Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PARK7	11315	broad.mit.edu	37	1	8037728	8037728	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8037728G>T	uc001aou.3	+	6	444	c.339G>T	c.(337-339)TTG>TTT	p.L113F	PARK7_uc001aox.3_Missense_Mutation_p.L113F|PARK7_uc001aov.3_Missense_Mutation_p.L93F	NM_001123377	NP_001116849	Q99497	PARK7_HUMAN	Parkinson disease protein 7	113					autophagy|cell death|cellular response to hydrogen peroxide|inflammatory response|mitochondrion organization|negative regulation of cell death|negative regulation of protein binding|neuroprotection|protein stabilization|regulation of androgen receptor signaling pathway|regulation of inflammatory response|single fertilization	mitochondrion|nucleus	mRNA binding|peptidase activity|peroxidase activity|protein homodimerization activity				0	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;1.28e-70)|GBM - Glioblastoma multiforme(8;3.05e-36)|Colorectal(212;6.83e-08)|COAD - Colon adenocarcinoma(227;7.51e-06)|Kidney(185;5.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000414)|KIRC - Kidney renal clear cell carcinoma(229;0.000967)|STAD - Stomach adenocarcinoma(132;0.00102)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCTCTGTTGGCTCATGAAA	0.284													4	120	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11318609	11318609	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11318609G>C	uc001asd.2	-	3	325	c.204C>G	c.(202-204)AAC>AAG	p.N68K		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	68					cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						AAATGTGATGGTTCAGTTGGT	0.413													68	182	---	---	---	---	PASS
PRAMEF13	400736	broad.mit.edu	37	1	13448272	13448272	+	Silent	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13448272G>A	uc010obi.1	-	4	1306	c.1203C>T	c.(1201-1203)ACC>ACT	p.T401T	PRAMEF14_uc009vnt.1_Silent_p.T353T	NM_001024661	NP_001019832	Q5VWM6	PRA13_HUMAN	PRAME family member 13	401											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;9.86e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|COAD - Colon adenocarcinoma(227;0.000502)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCAGCCCACTGGTGTGGCGCA	0.557													31	78	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16892443	16892443	+	Intron	SNP	A	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16892443A>G	uc009vos.1	-						uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TATTGCCTTTATGTTGGGATA	0.294													3	61	---	---	---	---	PASS
PADI6	353238	broad.mit.edu	37	1	17708501	17708501	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17708501G>T	uc001bak.1	+	6	593	c.593G>T	c.(592-594)GGC>GTC	p.G198V		NM_207421	NP_997304	Q6TGC4	PADI6_HUMAN	peptidylarginine deiminase type 6	190					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	AATGTCCAAGGCCCCAGCTGT	0.493													27	81	---	---	---	---	PASS
ARHGEF10L	55160	broad.mit.edu	37	1	18023729	18023729	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18023729C>T	uc001ban.2	+	29	3853	c.3694C>T	c.(3694-3696)CGC>TGC	p.R1232C	ARHGEF10L_uc001bao.2_Missense_Mutation_p.R1193C|ARHGEF10L_uc001bap.2_Missense_Mutation_p.R1188C|ARHGEF10L_uc001baq.2_Missense_Mutation_p.R993C|ARHGEF10L_uc010ocs.1_Missense_Mutation_p.R1005C|ARHGEF10L_uc001bar.2_Missense_Mutation_p.R935C|ARHGEF10L_uc009vpf.2_RNA|ARHGEF10L_uc001bas.2_Missense_Mutation_p.R256C	NM_018125	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF)	1232					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)|pancreas(1)	3		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CGACGCCCACCGCAAGGAGAT	0.682													3	64	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19477075	19477075	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19477075C>G	uc001bbi.2	-	49	7430	c.7426G>C	c.(7426-7428)GAG>CAG	p.E2476Q	UBR4_uc001bbk.1_Missense_Mutation_p.E130Q	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	2476					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGGTACCTCTCCAGGACAGTT	0.522													4	183	---	---	---	---	PASS
PCSK9	255738	broad.mit.edu	37	1	55524240	55524240	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55524240G>A	uc001cyf.1	+	9	1714	c.1423G>A	c.(1423-1425)GCC>ACC	p.A475T	PCSK9_uc010oom.1_RNA	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	475					cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4						CACAGCCGTCGCCCGCTGCGC	0.637													7	38	---	---	---	---	PASS
USP24	23358	broad.mit.edu	37	1	55545265	55545265	+	Silent	SNP	A	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55545265A>G	uc001cyg.3	-	57	6666	c.6666T>C	c.(6664-6666)CAT>CAC	p.H2222H		NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24	2382					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						CTACCTCCTCATGGAGGGGCA	0.448													56	164	---	---	---	---	PASS
GIPC2	54810	broad.mit.edu	37	1	78560690	78560690	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78560690C>G	uc001dik.2	+	3	671	c.481C>G	c.(481-483)CAT>GAT	p.H161D		NM_017655	NP_060125	Q8TF65	GIPC2_HUMAN	PDZ domain protein GIPC2	161	PDZ.					cytoplasm				ovary(1)	1						TGTTGGGGATCATATTGAATC	0.313													5	206	---	---	---	---	PASS
GPR61	83873	broad.mit.edu	37	1	110085901	110085901	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110085901A>G	uc001dxy.2	+	2	940	c.257A>G	c.(256-258)GAC>GGC	p.D86G		NM_031936	NP_114142	Q9BZJ8	GPR61_HUMAN	G protein-coupled receptor 61	86	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(2)	2		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)		TGCCTGGTGGACCTGCTGGCT	0.622													54	182	---	---	---	---	PASS
RORC	6097	broad.mit.edu	37	1	151787406	151787406	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151787406G>A	uc001ezh.2	-	5	902	c.794C>T	c.(793-795)GCC>GTC	p.A265V	RORC_uc001ezg.2_Missense_Mutation_p.A244V|RORC_uc010pdo.1_Missense_Mutation_p.A319V|RORC_uc010pdp.1_Missense_Mutation_p.A265V	NM_005060	NP_005051	P51449	RORG_HUMAN	RAR-related orphan receptor C isoform a	265	Hinge (Potential).				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGTCAGGGAGGCATAGGGTGC	0.602													13	45	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152283373	152283373	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152283373C>T	uc001ezu.1	-	3	4025	c.3989G>A	c.(3988-3990)GGC>GAC	p.G1330D	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1330	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGATGAGTGCCTGATTGTCT	0.423									Ichthyosis				102	366	---	---	---	---	PASS
NES	10763	broad.mit.edu	37	1	156639850	156639850	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156639850G>T	uc001fpq.2	-	4	4263	c.4130C>A	c.(4129-4131)CCT>CAT	p.P1377H		NM_006617	NP_006608	P48681	NEST_HUMAN	nestin	1377	Tail.				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGGAAGAAAAGGTGCCTCAGT	0.517													31	108	---	---	---	---	PASS
PVRL4	81607	broad.mit.edu	37	1	161046204	161046204	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161046204T>G	uc001fxo.2	-	4	1091	c.792A>C	c.(790-792)GAA>GAC	p.E264D	PVRL4_uc010pjy.1_5'Flank|PVRL4_uc010pjz.1_5'UTR	NM_030916	NP_112178	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4 precursor	264	Ig-like C2-type 2.|Extracellular (Potential).				adherens junction organization|cell adhesion|cell junction assembly	adherens junction|extracellular region|integral to membrane				ovary(2)	2	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GCATAGCTCCTTCTCTGCCAA	0.552													38	108	---	---	---	---	PASS
DUSP12	11266	broad.mit.edu	37	1	161726673	161726673	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161726673A>G	uc001gbo.2	+	6	970	c.959A>G	c.(958-960)CAT>CGT	p.H320R	DUSP12_uc001gbp.2_Missense_Mutation_p.H190R	NM_007240	NP_009171	Q9UNI6	DUS12_HUMAN	dual specificity phosphatase 12	320					positive regulation of glucokinase activity	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity|zinc ion binding			breast(1)	1	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			TTTCAAATACATAAGAATAGA	0.388													39	122	---	---	---	---	PASS
PBX1	5087	broad.mit.edu	37	1	164789305	164789305	+	Intron	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164789305C>T	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						TCTTTCCTTTCCAGGTTCTTC	0.488			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								4	134	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247588376	247588376	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247588376C>T	uc001icr.2	+	5	1769	c.1631C>T	c.(1630-1632)ACG>ATG	p.T544M	NLRP3_uc001ics.2_Missense_Mutation_p.T544M|NLRP3_uc001icu.2_Missense_Mutation_p.T544M|NLRP3_uc001icw.2_Missense_Mutation_p.T544M|NLRP3_uc001icv.2_Missense_Mutation_p.T544M|NLRP3_uc010pyw.1_Missense_Mutation_p.T542M|NLRP3_uc001ict.1_Missense_Mutation_p.T542M	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	544					detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GAAGGAAGGACGAACGTTCCA	0.473													14	55	---	---	---	---	PASS
SMPD4	55627	broad.mit.edu	37	2	130914906	130914906	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130914906C>A	uc002tqq.1	-	12	1652	c.1132G>T	c.(1132-1134)GCC>TCC	p.A378S	SMPD4_uc002tqo.1_5'UTR|SMPD4_uc002tqp.1_Missense_Mutation_p.A71S|SMPD4_uc010yzy.1_Missense_Mutation_p.A127S|SMPD4_uc010yzz.1_Missense_Mutation_p.A42S|SMPD4_uc002tqr.1_Missense_Mutation_p.A349S|SMPD4_uc002tqs.1_Missense_Mutation_p.A246S|SMPD4_uc002tqt.1_Missense_Mutation_p.A227S|SMPD4_uc010zaa.1_Missense_Mutation_p.A236S|SMPD4_uc010zab.1_Missense_Mutation_p.A276S|SMPD4_uc010zac.1_Missense_Mutation_p.A119S|SMPD4_uc010zad.1_Intron	NM_017951	NP_060421	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4 isoform 2	339					sphingomyelin catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|trans-Golgi network	metal ion binding|protein binding|sphingomyelin phosphodiesterase activity|sphingomyelin phosphodiesterase D activity				0	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	TTGGCAAAGGCGTGCAGGTGC	0.657													5	10	---	---	---	---	PASS
ACMSD	130013	broad.mit.edu	37	2	135616876	135616876	+	Silent	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135616876C>A	uc002ttz.2	+	3	215	c.148C>A	c.(148-150)CGA>AGA	p.R50R	ACMSD_uc002tua.2_Nonsense_Mutation_p.C8*	NM_138326	NP_612199	Q8TDX5	ACMSD_HUMAN	aminocarboxymuconate semialdehyde decarboxylase	50					quinolinate metabolic process|tryptophan catabolic process	cytosol	aminocarboxymuconate-semialdehyde decarboxylase activity|metal ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.115)		CAGAGTGGTGCGAGAGAATTG	0.423													19	52	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136587206	136587206	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136587206C>T	uc002tuu.1	-	3	772	c.761G>A	c.(760-762)TGC>TAC	p.C254Y		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	254	Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		CTCATTTTGGCATTCATAAGA	0.423													32	151	---	---	---	---	PASS
MBD5	55777	broad.mit.edu	37	2	149247999	149247999	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149247999C>G	uc002twm.3	+	12	5087	c.4099C>G	c.(4099-4101)CCA>GCA	p.P1367A	MBD5_uc010zbs.1_Intron|MBD5_uc010fns.2_Missense_Mutation_p.P1367A|MBD5_uc002two.2_Missense_Mutation_p.P625A|MBD5_uc002twp.2_Missense_Mutation_p.P417A	NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1367						chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		CCTAAGGAACCCAGACTCCCC	0.453													30	119	---	---	---	---	PASS
