PEX14_uc009vmu.1_Intron|PEX14_uc009vmv.2_Intron|PEX14_uc010oam.1_Intron|PEX14_uc010oan.1_Intron|PEX14_uc001arl.2_Intron	NM_004565	NP_004556	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14						negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|protein homooligomerization|protein import into peroxisome matrix|transmembrane transport	integral to membrane|nucleus|peroxisomal membrane|protein complex	protein N-terminus binding|transcription corepressor activity			breast(1)	1	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		ttccttttcctttcctttcct	0.204													4	2	---	---	---	---	
ZBTB17	7709	broad.mit.edu	37	1	16294012	16294012	+	Intron	DEL	A	-	-	rs111683978		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16294012delA	uc001axl.3	-						ZBTB17_uc010obq.1_Intron|ZBTB17_uc010obr.1_Intron|ZBTB17_uc010obs.1_Intron|ZBTB17_uc010obt.1_Intron|ZBTB17_uc010obu.1_Intron|ZBTB17_uc009vom.1_Intron|ZBTB17_uc010obv.1_Intron|ZBTB17_uc009von.1_Intron	NM_003443	NP_003434	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17						negative regulation of cell cycle	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		tgtctctaccaaaaaaaaaaa	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	16425507	16425509	+	IGR	DEL	GGA	-	-	rs111888572		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16425507_16425509delGGA								FAM131C (25380 upstream) : EPHA2 (25323 downstream)																							ggaggagaggggaggagGggaag	0.025													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	16871356	16871356	+	IGR	DEL	A	-	-	rs146127856		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16871356delA								CROCCL2 (52160 upstream) : NBPF1 (19056 downstream)																							CTACATAATTAAAAAAAAAAT	0.448													10	5	---	---	---	---	
ESPNP	284729	broad.mit.edu	37	1	17025552	17025553	+	Intron	INS	-	C	C	rs139667607	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17025552_17025553insC	uc001azn.1	-							NR_026567				RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;												0						TACCAGCTCATCAGAAACACCA	0.525													6	3	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17256063	17256064	+	Intron	INS	-	A	A	rs66780576		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17256063_17256064insA	uc001azt.2	+						CROCC_uc009voy.1_Intron|CROCC_uc009voz.1_Intron	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CCCTGAGGTTGACCCAGGTGCA	0.396													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	20839648	20839649	+	IGR	DEL	AG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20839648_20839649delAG								MUL1 (4974 upstream) : FAM43B (39283 downstream)																							CTCTGAagacagagagagagag	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	20849041	20849042	+	IGR	INS	-	C	C	rs140923259	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20849041_20849042insC								MUL1 (14367 upstream) : FAM43B (29890 downstream)																							GCGAAGCAAAGCGCCCTGAAGG	0.535											OREG0013193	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	3	---	---	---	---	
HSPG2	3339	broad.mit.edu	37	1	22161636	22161636	+	Intron	DEL	T	-	-	rs71569850		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22161636delT	uc001bfj.2	-						HSPG2_uc009vqd.2_Intron	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor						angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	TGTCCACttcttttttttttt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	26987645	26987646	+	IGR	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26987645_26987646insA								RPS6KA1 (86125 upstream) : ARID1A (34876 downstream)																							CCCCCCCCACCAAAAAaaaagt	0.054													4	2	---	---	---	---	
ARID1A	8289	broad.mit.edu	37	1	27094617	27094617	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27094617delA	uc001bmv.1	+						ARID1A_uc001bmt.1_Intron|ARID1A_uc001bmu.1_Intron|ARID1A_uc001bmw.1_Intron|ARID1A_uc001bmx.1_5'Flank	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a						androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TTCTGAGTCTAATATTGATAG	0.502			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								4	2	---	---	---	---	
SYTL1	84958	broad.mit.edu	37	1	27672272	27672272	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27672272delT	uc001bnw.1	+						SYTL1_uc001bnv.1_Intron|SYTL1_uc009vsu.1_Intron|SYTL1_uc001bnx.2_Intron|SYTL1_uc009vsv.1_Intron	NM_032872	NP_116261	Q8IYJ3	SYTL1_HUMAN	synaptotagmin-like 1						exocytosis|intracellular protein transport	extrinsic to plasma membrane|melanosome|soluble fraction	neurexin binding|Rab GTPase binding			ovary(1)	1		Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0908)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.0013)|KIRC - Kidney renal clear cell carcinoma(1967;0.00158)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		ATCTGTCTGCttttttttttt	0.328													6	4	---	---	---	---	
PHACTR4	65979	broad.mit.edu	37	1	28777302	28777303	+	Intron	DEL	TG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28777302_28777303delTG	uc001bpw.2	+						PHACTR4_uc001bpu.2_Intron|PHACTR4_uc001bpv.1_Intron|PHACTR4_uc001bpx.2_Intron|PHACTR4_uc001bpy.2_Intron	NM_001048183	NP_001041648	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4 isoform 1								actin binding|protein phosphatase inhibitor activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		agccaattgttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	29842301	29842303	+	IGR	DEL	CTT	-	-	rs140458694	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29842301_29842303delCTT								PTPRU (188986 upstream) : None (None downstream)																							cctcctcctccttcttcttcttc	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	31128524	31128526	+	IGR	DEL	GAC	-	-	rs71028713		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31128524_31128526delGAC								None (None upstream) : MATN1 (55600 downstream)																							tggtggtggtgacggtggtggtg	0.005													4	2	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34507405	34507405	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34507405delA	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				cttggcaaagaaaaaggacca	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37544042	37544043	+	IGR	INS	-	CA	CA	rs137910744	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37544042_37544043insCA								GRIK3 (44198 upstream) : ZC3H12A (396076 downstream)																							CACAATCGCTGCACACACAtgt	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	39167266	39167267	+	IGR	DEL	GT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39167266_39167267delGT								POU3F1 (654816 upstream) : RRAGC (137748 downstream)																							TATTTGGGTGGTGTGTGTGTGT	0.475													4	2	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39720852	39720853	+	Intron	DEL	CC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39720852_39720853delCC	uc010ois.1	+						MACF1_uc001cda.1_Intron|MACF1_uc010oit.1_Intron	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			cttccactatccatgctgcTTT	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	41730645	41730645	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41730645delT								SCMH1 (22857 upstream) : EDN2 (213804 downstream)																							TCTGAGCTGCttttttttttt	0.214													4	2	---	---	---	---	
CCDC30	728621	broad.mit.edu	37	1	43096060	43096061	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43096060_43096061insT	uc009vwk.1	+						CCDC30_uc001chm.2_Intron|CCDC30_uc001chn.2_Intron	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30												0						ttctttttttcttttttttttt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	43745578	43745578	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43745578delG								TMEM125 (5906 upstream) : C1orf210 (1981 downstream)																							CATGTGAGCTGGGCTTCCCTC	0.433													4	2	---	---	---	---	
ERI3	79033	broad.mit.edu	37	1	44691165	44691165	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44691165delT	uc001clt.2	-						ERI3_uc010okv.1_Intron|ERI3_uc009vxg.2_Intron|ERI3_uc010okw.1_Intron|ERI3_uc001clu.2_Intron	NM_024066	NP_076971	O43414	ERI3_HUMAN	prion protein interacting protein							intracellular	exonuclease activity|metal ion binding|nucleic acid binding			ovary(2)|large_intestine(1)	3						TCTCCTCTTCTTTTTTGGGGC	0.274													4	2	---	---	---	---	
ZSWIM5	57643	broad.mit.edu	37	1	45512306	45512307	+	Intron	INS	-	TG	TG	rs140153010	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45512306_45512307insTG	uc001cnd.2	-							NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5								zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)					tgggcaagatatgtgtgtgtgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	47914354	47914355	+	IGR	DEL	TA	-	-	rs7524050		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47914354_47914355delTA								FOXD2 (7992 upstream) : SKINTL (653032 downstream)																							tgtgtgtgtgtatgtgtgtgcg	0.391													4	2	---	---	---	---	
NRD1	4898	broad.mit.edu	37	1	52305532	52305532	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52305532delT	uc001ctc.3	-						NRD1_uc009vzb.2_Intron|NRD1_uc001ctd.3_Intron|NRD1_uc001cte.2_Intron|NRD1_uc001ctf.2_Intron|NRD1_uc010ong.1_Intron|NRD1_uc009vzc.1_Intron|NRD1_uc001ctg.1_5'Flank	NM_002525	NP_002516	O43847	NRDC_HUMAN	nardilysin isoform a						cell migration|cell proliferation|neuromuscular junction development|positive regulation of membrane protein ectodomain proteolysis|proteolysis|regulation of endopeptidase activity	cell surface|cytosol	epidermal growth factor binding|metalloendopeptidase activity|zinc ion binding				0						CATACTCTTATTTCTCTAATC	0.299													4	2	---	---	---	---	
ZFYVE9	9372	broad.mit.edu	37	1	52726493	52726493	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52726493delA	uc001cto.2	+						ZFYVE9_uc001ctn.2_Intron|ZFYVE9_uc001ctp.2_Intron	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3						endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						tagctcaaagaaaaaaaaaTG	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	54924635	54924636	+	IGR	INS	-	GAAT	GAAT	rs139589580	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54924635_54924636insGAAT								SSBP3 (52543 upstream) : ACOT11 (83294 downstream)																							agggaaggaaggtgggcaggcg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	54942086	54942087	+	IGR	DEL	CA	-	-	rs72668210		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54942086_54942087delCA								SSBP3 (69994 upstream) : ACOT11 (65843 downstream)																							acaacacgcgcacacacacaca	0.099													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	55715016	55715016	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55715016delG								USP24 (34254 upstream) : None (None downstream)																							tgggacctatggagtgctagt	0.000													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57571931	57571931	+	Intron	DEL	C	-	-	rs148285726		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57571931delC	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						CCCCCTAACACCCCCCCCCAT	0.388													3	3	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	58160968	58160971	+	Intron	DEL	GAAG	-	-	rs7553249		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58160968_58160971delGAAG	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						aagggagagagaaggaaagaaaga	0.005													3	3	---	---	---	---	
CACHD1	57685	broad.mit.edu	37	1	65112256	65112257	+	Intron	INS	-	A	A	rs144480084	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65112256_65112257insA	uc001dbo.1	+						CACHD1_uc001dbp.1_Intron|CACHD1_uc001dbq.1_Intron	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN	cache domain containing 1						calcium ion transport	integral to membrane				ovary(2)	2						accaaaaatacaaaaaaaaaat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	65461738	65461738	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65461738delT	uc001dbw.2	-											Homo sapiens cDNA FLJ44251 fis, clone TKIDN2004458.																		CATTGGGCTCTTTTTTTTTCT	0.174													4	2	---	---	---	---	
SERBP1	26135	broad.mit.edu	37	1	67878790	67878790	+	3'UTR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67878790delT	uc001ddv.2	-	8					SERBP1_uc001ddx.2_3'UTR|SERBP1_uc001ddy.2_3'UTR|SERBP1_uc001ddw.2_3'UTR	NM_001018067	NP_001018077	Q8NC51	PAIRB_HUMAN	SERPINE1 mRNA binding protein 1 isoform 1						regulation of mRNA stability	nucleus|perinuclear region of cytoplasm	mRNA 3'-UTR binding|protein binding			skin(1)	1						AATGACAGTCTTTTTTTTTTT	0.353													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	74334829	74334829	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74334829delT								None (None upstream) : LRRIQ3 (156875 downstream)																							TGATGCATAATTTTTTCCCCT	0.318													4	2	---	---	---	---	
SLC44A5	204962	broad.mit.edu	37	1	75739865	75739865	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75739865delT	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						TGCTTTGGGGTTTTTTTTTTA	0.418													2	4	---	---	---	---	
ST6GALNAC3	256435	broad.mit.edu	37	1	77003574	77003575	+	Intron	INS	-	A	A	rs144080753	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77003574_77003575insA	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						gcctaccaaccaaaaaaaagac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	80389645	80389645	+	IGR	DEL	C	-	-	rs140309977		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80389645delC								ELTD1 (917150 upstream) : None (None downstream)																							tttgtggcaaccccccccatc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	83658334	83658334	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:83658334delT								None (None upstream) : TTLL7 (676725 downstream)																							taagtggaaatATCTCCTTCA	0.169													3	3	---	---	---	---	
LRRC8D	55144	broad.mit.edu	37	1	90377253	90377254	+	Intron	INS	-	T	T	rs138025435	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90377253_90377254insT	uc001dnm.2	+						LRRC8D_uc001dnn.2_Intron	NM_001134479	NP_001127951	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member							integral to membrane	protein binding			ovary(2)	2		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		CCCTTGCACACGTGAGCCAGAC	0.282													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	105745480	105745480	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:105745480delG								None (None upstream) : None (None downstream)																							TTATTAAAAAGGAAAAAGCAA	0.443													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	120152157	120152158	+	IGR	INS	-	T	T	rs11387175		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120152157_120152158insT								HSD3B1 (94476 upstream) : ZNF697 (9842 downstream)																							GTCTCTCTCTCttttttttttt	0.203													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121402149	121402149	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121402149delC								LOC647121 (88463 upstream) : None (None downstream)																							cacaaagcagcttctgagaat	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142649332	142649333	+	Intron	INS	-	TT	TT	rs141768307	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142649332_142649333insTT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		gacccagctaatttttttgtgt	0.000													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145204443	145204444	+	Intron	INS	-	G	G	rs144070974	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145204443_145204444insG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						cagaaggcaaaggggaagcaag	0.000													3	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145231553	145231554	+	Intron	INS	-	C	C	rs142041832		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145231553_145231554insC	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ATGCTATGGAACCTTCAGGGAT	0.386													6	5	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145264367	145264368	+	Intron	INS	-	T	T	rs71272964		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145264367_145264368insT	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGAAATGACACttttttttttt	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148849797	148849797	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148849797delT								NBPF16 (91486 upstream) : LOC645166 (78489 downstream)																							tctcatttcatttgatcattt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148851648	148851649	+	IGR	INS	-	TG	TG	rs77978937		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148851648_148851649insTG								NBPF16 (93337 upstream) : LOC645166 (76637 downstream)																							TGGCTTTTTTTTTTCCTTATTC	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149029055	149029055	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149029055delG								LOC645166 (76001 upstream) : LOC388692 (250421 downstream)																							aagaaagaaaggaagggagga	0.030													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149302689	149302689	+	IGR	DEL	A	-	-	rs140796132		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149302689delA								LOC388692 (10947 upstream) : FCGR1C (66605 downstream)																							aggcagaaataaaaaaaaatt	0.000													6	3	---	---	---	---	
PIP5K1A	8394	broad.mit.edu	37	1	151200077	151200077	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151200077delT	uc001exj.2	+						PIP5K1A_uc001exi.2_Intron|PIP5K1A_uc010pcu.1_Intron|PIP5K1A_uc001exk.2_Intron	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type						phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding			ovary(1)|central_nervous_system(1)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTAAATGAGATTTTTTTTggc	0.149													4	2	---	---	---	---	
SELENBP1	8991	broad.mit.edu	37	1	151339440	151339440	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151339440delC	uc001exx.2	-						SELENBP1_uc010pcy.1_Intron|SELENBP1_uc001exy.2_Intron|SELENBP1_uc001exz.2_Intron|SELENBP1_uc010pcz.1_Intron|SELENBP1_uc009wms.2_Intron|SELENBP1_uc009wmt.2_Intron|SELENBP1_uc001eya.2_Intron|SELENBP1_uc009wmu.2_Intron	NM_003944	NP_003935	Q13228	SBP1_HUMAN	selenium binding protein 1						protein transport	cytosol|membrane|nucleolus	protein binding|selenium binding				0	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			ACCCCACCCTCCAGCCCTCTC	0.567													45	28	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	153418975	153418975	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153418975delA								S100A7L2 (6472 upstream) : S100A7 (11245 downstream)																							TACTCAGAGGAAAAAAAAAAA	0.418													4	2	---	---	---	---	
ZBTB7B	51043	broad.mit.edu	37	1	154986421	154986421	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154986421delG	uc001fgk.3	+						ZBTB7B_uc009wpa.2_Intron|ZBTB7B_uc001fgj.3_Intron|ZBTB7B_uc010peq.1_Intron|ZBTB7B_uc001fgl.3_5'Flank	NM_015872	NP_056956	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B						cell differentiation|ectoderm development|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TTGGTAGCCAGGGGAGGGGCA	0.542													4	2	---	---	---	---	
DCST1	149095	broad.mit.edu	37	1	155016957	155016958	+	Intron	DEL	AA	-	-	rs71833460		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155016957_155016958delAA	uc001fgn.1	+						DCST1_uc010per.1_Intron|DCST1_uc010pes.1_Intron	NM_152494	NP_689707	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1 isoform 1							integral to membrane	zinc ion binding			ovary(1)|skin(1)	2	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			agcttgtctcaaaaaaaaaaaa	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	156423114	156423114	+	IGR	DEL	T	-	-	rs66985332		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156423114delT								C1orf61 (22621 upstream) : MEF2D (10406 downstream)																							cttttctttcttttttttttt	0.005													2	4	---	---	---	---	
C1orf66	51093	broad.mit.edu	37	1	156704328	156704329	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156704328_156704329insT	uc001fpu.2	+						C1orf66_uc001fpv.2_Intron	NM_015997	NP_057081	Q96FB5	RRNAD_HUMAN	hypothetical protein LOC51093 isoform 1							integral to membrane	rRNA (adenine-N6,N6-)-dimethyltransferase activity				0	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GAGGAGAtttcttttttttttt	0.312													3	4	---	---	---	---	
OR6K3	391114	broad.mit.edu	37	1	158688032	158688033	+	5'Flank	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158688032_158688033insT	uc010pip.1	-							NM_001005327	NP_001005327	Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					TGAAGGTTTCATTTTTTTTCCT	0.312													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	160942091	160942092	+	IGR	DEL	AC	-	-	rs138834597		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160942091_160942092delAC								ITLN2 (17502 upstream) : F11R (22910 downstream)																							agTTCAGAGTACAGTGTCTAGC	0.248													5	3	---	---	---	---	
ADAMTS4	9507	broad.mit.edu	37	1	161165724	161165725	+	Intron	INS	-	AC	AC	rs143918790	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161165724_161165725insAC	uc001fyt.3	-							NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			cacacacacagacacacacaca	0.347													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161361000	161361000	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161361000delG								C1orf192 (23336 upstream) : FCGR2A (114205 downstream)																							TTTccagcctgggcatataat	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161405485	161405485	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161405485delC								C1orf192 (67821 upstream) : FCGR2A (69720 downstream)																							agcaacttatccttcacctta	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161442232	161442235	+	IGR	DEL	GAAA	-	-	rs148443521		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161442232_161442235delGAAA								C1orf192 (104568 upstream) : FCGR2A (32970 downstream)																							AACACCTCACgaaagaaagaaaga	0.397													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	165036465	165036465	+	IGR	DEL	T	-	-	rs35058635		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165036465delT								PBX1 (182165 upstream) : LMX1A (134640 downstream)																							AGAAAATTAAttttttttttt	0.179													4	2	---	---	---	---	
CREG1	8804	broad.mit.edu	37	1	167515717	167515717	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167515717delA	uc001gel.2	-							NM_003851	NP_003842	O75629	CREG1_HUMAN	cellular repressor of E1A-stimulated genes						cell proliferation|multicellular organismal development|regulation of growth|regulation of transcription from RNA polymerase II promoter	extracellular region	FMN binding|transcription corepressor activity				0						catctctactaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	171423964	171423965	+	IGR	INS	-	T	T	rs144034065	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171423964_171423965insT								FMO4 (112742 upstream) : BAT2L2 (30701 downstream)																							tgttcaactaatttttttttag	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	181265174	181265197	+	IGR	DEL	ACACACACACACACACACACACAC	-	-	rs72181459		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181265174_181265197delACACACACACACACACACACACAC								IER5 (205197 upstream) : CACNA1E (187519 downstream)																							GATTATGcatacacacacacacacacacacacacacacacacac	0.170													4	3	---	---	---	---	
LAMC2	3918	broad.mit.edu	37	1	183205571	183205571	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183205571delC	uc001gqa.2	+						LAMC2_uc001gpz.3_Intron|LAMC2_uc010poa.1_Intron	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor						cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						TTTATTACCGCCCCCTCCCCA	0.328													34	19	---	---	---	---	
RGS21	431704	broad.mit.edu	37	1	192294898	192294898	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192294898delT	uc001gsh.2	+							NM_001039152	NP_001034241	Q2M5E4	RGS21_HUMAN	regulator of G-protein signaling 21						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|skin(1)	2						tctctgttcatgtcctttgcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	201612466	201612469	+	IGR	DEL	TTCT	-	-	rs35863451		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201612466_201612469delTTCT								RPS10P7 (112864 upstream) : NAV1 (4981 downstream)																							cttccctctcttctttctttcttt	0.000													3	5	---	---	---	---	
NAV1	89796	broad.mit.edu	37	1	201784980	201784980	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201784980delC	uc001gwu.2	+						NAV1_uc001gwx.2_Intron	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1						cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						gattctcctgcctcagcctcc	0.000													4	2	---	---	---	---	
IPO9	55705	broad.mit.edu	37	1	201801014	201801016	+	Intron	DEL	TTG	-	-	rs72242479		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201801014_201801016delTTG	uc001gwz.2	+							NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9						protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						TTTTTTGCTTttgttgttgttgt	0.197													4	3	---	---	---	---	
SYT2	127833	broad.mit.edu	37	1	202607465	202607466	+	Intron	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202607465_202607466insA	uc001gye.2	-						SYT2_uc010pqb.1_Intron|SYT2_uc009xaf.2_Intron	NM_001136504	NP_001129976	Q8N9I0	SYT2_HUMAN	synaptotagmin II						neurotransmitter secretion	cell junction|chromaffin granule membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	protein binding|transporter activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	AACAAAGGAAGAAAAAAAAATA	0.485													4	2	---	---	---	---	
FMOD	2331	broad.mit.edu	37	1	203225510	203225511	+	Intron	INS	-	AA	AA			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203225510_203225511insAA	uc010pqi.1	-						CHIT1_uc001gzm.1_Intron	NM_002023		Q06828	FMOD_HUMAN	fibromodulin precursor						transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix				ovary(2)|breast(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.171)			AAGAATCCTTCaaaaaaaaaaa	0.312													4	2	---	---	---	---	
LAX1	54900	broad.mit.edu	37	1	203744527	203744528	+	3'UTR	INS	-	C	C	rs142836373		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203744527_203744528insC	uc001haa.2	+	5					LAX1_uc010pql.1_3'UTR|LAX1_uc001hab.2_3'UTR	NM_017773	NP_060243	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1 isoform a						B cell activation|immune response|inactivation of MAPK activity|intracellular signal transduction|negative regulation of T cell activation	Golgi apparatus|integral to membrane|plasma membrane	protein kinase binding|SH2 domain binding			central_nervous_system(2)	2	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			tctcaaaaaaaaaaacaaacaa	0.030													2	5	---	---	---	---	
GOLT1A	127845	broad.mit.edu	37	1	204171582	204171582	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204171582delC	uc001has.1	-						GOLT1A_uc001hat.1_Intron	NM_198447	NP_940849	Q6ZVE7	GOT1A_HUMAN	golgi transport 1 homolog A						protein transport|vesicle-mediated transport	Golgi membrane|integral to membrane					0	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.244)			AAATTCCTCTCCACCATTCTC	0.498													4	2	---	---	---	---	
MDM4	4194	broad.mit.edu	37	1	204670014	204670016	+	Intron	DEL	CTT	-	-	rs35749150		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204670014_204670016delCTT	uc001hbd.1	+							NM_002393		O15151	MDM4_HUMAN	mouse double minute 4 homolog						apoptosis|cell proliferation|cellular response to hypoxia|G0 to G1 transition|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of protein catabolic process|negative regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization	nucleus	enzyme binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)			taccctgatccttcttcttcttc	0.099			A		GBM|bladder|retinoblastoma								3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	209111753	209111754	+	IGR	INS	-	GG	GG	rs138551854	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209111753_209111754insGG								PLXNA2 (694088 upstream) : LOC642587 (490414 downstream)																							ATTTGCAAAAAGTTCCCATTTG	0.426													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	210442648	210442648	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210442648delA								SERTAD4 (26210 upstream) : HHAT (58958 downstream)																							agaagagtctaaaaaaaaaag	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	214418349	214418350	+	IGR	DEL	AC	-	-	rs71868061		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214418349_214418350delAC								PROX1 (208589 upstream) : SMYD2 (36215 downstream)																							acatatgcatacacacacacac	0.317													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	218120023	218120023	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218120023delA								SPATA17 (79521 upstream) : RRP15 (338606 downstream)																							ATCAAAAGGCAAAAAACTCCC	0.458													3	4	---	---	---	---	
SLC30A10	55532	broad.mit.edu	37	1	219932559	219932562	+	Intron	DEL	AAAG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219932559_219932562delAAAG	uc001hlu.1	-									Q6XR72	ZNT10_HUMAN	Synthetic construct DNA, clone: pF1KB7405, Homo sapiens SLC30A10 gene for solute carrier family 30, member 10, without stop codon, in Flexi system.						zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		aggagagaaaaaagaaagaaagga	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	220579277	220579278	+	IGR	DEL	TG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220579277_220579278delTG								RAB3GAP2 (133434 upstream) : MARK1 (122290 downstream)																							tgtgtgtttttgtgtgtgtgtg	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	224201666	224201670	+	IGR	DEL	GGAAC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224201666_224201670delGGAAC								TP53BP2 (167992 upstream) : FBXO28 (100121 downstream)																							ggactcggatggaacggaacggaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	224751163	224751166	+	IGR	DEL	GTGT	-	-	rs34894588		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224751163_224751166delGTGT								WDR26 (129431 upstream) : CNIH3 (53013 downstream)																							TTTAGACGGGgtgtgtgtgtgtgt	0.343													4	4	---	---	---	---	
DNAH14	127602	broad.mit.edu	37	1	225367603	225367603	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225367603delT	uc001how.2	+							NM_001373	NP_001364	Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1						cagttgacagttttttttttc	0.000													4	2	---	---	---	---	
LEFTY1	10637	broad.mit.edu	37	1	226102465	226102467	+	Intron	DEL	CCC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226102465_226102467delCCC	uc010pvj.1	-									O75610	LFTY1_HUMAN	SubName: Full=cDNA FLJ54750, moderately similar to Pyrroline-5-carboxylate reductase 2 (EC 1.5.1.2);						cell growth|multicellular organismal development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)					TGAAAGGTCTCCCTCCTGCCCTG	0.433													4	2	---	---	---	---	
ERO1LB	56605	broad.mit.edu	37	1	236425242	236425243	+	Intron	INS	-	AAA	AAA	rs145820068		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236425242_236425243insAAA	uc001hxt.2	-						ERO1LB_uc010pxt.1_Intron	NM_019891	NP_063944	Q86YB8	ERO1B_HUMAN	endoplasmic reticulum oxidoreductin 1-Lbeta						electron transport chain|protein thiol-disulfide exchange|transport	endoplasmic reticulum membrane	flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor|unfolded protein binding				0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			ggctctgtctcaaaaacaaaaa	0.000													4	2	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241288727	241288728	+	Intron	INS	-	AC	AC	rs138636291	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241288727_241288728insAC	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			CAAAGACATGGacacacacaca	0.401													3	3	---	---	---	---	
C1orf101	257044	broad.mit.edu	37	1	244660709	244660709	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244660709delA	uc001iam.2	+						C1orf101_uc001iak.1_Intron|C1orf101_uc001ial.2_Intron|C1orf101_uc010pym.1_Intron|C1orf101_uc010pyn.1_Intron	NM_001130957	NP_001124429	Q5SY80	CA101_HUMAN	hypothetical protein LOC257044 isoform 1							integral to membrane				ovary(1)|breast(1)	2	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			acaatccaacaaaaaaaaaat	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	248573340	248573340	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248573340delC								OR2T1 (2936 upstream) : OR2T2 (42759 downstream)																							ATGTGCCTTGCCAGGTTCATC	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	249240419	249240420	+	IGR	INS	-	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249240419_249240420insG								PGBD2 (27075 upstream) : None (None downstream)																							ggttagggttagggttagggtt	0.000													4	2	---	---	---	---	
SNTG2	54221	broad.mit.edu	37	2	951717	951722	+	Intron	DEL	GCCCCT	-	-	rs67725613		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:951717_951722delGCCCCT	uc002qwq.2	+						SNTG2_uc002qwp.2_Intron|SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GACTGTGCTGgcccctgcccctgccc	0.107													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	5574795	5574796	+	IGR	INS	-	GT	GT	rs145241058	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5574795_5574796insGT								None (None upstream) : SOX11 (258003 downstream)																							TATTTGAAAGAgtgtgtgtgtg	0.356													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8490605	8490605	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8490605delG								LOC339788 (373628 upstream) : ID2 (328735 downstream)																							actacttatcgggtatagtgt	0.000													4	2	---	---	---	---	
KIDINS220	57498	broad.mit.edu	37	2	8900853	8900854	+	Intron	DEL	TT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8900853_8900854delTT	uc002qzc.2	-						KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Intron|KIDINS220_uc010yiw.1_Intron|KIDINS220_uc002qze.2_Intron	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa						activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GAATAGCTCATTTTTCTCACTA	0.267													4	2	---	---	---	---	
WDR35	57539	broad.mit.edu	37	2	20169510	20169510	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20169510delT	uc002rdi.2	-						WDR35_uc002rdj.2_Intron|WDR35_uc010ext.2_Intron|WDR35_uc002rdh.2_Intron	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1											ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTTCTTGAAttttttttttt	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20578873	20578874	+	IGR	INS	-	CT	CT	rs141030900	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20578873_20578874insCT								PUM2 (28410 upstream) : RHOB (67961 downstream)																							GCCTTGACGCCctctctctctc	0.351											OREG0014477	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	21694107	21694107	+	IGR	DEL	A	-	-	rs111832951		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21694107delA								APOB (427162 upstream) : None (None downstream)																							actctgtctcaaaaaaaaaaa	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	23274071	23274073	+	IGR	DEL	GAT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23274071_23274073delGAT								None (None upstream) : KLHL29 (481382 downstream)																							ggcatagatagatGATGATCTCA	0.222													0	6	---	---	---	---	
RAB10	10890	broad.mit.edu	37	2	26274624	26274624	+	Intron	DEL	A	-	-	rs74467481		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26274624delA	uc002rgv.2	+							NM_016131	NP_057215	P61026	RAB10_HUMAN	ras-related GTP-binding protein RAB10						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ctccgtctccaaaaaaaaaaa	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	26910024	26910025	+	IGR	DEL	AC	-	-	rs72323112	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26910024_26910025delAC								CIB4 (45813 upstream) : KCNK3 (5556 downstream)																							acacacacagacacacacacac	0.391													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	32027825	32027826	+	IGR	INS	-	A	A	rs139615861	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32027825_32027826insA								SRD5A2 (221785 upstream) : MEMO1 (65070 downstream)																							ggagcaaacagaaaaaaaaaga	0.000													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34175107	34175108	+	IGR	INS	-	C	C	rs143138372	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34175107_34175108insC								MYADML (221823 upstream) : None (None downstream)																							ctcatgctaataagtgacctta	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	37966211	37966212	+	IGR	INS	-	AGC	AGC	rs149422408	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37966211_37966212insAGC								CDC42EP3 (66885 upstream) : FAM82A1 (186250 downstream)																							CAGCGTCTCAGAGCTCTGCTTA	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	38756627	38756627	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38756627delT								ATL2 (152195 upstream) : HNRPLL (33701 downstream)																							CTTCTTTGCCTTTTTTCCACG	0.557													4	2	---	---	---	---	
