Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIAA1751	85452	broad.mit.edu	37	1	1888127	1888127	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1888127T>A	uc001aim.1	-	17	2104	c.1948A>T	c.(1948-1950)ACG>TCG	p.T650S	KIAA1751_uc009vkz.1_Missense_Mutation_p.T650S	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452	650										pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		TTGAAAGTCGTGCCCAAGCCC	0.582													18	24	---	---	---	---	PASS
KAZ	23254	broad.mit.edu	37	1	14925564	14925564	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14925564C>T	uc001avm.3	+	1	352	c.71C>T	c.(70-72)ACC>ATC	p.T24I	KAZ_uc009vog.1_Missense_Mutation_p.T24I|KAZ_uc010obj.1_Missense_Mutation_p.T24I	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E	24					keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						CAGGAGGTGACCAACCTGCGA	0.473													7	12	---	---	---	---	PASS
NR0B2	8431	broad.mit.edu	37	1	27240233	27240233	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27240233C>T	uc001bnf.2	-	1	335	c.199G>A	c.(199-201)GTG>ATG	p.V67M		NM_021969	NP_068804	Q15466	NR0B2_HUMAN	short heterodimer partner	67	Ligand-binding (By similarity).				cholesterol metabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	DNA binding|protein domain specific binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity				0		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.01e-51)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		AGGAAGGCCACTGTCTTGGCC	0.662													15	8	---	---	---	---	PASS
SGIP1	84251	broad.mit.edu	37	1	67185073	67185073	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67185073G>A	uc001dcr.2	+	19	1944	c.1727G>A	c.(1726-1728)GGA>GAA	p.G576E	SGIP1_uc010opd.1_Missense_Mutation_p.G176E|SGIP1_uc001dcs.2_Missense_Mutation_p.G176E|SGIP1_uc001dct.2_Missense_Mutation_p.G178E|SGIP1_uc009wat.2_Missense_Mutation_p.G370E|SGIP1_uc001dcu.2_Missense_Mutation_p.G81E	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	576					positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						TATTTCAAAGGAGCAGACCCA	0.468													21	38	---	---	---	---	PASS
CLCA1	1179	broad.mit.edu	37	1	86959914	86959914	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86959914G>T	uc001dlt.2	+	11	1854	c.1725G>T	c.(1723-1725)TTG>TTT	p.L575F	CLCA1_uc001dls.1_Missense_Mutation_p.L514F	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor	575					calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		CACAAACCTTGACCCTGACTG	0.488													25	32	---	---	---	---	PASS
BRDT	676	broad.mit.edu	37	1	92441932	92441932	+	Silent	SNP	T	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92441932T>C	uc001dok.3	+	5	904	c.555T>C	c.(553-555)TCT>TCC	p.S185S	BRDT_uc001dol.3_Silent_p.S185S|BRDT_uc010osz.1_Silent_p.S189S|BRDT_uc009wdf.2_Silent_p.S112S|BRDT_uc010ota.1_Silent_p.S139S|BRDT_uc010otb.1_Silent_p.S139S|BRDT_uc001dom.3_Silent_p.S185S	NM_207189	NP_997072	Q58F21	BRDT_HUMAN	testis-specific bromodomain protein	185					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		CTAAGACATCTATTTCTCCCT	0.373													60	72	---	---	---	---	PASS
BTBD8	284697	broad.mit.edu	37	1	92546279	92546279	+	Splice_Site	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92546279T>A	uc001doo.2	+	1	416	c.149_splice	c.e1+2	p.R50_splice	BTBD8_uc010otc.1_Splice_Site	NM_183242	NP_899065	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8							nucleus				ovary(1)	1		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		TTTGCTCAGGTAGGAGGAGGC	0.632													6	4	---	---	---	---	PASS
RWDD3	25950	broad.mit.edu	37	1	95709967	95709967	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95709967T>C	uc009wdu.2	+	2	362	c.286T>C	c.(286-288)TCG>CCG	p.S96P	RWDD3_uc001drd.3_3'UTR|RWDD3_uc010oty.1_Missense_Mutation_p.S81P|RWDD3_uc009wdt.2_Missense_Mutation_p.S96P|RWDD3_uc001drf.3_Missense_Mutation_p.S96P|RWDD3_uc001drh.3_Missense_Mutation_p.S81P|RWDD3_uc009wdv.2_Intron|RWDD3_uc001drg.3_RNA|RWDD3_uc001dri.3_Missense_Mutation_p.S96P	NM_015485	NP_056300	Q9Y3V2	RWDD3_HUMAN	RWD domain containing 3 isoform a	96	RWD.					cytoplasm|nucleus	protein binding			ovary(1)	1		all_epithelial(167;5.99e-05)|all_lung(203;0.00168)|Lung NSC(277;0.00769)		all cancers(265;0.112)|Epithelial(280;0.229)		GAGCCTTTTGTCGGAGCCTAT	0.468													73	81	---	---	---	---	PASS
PTBP2	58155	broad.mit.edu	37	1	97250688	97250688	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97250688A>G	uc001drq.2	+	8	1028	c.782A>G	c.(781-783)AAT>AGT	p.N261S	PTBP2_uc001drn.2_Missense_Mutation_p.N261S|PTBP2_uc001dro.2_Missense_Mutation_p.N261S|PTBP2_uc010otz.1_Missense_Mutation_p.N272S|PTBP2_uc001drp.2_RNA|PTBP2_uc009wdw.2_Missense_Mutation_p.N209S|PTBP2_uc001drr.2_Missense_Mutation_p.N261S|PTBP2_uc010oua.1_Missense_Mutation_p.N269S|PTBP2_uc001dru.2_RNA|PTBP2_uc001drs.1_5'UTR|PTBP2_uc001drt.2_5'UTR	NM_021190	NP_067013	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	261							nucleotide binding				0		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		GTGAATTTGAATGTAAAATAC	0.388													93	132	---	---	---	---	PASS
OLFM3	118427	broad.mit.edu	37	1	102302451	102302451	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102302451C>A	uc001duf.2	-	2	331	c.260G>T	c.(259-261)CGC>CTC	p.R87L	OLFM3_uc001dug.2_Missense_Mutation_p.R67L|OLFM3_uc001duh.2_RNA|OLFM3_uc001dui.2_RNA|OLFM3_uc001duj.2_5'UTR|OLFM3_uc001due.2_RNA	NM_058170	NP_477518	Q96PB7	NOE3_HUMAN	olfactomedin 3	87	Potential.					extracellular region				ovary(2)|skin(1)	3		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		CAGTAGTTGGCGAAGTTGCCT	0.458													51	58	---	---	---	---	PASS
SORT1	6272	broad.mit.edu	37	1	109884723	109884723	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109884723G>A	uc001dxm.1	-	9	1070	c.1021C>T	c.(1021-1023)CAG>TAG	p.Q341*	SORT1_uc010ovi.1_Nonsense_Mutation_p.Q204*	NM_002959	NP_002950	Q99523	SORT_HUMAN	sortilin 1 preproprotein	341	Extracellular (Potential).				endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		GAGGGGAGCTGGGCCATGCTC	0.433													62	62	---	---	---	---	PASS
NOTCH2NL	388677	broad.mit.edu	37	1	145290427	145290427	+	Splice_Site	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145290427A>T	uc001emo.2	+	5	1005	c.635_splice	c.e5-2	p.A212_splice	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NOTCH2NL_uc010oyh.1_Splice_Site|NBPF10_uc001end.3_5'Flank|NBPF10_uc001emq.1_5'Flank	NM_203458	NP_982283	Q7Z3S9	NT2NL_HUMAN	Notch homolog 2 N-terminal like protein						cell differentiation|multicellular organismal development|Notch signaling pathway	cytoplasm|extracellular region	calcium ion binding			ovary(1)	1						CTTTTTGCACAGCAACATGGC	0.393													28	449	---	---	---	---	PASS