KCNJ3	3760	broad.mit.edu	37	2	155711815	155711815	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155711815G>T	uc002tyv.1	+	3	1691	c.1496G>T	c.(1495-1497)CGC>CTC	p.R499L	KCNJ3_uc010zce.1_3'UTR	NM_002239	NP_002230	P48549	IRK3_HUMAN	potassium inwardly-rectifying channel J3	499	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)	AACTCTGATCGCTTCACATAA	0.408													5	22	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170092442	170092442	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170092442T>C	uc002ues.2	-	29	5041	c.4828A>G	c.(4828-4830)AGA>GGA	p.R1610G		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1610	LDL-receptor class B 13.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TAGAGCAGTCTGTTGGGGTAG	0.498													21	83	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179474495	179474495	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179474495G>T	uc010zfg.1	-	221	44175	c.43951C>A	c.(43951-43953)CAA>AAA	p.Q14651K	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.Q8346K|TTN_uc010zfi.1_Missense_Mutation_p.Q8279K|TTN_uc010zfj.1_Missense_Mutation_p.Q8154K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15578							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACACGGAATTGGTACTCTTTC	0.473													168	492	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179571596	179571596	+	Silent	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179571596G>A	uc010zfg.1	-	98	25619	c.25395C>T	c.(25393-25395)GTC>GTT	p.V8465V	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.V5126V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9392							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACTTTCTACGACTCTGATAC	0.353													4	22	---	---	---	---	PASS
UGT1A8	54576	broad.mit.edu	37	2	234526420	234526420	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234526420G>C	uc002vup.2	+	1	130	c.67G>C	c.(67-69)GCT>CCT	p.A23P	UGT1A8_uc010zmv.1_Missense_Mutation_p.A23P	NM_019076	NP_061949	Q9HAW9	UD18_HUMAN	UDP glycosyltransferase 1 family, polypeptide A8	23					drug metabolic process|fatty acid metabolic process|flavone metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme inhibitor activity|fatty acid binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|steroid binding			ovary(2)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;2.56e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000482)|Lung(119;0.00404)|LUSC - Lung squamous cell carcinoma(224;0.008)		CTGTGGCTTTGCTGAGGCAGG	0.587													16	97	---	---	---	---	PASS
UBE2E2	7325	broad.mit.edu	37	3	23541139	23541139	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23541139A>T	uc003ccg.2	+	4	448	c.268A>T	c.(268-270)ACT>TCT	p.T90S	UBE2E2_uc010hfc.2_Intron	NM_152653	NP_689866	Q96LR5	UB2E2_HUMAN	ubiquitin-conjugating enzyme E2E 2	90					ISG15-protein conjugation|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination	nucleolus	ATP binding|ISG15 ligase activity|ubiquitin-protein ligase activity				0						ATGGAGGTCAACTATATTGGG	0.398													27	54	---	---	---	---	PASS
TBC1D23	55773	broad.mit.edu	37	3	100018112	100018112	+	Silent	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100018112C>T	uc003dtt.2	+	10	1206	c.1029C>T	c.(1027-1029)TGC>TGT	p.C343C	TBC1D23_uc003dts.2_Silent_p.C343C	NM_018309	NP_060779	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	343	Rhodanese.					intracellular	Rab GTPase activator activity			ovary(1)|liver(1)	2						TGGTGGATTGCCGTCCTGCAG	0.378													4	186	---	---	---	---	PASS
ZBTB11	27107	broad.mit.edu	37	3	101383876	101383876	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101383876G>A	uc003dve.3	-	4	1785	c.1555C>T	c.(1555-1557)CGA>TGA	p.R519*		NM_014415	NP_055230	O95625	ZBT11_HUMAN	zinc finger protein ZNF-U69274	519					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TTGTGTAGTCGAATATATGCC	0.428													56	415	---	---	---	---	PASS
TRIM42	287015	broad.mit.edu	37	3	140401373	140401373	+	Silent	SNP	C	T	T	rs143388392	byFrequency	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140401373C>T	uc003eto.1	+	2	602	c.411C>T	c.(409-411)AAC>AAT	p.N137N		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	137						intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						TACCAGCCAACAGTCACCTGG	0.577													24	152	---	---	---	---	PASS
AADACL2	344752	broad.mit.edu	37	3	151463350	151463350	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151463350C>A	uc003ezc.2	+	4	605	c.485C>A	c.(484-486)GCT>GAT	p.A162D	AADACL2_uc010hvn.2_Translation_Start_Site	NM_207365	NP_997248	Q6P093	ADCL2_HUMAN	arylacetamide deacetylase-like 2 precursor	162						extracellular region|integral to membrane	carboxylesterase activity				0			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			GATGGCCTTGCTGCAGTCAAA	0.408													12	472	---	---	---	---	PASS
P2RY1	5028	broad.mit.edu	37	3	152554155	152554155	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152554155G>A	uc003ezq.2	+	1	1420	c.584G>A	c.(583-585)CGC>CAC	p.R195H		NM_002563	NP_002554	P47900	P2RY1_HUMAN	purinergic receptor P2Y1	195	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			ACCGGGGTCCGCAAAAACAAA	0.522													6	164	---	---	---	---	PASS
MYNN	55892	broad.mit.edu	37	3	169500440	169500440	+	Intron	SNP	G	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169500440G>C	uc003fft.2	+						MYNN_uc011bpm.1_Intron|MYNN_uc003ffu.2_Intron|MYNN_uc003ffv.2_Intron|MYNN_uc010hwo.2_Intron|MYNN_uc003ffw.1_Intron	NM_018657	NP_061127	Q9NPC7	MYNN_HUMAN	myoneurin							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			AGGTAAGTTTGACAGGGAGAG	0.378													32	136	---	---	---	---	PASS
APBB2	323	broad.mit.edu	37	4	40892515	40892515	+	Intron	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40892515C>A	uc003gvl.2	-						APBB2_uc010ifu.2_Intron|APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron|APBB2_uc011byt.1_Intron	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						TCCCCTGGGACACAACGAGAA	0.557													43	128	---	---	---	---	PASS
ANKRD17	26057	broad.mit.edu	37	4	73986694	73986694	+	Silent	SNP	A	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73986694A>G	uc003hgp.2	-	20	3870	c.3753T>C	c.(3751-3753)AAT>AAC	p.N1251N	ANKRD17_uc003hgo.2_Silent_p.N1138N|ANKRD17_uc003hgq.2_Silent_p.N1000N|ANKRD17_uc003hgr.2_Silent_p.N1250N|ANKRD17_uc011cbd.1_Silent_p.N816N	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	1251	ANK 21.				interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CAGTGTTCCGATTGGTTTCTA	0.438													4	242	---	---	---	---	PASS
SNHG8	100093630	broad.mit.edu	37	4	119200456	119200456	+	Intron	SNP	G	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119200456G>C	uc003iby.2	+						SNORA24_uc003ibz.1_RNA	NR_003584				Homo sapiens, clone IMAGE:4249217, mRNA.												0						ATCAGATTCTGACTTGCACAA	0.438													4	114	---	---	---	---	PASS
CTSO	1519	broad.mit.edu	37	4	156849517	156849517	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156849517G>A	uc003ipg.2	-	7	951	c.902C>T	c.(901-903)GCC>GTC	p.A301V		NM_001334	NP_001325	P43234	CATO_HUMAN	cathepsin O preproprotein	301					proteolysis	lysosome	cysteine-type endopeptidase activity				0	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.05)|Kidney(143;0.0627)|COAD - Colon adenocarcinoma(41;0.148)		TTTGACATGGGCATAACCATC	0.348													4	95	---	---	---	---	PASS
FSTL5	56884	broad.mit.edu	37	4	163032473	163032473	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:163032473C>T	uc003iqh.2	-	2	512	c.76G>A	c.(76-78)GGA>AGA	p.G26R	FSTL5_uc003iqi.2_Missense_Mutation_p.G26R|FSTL5_uc010iqv.2_Missense_Mutation_p.G26R	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	26						extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		CCATATCCTCCTTCTTTGGTT	0.408													46	154	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13919410	13919410	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13919410G>A	uc003jfd.2	-	7	892	c.850C>T	c.(850-852)CGA>TGA	p.R284*	DNAH5_uc003jfe.1_RNA	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	284	Potential.|Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AGCTCCGCTCGTGGCCCAACG	0.527									Kartagener_syndrome				9	367	---	---	---	---	PASS
CDKL3	51265	broad.mit.edu	37	5	133644403	133644403	+	Silent	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133644403C>T	uc003kzf.3	-	8	1016	c.897G>A	c.(895-897)CTG>CTA	p.L299L	CDKL3_uc011cxm.1_Silent_p.L106L|CDKL3_uc011cxn.1_RNA|CDKL3_uc010jdw.2_Intron|CDKL3_uc011cxo.1_Silent_p.L4L|CDKL3_uc011cxp.1_Silent_p.L4L|CDKL3_uc011cxq.1_Silent_p.L106L|CDKL3_uc003kzg.3_Silent_p.L299L	NM_001113575	NP_001107047	Q8IVW4	CDKL3_HUMAN	cyclin-dependent kinase-like 3 isoform 1	299						cytoplasm	ATP binding|cyclin-dependent protein kinase activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATTTAGCTTTCAGTTCTGGCA	0.299													10	24	---	---	---	---	PASS
RNF145	153830	broad.mit.edu	37	5	158634818	158634818	+	Intron	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158634818G>A	uc003lxp.2	-						RNF145_uc011ddy.1_5'Flank|RNF145_uc003lxo.1_5'UTR|RNF145_uc011ddz.1_Intron|RNF145_uc010jiq.1_Intron|RNF145_uc011dea.1_Intron	NM_144726	NP_653327	Q96MT1	RN145_HUMAN	ring finger protein 145							integral to membrane	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCCCAAACCGCAAAGACAGG	0.468													6	470	---	---	---	---	PASS
RPP40	10799	broad.mit.edu	37	6	5004203	5004203	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5004203G>A	uc003mwl.2	-	1	69	c.34C>T	c.(34-36)CGG>TGG	p.R12W	uc003mwn.1_Intron|RPP40_uc003mwm.2_Missense_Mutation_p.R12W	NM_006638	NP_006629	O75818	RPP40_HUMAN	ribonuclease P 40kDa subunit	12					tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0895)				AGTAAGTGCCGCGGCGCCTCC	0.672											OREG0017160	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	32	56	---	---	---	---	PASS
HIST1H4B	8366	broad.mit.edu	37	6	26027399	26027399	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26027399G>C	uc003nfr.2	-	1	82	c.82C>G	c.(82-84)CAA>GAA	p.Q28E		NM_003544	NP_003535	P62805	H4_HUMAN	histone cluster 1, H4b	28					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(2)	2						GTGATGCCTTGGATGTTATCC	0.542													15	112	---	---	---	---	PASS
GPR115	221393	broad.mit.edu	37	6	47681951	47681951	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47681951G>A	uc003oza.1	+	6	1228	c.970G>A	c.(970-972)GTT>ATT	p.V324I	GPR115_uc003oyz.1_Missense_Mutation_p.V381I|GPR115_uc003ozb.1_Missense_Mutation_p.V322I	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN	G-protein coupled receptor 115 precursor	324	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						GCTATCAGTGGTTTTACCAGA	0.468													37	164	---	---	---	---	PASS
LCA5	167691	broad.mit.edu	37	6	80203424	80203424	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80203424C>A	uc003pix.2	-	4	1199	c.764G>T	c.(763-765)CGA>CTA	p.R255L	LCA5_uc003piy.2_Missense_Mutation_p.R255L|LCA5_uc011dyq.1_RNA	NM_001122769	NP_001116241	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	255	Potential.				protein transport	cilium axoneme|microtubule basal body	protein binding				0		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		AAGCAACTGTCGTTGGAAACT	0.338													16	107	---	---	---	---	PASS