SOS1	6654	broad.mit.edu	37	2	39337571	39337572	+	Intron	INS	-	AT	AT	rs138451613	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39337571_39337572insAT	uc002rrk.3	-						SOS1_uc010ynr.1_Intron	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1						apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				TACATACACACGAATCATGTAA	0.139									Noonan_syndrome				2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	41422124	41422125	+	IGR	INS	-	AC	AC	rs145958973	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41422124_41422125insAC								SLC8A1 (682549 upstream) : PKDCC (853036 downstream)																							CTAacacacaaacacacacaca	0.297													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	41937889	41937890	+	IGR	DEL	AC	-	-	rs141957134		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41937889_41937890delAC								None (None upstream) : PKDCC (337271 downstream)																							aaacacacaaacacacacacac	0.406													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	43324221	43324222	+	IGR	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43324221_43324222insA								HAAO (304470 upstream) : ZFP36L2 (125320 downstream)																							actttgtctccaaaaaaaaaaa	0.000													4	2	---	---	---	---	
PLEKHH2	130271	broad.mit.edu	37	2	43925391	43925391	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43925391delT	uc010yny.1	+						PLEKHH2_uc002rte.3_Intron|PLEKHH2_uc002rtf.3_Intron	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H							cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				tctctctctcttttttttttt	0.169													4	2	---	---	---	---	
DYNC2LI1	51626	broad.mit.edu	37	2	43999332	43999333	+	5'Flank	DEL	AT	-	-	rs3834787		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43999332_43999333delAT	uc002rtk.2	+						DYNC2LI1_uc002rth.2_5'Flank|DYNC2LI1_uc002rti.2_5'Flank|DYNC2LI1_uc002rtj.2_5'Flank|DYNC2LI1_uc002rtl.2_5'Flank|DYNC2LI1_uc010ynz.1_5'Flank	NM_016008	NP_057092	Q8TCX1	DC2L1_HUMAN	dynein 2 light intermediate chain isoform 1							apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CTTaagaacaatcttcatctac	0.208													4	8	---	---	---	---	
ASB3	51130	broad.mit.edu	37	2	54010215	54010215	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54010215delT	uc002rxg.1	-						ASB3_uc002rxh.1_Intron|ASB3_uc002rxi.3_Intron|ASB3_uc010yoo.1_Intron	NM_016115	NP_057199	Q9Y575	ASB3_HUMAN	ankyrin repeat and SOCS box-containing protein 3						intracellular signal transduction					ovary(1)|kidney(1)	2			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			ccgccAAGAATTTTTTTTTTT	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	55859278	55859278	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55859278delC								SMEK2 (14165 upstream) : PNPT1 (1920 downstream)																							atttttttttcagtagagacg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	56007885	56007885	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56007885delT								PNPT1 (86874 upstream) : EFEMP1 (85218 downstream)																							ACCAATGACCTTTTTGCACTA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	59891877	59891877	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59891877delC								None (None upstream) : BCL11A (786426 downstream)																							cacacacacacaATTACAAGA	0.303													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60795836	60795837	+	IGR	INS	-	TG	TG	rs140705455	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60795836_60795837insTG								BCL11A (15203 upstream) : PAPOLG (187546 downstream)																							TATCTAGGATTtgtgtgtgtgt	0.292													6	3	---	---	---	---	
PAPOLG	64895	broad.mit.edu	37	2	61002898	61002898	+	Intron	DEL	T	-	-	rs67613831		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61002898delT	uc002sai.2	+						PAPOLG_uc002saj.2_Intron|PAPOLG_uc002sak.2_Intron	NM_022894	NP_075045	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma						mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			tactgtagtcttttttttttt	0.000													6	4	---	---	---	---	
APLF	200558	broad.mit.edu	37	2	68756296	68756297	+	Intron	INS	-	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68756296_68756297insG	uc002sep.2	+						APLF_uc002seq.1_5'Flank|APLF_uc010fdf.2_Intron	NM_173545	NP_775816	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor						double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2						TTCTTCCTTGAGGGGGGGCTCC	0.579													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	72116354	72116354	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72116354delC								DYSF (202462 upstream) : CYP26B1 (240013 downstream)																							gccccaaccacccatgtgatg	0.114													4	2	---	---	---	---	
TCF7L1	83439	broad.mit.edu	37	2	85535580	85535581	+	Intron	DEL	CT	-	-	rs112523821		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85535580_85535581delCT	uc002soy.2	+							NM_031283	NP_112573	Q9HCS4	TF7L1_HUMAN	HMG-box transcription factor TCF-3						chromatin organization|regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|breast(1)|central_nervous_system(1)	3						ctttccctccctctctttccct	0.000													3	5	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87452249	87452249	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87452249delG	uc002srs.3	+									Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						CGACGCCCCAGGGCCAGTGTC	0.358													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90417746	90417749	+	Intron	DEL	CTCA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90417746_90417749delCTCA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		gaggcattgcctcactcagaaagc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90439919	90439920	+	Intron	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90439919_90439920insA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		TAGTATTTTGGATTTCACATGT	0.198													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90479146	90479147	+	IGR	DEL	TT	-	-	rs71276607		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90479146_90479147delTT								None (None upstream) : None (None downstream)																							caggctggtctttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96841090	96841091	+	IGR	DEL	AA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96841090_96841091delAA								DUSP2 (29911 upstream) : STARD7 (9514 downstream)																							TATGAATTCTAAAGATTTCTCC	0.248													4	2	---	---	---	---	
STARD7	56910	broad.mit.edu	37	2	96864058	96864059	+	Intron	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96864058_96864059insA	uc002svm.3	-							NM_020151	NP_064536	Q9NQZ5	STAR7_HUMAN	START domain containing 7 precursor							mitochondrion					0						aaaactgtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106861005	106861006	+	IGR	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106861005_106861006insA								UXS1 (50210 upstream) : PLGLA (141763 downstream)																							aacaaagtaacaaaaaaaaggt	0.000													4	2	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	116575626	116575626	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116575626delA	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						CAGTTCATTGAAAAAAAAGAG	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	116682183	116682188	+	IGR	DEL	CACGTG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116682183_116682188delCACGTG								DPP10 (80247 upstream) : None (None downstream)																							tacaaacatacacgtgcagctatctt	0.000													3	3	---	---	---	---	
PTPN4	5775	broad.mit.edu	37	2	120554437	120554442	+	Intron	DEL	TGTGTG	-	-	rs148083200		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120554437_120554442delTGTGTG	uc002tmf.1	+							NM_002830	NP_002821	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton|internal side of plasma membrane	cytoskeletal protein binding|non-membrane spanning protein tyrosine phosphatase activity			ovary(2)	2					Alendronate(DB00630)	tcactgtttttgtgtgtgtgtgtgtg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	126318482	126318485	+	IGR	DEL	TGTC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126318482_126318485delTGTC								CNTNAP5 (645621 upstream) : None (None downstream)																							ATTTCATTTGtgtctgtctgtctg	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127227042	127227043	+	IGR	INS	-	TTTTGAGATGCTTTTTGC	TTTTGAGATGCTTTTTGC	rs144060855	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127227042_127227043insTTTTGAGATGCTTTTTGC								None (None upstream) : GYPC (186641 downstream)																							CTGTAGAATAATTTTTGCTCAT	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127491738	127491741	+	IGR	DEL	TCTC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127491738_127491741delTCTC								GYPC (37493 upstream) : BIN1 (313866 downstream)																							tcccttaaaatctctctctctctc	0.176													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132768769	132768769	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132768769delT								C2orf27B (209535 upstream) : NCRNA00164 (136395 downstream)																							GAAACATAGATTAAAAAAGGA	0.174													6	3	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133014827	133014828	+	Intron	INS	-	A	A	rs146639319		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133014827_133014828insA	uc002ttj.3	-						MIR663B_hsa-mir-663b|MI0006336_5'Flank	NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						CCAGGCGGCCCAACCCCGTGCC	0.683													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133023673	133023676	+	IGR	DEL	CCCT	-	-	rs111943961		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133023673_133023676delCCCT								NCRNA00164 (8131 upstream) : GPR39 (150471 downstream)																							ATTGAGAAAACCCTCCCAGCATCC	0.441													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133105213	133105213	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133105213delG								NCRNA00164 (89671 upstream) : GPR39 (68934 downstream)																							AGTAGCTCTAGGGGAGGAGAA	0.592													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	154092721	154092721	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154092721delA								ARL6IP6 (474954 upstream) : RPRM (241131 downstream)																							tcatgaagttaaggaaagaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	157597638	157597638	+	IGR	DEL	A	-	-	rs77352979		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157597638delA								GPD2 (127391 upstream) : GALNT5 (516702 downstream)																							AAGGCCAAGGAAGATAGTTCT	0.373													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	159546498	159546498	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159546498delC	uc002uab.1	-											Homo sapiens cDNA FLJ44380 fis, clone TRACH3035482.																		GGCCCTACCACCAAAGACCAT	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	171559840	171559840	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171559840delC								MYO3B (48857 upstream) : LOC440925 (9109 downstream)																							aatttgtcttcccaAGATTTC	0.080													4	2	---	---	---	---	
ZAK	51776	broad.mit.edu	37	2	174009975	174009975	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174009975delA	uc002uhz.2	+						ZAK_uc002uhx.2_Intron|ZAK_uc002uhy.2_Intron|ZAK_uc010zei.1_Intron|ZAK_uc002uia.1_Intron	NM_016653	NP_057737	Q9NYL2	MLTK_HUMAN	MLK-related kinase isoform 1						activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)			actccgtctcaaaaaaaaaga	0.000													4	2	---	---	---	---	
GLS	2744	broad.mit.edu	37	2	191823970	191823970	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191823970delT	uc002usf.2	+						GLS_uc002ush.2_Intron|GLS_uc010zgi.1_Intron|GLS_uc010zgj.1_Intron	NM_014905	NP_055720	O94925	GLSK_HUMAN	glutaminase precursor						cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	caacccctgcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	192060978	192060978	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192060978delT								STAT4 (22076 upstream) : MYO1B (49129 downstream)																							gtatggcacattttgaatttc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	196947044	196947044	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196947044delG								DNAH7 (13508 upstream) : STK17B (51264 downstream)																							tctctcacttggatgcctttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	204604236	204604237	+	IGR	DEL	CA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204604236_204604237delCA								CD28 (1680 upstream) : CTLA4 (128272 downstream)																							cacacagacccacacacacaca	0.312													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	207696166	207696166	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207696166delA								FASTKD2 (35257 upstream) : CPO (108112 downstream)																							ataatattgtaaagttcatga	0.224													4	2	---	---	---	---	
TNS1	7145	broad.mit.edu	37	2	218723395	218723396	+	Intron	DEL	AC	-	-	rs72308310		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218723395_218723396delAC	uc002vgt.2	-						TNS1_uc002vgr.2_Intron|TNS1_uc002vgs.2_Intron|TNS1_uc010zjv.1_Intron|TNS1_uc010fvj.1_Intron|TNS1_uc010fvk.1_Intron|TNS1_uc010fvi.1_Intron	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CTGCCCATGTacacacacacac	0.535													4	2	---	---	---	---	
STK36	27148	broad.mit.edu	37	2	219541343	219541343	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219541343delT	uc002viu.2	+						STK36_uc002viv.2_Intron	NM_015690	NP_056505	Q9NRP7	STK36_HUMAN	serine/threonine kinase 36						cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding			ovary(4)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	11		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		tgctacacgcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	222986449	222986449	+	IGR	DEL	T	-	-	rs34557129		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222986449delT								EPHA4 (547527 upstream) : PAX3 (78158 downstream)																							TGGATGAGGCTGTCAACACAT	0.537													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	227355495	227355496	+	IGR	DEL	TG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227355495_227355496delTG								KIAA1486 (760024 upstream) : IRS1 (240538 downstream)																							tgtgtgtgcttgtgtgtgtgtg	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	229372341	229372341	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229372341delG								SPHKAP (325980 upstream) : PID1 (516349 downstream)																							tctcagctaagggagagtcaa	0.159													4	2	---	---	---	---	
CHRNG	1146	broad.mit.edu	37	2	233408190	233408191	+	Intron	INS	-	C	C	rs142201594		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233408190_233408191insC	uc002vsx.1	+						CHRNG_uc010fye.1_Intron	NM_005199	NP_005190	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma						muscle contraction	cell junction|postsynaptic membrane	acetylcholine receptor activity				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)		CCCTCCATCCACCCCCCCCATC	0.619													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235974441	235974441	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235974441delA								SH3BP4 (10085 upstream) : AGAP1 (428295 downstream)																							ATATCCAAGCAAAAACAACTC	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	237546293	237546293	+	IGR	DEL	T	-	-	rs34576330		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237546293delT								CXCR7 (55301 upstream) : COPS8 (447791 downstream)																							TTCCCACCCCTGGCAGCTTCT	0.537													3	5	---	---	---	---	
TWIST2	117581	broad.mit.edu	37	2	239779118	239779119	+	Intron	DEL	CA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239779118_239779119delCA	uc010znx.1	+						TWIST2_uc010zny.1_Intron	NM_057179	NP_476527	Q8WVJ9	TWST2_HUMAN	twist homolog 2						negative regulation of osteoblast differentiation	cytoplasm	DNA binding				0						cgacacacgccacacacacacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	240615557	240615557	+	IGR	DEL	A	-	-	rs5839750		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240615557delA								HDAC4 (292211 upstream) : NDUFA10 (284601 downstream)																							GTGAGCCAGGAAAAAAAGAAG	0.572													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241140602	241140603	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241140602_241140603insT								OTOS (60529 upstream) : GPC1 (234512 downstream)																							aatattccccatggctgCTTTT	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	3326611	3326613	+	IGR	DEL	TCT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3326611_3326613delTCT								CRBN (105221 upstream) : SUMF1 (496423 downstream)																							ttcttcttcctcttcttcttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	3675071	3675071	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3675071delT								CRBN (453681 upstream) : SUMF1 (147965 downstream)																							gggtgattgatgtattggctc	0.005													4	2	---	---	---	---	
LMCD1	29995	broad.mit.edu	37	3	8561612	8561613	+	Intron	DEL	GT	-	-	rs113116817		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8561612_8561613delGT	uc003bqq.2	+						LMCD1_uc011atd.1_Intron|LMCD1_uc011ate.1_Intron	NM_014583	NP_055398	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1						positive regulation of calcineurin-NFAT signaling pathway|regulation of cardiac muscle hypertrophy|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus	transcription corepressor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(96;0.124)		gtgagagagagtgtgtgtgtgt	0.332													4	2	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10088533	10088536	+	Intron	DEL	AATC	-	-	rs148201951		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10088533_10088536delAATC	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc010hcw.1_5'Flank	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		tttttgcattaatcattttaattg	0.005			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				5	5	---	---	---	---	
VGLL4	9686	broad.mit.edu	37	3	11608197	11608197	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11608197delA	uc003bwf.2	-						VGLL4_uc010hdx.1_Intron|VGLL4_uc003bwg.2_Intron|VGLL4_uc010hdv.1_Intron|VGLL4_uc010hdw.1_Intron|VGLL4_uc011aun.1_Intron	NM_014667	NP_055482	Q14135	VGLL4_HUMAN	vestigial like 4 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		TGCAGTGTAGAATCCCAAGGC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	20629041	20629044	+	IGR	DEL	GTGT	-	-	rs148447038		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20629041_20629044delGTGT								SGOL1 (401358 upstream) : VENTXP7 (818174 downstream)																							gagttgtgtggtgtgtgtgtgtgt	0.108													3	3	---	---	---	---	
ZNF197	10168	broad.mit.edu	37	3	44672900	44672900	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44672900delT	uc003cnm.2	+						ZNF197_uc003cnn.2_Intron|ZNF197_uc003cno.2_Intron|ZNF197_uc003cnp.2_Intron	NM_006991	NP_008922	O14709	ZN197_HUMAN	zinc finger protein 197 isoform 1						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|skin(1)	4				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		ACATCCCCCCttttttttttt	0.244													4	2	---	---	---	---	
NRADDP	100129354	broad.mit.edu	37	3	47052225	47052226	+	5'Flank	INS	-	CT	CT			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47052225_47052226insCT	uc011bas.1	+							NR_024046				Homo sapiens NRADD pseudogene (LOC100129354), non-coding RNA.												0						CTCCAGGCAAGCTCTCCTTAGT	0.559													4	2	---	---	---	---	
ACOX2	8309	broad.mit.edu	37	3	58511742	58511742	+	Intron	DEL	A	-	-	rs112008217		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58511742delA	uc003dkl.2	-							NM_003500	NP_003491	Q99424	ACOX2_HUMAN	acyl-Coenzyme A oxidase 2						bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity|acyl-CoA dehydrogenase activity|pristanoyl-CoA oxidase activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		actccatctcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
FHIT	2272	broad.mit.edu	37	3	60293283	60293284	+	Intron	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60293283_60293284insA	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		GAGTGTGTTTTAAAAAATGACA	0.332			T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				2	4	---	---	---	---	
PSMD6	9861	broad.mit.edu	37	3	64009433	64009433	+	5'Flank	DEL	T	-	-	rs28372804		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64009433delT	uc003dma.1	-						PSMD6_uc003dlz.1_5'Flank|PSMD6_uc003dmb.1_5'Flank|PSMD6_uc003dmc.1_5'Flank|PSMD6_uc003dmd.1_Intron	NM_014814	NP_055629	Q15008	PSMD6_HUMAN	proteasome (prosome, macropain) 26S subunit,						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	ATPase activity|protein binding			central_nervous_system(1)|skin(1)	2		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000805)|Kidney(15;0.00188)|KIRC - Kidney renal clear cell carcinoma(15;0.00212)		GAGCTTAAAATTTTTTGAAAA	0.289											OREG0015652	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
ROBO1	6091	broad.mit.edu	37	3	78717259	78717259	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78717259delC	uc003dqe.2	-						ROBO1_uc003dqb.2_Intron|ROBO1_uc003dqc.2_Intron|ROBO1_uc003dqd.2_Intron|ROBO1_uc010hoh.2_Intron|ROBO1_uc011bgl.1_Intron|ROBO1_uc003dqf.1_Intron	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AAAAGAACAACTAGGAAGCAT	0.413													20	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	84824029	84824029	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84824029delA	uc003dqi.2	-											Homo sapiens cDNA clone IMAGE:4824471.																		agtagaccacaagttaaagac	0.000													4	2	---	---	---	---	
EPHA6	285220	broad.mit.edu	37	3	97356918	97356920	+	In_Frame_Del	DEL	ACA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97356918_97356920delACA	uc010how.1	+	14	2819_2821	c.2776_2778delACA	c.(2776-2778)ACAdel	p.T928del	EPHA6_uc011bgp.1_3'UTR|EPHA6_uc003drs.3_In_Frame_Del_p.T320del|EPHA6_uc003drr.3_In_Frame_Del_p.T320del|EPHA6_uc003drt.2_In_Frame_Del_p.T320del|EPHA6_uc010hox.1_RNA	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	833	Protein kinase.|Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						AGCTGCTTATACAACAACTGTAA	0.365													13	7	---	---	---	---	
BBX	56987	broad.mit.edu	37	3	107280998	107280999	+	Intron	DEL	CA	-	-	rs147864479		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107280998_107280999delCA	uc010hpr.2	+						BBX_uc003dwk.3_Intron|BBX_uc003dwl.3_Intron	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			TCTGGATTCTCACACGTTGAAA	0.376													4	5	---	---	---	---	
FLJ25363	401082	broad.mit.edu	37	3	109186301	109186302	+	Intron	INS	-	CAC	CAC			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109186301_109186302insCAC	uc003dxr.1	+							NM_001145553	NP_001139025			hypothetical protein LOC401082												0						agaagatcaaacaccgcatgtt	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	109662295	109662296	+	IGR	INS	-	TG	TG	rs140901843	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109662295_109662296insTG								FLJ25363 (448281 upstream) : None (None downstream)																							agttgtgtgtatgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	109975933	109975934	+	IGR	INS	-	T	T	rs139669082	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109975933_109975934insT								FLJ25363 (761919 upstream) : PVRL3 (814931 downstream)																							TAATCCCCATGTTTCAGTCCAG	0.391													0	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	110231602	110231602	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110231602delC								None (None upstream) : PVRL3 (559263 downstream)																							cctctggctgccccctgcccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	116213566	116213567	+	IGR	DEL	AC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116213566_116213567delAC								LSAMP (689548 upstream) : LOC285194 (215068 downstream)																							aattgagggtacacacacacac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	125396690	125396691	+	IGR	DEL	CA	-	-	rs112812202		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125396690_125396691delCA								OSBPL11 (82309 upstream) : MIR548I1 (112556 downstream)																							GCAGGGCACCCACACACACACA	0.465													2	12	---	---	---	---	
NEK11	79858	broad.mit.edu	37	3	130871046	130871047	+	Intron	INS	-	T	T	rs150507740	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130871046_130871047insT	uc003eny.2	+						NEK11_uc003enx.2_Intron|NEK11_uc003eoa.2_Intron|NEK11_uc003enz.2_Intron|NEK11_uc010htn.2_Intron|NEK11_uc011blk.1_Intron|NEK11_uc011bll.1_Intron|NEK11_uc011blm.1_Intron|NEK11_uc010hto.1_Intron	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1						cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6						CACTTTTTTGGTTTTTTTTTTG	0.322													4	5	---	---	---	---	
NEK11	79858	broad.mit.edu	37	3	131032975	131032976	+	Intron	DEL	GT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131032975_131032976delGT	uc003eny.2	+						NEK11_uc003eoa.2_Intron|NEK11_uc003enz.2_Intron|NEK11_uc010htn.2_Intron|NEK11_uc011blk.1_Intron|NEK11_uc011bll.1_Intron	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1						cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6						GAGAAAAAGAgtgtgtgtgtgt	0.317													4	2	---	---	---	---	
TMEM108	66000	broad.mit.edu	37	3	132808855	132808855	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132808855delA	uc003eph.2	+						TMEM108_uc003epi.2_Intron	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor							integral to membrane				ovary(2)|skin(2)	4						GGTTGAACATAGGTTGTAGAT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137105308	137105308	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137105308delA								IL20RB (375388 upstream) : SOX14 (378271 downstream)																							tctccttatcaaatagttgtt	0.025													4	2	---	---	---	---	
FAIM	55179	broad.mit.edu	37	3	138326920	138326920	+	5'Flank	DEL	T	-	-	rs71146133		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138326920delT	uc003esr.2	+						FAIM_uc003eso.1_5'Flank|FAIM_uc003esp.2_5'Flank|FAIM_uc003esq.2_5'Flank|FAIM_uc003ess.2_5'Flank	NM_001033032	NP_001028204	Q9NVQ4	FAIM1_HUMAN	Fas apoptotic inhibitory molecule isoform c						apoptosis	cytoplasm					0						tctctctctcttttttttttt	0.000													4	3	---	---	---	---	
COPB2	9276	broad.mit.edu	37	3	139093141	139093143	+	Intron	DEL	GAT	-	-	rs148039341		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139093141_139093143delGAT	uc003etf.3	-						COPB2_uc011bmv.1_Intron|COPB2_uc010hui.2_Intron|COPB2_uc011bmw.1_3'UTR	NM_004766	NP_004757	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(2)	2						GAatgatgacgatgatgatgatg	0.212													3	3	---	---	---	---	
SPSB4	92369	broad.mit.edu	37	3	140791321	140791321	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140791321delT	uc003ett.2	+						SPSB4_uc010hum.2_Intron	NM_080862	NP_543138	Q96A44	SPSB4_HUMAN	splA/ryanodine receptor domain and SOCS box						intracellular signal transduction	cytoplasm	protein binding				0						gttctcactattagttcatgt	0.000													4	2	---	---	---	---	
PCOLCE2	26577	broad.mit.edu	37	3	142569654	142569655	+	Intron	INS	-	CT	CT	rs139522427	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142569654_142569655insCT	uc003evd.2	-							NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2							extracellular region	collagen binding|heparin binding|peptidase activator activity			ovary(2)|skin(1)	3						tatgggggtaaggaaggggata	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	148645117	148645120	+	IGR	DEL	ATCC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148645117_148645120delATCC								CPA3 (30247 upstream) : GYG1 (64255 downstream)																							ctatctatttatccatccatccat	0.039													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	149426041	149426041	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149426041delT								WWTR1 (4926 upstream) : COMMD2 (30219 downstream)																							TTTTTTCTTGTTGGTTTTTGT	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	149987971	149987972	+	IGR	DEL	AA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149987971_149987972delAA								PFN2 (299230 upstream) : TSC22D2 (138816 downstream)																							actccacctcaaaaaaaaaaaa	0.129													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	151237144	151237145	+	IGR	INS	-	T	T	rs144796592	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151237144_151237145insT								IGSF10 (60647 upstream) : AADACL2 (214559 downstream)																							caaaagttagatttttaactgc	0.025													0	6	---	---	---	---	
PPM1L	151742	broad.mit.edu	37	3	160526078	160526079	+	Intron	DEL	TG	-	-	rs145547354		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160526078_160526079delTG	uc003fdr.2	+							NM_139245	NP_640338	Q5SGD2	PPM1L_HUMAN	protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			GATTTTCCTCtgtgtgtgtgtg	0.356													4	2	---	---	---	---	
TNIK	23043	broad.mit.edu	37	3	170926853	170926854	+	Intron	INS	-	GT	GT	rs141041586	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170926853_170926854insGT	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			ctttggaaggggtgtgtgtgtg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	172174282	172174283	+	IGR	DEL	AC	-	-	rs71824009		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172174282_172174283delAC								GHSR (8079 upstream) : TNFSF10 (49182 downstream)																							gcacacacatacacacacacac	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	173022786	173022786	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173022786delC								SPATA16 (163754 upstream) : NLGN1 (93458 downstream)																							attcttgcctccagtcactat	0.000													4	2	---	---	---	---	
NLGN1	22871	broad.mit.edu	37	3	173515485	173515486	+	Intron	DEL	AC	-	-	rs151304968	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173515485_173515486delAC	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			aacaacaacaacaacaaaaaaa	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	176941905	176941905	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176941905delT								TBL1XR1 (26857 upstream) : None (None downstream)																							TGTGGACTGATTAGAACCAGG	0.517													4	2	---	---	---	---	
LAMP3	27074	broad.mit.edu	37	3	182874152	182874153	+	Intron	INS	-	AACAAC	AACAAC	rs146255869	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182874152_182874153insAACAAC	uc003flh.3	-							NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3						cell proliferation	integral to membrane|lysosomal membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			gctgtctcaaaaacaacaacaa	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	191620270	191620271	+	IGR	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191620270_191620271insA								PYDC2 (441027 upstream) : FGF12 (239413 downstream)																							tcttatccctgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	196072646	196072646	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196072646delT								TM4SF19 (7388 upstream) : UBXN7 (7725 downstream)																							agcaggtcacttggaccagag	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	693909	693909	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:693909delA								MFSD7 (10936 upstream) : PCGF3 (5664 downstream)																							TCGCTTTCCTACCAGGAGGCC	0.398													4	2	---	---	---	---	
TBC1D14	57533	broad.mit.edu	37	4	6975378	6975378	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6975378delT	uc011bwg.1	+						TBC1D14_uc003gjs.3_Intron	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a							intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						agtttaccaatttttttttcc	0.000													4	2	---	---	---	---	
AFAP1	60312	broad.mit.edu	37	4	7849931	7849938	+	Intron	DEL	AGGGAGGG	-	-	rs28479993		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7849931_7849938delAGGGAGGG	uc003gkg.1	-						AFAP1_uc011bwk.1_Intron	NM_198595	NP_940997	Q8N556	AFAP1_HUMAN	actin filament associated protein 1							actin cytoskeleton|cytoplasm|focal adhesion	actin binding				0						gaaggaagcaagggagggagggagggag	0.000													4	3	---	---	---	---	
FLJ39653	202020	broad.mit.edu	37	4	16255017	16255017	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16255017delT	uc011bxf.1	+						FLJ39653_uc011bxg.1_Intron	NR_027696				RecName: Full=Uncharacterized protein FLJ39653;												0						atttcagggcttttttcatgc	0.000													4	2	---	---	---	---	
ZCCHC4	29063	broad.mit.edu	37	4	25349408	25349408	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25349408delA	uc003grl.3	+						ZCCHC4_uc003grm.1_Intron|ZCCHC4_uc003grn.3_Intron	NM_024936	NP_079212	Q9H5U6	ZCHC4_HUMAN	zinc finger, CCHC domain containing 4								methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(2)	2		Breast(46;0.0503)				TAGAGTCTTTAAAAAAATGTC	0.373													4	2	---	---	---	---	
TMEM156	80008	broad.mit.edu	37	4	38971753	38971754	+	Intron	DEL	TG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38971753_38971754delTG	uc003gto.2	-						TMEM156_uc010ifj.2_Intron	NM_024943	NP_079219	Q8N614	TM156_HUMAN	transmembrane protein 156							integral to membrane				skin(1)	1						cctcacacactgtgtgtgtgtg	0.094													4	3	---	---	---	---	
RBM47	54502	broad.mit.edu	37	4	40505208	40505209	+	Intron	DEL	TG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40505208_40505209delTG	uc003gvc.2	-						RBM47_uc003gvd.2_Intron|RBM47_uc003gve.2_Intron|RBM47_uc011bys.1_Intron|RBM47_uc003gvg.1_Intron	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a							nucleus	nucleotide binding|RNA binding			breast(3)	3						AAAGAAAAACTGTCACAGGAGT	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49106699	49106703	+	IGR	DEL	TTCCT	-	-	rs62637454		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49106699_49106703delTTCCT								CWH43 (42606 upstream) : None (None downstream)																							ttgcattgcattcctttcctttcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49156869	49156873	+	IGR	DEL	ATTTT	-	-	rs147965782	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49156869_49156873delATTTT								CWH43 (92776 upstream) : None (None downstream)																							attccgttccattttattccattcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49213584	49213585	+	IGR	INS	-	A	A	rs141768505		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49213584_49213585insA								CWH43 (149491 upstream) : None (None downstream)																							gggacttgcttaaaaaaaagtc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49650945	49650946	+	IGR	INS	-	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49650945_49650946insG								CWH43 (586852 upstream) : None (None downstream)																							tggaatcatccgagcggaatgg	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	74374121	74374121	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74374121delA								AFM (4404 upstream) : RASSF6 (64741 downstream)																							CTTCCACTCTAGGTAAGAGAA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	89510246	89510247	+	IGR	INS	-	GT	GT	rs147850626	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89510246_89510247insGT								PIGY (65291 upstream) : HERC3 (3400 downstream)																							cgcgtgtgtgcgtgtgtgtgtg	0.020													4	2	---	---	---	---	
GRID2	2895	broad.mit.edu	37	4	94436284	94436284	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94436284delT	uc011cdt.1	+						GRID2_uc011cdu.1_Intron	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	ACATATTGCCTTTTTTTTTCT	0.313													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	97913570	97913571	+	IGR	DEL	AC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97913570_97913571delAC								None (None upstream) : C4orf37 (566463 downstream)																							acacacacaaacacacacacac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	121288936	121288937	+	IGR	INS	-	GAA	GAA	rs146373610	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121288936_121288937insGAA								MAD2L1 (300923 upstream) : PRDM5 (326993 downstream)																							aagaagaagatgaagaagaaga	0.163													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	132594580	132594580	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:132594580delG								None (None upstream) : None (None downstream)																							CATTTCTAATGCAAATTTCTT	0.279													4	2	---	---	---	---	
OTUD4	54726	broad.mit.edu	37	4	146058557	146058557	+	3'UTR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146058557delT	uc003ika.3	-	21					OTUD4_uc003ijz.3_3'UTR	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3								protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					AGAGTTTCTGTTAGAAAATAC	0.458													11	50	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	150363469	150363469	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150363469delA	uc003ill.2	-											Homo sapiens cDNA clone IMAGE:5295442.																		gatggattggaattttccaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	189704197	189704197	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189704197delA								TRIML1 (635548 upstream) : None (None downstream)																							AGGCTTAGGTAGAAACCTCTC	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190558532	190558532	+	IGR	DEL	G	-	-	rs70944399		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190558532delG								None (None upstream) : FRG1 (303442 downstream)																							aaggaaggaaggaaggaatca	0.095													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190808280	190808280	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190808280delC	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		GAAAGGCAGGCTTAGCCAAGT	0.413													4	3	---	---	---	---	