SMG5	23381	broad.mit.edu	37	1	156244452	156244452	+	Silent	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156244452T>A	uc001foc.3	-	5	629	c.480A>T	c.(478-480)TCA>TCT	p.S160S		NM_015327	NP_056142	Q9UPR3	SMG5_HUMAN	SMG5 homolog nonsense mediated mRNA decay	160					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding			ovary(2)|skin(2)|pancreas(1)	5	Hepatocellular(266;0.158)					TCTCCTTCCCTGAGGCAGACA	0.478													145	61	---	---	---	---	PASS
OR10J5	127385	broad.mit.edu	37	1	159504938	159504938	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159504938A>G	uc010piw.1	-	1	860	c.860T>C	c.(859-861)GTT>GCT	p.V287A		NM_001004469	NP_001004469	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J,	287	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_hematologic(112;0.0429)					ACTGTAAACAACAGGGTTCAG	0.423													38	150	---	---	---	---	PASS
OR10J5	127385	broad.mit.edu	37	1	159505093	159505093	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159505093C>T	uc010piw.1	-	1	705	c.705G>A	c.(703-705)AAG>AAA	p.K235K		NM_001004469	NP_001004469	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J,	235	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_hematologic(112;0.0429)					TGGCAAAGGTCTTCTTCCGGC	0.473													19	100	---	---	---	---	PASS
ATP1A2	477	broad.mit.edu	37	1	160098476	160098476	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160098476G>A	uc001fvc.2	+	9	1184	c.1052G>A	c.(1051-1053)CGG>CAG	p.R351Q	ATP1A2_uc001fvb.2_Missense_Mutation_p.R351Q|ATP1A2_uc010piz.1_Missense_Mutation_p.R196Q|ATP1A2_uc001fvd.2_Missense_Mutation_p.R87Q|ATP1A2_uc009wtg.1_Missense_Mutation_p.R39Q	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein	351	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CGCATGGCACGGAAGAACTGC	0.577													15	193	---	---	---	---	PASS
LRRC52	440699	broad.mit.edu	37	1	165532887	165532887	+	Silent	SNP	C	T	T	rs140303863		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165532887C>T	uc001gde.2	+	2	824	c.768C>T	c.(766-768)TTC>TTT	p.F256F	LOC400794_uc001gdc.2_Intron|LOC400794_uc001gdd.2_Intron|LOC400794_uc009wvd.2_Intron	NM_001005214	NP_001005214	Q8N7C0	LRC52_HUMAN	leucine rich repeat containing 52 precursor	256	Helical; (Potential).					integral to membrane				ovary(1)	1	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					TCTGCATCTTCGCCGCGGGAA	0.597													42	13	---	---	---	---	PASS
METTL13	51603	broad.mit.edu	37	1	171765716	171765716	+	Silent	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171765716G>T	uc001ghz.2	+	8	2267	c.1920G>T	c.(1918-1920)CGG>CGT	p.R640R	METTL13_uc001gia.2_Silent_p.R554R|METTL13_uc001gib.2_Silent_p.R484R|METTL13_uc010pml.1_Silent_p.R639R|METTL13_uc001gic.1_RNA	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN	CGI-01 protein isoform 1	640							methyltransferase activity|protein binding			kidney(1)	1						TATATGTCCGGCGAATTGAGG	0.517													86	269	---	---	---	---	PASS
KLHL20	27252	broad.mit.edu	37	1	173721005	173721005	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173721005G>T	uc001gjc.2	+	4	879	c.700G>T	c.(700-702)GCA>TCA	p.A234S	KLHL20_uc010pmr.1_Missense_Mutation_p.A45S|KLHL20_uc009wwf.2_Missense_Mutation_p.A216S	NM_014458	NP_055273	Q9Y2M5	KLH20_HUMAN	kelch-like 20	234	BACK.				cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity			ovary(1)	1						AGTGTTCAATGCAGTGATGGC	0.383													27	99	---	---	---	---	PASS
C1orf125	126859	broad.mit.edu	37	1	179478447	179478447	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179478447G>A	uc001gmo.2	+	21	2532	c.2405G>A	c.(2404-2406)TGG>TAG	p.W802*	C1orf125_uc009wxg.2_RNA|C1orf125_uc001gmp.2_Intron|C1orf125_uc009wxh.2_RNA	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	802											0						TGTTATGAATGGATCAACACA	0.353													22	132	---	---	---	---	PASS
CFHR1	3078	broad.mit.edu	37	1	196795988	196795988	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196795988G>T	uc001gtn.2	+	3	397	c.283G>T	c.(283-285)GGT>TGT	p.G95C	CFHR1_uc001gtm.2_Intron	NM_002113	NP_002104	Q03591	FHR1_HUMAN	complement factor H-related 1 precursor	95	Sushi 2.				complement activation	extracellular space					0						TGTGGAAAATGGTCATTCTGA	0.348													61	501	---	---	---	---	PASS
LHX9	56956	broad.mit.edu	37	1	197896750	197896750	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197896750G>A	uc001guk.1	+	4	1200	c.763G>A	c.(763-765)GAC>AAC	p.D255N	LHX9_uc001gui.1_Missense_Mutation_p.D246N|LHX9_uc001guj.1_Missense_Mutation_p.D261N	NM_020204	NP_064589	Q9NQ69	LHX9_HUMAN	LIM homeobox 9 isoform 1	255					motor axon guidance|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						AGACCACTTGGACCGGGACCA	0.502													125	463	---	---	---	---	PASS
PROX1	5629	broad.mit.edu	37	1	214171167	214171167	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214171167C>T	uc001hkh.2	+	2	1561	c.1289C>T	c.(1288-1290)GCC>GTC	p.A430V	PROX1_uc001hkg.1_Missense_Mutation_p.A430V	NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	430					aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		GTGCAGATGGCCAGTTCCACT	0.612													70	196	---	---	---	---	PASS
HLX	3142	broad.mit.edu	37	1	221055663	221055663	+	Silent	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221055663G>A	uc001hmv.3	+	3	1387	c.930G>A	c.(928-930)GCG>GCA	p.A310A		NM_021958	NP_068777	Q14774	HLX_HUMAN	H2.0-like homeobox	310	Homeobox.				cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2				GBM - Glioblastoma multiforme(131;0.00914)		AGCAGCTGGCGGCGATGCTGG	0.632													9	43	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237886496	237886496	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237886496C>T	uc001hyl.1	+	74	10743	c.10623C>T	c.(10621-10623)ACC>ACT	p.T3541T	RYR2_uc010pxz.1_Silent_p.T496T	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3541					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTGATGATACCTCAGATCCAG	0.393													214	112	---	---	---	---	PASS
GREM2	64388	broad.mit.edu	37	1	240656438	240656438	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240656438T>A	uc001hys.2	-	2	618	c.338A>T	c.(337-339)GAG>GTG	p.E113V		NM_022469	NP_071914	Q9H772	GREM2_HUMAN	gremlin 2 precursor	113	CTCK.				BMP signaling pathway	extracellular space	cytokine activity				0		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)			GGACTCCTCCTCCTTCTTCAC	0.662													24	102	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	241032071	241032071	+	Intron	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241032071C>A	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron|RGS7_uc001hyt.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			CTCACAAGGACTCACTTTGCT	0.448													74	343	---	---	---	---	PASS