C6orf167	253714	broad.mit.edu	37	6	97694501	97694501	+	Intron	SNP	T	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97694501T>A	uc003ppb.2	-						C6orf167_uc011eaf.1_Intron|C6orf167_uc010kcn.1_Intron|C6orf167_uc010kco.1_Intron	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714						double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		TTTAATTGCATACCTGAACAC	0.294													16	105	---	---	---	---	PASS
IGF2R	3482	broad.mit.edu	37	6	160505221	160505221	+	Intron	SNP	G	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160505221G>C	uc003qta.2	+							NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor						receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		AGTCTCGTGAGTGCCTTCCCA	0.557													16	29	---	---	---	---	PASS
IQCE	23288	broad.mit.edu	37	7	2613047	2613047	+	Intron	SNP	T	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2613047T>G	uc003smo.3	+						IQCE_uc010ksm.1_Intron|IQCE_uc003sml.1_Intron|IQCE_uc011jvy.1_Intron|IQCE_uc011jvz.1_Intron|IQCE_uc003smk.3_Intron|IQCE_uc003smn.3_Intron	NM_152558	NP_689771	Q6IPM2	IQCE_HUMAN	IQ motif containing E isoform 1												0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		TTTATGTTTCTCTAGGTCATG	0.333													21	80	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20738138	20738138	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20738138C>T	uc003suw.3	+	8	1330	c.784C>T	c.(784-786)CCA>TCA	p.P262S	ABCB5_uc010kuh.2_Missense_Mutation_p.P707S	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	262	Helical; (Potential).|ABC transmembrane type-1.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						AACTGTTCATCCAGTATTTTC	0.333													16	69	---	---	---	---	PASS
NT5C3	51251	broad.mit.edu	37	7	33061712	33061712	+	Splice_Site	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33061712C>G	uc003tdk.2	-	4	400	c.323_splice	c.e4-1	p.N108_splice	AVL9_uc011kai.1_Intron|NT5C3_uc003tdi.2_Splice_Site_p.N69_splice|NT5C3_uc003tdj.2_Splice_Site_p.N69_splice	NM_001002010	NP_001002010	Q9H0P0	5NT3_HUMAN	5'-nucleotidase, cytosolic III isoform 1						nucleotide metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol|endoplasmic reticulum	2'-phosphotransferase activity|5'-nucleotidase activity|magnesium ion binding|nucleotide binding			ovary(1)	1			GBM - Glioblastoma multiforme(11;0.0894)			TCAATGATATCTAAAGATAGA	0.254													15	38	---	---	---	---	PASS
ELN	2006	broad.mit.edu	37	7	73461084	73461084	+	Silent	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73461084C>G	uc003tzw.2	+	12	721	c.630C>G	c.(628-630)GCC>GCG	p.A210A	RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_Intron|ELN_uc011kfe.1_Silent_p.A179A|ELN_uc003tzn.2_Silent_p.A210A|ELN_uc003tzz.2_Silent_p.A188A|ELN_uc003tzo.2_Silent_p.A210A|ELN_uc003tzp.2_Silent_p.A166A|ELN_uc003tzq.2_Silent_p.A107A|ELN_uc003tzr.2_RNA|ELN_uc003tzs.2_Silent_p.A210A|ELN_uc003tzt.2_Silent_p.A215A|ELN_uc003tzu.2_Silent_p.A215A|ELN_uc003tzv.2_Silent_p.A200A|ELN_uc003tzx.2_Silent_p.A200A|ELN_uc011kff.1_Silent_p.A210A|ELN_uc003tzy.2_Silent_p.A205A	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor	210					blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	CCATCAAGGCCCCCAAGCTGC	0.433			T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						13	47	---	---	---	---	PASS
GPC2	221914	broad.mit.edu	37	7	99769784	99769784	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99769784C>A	uc003utv.2	-	6	1117	c.949G>T	c.(949-951)GCC>TCC	p.A317S	GPC2_uc010lgr.2_RNA	NM_152742	NP_689955	Q8N158	GPC2_HUMAN	glypican 2 precursor	317						anchored to membrane|endoplasmic reticulum|extracellular space|plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			breast(1)|pancreas(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ATGGACTCGGCCGTCAGCTCA	0.552													25	67	---	---	---	---	PASS
AASS	10157	broad.mit.edu	37	7	121753257	121753257	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121753257C>A	uc003vka.2	-	10	1289	c.1193G>T	c.(1192-1194)TGT>TTT	p.C398F	AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Missense_Mutation_p.C398F|AASS_uc011knw.1_Intron	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor	398	Lysine-ketoglutarate reductase.				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)	GTCAATGGAACACATCAGGAT	0.413													25	80	---	---	---	---	PASS
CNOT4	4850	broad.mit.edu	37	7	135099078	135099078	+	Splice_Site	SNP	A	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135099078A>C	uc003vsv.1	-	5	868	c.561_splice	c.e5+1	p.K187_splice	CNOT4_uc003vss.2_Splice_Site_p.K187_splice|CNOT4_uc011kpz.1_Splice_Site_p.K187_splice|CNOT4_uc003vst.2_Splice_Site_p.K187_splice|CNOT4_uc003vsu.1_Splice_Site_p.K187_splice|CNOT4_uc011kpy.1_Splice_Site_p.K187_splice	NM_001008225	NP_001008226	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4						nuclear-transcribed mRNA poly(A) tail shortening|protein autoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	nucleotide binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding				0						GGACTATATTACCTTAAGTGT	0.358													6	257	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151879142	151879142	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151879142G>A	uc003wla.2	-	36	6022	c.5803C>T	c.(5803-5805)CCC>TCC	p.P1935S	MLL3_uc003wkz.2_Missense_Mutation_p.P996S	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	1935	Pro-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		ATTTGAAGGGGCCTAGATACC	0.463			N		medulloblastoma								45	148	---	---	---	---	PASS
DEFA5	1670	broad.mit.edu	37	8	6914113	6914113	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6914113C>T	uc003wra.1	-	1	147	c.107G>A	c.(106-108)GGG>GAG	p.G36E		NM_021010	NP_066290	Q01523	DEF5_HUMAN	defensin, alpha 5 preproprotein	36					defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space					0				COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		GTTGTCTTCCCCAGACTGCTT	0.527													41	164	---	---	---	---	PASS
PRSS55	203074	broad.mit.edu	37	8	10383111	10383111	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10383111G>A	uc003wta.2	+	1	31	c.16G>A	c.(16-18)GTG>ATG	p.V6M	uc010lru.2_Intron	NM_198464	NP_940866	Q6UWB4	PRS55_HUMAN	hypothetical protein LOC203074 precursor	6					proteolysis	integral to membrane	serine-type endopeptidase activity			ovary(1)	1						CCTGTTCTCAGTGTTGCTGCT	0.652													20	100	---	---	---	---	PASS
ZNF395	55893	broad.mit.edu	37	8	28209072	28209072	+	Silent	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28209072C>G	uc003xgq.2	-	7	1261	c.1173G>C	c.(1171-1173)GGG>GGC	p.G391G	ZNF395_uc003xgt.2_Silent_p.G391G|ZNF395_uc003xgr.2_Silent_p.G391G|ZNF395_uc003xgs.2_Silent_p.G391G	NM_018660	NP_061130	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	391					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding				0		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		TGCTGAGAGCCCCTGAGGGCA	0.627													54	144	---	---	---	---	PASS
SDC2	6383	broad.mit.edu	37	8	97620689	97620689	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97620689G>T	uc003yhv.1	+	4	1051	c.433G>T	c.(433-435)GTC>TTC	p.V145F	SDC2_uc011lgu.1_Missense_Mutation_p.V116F	NM_002998	NP_002989	P34741	SDC2_HUMAN	syndecan 2 precursor	145	Helical; (Potential).					integral to plasma membrane	cytoskeletal protein binding|PDZ domain binding			ovary(2)	2	Breast(36;3.41e-05)				Sargramostim(DB00020)	ACGGACAGAAGTCCTAGCAGG	0.478													24	117	---	---	---	---	PASS
EFR3A	23167	broad.mit.edu	37	8	132999873	132999873	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132999873C>A	uc003yte.2	+	18	2190	c.1989C>A	c.(1987-1989)AAC>AAA	p.N663K		NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A	663						plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			TTCTGACCAACAAGATTGCAG	0.373													7	27	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144943084	144943084	+	Silent	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144943084G>T	uc003zaa.1	-	1	4351	c.4338C>A	c.(4336-4338)ACC>ACA	p.T1446T		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	1446						cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GAGCCACCGCGGTGTGGTCGT	0.622													3	54	---	---	---	---	PASS
MPDZ	8777	broad.mit.edu	37	9	13183448	13183448	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13183448T>C	uc010mia.1	-	18	2675	c.2618A>G	c.(2617-2619)TAT>TGT	p.Y873C	MPDZ_uc010mhy.2_Missense_Mutation_p.Y873C|MPDZ_uc010mhz.2_Missense_Mutation_p.Y873C|MPDZ_uc011lmn.1_Missense_Mutation_p.Y873C|MPDZ_uc003zlb.3_Missense_Mutation_p.Y873C	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein	873					interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)		GGAAGAACCATAGTTCAGGCC	0.403													9	26	---	---	---	---	PASS
ACO1	48	broad.mit.edu	37	9	32408522	32408522	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32408522G>A	uc003zqw.3	+	4	432	c.277G>A	c.(277-279)GCT>ACT	p.A93T	ACO1_uc010mjh.1_5'UTR|ACO1_uc003zqx.3_Missense_Mutation_p.A93T|ACO1_uc003zqy.3_RNA	NM_002197	NP_002188	P21399	ACOC_HUMAN	aconitase 1	93					citrate metabolic process|response to iron(II) ion|tricarboxylic acid cycle	cytosol|endoplasmic reticulum|Golgi apparatus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron-responsive element binding|isocitrate hydro-lyase (cis-aconitate-forming) activity|metal ion binding|protein binding				0			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		GGGTGTGCCCGCTGTGGTTGA	0.408													39	281	---	---	---	---	PASS
UNC13B	10497	broad.mit.edu	37	9	35403942	35403942	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35403942G>A	uc003zwq.2	+	39	4980	c.4688G>A	c.(4687-4689)CGG>CAG	p.R1563Q	UNC13B_uc003zwr.2_Missense_Mutation_p.R1582Q|ATP8B5P_uc010mkn.1_5'Flank|ATP8B5P_uc010mko.2_5'Flank|ATP8B5P_uc010mkp.2_5'Flank|ATP8B5P_uc003zwu.2_5'Flank	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	1563					excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			ACCATTCTCCGGATTTTATCT	0.552													23	621	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84606081	84606081	+	Silent	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84606081G>A	uc004amn.2	+	4	743	c.696G>A	c.(694-696)AAG>AAA	p.K232K		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	232	Pro-rich.					integral to membrane					0						TGGATTCCAAGTTCCCCATAG	0.537													85	228	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90497821	90497821	+	Silent	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90497821C>T	uc004app.3	+	1	50	c.15C>T	c.(13-15)GTC>GTT	p.V5V	C9orf79_uc004apo.1_Silent_p.V5V	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	5						integral to membrane				ovary(3)	3						GAAATCTCGTCATCCCTCTAG	0.607													18	51	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	98775342	98775342	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98775342G>T	uc010msa.1	+	4	2329	c.1453G>T	c.(1453-1455)GAA>TAA	p.E485*	uc011lun.1_Intron					RecName: Full=Uncharacterized protein C9orf102;																		GACTCTGTGTGAAAAAGCACC	0.393													21	46	---	---	---	---	PASS
ZNF33A	7581	broad.mit.edu	37	10	38343662	38343662	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38343662G>C	uc001izh.2	+	5	785	c.607G>C	c.(607-609)GAG>CAG	p.E203Q	ZNF33A_uc001izg.2_Missense_Mutation_p.E204Q|ZNF33A_uc010qev.1_Missense_Mutation_p.E210Q|ZNF33A_uc001izi.1_Intron	NM_006974	NP_008905	Q06730	ZN33A_HUMAN	zinc finger protein 33A isoform b	203						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						GAGTCATCATGAGGAGACTTT	0.348													27	108	---	---	---	---	PASS