SLC9A3	6550	broad.mit.edu	37	5	482151	482152	+	Intron	INS	-	CC	CC	rs11385633		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:482151_482152insCC	uc003jbe.2	-						SLC9A3_uc011clx.1_Intron	NM_004174	NP_004165	P48764	SL9A3_HUMAN	solute carrier family 9 (sodium/hydrogen							cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			AACACGCAGTGCCCCCCCCCCG	0.708													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1191354	1191354	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1191354delA								SLC12A7 (79182 upstream) : SLC6A19 (10356 downstream)																							ACATGTCATgaggggaggaaa	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2094852	2094856	+	IGR	DEL	GGCCA	-	-	rs144215363		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2094852_2094856delGGCCA								IRX4 (211972 upstream) : IRX2 (651425 downstream)																							GGGAGGAGGCGGCCAGGCCAGCCCT	0.590													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3701098	3701100	+	IGR	DEL	CTT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3701098_3701100delCTT								IRX1 (99582 upstream) : None (None downstream)																							cctcctcctccttcttttcttct	0.000													5	3	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5158609	5158610	+	Intron	INS	-	CTCCC	CTCCC	rs140702879	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5158609_5158610insCTCCC	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron|ADAMTS16_uc003jdj.1_Intron	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						GGAAGCATACACTCCCCAATCA	0.485													4	2	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5232302	5232302	+	Intron	DEL	A	-	-	rs10713189		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5232302delA	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron|ADAMTS16_uc010itk.1_5'Flank	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						TTGGGTAAGGAAAAAAAAAAC	0.363													3	3	---	---	---	---	
LOC255167	255167	broad.mit.edu	37	5	6584836	6584836	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6584836delA	uc003jdq.2	+						LOC255167_uc003jdr.2_Intron	NR_024423				Homo sapiens cDNA FLJ43293 fis, clone MESAN2017373.												0						CGGGATGATGAAAAAAAAAAA	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6682077	6682078	+	IGR	DEL	GT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6682077_6682078delGT								SRD5A1 (12404 upstream) : PAPD7 (32640 downstream)																							agtgtgtatcgtgtgtgtgtgt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8584391	8584392	+	IGR	DEL	CG	-	-	rs141929973		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8584391_8584392delCG								MTRR (683158 upstream) : SEMA5A (450746 downstream)																							cacacacacacgcacacacaca	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	9571109	9571109	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9571109delG								SNORD123 (22083 upstream) : TAS2R1 (58000 downstream)																							GAGCGCGAGAGGGAATTGTCT	0.443													4	2	---	---	---	---	
ANKH	56172	broad.mit.edu	37	5	14796585	14796585	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14796585delC	uc003jfm.3	-							NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein						locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						CACACACCAACAAAAAAAAAA	0.328													4	2	---	---	---	---	
ANKH	56172	broad.mit.edu	37	5	14870158	14870159	+	Intron	INS	-	GAA	GAA	rs150942593	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14870158_14870159insGAA	uc003jfm.3	-							NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein						locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						GGTGGAGCAGGGAAGAAGCCCT	0.490													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	15029483	15029484	+	IGR	DEL	TG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15029483_15029484delTG								ANKH (157596 upstream) : FBXL7 (470821 downstream)																							tgtgtgtgtatgtgtgtgtgtg	0.129													4	2	---	---	---	---	
CDH12	1010	broad.mit.edu	37	5	22318992	22318992	+	Intron	DEL	A	-	-	rs75068712		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22318992delA	uc003jgk.2	-							NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						CTGGTAGGGGAAAAAAAAACA	0.328										HNSCC(59;0.17)			4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	23305427	23305428	+	IGR	INS	-	C	C	rs146936553	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23305427_23305428insC								CDH12 (451696 upstream) : PRDM9 (202296 downstream)																							CTGTGCAGCCGCCCCCCCCGGT	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	23370332	23370333	+	IGR	DEL	TG	-	-	rs72015611		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23370332_23370333delTG								CDH12 (516601 upstream) : PRDM9 (137391 downstream)																							CCCTCATAGTtgtgtgtgtgtg	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	27703591	27703592	+	IGR	INS	-	GAGG	GAGG	rs146127349	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27703591_27703592insGAGG								CDH9 (664902 upstream) : None (None downstream)																							gcgagagaaatgagggagggag	0.228													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	30007295	30007297	+	IGR	DEL	AAT	-	-	rs151029071		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30007295_30007297delAAT								None (None upstream) : None (None downstream)																							gctttgcaacaatgagacattgt	0.094													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	31104675	31104676	+	IGR	INS	-	AG	AG	rs139940764	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31104675_31104676insAG								None (None upstream) : CDH6 (89120 downstream)																							AACAAAAGAAAAGAGAGAGAGA	0.351													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	39611074	39611074	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39611074delT								DAB2 (185739 upstream) : None (None downstream)																							cctccttcccttccttccttc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	40026291	40026292	+	IGR	INS	-	G	G	rs112887415	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40026291_40026292insG								DAB2 (600956 upstream) : PTGER4 (653740 downstream)																							GTTAGttgtttttttttttttt	0.307													3	5	---	---	---	---	
C6	729	broad.mit.edu	37	5	41259388	41259389	+	Intron	INS	-	A	A	rs146373035	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41259388_41259389insA	uc003jml.1	-							NM_001115131	NP_001108603	P13671	CO6_HUMAN	complement component 6 precursor						complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				AAACAAAGAGTAAAAATAGCTG	0.277													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44015999	44015999	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44015999delA								NNT (310332 upstream) : FGF10 (289098 downstream)																							ctaacatcataatgacagggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44711970	44711971	+	IGR	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44711970_44711971insA								FGF10 (323186 upstream) : MRPS30 (97056 downstream)																							gaagtatacagaaaaaaaaaaa	0.054													4	2	---	---	---	---	
ARL15	54622	broad.mit.edu	37	5	53300942	53300942	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53300942delA	uc003jpg.1	-						ARL15_uc010ivs.1_Intron	NM_019087	NP_061960	Q9NXU5	ARL15_HUMAN	ADP-ribosylation factor-like 15								GTP binding			ovary(1)	1		Lung NSC(810;0.000779)				tcagcctcccaaagtactagg	0.025													4	2	---	---	---	---	
ARL15	54622	broad.mit.edu	37	5	53310355	53310356	+	Intron	INS	-	T	T	rs71598891		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53310355_53310356insT	uc003jpg.1	-						ARL15_uc010ivs.1_Intron	NM_019087	NP_061960	Q9NXU5	ARL15_HUMAN	ADP-ribosylation factor-like 15								GTP binding			ovary(1)	1		Lung NSC(810;0.000779)				agtccccattcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	55677376	55677377	+	IGR	INS	-	AATT	AATT	rs150539356	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55677376_55677377insAATT								ANKRD55 (148190 upstream) : MAP3K1 (433523 downstream)																							ataaaatgctcaaaaccagaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	61501278	61501278	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61501278delC								FLJ37543 (498916 upstream) : KIF2A (100711 downstream)																							GAGCCTGCCTCACCTTTTTGG	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	77276174	77276175	+	IGR	DEL	GT	-	-	rs150555530		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77276174_77276175delGT								TBCA (203989 upstream) : AP3B1 (21976 downstream)																							ccctctctGAgtgtgtgtgtgt	0.267													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	82294086	82294086	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82294086delA								ATP6AP1L (679940 upstream) : TMEM167A (54581 downstream)																							ggagaaggggaaaagccagat	0.000													4	2	---	---	---	---	
FBXL17	64839	broad.mit.edu	37	5	107407331	107407332	+	Intron	DEL	CT	-	-	rs147262931		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107407331_107407332delCT	uc011cvc.1	-						FBXL17_uc003kon.3_Intron	NM_001163315	NP_001156787	Q9UF56	FXL17_HUMAN	F-box and leucine-rich repeat protein 17												0		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)		ttcttttcccctctcttagtct	0.183													1	11	---	---	---	---	
REEP5	7905	broad.mit.edu	37	5	112238435	112238435	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112238435delA	uc003kqe.1	-						REEP5_uc011cvw.1_Intron|REEP5_uc011cvx.1_Intron|REEP5_uc011cvy.1_Intron|REEP5_uc011cvz.1_Intron	NM_005669	NP_005660	Q00765	REEP5_HUMAN	receptor accessory protein 5							integral to membrane	protein binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		GTCACCAGAGAAACCAGCACC	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	113409991	113409994	+	IGR	DEL	GTGT	-	-	rs72233806		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113409991_113409994delGTGT								YTHDC2 (479012 upstream) : KCNN2 (288022 downstream)																							CCAtgtttgcgtgtgtgtgtgtgt	0.319													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	115113521	115113521	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115113521delT								TMED7-TICAM2 (151651 upstream) : CDO1 (26911 downstream)																							tttctttctctttttcctttt	0.104													4	2	---	---	---	---	
FBN2	2201	broad.mit.edu	37	5	127707202	127707203	+	Intron	INS	-	TCCT	TCCT	rs12518130	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127707202_127707203insTCCT	uc003kuu.2	-						FBN2_uc003kuv.2_Intron	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ccctccctccatccttccttcc	0.005													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	132125584	132125585	+	IGR	INS	-	T	T	rs10588403		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132125584_132125585insT								SEPT8 (12023 upstream) : ANKRD43 (23448 downstream)																							GCtttgtcctcttttttttttt	0.257													4	3	---	---	---	---	
KDM3B	51780	broad.mit.edu	37	5	137739367	137739367	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137739367delA	uc003lcy.1	+						KDM3B_uc010jew.1_Intron|KDM3B_uc011cys.1_Intron	NM_016604	NP_057688	Q7LBC6	KDM3B_HUMAN	jumonji domain containing 1B						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11						actctgtctcaaaaaaaaaaa	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	138061814	138061815	+	IGR	INS	-	T	T	rs80300678		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138061814_138061815insT								HSPA9 (150699 upstream) : CTNNA1 (27292 downstream)																							ACCTACCTCCATTTTTTTTTTT	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141296822	141296822	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141296822delA								PCDH1 (38878 upstream) : KIAA0141 (6563 downstream)																							CTAATATTTGAAGTAAGAGTC	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	142137009	142137010	+	IGR	DEL	GT	-	-	rs140893047		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142137009_142137010delGT								FGF1 (59374 upstream) : ARHGAP26 (13282 downstream)																							aacagggtgagtgtgtgtgtgt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	149023328	149023329	+	IGR	DEL	GA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149023328_149023329delGA								ARHGEF37 (8801 upstream) : PPARGC1B (86535 downstream)																							GAGTGTCagggagagagagaga	0.248													4	2	---	---	---	---	
PDGFRB	5159	broad.mit.edu	37	5	149521511	149521512	+	Intron	DEL	GA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149521511_149521512delGA	uc003lro.2	-						PDGFRB_uc010jhd.2_Intron	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta						aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCAGTGAGATGAGAGAGAGAGG	0.599			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	152184135	152184136	+	Intron	INS	-	AT	AT	rs144394766	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152184135_152184136insAT	uc003lux.1	-											Homo sapiens cDNA FLJ35529 fis, clone SPLEN2001912.																		GCCCTATTACAATGTCCTTTTC	0.381													0	9	---	---	---	---	
GRIA1	2890	broad.mit.edu	37	5	153166320	153166320	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153166320delG	uc003lva.3	+						GRIA1_uc003luy.3_Intron|GRIA1_uc003luz.3_Intron|GRIA1_uc011dcv.1_Intron|GRIA1_uc011dcw.1_Intron|GRIA1_uc011dcx.1_Intron|GRIA1_uc011dcy.1_Intron|GRIA1_uc011dcz.1_Intron	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform						synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GCAGATTCAAGGAAAACATGG	0.453													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	154997008	154997009	+	IGR	DEL	TG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154997008_154997009delTG								KIF4B (599323 upstream) : SGCD (138054 downstream)																							CAtatgtatatgtgtgtgtgtg	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	157040917	157040917	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157040917delC								ADAM19 (38149 upstream) : SOX30 (11770 downstream)																							GAGAACACGGCCACAAGTAGA	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	159094109	159094109	+	IGR	DEL	T	-	-	rs67528378		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159094109delT								LOC285627 (200825 upstream) : ADRA1B (249631 downstream)																							tgttcatgtgttatgcgtgta	0.194													2	5	---	---	---	---	
ATP10B	23120	broad.mit.edu	37	5	160036389	160036389	+	Intron	DEL	T	-	-	rs11341335		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160036389delT	uc003lym.1	-						ATP10B_uc010jit.1_Intron	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCATAACTTAttttttttttt	0.095													5	3	---	---	---	---	
UBTD2	92181	broad.mit.edu	37	5	171683390	171683391	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171683390_171683391insT	uc003mbp.1	-							NM_152277	NP_689490	Q8WUN7	UBTD2_HUMAN	dendritic cell-derived ubiquitin-like protein							cytoplasm					0	Renal(175;0.000159)|Lung NSC(126;0.00976)|all_lung(126;0.0156)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTTCCTTATACttttttttttt	0.183													4	2	---	---	---	---	
ADAMTS2	9509	broad.mit.edu	37	5	178745342	178745342	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178745342delA	uc003mjw.2	-						ADAMTS2_uc011dgm.1_Intron	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		AGCCCTCATTAAAAAGGCATG	0.557													4	2	---	---	---	---	
FLT4	2324	broad.mit.edu	37	5	180078350	180078350	+	5'Flank	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180078350delT	uc003mma.3	-						FLT4_uc003mlz.3_5'Flank|FLT4_uc011dgy.1_5'Flank|FLT4_uc011dgz.1_5'Flank|FLT4_uc011dha.1_5'Flank	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	AATATACttgttttttttttg	0.015									Congenital_Hereditary_Lymphedema				4	2	---	---	---	---	
DUSP22	56940	broad.mit.edu	37	6	343455	343455	+	Intron	DEL	C	-	-	rs143874919		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:343455delC	uc003msx.2	+						DUSP22_uc011dhn.1_Intron|DUSP22_uc003msy.1_Intron	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22						apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		GCTGCTGTGGCCCCCCAAGGG	0.612													5	3	---	---	---	---	
EXOC2	55770	broad.mit.edu	37	6	689290	689290	+	Intron	DEL	T	-	-	rs36084318		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:689290delT	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		ATTTTTAATCTGAAATGCTAC	0.323													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	1544679	1544680	+	IGR	DEL	AC	-	-	rs13195764		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1544679_1544680delAC								FOXF2 (148848 upstream) : FOXC1 (66001 downstream)																							agagagagagacaaatagagaA	0.035													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	2545894	2545895	+	IGR	INS	-	C	C	rs147876085	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2545894_2545895insC								GMDS (300048 upstream) : C6orf195 (77077 downstream)																							TTTTTTTTTTTCCTCTTGATCA	0.351													3	6	---	---	---	---	
C6orf195	154386	broad.mit.edu	37	6	2627171	2627172	+	Intron	INS	-	T	T	rs139650687	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2627171_2627172insT	uc003mtw.2	-							NM_152554	NP_689767	Q96MT4	CF195_HUMAN	hypothetical protein LOC154386												0	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				TGATTGTTTGGTTTTTTTTTGA	0.203													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	3791509	3791509	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3791509delT								C6orf145 (39263 upstream) : FAM50B (58123 downstream)																							taatacctcattgagaagtgt	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	6727416	6727416	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6727416delT	uc003mxa.2	+											Homo sapiens, clone IMAGE:5189615, mRNA.																		tatcacatccttttttccctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	6918331	6918331	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6918331delG								LY86 (263115 upstream) : RREB1 (189857 downstream)																							AAGTACACATGGGCTTGGGGG	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	7262188	7262189	+	IGR	INS	-	ATCACTGT	ATCACTGT	rs147763118	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7262188_7262189insATCACTGT								RREB1 (10496 upstream) : SSR1 (19101 downstream)																							GCACATATCTGATCACTGTTCC	0.569													3	3	---	---	---	---	
DSP	1832	broad.mit.edu	37	6	7551863	7551863	+	Intron	DEL	A	-	-	rs5874101		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7551863delA	uc003mxp.1	+						DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I						cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		actccttctcaaaaaaaaaaa	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	7673916	7673916	+	IGR	DEL	C	-	-	rs34175652		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7673916delC								SNRNP48 (61717 upstream) : BMP6 (53095 downstream)																							GAGTGCATTACTGATATGCTC	0.398													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	7691637	7691638	+	IGR	INS	-	T	T	rs143257086		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7691637_7691638insT								SNRNP48 (79438 upstream) : BMP6 (35373 downstream)																							ccttctttgaattttttttttt	0.079													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8840042	8840043	+	IGR	INS	-	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8840042_8840043insG								HULC (185965 upstream) : None (None downstream)																							ATCAACATTCAGGGGAAATACA	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	9594922	9594923	+	IGR	DEL	TG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9594922_9594923delTG								HULC (940845 upstream) : TFAP2A (801994 downstream)																							tgtgcgtgcatgtgtgtgtgtg	0.094													4	2	---	---	---	---	
C6orf105	84830	broad.mit.edu	37	6	11777166	11777166	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11777166delT	uc003nab.2	-						C6orf105_uc011dip.1_Intron	NM_032744	NP_116133	Q96IZ2	CF105_HUMAN	hypothetical protein LOC84830 isoform 2							integral to membrane					0	Ovarian(93;0.0848)|Breast(50;0.0871)	all_hematologic(90;0.135)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.193)			AAACCAGTGCTTTGAGAAGAT	0.448													4	2	---	---	---	---	
RANBP9	10048	broad.mit.edu	37	6	13640911	13640911	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13640911delT	uc003nbb.2	-						RANBP9_uc003nba.2_Intron	NM_005493	NP_005484	Q96S59	RANB9_HUMAN	RAN binding protein 9						axon guidance|microtubule nucleation|protein complex assembly	cytosol|microtubule associated complex|nucleus	Ran GTPase binding			lung(1)|skin(1)	2	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			ctgattctacttatatgggta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	15147015	15147015	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15147015delT								None (None upstream) : JARID2 (98719 downstream)																							TGGAGTCCTAttttttttttt	0.224													5	3	---	---	---	---	
ATXN1	6310	broad.mit.edu	37	6	16571891	16571892	+	Intron	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16571891_16571892insA	uc003nbt.2	-						ATXN1_uc010jpi.2_Intron|ATXN1_uc010jpj.1_Intron|ATXN1_uc003nbu.1_Intron	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1						cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				ctcagcTAATTAAAAAAAAAAA	0.005													4	2	---	---	---	---	
FAM8A1	51439	broad.mit.edu	37	6	17609624	17609627	+	3'UTR	DEL	ATTA	-	-	rs35564453		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17609624_17609627delATTA	uc003ncc.2	+	5						NM_016255	NP_057339	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1							integral to membrane					0	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			TCTAAGTACTATTAATTAATAGCT	0.294													3	6	---	---	---	---	
NUP153	9972	broad.mit.edu	37	6	17656383	17656383	+	Intron	DEL	C	-	-	rs34394855		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17656383delC	uc003ncd.1	-						NUP153_uc011dje.1_Intron|NUP153_uc010jpl.1_Intron	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa						carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			ttgcagtgagccaagattgcg	0.095													2	4	---	---	---	---	
CDKAL1	54901	broad.mit.edu	37	6	20825357	20825358	+	Intron	INS	-	T	T	rs146110386	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20825357_20825358insT	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			ATCTTTAACTCTTCCCTTACAT	0.411													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	21486193	21486194	+	IGR	INS	-	GT	GT	rs138659445	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21486193_21486194insGT								CDKAL1 (253561 upstream) : SOX4 (107778 downstream)																							TGATCTTCTCCgtgtgtgtgtg	0.173													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	24056076	24056077	+	IGR	INS	-	TGAA	TGAA	rs146058150	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24056076_24056077insTGAA								None (None upstream) : NRSN1 (70337 downstream)																							CAAGAAAATAGTTCAGATCATT	0.426													3	3	---	---	---	---	
CMAH	8418	broad.mit.edu	37	6	25085313	25085313	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25085313delA	uc003nes.3	-						CMAH_uc003ner.3_Intron					SubName: Full=CMP-N-acetylneuraminic acid hydroxylase;												0						gaaaagttagaaatgacttac	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	25733107	25733108	+	IGR	INS	-	AAACAA	AAACAA	rs147896608	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25733107_25733108insAAACAA								HIST1H2BA (5535 upstream) : SLC17A4 (21819 downstream)																							ATGTCTAGAAGaaacaaaaaca	0.366													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	27669734	27669735	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27669734_27669735insT	uc003njk.2	+											Homo sapiens cDNA clone IMAGE:5262055.																		ttctgcttgggttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	28700747	28700747	+	IGR	DEL	A	-	-	rs140985883		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28700747delA								SCAND3 (145635 upstream) : TRIM27 (170033 downstream)																							CATCAGTTTCaaaaaaaaaaa	0.199													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	28755940	28755940	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28755940delG								SCAND3 (200828 upstream) : TRIM27 (114840 downstream)																							GTAGATAGTAGGGGGGAAATA	0.428													3	3	---	---	---	---	
MDC1	9656	broad.mit.edu	37	6	30677572	30677572	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30677572delA	uc003nrg.3	-						MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Intron	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1						cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						cacttaacataatgtcctcag	0.000								Other_conserved_DNA_damage_response_genes					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	30986732	30986733	+	IGR	INS	-	T	T	rs144058825	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30986732_30986733insT								MUC21 (29057 upstream) : HCG22 (35251 downstream)																							tattctccaacatactctccca	0.000													3	8	---	---	---	---	
HLA-B	3106	broad.mit.edu	37	6	31324369	31324370	+	Intron	DEL	AG	-	-	rs9279154		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31324369_31324370delAG	uc003nth.2	-						HLA-C_uc003ntb.2_5'Flank|HLA-C_uc003ntc.1_5'Flank|HLA-B_uc010jsm.1_5'Flank|HLA-B_uc011dnk.1_5'Flank|HLA-B_uc003ntf.2_Intron|HLA-B_uc003ntg.1_5'UTR|HLA-B_uc003nti.1_5'Flank|HLA-B_uc010jsn.1_5'Flank|HLA-B_uc010jso.2_Intron	NM_005514	NP_005505	P01889	1B07_HUMAN	major histocompatibility complex, class I, B						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0						CCGCGGCCTCAGGGAGGCGGAT	0.713									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				3	5	---	---	---	---	
PPARD	5467	broad.mit.edu	37	6	35386117	35386117	+	Intron	DEL	A	-	-	rs67211521		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35386117delA	uc003okm.2	+						PPARD_uc003okl.2_Intron|PPARD_uc003okn.2_Intron|PPARD_uc011dtb.1_Intron|PPARD_uc011dtc.1_Intron|PPARD_uc010jvv.1_Intron	NM_006238	NP_006229	Q03181	PPARD_HUMAN	peroxisome proliferative activated receptor,						apoptosis|axon ensheathment|cholesterol metabolic process|decidualization|embryo implantation|fatty acid beta-oxidation|fatty acid transport|generation of precursor metabolites and energy|glucose metabolic process|glucose transport|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fat cell differentiation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|linoleic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1					Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	TCCCTGTTATAAATGCCTCCA	0.547													1	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	36812999	36812999	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36812999delA	uc003omt.1	-											Homo sapiens cDNA FLJ38704 fis, clone KIDNE2002483, weakly similar to Homo sapiens copine I mRNA.																		TTCCCTTGATAAGAAACTCCA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	37000396	37000397	+	IGR	INS	-	T	T	rs146078867		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37000396_37000397insT								FGD2 (3551 upstream) : PIM1 (137525 downstream)																							ttctttctttcttttttttttt	0.000													4	2	---	---	---	---	
MDGA1	266727	broad.mit.edu	37	6	37623853	37623854	+	Intron	INS	-	T	T	rs35686779		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37623853_37623854insT	uc003onu.1	-							NM_153487	NP_705691	Q8NFP4	MDGA1_HUMAN	MAM domain containing						brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane				central_nervous_system(2)	2						GGACtttttccttttttttttt	0.248													1	5	---	---	---	---	
BTBD9	114781	broad.mit.edu	37	6	38220890	38220891	+	Intron	INS	-	AAC	AAC			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38220890_38220891insAAC	uc003ooa.3	-						BTBD9_uc003ony.3_Intron|BTBD9_uc010jwv.2_Intron|BTBD9_uc010jww.2_Intron|BTBD9_uc010jwx.2_Intron	NM_052893	NP_443125	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9 isoform a						cell adhesion						0						actctgtctcaaacaacaacaa	0.045													4	3	---	---	---	---	
KIF6	221458	broad.mit.edu	37	6	39569488	39569491	+	Intron	DEL	ACAC	-	-	rs149856634		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39569488_39569491delACAC	uc003oot.2	-						KIF6_uc010jxa.1_Intron|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						TTTCTTTGGGacacacacacacac	0.250													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	46055214	46055214	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46055214delT								CLIC5 (7129 upstream) : ENPP4 (42487 downstream)																							TCCCTGCCCCTACTGCTCTGC	0.507													4	2	---	---	---	---	
C6orf138	442213	broad.mit.edu	37	6	47980590	47980593	+	Intron	DEL	TGTT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47980590_47980593delTGTT	uc011dwm.1	-						C6orf138_uc011dwn.1_Intron|C6orf138_uc003ozf.2_Intron	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN	hypothetical protein LOC442213							integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1						tcattggttctgtttaagtgatgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	50318632	50318633	+	IGR	DEL	TG	-	-	rs138671685		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50318632_50318633delTG								DEFB112 (302268 upstream) : TFAP2D (362624 downstream)																							TTCCGTAAACtgtgtgtgtgtg	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	50379723	50379725	+	IGR	DEL	AAA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50379723_50379725delAAA								DEFB112 (363359 upstream) : TFAP2D (301532 downstream)																							GCTTTTAAGGAAAAAAAAAAAAA	0.330													4	2	---	---	---	---	
ICK	22858	broad.mit.edu	37	6	52909590	52909591	+	Intron	DEL	CA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52909590_52909591delCA	uc003pbh.2	-						ICK_uc003pbi.2_Intron|ICK_uc003pbj.2_Intron	NM_016513	NP_057597	Q9UPZ9	ICK_HUMAN	intestinal cell kinase						intracellular protein kinase cascade|multicellular organismal development	cytosol|nucleus	ATP binding|cyclin-dependent protein kinase activity|magnesium ion binding			ovary(1)|large_intestine(1)|lung(1)|kidney(1)|central_nervous_system(1)	5	Lung NSC(77;0.103)					acctctcccccacacaccctag	0.000													6	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57293417	57293418	+	Intron	INS	-	T	T	rs149853195	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57293417_57293418insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TAATATAATTGTTCTTTTGATG	0.272													3	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57397342	57397342	+	Intron	DEL	G	-	-	rs5876596		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57397342delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		tggaaaactagttagtaataa	0.000													3	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57432404	57432405	+	Intron	INS	-	TT	TT	rs147084165		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57432404_57432405insTT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttttgtttttgtttttttcagc	0.000													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57466685	57466686	+	Intron	INS	-	T	T	rs150786912		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57466685_57466686insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AGTAGAATGGGTAGATATGGGA	0.252													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57541207	57541208	+	IGR	INS	-	A	A	rs141618997		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57541207_57541208insA								PRIM2 (27832 upstream) : GUSBL2 (704951 downstream)																							AATCCAGTAGGAAAAAGCCTAA	0.342													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57543478	57543479	+	IGR	INS	-	AGG	AGG	rs143931327		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57543478_57543479insAGG								PRIM2 (30103 upstream) : GUSBL2 (702680 downstream)																							ggaattaaagaagaagagagaa	0.020													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58147860	58147861	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58147860_58147861insT								PRIM2 (634485 upstream) : GUSBL2 (98298 downstream)																							TTCGGAGCGTGTTTTTTTTTTC	0.446													4	2	---	---	---	---	
KHDRBS2	202559	broad.mit.edu	37	6	62758026	62758027	+	Intron	INS	-	ACAC	ACAC	rs112711589		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62758026_62758027insACAC	uc003peg.2	-							NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		GCCATAAacatacacacacaca	0.248													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	73271285	73271285	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73271285delT								RIMS1 (158778 upstream) : KCNQ5 (60286 downstream)																							tccacagtccttttaatatta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	82854685	82854686	+	IGR	INS	-	AC	AC	rs148989163	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82854685_82854686insAC								FAM46A (392257 upstream) : IBTK (25270 downstream)																							catacacacagacacacacaca	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	87821885	87821886	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87821885_87821886insT								CGA (17061 upstream) : ZNF292 (40665 downstream)																							tctttattcggtttttttgttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	88595372	88595373	+	Intron	INS	-	G	G	rs143233729	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88595372_88595373insG	uc003pmm.2	+											Homo sapiens mRNA sequence.																		TGTACAAGGAAGAAATCTATAA	0.307													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	98976774	98976774	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98976774delC								MIR2113 (504277 upstream) : POU3F2 (305806 downstream)																							TCTCCTTGCTCCCCACATTCC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	102989751	102989751	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102989751delG								GRIK2 (471794 upstream) : None (None downstream)																							ctttttttttggttctatatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	107472149	107472149	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107472149delG								BEND3 (36513 upstream) : PDSS2 (1612 downstream)																							TGCTGGTAAAGCTGGGGGAAG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	112952029	112952030	+	IGR	DEL	TT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112952029_112952030delTT								RFPL4B (279531 upstream) : None (None downstream)																							agtctaagtctttgtaggtcac	0.000													4	2	---	---	---	---	
RWDD1	51389	broad.mit.edu	37	6	116908835	116908836	+	Intron	INS	-	TG	TG	rs149843338	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116908835_116908836insTG	uc003pxd.2	+						RWDD1_uc003pxb.2_Intron|RWDD1_uc003pxc.2_Intron	NM_015952	NP_057036	Q9H446	RWDD1_HUMAN	RWD domain containing 1 isoform a								protein binding			ovary(2)|central_nervous_system(1)	3		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.0312)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)|Epithelial(106;0.161)		CTCtgtgtgtatgtgtgtgtgt	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	117544099	117544100	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117544099_117544100insT								RFX6 (290791 upstream) : VGLL2 (42621 downstream)																							tatacaccccattgacaagcat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	130317178	130317178	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130317178delG								C6orf191 (134762 upstream) : L3MBTL3 (22556 downstream)																							tagtagagatggggggggggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	133400729	133400729	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133400729delT								RPS12 (262027 upstream) : LOC285735 (8490 downstream)																							TAGACATTGGTTTTAAAAGGG	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	135432588	135432588	+	IGR	DEL	A	-	-	rs76390193		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135432588delA								HBS1L (56552 upstream) : MYB (69865 downstream)																							aattgagaagaaaaaaaaaaa	0.080													4	2	---	---	---	---	