ZNF238	10472	broad.mit.edu	37	1	244218431	244218431	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244218431G>A	uc001iae.2	+	1	1850	c.1328G>A	c.(1327-1329)TGC>TAC	p.C443Y	ZNF238_uc001iad.3_Missense_Mutation_p.C452Y|ZNF238_uc001iaf.1_3'UTR	NM_006352	NP_006343	Q99592	ZN238_HUMAN	zinc finger protein 238 isoform 2	443	C2H2-type 3.				negative regulation of transcription from RNA polymerase II promoter|skeletal muscle tissue development	nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|pancreas(2)	5	all_cancers(71;6.42e-05)|all_epithelial(71;7e-05)|Breast(184;0.0333)|Ovarian(71;0.0619)|all_lung(81;0.089)|all_neural(11;0.101)|Lung NSC(105;0.123)		all cancers(7;1.35e-08)|GBM - Glioblastoma multiforme(7;1e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00223)			TGCACCCAGTGCGGCAAGAGC	0.627													33	90	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004824	248004824	+	Silent	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004824G>T	uc001idn.1	-	1	375	c.375C>A	c.(373-375)GCC>GCA	p.A125A		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	125	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGCTGCAGATGGCCAGGTAAC	0.597													34	16	---	---	---	---	PASS
OR2T2	401992	broad.mit.edu	37	1	248616129	248616129	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248616129A>G	uc001iek.1	+	1	31	c.31A>G	c.(31-33)ACT>GCT	p.T11A		NM_001004136	NP_001004136	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T,	11	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCAGAACTCCACTAACTTCGT	0.502													20	173	---	---	---	---	PASS
COLEC11	78989	broad.mit.edu	37	2	3691564	3691564	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3691564C>T	uc002qya.2	+	7	820	c.672C>T	c.(670-672)ACC>ACT	p.T224T	COLEC11_uc002qxz.2_Silent_p.T221T|COLEC11_uc002qyb.2_Silent_p.T200T|COLEC11_uc002qyc.2_Silent_p.T200T|COLEC11_uc010ewo.2_Silent_p.T176T|COLEC11_uc010ewp.2_Silent_p.T198T|COLEC11_uc010ewq.2_Silent_p.T174T|COLEC11_uc010ewr.2_Silent_p.T174T|COLEC11_uc010ews.2_Silent_p.T150T	NM_024027	NP_076932	Q9BWP8	COL11_HUMAN	collectin sub-family member 11 isoform a	224	C-type lectin.					collagen	mannose binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		CCATGCGGACCTTCAACAAGT	0.642													37	87	---	---	---	---	PASS
RSAD2	91543	broad.mit.edu	37	2	7027272	7027272	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7027272G>T	uc002qyp.1	+	3	851	c.715G>T	c.(715-717)GCA>TCA	p.A239S		NM_080657	NP_542388	Q8WXG1	RSAD2_HUMAN	radical S-adenosyl methionine domain containing	239					defense response to virus	endoplasmic reticulum membrane|Golgi apparatus	catalytic activity|iron-sulfur cluster binding|metal ion binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			OV - Ovarian serous cystadenocarcinoma(76;0.191)		ACAGATCAAAGCACTAAACCC	0.398													14	59	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32754743	32754743	+	Silent	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32754743A>G	uc010ezu.2	+	60	12080	c.11946A>G	c.(11944-11946)ACA>ACG	p.T3982T	MIR558_hsa-mir-558|MI0003564_5'Flank	NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	3982					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					CTGAAATGACACTTGCCCAGC	0.373													46	146	---	---	---	---	PASS
C2orf56	55471	broad.mit.edu	37	2	37459294	37459294	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37459294A>T	uc002rqa.3	+	2	176	c.101A>T	c.(100-102)GAG>GTG	p.E34V	CEBPZ_uc002rpz.2_5'Flank|C2orf56_uc010ynj.1_RNA|C2orf56_uc002rqc.3_Missense_Mutation_p.E34V|C2orf56_uc010ynk.1_Missense_Mutation_p.E34V|C2orf56_uc010ynl.1_Missense_Mutation_p.E34V	NM_144736	NP_653337	Q7L592	MIDA_HUMAN	hypothetical protein LOC55471 isoform 1	34					mitochondrial respiratory chain complex I assembly	mitochondrion	enzyme binding|methyltransferase activity			central_nervous_system(1)	1		all_hematologic(82;0.21)				TCCGGGAATGAGCCTGCAGAA	0.473													84	186	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80620414	80620414	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80620414C>A	uc010ysh.1	+	7	1140	c.1135C>A	c.(1135-1137)CAG>AAG	p.Q379K	CTNNA2_uc010yse.1_Missense_Mutation_p.Q379K|CTNNA2_uc010ysf.1_Missense_Mutation_p.Q379K|CTNNA2_uc010ysg.1_Missense_Mutation_p.Q379K|CTNNA2_uc010ysi.1_Missense_Mutation_p.Q11K	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	379					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						TCTAAGGAGACAGGTACTATT	0.338													50	170	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90044199	90044199	+	Intron	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90044199C>T	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		AGCCGGCCTCCATCTCCTTCA	0.517													55	178	---	---	---	---	PASS
SLC9A2	6549	broad.mit.edu	37	2	103324608	103324608	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103324608C>A	uc002tca.2	+	12	2241	c.2099C>A	c.(2098-2100)GCC>GAC	p.A700D		NM_003048	NP_003039	Q9UBY0	SL9A2_HUMAN	solute carrier family 9 (sodium/hydrogen	700	Cytoplasmic (Potential).					integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			central_nervous_system(3)|skin(3)|breast(2)	8						GACGCAGATGCCGGGACCACC	0.498													59	145	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125262050	125262050	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125262050G>T	uc002tno.2	+	8	1605	c.1241G>T	c.(1240-1242)GGA>GTA	p.G414V	CNTNAP5_uc010flu.2_Missense_Mutation_p.G415V	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	414	Laminin G-like 2.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GAGGGCTCGGGAACCCTGCTG	0.542													25	89	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130832650	130832650	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130832650C>T	uc010fmh.2	-	17	2795	c.2395G>A	c.(2395-2397)GAG>AAG	p.E799K		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	799	Actin-like.					cell cortex	ATP binding			skin(3)|ovary(2)	5						GGGTGCTCCTCGGGAGCCACA	0.577													59	174	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	137814051	137814051	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137814051G>T	uc002tva.1	+	2	108	c.108G>T	c.(106-108)TGG>TGT	p.W36C	THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_5'UTR	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		GGGCAGTGTGGTGTTTTCATG	0.507													32	85	---	---	---	---	PASS