PIK3AP1	118788	broad.mit.edu	37	10	98383279	98383279	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98383279C>A	uc001kmq.2	-	11	1813	c.1685G>T	c.(1684-1686)AGT>ATT	p.S562I	PIK3AP1_uc001kmo.2_Missense_Mutation_p.S161I|PIK3AP1_uc001kmp.2_Missense_Mutation_p.S384I	NM_152309	NP_689522	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	562						cytoplasm|plasma membrane				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		CCGCTCTTGACTTTTTTCTGC	0.343													88	314	---	---	---	---	PASS
EIF3A	8661	broad.mit.edu	37	10	120802059	120802059	+	Silent	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120802059G>A	uc001ldu.2	-	19	3119	c.2973C>T	c.(2971-2973)AAC>AAT	p.N991N	EIF3A_uc010qsu.1_Silent_p.N957N|EIF3A_uc009xzg.1_Silent_p.N30N	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,	991	7.|Asp-rich.|25 X 10 AA approximate tandem repeats of [DE]-[DE]-[DE]-R-[SEVGFPILV]-[HPSN]- [RSW]-[RL]-[DRGTIHN]-[EPMANLGDT].				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		CATCATCTGTGTTACGCCAGG	0.582													55	162	---	---	---	---	PASS
OR52J3	119679	broad.mit.edu	37	11	5068546	5068546	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5068546G>T	uc010qyv.1	+	1	791	c.791G>T	c.(790-792)CGA>CTA	p.R264L		NM_001001916	NP_001001916	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J,	264	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|lung(1)|skin(1)	3		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTTACTCATCGATTTGGACAC	0.443													73	329	---	---	---	---	PASS
PIK3C2A	5286	broad.mit.edu	37	11	17191060	17191060	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17191060C>G	uc001mmq.3	-	1	295	c.229G>C	c.(229-231)GTG>CTG	p.V77L	PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Intron|PIK3C2A_uc001mmr.3_RNA|PIK3C2A_uc010rcx.1_Missense_Mutation_p.V77L|PIK3C2A_uc009ygv.1_Missense_Mutation_p.V77L	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha	77	Interaction with clathrin.				cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	TCAGGAAACACCATGAGATCA	0.393													14	511	---	---	---	---	PASS
PIK3C2A	5286	broad.mit.edu	37	11	17191061	17191061	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17191061C>A	uc001mmq.3	-	1	294	c.228G>T	c.(226-228)ATG>ATT	p.M76I	PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Intron|PIK3C2A_uc001mmr.3_RNA|PIK3C2A_uc010rcx.1_Missense_Mutation_p.M76I|PIK3C2A_uc009ygv.1_Missense_Mutation_p.M76I	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha	76	Interaction with clathrin.				cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	CAGGAAACACCATGAGATCAT	0.393													14	517	---	---	---	---	PASS
SLC6A5	9152	broad.mit.edu	37	11	20673901	20673901	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20673901T>A	uc001mqd.2	+	15	2410	c.2137T>A	c.(2137-2139)TGG>AGG	p.W713R	SLC6A5_uc009yic.2_Missense_Mutation_p.W478R	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter	713					synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)	CTATCCTAACTGGTCCATGGT	0.468													114	206	---	---	---	---	PASS
OR4C6	219432	broad.mit.edu	37	11	55433015	55433015	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55433015T>A	uc001nht.3	+	3	638	c.373T>A	c.(373-375)TGT>AGT	p.C125S	OR4C6_uc010rik.1_Missense_Mutation_p.C125S	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	125	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						CGTGGCCATCTGTAAGCCCCT	0.542													79	128	---	---	---	---	PASS
SLC22A25	387601	broad.mit.edu	37	11	62931543	62931543	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62931543C>A	uc001nwr.1	-	9	1397	c.1397G>T	c.(1396-1398)GGA>GTA	p.G466V	SLC22A10_uc010rmo.1_Intron|SLC22A25_uc009yoq.1_RNA|SLC22A25_uc001nws.1_RNA	NM_199352	NP_955384	Q6T423	S22AP_HUMAN	putative UST1-like organic anion transporter	466	Cytoplasmic (Potential).				transmembrane transport	integral to membrane				ovary(3)|skin(1)	4						AGTAGCTCTTCCCCTTGGAGT	0.403													58	255	---	---	---	---	PASS
CNTN5	53942	broad.mit.edu	37	11	99715991	99715991	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99715991G>T	uc001pga.2	+	6	913	c.574G>T	c.(574-576)GCC>TCC	p.A192S	CNTN5_uc009ywv.1_Missense_Mutation_p.A192S|CNTN5_uc001pfz.2_Missense_Mutation_p.A192S|CNTN5_uc001pgb.2_Missense_Mutation_p.A118S	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	192					cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ACTGCAGTTTGCCTGTGAGTA	0.328													38	155	---	---	---	---	PASS
ANGPTL5	253935	broad.mit.edu	37	11	101765758	101765758	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101765758T>C	uc001pgl.2	-	8	1295	c.699A>G	c.(697-699)ATA>ATG	p.I233M		NM_178127	NP_835228	Q86XS5	ANGL5_HUMAN	angiopoietin-like 5 precursor	233	Fibrinogen C-terminal.				signal transduction	extracellular space	receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.043)		BRCA - Breast invasive adenocarcinoma(274;0.0328)		TCTGATTTACTATATAAAAAA	0.274													40	61	---	---	---	---	PASS
YAP1	10413	broad.mit.edu	37	11	102080293	102080293	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102080293C>A	uc001pgt.2	+	6	1400	c.1030C>A	c.(1030-1032)CAG>AAG	p.Q344K	YAP1_uc001pgs.2_Intron|YAP1_uc001pgu.2_Intron|YAP1_uc001pgv.2_Intron|YAP1_uc010ruo.1_Missense_Mutation_p.Q166K|YAP1_uc001pgw.2_Missense_Mutation_p.Q168K|YAP1_uc010rup.1_Missense_Mutation_p.Q109K	NM_001130145	NP_001123617	P46937	YAP1_HUMAN	Yes-associated protein 1, 65kDa isoform 1	344	Transactivation domain.				cell proliferation|cellular response to gamma radiation|contact inhibition|hippo signaling cascade|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		TCCAAAATGTCAGGTAGGCTC	0.358													294	110	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49431061	49431061	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49431061G>A	uc001rta.3	-	34	10078	c.10078C>T	c.(10078-10080)CAG>TAG	p.Q3360*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	3360	Gln-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CCTCCATGCTGCCCACTTAGC	0.602			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			9	23	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49438218	49438218	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49438218C>G	uc001rta.3	-	20	5051	c.5051G>C	c.(5050-5052)AGC>ACC	p.S1684T		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1684					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GCGTTTTTTGCTTTCCTCGGT	0.597			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)	OREG0021780	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	29	104	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	72936106	72936106	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72936106G>T	uc001sxa.2	+	7	1653	c.1623G>T	c.(1621-1623)ATG>ATT	p.M541I		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	541	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						CTAATTTTATGGGCCATTCAG	0.308													19	54	---	---	---	---	PASS
UTP20	27340	broad.mit.edu	37	12	101702101	101702101	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101702101C>G	uc001tia.1	+	18	2290	c.2134C>G	c.(2134-2136)CCT>GCT	p.P712A		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	712					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						GACTGCTGTCCCTGATGGGCC	0.393													36	115	---	---	---	---	PASS
KSR2	283455	broad.mit.edu	37	12	118112090	118112090	+	Intron	SNP	G	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118112090G>C	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					cttctcacctgggctgccgct	0.070													3	10	---	---	---	---	PASS
RFC5	5985	broad.mit.edu	37	12	118464747	118464747	+	Silent	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118464747C>A	uc001twq.2	+	8	842	c.717C>A	c.(715-717)ACC>ACA	p.T239T	RFC5_uc010syx.1_Silent_p.T218T|RFC5_uc010syy.1_Silent_p.T218T|RFC5_uc010syz.1_Silent_p.T154T|RFC5_uc009zwr.2_Silent_p.T239T	NM_007370	NP_031396	P40937	RFC5_HUMAN	replication factor C 5 isoform 1	239					cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ACACCTGCACCGGGCACCCGC	0.527													68	174	---	---	---	---	PASS
MED4	29079	broad.mit.edu	37	13	48669218	48669218	+	5'UTR	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48669218C>T	uc001vby.1	-	1					MED4_uc010tge.1_5'UTR|MED4_uc010tgf.1_5'UTR	NM_014166	NP_054885	Q9NPJ6	MED4_HUMAN	mediator complex subunit 4						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1		all_cancers(8;2.93e-25)|all_epithelial(8;4.38e-13)|all_lung(13;7.37e-06)|all_hematologic(8;8.61e-05)|Breast(56;0.000141)|Lung NSC(96;0.000518)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.00559)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;5.18e-07)		CAGCCATTTTCCCCAGAGTCC	0.652											OREG0022406	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	38	---	---	---	---	PASS
COL4A2	1284	broad.mit.edu	37	13	111143635	111143635	+	Silent	SNP	G	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111143635G>C	uc001vqx.2	+	37	3691	c.3402G>C	c.(3400-3402)GGG>GGC	p.G1134G		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	1134	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GCTTCCCTGGGATAACAGGCG	0.562													4	13	---	---	---	---	PASS
OR4N2	390429	broad.mit.edu	37	14	20296344	20296344	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20296344T>C	uc010tkv.1	+	1	737	c.737T>C	c.(736-738)GTT>GCT	p.V246A		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	246	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CATATCATTGTTATATTCTTC	0.483													44	429	---	---	---	---	PASS
OR4K2	390431	broad.mit.edu	37	14	20345187	20345187	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20345187G>T	uc001vwh.1	+	1	761	c.761G>T	c.(760-762)TGC>TTC	p.C254F		NM_001005501	NP_001005501	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K,	254	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTTGGGCCATGCATCTTCATC	0.418													42	500	---	---	---	---	PASS
SALL2	6297	broad.mit.edu	37	14	21991220	21991220	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21991220G>C	uc001wbe.2	-	2	2924	c.2642C>G	c.(2641-2643)CCA>CGA	p.P881R	SALL2_uc010tly.1_Missense_Mutation_p.P879R|SALL2_uc010tlz.1_Missense_Mutation_p.P744R|SALL2_uc001wbf.3_Intron|SALL2_uc010tma.1_Missense_Mutation_p.P746R|SALL2_uc001wbg.1_Intron	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2	881							DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		TTCCCCTTCTGGGGTGAGTGC	0.592													14	49	---	---	---	---	PASS
C14orf37	145407	broad.mit.edu	37	14	58604947	58604947	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58604947C>G	uc001xdc.2	-	2	1241	c.1130G>C	c.(1129-1131)GGC>GCC	p.G377A	C14orf37_uc010tro.1_Missense_Mutation_p.G415A|C14orf37_uc001xdd.2_Missense_Mutation_p.G377A|C14orf37_uc001xde.2_Missense_Mutation_p.G377A	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor	377	Extracellular (Potential).					integral to membrane	binding				0						CAGGGCTGTGCCCGTGTGTGT	0.537													80	347	---	---	---	---	PASS