PHACTR2	9749	broad.mit.edu	37	6	144128096	144128096	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144128096delA	uc003qjq.3	+						PHACTR2_uc010khh.2_Intron|PHACTR2_uc010khi.2_Intron|PHACTR2_uc003qjr.3_Intron	NM_014721	NP_055536	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2 isoform 3								actin binding|protein phosphatase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		tctatctcttaaaaaaaaaaa	0.149													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	147893119	147893119	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147893119delT								SAMD5 (1962 upstream) : SASH1 (770610 downstream)																							TAATTTCAACTTTTTTTTTTT	0.338													3	3	---	---	---	---	
RAET1E	135250	broad.mit.edu	37	6	150209849	150209850	+	Intron	INS	-	A	A	rs11316635		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150209849_150209850insA	uc003qnl.1	-						uc003qni.1_Intron|RAET1E_uc003qnj.2_Intron|RAET1E_uc003qnk.1_Intron|RAET1E_uc010kih.1_Intron	NM_139165	NP_631904	Q8TD07	N2DL4_HUMAN	retinoic acid early transcript 1E precursor						antigen processing and presentation|immune response|regulation of immune response	integral to membrane|MHC class I protein complex	protein binding				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		CCCTGTCACATAAAAAAAAAAA	0.342													8	4	---	---	---	---	
IPCEF1	26034	broad.mit.edu	37	6	154589889	154589889	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154589889delT	uc003qpx.2	-						IPCEF1_uc003qpw.2_Intron|IPCEF1_uc010kjh.2_Intron	NM_015553	NP_056368	Q8WWN9	ICEF1_HUMAN	phosphoinositide-binding protein PIP3-E isoform						response to oxidative stress	cytoplasm|plasma membrane	oxygen transporter activity|peroxidase activity				0						actcattgtcttttttttttt	0.000													4	2	---	---	---	---	
ARID1B	57492	broad.mit.edu	37	6	157291186	157291186	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157291186delT	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron|ARID1B_uc003qqq.1_Intron	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TTTGACtttgttttttttgtg	0.119													1	5	---	---	---	---	
AGPAT4	56895	broad.mit.edu	37	6	161693738	161693741	+	Intron	DEL	ACAC	-	-	rs67731450		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161693738_161693741delACAC	uc003qtr.1	-						AGPAT4_uc003qts.1_Intron|AGPAT4_uc011egb.1_Intron|AGPAT4_uc011egc.1_Intron|AGPAT4_uc011egd.1_Intron|AGPAT4_uc011ege.1_Intron	NM_020133	NP_064518	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4						phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity|protein binding				0		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		ATTTCCCTAAacacacacacacac	0.343													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	166655247	166655247	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166655247delG								T (73116 upstream) : PRR18 (63921 downstream)																							TTACAAAACTGGCAGTGGGTT	0.517													2	4	---	---	---	---	
THBS2	7058	broad.mit.edu	37	6	169636235	169636238	+	Intron	DEL	CACT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169636235_169636238delCACT	uc003qwt.2	-							NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor						cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		ACACCATCCACACTCACTCCCCAT	0.270													4	2	---	---	---	---	
THBS2	7058	broad.mit.edu	37	6	169643156	169643156	+	Intron	DEL	C	-	-	rs112849189		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169643156delC	uc003qwt.2	-							NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor						cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		caccttcccaccactcccacc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	169715157	169715158	+	IGR	INS	-	AC	AC	rs148385875	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169715157_169715158insAC								THBS2 (61020 upstream) : WDR27 (142149 downstream)																							cacacttatttacacacacaca	0.074													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	175000	175000	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:175000delT								None (None upstream) : FAM20C (17969 downstream)																							AGTTTCTGCCTTTTTTTTTTT	0.443													4	2	---	---	---	---	
MAD1L1	8379	broad.mit.edu	37	7	2090054	2090054	+	Intron	DEL	G	-	-	rs112473368		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2090054delG	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		GGCTGAGGGTGGTGAGCCAGG	0.637													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	2890276	2890281	+	IGR	DEL	ATCACC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2890276_2890281delATCACC								GNA12 (6317 upstream) : CARD11 (55488 downstream)																							caccatcattatcaccatcaccatca	0.000													4	2	---	---	---	---	
SDK1	221935	broad.mit.edu	37	7	4194499	4194499	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4194499delG	uc003smx.2	+						SDK1_uc010kso.2_Intron|SDK1_uc003smy.2_Intron	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GGTTACAGGAGGGTGTTCTTG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	4451120	4451120	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4451120delT								SDK1 (142491 upstream) : FOXK1 (232268 downstream)																							ctgtatcaccttttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	5161859	5161859	+	Intron	DEL	A	-	-	rs11289360		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5161859delA	uc003snu.1	-						uc010ksu.1_Intron|uc011jwf.1_Intron					SubName: Full=cDNA FLJ60262, weakly similar to Zinc finger protein 81;																		CTTCTTCTAGAAAAAAAAAAA	0.279													4	4	---	---	---	---	
GLCCI1	113263	broad.mit.edu	37	7	8092444	8092444	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8092444delT	uc003srk.2	+							NM_138426	NP_612435	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1												0		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		GCTCCTTCTCTTTTTTTCTTC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	17327543	17327544	+	IGR	INS	-	AC	AC	rs141048067	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17327543_17327544insAC								AGR3 (405930 upstream) : AHR (10732 downstream)																							TCTTAGGAGATacacacacaca	0.287													6	3	---	---	---	---	
HDAC9	9734	broad.mit.edu	37	7	18307609	18307610	+	Intron	INS	-	AT	AT	rs148795458	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18307609_18307610insAT	uc011jya.1	+							NM_014707	NP_055522	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 3						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	TCTTTCTTTACATAGTACTTGA	0.312													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	19916985	19916985	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19916985delC								TMEM196 (103769 upstream) : MACC1 (257303 downstream)																							cccgcacttacccccaaagac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	20289591	20289592	+	IGR	DEL	TC	-	-	rs78126826		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20289591_20289592delTC								MACC1 (32578 upstream) : ITGB8 (80733 downstream)																							AGGAAATTGTTCTGTTTATAAT	0.386													4	4	---	---	---	---	
ITGB8	3696	broad.mit.edu	37	7	20444100	20444101	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20444100_20444101insT	uc003suu.2	+						ITGB8_uc011jyh.1_Intron	NM_002214	NP_002205	P26012	ITB8_HUMAN	integrin, beta 8 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(3)	3						ATCCAGCACTGTTTGTGTCAGA	0.450													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	24481470	24481470	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24481470delG								NPY (149993 upstream) : MPP6 (131615 downstream)																							CAGCTTCTCCGCCCGCCCTTC	0.358													4	2	---	---	---	---	
OSBPL3	26031	broad.mit.edu	37	7	24867961	24867961	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24867961delG	uc003sxf.2	-						OSBPL3_uc003sxd.2_Intron|OSBPL3_uc003sxe.2_Intron|OSBPL3_uc003sxg.2_Intron|OSBPL3_uc003sxh.2_Intron|OSBPL3_uc003sxi.2_Intron	NM_015550	NP_056365	Q9H4L5	OSBL3_HUMAN	oxysterol-binding protein-like protein 3 isoform						lipid transport		lipid binding|protein binding			skin(1)	1						caggcgtggtggttcatgcct	0.050													4	2	---	---	---	---	
HNRNPA2B1	3181	broad.mit.edu	37	7	26237495	26237495	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26237495delA	uc003sxr.3	-						HNRNPA2B1_uc003sxs.3_Intron	NM_031243	NP_112533	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1						RNA transport	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|protein binding|protein binding|RNA binding|single-stranded telomeric DNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3						TTCTGGGGGGAAAAAAAAAAC	0.343			T	ETV1	prostate								8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	27325729	27325729	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27325729delG								EVX1 (39537 upstream) : HIBADH (239334 downstream)																							tagtgagttaggagatgggca	0.000													4	2	---	---	---	---	
CHN2	1124	broad.mit.edu	37	7	29217176	29217177	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29217176_29217177insT	uc011jzs.1	+						CPVL_uc003szx.2_Intron	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						ggccCCCTCACTTTTTTTTTTT	0.129													4	2	---	---	---	---	
AQP1	358	broad.mit.edu	37	7	30937709	30937709	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30937709delT	uc011kac.1	+							NM_198098	NP_932766	P29972	AQP1_HUMAN	aquaporin 1						ammonium transport|cell volume homeostasis|cellular hyperosmotic response|cellular response to cAMP|cellular response to copper ion|cellular response to dexamethasone stimulus|cellular response to hydrogen peroxide|cellular response to hypoxia|cellular response to mechanical stimulus|cellular response to mercury ion|cellular response to nitric oxide|cellular response to retinoic acid|cellular response to salt stress|cellular response to UV|cerebrospinal fluid secretion|cGMP biosynthetic process|establishment or maintenance of actin cytoskeleton polarity|lateral ventricle development|maintenance of symbiont-containing vacuole via substance secreted by host|negative regulation of apoptosis|odontogenesis|pancreatic juice secretion|positive regulation of angiogenesis|positive regulation of fibroblast proliferation|positive regulation of saliva secretion|renal water transport|response to drug|transepithelial water transport	apical plasma membrane|basal plasma membrane|brush border membrane|cytoplasm|integral to plasma membrane|nuclear membrane|sarcolemma|symbiont-containing vacuole	ammonia transmembrane transporter activity|carbon dioxide transmembrane transporter activity|glycerol transmembrane transporter activity|intracellular cGMP activated cation channel activity|nitric oxide transmembrane transporter activity|potassium channel activity|potassium ion transmembrane transporter activity|protein binding|water channel activity				0		Melanoma(862;0.16)			Acetazolamide(DB00819)	GAGAGCCTGCttttttttttt	0.269													4	2	---	---	---	---	
DPY19L1	23333	broad.mit.edu	37	7	35072900	35072900	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35072900delT	uc003tem.3	-							NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1							integral to membrane					0						gggtatttccttttttttcta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	37510642	37510643	+	IGR	INS	-	ATA	ATA	rs74456953		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37510642_37510643insATA								ELMO1 (22112 upstream) : GPR141 (269353 downstream)																							TAAGCGTTGTCATGACTGTGCA	0.460													4	2	---	---	---	---	
TXNDC3	51314	broad.mit.edu	37	7	37887472	37887472	+	5'Flank	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37887472delA	uc003tfn.2	+							NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3						cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						gaggaagaagaagaaagaaga	0.000									Kartagener_syndrome				4	2	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38626613	38626614	+	Intron	DEL	AC	-	-	rs113399829		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38626613_38626614delAC	uc003tgu.2	-						AMPH_uc003tgv.2_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						TTGTGTAAATacacacacacac	0.198													1	5	---	---	---	---	
HECW1	23072	broad.mit.edu	37	7	43277989	43277989	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43277989delA	uc003tid.1	+						HECW1_uc011kbi.1_Intron|HECW1_uc003tie.1_Intron	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						TGGTGCTCAGAAATTGGAGTC	0.537													1	5	---	---	---	---	
TNS3	64759	broad.mit.edu	37	7	47532587	47532587	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47532587delG	uc003tnv.2	-						TNS3_uc003tnw.2_Intron|TNS3_uc010kyo.1_Intron	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3							focal adhesion	protein binding			ovary(4)	4						CCTGCTTCTTGGGGGTCTGTG	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	52391481	52391481	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52391481delT								None (None upstream) : POM121L12 (711868 downstream)																							tttcctcttcttttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56208190	56208191	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56208190_56208191insT								PSPH (24100 upstream) : DKFZp434L192 (355725 downstream)																							ACTGCATTTAAttttttttttt	0.163													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57731360	57731363	+	IGR	DEL	TTTA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57731360_57731363delTTTA								ZNF716 (198095 upstream) : None (None downstream)																							ttttaaagagtttatttaagcaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57738530	57738531	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57738530_57738531insT								ZNF716 (205265 upstream) : None (None downstream)																							AACAGTGATAATTTTTAATGAA	0.149													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57914934	57914935	+	IGR	DEL	CC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57914934_57914935delCC								ZNF716 (381669 upstream) : None (None downstream)																							acactaaaagccacaattctta	0.025													3	3	---	---	---	---	
TYW1	55253	broad.mit.edu	37	7	66646664	66646665	+	Intron	INS	-	T	T	rs150182047	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66646664_66646665insT	uc003tvn.2	+						TYW1_uc010lai.2_Intron|TYW1_uc011kef.1_Intron	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				cagcctgagtgttacctgggca	0.134													0	6	---	---	---	---	
POR	5447	broad.mit.edu	37	7	75603306	75603307	+	Intron	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75603306_75603307insA	uc003udy.2	+						POR_uc011kgb.1_Intron	NM_000941	NP_000932	P16435	NCPR_HUMAN	cytochrome P450 reductase						cellular organofluorine metabolic process|positive regulation of monooxygenase activity	endoplasmic reticulum membrane	iron ion binding|NADPH-hemoprotein reductase activity			central_nervous_system(1)	1					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Lipoic Acid(DB00166)|Menadione(DB00170)|Methoxyflurane(DB01028)|Mitomycin(DB00305)|Nilutamide(DB00665)	gaccttgctttaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	75778000	75778000	+	IGR	DEL	T	-	-	rs35120128		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75778000delT								MDH2 (82072 upstream) : SRRM3 (53216 downstream)																							cttcttcttcttttttttttt	0.219													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	86169485	86169485	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86169485delA								None (None upstream) : GRM3 (103745 downstream)																							cagaacaactagggatacaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	91253425	91253426	+	IGR	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91253425_91253426insA								FZD1 (355294 upstream) : MTERF (178034 downstream)																							gatcctccctcagcctcctggg	0.000													3	3	---	---	---	---	
FAM133B	257415	broad.mit.edu	37	7	92221684	92221684	+	5'Flank	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92221684delC	uc003umc.2	-						FAM133B_uc003umb.2_5'Flank|FAM133B_uc003umd.2_5'Flank	NM_152789	NP_690002	Q5BKY9	F133B_HUMAN	hypothetical protein LOC257415 isoform 1											ovary(1)	1	all_cancers(62;7.39e-11)|all_epithelial(64;7.03e-10)|Breast(17;0.00201)|all_lung(186;0.0384)|Lung NSC(181;0.053)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;9.78e-06)|all cancers(6;1.67e-05)|Epithelial(20;0.113)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TACATGCCCTCCCGAATGTTC	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	105695047	105695048	+	IGR	DEL	GT	-	-	rs112574969		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105695047_105695048delGT								CDHR3 (18171 upstream) : SYPL1 (35905 downstream)																							AATGCCCAGGgtgtgtgtgtgt	0.386													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	112004392	112004392	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112004392delC								ZNF277 (20403 upstream) : IFRD1 (58834 downstream)																							GCACATTTGTCCATTGCTctg	0.229													4	2	---	---	---	---	
C7orf60	154743	broad.mit.edu	37	7	112462479	112462479	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112462479delT	uc003vgo.1	-						C7orf60_uc011kms.1_Intron	NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN	hypothetical protein LOC154743											ovary(2)|skin(1)	3						TTATTTCCACTTTAGTACATA	0.313													18	8	---	---	---	---	
EXOC4	60412	broad.mit.edu	37	7	133547246	133547247	+	Intron	INS	-	A	A	rs141696187	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133547246_133547247insA	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN	SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)				aGGGGGCGGGGAAAAAAAAAGA	0.213													4	2	---	---	---	---	
CALD1	800	broad.mit.edu	37	7	134576462	134576462	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134576462delT	uc003vrz.2	+						CALD1_uc003vry.2_Intron|CALD1_uc003vsa.2_Intron|CALD1_uc003vsb.2_Intron|CALD1_uc010lmm.2_Intron|CALD1_uc011kpt.1_Intron|CALD1_uc003vsc.2_Intron|CALD1_uc003vsd.2_Intron	NM_033138	NP_149129	Q05682	CALD1_HUMAN	caldesmon 1 isoform 1						cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0						TTTTCCTTTCTTTTTTTTTTT	0.438													4	2	---	---	---	---	
DENND2A	27147	broad.mit.edu	37	7	140315333	140315333	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140315333delT	uc010lnk.2	-						DENND2A_uc003vvw.2_Intron|DENND2A_uc003vvx.2_Intron	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A											ovary(3)|breast(1)	4	Melanoma(164;0.00956)					GGAGTTCTGCttttttttttt	0.244													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	143916057	143916058	+	IGR	DEL	AC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143916057_143916058delAC								ARHGEF35 (23321 upstream) : OR2A1 (12948 downstream)																							CCCATGTCTGacacacacacac	0.470													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	150421748	150421753	+	IGR	DEL	CACACA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150421748_150421753delCACACA								GIMAP1 (3497 upstream) : GIMAP5 (12698 downstream)																							TGCGCGCGCGcacacacacacacaca	0.369													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	151718038	151718038	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151718038delA								GALNTL5 (1027 upstream) : GALNT11 (4740 downstream)																							TGAAAGGGGCAAAAAAAAAAA	0.328													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157892475	157892476	+	Intron	DEL	AC	-	-	rs71198565		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157892475_157892476delAC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		cctccccccaacacatcccggc	0.000													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158287637	158287637	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158287637delC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CCGCCAGCCTCCCCCGCTCTT	0.498													4	2	---	---	---	---	
CSGALNACT1	55790	broad.mit.edu	37	8	19265417	19265418	+	Intron	DEL	TG	-	-	rs71931179		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19265417_19265418delTG	uc011kyn.1	-						CSGALNACT1_uc011kyo.1_Intron|CSGALNACT1_uc003wzg.2_Intron|CSGALNACT1_uc011kyp.1_Intron	NM_001130518	NP_001123990	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate						anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)		GTATATGAATtgtgtgtgtgtg	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	20792196	20792197	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20792196_20792197insT								LZTS1 (679393 upstream) : GFRA2 (757333 downstream)																							CTTTGAACCCCTTAGCATAGCA	0.505													4	2	---	---	---	---	
PPP2R2A	5520	broad.mit.edu	37	8	26172405	26172405	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26172405delC	uc003xeu.2	+						PPP2R2A_uc003xek.2_Intron|PPP2R2A_uc011laf.1_Intron	NM_002717	NP_002708	P63151	2ABA_HUMAN	alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		tttttcccttccccccccccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	38501101	38501101	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38501101delA								RNF5P1 (42326 upstream) : TACC1 (84603 downstream)																							ggagggagggaaaaaaaaaag	0.249													4	2	---	---	---	---	
PLEKHA2	59339	broad.mit.edu	37	8	38768263	38768263	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38768263delT	uc003xmi.3	+						PLEKHA2_uc011lce.1_Intron	NM_021623	NP_067636	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A						positive regulation of cell-matrix adhesion	cytoplasm|nucleus|plasma membrane|protein complex	fibronectin binding|laminin binding				0		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			aattttagccttatgtataac	0.000													4	2	---	---	---	---	
ADAM18	8749	broad.mit.edu	37	8	39457084	39457085	+	Intron	DEL	AC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39457084_39457085delAC	uc003xni.2	+						ADAM18_uc003xnh.2_Intron|ADAM18_uc010lww.2_Intron|ADAM18_uc010lwx.2_Intron	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	a disintegrin and metalloprotease domain 18						cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			ATATGTATATACACACACACAc	0.054													4	2	---	---	---	---	
NKAIN3	286183	broad.mit.edu	37	8	63660904	63660905	+	Intron	INS	-	A	A	rs71501601	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63660904_63660905insA	uc010lyq.1	+							NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				ctctttctgggaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CPA6	57094	broad.mit.edu	37	8	68495393	68495393	+	Intron	DEL	A	-	-	rs112972020		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68495393delA	uc003xxq.3	-						CPA6_uc003xxr.3_Intron|CPA6_uc003xxs.2_Intron	NM_020361	NP_065094	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6 isoform 1 precursor						proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			TTTGAGGGTGAGGGGGCTGGG	0.438													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	74278330	74278331	+	IGR	INS	-	A	A	rs147932777	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74278330_74278331insA								RDH10 (40816 upstream) : STAU2 (54275 downstream)																							AATTAAAAGTTAAAAAAAAATA	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	75997551	75997551	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75997551delT								CRISPLD1 (50760 upstream) : HNF4G (322632 downstream)																							TTTTAATCACTTTTTATTCAT	0.313													4	2	---	---	---	---	
HNF4G	3174	broad.mit.edu	37	8	76364953	76364954	+	Intron	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76364953_76364954insA	uc003yaq.2	+						HNF4G_uc003yap.1_Intron	NM_004133	NP_004124	Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma						endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			gactccgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	76755653	76755654	+	IGR	INS	-	AAAG	AAAG	rs150930484	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76755653_76755654insAAAG								HNF4G (276594 upstream) : LOC100192378 (767461 downstream)																							agactaaaaaaaaagaaagaaa	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	80480437	80480438	+	IGR	INS	-	T	T	rs140363298	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80480437_80480438insT								IL7 (762679 upstream) : STMN2 (42942 downstream)																							aagtcaatacattttttataat	0.099													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	84171761	84171761	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84171761delC								None (None upstream) : RALYL (923692 downstream)																							TATCTCCTTTCCCCTCATCAT	0.383													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	93706442	93706443	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93706442_93706443insT								RUNX1T1 (598736 upstream) : C8orf83 (189422 downstream)																							ATCTGCCTTCCTTTTTTTTCTA	0.371													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	101851915	101851918	+	IGR	DEL	ACAT	-	-	rs113737347		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101851915_101851918delACAT								PABPC1 (117600 upstream) : YWHAZ (78886 downstream)																							acacacacacacatacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	106972070	106972070	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106972070delA								ZFPM2 (155305 upstream) : OXR1 (310403 downstream)																							AGAAATGTACATGAAGGGTCT	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	112444521	112444522	+	IGR	INS	-	AGAG	AGAG	rs145103714	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:112444521_112444522insAGAG								None (None upstream) : CSMD3 (790639 downstream)																							cagagagagaaagagagaTTga	0.054													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	129473582	129473583	+	IGR	INS	-	AGA	AGA	rs139559078	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129473582_129473583insAGA								MIR1208 (311148 upstream) : None (None downstream)																							gtgatagagagagaagggcagg	0.069													3	3	---	---	---	---	
GSDMC	56169	broad.mit.edu	37	8	130798277	130798277	+	5'UTR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130798277delC	uc003ysr.2	-	1						NM_031415	NP_113603	Q9BYG8	GSDMC_HUMAN	melanoma-derived leucine zipper, extra-nuclear							mitochondrion				ovary(2)|skin(1)	3						ATCCCTTTGTCCTGTAGAGAA	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	131665256	131665256	+	IGR	DEL	A	-	-	rs35105526		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131665256delA								ASAP1 (251040 upstream) : ADCY8 (127292 downstream)																							actacgtctcaaaaaaaaaaa	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	131713035	131713036	+	IGR	DEL	AC	-	-	rs10533710		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131713035_131713036delAC								ASAP1 (298819 upstream) : ADCY8 (79512 downstream)																							CTACACATGAacacacacacac	0.252													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134708160	134708160	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134708160delG								ST3GAL1 (123977 upstream) : ZFAT (781873 downstream)																							TAAAGGGTAAGTGTAAAGATT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	136421257	136421257	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136421257delT								LOC286094 (109298 upstream) : KHDRBS3 (48459 downstream)																							ttatgtgtagtttttttgcct	0.000													4	2	---	---	---	---	
TSNARE1	203062	broad.mit.edu	37	8	143337326	143337326	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143337326delC	uc003ywk.2	-						TSNARE1_uc011lju.1_Intron|TSNARE1_uc003ywj.2_Intron	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1						vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					atcaccaccaccatcaccatc	0.000													4	2	---	---	---	---	
BAI1	575	broad.mit.edu	37	8	143565154	143565154	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143565154delG	uc003ywm.2	+							NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1						axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CCTCGATCCTGGTTACACACT	0.577													7	4	---	---	---	---	
C8orf55	51337	broad.mit.edu	37	8	143816520	143816521	+	Intron	DEL	GG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143816520_143816521delGG	uc003yww.1	+						C8orf55_uc011ljy.1_Intron|C8orf55_uc003ywx.1_RNA	NM_016647	NP_057731	Q8WUY1	CH055_HUMAN	mesenchymal stem cell protein DSCD75 precursor							extracellular region					0	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GCTGGGTTCTGGGGATGGCCCC	0.644													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	144251105	144251105	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144251105delC								LY6H (9052 upstream) : GPIHBP1 (43963 downstream)																							CCTGCATCCTCCCCGAATGTC	0.632													4	2	---	---	---	---	
MAFA	389692	broad.mit.edu	37	8	144514017	144514017	+	5'Flank	DEL	T	-	-	rs34540942		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144514017delT	uc003yyc.1	-							NM_201589	NP_963883	Q8NHW3	MAFA_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene						insulin secretion|nitric oxide mediated signal transduction|response to glucose stimulus	nucleus	protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			ACTTCAGCaatttaaaaaaaa	0.473										HNSCC(29;0.082)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	21429379	21429380	+	IGR	INS	-	GTGT	GTGT	rs139404341	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21429379_21429380insGTGT								IFNA8 (19195 upstream) : IFNA1 (11060 downstream)																							TTAATCAGGAAgtgtgtgtgtg	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	25724039	25724039	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25724039delT								TUSC1 (45183 upstream) : None (None downstream)																							tttttatgccttggcaaattg	0.000													4	2	---	---	---	---	
TEK	7010	broad.mit.edu	37	9	27205970	27205971	+	Intron	INS	-	G	G	rs138499775	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27205970_27205971insG	uc003zqi.3	+						TEK_uc011lno.1_Intron|TEK_uc011lnp.1_Intron|TEK_uc003zqj.1_Intron	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor						angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)		TTGGGAGTGCTGAGCCTGTCAA	0.500													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44207259	44207259	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44207259delG								FAM75A6 (576529 upstream) : FAM27C (782977 downstream)																							cacattttcaggtatctttat	0.005													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	46332852	46332852	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:46332852delA								FAM27A (604570 upstream) : KGFLP1 (354714 downstream)																							aagatgtagtaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68359937	68359937	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68359937delA								FAM27B (565748 upstream) : MIR1299 (642302 downstream)																							cttcacctgtaaaaatggaat	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68377396	68377397	+	IGR	INS	-	G	G	rs75940386		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68377396_68377397insG								FAM27B (583207 upstream) : MIR1299 (624842 downstream)																							cccagagcgccggcgcaggcgc	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69982826	69982827	+	IGR	DEL	CT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69982826_69982827delCT								LOC100133920 (317877 upstream) : FOXD4L5 (192882 downstream)																							gtttgaaacactctttttccag	0.000													4	3	---	---	---	---	
PGM5	5239	broad.mit.edu	37	9	71098401	71098401	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71098401delG	uc004agr.2	+							NM_021965	NP_068800	Q15124	PGM5_HUMAN	phosphoglucomutase 5						cell adhesion|cellular calcium ion homeostasis|glucose metabolic process	costamere|dystrophin-associated glycoprotein complex|focal adhesion|intercalated disc|internal side of plasma membrane|sarcolemma|spot adherens junction|stress fiber|Z disc	intramolecular transferase activity, phosphotransferases|magnesium ion binding|structural molecule activity			ovary(1)|pancreas(1)	2						aatgcacactggagaagagac	0.000													4	2	---	---	---	---	
PIP5K1B	8395	broad.mit.edu	37	9	71501095	71501095	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71501095delA	uc004agu.2	+						PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_003558	NP_003549	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type							endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)		actccgtctgaaaaaaaaaaa	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93457222	93457223	+	IGR	DEL	TG	-	-	rs138017086	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93457222_93457223delTG								DIRAS2 (52114 upstream) : SYK (106789 downstream)																							tgtgtctgtatgtgtgtgtgtg	0.104													4	2	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94487699	94487700	+	Intron	DEL	AC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94487699_94487700delAC	uc004arj.1	-						ROR2_uc004ari.1_Intron	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						GCATGTGTGGACACACACACAC	0.589													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	104940116	104940116	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104940116delG								GRIN3A (439254 upstream) : CYLC2 (817477 downstream)																							agcagctactgggtggggtat	0.000													4	2	---	---	---	---	
ABCA1	19	broad.mit.edu	37	9	107648477	107648477	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107648477delC	uc004bcl.2	-						ABCA1_uc004bcm.2_Intron	NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1						Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CAGGAACACTCCTTCCATCTC	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	112121768	112121769	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112121768_112121769insT								EPB41L4B (38747 upstream) : PTPN3 (16205 downstream)																							agcagggttaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	112313807	112313807	+	IGR	DEL	T	-	-	rs79448349		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112313807delT								PTPN3 (53214 upstream) : PALM2 (89265 downstream)																							GTCTCCACAGTCATAGCAATT	0.473													2	6	---	---	---	---	
ROD1	9991	broad.mit.edu	37	9	114985972	114985973	+	3'UTR	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114985972_114985973insA	uc004bfw.2	-	15					ROD1_uc004bfv.2_3'UTR|ROD1_uc004bfx.2_3'UTR|ROD1_uc011lwu.1_3'UTR|ROD1_uc004bfy.2_3'UTR|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						AGGGGGAATACAAAAAAAAAAA	0.327													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	115884157	115884157	+	IGR	DEL	T	-	-	rs113096070		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115884157delT								C9orf109 (2033 upstream) : SLC31A2 (29081 downstream)																							tacttgatgattttttttttt	0.119													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	116420160	116420161	+	IGR	DEL	CA	-	-	rs10563239		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116420160_116420161delCA								RGS3 (60143 upstream) : ZNF618 (218401 downstream)																							gtacacattgcacacacacaca	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	116872087	116872088	+	IGR	DEL	TT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116872087_116872088delTT								KIF12 (10580 upstream) : COL27A1 (46143 downstream)																							GACGAGGAGCTTTTTTtttttt	0.302													4	2	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119956238	119956239	+	Intron	INS	-	TGT	TGT	rs138088505	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119956238_119956239insTGT	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						AGAGGGCAGGGTGTTGTTGTTG	0.495													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	120745439	120745440	+	IGR	DEL	GA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120745439_120745440delGA								TLR4 (265675 upstream) : None (None downstream)																							gggagggagggagagagagaga	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	122995969	122995970	+	IGR	DEL	CA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122995969_122995970delCA								DBC1 (864230 upstream) : MIR147 (11287 downstream)																							Aacacacatgcacacacacaca	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132201159	132201161	+	IGR	DEL	GTT	-	-	rs146114358	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132201159_132201161delGTT								C9orf106 (116277 upstream) : C9orf50 (173345 downstream)																							CTGAAGTGAGgttgttgttgttg	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132547657	132547657	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132547657delG								PTGES (32313 upstream) : TOR1B (17775 downstream)																							aaagaaggaaggaaaggaaga	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	133866131	133866131	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133866131delG								FIBCD1 (51676 upstream) : LAMC3 (18373 downstream)																							ATAGCCCCCAGCACATCCTTG	0.398													1	5	---	---	---	---	
VAV2	7410	broad.mit.edu	37	9	136796606	136796607	+	Intron	INS	-	TCCCTCCCTTC	TCCCTCCCTTC	rs112992599		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136796606_136796607insTCCCTCCCTTC	uc004ces.2	-						VAV2_uc004cer.2_Intron	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		ccctcctttcttccctcccttc	0.455													2	4	---	---	---	---	