KCNJ3	3760	broad.mit.edu	37	2	155555400	155555400	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155555400T>C	uc002tyv.1	+	1	308	c.113T>C	c.(112-114)GTG>GCG	p.V38A	KCNJ3_uc010zce.1_Missense_Mutation_p.V38A	NM_002239	NP_002230	P48549	IRK3_HUMAN	potassium inwardly-rectifying channel J3	38	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)	CAGCAGCTTGTGCCCAAGAAG	0.622													18	50	---	---	---	---	PASS
TANC1	85461	broad.mit.edu	37	2	160035208	160035208	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160035208G>A	uc002uag.2	+	14	2318	c.2044G>A	c.(2044-2046)GGC>AGC	p.G682S	TANC1_uc010fol.1_Missense_Mutation_p.G576S|TANC1_uc010zcm.1_Missense_Mutation_p.G674S|TANC1_uc010fom.1_Missense_Mutation_p.G488S|TANC1_uc002uai.1_RNA	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and	682						cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						CTCCCTGAATGGCAAGGCCGA	0.572													36	84	---	---	---	---	PASS
TANK	10010	broad.mit.edu	37	2	162087631	162087631	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162087631A>T	uc002ubr.1	+	7	828	c.670A>T	c.(670-672)ACC>TCC	p.T224S	TANK_uc002ubs.2_Missense_Mutation_p.T224S	NM_004180	NP_004171	Q92844	TANK_HUMAN	TRAF interacting protein TANK isoform a	224						cytosol	metal ion binding|protein binding			ovary(1)	1						TGAGGAAGACACCTCTTTTGA	0.433													64	182	---	---	---	---	PASS
FAP	2191	broad.mit.edu	37	2	163059575	163059575	+	Silent	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163059575A>G	uc002ucd.2	-	13	1336	c.1128T>C	c.(1126-1128)CAT>CAC	p.H376H	FAP_uc010zct.1_Silent_p.H351H|FAP_uc010fpd.2_Intron	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit	376	Extracellular (Potential).				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						TATAGTGAATATGTTTGTAGC	0.363													29	84	---	---	---	---	PASS
IFIH1	64135	broad.mit.edu	37	2	163174519	163174519	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163174519G>A	uc002uce.2	-	1	521	c.299C>T	c.(298-300)ACG>ATG	p.T100M	IFIH1_uc002ucf.2_Missense_Mutation_p.T100M	NM_022168	NP_071451	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	100					detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding			ovary(1)	1						GGGCAAGTCCGTGAGCTCAGG	0.572													94	204	---	---	---	---	PASS
TLK1	9874	broad.mit.edu	37	2	171853274	171853274	+	Intron	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171853274A>T	uc002ugn.2	-						TLK1_uc002ugo.2_Intron|TLK1_uc002ugp.2_Intron|TLK1_uc002ugq.2_Intron|TLK1_uc010zdn.1_Intron	NM_012290	NP_036422	Q9UKI8	TLK1_HUMAN	tousled-like kinase 1 isoform 1						cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1						CAAATGGCTTAAAAAAAAAAT	0.299													16	85	---	---	---	---	PASS
WIPF1	7456	broad.mit.edu	37	2	175436394	175436394	+	Intron	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175436394C>T	uc002uiy.2	-						uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Intron|WIPF1_uc010fqt.1_Intron|WIPF1_uc002ujc.1_Missense_Mutation_p.R380K|WIPF1_uc002uiz.2_Intron|WIPF1_uc002ujb.1_Intron|WIPF1_uc010zep.1_Missense_Mutation_p.R380K	NM_003387	NP_003378	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1						actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding			ovary(1)|skin(1)	2						CACTCCACGTCTTGTCATACC	0.542													56	124	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098810	178098810	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098810C>G	uc002ulh.3	-	2	790	c.235G>C	c.(235-237)GAG>CAG	p.E79Q	NFE2L2_uc002ulg.3_Missense_Mutation_p.E63Q|NFE2L2_uc010zfa.1_Missense_Mutation_p.E63Q|NFE2L2_uc002uli.3_Missense_Mutation_p.E63Q|NFE2L2_uc010fra.2_Missense_Mutation_p.E63Q|NFE2L2_uc010frb.2_Missense_Mutation_p.E63Q	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	79					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TCACCTGTCTCTTCATCTAGT	0.443			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			49	113	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179441405	179441405	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179441405G>A	uc010zfg.1	-	274	62086	c.61862C>T	c.(61861-61863)GCA>GTA	p.A20621V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.A14316V|TTN_uc010zfi.1_Missense_Mutation_p.A14249V|TTN_uc010zfj.1_Missense_Mutation_p.A14124V|uc002umv.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	21548							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTTTTTATTGCTCTCACCCA	0.468													145	339	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179633506	179633506	+	Silent	SNP	T	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179633506T>C	uc010zfg.1	-	38	9281	c.9057A>G	c.(9055-9057)AAA>AAG	p.K3019K	TTN_uc010zfh.1_Silent_p.K2973K|TTN_uc010zfi.1_Silent_p.K2973K|TTN_uc010zfj.1_Silent_p.K2973K|TTN_uc002unb.2_Silent_p.K3019K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	3019							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGTGAGCTTTTTGGTTCTCA	0.418													49	140	---	---	---	---	PASS
ITGA4	3676	broad.mit.edu	37	2	182360566	182360566	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182360566G>A	uc002unu.2	+	14	2205	c.1442G>A	c.(1441-1443)AGA>AAA	p.R481K	ITGA4_uc010frj.1_5'Flank	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	481	Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	TCAGTAAATAGAACGAAATTT	0.373													62	171	---	---	---	---	PASS
CALCRL	10203	broad.mit.edu	37	2	188247906	188247906	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188247906C>G	uc002upv.3	-	5	726	c.178G>C	c.(178-180)GCA>CCA	p.A60P	CALCRL_uc010frt.2_Missense_Mutation_p.A60P	NM_005795	NP_005786	Q16602	CALRL_HUMAN	calcitonin receptor-like precursor	60	Extracellular (Potential).					integral to plasma membrane				lung(3)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			TTACCTTCTGCTTGTTGAATG	0.338													74	195	---	---	---	---	PASS
ANKRD44	91526	broad.mit.edu	37	2	197878392	197878392	+	Silent	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197878392C>G	uc002uua.1	-	18	1769	c.1692G>C	c.(1690-1692)TCG>TCC	p.S564S	ANKRD44_uc002utz.3_Silent_p.S296S	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	589	ANK 17.						protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GGTCCACCAACGACTGCAGAA	0.532													112	266	---	---	---	---	PASS