EIF2B2	8892	broad.mit.edu	37	14	75475874	75475874	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75475874G>C	uc001xrc.1	+	8	1121	c.1039G>C	c.(1039-1041)GAT>CAT	p.D347H		NM_014239	NP_055054	P49770	EI2BB_HUMAN	eukaryotic translation initiation factor 2B,	347					cellular response to stimulus|myelination|oligodendrocyte development|ovarian follicle development|regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	ATP binding|GTP binding|protein binding|translation initiation factor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00661)		CTACCATCCTGATGATCATGT	0.473													89	234	---	---	---	---	PASS
SNHG10	283596	broad.mit.edu	37	14	95999947	95999947	+	Intron	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95999947C>T	uc001yek.2	-						SNHG10_uc001yel.2_RNA|GLRX5_uc001yem.1_5'Flank	NR_001459				Homo sapiens cDNA FLJ40557 fis, clone THYMU2002745.												0						CAACCCTGTGCGGCTCCAAGA	0.458													4	222	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	25422021	25422021	+	Intron	SNP	T	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25422021T>G	uc001yys.1	+						SNORD115-4_uc001yyu.1_RNA|SNORD115-5_uc001yyv.1_5'Flank					Homo sapiens clone Rt-5 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.																		AGAGAGGTGATGACTTAAAAA	0.547													18	372	---	---	---	---	PASS
DUOX2	50506	broad.mit.edu	37	15	45400380	45400380	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45400380G>C	uc010bea.2	-	13	1642	c.1439C>G	c.(1438-1440)TCC>TGC	p.S480C	DUOX2_uc001zun.2_Missense_Mutation_p.S480C	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	480	Extracellular (Potential).|Peroxidase-like; mediates peroxidase activity (By similarity).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CTCTAGCTGGGATAGGTCCTG	0.617													28	91	---	---	---	---	PASS
ZNF75A	7627	broad.mit.edu	37	16	3367720	3367720	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3367720C>T	uc002cut.3	+	6	1268	c.742C>T	c.(742-744)CAT>TAT	p.H248Y	ZNF75A_uc002cuv.3_RNA	NM_153028	NP_694573	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	248	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1						CTTCACATGTCATGAATGTGG	0.388													39	121	---	---	---	---	PASS
CD2BP2	10421	broad.mit.edu	37	16	30364863	30364863	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30364863G>A	uc002dxr.2	-	4	887	c.634C>T	c.(634-636)CGG>TGG	p.R212W	CD2BP2_uc002dxs.2_Missense_Mutation_p.R212W	NM_006110	NP_006101	O95400	CD2B2_HUMAN	CD2 antigen (cytoplasmic tail) binding protein	212					assembly of spliceosomal tri-snRNP	cytoplasm|nucleoplasm|U5 snRNP	protein binding|ribonucleoprotein binding			ovary(1)	1						AGGTTGCCCCGGGCCACCATC	0.652													17	49	---	---	---	---	PASS
ZNF747	65988	broad.mit.edu	37	16	30544471	30544471	+	Missense_Mutation	SNP	T	C	C	rs142751951		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30544471T>C	uc002dyn.2	-	2	679	c.485A>G	c.(484-486)CAG>CGG	p.Q162R	ZNF768_uc010vex.1_Splice_Site|ZNF747_uc002dyo.1_Intron|ZNF747_uc010vey.1_Intron|uc002dyp.1_5'Flank	NM_023931	NP_076420	Q9BV97	ZN747_HUMAN	zinc finger protein 747	162					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding				0						TTCTGGAATCTGCTGAAAGAT	0.617													26	73	---	---	---	---	PASS
ADCY7	113	broad.mit.edu	37	16	50324372	50324372	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50324372C>T	uc002egd.1	+	2	444	c.176C>T	c.(175-177)CCC>CTC	p.P59L	ADCY7_uc002egb.1_Missense_Mutation_p.P59L|ADCY7_uc002egc.1_Missense_Mutation_p.P59L	NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7	59					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			skin(1)	1		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)	ACCCAGGACCCCTCCAGACAC	0.637													13	52	---	---	---	---	PASS
CBFA2T3	863	broad.mit.edu	37	16	88951442	88951442	+	Intron	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88951442C>A	uc002fmm.1	-						CBFA2T3_uc002fml.1_Intron|CBFA2T3_uc010cif.1_Intron	NM_005187	NP_005178	O75081	MTG16_HUMAN	myeloid translocation gene on chromosome 16						cell proliferation|granulocyte differentiation	Golgi membrane|nucleolus|nucleoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(3)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CCCGCCCCACCGGGCTGCTCA	0.667			T	RUNX1	AML								3	25	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7576851	7576851	+	Splice_Site	SNP	A	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7576851A>T	uc002gim.2	-	9	1187	c.993_splice	c.e9+1	p.Q331_splice	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Splice_Site_p.Q331_splice|TP53_uc010cne.1_Intron|TP53_uc010cnf.1_Splice_Site_p.Q199_splice|TP53_uc010cng.1_Splice_Site_p.Q199_splice|TP53_uc002gii.1_Splice_Site_p.Q199_splice|TP53_uc010cnh.1_Splice_Site_p.Q331_splice|TP53_uc010cni.1_Splice_Site_p.Q331_splice|TP53_uc002gij.2_Splice_Site_p.Q331_splice	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.?(8)|p.0?(7)|p.I332fs*49(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AAGACTTAGTACCTGAAGGGT	0.463		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			62	69	---	---	---	---	PASS
ZNF286A	57335	broad.mit.edu	37	17	15619753	15619753	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15619753G>T	uc010cot.2	+	6	1111	c.715G>T	c.(715-717)GAG>TAG	p.E239*	ZNF286A_uc002goz.3_Nonsense_Mutation_p.E127*|ZNF286A_uc010vwa.1_Nonsense_Mutation_p.E239*|ZNF286A_uc002gpa.2_Nonsense_Mutation_p.E239*	NM_001130842	NP_001124314	Q9HBT8	Z286A_HUMAN	zinc finger protein 286	239					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		AACTTATAAAGAGAAAAAACC	0.368													40	44	---	---	---	---	PASS
KRT40	125115	broad.mit.edu	37	17	39134531	39134531	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39134531C>G	uc010cxh.1	-	9	1375	c.1214G>C	c.(1213-1215)TGT>TCT	p.C405S	KRT40_uc002hvq.1_RNA	NM_182497	NP_872303	Q6A162	K1C40_HUMAN	type I hair keratin KA36	405	Tail.					intermediate filament	structural molecule activity				0		Breast(137;0.00043)				TGTGGTCGAACATGGGCTACA	0.443													3	136	---	---	---	---	PASS
EZH1	2145	broad.mit.edu	37	17	40859999	40859999	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40859999T>A	uc002iaz.2	-	15	1782	c.1637A>T	c.(1636-1638)AAG>ATG	p.K546M	EZH1_uc002iba.2_Missense_Mutation_p.K537M|EZH1_uc010wgt.1_Missense_Mutation_p.K476M|EZH1_uc010wgu.1_Missense_Mutation_p.K552M|EZH1_uc010wgv.1_Missense_Mutation_p.K506M|EZH1_uc010wgw.1_Missense_Mutation_p.K407M|EZH1_uc010cyp.2_Missense_Mutation_p.K447M|EZH1_uc010cyq.2_Missense_Mutation_p.K463M|EZH1_uc010cyo.1_Missense_Mutation_p.K209M|EZH1_uc010cyr.1_Missense_Mutation_p.K198M	NM_001991	NP_001982	Q92800	EZH1_HUMAN	enhancer of zeste homolog 1	546	Cys-rich.				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	chromatin binding|DNA binding			ovary(3)	3		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		CTGGCAGAACTTCTCACAGAA	0.522													9	236	---	---	---	---	PASS
AOC3	8639	broad.mit.edu	37	17	41004946	41004946	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41004946A>T	uc002ibv.2	+	1	1746	c.1586A>T	c.(1585-1587)GAT>GTT	p.D529V		NM_003734	NP_003725	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3 precursor	529	Extracellular (Potential).	Calcium 1.			amine metabolic process|cell adhesion|inflammatory response	cell surface|integral to membrane|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|protein homodimerization activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	TTCAAGGTGGATCTGGATGTA	0.512													3	88	---	---	---	---	PASS
CACNA1G	8913	broad.mit.edu	37	17	48695601	48695601	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48695601C>A	uc002irk.1	+	32	5696	c.5324C>A	c.(5323-5325)CCC>CAC	p.P1775H	CACNA1G_uc002irj.1_Missense_Mutation_p.P1741H|CACNA1G_uc002irl.1_Missense_Mutation_p.P1752H|CACNA1G_uc002irm.1_Missense_Mutation_p.P1741H|CACNA1G_uc002irn.1_Missense_Mutation_p.P1734H|CACNA1G_uc002iro.1_Missense_Mutation_p.P1741H|CACNA1G_uc002irp.1_Missense_Mutation_p.P1775H|CACNA1G_uc002irq.1_Missense_Mutation_p.P1752H|CACNA1G_uc002irr.1_Missense_Mutation_p.P1775H|CACNA1G_uc002irs.1_Missense_Mutation_p.P1764H|CACNA1G_uc002irt.1_Missense_Mutation_p.P1757H|CACNA1G_uc002irv.1_Missense_Mutation_p.P1764H|CACNA1G_uc002irw.1_Missense_Mutation_p.P1752H|CACNA1G_uc002iru.1_Missense_Mutation_p.P1741H|CACNA1G_uc002irx.1_Missense_Mutation_p.P1688H|CACNA1G_uc002iry.1_Missense_Mutation_p.P1677H|CACNA1G_uc002irz.1_Missense_Mutation_p.P1681H|CACNA1G_uc002isa.1_Missense_Mutation_p.P1654H|CACNA1G_uc002isb.1_Missense_Mutation_p.P1695H|CACNA1G_uc002isc.1_Missense_Mutation_p.P1677H|CACNA1G_uc002isd.1_Missense_Mutation_p.P1663H|CACNA1G_uc002ise.1_Missense_Mutation_p.P1643H|CACNA1G_uc002isf.1_Missense_Mutation_p.P1670H|CACNA1G_uc002isg.1_Missense_Mutation_p.P1636H|CACNA1G_uc002ish.1_Missense_Mutation_p.P1643H|CACNA1G_uc002isi.1_Missense_Mutation_p.P1631H	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G	1775	IV.|Extracellular (Potential).				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GAGACACACCCCTGTGAGGGC	0.612													53	62	---	---	---	---	PASS
ABCC3	8714	broad.mit.edu	37	17	48764928	48764928	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48764928C>G	uc002isl.2	+	30	4392	c.4312C>G	c.(4312-4314)CGA>GGA	p.R1438G	ABCC3_uc002isn.2_Missense_Mutation_p.R192G	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3	1438	Cytoplasmic (By similarity).|ABC transporter 2.				bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)	GTGCCTGGCCCGAGCCCTGCT	0.647													21	25	---	---	---	---	PASS
SERPINB2	5055	broad.mit.edu	37	18	61569664	61569664	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61569664G>A	uc010xeu.1	+	8	1038	c.705G>A	c.(703-705)ATG>ATA	p.M235I	SERPINB2_uc002ljo.2_Missense_Mutation_p.M235I|SERPINB2_uc010dqh.2_Missense_Mutation_p.M165I|SERPINB2_uc002ljp.1_Missense_Mutation_p.M40I|SERPINB2_uc002ljq.1_Missense_Mutation_p.M40I	NM_001143818	NP_001137290	P05120	PAI2_HUMAN	serine (or cysteine) proteinase inhibitor, clade	235					anti-apoptosis|blood coagulation|fibrinolysis|regulation of proteolysis	extracellular space|Golgi apparatus|plasma membrane	serine-type endopeptidase inhibitor activity			lung(1)|skin(1)	2		Esophageal squamous(42;0.131)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	TACAGATGATGTACTTGCGTG	0.363													27	81	---	---	---	---	PASS
TRAPPC5	126003	broad.mit.edu	37	19	7747477	7747477	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7747477G>T	uc002mhi.1	+	2	408	c.338G>T	c.(337-339)CGC>CTC	p.R113L	TRAPPC5_uc002mhj.1_Missense_Mutation_p.R113L|TRAPPC5_uc002mhk.1_Missense_Mutation_p.R113L	NM_001042462	NP_001035927	Q8IUR0	TPPC5_HUMAN	trafficking protein particle complex 5	113					vesicle-mediated transport	endoplasmic reticulum	guanylate cyclase activity|heme binding				0						GATGACGCGCGCACCTTCTAC	0.627													9	23	---	---	---	---	PASS
ABHD8	79575	broad.mit.edu	37	19	17411739	17411739	+	Silent	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17411739C>G	uc002ngb.3	-	2	927	c.687G>C	c.(685-687)GCG>GCC	p.A229A		NM_024527	NP_078803	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	229							hydrolase activity				0						CCTCAGCCAGCGCATAGAAGG	0.602													37	107	---	---	---	---	PASS