PNPLA7	375775	broad.mit.edu	37	9	140398378	140398383	+	Intron	DEL	AAGGAA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140398378_140398383delAAGGAA	uc004cnf.2	-						C9orf167_uc011mew.1_Intron|PNPLA7_uc011mfa.1_Intron|PNPLA7_uc010ncj.1_Intron	NM_152286	NP_689499	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7						lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity			skin(1)	1	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		aaggaagaagaaggaagaagaagaag	0.000													6	3	---	---	---	---	
LARP4B	23185	broad.mit.edu	37	10	893465	893465	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:893465delT	uc001ifs.1	-							NM_015155	NP_055970	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B								nucleotide binding|RNA binding			ovary(2)|central_nervous_system(1)	3						aacttttttcttttttttttt	0.000													4	2	---	---	---	---	
WDR37	22884	broad.mit.edu	37	10	1146374	1146374	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1146374delT	uc001igf.1	+						WDR37_uc009xhm.1_Intron|WDR37_uc009xhn.1_Intron|WDR37_uc001igg.1_Intron	NM_014023	NP_054742	Q9Y2I8	WDR37_HUMAN	WD repeat domain 37												0		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		AGCAGTTTTGTTTTCTGAAGC	0.458													0	6	---	---	---	---	
FAM107B	83641	broad.mit.edu	37	10	14771502	14771503	+	Intron	INS	-	A	A	rs72511764		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14771502_14771503insA	uc001ina.1	-						FAM107B_uc010qbu.1_Intron	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641											breast(4)	4						GTGTCAGGGGGCATAAGTATGG	0.262													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	18978334	18978335	+	IGR	INS	-	T	T	rs113896618		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18978334_18978335insT								ARL5B (11394 upstream) : None (None downstream)																							ctctctctctcttttttttttG	0.144													4	2	---	---	---	---	
PLXDC2	84898	broad.mit.edu	37	10	20547874	20547874	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20547874delT	uc001iqg.1	+						PLXDC2_uc001iqh.1_Intron|PLXDC2_uc009xkc.1_Intron	NM_032812	NP_116201	Q6UX71	PXDC2_HUMAN	plexin domain containing 2 precursor							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4						gaggtggagcttgcagtgagc	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	37717387	37717390	+	IGR	DEL	AAAG	-	-	rs71973021		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37717387_37717390delAAAG								ANKRD30A (195892 upstream) : ZNF248 (373057 downstream)																							gaaagaaagaaaagaaagaaagaa	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42366066	42366075	+	IGR	DEL	TTCTAGTCAT	-	-	rs145028456	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42366066_42366075delTTCTAGTCAT								None (None upstream) : LOC441666 (461240 downstream)																							ttccattccattctagtcatttccattcca	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42602922	42602923	+	IGR	DEL	AA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42602922_42602923delAA								None (None upstream) : LOC441666 (224392 downstream)																							ACACAACAACAAAGAGAGGTAA	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42676291	42676292	+	IGR	DEL	AG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42676291_42676292delAG								None (None upstream) : LOC441666 (151023 downstream)																							acacagagacagagattgcagt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42760617	42760618	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42760617_42760618insT								None (None upstream) : LOC441666 (66697 downstream)																							gttgagtcttctttttttttct	0.000													3	3	---	---	---	---	
ALOX5	240	broad.mit.edu	37	10	45873629	45873630	+	Intron	INS	-	T	T	rs148099691	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45873629_45873630insT	uc001jce.2	+						ALOX5_uc009xmt.2_Intron|ALOX5_uc010qfg.1_Intron	NM_000698	NP_000689	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase						hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	cytosol|nuclear envelope lumen|nuclear matrix|nuclear membrane	arachidonate 5-lipoxygenase activity|iron ion binding|lipoxygenase activity|protein binding			ovary(1)|pancreas(1)	2		Lung SC(717;0.0257)			Diethylcarbamazine(DB00711)|Hydrocortisone(DB00741)|Leflunomide(DB01097)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Minocycline(DB01017)|Montelukast(DB00471)|Quinacrine(DB01103)|Vitamin E(DB00163)|Zileuton(DB00744)	GAAATACCCTCTTATGAAGCTT	0.520													0	6	---	---	---	---	
WDFY4	57705	broad.mit.edu	37	10	50141145	50141146	+	Intron	INS	-	G	G	rs76943447	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50141145_50141146insG	uc001jha.3	+						LRRC18_uc001jhe.1_Intron	NM_020945	NP_065996	Q6ZS81	WDFY4_HUMAN	WDFY family member 4							integral to membrane	binding				0						GTCTGTGCTGAAGGGCATGGCA	0.564													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	58331583	58331584	+	IGR	DEL	TG	-	-	rs71883131		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58331583_58331584delTG								ZWINT (210549 upstream) : None (None downstream)																							AAAATAAATAtgtgtgtgtgtg	0.248													2	4	---	---	---	---	
COL13A1	1305	broad.mit.edu	37	10	71640068	71640068	+	Intron	DEL	C	-	-	rs35255453		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71640068delC	uc001jpr.1	+						COL13A1_uc001jqj.1_Intron|COL13A1_uc001jps.1_Intron|COL13A1_uc001jpt.1_Intron|COL13A1_uc001jpu.1_Intron|COL13A1_uc001jpv.1_Intron|COL13A1_uc001jpx.1_Intron|COL13A1_uc001jpw.1_Intron|COL13A1_uc001jpy.1_Intron|COL13A1_uc001jpz.1_Intron|COL13A1_uc001jqa.1_Intron|COL13A1_uc001jqc.1_Intron|COL13A1_uc001jqb.1_Intron|COL13A1_uc001jql.2_Intron|COL13A1_uc001jqd.1_Intron|COL13A1_uc001jqe.1_Intron|COL13A1_uc001jqf.1_Intron|COL13A1_uc001jqg.1_Intron|COL13A1_uc001jqh.1_Intron|COL13A1_uc001jqi.1_Intron|COL13A1_uc010qjf.1_Intron|COL13A1_uc001jqk.1_Intron	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1						cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)	TGCCCCTGTGCCCTCTGTGTT	0.632													2	7	---	---	---	---	
BMPR1A	657	broad.mit.edu	37	10	88626448	88626448	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88626448delT	uc001kdy.2	+							NM_004329	NP_004320	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA						BMP signaling pathway|immune response|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	integral to membrane|plasma membrane	ATP binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta receptor activity			lung(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	8						ttgcgcttcattttttttttt	0.065			Mis|N|F			gastrointestinal polyps			Hereditary_Mixed_Polyposis_syndrome_type_2|Juvenile_Polyposis				4	2	---	---	---	---	
GLUD1	2746	broad.mit.edu	37	10	88820739	88820739	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88820739delC	uc001keh.2	-	7	1089	c.992delG	c.(991-993)GGTfs	p.G331fs	GLUD1_uc001keg.2_Frame_Shift_Del_p.G164fs|GLUD1_uc010qmp.1_Frame_Shift_Del_p.G198fs	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor	331					glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	ATCAGACTCACCAACAGCAAT	0.363													58	40	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	92907445	92907448	+	IGR	DEL	GAGA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92907445_92907448delGAGA								ANKRD1 (226413 upstream) : NUDT9P1 (4313 downstream)																							gcgagcaagtgagagagagagaga	0.000													4	2	---	---	---	---	
LOC100188947	100188947	broad.mit.edu	37	10	93340894	93340895	+	Intron	DEL	TG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93340894_93340895delTG	uc010qnl.1	-							NR_024467				Homo sapiens, clone IMAGE:6063621, mRNA.												0						CATTtgtgtatgtgtgtgtgtg	0.119													4	2	---	---	---	---	
IDE	3416	broad.mit.edu	37	10	94268317	94268317	+	Intron	DEL	A	-	-	rs33917554		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94268317delA	uc001kia.2	-							NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	tctaaaaaagaaaaaaaaAAA	0.189													4	2	---	---	---	---	
ALDH18A1	5832	broad.mit.edu	37	10	97415312	97415312	+	Intron	DEL	A	-	-	rs11287393		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97415312delA	uc001kkz.2	-						ALDH18A1_uc001kky.2_Intron|ALDH18A1_uc010qog.1_Intron|ALDH18A1_uc010qoh.1_Intron	NM_002860	NP_002851	P54886	P5CS_HUMAN	pyrroline-5-carboxylate synthetase isoform 1						proline biosynthetic process	mitochondrial inner membrane	ATP binding|glutamate 5-kinase activity|glutamate-5-semialdehyde dehydrogenase activity			pancreas(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)	L-Glutamic Acid(DB00142)	TCACTGAAATAAGAGATTGAA	0.443													1	5	---	---	---	---	
MMS19	64210	broad.mit.edu	37	10	99221730	99221731	+	Intron	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99221730_99221731insA	uc001kns.3	-						MMS19_uc001knq.2_5'Flank|MMS19_uc009xvs.2_Intron|MMS19_uc009xvt.2_Intron|MMS19_uc001knr.2_Intron|MMS19_uc010qox.1_Intron|MMS19_uc001knt.2_Intron|MMS19_uc001knu.1_Intron	NM_022362	NP_071757	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog						chromosome segregation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|response to hormone stimulus|transcription, DNA-dependent|two-component signal transduction system (phosphorelay)	cytoplasm|holo TFIIH complex|MMXD complex	estrogen receptor binding|protein binding, bridging|receptor signaling complex scaffold activity|transcription coactivator activity				0		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		AGATTAGCCCTAAAAAAAAACC	0.505								Direct_reversal_of_damage|NER					5	3	---	---	---	---	
SH3PXD2A	9644	broad.mit.edu	37	10	105484549	105484549	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105484549delA	uc001kxj.1	-						SH3PXD2A_uc010qqu.1_Intron	NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1						cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		TGACTTAAACAAAAAAAAAAA	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134718662	134718665	+	Intron	DEL	TTCT	-	-	rs10580367		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134718662_134718665delTTCT	uc010qux.1	-						uc009ybf.2_Intron	NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		GTCAAAATGCTTCTTTCTTTGTCA	0.402													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	341013	341013	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:341013delA								IFITM3 (20099 upstream) : B4GALNT4 (28782 downstream)																							gaagggagggaagggaaggga	0.000													4	2	---	---	---	---	
C11orf35	256329	broad.mit.edu	37	11	559299	559300	+	Intron	DEL	TT	-	-	rs112162682		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:559299_559300delTT	uc001lpx.2	-						uc001lpy.2_RNA|uc001lpz.2_5'Flank|RASSF7_uc001lqa.2_5'Flank|RASSF7_uc001lqb.2_5'Flank|RASSF7_uc001lqc.2_5'Flank|RASSF7_uc001lqd.2_5'Flank	NM_173573	NP_775844	Q8IXW0	CK035_HUMAN	hypothetical protein LOC256329											pancreas(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTGTCCCTCTTTCTCTCTCTT	0.644													2	6	---	---	---	---	
CD151	977	broad.mit.edu	37	11	836540	836540	+	Intron	DEL	G	-	-	rs56063221		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:836540delG	uc001lry.2	+						CD151_uc001lrx.2_Intron|CD151_uc001lrz.2_Intron|CD151_uc001lsa.2_Intron|CD151_uc001lsb.2_Intron	NM_004357	NP_004348	P48509	CD151_HUMAN	CD151 antigen						cell adhesion|hemidesmosome assembly	cytosol|integral to plasma membrane|membrane fraction	protein binding				0		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;1.54e-25)|Epithelial(43;1.22e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.91e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGCTCACCTGGGGGGGGGGT	0.652													2	5	---	---	---	---	
OSBPL5	114879	broad.mit.edu	37	11	3133183	3133184	+	Intron	INS	-	TGTG	TGTG	rs151259305	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3133183_3133184insTGTG	uc001lxk.2	-						OSBPL5_uc010qxq.1_Intron|OSBPL5_uc009ydw.2_Intron|OSBPL5_uc001lxl.2_Intron|OSBPL5_uc009ydx.2_Intron	NM_020896	NP_065947	Q9H0X9	OSBL5_HUMAN	oxysterol-binding protein-like protein 5 isoform						cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		aacatccaagctgtgtgtgtgt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11024386	11024386	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11024386delC								ZBED5 (144766 upstream) : GALNTL4 (268035 downstream)																							tgggatacttccttgtctttg	0.209													4	2	---	---	---	---	
PDE3B	5140	broad.mit.edu	37	11	14854498	14854498	+	Intron	DEL	T	-	-	rs80137325		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14854498delT	uc001mln.2	+						PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						TGAAAttttcttttttttttt	0.129													4	2	---	---	---	---	
SERGEF	26297	broad.mit.edu	37	11	18029268	18029280	+	Intron	DEL	GGGGTGGGGGAAA	-	-	rs112112013		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18029268_18029280delGGGGTGGGGGAAA	uc001mnm.2	-						SERGEF_uc009yhd.2_Intron|SERGEF_uc001mnn.2_Intron|SERGEF_uc010rcz.1_Intron|SERGEF_uc001mno.1_Intron	NM_012139	NP_036271	Q9UGK8	SRGEF_HUMAN	deafness locus associated putative guanine						negative regulation of protein secretion|signal transduction	cytoplasm|nucleus	protein binding|Ran guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1						tataatggagggggtgggggaaaggggtggcct	0.089													2	4	---	---	---	---	
LDHC	3948	broad.mit.edu	37	11	18431370	18431371	+	5'Flank	INS	-	T	T	rs138942929	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18431370_18431371insT	uc001mon.3	+						LDHC_uc001mom.3_5'Flank|LDHC_uc009yhp.2_5'Flank|LDHC_uc001moo.3_5'Flank|LDHC_uc009yhq.2_5'Flank|LDHC_uc009yhr.2_5'Flank	NM_017448	NP_059144	P07864	LDHC_HUMAN	L-lactate dehydrogenase C						glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity				0					NADH(DB00157)	GTTCTACTTCCTTTTTTTCCCC	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	20687115	20687116	+	IGR	DEL	AT	-	-	rs139943171		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20687115_20687116delAT								SLC6A5 (10507 upstream) : NELL1 (4001 downstream)																							tatgggagagataatgatgggt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	27269006	27269006	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27269006delT								BBOX1 (119652 upstream) : CCDC34 (91055 downstream)																							TAGTAGCTTATTTAAGGTCAA	0.134													4	2	---	---	---	---	
CCDC73	493860	broad.mit.edu	37	11	32795325	32795326	+	Intron	INS	-	A	A	rs113975181		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32795325_32795326insA	uc001mtv.2	-						CCDC73_uc001mtw.1_Intron|CCDC73_uc009yjt.2_Intron	NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79											ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)					gatgctgtctcaaaaaaaaaaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	33866463	33866464	+	IGR	INS	-	TG	TG	rs141803689		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33866463_33866464insTG								FBXO3 (70392 upstream) : LMO2 (13661 downstream)																							CTCTTTTTTCAtgtgtgtgtgt	0.252													5	3	---	---	---	---	
PHF21A	51317	broad.mit.edu	37	11	46023346	46023346	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46023346delA	uc001ncc.3	-						PHF21A_uc001ncb.3_Intron|PHF21A_uc009ykx.2_Intron|PHF21A_uc001nce.2_Intron	NM_001101802	NP_001095272	Q96BD5	PF21A_HUMAN	BRAF35/HDAC2 complex isoform a						blood coagulation|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2						CGTCACTTTGAAGCCCTGTTT	0.408													4	2	---	---	---	---	
ARHGAP1	392	broad.mit.edu	37	11	46710333	46710335	+	Intron	DEL	TTT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46710333_46710335delTTT	uc001ndd.2	-						ARHGAP1_uc009yle.1_Intron	NM_004308	NP_004299	Q07960	RHG01_HUMAN	Rho GTPase activating protein 1						Rho protein signal transduction	cytosol|intracellular membrane-bounded organelle	SH3 domain binding|SH3/SH2 adaptor activity			skin(1)	1		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)		ccAACATCACTTTTTAAAAAGTC	0.039													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	50103814	50103815	+	IGR	INS	-	A	A	rs138180138	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50103814_50103815insA								OR4C12 (99777 upstream) : LOC441601 (135185 downstream)																							GATTCCAGGCCGGGGGAGAGAG	0.465													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	50533736	50533736	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50533736delA								LOC646813 (153933 upstream) : OR4A5 (877712 downstream)																							cagaatggacaaaaactgttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	55353628	55353629	+	IGR	DEL	TA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55353628_55353629delTA								OR4C16 (13094 upstream) : OR4C11 (17290 downstream)																							accctctttttatagtcccttt	0.000													4	2	---	---	---	---	
SF3B2	10992	broad.mit.edu	37	11	65825456	65825458	+	Intron	DEL	AAG	-	-	rs60074596		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65825456_65825458delAAG	uc001ogy.1	+							NM_006842	NP_006833	Q13435	SF3B2_HUMAN	splicing factor 3B subunit 2						interspecies interaction between organisms	catalytic step 2 spliceosome|nucleoplasm|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(2)|breast(1)	3						aaaaaaaaaaaagaaagaaagaa	0.232													5	4	---	---	---	---	
CPT1A	1374	broad.mit.edu	37	11	68524964	68524965	+	3'UTR	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68524964_68524965insA	uc001oog.3	-	19					CPT1A_uc001oof.3_Intron|CPT1A_uc009ysj.2_Intron	NM_001876	NP_001867	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A liver isoform						carnitine shuttle|fatty acid beta-oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			skin(2)	2	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		L-Carnitine(DB00583)|Perhexiline(DB01074)	ACTGTTCTAGGAAAAAAAAACA	0.441													4	2	---	---	---	---	
TPCN2	219931	broad.mit.edu	37	11	68884173	68884173	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68884173delA	uc001oot.2	+							NM_139075		Q8NHX9	TPC2_HUMAN	two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			tttcgaagccaccatgcaggc	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	71918436	71918436	+	IGR	DEL	A	-	-	rs35124063		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71918436delA								FOLR1 (11070 upstream) : FOLR2 (9383 downstream)																							ATCGCCCattaaaaaaaaaaa	0.075													5	7	---	---	---	---	
ARAP1	116985	broad.mit.edu	37	11	72440030	72440030	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72440030delG	uc001osu.2	-						ARAP1_uc001osv.2_Intron	NM_001040118	NP_001035207	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH						actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding			skin(1)	1						ggtggagggcggggagggtaa	0.000													4	2	---	---	---	---	
SYTL2	54843	broad.mit.edu	37	11	85457076	85457077	+	Intron	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85457076_85457077insA	uc010rth.1	-						SYTL2_uc010rtg.1_Intron|SYTL2_uc010rti.1_Intron|SYTL2_uc010rtj.1_Intron|SYTL2_uc001pbf.3_Intron	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CAGAGACCATTAAAGCAAAATT	0.460													4	2	---	---	---	---	
SYTL2	54843	broad.mit.edu	37	11	85513263	85513263	+	Intron	DEL	C	-	-	rs74766770		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85513263delC	uc010rti.1	-						SYTL2_uc010rtj.1_Intron	NM_032943	NP_116561	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform a						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		tttttcttttctttttttttt	0.219													4	2	---	---	---	---	
PRSS23	11098	broad.mit.edu	37	11	86649522	86649524	+	Intron	DEL	AAC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86649522_86649524delAAC	uc001pcc.1	+									O95084	PRS23_HUMAN	Homo sapiens serine protease mRNA, complete cds.						proteolysis	extracellular region|nucleus	serine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AGGAGCAGAGAACACTGAAACAG	0.424													0	9	---	---	---	---	
MAML2	84441	broad.mit.edu	37	11	95735714	95735716	+	Intron	DEL	GAT	-	-	rs112698553		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95735714_95735716delGAT	uc001pfw.1	-							NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				tgatgatggggatgatgaagatg	0.025			T	MECT1|CRTC3	salivary gland mucoepidermoid								4	2	---	---	---	---	
ARHGAP42	143872	broad.mit.edu	37	11	100753230	100753231	+	Intron	INS	-	T	T	rs34517485		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100753230_100753231insT	uc001pge.2	+							NM_152432	NP_689645	A6NI28	RHG42_HUMAN	Rho-type GTPase-activating protein FLJ32810						filopodium assembly|signal transduction	intracellular	cytoskeletal adaptor activity|GTPase activator activity|SH3 domain binding				0						gttagccagtattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	101079626	101079626	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101079626delC								PGR (79082 upstream) : TRPC6 (242670 downstream)																							catgtgctgacaaaaataata	0.134													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	105984793	105984793	+	IGR	DEL	T	-	-	rs34152674		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105984793delT								AASDHPPT (15374 upstream) : GUCY1A2 (573117 downstream)																							ctacttcaagttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	106000189	106000189	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106000189delC								AASDHPPT (30770 upstream) : GUCY1A2 (557721 downstream)																							AGCAGGAGTGCCCAGGGACCA	0.542													5	6	---	---	---	---	
ALKBH8	91801	broad.mit.edu	37	11	107378899	107378900	+	Intron	INS	-	TT	TT	rs34261151		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107378899_107378900insTT	uc010rvr.1	-						ALKBH8_uc001pjk.2_Intron|ALKBH8_uc010rvq.1_Intron|ALKBH8_uc009yxp.2_Intron|ALKBH8_uc001pjl.2_Intron	NM_138775	NP_620130	Q96BT7	ALKB8_HUMAN	alkB, alkylation repair homolog 8						response to DNA damage stimulus	cytosol|nucleus	metal ion binding|nucleotide binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|protein binding|RNA binding|tRNA (uracil) methyltransferase activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00512)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.53e-05)|Epithelial(105;0.00029)|all cancers(92;0.00518)		TTTTCAATGCCttttttttttt	0.064													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	109056434	109056434	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109056434delT								DDX10 (244788 upstream) : C11orf87 (236441 downstream)																							ATACATATGATTTAACTTTGa	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	116351356	116351357	+	IGR	INS	-	GATG	GATG	rs111896299		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116351356_116351357insGATG								CADM1 (976115 upstream) : BUD13 (267531 downstream)																							aacagtgggaagatggatggat	0.035													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	119632292	119632296	+	IGR	DEL	CTTTT	-	-	rs10536629		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119632292_119632296delCTTTT								PVRL1 (32857 upstream) : TRIM29 (349699 downstream)																							TTAGCAtttccttttcttttctttt	0.307													3	3	---	---	---	---	
GRIK4	2900	broad.mit.edu	37	11	120423684	120423684	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120423684delG	uc001pxn.2	+							NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	attacagcgtgggggacagag	0.000													4	2	---	---	---	---	
GRIK4	2900	broad.mit.edu	37	11	120608789	120608790	+	Intron	INS	-	AAG	AAG	rs138587733	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120608789_120608790insAAG	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	gaacgtctggtaagaggagatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	122860408	122860409	+	IGR	INS	-	TGA	TGA	rs143836978	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122860408_122860409insTGA								BSX (8029 upstream) : LOC341056 (27865 downstream)																							gatgatggtggtggtggtgatg	0.054													6	3	---	---	---	---	
ASAM	79827	broad.mit.edu	37	11	123056096	123056097	+	Intron	DEL	GA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123056096_123056097delGA	uc001pyt.2	-							NM_024769	NP_079045	Q9H6B4	CLMP_HUMAN	adipocyte-specific adhesion molecule precursor							integral to membrane|tight junction					0		Breast(109;0.0025)|Lung NSC(97;0.0179)|all_lung(97;0.0182)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.73e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		GGCGCCAGGGgagagagagaga	0.510													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	123818585	123818586	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123818585_123818586insT								OR6T1 (4040 upstream) : OR10S1 (28817 downstream)																							TGCAGAGGCTATTTTTTTTTTT	0.460													6	3	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126398611	126398611	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126398611delG	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TAGAAAAGGAGGgaagagatg	0.194													4	2	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126615000	126615001	+	Intron	DEL	GA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126615000_126615001delGA	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron|KIRREL3_uc001qed.3_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		CCCTTTCCTTGAGAGGATCTCA	0.540													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127802227	127802227	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127802227delC								KIRREL3 (928872 upstream) : ETS1 (526429 downstream)																							GTATTACAgtcaggagatcga	0.139													4	2	---	---	---	---	
OPCML	4978	broad.mit.edu	37	11	133344349	133344349	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133344349delG	uc001qgu.2	-							NM_001012393	NP_001012393	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		CACTGTTCTAGGTAAGCATGT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	134574598	134574598	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134574598delT								B3GAT1 (292786 upstream) : None (None downstream)																							ATGAACGGCATTTAGAACACT	0.259													6	4	---	---	---	---	
IQSEC3	440073	broad.mit.edu	37	12	257728	257728	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:257728delG	uc001qhw.1	+						IQSEC3_uc001qhu.1_Intron|uc001qhv.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		CAGGAACACTGGCAGATCCTG	0.498													4	2	---	---	---	---	
WNK1	65125	broad.mit.edu	37	12	910590	910591	+	Intron	DEL	TG	-	-	rs72247595		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:910590_910591delTG	uc001qio.3	+						WNK1_uc001qin.2_Intron|WNK1_uc001qip.3_Intron	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TTTTTTTCTTtgtgtgtgtgtg	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	4355394	4355395	+	IGR	INS	-	A	A	rs113625850		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4355394_4355395insA								PARP11 (372786 upstream) : CCND2 (27507 downstream)																							AAAAGCCCTTCAAAAAAAAAAA	0.441													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5163202	5163202	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5163202delA								KCNA5 (7254 upstream) : NTF3 (378078 downstream)																							ACAATCACTTATGTGCCTCCT	0.308													4	2	---	---	---	---	
ETV6	2120	broad.mit.edu	37	12	11962099	11962100	+	Intron	INS	-	A	A	rs35743843		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11962099_11962100insA	uc001qzz.2	+							NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				gaccctgtgtcaaaaaaaaaaa	0.099			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								6	3	---	---	---	---	
GRIN2B	2904	broad.mit.edu	37	12	13955922	13955924	+	Intron	DEL	TCT	-	-	rs139279799		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13955922_13955924delTCT	uc001rbt.2	-							NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	aagaacgacctcttctcttcctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	19959946	19959946	+	IGR	DEL	T	-	-	rs35369689		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19959946delT								AEBP2 (284773 upstream) : PDE3A (562251 downstream)																							taatcaaccctgagatggtgt	0.109													2	4	---	---	---	---	
SLCO1B3	28234	broad.mit.edu	37	12	20985433	20985433	+	Intron	DEL	A	-	-	rs140191115		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20985433delA	uc001rek.2	+						SLCO1B3_uc001rel.2_Intron|SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Intron	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					AATGATTATTAAAAAAAAAAT	0.328													2	4	---	---	---	---	
SOX5	6660	broad.mit.edu	37	12	23892766	23892766	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23892766delT	uc001rfw.2	-						SOX5_uc001rfx.2_Intron|SOX5_uc001rfy.2_Intron|SOX5_uc010siv.1_Intron|SOX5_uc010siw.1_Intron|SOX5_uc001rfz.1_Intron	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						gagcattgccttgtcatagca	0.000													6	3	---	---	---	---	
TM7SF3	51768	broad.mit.edu	37	12	27133722	27133722	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27133722delA	uc010sjl.1	-							NM_016551	NP_057635	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3 precursor							integral to membrane|plasma membrane				upper_aerodigestive_tract(2)	2	Colorectal(261;0.0847)					CATTCAGAAGAAAAAAAAAAT	0.303													4	2	---	---	---	---	
TMTC1	83857	broad.mit.edu	37	12	29750561	29750561	+	Intron	DEL	A	-	-	rs35882753		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29750561delA	uc001rjb.2	-						TMTC1_uc001riz.2_Intron|TMTC1_uc001rja.2_Intron|TMTC1_uc001rjc.1_Intron	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat							integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					ATAAAATGTGAAAAAAAAAAA	0.383													2	4	---	---	---	---	
TMTC1	83857	broad.mit.edu	37	12	29931487	29931488	+	Intron	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29931487_29931488insA	uc001rjb.2	-						TMTC1_uc001rjc.1_Intron	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat							integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GAAAAAGAAGCAAAAAAAAAAT	0.386													4	2	---	---	---	---	
DDX11	1663	broad.mit.edu	37	12	31229416	31229416	+	Intron	DEL	A	-	-	rs11301065		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31229416delA	uc001rjt.1	+						uc001rjq.1_5'Flank|DDX11_uc010sjw.1_Intron|DDX11_uc010sjx.1_Intron|DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					tatgctggatatctcttgcaa	0.000										Multiple Myeloma(12;0.14)			1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	31372996	31372996	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31372996delA								DDX11 (115271 upstream) : FAM60A (60531 downstream)																							taagccaatcagtgtgtcata	0.214													4	2	---	---	---	---	
DENND5B	160518	broad.mit.edu	37	12	31601792	31601793	+	Intron	INS	-	A	A	rs146812148	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31601792_31601793insA	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc009zjq.1_Intron|DENND5B_uc001rkj.2_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2						aaaaaacaaacaaaCAAAAACA	0.203													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	33919134	33919135	+	IGR	INS	-	GT	GT	rs138570622	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33919134_33919135insGT								SYT10 (326380 upstream) : ALG10 (256081 downstream)																							AAAGGCAGGCAgtgtgtgtgtg	0.277													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34200411	34200411	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34200411delA								ALG10 (19177 upstream) : None (None downstream)																							tatttgtgtcaaaacctgaag	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34464208	34464208	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34464208delT								ALG10 (282974 upstream) : None (None downstream)																							ctgttgtgtcttttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	39452629	39452634	+	IGR	DEL	ACACAC	-	-	rs72176453		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39452629_39452634delACACAC								CPNE8 (153209 upstream) : KIF21A (234397 downstream)																							cacccctacTacacacacacacacac	0.170													4	2	---	---	---	---	
TUBA1B	10376	broad.mit.edu	37	12	49557335	49557336	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49557335_49557336insT	uc001rto.2	-							NM_006082	NP_006073	P68363	TBA1B_HUMAN	tubulin, alpha, ubiquitous						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding				0						tgcccagcTAAttttttttttt	0.000													4	2	---	---	---	---	
FAIM2	23017	broad.mit.edu	37	12	50271844	50271845	+	Intron	INS	-	GT	GT	rs147485870		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50271844_50271845insGT	uc001rvj.1	-						FAIM2_uc001rvi.1_Intron|FAIM2_uc001rvk.1_Intron	NM_012306	NP_036438	Q9BWQ8	FAIM2_HUMAN	Fas apoptotic inhibitory molecule 2						anti-apoptosis|apoptosis	cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|ovary(1)|skin(1)	3						tgtatatgtgcgtgtatgtgtg	0.000													3	3	---	---	---	---	
KRT77	374454	broad.mit.edu	37	12	53086163	53086163	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53086163delC	uc001saw.2	-						KRT77_uc009zmi.2_Intron	NM_175078	NP_778253	Q7Z794	K2C1B_HUMAN	keratin 77							keratin filament	structural molecule activity			ovary(1)	1						TTCATGGGTGCATCTCAAGCC	0.552													31	31	---	---	---	---	
KRT79	338785	broad.mit.edu	37	12	53215475	53215475	+	3'UTR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53215475delC	uc001sbb.2	-	9					KRT79_uc001sba.2_3'UTR	NM_175834	NP_787028	Q5XKE5	K2C79_HUMAN	keratin 6L							keratin filament	structural molecule activity			ovary(2)|skin(2)	4						TACTGCAGGACCAAGGAGAAA	0.517													4	2	---	---	---	---	
ATF7	11016	broad.mit.edu	37	12	54012486	54012487	+	Intron	INS	-	TT	TT	rs144676581	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54012486_54012487insTT	uc001sdz.2	-						ATF7_uc010sok.1_Intron|ATF7_uc010sol.1_Intron|ATF7_uc001sea.3_Intron|ATF7_uc001seb.3_Intron	NM_006856	NP_006847	P17544	ATF7_HUMAN	activating transcription factor 7 isoform 2						interspecies interaction between organisms	cytoplasm|nuclear periphery|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)	2						ATAAATGGCAATTGTGTGTGTG	0.297													5	6	---	---	---	---	
COPZ1	22818	broad.mit.edu	37	12	54720425	54720426	+	Intron	DEL	GT	-	-	rs71444847		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54720425_54720426delGT	uc001sfs.1	+						COPZ1_uc001sft.2_Intron|COPZ1_uc009znm.1_Intron|COPZ1_uc010sot.1_Intron	NM_016057	NP_057141	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol					0						ATTTGGAGGGgtgtgtgtgtgt	0.312													4	2	---	---	---	---	
NCKAP1L	3071	broad.mit.edu	37	12	54888561	54888561	+	5'Flank	DEL	A	-	-	rs5798302		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54888561delA	uc001sgc.3	+						NCKAP1L_uc010sox.1_5'Flank	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like						actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						GGTGGCTCacaaaaaatacaa	0.209													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	55529109	55529110	+	IGR	INS	-	C	C	rs148207481	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55529109_55529110insC								OR9K2 (4550 upstream) : OR10A7 (85699 downstream)																							cggacacgtgacccccccaccc	0.000													4	2	---	---	---	---	
R3HDM2	22864	broad.mit.edu	37	12	57775765	57775766	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57775765_57775766insT	uc001snt.2	-						R3HDM2_uc001sns.2_Intron|R3HDM2_uc009zpo.1_Intron	NM_014925	NP_055740	Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2							nucleus	nucleic acid binding			ovary(2)	2						tgcctggctaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	58253932	58253932	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58253932delG								CTDSP2 (13185 upstream) : XRCC6BP1 (81513 downstream)																							AACTTGATTTGGAACCCCTGC	0.547													4	2	---	---	---	---	
LRIG3	121227	broad.mit.edu	37	12	59316608	59316610	+	5'Flank	DEL	CAC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59316608_59316610delCAC	uc001sqr.2	-						LRIG3_uc010ssh.1_5'Flank	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like							integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			acttcattctcaccaccaccacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	59328134	59328135	+	IGR	DEL	GT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59328134_59328135delGT								LRIG3 (13872 upstream) : SLC16A7 (661713 downstream)																							tgctcaAGAGgtgtgtgtgtgt	0.119													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	59933520	59933521	+	IGR	DEL	AC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59933520_59933521delAC								LRIG3 (619258 upstream) : SLC16A7 (56327 downstream)																							tacagaaggtacacacacacac	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	61308708	61308711	+	IGR	DEL	TGTG	-	-	rs68038820		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61308708_61308711delTGTG								None (None upstream) : FAM19A2 (793332 downstream)																							TATATTTTTCtgtgtgtgtgtgtg	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	63624576	63624576	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63624576delC								AVPR1A (77986 upstream) : DPY19L2 (328117 downstream)																							TTAACagataccatctcacac	0.169													4	2	---	---	---	---	