SMARCAL1	50485	broad.mit.edu	37	2	217279494	217279494	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217279494C>G	uc002vgc.3	+	3	397	c.67C>G	c.(67-69)CGC>GGC	p.R23G	SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.R23G|SMARCAL1_uc010fvg.2_Missense_Mutation_p.R23G	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN	SWI/SNF-related matrix-associated	23	Potential.				chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		GGCTCTGGCCCGCAGAGCTGA	0.498									Schimke_Immuno-Osseous_Dysplasia				77	169	---	---	---	---	PASS
CRYBA2	1412	broad.mit.edu	37	2	219857818	219857818	+	Silent	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219857818A>G	uc002vjj.1	-	2	116	c.81T>C	c.(79-81)TGT>TGC	p.C27C	CRYBA2_uc002vjk.1_Silent_p.C27C	NM_057094	NP_476435	P53672	CRBA2_HUMAN	crystallin, beta A2	27	Beta/gamma crystallin 'Greek key' 1.						structural constituent of eye lens				0		Renal(207;0.0474)		Epithelial(149;9.77e-07)|all cancers(144;0.000167)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTAGCAGCCGACAGCGACGGC	0.572													11	22	---	---	---	---	PASS
FAM124B	79843	broad.mit.edu	37	2	225266335	225266335	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225266335C>A	uc002vnx.2	-	1	377	c.151G>T	c.(151-153)GTG>TTG	p.V51L	FAM124B_uc002vnw.2_Missense_Mutation_p.V51L	NM_001122779	NP_001116251	Q9H5Z6	F124B_HUMAN	hypothetical protein LOC79843 isoform a	51							protein binding			ovary(2)	2		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		CAGTATTTCACAGGACTGGCC	0.572													24	55	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228882360	228882360	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228882360C>T	uc002vpq.2	-	7	3257	c.3210G>A	c.(3208-3210)CTG>CTA	p.L1070L	SPHKAP_uc002vpp.2_Silent_p.L1070L|SPHKAP_uc010zlx.1_Silent_p.L1070L	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1070						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TGTCGCCACTCAGTAACCGAT	0.567													18	96	---	---	---	---	PASS
SGOL1	151648	broad.mit.edu	37	3	20212600	20212600	+	Silent	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20212600T>A	uc003cbs.2	-	7	1594	c.1407A>T	c.(1405-1407)CCA>CCT	p.P469P	SGOL1_uc003cbr.2_Silent_p.P200P|SGOL1_uc010hfa.2_Intron|SGOL1_uc003cbt.2_Silent_p.P217P|SGOL1_uc003cbu.2_Silent_p.P469P|SGOL1_uc003cbv.2_Silent_p.P217P|SGOL1_uc003cbw.2_Silent_p.P200P|SGOL1_uc003cbx.2_Silent_p.P217P|SGOL1_uc003cby.2_Silent_p.P200P|SGOL1_uc003cbz.2_Silent_p.P469P|SGOL1_uc003cca.2_Silent_p.P469P|SGOL1_uc003ccb.2_Silent_p.P217P|SGOL1_uc003ccc.2_Silent_p.P200P	NM_001012410	NP_001012410	Q5FBB7	SGOL1_HUMAN	shugoshin-like 1 isoform A2	469					attachment of spindle microtubules to kinetochore|cell division|centriole-centriole cohesion|meiotic chromosome segregation|mitotic prometaphase	centrosome|condensed chromosome kinetochore|cytosol|mitotic cohesin complex|spindle pole	protein binding				0						GAGCCACTGCTGGGCTTGCTT	0.438													16	28	---	---	---	---	PASS
GADL1	339896	broad.mit.edu	37	3	30885900	30885900	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30885900C>A	uc003cep.2	-	7	757	c.710G>T	c.(709-711)TGC>TTC	p.C237F	GADL1_uc003ceq.1_Missense_Mutation_p.C237F	NM_207359	NP_997242	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	237					carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)	TTCCACAAAGCAAACATTCTC	0.433													108	156	---	---	---	---	PASS
MAPKAPK3	7867	broad.mit.edu	37	3	50684637	50684637	+	Intron	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50684637G>A	uc003day.1	+						MAPKAPK3_uc003daz.1_Intron|MAPKAPK3_uc003dba.1_Intron|MAPKAPK3_uc010hlr.1_Intron	NM_004635	NP_004626	Q16644	MAPK3_HUMAN	mitogen-activated protein kinase-activated						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.0188)|Kidney(197;0.0223)		AAGTCAAGGTGGGTGGGCTCT	0.602													9	4	---	---	---	---	PASS
RRP9	9136	broad.mit.edu	37	3	51967584	51967584	+	Silent	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51967584G>T	uc003dbw.1	-	15	1405	c.1366C>A	c.(1366-1368)CGG>AGG	p.R456R		NM_004704	NP_004695	O43818	U3IP2_HUMAN	RNA, U3 small nucleolar interacting protein 2	456	WD 7.				rRNA processing	nucleolus|small nuclear ribonucleoprotein complex|small nucleolar ribonucleoprotein complex	RNA binding			breast(2)|ovary(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		ACAGAATTCCGAGCCTCTTTG	0.572													31	33	---	---	---	---	PASS
ACY1	95	broad.mit.edu	37	3	52022593	52022593	+	Silent	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52022593A>T	uc003dcp.2	+	13	1036	c.975A>T	c.(973-975)GCA>GCT	p.A325A	ACY1_uc011bea.1_Silent_p.A415A|ACY1_uc003dcq.2_Silent_p.A325A	NM_000666	NP_000657	Q03154	ACY1_HUMAN	aminoacylase 1	325					cellular amino acid metabolic process|proteolysis	cytosol	aminoacylase activity|metal ion binding|metallopeptidase activity			breast(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	L-Aspartic Acid(DB00128)	CTTGGTGGGCAGCTTTTAGCC	0.463													24	44	---	---	---	---	PASS
WDR82	80335	broad.mit.edu	37	3	52312361	52312361	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52312361C>G	uc003ddl.2	-	1	299	c.17G>C	c.(16-18)AGC>ACC	p.S6T		NM_025222	NP_079498	Q6UXN9	WDR82_HUMAN	WD repeat domain 82	6					histone H3-K4 methylation	chromatin|PTW/PP1 phosphatase complex|Set1C/COMPASS complex	protein binding				0				BRCA - Breast invasive adenocarcinoma(193;2.67e-05)|Kidney(197;0.00198)|KIRC - Kidney renal clear cell carcinoma(197;0.00223)|OV - Ovarian serous cystadenocarcinoma(275;0.246)		CCGCAACACGCTGTCGGTCAG	0.323													14	10	---	---	---	---	PASS
MIR567	693152	broad.mit.edu	37	3	111831729	111831729	+	RNA	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111831729A>G	hsa-mir-567|MI0003573	+			c.82A>G			C3orf52_uc003dyq.3_Intron|C3orf52_uc011bhs.1_Intron|C3orf52_uc011bht.1_Intron|C3orf52_uc003dyr.1_Intron																	0						AAACTAAAAAAAAAAAAAGTT	0.333													10	27	---	---	---	---	PASS
CCDC80	151887	broad.mit.edu	37	3	112358447	112358447	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112358447C>T	uc003dzf.2	-	2	524	c.306G>A	c.(304-306)GTG>GTA	p.V102V	CCDC80_uc011bhv.1_Silent_p.V102V|CCDC80_uc003dzg.2_Silent_p.V102V|CCDC80_uc003dzh.1_Silent_p.V102V	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	102										ovary(2)	2						GCTCAGGTCTCACGGCGGCCC	0.607													32	140	---	---	---	---	PASS
DRD3	1814	broad.mit.edu	37	3	113849981	113849981	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113849981C>T	uc003ebd.2	-	7	1413	c.990G>A	c.(988-990)ATG>ATA	p.M330I	DRD3_uc010hqn.1_Missense_Mutation_p.M330I|DRD3_uc003ebb.1_Missense_Mutation_p.M297I|DRD3_uc003ebc.1_Missense_Mutation_p.M330I	NM_000796	NP_000787	P35462	DRD3_HUMAN	dopamine receptor D3 isoform a	330	Helical; Name=6.				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)	CAATGGCCACCATTTGGGTTG	0.388													129	65	---	---	---	---	PASS