CILP2	148113	broad.mit.edu	37	19	19654937	19654937	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19654937G>A	uc002nmv.3	+	8	1668	c.1583G>A	c.(1582-1584)AGC>AAC	p.S528N	CILP2_uc002nmw.3_Missense_Mutation_p.S534N	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	528						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1						GTGGACCCCAGCGGTGAGTTC	0.627													19	47	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23545124	23545124	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23545124A>T	uc002nre.2	-	4	770	c.657T>A	c.(655-657)TTT>TTA	p.F219L	ZNF91_uc010xrj.1_Missense_Mutation_p.F187L	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	219	C2H2-type 3.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				AGGACCAATGAAAGGTTTTTT	0.353													4	131	---	---	---	---	PASS
FUZ	80199	broad.mit.edu	37	19	50310553	50310553	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50310553G>T	uc002ppq.1	-	11	1217	c.1112C>A	c.(1111-1113)ACT>AAT	p.T371N	FUZ_uc002ppr.1_Missense_Mutation_p.T271N|FUZ_uc002pps.1_RNA|FUZ_uc002ppt.1_RNA|FUZ_uc002ppu.1_Missense_Mutation_p.T335N|FUZ_uc002ppv.1_Missense_Mutation_p.T321N	NM_025129	NP_079405	Q9BT04	FUZZY_HUMAN	fuzzy homolog	371	Leu-rich.				cilium assembly|embryonic body morphogenesis|embryonic skeletal system morphogenesis|establishment of planar polarity|hair follicle development|neural tube closure|protein transport|regulation of smoothened signaling pathway	cytoplasm|cytoskeleton					0		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00793)|GBM - Glioblastoma multiforme(134;0.0116)		TGGTTCCTCAGTCCCCAACAC	0.637													15	51	---	---	---	---	PASS
VN1R2	317701	broad.mit.edu	37	19	53762406	53762406	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53762406T>A	uc002qbi.2	+	1	862	c.778T>A	c.(778-780)TCA>ACA	p.S260T		NM_173856	NP_776255	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	260	Extracellular (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity				0				GBM - Glioblastoma multiforme(134;0.00301)		AGTCACAAAGTCAGTATATGC	0.433													28	222	---	---	---	---	PASS
ZNF667	63934	broad.mit.edu	37	19	56953173	56953173	+	Silent	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56953173C>T	uc002qnd.2	-	5	1353	c.1191G>A	c.(1189-1191)CGG>CGA	p.R397R	ZNF667_uc010etl.2_Silent_p.R179R|ZNF667_uc002qne.2_Silent_p.R397R|ZNF667_uc010etm.2_Silent_p.R340R	NM_022103	NP_071386	Q5HYK9	ZN667_HUMAN	zinc finger protein 667	397	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		GGGATGAATGCCGATTGCAGA	0.363													4	115	---	---	---	---	PASS
SNAP25	6616	broad.mit.edu	37	20	10280021	10280021	+	Silent	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10280021C>T	uc002wnq.1	+	7	725	c.513C>T	c.(511-513)ATC>ATT	p.I171I	SNAP25_uc002wnr.1_Silent_p.I171I|SNAP25_uc002wns.1_Silent_p.I108I|SNAP25_uc010gca.1_Silent_p.I171I|SNAP25_uc010gcb.1_Silent_p.I108I|SNAP25_uc010gcc.1_Silent_p.I65I	NM_130811	NP_570824	P60880	SNP25_HUMAN	synaptosomal-associated protein 25 isoform	171	t-SNARE coiled-coil homology 2.				energy reserve metabolic process|glutamate secretion|neurotransmitter uptake|synaptic vesicle docking involved in exocytosis	cell junction|growth cone|perinuclear region of cytoplasm|synapse|synaptosome				skin(2)	2					Botulinum Toxin Type A(DB00083)	GCAATGAGATCGATACACAGA	0.507													29	92	---	---	---	---	PASS
MYH7B	57644	broad.mit.edu	37	20	33582189	33582189	+	Silent	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33582189C>T	uc002xbi.1	+	25	2903	c.2811C>T	c.(2809-2811)GCC>GCT	p.A937A		NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	895	Potential.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			ATGACCTGGCCCTGCAGCTGC	0.667													12	27	---	---	---	---	PASS
JPH2	57158	broad.mit.edu	37	20	42788493	42788493	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42788493G>T	uc002xli.1	-	2	1807	c.934C>A	c.(934-936)CTC>ATC	p.L312I		NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1	312	MORN 7.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			TCGTAGCGGAGGCCACTGGAG	0.662													9	21	---	---	---	---	PASS
SULF2	55959	broad.mit.edu	37	20	46295097	46295097	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46295097G>T	uc002xto.2	-	12	2042	c.1712C>A	c.(1711-1713)CCT>CAT	p.P571H	SULF2_uc002xtr.2_Missense_Mutation_p.P571H|SULF2_uc002xtq.2_Missense_Mutation_p.P571H|SULF2_uc010zyd.1_5'Flank	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	571					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						TTGGTCCTCAGGGGCCCCTGG	0.632													32	110	---	---	---	---	PASS
DDX27	55661	broad.mit.edu	37	20	47835947	47835947	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47835947C>T	uc002xuh.2	+	1	116	c.55C>T	c.(55-57)CAG>TAG	p.Q19*		NM_017895	NP_060365	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	19						nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			kidney(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GGCCGGACCGCAGGCTGTGCT	0.622													8	25	---	---	---	---	PASS
DIDO1	11083	broad.mit.edu	37	20	61512601	61512601	+	Silent	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61512601C>T	uc002ydr.1	-	16	4971	c.4707G>A	c.(4705-4707)GAG>GAA	p.E1569E	DIDO1_uc002yds.1_Silent_p.E1569E	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	1569					apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					CCTCACCGGTCTCAGTGGCCA	0.711													4	18	---	---	---	---	PASS
NPBWR2	2832	broad.mit.edu	37	20	62737655	62737655	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62737655A>G	uc011abt.1	-	1	530	c.530T>C	c.(529-531)CTG>CCG	p.L177P		NM_005286	NP_005277	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	177	Helical; Name=4; (Potential).					plasma membrane	opioid receptor activity|protein binding			large_intestine(1)	1	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					GGGCAGAACCAGGACCGTGAC	0.662													8	39	---	---	---	---	PASS
PPEF1	5475	broad.mit.edu	37	X	18725907	18725907	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18725907G>A	uc004cyq.2	+	4	489	c.8G>A	c.(7-9)TGC>TAC	p.C3Y	PPEF1_uc004cyp.2_Missense_Mutation_p.C3Y|PPEF1_uc004cyr.2_Missense_Mutation_p.C3Y|PPEF1_uc004cys.2_Missense_Mutation_p.C3Y|PPEF1_uc011mja.1_5'UTR	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding	3					detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					GTCATGGGATGCAGCAGTTCT	0.438													17	34	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34149040	34149040	+	Silent	SNP	A	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34149040A>G	uc004ddg.2	-	1	1389	c.1356T>C	c.(1354-1356)ACT>ACC	p.T452T		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	452										ovary(4)|central_nervous_system(1)	5						TGGGTTCCTTAGTTTTCTTCA	0.557													4	52	---	---	---	---	PASS
SHROOM4	57477	broad.mit.edu	37	X	50341478	50341478	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50341478C>G	uc004dpe.2	-	8	4026	c.4000G>C	c.(4000-4002)GGG>CGG	p.G1334R	SHROOM4_uc004dpd.3_RNA	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	1334	ASD2.				actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					TCTAGCAGCCCTCGCTGGGCC	0.478													9	7	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70349706	70349706	+	Splice_Site	SNP	G	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70349706G>A	uc004dyy.2	+	27	4066	c.3867_splice	c.e27+1	p.Q1289_splice	MED12_uc011mpq.1_Splice_Site_p.Q1289_splice|MED12_uc004dyz.2_Splice_Site_p.Q1289_splice|MED12_uc004dza.2_Splice_Site_p.Q1136_splice|MED12_uc010nla.2_Splice_Site	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12						androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					CTGCCAACAGGTCAGTTTCAC	0.532											OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	25	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107449748	107449748	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107449748T>A	uc004enw.3	-	9	715	c.612A>T	c.(610-612)CAA>CAT	p.Q204H	COL4A6_uc004env.3_Missense_Mutation_p.Q203H|COL4A6_uc011msn.1_Missense_Mutation_p.Q203H|COL4A6_uc010npk.2_Missense_Mutation_p.Q203H	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	204	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						TTGATCTTACTTGTAATCCTG	0.433									Alport_syndrome_with_Diffuse_Leiomyomatosis				51	41	---	---	---	---	PASS
MIR510	574515	broad.mit.edu	37	X	146353861	146353861	+	RNA	SNP	C	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146353861C>T	hsa-mir-510|MI0003197	-			c.66C>T																				0						ATGTGTTACTCCACTCTTAGA	0.413													21	24	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120612224	120612226	+	5'UTR	DEL	GCC	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612224_120612226delGCC	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGCCGCCTCAGCCGCCGCCCGAA	0.695			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				5	3	---	---	---	---	
CD55	1604	broad.mit.edu	37	1	207504820	207504821	+	Intron	DEL	AC	-	-	rs67713531		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207504820_207504821delAC	uc001hfq.3	+						CD55_uc001hfp.3_Intron|CD55_uc001hfr.3_Intron|CD55_uc010psf.1_Intron|CD55_uc009xcf.2_Intron|CD55_uc009xce.2_Intron|CD55_uc009xcg.2_Intron	NM_000574	NP_000565	P08174	DAF_HUMAN	decay accelerating factor for complement isoform						complement activation, classical pathway|elevation of cytosolic calcium ion concentration|innate immune response|respiratory burst	anchored to membrane|extracellular region|integral to plasma membrane|membrane raft|soluble fraction	receptor activity			ovary(1)	1					Chloramphenicol(DB00446)	tggcTTGTATacacacacacac	0.104													5	4	---	---	---	---	
URB2	9816	broad.mit.edu	37	1	229763687	229763687	+	Intron	DEL	T	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229763687delT	uc001hts.1	+						URB2_uc009xfd.1_Intron|TAF5L_uc001htq.2_5'Flank|TAF5L_uc001htr.2_5'Flank	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog							nucleolus				central_nervous_system(2)|ovary(1)	3						CATTAATACATTTTTTTTTTC	0.164													4	2	---	---	---	---	
HEATR1	55127	broad.mit.edu	37	1	236751520	236751520	+	Intron	DEL	A	-	-	rs34200005		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236751520delA	uc001hyd.1	-							NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28						rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GGGCCTTTTGAGATTAATAAT	0.343													3	4	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237850666	237850667	+	Intron	INS	-	T	T	rs41267515		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237850666_237850667insT	uc001hyl.1	+						RYR2_uc010pxz.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ttttcttcttcttttttttttt	0.327													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90048090	90048091	+	Intron	DEL	CA	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90048090_90048091delCA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		cacacacactcacacacacaca	0.238													5	3	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241726090	241726119	+	Intron	DEL	CACCAGGACCCCTGAGGGGATGGGAGCCAG	-	-	rs67004852	by1000genomes	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241726090_241726119delCACCAGGACCCCTGAGGGGATGGGAGCCAG	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		TGGGGGCCACCACCAGGACCCCTGAGGGGATGGGAGCCAGCATCAGGACC	0.691													4	2	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21305673	21305692	+	Intron	DEL	AGAGAGAGAGAGAGAGAGAC	-	-	rs6858028	by1000genomes	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21305673_21305692delAGAGAGAGAGAGAGAGAGAC	uc003gqh.1	-						KCNIP4_uc003gqf.1_5'Flank|KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				agagagagagagagagagagagagagagacagagagagag	0.223													2	4	---	---	---	---	