SRGAP1	57522	broad.mit.edu	37	12	64453986	64453986	+	Intron	DEL	T	-	-	rs66491269		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64453986delT	uc010ssp.1	+						SRGAP1_uc001srt.2_Intron|SRGAP1_uc001srv.2_Intron	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1						axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		tctttttttcttttttttttt	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	68518287	68518287	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68518287delC								DYRK2 (461844 upstream) : IFNG (30263 downstream)																							gacagctttaccaggcaatat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	72487410	72487410	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72487410delT								TPH2 (61189 upstream) : LOC283392 (168918 downstream)																							aatttttcacttctgtcgttg	0.000													4	2	---	---	---	---	
KCNC2	3747	broad.mit.edu	37	12	75497247	75497247	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75497247delC	uc001sxg.1	-						KCNC2_uc009zry.2_Intron|KCNC2_uc001sxe.2_Intron|KCNC2_uc001sxf.2_Intron|KCNC2_uc010stw.1_Intron	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel						energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6						GCCAGGGGTACTTTTATATTG	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	77123582	77123583	+	IGR	INS	-	ACAC	ACAC	rs140951397	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77123582_77123583insACAC								OSBPL8 (169993 upstream) : ZDHHC17 (34271 downstream)																							TAGATATACGTacacacacaca	0.109													4	2	---	---	---	---	
CSRP2	1466	broad.mit.edu	37	12	77257607	77257608	+	Intron	INS	-	CC	CC	rs7308963	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77257607_77257608insCC	uc001syl.1	-							NM_001321	NP_001312	Q16527	CSRP2_HUMAN	cysteine and glycine-rich protein 2						multicellular organismal development	nucleus	zinc ion binding			ovary(1)	1						TCACAACCTAATACAGAACAGA	0.426													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	77628140	77628140	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77628140delA								E2F7 (168780 upstream) : NAV3 (596929 downstream)																							GCTTCCTTCTAAGAGTATCAC	0.378													4	2	---	---	---	---	
SYT1	6857	broad.mit.edu	37	12	79741823	79741823	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79741823delA	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron|SYT1_uc001syv.2_Intron	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						catgttttggaaagaggaagt	0.000													4	2	---	---	---	---	
PTPRQ	374462	broad.mit.edu	37	12	81033805	81033806	+	Intron	DEL	GT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81033805_81033806delGT	uc001sze.2	+							NM_001145026	NP_001138498			protein tyrosine phosphatase, receptor type, Q												0						GAAGATACACgtgtgtgtgtgt	0.134													4	2	---	---	---	---	
MGAT4C	25834	broad.mit.edu	37	12	86825734	86825735	+	Intron	DEL	AG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86825734_86825735delAG	uc001tal.3	-						MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						agagcgagacagagagagagag	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	95139131	95139132	+	IGR	DEL	AC	-	-	rs140922808		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95139131_95139132delAC								TMCC3 (94807 upstream) : MIR492 (89042 downstream)																							AAAAAAACAAACAGAGCCCCAA	0.342													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	95200901	95200901	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95200901delT								TMCC3 (156577 upstream) : MIR492 (27273 downstream)																							ccatccattattggccaaatt	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	95796476	95796477	+	IGR	INS	-	AA	AA	rs113133093		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95796476_95796477insAA								MIR331 (94187 upstream) : METAP2 (71345 downstream)																							ctgtctcaattaaaaaaaaaaa	0.198													4	3	---	---	---	---	
USP44	84101	broad.mit.edu	37	12	95925944	95925944	+	Intron	DEL	T	-	-	rs148015527		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95925944delT	uc001teg.2	-						USP44_uc001teh.2_Intron|USP44_uc009zte.2_Intron	NM_001042403	NP_001035862	Q9H0E7	UBP44_HUMAN	ubiquitin thiolesterase 44						anaphase|cell division|mitosis|negative regulation of mitotic anaphase-promoting complex activity|protein deubiquitination|regulation of spindle checkpoint|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)|breast(1)|central_nervous_system(1)	3						tttctttgggttttttttttt	0.199													3	3	---	---	---	---	
NTN4	59277	broad.mit.edu	37	12	96087060	96087061	+	Intron	INS	-	T	T	rs140914258		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96087060_96087061insT	uc001tei.2	-						NTN4_uc009ztf.2_Intron|NTN4_uc009ztg.2_Intron	NM_021229	NP_067052	Q9HB63	NET4_HUMAN	netrin 4 precursor						axon guidance	basement membrane|plasma membrane				upper_aerodigestive_tract(1)|ovary(1)	2						TTGTAGATATGTTTTTTTTTTT	0.391													4	5	---	---	---	---	
ANKS1B	56899	broad.mit.edu	37	12	100184005	100184005	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100184005delG	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		ttaaagtgctgaaggaagaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	101938480	101938481	+	IGR	INS	-	A	A	rs138154727	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101938480_101938481insA								SPIC (57706 upstream) : MYBPC1 (50266 downstream)																							AGAGTAGGTTTAAAAAAAAAGA	0.272													3	3	---	---	---	---	
NT5DC3	51559	broad.mit.edu	37	12	104171946	104171947	+	Intron	INS	-	A	A	rs142223426	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104171946_104171947insA	uc010swe.1	-						NT5DC3_uc010swd.1_5'Flank	NM_001031701	NP_001026871	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3								hydrolase activity|metal ion binding			ovary(2)|skin(1)	3						CACTTCtttttttaaaaaaaaa	0.272													10	5	---	---	---	---	
SLC41A2	84102	broad.mit.edu	37	12	105307849	105307849	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105307849delA	uc001tla.2	-							NM_032148	NP_115524	Q96JW4	S41A2_HUMAN	solute carrier family 41, member 2							integral to membrane|plasma membrane	magnesium ion transmembrane transporter activity			ovary(1)|skin(1)	2						caaaaaaaagaaaaaaaaaaG	0.050													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	105693245	105693245	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105693245delT								APPL2 (63237 upstream) : C12orf75 (31169 downstream)																							tatgcctgtctttactttaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	106004989	106004990	+	IGR	DEL	AG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106004989_106004990delAG								C12orf75 (239694 upstream) : NUAK1 (452135 downstream)																							agagatggaaagagagagagag	0.045													4	2	---	---	---	---	
CMKLR1	1240	broad.mit.edu	37	12	108719676	108719677	+	Intron	INS	-	G	G	rs149434957	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108719676_108719677insG	uc001tmw.2	-						CMKLR1_uc001tmv.2_Intron|CMKLR1_uc009zuv.2_Intron	NM_001142343	NP_001135815	Q99788	CML1_HUMAN	chemokine-like receptor 1 isoform a						chemotaxis|immune response|negative regulation of interleukin-12 production|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage chemotaxis|regulation of calcium-mediated signaling|skeletal system development	integral to plasma membrane	chemokine receptor activity			lung(3)|ovary(1)|pancreas(1)	5						CTGCAGAAAGTGCAAGGACCCC	0.554													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	108797702	108797703	+	IGR	INS	-	A	A	rs138533146		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108797702_108797703insA								CMKLR1 (64608 upstream) : FICD (111348 downstream)																							gactctgtctcaaaaaaaaaaa	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110038721	110038722	+	IGR	INS	-	ACAC	ACAC	rs139715085	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110038721_110038722insACAC								MVK (3651 upstream) : C12orf34 (113468 downstream)																							ACAGCAGCCCTacacacacaca	0.426													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110658984	110658984	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110658984delT								IFT81 (2385 upstream) : ATP2A2 (60048 downstream)																							ggccCAAAACttttttttttt	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	111365484	111365485	+	IGR	DEL	AC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111365484_111365485delAC								MYL2 (7080 upstream) : CUX2 (106344 downstream)																							acacacacagacacacacacac	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	112948168	112948169	+	IGR	DEL	AC	-	-	rs34602387		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112948168_112948169delAC								PTPN11 (452 upstream) : RPH3A (64732 downstream)																							acacacacatacacacacacac	0.228													6	3	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	118133523	118133524	+	Intron	INS	-	A	A	rs76867998	byFrequency	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118133523_118133524insA	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ctcaaacaaacaaaaaaaaaaa	0.163													4	2	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	118404499	118404500	+	Intron	DEL	CT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118404499_118404500delCT	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ttctccctccctctctctctct	0.168													3	6	---	---	---	---	
CCDC60	160777	broad.mit.edu	37	12	119838230	119838230	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119838230delA	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		GGAGACGAGTAAATATTTCAA	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	120325882	120325882	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120325882delA								CIT (10790 upstream) : CCDC64 (101766 downstream)																							ctccgtccccaaaaaaaagaa	0.124													4	2	---	---	---	---	
KDM2B	84678	broad.mit.edu	37	12	121915382	121915383	+	Intron	INS	-	T	T	rs35681515		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121915382_121915383insT	uc001uat.2	-						KDM2B_uc001uar.2_Intron|KDM2B_uc001uas.2_Intron|KDM2B_uc001uau.2_Intron	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						tttgtctttccttttttttttt	0.005													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	122507744	122507747	+	IGR	DEL	GTGT	-	-	rs113442295		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122507744_122507747delGTGT								BCL7A (7796 upstream) : MLXIP (9013 downstream)																							actggaactggtgtgtgtgtgtgt	0.029													3	4	---	---	---	---	
MLXIP	22877	broad.mit.edu	37	12	122584608	122584608	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122584608delT	uc001ubq.2	+							NM_014938	NP_055753	Q9HAP2	MLXIP_HUMAN	MLX interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial outer membrane|nucleus	DNA binding			ovary(2)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		AGTTCAAGTGTTTTTTTTTTC	0.483													6	3	---	---	---	---	
PITPNM2	57605	broad.mit.edu	37	12	123573540	123573540	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123573540delG	uc001uej.1	-						PITPNM2_uc001uek.1_Intron|PITPNM2_uc009zxu.1_Intron	NM_020845	NP_065896	Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein,						metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		agtgagcactgcataaatgtt	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	127888189	127888190	+	IGR	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127888189_127888190insA								LOC100128554 (930859 upstream) : None (None downstream)																							ATTCAATGGACAAAAAAAAATT	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	127990320	127990323	+	IGR	DEL	CCTT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127990320_127990323delCCTT								None (None upstream) : TMEM132C (908968 downstream)																							tccttccctcccttccttccttcc	0.059													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	129334168	129334183	+	IGR	DEL	CTTCTTACTTTTATTA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129334168_129334183delCTTCTTACTTTTATTA								SLC15A4 (25627 upstream) : GLT1D1 (3898 downstream)																							tcctttctttcttcTTACTTTTATTACTTCTtttgt	0.051													4	2	---	---	---	---	
SFRS8	6433	broad.mit.edu	37	12	132277638	132277638	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132277638delT	uc001uja.1	+						SFRS8_uc010tbn.1_Intron	NM_004592	NP_004583	Q12872	SFSWA_HUMAN	splicing factor, arginine/serine-rich 8						mRNA splice site selection|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|RNA binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.44e-07)|Epithelial(86;2.94e-06)|all cancers(50;4.82e-05)		aaggaaagtcttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	80891670	80891670	+	IGR	DEL	A	-	-	rs112296790		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80891670delA								NDFIP2 (761465 upstream) : SPRY2 (18444 downstream)																							ctgtttcaagaaaaaaaaaaa	0.129													4	2	---	---	---	---	
ABCC4	10257	broad.mit.edu	37	13	95735660	95735661	+	Intron	INS	-	GGACT	GGACT			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95735660_95735661insGGACT	uc001vmd.3	-						ABCC4_uc010afk.2_Intron	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	TGTAGTACCAGGGACTGCTTTT	0.267													3	6	---	---	---	---	
CLDN10	9071	broad.mit.edu	37	13	96120474	96120477	+	Intron	DEL	TTTG	-	-	rs150111478		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96120474_96120477delTTTG	uc001vmg.2	+						CLDN10_uc010tii.1_Intron	NM_182848	NP_878268	P78369	CLD10_HUMAN	claudin 10 isoform a						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			TCTTCCTGTTtttgtttgtttgtt	0.127													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19071908	19071908	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19071908delA								None (None upstream) : OR11H12 (305686 downstream)																							AACTGCTACTAAAAAACAAGT	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	31291082	31291082	+	IGR	DEL	A	-	-	rs111525555		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31291082delA								SCFD1 (86064 upstream) : COCH (52659 downstream)																							AATTAAAAAGAAAAAAAAAAC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	38211789	38211790	+	Intron	INS	-	TT	TT	rs71433924		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38211789_38211790insTT	uc001wug.2	+											Homo sapiens chromosome 14 open reading frame 25, mRNA (cDNA clone IMAGE:5268731), partial cds.																		taatttttgcattttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	48161228	48161230	+	IGR	DEL	TTC	-	-	rs7492328		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:48161228_48161230delTTC								MDGA2 (17240 upstream) : None (None downstream)																							ctttctttttttcttcctttctc	0.000													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	60416290	60416290	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60416290delG	uc001xep.1	+											Homo sapiens cDNA FLJ46156 fis, clone TESTI4001569.																		gtttgctcttgcttttaattg	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	65734530	65734531	+	IGR	DEL	GT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65734530_65734531delGT								MAX (165303 upstream) : LOC645431 (142782 downstream)																							GTGTTGGCGGGTGTGTGTGTGT	0.495													4	2	---	---	---	---	
TTLL5	23093	broad.mit.edu	37	14	76166066	76166066	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76166066delT	uc001xrx.2	+						TTLL5_uc001xrw.1_Intron|TTLL5_uc010ask.1_Intron|TTLL5_uc001xry.1_Intron	NM_015072	NP_055887	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5						protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)		tcctccttccttcctctttcc	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	85974763	85974764	+	IGR	INS	-	G	G	rs140497598	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85974763_85974764insG								None (None upstream) : FLRT2 (21724 downstream)																							agtggaggtcaggggcaaagga	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	92011862	92011865	+	IGR	DEL	TTCC	-	-	rs144218730		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92011862_92011865delTTCC								SMEK1 (35049 upstream) : C14orf184 (26923 downstream)																							ctttcctctattccttccttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	102049895	102049895	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102049895delC								DIO3 (20106 upstream) : C14orf72 (146879 downstream)																							cacacgtgcacacaccctcat	0.318													4	2	---	---	---	---	
CINP	51550	broad.mit.edu	37	14	102828834	102828834	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102828834delT	uc001ylv.1	-						TECPR2_uc010txw.1_5'Flank|TECPR2_uc010awl.2_5'Flank|TECPR2_uc001ylw.1_5'Flank|TECPR2_uc010txx.1_5'Flank|CINP_uc001ylu.1_5'Flank	NM_032630	NP_116019	Q9BW66	CINP_HUMAN	cyclin-dependent kinase 2-interacting protein						cell cycle|cell division|DNA repair|DNA replication	nucleus	protein binding			large_intestine(1)	1						CAGAGAGGAGTTTCTGGACGA	0.303													4	2	---	---	---	---	
BRF1	2972	broad.mit.edu	37	14	105682183	105682184	+	Intron	DEL	AC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105682183_105682184delAC	uc001yqp.2	-						BRF1_uc010tyo.1_Intron|BRF1_uc010typ.1_Intron|BRF1_uc001yqk.2_Intron|BRF1_uc001yql.2_Intron|BRF1_uc001yqo.2_Intron|BRF1_uc010axg.1_Intron|BRF1_uc001yqn.2_Intron|BRF1_uc010axh.1_Intron|BRF1_uc010axi.1_Intron	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1						positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		gcatacacagacacaggcacac	0.000													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106503360	106503360	+	Intron	DEL	T	-	-	rs113547368		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106503360delT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						gcaaacaacattttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20012588	20012588	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20012588delG								None (None upstream) : GOLGA6L6 (724506 downstream)																							acatcagaaagaagtttctca	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20019051	20019051	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20019051delC								None (None upstream) : GOLGA6L6 (718043 downstream)																							gaatatatttccttttctaac	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20491110	20491111	+	Intron	INS	-	A	A	rs111296599		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20491110_20491111insA	uc001ytf.1	+											full-length cDNA clone CS0DI026YN18 of Placenta Cot 25-normalized of Homo sapiens (human).																		CTGCTCTTCATAGGTGGGGTGC	0.559													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	26443490	26443491	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26443490_26443491insT								ATP10A (333173 upstream) : GABRB3 (345204 downstream)																							CCCGATGtttctttttttttct	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45988828	45988829	+	IGR	DEL	TT	-	-	rs141285638		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45988828_45988829delTT								SQRDL (5350 upstream) : None (None downstream)																							ccttctttcctttttttttttt	0.000													4	2	---	---	---	---	
BNIP2	663	broad.mit.edu	37	15	59970049	59970050	+	Intron	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59970049_59970050insA	uc010uhc.1	-						BNIP2_uc010uhb.1_Intron	NM_004330	NP_004321	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 2						anti-apoptosis|apoptosis|positive regulation of muscle cell differentiation	nuclear envelope|perinuclear region of cytoplasm	calcium ion binding|GTPase activator activity|protein binding			ovary(1)	1						GATATCCTTCCAAAAAAAAAAG	0.371													33	22	---	---	---	---	
RORA	6095	broad.mit.edu	37	15	60812027	60812030	+	Intron	DEL	AAAC	-	-	rs10565625		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60812027_60812030delAAAC	uc002agv.2	-						uc002ags.1_Intron|RORA_uc002agt.3_Intron|RORA_uc002agw.2_Intron|RORA_uc002agx.2_Intron	NM_134260	NP_599022	P35398	RORA_HUMAN	RAR-related orphan receptor A isoform b						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						tagctcatttaaacaaacaaacaa	0.000													2	7	---	---	---	---	
RORA	6095	broad.mit.edu	37	15	61461472	61461472	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61461472delA	uc002agx.2	-							NM_134261	NP_599023	P35398	RORA_HUMAN	RAR-related orphan receptor A isoform a						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						CACAGCTTGGAAAAAAAAAAA	0.488													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	63273210	63273211	+	IGR	INS	-	T	T	rs138237423	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63273210_63273211insT								TLN2 (136383 upstream) : TPM1 (61627 downstream)																							cttccctggcatttttttttgc	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	63275985	63275986	+	IGR	INS	-	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63275985_63275986insG								TLN2 (139158 upstream) : TPM1 (58852 downstream)																							TTTGGAGAAATTTTTTTATGTG	0.401													3	3	---	---	---	---	
IGDCC3	9543	broad.mit.edu	37	15	65668405	65668405	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65668405delC	uc002aos.2	-							NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule											ovary(3)	3						GGTCCCAGTACCCGGGGTACA	0.507													4	2	---	---	---	---	
DENND4A	10260	broad.mit.edu	37	15	66036507	66036508	+	Intron	INS	-	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66036507_66036508insC	uc002aph.2	-						DENND4A_uc002api.2_Intron|DENND4A_uc002apj.3_Intron|DENND4A_uc010ujj.1_Intron	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						aatacagacaaaaaaaaatcct	0.000													4	2	---	---	---	---	
MEGF11	84465	broad.mit.edu	37	15	66224813	66224814	+	Intron	INS	-	G	G	rs142779049	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66224813_66224814insG	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1						GTTACAGGGTAGGAGACCAGGA	0.446													2	5	---	---	---	---	
MEGF11	84465	broad.mit.edu	37	15	66522081	66522082	+	Intron	DEL	AG	-	-	rs35377947		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66522081_66522082delAG	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1						CCCAGACAACAGAGAGAGCTGG	0.559													3	4	---	---	---	---	
MAP2K5	5607	broad.mit.edu	37	15	68058099	68058100	+	Intron	DEL	AC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68058099_68058100delAC	uc002aqu.2	+						MAP2K5_uc002aqv.2_Intron|MAP2K5_uc002aqw.2_Intron|MAP2K5_uc002aqx.2_Intron	NM_145160	NP_660143	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5						nerve growth factor receptor signaling pathway		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)	2						GCAGGTACAGACACACACACAC	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	68234630	68234631	+	IGR	INS	-	G	G	rs143212519	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68234630_68234631insG								LBXCOR1 (108456 upstream) : PIAS1 (111941 downstream)																							GGACTAGAAGTGGGCCTCTCAG	0.426													3	4	---	---	---	---	
ITGA11	22801	broad.mit.edu	37	15	68659394	68659394	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68659394delT	uc002ari.2	-						ITGA11_uc010bib.2_Intron	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	CTGCCATGCATTTTCTTCTCA	0.507													4	2	---	---	---	---	
THSD4	79875	broad.mit.edu	37	15	71796552	71796552	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71796552delG	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						CTTGAGGGCTGGGACTCCAAA	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	73220334	73220335	+	IGR	DEL	AC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73220334_73220335delAC								ADPGK (143667 upstream) : NEO1 (124540 downstream)																							acacacacagacacacacacac	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	74128390	74128390	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74128390delT								C15orf59 (84574 upstream) : TBC1D21 (37578 downstream)																							tgaaagggacttTTTTTTTTT	0.179													3	3	---	---	---	---	
ARID3B	10620	broad.mit.edu	37	15	74865018	74865019	+	Intron	DEL	AA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74865018_74865019delAA	uc002aye.2	+						ARID3B_uc002ayc.2_Intron|ARID3B_uc002ayd.2_Intron	NM_006465	NP_006456	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						ATCAAAAGCCAAAAAAAAAAAA	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	75261774	75261774	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75261774delT								RPP25 (11999 upstream) : SCAMP5 (26127 downstream)																							catttttagattttttttttt	0.000													3	4	---	---	---	---	
PTPN9	5780	broad.mit.edu	37	15	75792396	75792397	+	Intron	DEL	TG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75792396_75792397delTG	uc002bal.2	-							NM_002833	NP_002824	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type							cytoplasmic part	non-membrane spanning protein tyrosine phosphatase activity|protein binding			lung(1)|skin(1)	2						ggctcacgcctgtaatcctagc	0.000													4	2	---	---	---	---	
SGK269	79834	broad.mit.edu	37	15	77419489	77419490	+	Intron	DEL	CA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77419489_77419490delCA	uc002bcm.2	-							NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member						cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		tgttctctctcacgctctctct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	83413368	83413368	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83413368delA								AP3B2 (34733 upstream) : SCARNA15 (11329 downstream)																							ctgaaaatacaaaaaaaaaag	0.000													4	2	---	---	---	---	
SLC28A1	9154	broad.mit.edu	37	15	85463696	85463697	+	Intron	INS	-	GGGGAA	GGGGAA			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85463696_85463697insGGGGAA	uc002blg.2	+						SLC28A1_uc010upd.1_Intron|SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			aggaaaggaaaggggaagggga	0.015													5	3	---	---	---	---	
SLC28A1	9154	broad.mit.edu	37	15	85470379	85470379	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85470379delG	uc002blg.2	+						SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCCTAGAAAAGGGCTCATTAA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	85695610	85695610	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85695610delT								PDE8A (13240 upstream) : AKAP13 (228261 downstream)																							tgtgcatctcttccatttgac	0.000													4	2	---	---	---	---	
ACAN	176	broad.mit.edu	37	15	89367562	89367562	+	Intron	DEL	C	-	-	rs67696635		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89367562delC	uc010upo.1	+						ACAN_uc002bmx.2_Intron|ACAN_uc010upp.1_Intron|ACAN_uc002bna.2_Intron	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor						cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			aaaaaaaaaacaacaacaaca	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	90722812	90722813	+	IGR	INS	-	T	T	rs74361571		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90722812_90722813insT								IDH2 (77104 upstream) : SEMA4B (5339 downstream)																							AGCCTCAGGGCTTTTTTTTTTT	0.505													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92255026	92255026	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92255026delT								SV2B (416378 upstream) : SLCO3A1 (141912 downstream)																							TTATTATGCGTTTTCATCTTC	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	94257975	94257975	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94257975delA								RGMA (625542 upstream) : MCTP2 (516826 downstream)																							AACGTAGATGAAGAGAGATAA	0.408													4	2	---	---	---	---	
MCTP2	55784	broad.mit.edu	37	15	94951005	94951006	+	Intron	DEL	CA	-	-	rs141182964	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94951005_94951006delCA	uc002btj.2	+						MCTP2_uc010boj.2_Intron|MCTP2_uc010bok.2_Intron|MCTP2_uc002btl.2_Intron	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			TGTACTTGTGcacacacacaca	0.287													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	97266046	97266047	+	IGR	INS	-	GAGA	GAGA	rs141816647	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97266046_97266047insGAGA								NR2F2 (382556 upstream) : SPATA8 (60632 downstream)																							agagagggacggagagagagag	0.287													4	2	---	---	---	---	
RPS2	6187	broad.mit.edu	37	16	2015553	2015555	+	5'Flank	DEL	GGC	-	-	rs10554850		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2015553_2015555delGGC	uc002cnn.2	-						RPS2_uc010bsa.1_5'Flank|RPS2_uc002cnl.2_5'Flank|RPS2_uc002cnm.2_5'Flank|RPS2_uc002cno.2_5'Flank|SNORA64_uc002cnq.2_5'Flank|RNF151_uc002cnt.1_5'Flank	NM_002952	NP_002943	P15880	RS2_HUMAN	ribosomal protein S2						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleoplasm	fibroblast growth factor 1 binding|fibroblast growth factor 3 binding|RNA binding|structural constituent of ribosome				0						CTATCAGCCTGGCGGCAAGTGCA	0.379													1	7	---	---	---	---	
GFER	2671	broad.mit.edu	37	16	2036481	2036482	+	3'UTR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2036481_2036482insT	uc002cob.2	+	3					GFER_uc002coc.2_3'UTR	NM_005262	NP_005253	P55789	ALR_HUMAN	erv1-like growth factor						cell proliferation|spermatogenesis	extracellular region|mitochondrial intermembrane space	growth factor activity|thiol oxidase activity				0						GCTCACTTTAGGGGGCTCAATT	0.624													4	2	---	---	---	---	
KCTD5	54442	broad.mit.edu	37	16	2730360	2730360	+	5'Flank	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2730360delT	uc002crd.2	+							NM_018992	NP_061865	Q9NXV2	KCTD5_HUMAN	potassium channel tetramerisation domain						interspecies interaction between organisms	cytosol|nucleus|voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity				0						GTGCAGGAGGTTTTTCTAGGC	0.522													4	2	---	---	---	---	
PRSS27	83886	broad.mit.edu	37	16	2767421	2767421	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2767421delC	uc002crf.2	-						PRSS27_uc002cre.2_5'Flank|PRSS27_uc002crg.2_Intron|PRSS27_uc010bst.1_Intron	NM_031948	NP_114154	Q9BQR3	PRS27_HUMAN	marapsin precursor						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						GAGACCCCAGCCAGGACCATA	0.582													4	2	---	---	---	---	
NUBP1	4682	broad.mit.edu	37	16	10859120	10859121	+	Intron	DEL	AC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10859120_10859121delAC	uc002daa.1	+						FAM18A_uc010uyr.1_Intron|FAM18A_uc010uys.1_Intron|FAM18A_uc010uyt.1_Intron|FAM18A_uc010bun.2_Intron|FAM18A_uc010uyu.1_Intron|FAM18A_uc002dad.3_Intron|NUBP1_uc002dab.1_Intron	NM_002484	NP_002475	P53384	NUBP1_HUMAN	nucleotide binding protein 1						cell growth|cellular iron ion homeostasis|iron-sulfur cluster assembly	cytosol	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding|nucleoside-triphosphatase activity|protein binding			ovary(1)|skin(1)	2						tcCATTAAATacacacacacac	0.030													3	3	---	---	---	---	
RRN3	54700	broad.mit.edu	37	16	15169108	15169108	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15169108delA	uc002dde.2	-						PDXDC1_uc002ddc.2_Intron|RRN3_uc010uzp.1_Intron|RRN3_uc010uzq.1_Intron	NM_018427	NP_060897	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor						regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm				ovary(1)	1						gtgccccaccaaaaaaaaaaa	0.045													4	2	---	---	---	---	
METTL9	51108	broad.mit.edu	37	16	21613050	21613051	+	Intron	INS	-	TG	TG	rs141525387	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21613050_21613051insTG	uc002dje.2	+						uc002diq.3_Intron|METTL9_uc002djf.2_Intron	NM_016025	NP_057109	Q9H1A3	METL9_HUMAN	methyltransferase like 9 isoform 1											ovary(1)	1				GBM - Glioblastoma multiforme(48;0.0759)		TATTTATATTCtgtgtgtgtgt	0.257													4	2	---	---	---	---	
C16orf52	730094	broad.mit.edu	37	16	22080402	22080402	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22080402delA	uc010vbp.1	+						C16orf52_uc002dkb.1_Intron					RecName: Full=Uncharacterized protein C16orf52;												0						ttcagtaaGGagatacagtgc	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	22734984	22734989	+	IGR	DEL	GAGGCT	-	-	rs112802254		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22734984_22734989delGAGGCT								LOC653786 (146798 upstream) : HS3ST2 (90871 downstream)																							agctactccagaggctgaggctgagg	0.000													3	3	---	---	---	---	
PRKCB	5579	broad.mit.edu	37	16	24141032	24141033	+	Intron	INS	-	ATCA	ATCA	rs150796694	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24141032_24141033insATCA	uc002dmd.2	+						PRKCB_uc002dme.2_Intron	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	gtctacgtatcatcaatcaatc	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	24542612	24542612	+	IGR	DEL	A	-	-	rs111742537		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24542612delA								CACNG3 (168876 upstream) : RBBP6 (6402 downstream)																							CTATTTGGAGAAAAAAAAATG	0.065													2	4	---	---	---	---	
SLC5A11	115584	broad.mit.edu	37	16	24869749	24869750	+	Intron	INS	-	TGAA	TGAA	rs140546428	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24869749_24869750insTGAA	uc002dmu.2	+						SLC5A11_uc002dms.2_Intron|SLC5A11_uc010vcd.1_Intron|SLC5A11_uc002dmt.2_Intron|SLC5A11_uc010vce.1_Intron|SLC5A11_uc010bxt.2_Intron	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose						apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)		TGAATATGTGTtgaatgaatga	0.302													5	3	---	---	---	---	
STX1B	112755	broad.mit.edu	37	16	31017186	31017186	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31017186delC	uc010cad.2	-						STX1B_uc010vfd.1_Intron	NM_052874	NP_443106	P61266	STX1B_HUMAN	syntaxin 1B						intracellular protein transport|neurotransmitter transport|synaptic transmission	integral to plasma membrane	extracellular-glutamate-gated ion channel activity|SNAP receptor activity				0						ATCCAAGCCTCCAGCTGCAGC	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32094264	32094264	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32094264delT								ZNF267 (165638 upstream) : HERC2P4 (68346 downstream)																							gtgggtatcatgaaaattatg	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32381128	32381129	+	IGR	DEL	TT	-	-	rs139854716		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32381128_32381129delTT								HERC2P4 (217254 upstream) : TP53TG3B (303712 downstream)																							gtcttgactctttatccagttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32526437	32526437	+	IGR	DEL	T	-	-	rs112044218		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32526437delT								HERC2P4 (362563 upstream) : TP53TG3B (158404 downstream)																							agaaagttactttctagtctt	0.000													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32527151	32527152	+	IGR	INS	-	TTT	TTT	rs145341404		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32527151_32527152insTTT								HERC2P4 (363277 upstream) : TP53TG3B (157689 downstream)																							tggatattcacttcaccattgg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32643600	32643601	+	IGR	INS	-	G	G	rs137989120	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32643600_32643601insG								HERC2P4 (479726 upstream) : TP53TG3B (41240 downstream)																							ATCTTCCCGGCGGGGGGGTTCC	0.525													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32831523	32831523	+	IGR	DEL	A	-	-	rs147098957		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32831523delA								TP53TG3B (142645 upstream) : SLC6A10P (57274 downstream)																							gaaaaaatccaaaggtacagt	0.104													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33361839	33361840	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33361839_33361840insT								SLC6A10P (465376 upstream) : MIR1826 (603668 downstream)																							CTCCCACAAAAttttttttttt	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33384858	33384859	+	IGR	INS	-	CAA	CAA	rs149723686	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33384858_33384859insCAA								SLC6A10P (488395 upstream) : MIR1826 (580649 downstream)																							accagcctgggcaacagaatga	0.045													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33492738	33492738	+	IGR	DEL	T	-	-	rs71378056		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33492738delT								SLC6A10P (596275 upstream) : MIR1826 (472770 downstream)																							cacccagggatcccccagcag	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33922626	33922627	+	IGR	DEL	TG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33922626_33922627delTG								None (None upstream) : MIR1826 (42881 downstream)																							ATTGCCTGTCTGTGGCCACAAG	0.535													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34181148	34181148	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34181148delT								MIR1826 (215556 upstream) : UBE2MP1 (222654 downstream)																							cattgatttctttttgatgat	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46466145	46466145	+	IGR	DEL	A	-	-	rs148234300	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46466145delA								None (None upstream) : ANKRD26P1 (37104 downstream)																							TCTAATCTTTAAAAAATAAAA	0.284													4	2	---	---	---	---	