IGSF11	152404	broad.mit.edu	37	3	118621695	118621695	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118621695C>T	uc003ebw.2	-	7	1215	c.968G>A	c.(967-969)AGC>AAC	p.S323N	IGSF11_uc011biv.1_Missense_Mutation_p.S295N|IGSF11_uc003ebx.2_Missense_Mutation_p.S299N|IGSF11_uc003eby.2_Missense_Mutation_p.S322N|IGSF11_uc003ebz.2_Missense_Mutation_p.S298N|IGSF11_uc010hqs.2_Missense_Mutation_p.S322N	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b	323	Cytoplasmic (Potential).				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0						TGGATTGTTGCTCCAGTATCG	0.463													42	264	---	---	---	---	PASS
ATP2C1	27032	broad.mit.edu	37	3	130656305	130656305	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130656305C>T	uc003enl.2	+	6	580	c.358C>T	c.(358-360)CAG>TAG	p.Q120*	ATP2C1_uc011blg.1_Nonsense_Mutation_p.Q154*|ATP2C1_uc011blh.1_Nonsense_Mutation_p.Q115*|ATP2C1_uc011bli.1_Nonsense_Mutation_p.Q154*|ATP2C1_uc003enk.2_Nonsense_Mutation_p.Q104*|ATP2C1_uc003enm.2_Nonsense_Mutation_p.Q120*|ATP2C1_uc003enn.2_Nonsense_Mutation_p.Q104*|ATP2C1_uc003eno.2_Nonsense_Mutation_p.Q120*|ATP2C1_uc003enp.2_Nonsense_Mutation_p.Q120*|ATP2C1_uc003enq.2_Nonsense_Mutation_p.Q120*|ATP2C1_uc003enr.2_Nonsense_Mutation_p.Q120*|ATP2C1_uc003ens.2_Nonsense_Mutation_p.Q120*|ATP2C1_uc003ent.2_Nonsense_Mutation_p.Q120*	NM_014382	NP_055197	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1a	120	Helical; Name=2; (By similarity).				actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	TGCCTTTGTTCAGGTAAGTAC	0.338									Hailey-Hailey_disease				39	146	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147131323	147131323	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147131323C>G	uc003ewe.2	+	3	2048	c.1329C>G	c.(1327-1329)AAC>AAG	p.N443K		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	443					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CCAATTTTAACGAATGGTACG	0.473													34	115	---	---	---	---	PASS
C3orf33	285315	broad.mit.edu	37	3	155481693	155481693	+	Missense_Mutation	SNP	G	T	T	rs115731681	by1000genomes	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155481693G>T	uc003fal.1	-	6	639	c.369C>A	c.(367-369)AGC>AGA	p.S123R	C3orf33_uc003fam.1_Missense_Mutation_p.S166R	NM_173657	NP_775928	Q96NB5	Q96NB5_HUMAN	hypothetical protein LOC285315	123							hydrolase activity, acting on ester bonds|nucleic acid binding				0			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TCAGATTCACGCTGAAATATC	0.303													5	49	---	---	---	---	PASS
GPR160	26996	broad.mit.edu	37	3	169801789	169801789	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169801789C>A	uc003fgi.2	+	4	619	c.29C>A	c.(28-30)TCT>TAT	p.S10Y	GPR160_uc010hwq.2_Missense_Mutation_p.S10Y	NM_014373	NP_055188	Q9UJ42	GP160_HUMAN	G protein-coupled receptor 160	10	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_cancers(22;3.26e-22)|all_epithelial(15;5.71e-27)|all_lung(20;8.41e-17)|Lung NSC(18;3.49e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			GAGAACTGCTCTTTTCAGTAC	0.353													198	225	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195515753	195515753	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195515753C>T	uc011bto.1	-	2	3158	c.2698G>A	c.(2698-2700)GAG>AAG	p.E900K	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Missense_Mutation_p.E782K	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	905	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCGGCTGTCTCCTGAGGAGAG	0.612													36	39	---	---	---	---	PASS
FGFR3	2261	broad.mit.edu	37	4	1803568	1803568	+	Missense_Mutation	SNP	C	G	G	rs121913483		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1803568C>G	uc003gdr.3	+	7	1002	c.746C>G	c.(745-747)TCC>TGC	p.S249C	FGFR3_uc003gdu.2_Missense_Mutation_p.S249C|FGFR3_uc003gds.3_Missense_Mutation_p.S249C|FGFR3_uc003gdq.3_Missense_Mutation_p.S249C|FGFR3_uc010icb.1_Missense_Mutation_p.S91C|FGFR3_uc003gdt.1_Missense_Mutation_p.S91C	NM_000142	NP_000133	P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3 isoform 1	249	Extracellular (Potential).		S -> C (in KERSEB, bladder cancer, cervical cancer and TD1).		bone maturation|cell growth|insulin receptor signaling pathway|JAK-STAT cascade|MAPKKK cascade|negative regulation of developmental growth|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|identical protein binding	p.S249C(1368)|p.R248_S249insC(2)|p.S249T(1)|p.R248_S249del(1)		urinary_tract(2177)|skin(314)|upper_aerodigestive_tract(57)|haematopoietic_and_lymphoid_tissue(24)|prostate(9)|cervix(6)|central_nervous_system(4)|large_intestine(3)|lung(3)|testis(2)|pancreas(1)	2600		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)	ACAGAGCGCTCCCCGCACCGG	0.562		1	Mis|T	IGH@|ETV6	bladder|MM|T-cell lymphoma		Hypochondroplasia|Thanatophoric dysplasia		Muenke_syndrome|Saethre-Chotzen_syndrome				2	10	---	---	---	---	PASS
JAKMIP1	152789	broad.mit.edu	37	4	6083357	6083357	+	Silent	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6083357G>T	uc003giu.3	-	6	1356	c.1080C>A	c.(1078-1080)CTC>CTA	p.L360L	JAKMIP1_uc010idb.1_Silent_p.L360L|JAKMIP1_uc010idc.1_Silent_p.L195L|JAKMIP1_uc010idd.1_Silent_p.L360L|JAKMIP1_uc011bwc.1_Silent_p.L195L|JAKMIP1_uc003giv.3_Silent_p.L360L|JAKMIP1_uc010ide.2_Silent_p.L360L	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	360	Potential.|Mediates association with microtubules.				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						TTTCCCGCGTGAGGTTCTTGA	0.527													28	122	---	---	---	---	PASS
ABLIM2	84448	broad.mit.edu	37	4	8108243	8108243	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8108243G>T	uc003gko.2	-	2	275	c.132C>A	c.(130-132)CAC>CAA	p.H44Q	ABLIM2_uc003gkj.3_Missense_Mutation_p.H44Q|ABLIM2_uc003gkm.3_Missense_Mutation_p.H44Q|ABLIM2_uc003gkp.2_Missense_Mutation_p.H44Q|ABLIM2_uc003gkq.2_Missense_Mutation_p.H44Q|ABLIM2_uc003gkr.2_Missense_Mutation_p.H44Q|ABLIM2_uc003gks.3_Missense_Mutation_p.H44Q|ABLIM2_uc011bwl.1_Missense_Mutation_p.H49Q	NM_001130084	NP_001123556	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	44	LIM zinc-binding 1.				axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding			pancreas(3)	3						AGCACTTGATGTGGAAGTACT	0.642													9	6	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13615294	13615294	+	Intron	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13615294G>A	uc003gmz.1	-						BOD1L_uc010idr.1_Intron|BOD1L_uc010ids.1_Intron	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division								DNA binding			ovary(5)|breast(1)	6						ATCTTCAAGCGGAAAATAAAA	0.313													4	56	---	---	---	---	PASS