GABRB1	2560	broad.mit.edu	37	4	47034146	47034147	+	Intron	DEL	CA	-	-	rs28475494		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47034146_47034147delCA	uc003gxh.2	+						GABRB1_uc011bze.1_Intron|GABRB1_uc011bzd.1_Intron|GABRB1_uc010igg.2_Intron	NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	ATACCCTGGGcacacacacaca	0.416													4	2	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48596037	48596037	+	Intron	DEL	A	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48596037delA	uc003gyh.1	-						FRYL_uc003gyk.2_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						AGCGTTCCTTAAAAAAAAAAA	0.169													8	4	---	---	---	---	
PPAT	5471	broad.mit.edu	37	4	57267247	57267248	+	Intron	INS	-	A	A	rs6834384	by1000genomes	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57267247_57267248insA	uc003hbr.2	-							NM_002703	NP_002694	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase						glutamine metabolic process|nucleoside metabolic process|purine base biosynthetic process|purine ribonucleoside monophosphate biosynthetic process	cytosol	4 iron, 4 sulfur cluster binding|amidophosphoribosyltransferase activity|metal ion binding				0	Glioma(25;0.08)|all_neural(26;0.101)				L-Glutamine(DB00130)|Thioguanine(DB00352)	TGTGTGGTTTTAAAAAAAAAAT	0.287													6	3	---	---	---	---	
TMEM154	201799	broad.mit.edu	37	4	153573516	153573516	+	Intron	DEL	T	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153573516delT	uc003imw.1	-							NM_152680	NP_689893	Q6P9G4	TM154_HUMAN	transmembrane protein 154 precursor							integral to membrane					0	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				TCAATTAAACTTTTTTTTTTT	0.129													6	3	---	---	---	---	
ODZ3	55714	broad.mit.edu	37	4	183673226	183673227	+	Intron	INS	-	A	A	rs5864797		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183673226_183673227insA	uc003ivd.1	+						ODZ3_uc003ive.1_Intron	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		ttttatttattaaaaaaaaaaa	0.416													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	15379931	15379932	+	IGR	INS	-	AGGA	AGGA	rs151247219	by1000genomes	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15379931_15379932insAGGA								ANKH (508044 upstream) : FBXL7 (120373 downstream)																							gggagggagggaggaaggaagg	0.000													6	3	---	---	---	---	
GABBR1	2550	broad.mit.edu	37	6	29550536	29550536	+	Intron	DEL	A	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29550536delA	uc003nmp.3	-							NM_021903	NP_068703	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor 1						gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(5)|liver(1)|skin(1)	7					Baclofen(DB00181)|Progabide(DB00837)	CCATGACAAGAAAAAGCTTTG	0.552													4	2	---	---	---	---	
MTO1	25821	broad.mit.edu	37	6	74192512	74192513	+	Intron	INS	-	T	T	rs35121302		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74192512_74192513insT	uc003pgy.3	+						MTO1_uc010kav.2_Intron|MTO1_uc003pgz.3_Intron|MTO1_uc003pha.3_Intron|MTO1_uc003phb.3_Intron	NM_133645	NP_598400	Q9Y2Z2	MTO1_HUMAN	mitochondrial translation optimization 1 homolog						tRNA processing	mitochondrion	flavin adenine dinucleotide binding			ovary(3)|skin(2)|pancreas(1)	6						TTTtttctttcttttttttttt	0.158													4	2	---	---	---	---	
GPR31	2853	broad.mit.edu	37	6	167571409	167571410	+	5'Flank	INS	-	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167571409_167571410insC	uc011egq.1	-							NM_005299	NP_005290	O00270	GPR31_HUMAN	G protein-coupled receptor 31							integral to plasma membrane	G-protein coupled receptor activity				0		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		AAAGGCCTTTTCCTGCCACAGA	0.490													5	3	---	---	---	---	
RNF216	54476	broad.mit.edu	37	7	5800900	5800901	+	Intron	INS	-	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5800900_5800901insA	uc003soy.1	-						RNF216_uc010ksz.1_5'Flank|RNF216_uc010kta.1_5'Flank|RNF216_uc011jwj.1_5'Flank|RNF216_uc003sox.1_Intron	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b						apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		GGAGGTGGGTCAAAAAAAAAAA	0.337													6	3	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151936095	151936096	+	Intron	DEL	TT	-	-	rs3056723		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151936095_151936096delTT	uc003wla.2	-						MLL3_uc003wkz.2_5'Flank	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TAAGTATAACTTAAATGTTTGC	0.277			N		medulloblastoma								6	5	---	---	---	---	
ARFGEF1	10565	broad.mit.edu	37	8	68138509	68138510	+	Intron	DEL	CT	-	-	rs3837215		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68138509_68138510delCT	uc003xxo.1	-						ARFGEF1_uc003xxl.1_Intron|ARFGEF1_uc003xxn.1_Intron	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine						exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			AATGCACTTCCTCTTAAAGGTT	0.228													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	36409297	36409314	+	IGR	DEL	AGAAAGAAAAAGAAAGAA	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36409297_36409314delAGAAAGAAAAAGAAAGAA								RNF38 (8102 upstream) : MELK (163591 downstream)																							agaaagagagagaaagaaaaagaaagaaagaaagaaaa	0.147													3	3	---	---	---	---	
SEMA4D	10507	broad.mit.edu	37	9	91978182	91978183	+	Intron	INS	-	C	C	rs139774075	by1000genomes	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91978182_91978183insC	uc011ltm.1	-						SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aql.2_Intron|SEMA4D_uc004aqm.2_Intron	NM_001142287	NP_001135759	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 2						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						ACGTGGGATTTCCCCCCCCAGT	0.554													7	4	---	---	---	---	
ROD1	9991	broad.mit.edu	37	9	114994246	114994247	+	Intron	DEL	AG	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114994246_114994247delAG	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						agagaagagaagagagaagaga	0.045													5	3	---	---	---	---	
SPTAN1	6709	broad.mit.edu	37	9	131347294	131347295	+	Intron	INS	-	T	T	rs11382658		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131347294_131347295insT	uc004bvl.3	+						SPTAN1_uc011mbg.1_Intron|SPTAN1_uc011mbh.1_Intron|SPTAN1_uc004bvm.3_Intron|SPTAN1_uc004bvn.3_Intron	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1						actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						gcctgaatttcttttttttttt	0.045													4	2	---	---	---	---	
C9orf98	158067	broad.mit.edu	37	9	135695600	135695600	+	Intron	DEL	A	-	-	rs66490117		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135695600delA	uc004cbu.1	-						C9orf98_uc010mzx.1_Intron|C9orf98_uc004cbv.1_Intron	NM_152572	NP_689785	Q96MA6	KAD8_HUMAN	putative adenylate kinase-like protein C9orf98							cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)		TGCTCACtgtaaaaaaaaaaa	0.030													4	2	---	---	---	---	
ARHGAP12	94134	broad.mit.edu	37	10	32141656	32141657	+	Intron	DEL	TC	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32141656_32141657delTC	uc001ivz.1	-						ARHGAP12_uc001ivy.1_Intron|ARHGAP12_uc009xls.2_Intron|ARHGAP12_uc001iwb.1_Intron|ARHGAP12_uc001iwc.1_Intron|ARHGAP12_uc009xlq.1_Intron|ARHGAP12_uc001iwd.1_Intron|ARHGAP12_uc009xlr.1_Intron	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)				AACAAAAAAttctttttttttt	0.114													9	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42383711	42383712	+	IGR	INS	-	C	C			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42383711_42383712insC								None (None upstream) : LOC441666 (443603 downstream)																							tcaaatggaatcaaaataacca	0.000													3	3	---	---	---	---	
CCDC6	8030	broad.mit.edu	37	10	61572221	61572222	+	Intron	INS	-	A	A	rs35063910		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61572221_61572222insA	uc001jks.3	-							NM_005436	NP_005427	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6							cytoplasm|cytoskeleton	SH3 domain binding|structural constituent of cytoskeleton			ovary(3)|breast(1)	4				Kidney(211;0.0597)		CTATAACACTCAAAAAAAAAAA	0.272													5	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	121312536	121312536	+	IGR	DEL	A	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121312536delA								RGS10 (10314 upstream) : TIAL1 (20442 downstream)																							caagactctcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
OTUB1	55611	broad.mit.edu	37	11	63764701	63764701	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63764701delG	uc001nyf.1	+	6	1207	c.603delG	c.(601-603)AAGfs	p.K201fs	OTUB1_uc001nyg.1_Frame_Shift_Del_p.K244fs|OTUB1_uc010rmz.1_Frame_Shift_Del_p.K238fs|OTUB1_uc010rna.1_Frame_Shift_Del_p.K210fs|OTUB1_uc009ypa.2_Frame_Shift_Del_p.K100fs|OTUB1_uc009ypb.1_Frame_Shift_Del_p.K171fs	NM_017670	NP_060140	Q96FW1	OTUB1_HUMAN	otubain 1	201	OTU.				protein K48-linked deubiquitination	cytoplasm	NEDD8-specific protease activity|omega peptidase activity|ubiquitin binding|ubiquitin-specific protease activity			breast(1)	1						GGACTGTCAAGGAGTTCTGCC	0.667													109	57	---	---	---	---	
SAPS3	55291	broad.mit.edu	37	11	68305521	68305522	+	Intron	INS	-	T	T	rs147520180	by1000genomes	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68305521_68305522insT	uc001onw.2	+						SAPS3_uc010rqb.1_Intron|SAPS3_uc001onv.2_Intron|SAPS3_uc001ony.3_Intron|SAPS3_uc001onx.2_Intron|SAPS3_uc009ysh.2_Intron|SAPS3_uc001onu.2_Intron|SAPS3_uc010rqc.1_Intron	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6						regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			CATTCTAGCAGTAAGTCCAGGG	0.406													2	4	---	---	---	---	
UCP2	7351	broad.mit.edu	37	11	73686860	73686862	+	Intron	DEL	CTT	-	-	rs141148353		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73686860_73686862delCTT	uc001oup.1	-						UCP2_uc001ouq.1_Intron	NM_003355	NP_003346	P55851	UCP2_HUMAN	uncoupling protein 2						proton transport|respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	binding				0	Breast(11;0.000112)					taatccaggacttcttttggagg	0.118													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	77811794	77811795	+	IGR	INS	-	T	T	rs146323800	by1000genomes	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77811794_77811795insT								NDUFC2 (20529 upstream) : ALG8 (193 downstream)																							GGAAAGGTGAGTTTTTTTCAGA	0.450													0	7	---	---	---	---	
DDX11	1663	broad.mit.edu	37	12	31255056	31255056	+	Intron	DEL	C	-	-	rs145143657		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31255056delC	uc001rjt.1	+						DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron|DDX11_uc009zjn.1_Intron|DDX11_uc009zjo.1_5'Flank	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CAGAGGATTTCCCCCAAAGTC	0.607										Multiple Myeloma(12;0.14)			7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	33452396	33452397	+	IGR	INS	-	AAGG	AAGG	rs143444187	by1000genomes	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33452396_33452397insAAGG								PKP2 (402616 upstream) : SYT10 (75951 downstream)																							gaaagaaaggaaaggaaggaag	0.000													6	3	---	---	---	---	