ZNF423	23090	broad.mit.edu	37	16	49827933	49827934	+	Intron	DEL	TC	-	-	rs111408512		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49827933_49827934delTC	uc002efs.2	-							NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423						cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				tctgtctctgtctctctctctc	0.000													2	4	---	---	---	---	
NLRC5	84166	broad.mit.edu	37	16	57111993	57111994	+	Intron	INS	-	G	G	rs142860883	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57111993_57111994insG	uc002ekk.1	+						NLRC5_uc010ccr.1_Intron|NLRC5_uc010ccs.1_Intron|NLRC5_uc002eko.1_Intron|NLRC5_uc002ekq.1_Intron|NLRC5_uc002ekr.1_Intron	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27						defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				TCGGGAGCAGTGGGGGGGTCCA	0.649													6	3	---	---	---	---	
PLLP	51090	broad.mit.edu	37	16	57309033	57309042	+	Intron	DEL	ACACACACAT	-	-	rs147068559	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57309033_57309042delACACACACAT	uc002elg.1	-							NM_015993	NP_057077	Q9Y342	PLLP_HUMAN	plasmolipin							integral to membrane	ion channel activity				0						acacacacacacacacacaTGCATTTCAGA	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	63279598	63279599	+	IGR	DEL	CA	-	-	rs71391874		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63279598_63279599delCA								None (None upstream) : None (None downstream)																							gaaaatccatcacacacacaca	0.094													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	64421851	64421851	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64421851delA								None (None upstream) : CDH11 (558834 downstream)																							CATCAGACAGAAAAAAAAATG	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	66203427	66203432	+	IGR	DEL	AAAGAA	-	-	rs142904820	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66203427_66203432delAAAGAA								LOC283867 (593224 upstream) : CDH5 (197093 downstream)																							ggaaggaaagaaagaaagaaaagaaa	0.024													4	2	---	---	---	---	
LRRC36	55282	broad.mit.edu	37	16	67412318	67412319	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67412318_67412319insT	uc002esv.2	+						LRRC36_uc002esw.2_Intron|LRRC36_uc002esx.2_Intron|LRRC36_uc010vjk.1_Intron|LRRC36_uc010vjl.1_Intron|LRRC36_uc002esy.2_Intron	NM_018296	NP_060766	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36 isoform 1												0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		aattttttgtattttagtagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	68652935	68652936	+	IGR	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68652935_68652936insA								ZFP90 (51897 upstream) : CDH3 (25215 downstream)														p.?(1)									ttatcaatgttaaaaaaaAaat	0.000													4	2	---	---	---	---	
WDR59	79726	broad.mit.edu	37	16	74948493	74948493	+	Intron	DEL	T	-	-	rs68101656		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74948493delT	uc002fdh.1	-						WDR59_uc002fdi.2_Intron|WDR59_uc002fdj.2_Intron|WDR59_uc002fdg.1_Intron	NM_030581	NP_085058	Q6PJI9	WDR59_HUMAN	WD repeat domain 59											ovary(1)|breast(1)	2						cagcagactattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	75785279	75785280	+	IGR	INS	-	TG	TG	rs148638860	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75785279_75785280insTG								TERF2IP (93951 upstream) : CNTNAP4 (525896 downstream)																							atgtgtgtatatgtgtgtgtgt	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	77722008	77722009	+	IGR	INS	-	A	A	rs5818076		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77722008_77722009insA								ADAMTS18 (252997 upstream) : NUDT7 (34402 downstream)																							AAGTTAAAAAGAAAAAAAAAAA	0.416													4	2	---	---	---	---	
WWOX	51741	broad.mit.edu	37	16	78138229	78138236	+	Intron	DEL	CACGCACG	-	-	rs72048327		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78138229_78138236delCACGCACG	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron|WWOX_uc002ffj.1_Intron	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		TCAAAAAacacacgcacgcacgcacgca	0.178													4	2	---	---	---	---	
WWOX	51741	broad.mit.edu	37	16	79015339	79015339	+	Intron	DEL	T	-	-	rs112807305		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79015339delT	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		TGAAGCATCAttttttttttt	0.249													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	80265675	80265676	+	IGR	DEL	GA	-	-	rs66824120		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80265675_80265676delGA								MAF (631053 upstream) : DYNLRB2 (309178 downstream)																							CAGAAAAGGTGAGAGAGAGAGA	0.485													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	80330142	80330144	+	IGR	DEL	TTG	-	-	rs71751249		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80330142_80330144delTTG								MAF (695520 upstream) : DYNLRB2 (244710 downstream)																							ttgttttgttttgttgttgttgt	0.000													5	3	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	82689918	82689919	+	Intron	DEL	GT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82689918_82689919delGT	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		AATGgtgtgcgtgtgtgtgtgt	0.238													3	5	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	82706404	82706407	+	Intron	DEL	ACAT	-	-	rs10612753	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82706404_82706407delACAT	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		acacacacacacatacacacacac	0.123													3	5	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	82748880	82748880	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82748880delA	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		TTGCAGGCTGAAAATCAACTA	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	83907676	83907677	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83907676_83907677insT								HSBP1 (61082 upstream) : MLYCD (25053 downstream)																							ggatttgtcaattttatccttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	83923257	83923262	+	IGR	DEL	CTGCAC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83923257_83923262delCTGCAC								HSBP1 (76663 upstream) : MLYCD (9468 downstream)																							gcatgagccactgcacctggcctgaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	83968696	83968697	+	IGR	INS	-	GACA	GACA	rs150971160	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83968696_83968697insGACA								MLYCD (18911 upstream) : OSGIN1 (13975 downstream)																							agagagcagaggacaccctgcc	0.064													3	3	---	---	---	---	
ATP2C2	9914	broad.mit.edu	37	16	84438416	84438416	+	Intron	DEL	T	-	-	rs147406866		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84438416delT	uc002fhx.2	+						ATP2C2_uc010chj.2_Intron|ATP2C2_uc002fhy.2_5'UTR|ATP2C2_uc002fhz.2_5'Flank	NM_014861	NP_055676	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2						ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			breast(1)|central_nervous_system(1)	2						tcccaAGACCttttttttttt	0.159													4	2	---	---	---	---	
KIAA0513	9764	broad.mit.edu	37	16	85102813	85102814	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85102813_85102814insT	uc002fiu.2	+						KIAA0513_uc002fis.3_Intron|KIAA0513_uc010voj.1_Intron|KIAA0513_uc002fit.2_Intron	NM_014732	NP_055547	O60268	K0513_HUMAN	hypothetical protein LOC9764							cytoplasm				breast(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.234)		atttttttgtgttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85289019	85289019	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85289019delT								FAM92B (142905 upstream) : KIAA0182 (356010 downstream)																							cagtgcctacttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86135856	86135857	+	IGR	INS	-	GGG	GGG	rs111500347		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86135856_86135857insGGG								IRF8 (179647 upstream) : LOC732275 (229599 downstream)																							GGAGATGCTcttccttcctccc	0.233													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86427763	86427768	+	IGR	DEL	ACCATC	-	-	rs146654727		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86427763_86427768delACCATC								LOC732275 (48478 upstream) : FOXF1 (116365 downstream)																							catcagcattaccatcaccatcacca	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86659573	86659574	+	IGR	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86659573_86659574insA								FOXL1 (44270 upstream) : FBXO31 (703370 downstream)																							ATGTAGAAAAGAAAAAAAATTC	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87047752	87047752	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87047752delC								FOXL1 (432449 upstream) : FBXO31 (315192 downstream)																							cattcgctcactttctcattc	0.000													4	2	---	---	---	---	
ZFPM1	161882	broad.mit.edu	37	16	88527642	88527646	+	Intron	DEL	CAGGG	-	-	rs68149105		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88527642_88527646delCAGGG	uc002fkv.2	+							NM_153813	NP_722520	Q8IX07	FOG1_HUMAN	zinc finger protein, multitype 1						blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|transcription factor binding|zinc ion binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGTGAGGACCCAGGGGTGGGGCGGG	0.737													5	3	---	---	---	---	
RNF166	115992	broad.mit.edu	37	16	88766976	88766977	+	Intron	INS	-	T	T	rs149328410	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88766976_88766977insT	uc002flk.2	-						RNF166_uc002fll.2_Intron	NM_178841	NP_849163	Q96A37	RN166_HUMAN	ring finger protein 166							intracellular	zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0476)		CTTCATAGAACTTATTCACCTG	0.574													4	7	---	---	---	---	
ARRB2	409	broad.mit.edu	37	17	4618989	4618990	+	Intron	INS	-	AC	AC	rs150787978	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4618989_4618990insAC	uc002fyj.2	+						ARRB2_uc002fyk.2_Intron|ARRB2_uc002fyl.2_Intron|ARRB2_uc010vsg.1_Intron|ARRB2_uc002fym.2_Intron|ARRB2_uc002fyn.2_Intron|ARRB2_uc010ckq.2_Intron|ARRB2_uc002fyo.2_5'Flank	NM_004313	NP_004304	P32121	ARRB2_HUMAN	arrestin, beta 2 isoform 1						cell chemotaxis|desensitization of G-protein coupled receptor protein signaling pathway by arrestin|G-protein coupled receptor internalization|negative regulation of natural killer cell mediated cytotoxicity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|transcription from RNA polymerase II promoter|transforming growth factor beta receptor signaling pathway	coated pit|cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	angiotensin receptor binding|ubiquitin protein ligase binding				0						GTTGGCTGAGGacacacacaca	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6300393	6300393	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6300393delA								WSCD1 (272648 upstream) : AIPL1 (26667 downstream)																							tacaggaagcaaaaggaaaac	0.000													4	2	---	---	---	---	
MYH3	4621	broad.mit.edu	37	17	10555065	10555065	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10555065delT	uc002gmq.1	-							NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,						muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						attattattgttttttttttt	0.189													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	13038550	13038551	+	IGR	DEL	TG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13038550_13038551delTG								ELAC2 (117191 upstream) : HS3ST3A1 (360455 downstream)																							gcttgtatgatgtgtgtgtgtg	0.238													4	2	---	---	---	---	
ADORA2B	136	broad.mit.edu	37	17	15870546	15870546	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15870546delT	uc002gpd.1	+							NM_000676	NP_000667	P29275	AA2BR_HUMAN	adenosine A2b receptor						activation of MAPK activity|cellular defense response|excretion|JNK cascade	integral to plasma membrane				ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.0855)	Defibrotide(DB04932)|Enprofylline(DB00824)|Pegademase bovine(DB00061)|Theophylline(DB00277)	CCTGCTTGCCttttttttttt	0.318													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	19015760	19015765	+	5'Flank	DEL	CACTCC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19015760_19015765delCACTCC	uc010vym.1	-											DL492381																		ctctccctctcactccccaatacgga	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21326303	21326303	+	IGR	DEL	G	-	-	rs76864456	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21326303delG								KCNJ12 (3124 upstream) : C17orf51 (105269 downstream)																							TGAGGGGGGTGGGGCTGCGGT	0.622													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21408393	21408394	+	IGR	INS	-	AA	AA	rs111709964		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21408393_21408394insAA								KCNJ12 (85214 upstream) : C17orf51 (23178 downstream)																							TAATAGGTGTTAAAAAAAAAAA	0.287													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25279732	25279733	+	IGR	INS	-	AGG	AGG			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25279732_25279733insAGG								None (None upstream) : WSB1 (341373 downstream)																							agaaggaaggaagaaaaaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25291481	25291481	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25291481delA								None (None upstream) : WSB1 (329625 downstream)																							cataattttcatgatacccac	0.085													6	3	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	31638446	31638447	+	Intron	INS	-	TG	TG	rs149270237	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31638446_31638447insTG	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	gtctgtctatctgtgtgtgtgt	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	32576882	32576882	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32576882delG								ACCN1 (93057 upstream) : CCL2 (5414 downstream)																							gacaccacctggggctccttc	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	32719714	32719715	+	IGR	INS	-	GT	GT	rs146061824	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32719714_32719715insGT								CCL1 (29462 upstream) : C17orf102 (181427 downstream)																							tgtgtgtgtgagtgtgtgtgtg	0.218													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	37019196	37019196	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37019196delT								RPL23 (9143 upstream) : LASP1 (6916 downstream)																							aattttttactttttttttgg	0.025													4	2	---	---	---	---	
FBXO47	494188	broad.mit.edu	37	17	37120055	37120056	+	Intron	INS	-	T	T	rs55720457		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37120055_37120056insT	uc002hrc.2	-							NM_001008777	NP_001008777	Q5MNV8	FBX47_HUMAN	F-box protein 47												0						ttgttttgttgttttttttttt	0.074													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	39458574	39458586	+	IGR	DEL	GTACAGATGGTTG	-	-	rs149006127		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39458574_39458586delGTACAGATGGTTG								KRTAP9-9 (45959 upstream) : KRTAP17-1 (12585 downstream)																							TGGACTAGCTGTACAGATGGTTGGTAGGCAAGA	0.516													4	3	---	---	---	---	
PYY	5697	broad.mit.edu	37	17	42047117	42047118	+	Intron	INS	-	T	T	rs145113407		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42047117_42047118insT	uc002ieq.2	-							NM_004160	NP_004151	P10082	PYY_HUMAN	peptide YY precursor						cell proliferation|cell-cell signaling|cellular component movement|cytoskeleton organization|digestion|G-protein coupled receptor protein signaling pathway	soluble fraction					0		Breast(137;0.00314)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.12)		acaaaaaaaacttttttttttt	0.000													2	4	---	---	---	---	
ADAM11	4185	broad.mit.edu	37	17	42840511	42840513	+	Intron	DEL	ACA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42840511_42840513delACA	uc002ihh.2	+						ADAM11_uc010wjd.1_Intron	NM_002390	NP_002381	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11 preproprotein						integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			pancreas(1)	1		Prostate(33;0.0959)				ctcacacaatacaacaacaacaa	0.025													4	2	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45329344	45329345	+	5'Flank	DEL	AC	-	-	rs111355407		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45329344_45329345delAC	uc002ilj.2	+						ITGB3_uc002ili.1_5'Flank|ITGB3_uc010wkr.1_5'Flank	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	cctagagcaaacacacacacac	0.000													4	2	---	---	---	---	
SNX11	29916	broad.mit.edu	37	17	46190911	46190911	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46190911delT	uc002inf.1	+						SNX11_uc010wlg.1_Intron|SNX11_uc010wlh.1_Intron|SNX11_uc010wli.1_Intron|SNX11_uc010wlj.1_Intron|SNX11_uc002ing.1_Intron|SNX11_uc002inh.1_Intron	NM_152244	NP_689450	Q9Y5W9	SNX11_HUMAN	sorting nexin 11						cell communication|protein transport	membrane	phosphatidylinositol binding				0						gttttttgggttttttttttt	0.164													8	4	---	---	---	---	
HOXB6	3216	broad.mit.edu	37	17	46678354	46678355	+	Intron	DEL	GT	-	-	rs145692409		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46678354_46678355delGT	uc002ins.1	-						HOXB6_uc010dbh.1_Intron|HOXB6_uc002int.1_5'Flank|uc002inu.2_5'Flank	NM_018952	NP_061825	P17509	HXB6_HUMAN	homeobox B6						anterior/posterior axis specification, embryo	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GGATATTtgcgtgtgtgtgtgt	0.342													3	3	---	---	---	---	
UTP18	51096	broad.mit.edu	37	17	49353082	49353083	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49353082_49353083insT	uc002its.2	+							NM_016001	NP_057085	Q9Y5J1	UTP18_HUMAN	UTP18, small subunit processome component						rRNA processing	nucleolus					0			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			TTTGTTTTTTGTTTTTTTTTTT	0.287													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	53630528	53630528	+	IGR	DEL	T	-	-	rs71361792		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53630528delT								MMD (131187 upstream) : TMEM100 (166462 downstream)																							agaaactcagttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	54675813	54675814	+	IGR	INS	-	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54675813_54675814insC								NOG (2862 upstream) : C17orf67 (193461 downstream)																							GGGTCCTCTGGCCCCCAGAGTC	0.545													4	2	---	---	---	---	
DGKE	8526	broad.mit.edu	37	17	54912088	54912088	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54912088delG	uc002iur.2	+						DGKE_uc002ius.1_5'Flank|C17orf67_uc002iuq.2_5'Flank	NM_003647	NP_003638	P52429	DGKE_HUMAN	diacylglycerol kinase epsilon						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|phospholipid biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding|protein binding			breast(2)	2	Breast(9;3.59e-07)					GGAAGGGGGCGGGGAAGGGAT	0.697													21	16	---	---	---	---	
SFRS1	6426	broad.mit.edu	37	17	56082957	56082958	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56082957_56082958delTC	uc002ivi.2	-	4	765_766	c.556_557delGA	c.(556-558)GAAfs	p.E186fs	SFRS1_uc002ivj.2_3'UTR	NM_006924	NP_008855	Q07955	SRSF1_HUMAN	splicing factor, arginine/serine-rich 1 isoform	186	RRM 2.			Missing: In MR-E; loss of ability to activate splicing.|Missing: In MR-B; strongly inhibits splicing.	mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA 5'-splice site recognition|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytoplasm|nuclear speck	nucleotide binding|RNA binding				0		Colorectal(1115;0.0691)		LUAD - Lung adenocarcinoma(1115;0.247)		GTAGGCAGTTTCTCCCTATTGG	0.431													39	29	---	---	---	---	
PPM1E	22843	broad.mit.edu	37	17	57001108	57001110	+	Intron	DEL	AAA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57001108_57001110delAAA	uc002iwx.2	+						PPM1E_uc010ddd.2_Intron	NM_014906	NP_055721	Q8WY54	PPM1E_HUMAN	protein phosphatase 1E						protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(3)|lung(1)|skin(1)	5	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			acttcgtctcaaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	63457339	63457339	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63457339delT								RGS9 (233520 upstream) : AXIN2 (67346 downstream)																							GTTTTCAACAttttttttttt	0.189													3	3	---	---	---	---	
CACNG5	27091	broad.mit.edu	37	17	64874302	64874302	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64874302delT	uc010wqi.1	+						CACNG5_uc002jfr.2_Intron|CACNG5_uc010wqj.1_Intron	NM_145811	NP_665810	Q9UF02	CCG5_HUMAN	voltage-dependent calcium channel gamma-5						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|postsynaptic density|postsynaptic membrane	voltage-gated calcium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)			AATTCTATCCTTTATCCCTTT	0.473													4	2	---	---	---	---	
BPTF	2186	broad.mit.edu	37	17	65979894	65979894	+	3'UTR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65979894delA	uc002jgf.2	+	28					BPTF_uc002jge.2_3'UTR|BPTF_uc002jgg.2_3'UTR	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor						brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTATCTAATTATTGTTTTTCA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	66623829	66623830	+	IGR	INS	-	TT	TT	rs56351818		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66623829_66623830insTT								FAM20A (26734 upstream) : ABCA8 (239603 downstream)																							ttctctttctctctctttcttt	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68547129	68547130	+	IGR	INS	-	TG	TG	rs144010401	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68547129_68547130insTG								KCNJ2 (370948 upstream) : None (None downstream)																							CTGTATCTCACtgtgtgtgagt	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68651249	68651250	+	IGR	INS	-	GT	GT	rs144804846	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68651249_68651250insGT								KCNJ2 (475068 upstream) : None (None downstream)																							CTCCTTTGCAGgtgtgtgtgtg	0.287													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70281454	70281455	+	IGR	DEL	GT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70281454_70281455delGT								SOX9 (158902 upstream) : SLC39A11 (360631 downstream)																							gtgtatgttcgtgtgtgtgtgt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70514803	70514803	+	Intron	DEL	C	-	-	rs113434423		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70514803delC	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																		CTCATTCAGTCCAAGCCTAAA	0.318													4	2	---	---	---	---	
SLC39A11	201266	broad.mit.edu	37	17	70869597	70869597	+	Intron	DEL	A	-	-	rs66968967		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70869597delA	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						ccatccttccaacttggctgg	0.035													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	71669410	71669411	+	IGR	INS	-	A	A	rs143922016		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71669410_71669411insA								SDK2 (29183 upstream) : C17orf54 (75998 downstream)																							gactccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	71700283	71700284	+	IGR	INS	-	CT	CT			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71700283_71700284insCT								SDK2 (60056 upstream) : C17orf54 (45125 downstream)																							ttccatccttcctctctcttcc	0.005													4	2	---	---	---	---	
UNC13D	201294	broad.mit.edu	37	17	73833153	73833154	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73833153_73833154insT	uc002jpp.2	-						UNC13D_uc010wsk.1_Intron|UNC13D_uc002jpq.1_Intron|UNC13D_uc010dgq.1_Intron	NM_199242	NP_954712	Q70J99	UN13D_HUMAN	unc-13 homolog D						positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding			upper_aerodigestive_tract(1)|skin(1)	2			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			tttgttttgtgttttttttttt	0.248									Familial_Hemophagocytic_Lymphohistiocytosis				4	2	---	---	---	---	
SEPT9	10801	broad.mit.edu	37	17	75347126	75347126	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75347126delG	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)			ggacctgtgtggtgtgtgctg	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75553217	75553225	+	5'Flank	DEL	CCTTCCTTC	-	-	rs67301595	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75553217_75553225delCCTTCCTTC	uc002jua.1	+											Homo sapiens cDNA FLJ38915 fis, clone NT2NE2008867.																		TTCttcctttccttccttcccttccttcc	0.211													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	78228024	78228026	+	IGR	DEL	CCT	-	-	rs67904697		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78228024_78228026delCCT								SLC26A11 (727 upstream) : RNF213 (85700 downstream)																							AGGTCCCTTGCCTCCTCCCATTt	0.350													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	78471870	78471871	+	IGR	DEL	TG	-	-	rs143186253		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78471870_78471871delTG								NPTX1 (21466 upstream) : RPTOR (46754 downstream)																							gtgtgtgtgttgtgtgtatatg	0.198													1	6	---	---	---	---	
FASN	2194	broad.mit.edu	37	17	80047647	80047647	+	Intron	DEL	G	-	-	rs12937862	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80047647delG	uc002kdu.2	-						FASN_uc002kdw.1_5'Flank	NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase						energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	ACACCGAGCCGCTCCCAGCCA	0.642													4	2	---	---	---	---	
EMILIN2	84034	broad.mit.edu	37	18	2865909	2865910	+	Intron	INS	-	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2865909_2865910insG	uc002kln.2	+							NM_032048	NP_114437	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2 precursor						cell adhesion	collagen	extracellular matrix constituent conferring elasticity|protein binding			skin(2)|ovary(1)	3				READ - Rectum adenocarcinoma(2;0.1)		cggcaatggcaggtgcccctcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11536657	11536657	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11536657delA								FAM38B (834678 upstream) : GNAL (152479 downstream)																							catgctgaggaaaagaattca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	12217676	12217676	+	IGR	DEL	T	-	-	rs112871832		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12217676delT								IMPA2 (186800 upstream) : CIDEA (36642 downstream)																							ACATTAGAAATTTTTTTTCCA	0.363													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15384999	15384999	+	IGR	DEL	G	-	-	rs112267991		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15384999delG								LOC644669 (59081 upstream) : None (None downstream)																							tcatctcatagagttgaacat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	18513343	18513344	+	IGR	INS	-	T	T	rs80208589		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18513343_18513344insT								None (None upstream) : ROCK1 (16361 downstream)																							ttctcagaagctccttgtgatg	0.000													4	2	---	---	---	---	
KCTD1	284252	broad.mit.edu	37	18	24049888	24049889	+	Intron	INS	-	AAAC	AAAC	rs142245337	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24049888_24049889insAAAC	uc002kvw.2	-						KCTD1_uc010xbj.1_Intron|KCTD1_uc010xbk.1_Intron|KCTD1_uc002kvy.2_Intron	NM_001136205	NP_001129677	Q719H9	KCTD1_HUMAN	potassium channel tetramerisation domain						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity			ovary(1)	1	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			CCATCTcaaaaaaacaaacaaa	0.228													2	4	---	---	---	---	
ASXL3	80816	broad.mit.edu	37	18	31198534	31198534	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31198534delT	uc010dmg.1	+						ASXL3_uc002kxq.2_Intron	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						TCCTGATAACTTTTTGGAAGT	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	36380784	36380784	+	IGR	DEL	T	-	-	rs71383588		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36380784delT								None (None upstream) : LOC647946 (406104 downstream)																							CCCAATAGAATTAATAATCAG	0.368													1	5	---	---	---	---	
LOC647946	647946	broad.mit.edu	37	18	36788075	36788075	+	RNA	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36788075delA	uc002lak.1	-	4		c.1155delT			LOC647946_uc010xcj.1_RNA|LOC647946_uc002lal.1_RNA					Homo sapiens cDNA FLJ33284 fis, clone ASTRO2009458.												0						AAGTTGCCTTAAAAAAAAAAG	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	37545732	37545732	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37545732delT								LOC647946 (165450 upstream) : None (None downstream)																							TAGAAGAGCATTTTAAAATAG	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	38229630	38229631	+	IGR	DEL	AC	-	-	rs111690427		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38229630_38229631delAC								LOC647946 (849348 upstream) : KC6 (830607 downstream)																							acacacacatacacacacacac	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	68098364	68098364	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68098364delT								SOCS6 (100930 upstream) : None (None downstream)																							CAACACAGGGTTTTATACACA	0.438													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75670148	75670149	+	IGR	INS	-	C	C			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75670148_75670149insC								GALR1 (688054 upstream) : None (None downstream)																							caccaccagcaccccaaaaaca	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	80841	80842	+	IGR	DEL	CT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:80841_80842delCT								FAM138F (3151 upstream) : OR4F17 (26304 downstream)																							cccctgctgcctctttctgaac	0.000													3	3	---	---	---	---	
STK11	6794	broad.mit.edu	37	19	1221314	1221314	+	Frame_Shift_Del	DEL	C	-	-	rs67873004		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1221314delC	uc002lrl.1	+	6	1952	c.837delC	c.(835-837)GGCfs	p.G279fs		NM_000455	NP_000446	Q15831	STK11_HUMAN	serine/threonine protein kinase 11	279	Protein kinase.				anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	p.0?(19)|p.P281fs*6(2)|p.?(2)|p.Y246fs*3(1)|p.G279F(1)		lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGACTGTGGCCCCCCGCTCT	0.607		14	D|Mis|N|F|S		NSCLC|pancreatic	jejunal harmartoma|ovarian|testicular|pancreatic			Peutz-Jeghers_syndrome	TSP Lung(3;<1E-08)			3	15	---	---	---	---	
PLK5P	126520	broad.mit.edu	37	19	1525005	1525005	+	Intron	DEL	T	-	-	rs66651666		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1525005delT	uc002ltf.2	+						PLK5P_uc002ltg.1_5'UTR|PLK5P_uc010dsm.1_5'Flank	NR_026557				RecName: Full=Putative serine/threonine-protein kinase-like protein PLK5; AltName: Full=Putative Polo-like kinase 5;          Short=PLK-5;												0						tgtctgggcgttgcgtgtttg	0.244													0	9	---	---	---	---	
GNG7	2788	broad.mit.edu	37	19	2587907	2587908	+	Intron	DEL	GA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2587907_2587908delGA	uc002lwd.2	-							NM_052847	NP_443079	O60262	GBG7_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		agaaaagaaggagagagagaga	0.015													5	3	---	---	---	---	
THOP1	7064	broad.mit.edu	37	19	2802884	2802884	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2802884delA	uc002lwj.2	+						THOP1_uc010xgz.1_Intron	NM_003249	NP_003240	P52888	THOP1_HUMAN	thimet oligopeptidase 1						proteolysis	cytoplasm	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		catttatcccagtgctcaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	6643763	6643764	+	IGR	DEL	AA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6643763_6643764delAA								CD70 (52600 upstream) : TNFSF14 (20802 downstream)																							aactccgtctaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9916179	9916180	+	IGR	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9916179_9916180insA								ZNF846 (36769 upstream) : FBXL12 (4765 downstream)																							aaacaaaaaacaaaaaaaaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	11251249	11251249	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11251249delC								LDLR (6746 upstream) : SPC24 (6582 downstream)																							gaggctgaggcggcagatcac	0.000													4	2	---	---	---	---	
RGL3	57139	broad.mit.edu	37	19	11526893	11526893	+	Intron	DEL	T	-	-	rs143904966		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11526893delT	uc002mrp.2	-						RGL3_uc002mrn.2_Intron|RGL3_uc002mrm.2_Intron|RGL3_uc002mro.2_Intron	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						TCCTGGTACCttttttttttt	0.308													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	12317613	12317614	+	Intron	INS	-	T	T	rs113076419		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12317613_12317614insT	uc002mtk.1	+						uc010dyq.1_Intron|uc002mtj.1_Intron					Homo sapiens cDNA FLJ13242 fis, clone OVARC1000578.																		ttttgtttttgttttttttttt	0.198													4	2	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13386554	13386554	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13386554delC	uc010dze.2	-						CACNA1A_uc010xnd.1_Intron|CACNA1A_uc002mwx.3_Intron|CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc010xne.1_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	GTCCCCGGAGCCCACACACCC	0.582													4	2	---	---	---	---	
PKN1	5585	broad.mit.edu	37	19	14566015	14566015	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14566015delA	uc002myp.2	+						PKN1_uc002myq.2_Intron	NM_002741	NP_002732	Q16512	PKN1_HUMAN	protein kinase N1 isoform 2						activation of JUN kinase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	endosome|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|GTP-Rho binding|histone binding|histone deacetylase binding|histone kinase activity (H3-T11 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|Rac GTPase binding			ovary(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8						ACGTATGTACAAAAAAAAAAG	0.264													4	2	---	---	---	---	
CYP4F3	4051	broad.mit.edu	37	19	15762183	15762183	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15762183delT	uc002nbj.2	+						CYP4F3_uc010xok.1_Intron|CYP4F3_uc010xol.1_Intron|CYP4F3_uc010xom.1_Intron|CYP4F3_uc002nbk.2_Intron|CYP4F3_uc010xon.1_Intron	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,						leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						TATCtttgtcttttttttttt	0.020													3	3	---	---	---	---	
CYP4F3	4051	broad.mit.edu	37	19	15769843	15769843	+	Intron	DEL	G	-	-	rs111660338		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15769843delG	uc002nbj.2	+						CYP4F3_uc010xok.1_Intron|CYP4F3_uc010xol.1_Intron|CYP4F3_uc010xom.1_Intron|CYP4F3_uc002nbk.2_Intron|CYP4F3_uc010xon.1_Intron	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,						leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						GGTCTAGGCTGGGGGGTTGGA	0.577													1	6	---	---	---	---	
CIB3	117286	broad.mit.edu	37	19	16281633	16281634	+	Intron	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16281633_16281634insA	uc002nds.2	-						CIB3_uc010eae.2_Intron|CIB3_uc010eaf.2_Intron|CIB3_uc010eag.2_Intron	NM_054113	NP_473454	Q96Q77	CIB3_HUMAN	DNA-dependent protein kinase catalytic								calcium ion binding			ovary(1)	1						gactctgtctcaaaaaaaaaaa	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	16364284	16364288	+	IGR	DEL	ACAAA	-	-	rs10579176		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16364284_16364288delACAAA								AP1M1 (18128 upstream) : KLF2 (71363 downstream)																							acacagacacacaaaacaaaactac	0.000													3	3	---	---	---	---	
IL12RB1	3594	broad.mit.edu	37	19	18180373	18180373	+	Frame_Shift_Del	DEL	G	-	-	rs140254802		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18180373delG	uc002nhw.1	-	10	1236	c.1172delC	c.(1171-1173)CCGfs	p.P391fs	IL12RB1_uc010xqb.1_Frame_Shift_Del_p.P391fs|IL12RB1_uc002nhx.1_Frame_Shift_Del_p.P431fs	NM_005535	NP_005526	P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1 isoform 1	391	Extracellular (Potential).|Fibronectin type-III 4.				cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1						AGCCGGATCCGGGTCTTGCGG	0.637													1	30	---	---	---	---	
MEF2B	100271849	broad.mit.edu	37	19	19272620	19272621	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19272620_19272621insT	uc002nlm.2	-						MEF2B_uc002nln.2_Intron|MEF2B_uc002nll.2_Intron|LOC729991-MEF2B_uc010xqo.1_Intron|LOC729991-MEF2B_uc010xqp.1_Intron|LOC729991-MEF2B_uc002nlo.2_Intron|LOC729991-MEF2B_uc002nlp.2_Intron|MEF2B_uc002nlk.2_Intron	NM_001145785	NP_001139257			myocyte enhancer factor 2B isoform a											skin(1)	1			OV - Ovarian serous cystadenocarcinoma(5;0.00011)|Epithelial(12;0.00412)			cttcttttttgttttttttttt	0.252													4	2	---	---	---	---	
ZNF14	7561	broad.mit.edu	37	19	19844407	19844408	+	5'Flank	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19844407_19844408insT	uc002nnk.1	-							NM_021030	NP_066358	P17017	ZNF14_HUMAN	zinc finger protein 14						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Renal(1328;0.0474)				tttatttcttcttttttttttt	0.000													4	3	---	---	---	---	
ZNF98	148198	broad.mit.edu	37	19	22575389	22575389	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22575389delC	uc002nqt.2	-	4	770	c.648delG	c.(646-648)GGGfs	p.G216fs		NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98	216	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				TATAGGCTTTCCCACATTCTT	0.373													0	6	---	---	---	---	