TBC1D19	55296	broad.mit.edu	37	4	26689973	26689973	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26689973A>T	uc003gsf.3	+	13	1168	c.898A>T	c.(898-900)AAG>TAG	p.K300*	TBC1D19_uc010iew.2_Nonsense_Mutation_p.K300*|TBC1D19_uc011bxu.1_Nonsense_Mutation_p.K235*	NM_018317	NP_060787	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	300	Rab-GAP TBC.					intracellular	Rab GTPase activator activity			breast(1)	1		Breast(46;0.0503)				ATAGGATGTGAAGTTGACAGC	0.284													38	76	---	---	---	---	PASS
CENPC1	1060	broad.mit.edu	37	4	68396613	68396613	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68396613T>A	uc003hdd.1	-	5	434	c.251A>T	c.(250-252)AAG>ATG	p.K84M	CENPC1_uc010ihj.1_RNA|CENPC1_uc010ihk.1_RNA|CENPC1_uc010ihm.1_Missense_Mutation_p.K84M	NM_001812	NP_001803	Q03188	CENPC_HUMAN	centromere protein C 1	84					mitotic prometaphase	condensed chromosome kinetochore|condensed nuclear chromosome, centromeric region|cytosol	DNA binding			urinary_tract(1)|lung(1)	2						TGGAACTGACTTTGGATGTGA	0.368													22	11	---	---	---	---	PASS
TUBB4Q	56604	broad.mit.edu	37	4	190905449	190905449	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190905449G>T	uc011clg.1	-	3	238	c.235C>A	c.(235-237)CCC>ACC	p.P79T		NM_020040	NP_064424	Q99867	TBB4Q_HUMAN	tubulin, beta polypeptide 4, member Q	80					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;4.1e-31)|Epithelial(3;1.44e-30)|OV - Ovarian serous cystadenocarcinoma(60;2.03e-15)|BRCA - Breast invasive adenocarcinoma(30;8.54e-06)|Lung(3;3.23e-05)|STAD - Stomach adenocarcinoma(60;8.24e-05)|LUSC - Lung squamous cell carcinoma(40;0.000184)|GBM - Glioblastoma multiforme(59;0.00839)|READ - Rectum adenocarcinoma(43;0.155)		TGCCCGAAGGGCCCCGAGCGC	0.667													13	56	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21975401	21975401	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21975401C>T	uc010iuc.2	-	3	783	c.325G>A	c.(325-327)GGG>AGG	p.G109R	CDH12_uc011cno.1_Missense_Mutation_p.G109R|CDH12_uc003jgk.2_Missense_Mutation_p.G109R	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	109	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						TGAATGTCCCCTGTGGTTTCA	0.498										HNSCC(59;0.17)			109	197	---	---	---	---	PASS
CDH6	1004	broad.mit.edu	37	5	31323023	31323023	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31323023G>A	uc003jhe.1	+	12	2307	c.1981G>A	c.(1981-1983)GAC>AAC	p.D661N		NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein	661	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7						CAGTTACAACGACGAAGGTGG	0.488													57	114	---	---	---	---	PASS
PLCXD3	345557	broad.mit.edu	37	5	41382178	41382178	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41382178C>A	uc003jmm.1	-	2	664	c.562G>T	c.(562-564)GAC>TAC	p.D188Y		NM_001005473	NP_001005473	Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X	188	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						ACTTGATAGTCCTTCTCCCAC	0.488													116	182	---	---	---	---	PASS
MGC42105	167359	broad.mit.edu	37	5	43280396	43280396	+	Silent	SNP	G	A	A	rs143914564	byFrequency	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43280396G>A	uc003jno.2	+	4	1757	c.876G>A	c.(874-876)CCG>CCA	p.P292P		NM_153361	NP_699192	Q8IY84	NIM1_HUMAN	serine/threonine-protein kinase NIM1	292	Protein kinase.						ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|stomach(1)|large_intestine(1)|breast(1)	9						GTGTACCGCCGCACGTGTCAG	0.537													35	103	---	---	---	---	PASS
CDC20B	166979	broad.mit.edu	37	5	54436132	54436132	+	Intron	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54436132G>T	uc003jpo.1	-						CDC20B_uc003jpn.1_Intron|CDC20B_uc010ivu.1_Intron|CDC20B_uc010ivv.1_Intron|CDC20B_uc003jpp.2_Intron	NM_152623	NP_689836	Q86Y33	CD20B_HUMAN	CDC20 cell division cycle 20 homolog B isoform												0		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)			ACAATGTCTTGATCCTGTACC	0.383													19	90	---	---	---	---	PASS
AP3B1	8546	broad.mit.edu	37	5	77423970	77423970	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77423970G>A	uc003kfj.2	-	17	1977	c.1852C>T	c.(1852-1854)CAG>TAG	p.Q618*		NM_003664	NP_003655	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1	618					endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		GTGCCAAGCTGGAAATGATCT	0.373									Hermansky-Pudlak_syndrome				29	67	---	---	---	---	PASS
SCAMP1	9522	broad.mit.edu	37	5	77684689	77684689	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77684689A>G	uc003kfl.2	+	2	243	c.86A>G	c.(85-87)AAT>AGT	p.N29S	SCAMP1_uc010jaa.2_RNA|SCAMP1_uc011ctc.1_Intron|SCAMP1_uc011ctd.1_RNA	NM_004866	NP_004857	O15126	SCAM1_HUMAN	secretory carrier membrane protein 1	29	Cytoplasmic (Potential).				post-Golgi vesicle-mediated transport|protein transport	integral to membrane|recycling endosome membrane|trans-Golgi network	protein binding				0		all_lung(232;0.000397)|Lung NSC(167;0.00105)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.9e-46)|Epithelial(54;9.4e-43)|all cancers(79;1.12e-37)		GTGACAAGAAATGTTCCACCA	0.279													5	13	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79031918	79031918	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79031918G>T	uc003kgc.2	+	2	7402	c.7330G>T	c.(7330-7332)GAG>TAG	p.E2444*		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2444						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AATTTCTGAAGAGGAAACAAA	0.353													22	50	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127730898	127730898	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127730898A>T	uc003kuu.2	-	9	1587	c.1148T>A	c.(1147-1149)ATG>AAG	p.M383K	FBN2_uc003kuv.2_Missense_Mutation_p.M350K	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	383	TB 2.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CATTTTCGTCATTCTCCCCGG	0.542													9	46	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127744403	127744403	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127744403C>A	uc003kuu.2	-	8	1481	c.1042G>T	c.(1042-1044)GGA>TGA	p.G348*	FBN2_uc003kuv.2_Nonsense_Mutation_p.G315*	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	348	EGF-like 5; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GTTACATATCCACGTGGACAA	0.443													49	85	---	---	---	---	PASS