SLC2A13	114134	broad.mit.edu	37	12	40247410	40247410	+	Intron	DEL	T	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40247410delT	uc010skm.1	-						C12orf40_uc009zjv.1_Intron|SLC2A13_uc001rme.1_Intron	NM_052885	NP_443117	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose							integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)				tctttctttcttttttttttt	0.174										HNSCC(50;0.14)			9	6	---	---	---	---	
KRT83	3889	broad.mit.edu	37	12	52710046	52710049	+	Intron	DEL	ACAC	-	-	rs140413807		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52710046_52710049delACAC	uc001saf.2	-							NM_002282	NP_002273	P78385	KRT83_HUMAN	keratin 83						epidermis development	keratin filament	structural molecule activity			skin(1)	1	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CACTTacactacacacacacacac	0.299													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	49785470	49785471	+	IGR	INS	-	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49785470_49785471insA								FNDC3A (1556 upstream) : MLNR (9003 downstream)																							aaaatgataataaaaaaaaaaa	0.213													5	3	---	---	---	---	
DHRS12	79758	broad.mit.edu	37	13	52343499	52343500	+	Intron	INS	-	A	A	rs11374211		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52343499_52343500insA	uc001vfq.2	-						DHRS12_uc001vfr.1_Intron			A0PJE2	DHR12_HUMAN	RecName: Full=Dehydrogenase/reductase SDR family member 12;          EC=1.1.-.-;								binding|oxidoreductase activity				0		Breast(56;0.00173)|Prostate(109;0.00899)|Lung NSC(96;0.0199)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.81e-08)		TCCCttaatttaaaaaaaaaaa	0.460													4	2	---	---	---	---	
JAG2	3714	broad.mit.edu	37	14	105617550	105617551	+	Intron	INS	-	GCAGCCCCA	GCAGCCCCA	rs3830678		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105617550_105617551insGCAGCCCCA	uc001yqg.2	-						JAG2_uc001yqf.2_Intron|JAG2_uc001yqh.2_Intron	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor						auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		cagcagcccccgcagccccagc	0.515													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22167613	22167616	+	IGR	DEL	TGTG	-	-	rs141898257	by1000genomes	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22167613_22167616delTGTG								CXADRP2 (150735 upstream) : LOC727924 (110416 downstream)																							TAACCTAAGCtgtgtgtgtgtgtg	0.284													2	4	---	---	---	---	
TMOD3	29766	broad.mit.edu	37	15	52218858	52218859	+	Intron	INS	-	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52218858_52218859insA	uc010bfc.1	+							NM_014547		Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)							cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(1)	1				all cancers(107;0.00194)		gagtctgtctcaaaaaaaaaaa	0.163													9	4	---	---	---	---	
TMC3	342125	broad.mit.edu	37	15	81664691	81664698	+	Intron	DEL	ACACACAC	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81664691_81664698delACACACAC	uc002bgo.1	-						TMC3_uc010blr.1_Intron|TMC3_uc002bgp.2_Intron	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3							integral to membrane				ovary(1)|liver(1)	2						TGTCTCTCTGacacacacacacacacac	0.327													4	4	---	---	---	---	
TTLL13	440307	broad.mit.edu	37	15	90794347	90794347	+	Intron	DEL	T	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90794347delT	uc002bpd.1	+						TTLL13_uc002bpe.1_Intron	NM_001029964	NP_001025135	A6NNM8	TTL13_HUMAN	tubulin tyrosine ligase-like family, member 13						protein modification process		ATP binding|tubulin-tyrosine ligase activity				0	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			CTGGTCTGTCttttttttttt	0.209													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	100328699	100328700	+	IGR	INS	-	CTCCCTTT	CTCCCTTT	rs146694833	by1000genomes	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100328699_100328700insCTCCCTTT								LYSMD4 (55073 upstream) : C15orf51 (1661 downstream)																							tccctccctccctttcttcctt	0.129													3	3	---	---	---	---	
C1QTNF8	390664	broad.mit.edu	37	16	1143444	1143445	+	Intron	DEL	AC	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1143444_1143445delAC	uc010uuw.1	-							NM_207419	NP_997302	P60827	C1QT8_HUMAN	C1q and tumor necrosis factor related protein 8							collagen				skin(1)	1		Hepatocellular(780;0.00369)				acacacacagacacacacacac	0.485													4	2	---	---	---	---	
TMC7	79905	broad.mit.edu	37	16	19041901	19041901	+	Intron	DEL	T	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19041901delT	uc002dfq.2	+						TMC7_uc010vao.1_Intron|TMC7_uc002dfp.2_Intron|TMC7_uc010vap.1_Intron	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a							integral to membrane				skin(2)|ovary(1)	3						GAGGttcttcttttttttttt	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	27088704	27088705	+	IGR	INS	-	CTTT	CTTT	rs143025532	by1000genomes	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27088704_27088705insCTTT								C16orf82 (8218 upstream) : JMJD5 (126102 downstream)																							ctccttccttccttccttcctt	0.000													4	3	---	---	---	---	
TEPP	374739	broad.mit.edu	37	16	58019066	58019066	+	Intron	DEL	G	-	-	rs35768173		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58019066delG	uc002emw.3	+						TEPP_uc002emv.3_Intron	NM_199456	NP_955535	Q6URK8	TEPP_HUMAN	testis/prostate/placenta-expressed protein							extracellular region				kidney(1)|central_nervous_system(1)|skin(1)	3						GGCTTGTCCTGGGGGGGGGCG	0.677													4	5	---	---	---	---	
FANCA	2175	broad.mit.edu	37	16	89874491	89874497	+	Intron	DEL	CAAAACC	-	-	rs67590431		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89874491_89874497delCAAAACC	uc002fou.1	-						FANCA_uc010vpn.1_Intron|FANCA_uc002fov.1_Intron|FANCA_uc002fow.1_Intron|FANCA_uc002fox.1_Intron|FANCA_uc010ciu.1_Intron|FANCA_uc002foy.2_Intron	NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform						DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		aaaaagcaaacaaaaCCAAAACACCAT	0.155			D|Mis|N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	3	---	---	---	---	
RICH2	9912	broad.mit.edu	37	17	12860184	12860185	+	Intron	DEL	AC	-	-	rs71369354		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12860184_12860185delAC	uc002gnr.3	+						RICH2_uc010vvk.1_Intron|RICH2_uc010vvl.1_Intron|RICH2_uc002gns.3_Intron|RICH2_uc010vvm.1_Intron|RICH2_uc010vvn.1_Intron|RICH2_uc002gnt.1_Intron	NM_014859	NP_055674	Q17R89	RHG44_HUMAN	Rho GTPase-activating protein RICH2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						TCCCCTATAAacacacacacac	0.351													4	2	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36361540	36361541	+	Intron	INS	-	A	A			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36361540_36361541insA	uc010wdn.1	-									Q8IZP1	TBC3A_HUMAN	Homo sapiens TBC1D3 mRNA for TBC1 domain family, member 3, complete cds.							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		aaaaAAGAAAGAAAAAGAGGCT	0.035													5	4	---	---	---	---	
TANC2	26115	broad.mit.edu	37	17	61315447	61315449	+	Intron	DEL	TTG	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61315447_61315449delTTG	uc002jal.3	+						TANC2_uc010wpe.1_Intron	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2						AGGTAAgtttttgttgttgttgt	0.276													4	2	---	---	---	---	
CCDC57	284001	broad.mit.edu	37	17	80141908	80141911	+	Intron	DEL	CACA	-	-	rs11650529	by1000genomes	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80141908_80141911delCACA	uc002kdz.1	-						CCDC57_uc002kdx.1_Intron|CCDC57_uc010dik.1_Intron	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			CGCGCGCGCGcacacacacacaca	0.382													8	5	---	---	---	---	
MUM1	84939	broad.mit.edu	37	19	1358189	1358189	+	Intron	DEL	A	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1358189delA	uc010xgm.1	+						MUM1_uc010dsi.2_Intron|MUM1_uc002lrz.2_Intron|MUM1_uc002lsb.2_Intron|MUM1_uc002lsc.1_5'UTR			Q2TAK8	MUM1_HUMAN	SubName: Full=MUM1 protein;						chromatin organization|DNA repair	nucleus	nucleosome binding|protein binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTTAAAAGGAAAAAAAAAAA	0.368													5	4	---	---	---	---	
HAPLN4	404037	broad.mit.edu	37	19	19379018	19379018	+	Intron	DEL	T	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19379018delT	uc002nmc.2	-						TM6SF2_uc002nmd.1_Intron	NM_023002	NP_075378	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4						cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			pancreas(1)	1			Epithelial(12;0.00575)			ttcttttttcttttttttttt	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	21823321	21823322	+	IGR	INS	-	T	T			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21823321_21823322insT								ZNF429 (84253 upstream) : ZNF100 (83522 downstream)																							ttgtttttttgttttttttttg	0.010													4	2	---	---	---	---	
ZNF578	147660	broad.mit.edu	37	19	53004973	53004974	+	Intron	INS	-	C	C	rs146856334	by1000genomes	TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53004973_53004974insC	uc002pzp.3	+							NM_001099694	NP_001093164	Q96N58	ZN578_HUMAN	zinc finger protein 578						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		GTGGGCAGTGGGGGGGGCTTCT	0.490													8	4	---	---	---	---	
LAMA5	3911	broad.mit.edu	37	20	60904422	60904426	+	Intron	DEL	CAGCC	-	-	rs3065756		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60904422_60904426delCAGCC	uc002ycq.2	-							NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor						angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTGGCAGCAGcagcccagcccagcc	0.600													9	4	---	---	---	---	
HUNK	30811	broad.mit.edu	37	21	33346635	33346635	+	Intron	DEL	A	-	-			TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33346635delA	uc002yph.2	+							NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase						multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						atacttcagcaaaaaaaaaat	0.000													4	2	---	---	---	---	
PAGE1	8712	broad.mit.edu	37	X	49458625	49458626	+	Intron	DEL	AC	-	-	rs72312865		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49458625_49458626delAC	uc004dom.2	-							NM_003785	NP_003776	O75459	GAGB1_HUMAN	P antigen family, member 1						cellular defense response					skin(1)	1	Ovarian(276;0.236)					AATGCATGAGacacacacacac	0.366													4	2	---	---	---	---	
FAAH2	158584	broad.mit.edu	37	X	57458220	57458220	+	Intron	DEL	G	-	-	rs6521622		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57458220delG	uc004dvc.2	+							NM_174912	NP_777572	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2							integral to membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|hydrolase activity			ovary(3)	3						ttgtttttttgttttttttgg	0.060										HNSCC(52;0.14)			3	3	---	---	---	---	
DOCK11	139818	broad.mit.edu	37	X	117676483	117676484	+	Intron	INS	-	TA	TA	rs149027952		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117676483_117676484insTA	uc004eqp.2	+							NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11						blood coagulation	cytosol	GTP binding			ovary(3)	3						gtgtgtgtgtttgtgtgtgtgt	0.124													6	3	---	---	---	---	
THOC2	57187	broad.mit.edu	37	X	122772579	122772580	+	Intron	DEL	AC	-	-	rs35181346		TCGA-66-2765-01	TCGA-66-2765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122772579_122772580delAC	uc004etu.2	-						THOC2_uc011muh.1_Intron	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						acacacacgtacacacacacac	0.139													4	2	---	---	---	---	