RPSAP58	388524	broad.mit.edu	37	19	23990451	23990452	+	Intron	DEL	AG	-	-	rs140725153		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23990451_23990452delAG	uc002nrn.2	+							NM_002295	NP_002286			ribosomal protein SA												0						CTCTTTTCTCAGAGTTAGAGAA	0.322													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24596212	24596213	+	IGR	INS	-	CT	CT	rs142953620		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24596212_24596213insCT								LOC100101266 (249963 upstream) : None (None downstream)																							cagttctgaaactcttttagta	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28939859	28939860	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28939859_28939860insT	uc002nsa.1	-											Homo sapiens cDNA clone IMAGE:5297319, with apparent retained intron.																		ttttttttttgttttttttttt	0.000													4	2	---	---	---	---	
UBA2	10054	broad.mit.edu	37	19	34932776	34932776	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34932776delA	uc002nvk.2	+						UBA2_uc010xrx.1_Intron|UBA2_uc002nvl.2_Intron	NM_005499	NP_005490	Q9UBT2	SAE2_HUMAN	SUMO-1 activating enzyme subunit 2						protein sumoylation	nucleus	ATP binding|enzyme activator activity|ligase activity|metal ion binding|protein heterodimerization activity|SUMO activating enzyme activity			ovary(1)	1	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			aagtgaatggagatcatgcta	0.010													4	2	---	---	---	---	
LOC100128675	100128675	broad.mit.edu	37	19	35596483	35596500	+	Intron	DEL	CACCATCACCATCATCAT	-	-	rs143642353		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35596483_35596500delCACCATCACCATCATCAT	uc010xsi.1	-						LOC100128675_uc002nxu.2_Intron	NR_024562				SubName: Full=cDNA FLJ57934;												0						tcaccatcaccaccatcaccatcatcatcaccaccacc	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	36307415	36307416	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36307415_36307416insT								PRODH2 (3214 upstream) : NPHS1 (8858 downstream)																							tccgctgttccttttccctgaa	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	36443123	36443123	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36443123delT								LRFN3 (7028 upstream) : SDHAF1 (42978 downstream)																							TCATTTTCACTTGCAAATGTT	0.458													4	2	---	---	---	---	
SNAR-E	100170220	broad.mit.edu	37	19	47336320	47336320	+	5'Flank	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47336320delA	uc010xyi.1	-							NR_024258				Homo sapiens small ILF3/NF90-associated RNA E (SNAR-E), non-coding RNA.												0						agactccactaaaaaaaaaaa	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	48081144	48081144	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48081144delT								ZNF541 (22031 upstream) : GLTSCR1 (30309 downstream)																							TCAAAAAACATTTTTTTTTTT	0.224													4	2	---	---	---	---	
NUCB1	4924	broad.mit.edu	37	19	49407785	49407785	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49407785delT	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		GACTGGtttcttttttttttt	0.323													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	49430210	49430211	+	IGR	INS	-	AAAG	AAAG	rs74202555		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49430210_49430211insAAAG								NUCB1 (3685 upstream) : DHDH (6728 downstream)																							aaaaaaaaaaaaagaagtgtgg	0.000													4	2	---	---	---	---	
PPFIA3	8541	broad.mit.edu	37	19	49625972	49625975	+	Intron	DEL	TTTT	-	-	rs10418807		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49625972_49625975delTTTT	uc002pmr.2	+						PPFIA3_uc010yai.1_Intron	NM_003660	NP_003651	O75145	LIPA3_HUMAN	PTPRF interacting protein alpha 3							cell surface|cytoplasm	protein binding			lung(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		TGTTTAGttgtttttttttttttt	0.172													4	2	---	---	---	---	
SLC17A7	57030	broad.mit.edu	37	19	49947588	49947589	+	5'Flank	INS	-	TTTTC	TTTTC	rs149418644	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49947588_49947589insTTTTC	uc002pnp.2	-						uc002pnr.1_5'Flank	NM_020309	NP_064705	Q9P2U7	VGLU1_HUMAN	solute carrier family 17, member 7						glutamate secretion|neurotransmitter secretion	cell junction|clathrin sculpted glutamate transport vesicle membrane|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|sodium-dependent phosphate transmembrane transporter activity|sodium:inorganic phosphate symporter activity			ovary(1)|pancreas(1)|skin(1)	3		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		tttctcttctttttccttcttt	0.000													3	3	---	---	---	---	
PIH1D1	55011	broad.mit.edu	37	19	49953052	49953057	+	Intron	DEL	TTTTTT	-	-	rs144738776		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49953052_49953057delTTTTTT	uc002pns.2	-						PIH1D1_uc010yap.1_Intron|PIH1D1_uc010yaq.1_Intron	NM_017916	NP_060386	Q9NWS0	PIHD1_HUMAN	NOP17						box C/D snoRNP assembly	pre-snoRNP complex					0		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		CTCACttctctttttttttttttttt	0.252													5	3	---	---	---	---	
RCN3	57333	broad.mit.edu	37	19	50030560	50030561	+	5'Flank	INS	-	T	T	rs113746396		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50030560_50030561insT	uc002poj.2	+							NM_020650	NP_065701	Q96D15	RCN3_HUMAN	reticulocalbin 3, EF-hand calcium binding domain							endoplasmic reticulum lumen	calcium ion binding|protein binding			ovary(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)		tcttttctttcttttttttttt	0.208													4	2	---	---	---	---	
TSKS	60385	broad.mit.edu	37	19	50265683	50265684	+	Intron	DEL	TT	-	-	rs34463626		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50265683_50265684delTT	uc002ppm.2	-							NM_021733	NP_068379	Q9UJT2	TSKS_HUMAN	testis-specific kinase substrate								protein binding			large_intestine(1)|skin(1)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		tctttctttctttttttttttt	0.203													5	3	---	---	---	---	
MYH14	79784	broad.mit.edu	37	19	50801658	50801659	+	Intron	INS	-	AC	AC	rs144135989	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50801658_50801659insAC	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron|MYH14_uc010ycb.1_Intron|MYH14_uc002prs.1_Intron	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		cacacacacatacacacacaca	0.188													3	5	---	---	---	---	
NCRNA00085	147650	broad.mit.edu	37	19	52205010	52205011	+	Intron	DEL	AC	-	-	rs111977001		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52205010_52205011delAC	uc002pxk.3	+						NCRNA00085_uc002pxl.3_Intron|NCRNA00085_uc002pxm.1_5'Flank	NR_024330				Homo sapiens cDNA FLJ14300 fis, clone PLACE1011891.												0						CCTTCCCCAGACACACACACAC	0.292													4	2	---	---	---	---	
ZNF83	55769	broad.mit.edu	37	19	53146962	53146962	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53146962delA	uc010epz.2	-						ZNF83_uc010eqb.1_Intron	NM_001105554	NP_001099024	P51522	ZNF83_HUMAN	zinc finger protein 83 isoform b							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		cttaaaaaagaaaaaaaaaaa	0.239													4	2	---	---	---	---	
PRKCG	5582	broad.mit.edu	37	19	54387922	54387923	+	Intron	DEL	AG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54387922_54387923delAG	uc002qcq.1	+						PRKCG_uc010eqz.1_Intron|PRKCG_uc010yef.1_Intron|PRKCG_uc010yeg.1_Intron|PRKCG_uc010yeh.1_Intron	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		aagctgaggcagagagagagag	0.109													3	3	---	---	---	---	
PRKCG	5582	broad.mit.edu	37	19	54393517	54393517	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54393517delT	uc002qcq.1	+						PRKCG_uc010eqz.1_Intron|PRKCG_uc010yef.1_Intron|PRKCG_uc010yeg.1_Intron|PRKCG_uc010yeh.1_Intron	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		TTTGACtttcttttttttttt	0.264													4	2	---	---	---	---	
TTYH1	57348	broad.mit.edu	37	19	54925290	54925292	+	5'Flank	DEL	CAT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54925290_54925292delCAT	uc002qfq.2	+						TTYH1_uc010yey.1_5'Flank|TTYH1_uc002qfr.2_5'Flank|TTYH1_uc002qft.2_5'Flank	NM_020659	NP_065710	Q9H313	TTYH1_HUMAN	tweety 1 isoform 1						cell adhesion	chloride channel complex|plasma membrane	chloride channel activity|iron ion transmembrane transporter activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		tcaccaccaccatcaccaccatc	0.000													4	2	---	---	---	---	
KIR2DL1	3802	broad.mit.edu	37	19	55286500	55286501	+	Intron	DEL	GA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55286500_55286501delGA	uc002qhb.1	+						KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL3_uc010erw.1_Intron|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron|KIR3DP1_uc010yfi.1_Intron|KIR2DL1_uc010erz.1_Intron	NM_014218	NP_055033	P43626	KI2L1_HUMAN	killer cell immunoglobulin-like receptor, two						immune response|natural killer cell inhibitory signaling pathway	integral to plasma membrane	protein binding|receptor activity				0				GBM - Glioblastoma multiforme(193;0.0192)		GGTagagggtgagagagagaga	0.431													9	4	---	---	---	---	
HSPBP1	23640	broad.mit.edu	37	19	55777843	55777845	+	Intron	DEL	TCC	-	-	rs146055875		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55777843_55777845delTCC	uc002qjx.2	-						HSPBP1_uc002qjy.2_Intron|HSPBP1_uc002qkb.2_Intron|HSPBP1_uc002qka.2_Intron|HSPBP1_uc002qkd.2_Intron|HSPBP1_uc002qkc.2_Intron|uc002qke.2_5'Flank	NM_012267	NP_036399	Q9NZL4	HPBP1_HUMAN	hsp70-interacting protein						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		atcaccaccatcctcaccaccac	0.020													3	3	---	---	---	---	
ZSCAN5A	79149	broad.mit.edu	37	19	56814024	56814025	+	Intron	DEL	CT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56814024_56814025delCT	uc002qmr.2	-						ZSCAN5A_uc010ygi.1_Intron	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						tcttccccccctccctgttctt	0.069													4	3	---	---	---	---	
C20orf96	140680	broad.mit.edu	37	20	258441	258442	+	Intron	INS	-	AG	AG	rs151216421	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:258441_258442insAG	uc002wde.1	-						C20orf96_uc002wdc.2_Intron|C20orf96_uc002wdd.2_Intron|C20orf96_uc010zpi.1_Intron|C20orf96_uc010zpj.1_Intron|C20orf96_uc010zpk.1_Intron	NM_153269	NP_695001	Q9NUD7	CT096_HUMAN	hypothetical protein LOC140680												0		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			TGTCTTCCTCCAGAGAGACCCC	0.545													3	3	---	---	---	---	
FAM110A	83541	broad.mit.edu	37	20	825319	825320	+	Intron	DEL	TT	-	-	rs75434277		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:825319_825320delTT	uc002wef.1	+						FAM110A_uc002weg.1_Intron|FAM110A_uc002weh.1_5'UTR|FAM110A_uc010fzz.2_5'Flank	NM_001042353	NP_001035812	Q9BQ89	F110A_HUMAN	hypothetical protein LOC83541							microtubule organizing center|spindle pole	protein binding				0						CGCGCTCGGCTTTTTTTTTTTT	0.569													4	2	---	---	---	---	
TMC2	117532	broad.mit.edu	37	20	2597211	2597214	+	Intron	DEL	AAAG	-	-	rs72247167		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2597211_2597214delAAAG	uc002wgf.1	+						TMC2_uc002wgg.1_Intron	NM_080751	NP_542789	Q8TDI7	TMC2_HUMAN	transmembrane cochlear-expressed protein 2							integral to membrane				ovary(3)	3						aaaggaaaataaagaaggagggag	0.142													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	6055171	6055172	+	IGR	DEL	GT	-	-	rs72256416		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6055171_6055172delGT								LRRN4 (20477 upstream) : FERMT1 (321 downstream)																							TTGCTTGCTGgtgtgtgtgtgt	0.361													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	6201920	6201921	+	IGR	INS	-	A	A			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6201920_6201921insA								FERMT1 (97729 upstream) : BMP2 (546824 downstream)																							AATGTGGCCTGAAAAAAAAAAG	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	10819658	10819659	+	IGR	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10819658_10819659insT								JAG1 (164964 upstream) : None (None downstream)																							TCCAGACACCGTTTTTTTTTTT	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	11643471	11643472	+	IGR	DEL	TT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11643471_11643472delTT								JAG1 (988777 upstream) : BTBD3 (228005 downstream)																							cttgagttgatttttttttttt	0.000													4	2	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15279096	15279097	+	Intron	DEL	AG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15279096_15279097delAG	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				AATGGAAGCAAGAGAGAGAGAG	0.475													4	2	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15613587	15613588	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15613587_15613588insT	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				ttcttccttcctcccctccttc	0.158													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	16052055	16052055	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16052055delT								MACROD2 (18216 upstream) : KIF16B (200694 downstream)																							taccatgctattttggttact	0.000													4	2	---	---	---	---	
FAM182B	728882	broad.mit.edu	37	20	25840580	25840580	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25840580delC	uc002wvd.1	-						FAM182B_uc002wve.2_Intron					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0						ctttgccaagcctcagggact	0.000													6	3	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29635890	29635890	+	Intron	DEL	A	-	-	rs139182760		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29635890delA	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						actttggtttaaagcactact	0.114													4	2	---	---	---	---	
HM13	81502	broad.mit.edu	37	20	30151881	30151881	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30151881delA	uc002wwe.2	+						HM13_uc002wwc.2_Intron|HM13_uc002wwd.2_Intron|HM13_uc002wwf.2_Intron|HM13_uc010gdu.2_Intron	NM_030789	NP_110416	Q8TCT9	HM13_HUMAN	minor histocompatibility antigen 13 isoform 1						membrane protein proteolysis	cell surface|endoplasmic reticulum membrane|integral to membrane|plasma membrane	aspartic-type endopeptidase activity|protein binding			breast(1)	1	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			tctgtctcagaaaaaaaaaaa	0.184													4	2	---	---	---	---	
ITCH	83737	broad.mit.edu	37	20	32958470	32958470	+	Intron	DEL	A	-	-	rs145021004		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32958470delA	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6						agtctgtctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37232798	37232798	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37232798delA								ADIG (15694 upstream) : SLC32A1 (120307 downstream)																							ctatctacctacctatTATGG	0.284													4	2	---	---	---	---	
CHD6	84181	broad.mit.edu	37	20	40166513	40166514	+	Intron	INS	-	AC	AC	rs149184928	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40166513_40166514insAC	uc002xka.1	-						CHD6_uc002xkd.2_Intron|CHD6_uc002xkc.2_Intron	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				ccatcatagatacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	40385003	40385003	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40385003delC								CHD6 (137870 upstream) : PTPRT (316390 downstream)																							cttctgttttccaaagtgggt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	40391574	40391574	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40391574delT								CHD6 (144441 upstream) : PTPRT (309819 downstream)																							gcatggaatgtttttccatgt	0.000													4	2	---	---	---	---	
SLC13A3	64849	broad.mit.edu	37	20	45228901	45228901	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45228901delA	uc002xsf.1	-						SLC13A3_uc010ghn.1_Intron|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	ggaaggaaggaaaggaaagga	0.020													1	5	---	---	---	---	
EYA2	2139	broad.mit.edu	37	20	45598190	45598191	+	Intron	INS	-	TTTG	TTTG	rs140586563	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45598190_45598191insTTTG	uc002xsm.2	+						EYA2_uc010ghp.2_Intron	NM_005244	NP_005235	O00167	EYA2_HUMAN	eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)				cctcttttgtttttgtttgttt	0.134													0	7	---	---	---	---	
NCOA3	8202	broad.mit.edu	37	20	46160855	46160856	+	Intron	DEL	TG	-	-	rs11474538		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46160855_46160856delTG	uc002xtk.2	+						NCOA3_uc010ght.1_Intron|NCOA3_uc002xtl.2_Intron|NCOA3_uc002xtm.2_Intron|NCOA3_uc002xtn.2_Intron	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						gggggggacttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46843272	46843273	+	IGR	INS	-	T	T	rs148699456	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46843272_46843273insT								SULF2 (427912 upstream) : LOC284749 (145381 downstream)																							tctgggtcctcccccaacctcc	0.228													4	4	---	---	---	---	
PREX1	57580	broad.mit.edu	37	20	47434120	47434124	+	Intron	DEL	GAGAT	-	-	rs66816241		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47434120_47434124delGAGAT	uc002xtw.1	-							NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,						actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			ctgaggcgcagagataagattcaga	0.151													4	2	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	51862579	51862579	+	Intron	DEL	C	-	-	rs2057760	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51862579delC	uc002xwo.2	+							NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			ttctttctttctttttttttt	0.164													4	2	---	---	---	---	
AURKA	6790	broad.mit.edu	37	20	54949073	54949074	+	Intron	DEL	AC	-	-	rs144437309		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54949073_54949074delAC	uc002xxd.1	-						AURKA_uc002xxe.1_Intron|AURKA_uc002xxf.1_Intron|AURKA_uc002xxg.1_Intron|AURKA_uc002xxh.1_Intron|AURKA_uc002xxi.1_Intron|AURKA_uc002xxj.1_Intron|AURKA_uc002xxk.1_Intron|AURKA_uc010zzd.1_Intron	NM_198433	NP_940835	O14965	AURKA_HUMAN	serine/threonine protein kinase 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|phosphatidylinositol-mediated signaling|regulation of protein stability|spindle organization	cytosol|nucleus|perinuclear region of cytoplasm|spindle microtubule|spindle pole centrosome	ATP binding|protein kinase binding|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(1)|large_intestine(1)|skin(1)	8			Colorectal(105;0.202)			ATAGGAGTCTacacacacacac	0.193													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55985212	55985212	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55985212delG								RBM38 (828 upstream) : CTCFL (78668 downstream)																							GGGTCAGGGAGGGCAGCATGG	0.617													4	2	---	---	---	---	
CTCFL	140690	broad.mit.edu	37	20	56072550	56072550	+	3'UTR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56072550delA	uc010gix.1	-	10					CTCFL_uc010giw.1_Intron|CTCFL_uc002xym.2_3'UTR|CTCFL_uc010giz.1_3'UTR|CTCFL_uc010giy.1_3'UTR|CTCFL_uc010gja.1_3'UTR|CTCFL_uc010gjb.1_3'UTR|CTCFL_uc010gjc.1_3'UTR|CTCFL_uc010gjd.1_3'UTR|CTCFL_uc010giu.2_Intron|CTCFL_uc010giv.2_Intron	NM_080618	NP_542185	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor-like protein						cell cycle|DNA methylation involved in gamete generation|histone methylation|positive regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|regulation of histone H3-K4 methylation|transcription, DNA-dependent	cytoplasm|nucleus	histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|skin(1)	4	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			GGTTGGCAGCAAAACAAACTG	0.378													4	2	---	---	---	---	
GNAS	2778	broad.mit.edu	37	20	57474231	57474232	+	Intron	INS	-	T	T			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57474231_57474232insT	uc002xzw.2	+						GNAS_uc002xzt.2_Intron|GNAS_uc002xzu.3_Intron|GNAS_uc010gjq.2_Intron|GNAS_uc002xzv.2_Intron|GNAS_uc002xzx.2_Intron|GNAS_uc010gjr.2_Intron|GNAS_uc002xzy.2_Intron|GNAS_uc002yaa.2_Intron|GNAS_uc010zzt.1_Intron|GNAS_uc002yab.2_Intron|GNAS_uc002yad.2_Intron	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas						activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CGTAACATAAATTTTTTTGGCC	0.337			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57652793	57652793	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57652793delG								SLMO2 (34892 upstream) : ZNF831 (113282 downstream)																							GAGCTATGATGGTATTATCAT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	60660685	60660686	+	IGR	INS	-	T	T	rs113009488		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60660685_60660686insT								TAF4 (19819 upstream) : LSM14B (36831 downstream)																							ATGCACGTTACttttttttttt	0.272													3	3	---	---	---	---	
DIDO1	11083	broad.mit.edu	37	20	61516247	61516247	+	Intron	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61516247delG	uc002ydr.1	-						DIDO1_uc002yds.1_Intron	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c						apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					AAAACCAGCCGGGCCACACCG	0.537													3	3	---	---	---	---	
OPRL1	4987	broad.mit.edu	37	20	62719949	62719950	+	Intron	INS	-	GA	GA	rs148325563		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62719949_62719950insGA	uc002yic.2	+						OPRL1_uc002yid.2_Intron	NM_182647	NP_872588	P41146	OPRX_HUMAN	opiate receptor-like 1						elevation of cytosolic calcium ion concentration|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception	integral to plasma membrane	protein binding|X-opioid receptor activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					ATCTGTGCAAGGGGTAGGATCT	0.599													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10841905	10841914	+	IGR	DEL	GGAATGGAAT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10841905_10841914delGGAATGGAAT								None (None upstream) : TPTE (64829 downstream)																							ggactcgaaaggaatggaatggaatggaat	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11064449	11064449	+	Intron	DEL	A	-	-	rs144282035		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11064449delA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		catggcaaggataatgccatt	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11093710	11093711	+	Intron	INS	-	A	A	rs141963528		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11093710_11093711insA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		tcAAAACCTCCAAAAAACACTG	0.193													4	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11094184	11094184	+	Intron	DEL	G	-	-	rs2775396		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11094184delG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GTTTTATAAAGATAACTACCT	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14361139	14361139	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14361139delT								None (None upstream) : C21orf99 (49348 downstream)																							cacttgcagatttttacaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	15275937	15275938	+	5'Flank	INS	-	A	A	rs147035684	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15275937_15275938insA	uc002yjg.2	+											DQ579288																		cctccgtgtggaaaatctacag	0.000													4	2	---	---	---	---	
SAMSN1	64092	broad.mit.edu	37	21	15953174	15953174	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15953174delA	uc002yjv.1	-							NM_022136	NP_071419	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization						negative regulation of adaptive immune response|negative regulation of B cell activation|negative regulation of peptidyl-tyrosine phosphorylation	cytoplasm|nucleus|ruffle	phosphotyrosine binding			ovary(3)|pancreas(1)	4				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		GGCTCCCTGGATACACAGAAT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	22272297	22272298	+	IGR	INS	-	GT	GT	rs140047738	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22272297_22272298insGT								C21orf131 (96871 upstream) : NCAM2 (98335 downstream)																							GGAgtgtgtgggtgtgtgtgtg	0.149													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	24638667	24638668	+	IGR	DEL	AA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24638667_24638668delAA								None (None upstream) : None (None downstream)																							GTTCCATTTGAAAAAAAAAAAA	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	25157563	25157566	+	IGR	DEL	AAGG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25157563_25157566delAAGG								None (None upstream) : None (None downstream)																							gagggagggaaaggaaggaaggaa	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	30555872	30555872	+	IGR	DEL	T	-	-	rs112168273		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30555872delT								C21orf7 (7672 upstream) : NCRNA00189 (9929 downstream)																							AGGTCGGTGGttttttttttt	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	39617506	39617507	+	IGR	DEL	AG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39617506_39617507delAG								DSCR10 (36770 upstream) : KCNJ15 (11157 downstream)																							aaagaaagaaagagagagagag	0.139													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40375834	40375834	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40375834delA								ETS2 (178958 upstream) : PSMG1 (171556 downstream)																							CTTTCTTTGCAAAACAAAAAA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44621092	44621092	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44621092delT								CRYAA (28179 upstream) : SIK1 (213306 downstream)																							aatttttgtatttttttgtag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44755961	44755961	+	IGR	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44755961delC								CRYAA (163048 upstream) : SIK1 (78437 downstream)																							accatcaccaccatcaccacc	0.000													4	2	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45794814	45794814	+	Intron	DEL	T	-	-	rs66502008		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45794814delT	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						ctgcgagttgttttttttctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17375305	17375306	+	IGR	DEL	TT	-	-	rs111428817		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17375305_17375306delTT								HSFYL1 (65080 upstream) : GAB4 (67523 downstream)																							gaaaagggaCtttttttttgac	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17392645	17392648	+	IGR	DEL	TTCT	-	-	rs143459372		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17392645_17392648delTTCT								HSFYL1 (82420 upstream) : GAB4 (50181 downstream)																							caatagatgattctttctttaatc	0.039													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	19695942	19695942	+	IGR	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19695942delT								LOC150185 (141580 upstream) : SEPT5 (6045 downstream)																							GTGGAAGGACTTTGGCGGCAT	0.602													4	2	---	---	---	---	
PPIL2	23759	broad.mit.edu	37	22	22031976	22031981	+	Intron	DEL	GGGAGC	-	-	rs10604344		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22031976_22031981delGGGAGC	uc010gtj.1	+						PPIL2_uc002zvh.3_Intron|PPIL2_uc002zvi.3_Intron|PPIL2_uc002zvg.3_Intron|PPIL2_uc011aij.1_Intron	NM_148175	NP_680480	Q13356	PPIL2_HUMAN	peptidylprolyl isomerase-like 2 isoform a						blood coagulation|leukocyte migration|protein folding|protein polyubiquitination	Golgi lumen|nucleus|ubiquitin ligase complex	peptidyl-prolyl cis-trans isomerase activity|ubiquitin-ubiquitin ligase activity			ovary(2)	2	Colorectal(54;0.105)					ggagaccctggggagcgggagcggga	0.000													4	2	---	---	---	---	
TOP3B	8940	broad.mit.edu	37	22	22321341	22321341	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22321341delA	uc002zvs.2	-						TOP3B_uc010gtm.1_Intron|TOP3B_uc002zvr.2_Intron|TOP3B_uc010gtl.2_Intron|TOP3B_uc002zvt.3_Intron	NM_003935	NP_003926	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta						DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding			kidney(1)	1	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		AGAGAAGGACAAGGAGAAGGC	0.537													4	2	---	---	---	---	
LOC91316	91316	broad.mit.edu	37	22	24000122	24000123	+	Intron	INS	-	C	C	rs146111558	by1000genomes	TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24000122_24000123insC	uc002zxh.3	-						LOC91316_uc002zxi.3_Intron|LOC91316_uc002zxk.3_Intron|LOC91316_uc010gua.2_Intron|LOC91316_uc002zxl.3_Intron|LOC91316_uc011aiz.1_Intron|LOC91316_uc002zxm.3_Intron					Homo sapiens cDNA FLJ32313 fis, clone PROST2003232, weakly similar to BETA-GLUCURONIDASE PRECURSOR (EC 3.2.1.31).												0						tccttttttttcccctcctccg	0.000													4	2	---	---	---	---	
DEPDC5	9681	broad.mit.edu	37	22	32257320	32257322	+	Intron	DEL	CTG	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32257320_32257322delCTG	uc003als.2	+						DEPDC5_uc011als.1_Intron|DEPDC5_uc011alu.1_Intron|DEPDC5_uc011alv.1_Intron|DEPDC5_uc003alt.2_Intron|DEPDC5_uc003alu.2_Intron|DEPDC5_uc003alv.2_Intron|DEPDC5_uc011alw.1_Intron|DEPDC5_uc003alw.2_Intron|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_Intron|DEPDC5_uc011aly.1_Intron	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						TTCCTTGCAACTGCTGCTGCTGC	0.453													4	2	---	---	---	---	
LARGE	9215	broad.mit.edu	37	22	34209242	34209242	+	Intron	DEL	A	-	-	rs35860480		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34209242delA	uc003and.3	-						LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				ccgtctcaagaaaaaaaaaaa	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35515015	35515015	+	IGR	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35515015delA								ISX (31637 upstream) : HMGXB4 (138430 downstream)																							tgggcacgataacaccttttg	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	36082302	36082302	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36082302delG								APOL6 (17847 upstream) : APOL5 (31617 downstream)																							TTTGTAGGCAGGGGGGCAAGG	0.493													4	2	---	---	---	---	
RBM9	23543	broad.mit.edu	37	22	36221657	36221657	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36221657delT	uc003aon.3	-						RBM9_uc003aol.3_Intron|RBM9_uc003aoj.3_Intron|RBM9_uc003aok.3_Intron|RBM9_uc003aoh.3_Intron|RBM9_uc003aom.3_Intron|RBM9_uc010gwu.2_Intron|RBM9_uc003aoo.3_Intron|RBM9_uc003aop.3_Intron	NM_001082578	NP_001076047	O43251	RFOX2_HUMAN	RNA binding motif protein 9 isoform 5						estrogen receptor signaling pathway|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of cell proliferation|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding|transcription corepressor activity|transcription factor binding				0						gatgagtaacttaagctctca	0.000													4	2	---	---	---	---	
TMPRSS6	164656	broad.mit.edu	37	22	37469387	37469390	+	Intron	DEL	GATG	-	-	rs111916270		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37469387_37469390delGATG	uc003aqs.1	-						TMPRSS6_uc003aqt.1_Intron	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6						angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						GAGACCAGAAgatggatggatgga	0.162													4	2	---	---	---	---	
TRIOBP	11078	broad.mit.edu	37	22	38137053	38137053	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38137053delA	uc003atr.2	+						TRIOBP_uc003atu.2_Intron	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6						actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GGCTGGCTCCAGTGGGGACTG	0.652													4	2	---	---	---	---	
MKL1	57591	broad.mit.edu	37	22	40812948	40812948	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40812948delC	uc003ayv.1	-						MKL1_uc003ayw.1_Intron|MKL1_uc010gye.1_Intron|MKL1_uc010gyf.1_Intron	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein						positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						CACCTATGAACAGAGAAGGCC	0.537			T	RBM15	acute megakaryocytic leukemia								4	2	---	---	---	---	
GTSE1	51512	broad.mit.edu	37	22	46703409	46703409	+	Intron	DEL	T	-	-	rs141523913		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46703409delT	uc011aqy.1	+						GTSE1_uc011aqz.1_Intron	NM_016426	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule				ovary(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		ATGTAAtttcttttttttttg	0.164													4	2	---	---	---	---	
GRAMD4	23151	broad.mit.edu	37	22	47031643	47031643	+	Intron	DEL	C	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47031643delC	uc003bhx.2	+						GRAMD4_uc010had.2_5'Flank	NM_015124	NP_055939	Q6IC98	GRAM4_HUMAN	death-inducing-protein						apoptosis	integral to membrane|mitochondrial membrane				ovary(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		GTCCTCCCTGCCCCCCGCCCC	0.721													4	2	---	---	---	---	
CPT1B	1375	broad.mit.edu	37	22	51007559	51007560	+	Intron	INS	-	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51007559_51007560insG	uc003bmk.3	-						CPT1B_uc003bml.2_Intron|CPT1B_uc003bmm.2_3'UTR|CPT1B_uc003bmo.2_Intron|CPT1B_uc011asa.1_Intron|CPT1B_uc003bmn.2_3'UTR|CPT1B_uc011asb.1_Intron|CHKB-CPT1B_uc003bmp.2_Intron|uc003bmr.1_5'Flank	NM_001145137	NP_001138609	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B isoform a						carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)	2		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		TATCAAGAAAAAAAAAAATCAA	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	442484	442485	+	IGR	DEL	AC	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:442484_442485delAC								PPP2R3B (94857 upstream) : SHOX (142594 downstream)																							gaggaaggagacagggaggaag	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	488345	488346	+	IGR	INS	-	CTTT	CTTT			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:488345_488346insCTTT								PPP2R3B (140718 upstream) : SHOX (96733 downstream)																							catcttccttcctctttccttc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1451699	1451700	+	IGR	INS	-	TT	TT			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1451699_1451700insTT								CSF2RA (22871 upstream) : IL3RA (3809 downstream)																							ttctttctttcttttttttttt	0.020													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2132061	2132062	+	IGR	INS	-	G	G			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2132061_2132062insG								ASMT (370088 upstream) : DHRSX (5495 downstream)																							aaggaagggaaggaggaaggaa	0.000													4	4	---	---	---	---	
DHRSX	207063	broad.mit.edu	37	X	2290654	2290654	+	Intron	DEL	T	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2290654delT	uc004cqf.3	-							NM_145177	NP_660160	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				tccttctttgttttttttttt	0.214													2	5	---	---	---	---	
CLCN4	1183	broad.mit.edu	37	X	10163355	10163356	+	Intron	DEL	AT	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10163355_10163356delAT	uc004csy.3	+						CLCN4_uc011mid.1_Intron	NM_001830	NP_001821	P51793	CLCN4_HUMAN	chloride channel 4							early endosome membrane|integral to membrane|late endosome membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						TGCACAATGCATATATATATAT	0.376													3	3	---	---	---	---	
KLF8	11279	broad.mit.edu	37	X	56295626	56295626	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56295626delA	uc004dur.2	+						KLF8_uc010nkg.2_3'UTR|KLF8_uc011mop.1_Intron|KLF8_uc010nkh.2_Intron	NM_007250	NP_009181	O95600	KLF8_HUMAN	Kruppel-like factor 8 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CCTGCTATGCAAAAAAAAAAA	0.333													4	2	---	---	---	---	
CD99L2	83692	broad.mit.edu	37	X	150009868	150009868	+	Intron	DEL	A	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150009868delA	uc004fel.2	-						CD99L2_uc004fem.2_Intron|CD99L2_uc004fen.2_Intron|CD99L2_uc004feo.2_Intron|CD99L2_uc011myb.1_Intron	NM_031462	NP_113650	Q8TCZ2	C99L2_HUMAN	CD99 antigen-like 2 isoform E3'-E4'-E3-E4						cell adhesion	cell junction|integral to membrane				large_intestine(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GAATGAGAGTAACGGTCAGGG	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	8780103	8780103	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:8780103delG								TTTY11 (94680 upstream) : RBMY1A3P (374567 downstream)																							TGCTCCTTCTGCTATGGCAAG	0.418													3	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9941081	9941082	+	IGR	INS	-	CTAT	CTAT	rs113932715		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9941081_9941082insCTAT								TTTY22 (290227 upstream) : None (None downstream)																							gagtgtgatgcctatctgacct	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13285655	13285656	+	IGR	INS	-	GA	GA	rs113499634		TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13285655_13285656insGA								None (None upstream) : None (None downstream)																							caataccacgggggggtgtata	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	17071191	17071194	+	IGR	DEL	GAAA	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:17071191_17071194delGAAA								NLGN4Y (115343 upstream) : None (None downstream)																							aagaaagaacgaaagaaagaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28807116	28807116	+	IGR	DEL	G	-	-			TCGA-66-2754-01	TCGA-66-2754-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28807116delG								None (None upstream) : None (None downstream)																							cgaatcgaacggaaAATTATG	0.015													7	7	---	---	---	---	