RAD50	10111	broad.mit.edu	37	5	131939024	131939024	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131939024T>A	uc003kxi.2	+	14	2627	c.2240T>A	c.(2239-2241)ATA>AAA	p.I747K	RAD50_uc003kxh.2_Missense_Mutation_p.I608K	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1	747					DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GAGAAGGAAATACCAGAATTA	0.269								Homologous_recombination					13	47	---	---	---	---	PASS
IK	3550	broad.mit.edu	37	5	140032730	140032730	+	Splice_Site	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140032730G>A	uc003lgq.2	+	5	514	c.404_splice	c.e5+1	p.A135_splice	IK_uc011czk.1_Splice_Site_p.A135_splice	NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein						cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCTGAGGCGTGAGTACTGA	0.502													30	64	---	---	---	---	PASS
PCDHA6	56142	broad.mit.edu	37	5	140207985	140207985	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140207985C>A	uc003lho.2	+	1	336	c.309C>A	c.(307-309)AGC>AGA	p.S103R	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Missense_Mutation_p.S103R|PCDHA6_uc011dab.1_Missense_Mutation_p.S103R	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	103	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGAGTGCAGCATCCACCTGG	0.587													48	252	---	---	---	---	PASS
PCDHA11	56138	broad.mit.edu	37	5	140248877	140248877	+	Silent	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140248877G>A	uc003lia.2	+	1	1047	c.189G>A	c.(187-189)CTG>CTA	p.L63L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Silent_p.L63L	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	63	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCAGCGCCTGTTCCGGGTGG	0.612													89	120	---	---	---	---	PASS
PCDHB13	56123	broad.mit.edu	37	5	140595315	140595315	+	Silent	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140595315G>T	uc003lja.1	+	1	1807	c.1620G>T	c.(1618-1620)GCG>GCT	p.A540A		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	540	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCCCCGGCGCTGAGCAGCG	0.697													24	44	---	---	---	---	PASS
PCDHGB4	8641	broad.mit.edu	37	5	140768582	140768582	+	Silent	SNP	T	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140768582T>C	uc003lkc.1	+	1	1131	c.1131T>C	c.(1129-1131)AAT>AAC	p.N377N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Silent_p.N377N	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	377	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGACACAATGGAGAAGTGA	0.408													31	126	---	---	---	---	PASS
ARAP3	64411	broad.mit.edu	37	5	141059334	141059334	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141059334C>T	uc003llm.2	-	3	658	c.580G>A	c.(580-582)GGC>AGC	p.G194S	ARAP3_uc003lln.2_Missense_Mutation_p.G116S|ARAP3_uc003llo.1_Missense_Mutation_p.G194S	NM_022481	NP_071926	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	194					cytoskeleton organization|negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of ARF GTPase activity|regulation of cell shape|small GTPase mediated signal transduction|vesicle-mediated transport	cytoskeleton|cytosol|lamellipodium|plasma membrane|ruffle	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|Rho GTPase activator activity|zinc ion binding			breast(5)|ovary(1)|large_intestine(1)	7						TTACCTGTGCCTGTTGTGGGC	0.582													55	89	---	---	---	---	PASS
SLC36A3	285641	broad.mit.edu	37	5	150663691	150663691	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150663691G>C	uc003ltw.2	-	8	1307	c.888C>G	c.(886-888)ATC>ATG	p.I296M	GM2A_uc011dcs.1_Intron|SLC36A3_uc003ltv.2_Missense_Mutation_p.I281M|SLC36A3_uc003ltx.2_Missense_Mutation_p.I337M	NM_181774	NP_861439	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3 isoform 2	296	Helical; (Potential).					integral to membrane				ovary(2)|skin(1)	3		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGATATAGAGGATGATGACAA	0.473													92	143	---	---	---	---	PASS
CYFIP2	26999	broad.mit.edu	37	5	156755026	156755026	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156755026A>G	uc003lwq.2	+	21	2263	c.2125A>G	c.(2125-2127)ATC>GTC	p.I709V	CYFIP2_uc011ddn.1_Missense_Mutation_p.I683V|CYFIP2_uc011ddo.1_Missense_Mutation_p.I513V|CYFIP2_uc003lwr.2_Missense_Mutation_p.I709V|CYFIP2_uc003lws.2_Missense_Mutation_p.I709V|CYFIP2_uc003lwt.2_Missense_Mutation_p.I612V|CYFIP2_uc011ddp.1_Missense_Mutation_p.I443V	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2	734					apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGCAGACCAGATCTTTGCTTA	0.473													25	65	---	---	---	---	PASS
ADAM19	8728	broad.mit.edu	37	5	156920133	156920133	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156920133C>A	uc003lwz.2	-	16	1820	c.1756G>T	c.(1756-1758)GAG>TAG	p.E586*	ADAM19_uc003lww.1_Nonsense_Mutation_p.E319*|ADAM19_uc003lwy.2_Nonsense_Mutation_p.E185*|ADAM19_uc011ddr.1_Nonsense_Mutation_p.E517*	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19 preproprotein	586	Extracellular (Potential).|Cys-rich.				proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCGTTGGACTCCAGGGGCCGG	0.602													37	94	---	---	---	---	PASS
ADAM19	8728	broad.mit.edu	37	5	156920134	156920134	+	Silent	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156920134C>A	uc003lwz.2	-	16	1819	c.1755G>T	c.(1753-1755)CTG>CTT	p.L585L	ADAM19_uc003lww.1_Silent_p.L318L|ADAM19_uc003lwy.2_Silent_p.L184L|ADAM19_uc011ddr.1_Silent_p.L516L	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19 preproprotein	585	Extracellular (Potential).|Cys-rich.				proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CGTTGGACTCCAGGGGCCGGG	0.602													39	92	---	---	---	---	PASS
GABRA6	2559	broad.mit.edu	37	5	161117260	161117260	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161117260T>A	uc003lyu.2	+	7	1065	c.727T>A	c.(727-729)TTC>ATC	p.F243I	GABRA6_uc003lyv.2_Missense_Mutation_p.F14I	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	243	Helical; (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	GATGGGCTACTTCATGATACA	0.403										TCGA Ovarian(5;0.080)			38	171	---	---	---	---	PASS
NUP153	9972	broad.mit.edu	37	6	17669736	17669736	+	Silent	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17669736T>A	uc003ncd.1	-	6	1094	c.894A>T	c.(892-894)GCA>GCT	p.A298A	NUP153_uc011dje.1_Silent_p.A298A|NUP153_uc010jpl.1_Silent_p.A298A	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	298					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			CGTAAGATTGTGCACTGAGTT	0.368													27	120	---	---	---	---	PASS
GPLD1	2822	broad.mit.edu	37	6	24450130	24450130	+	Intron	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24450130G>A	uc003ned.1	-						GPLD1_uc010jpr.1_Intron|GPLD1_uc010jps.1_Intron	NM_001503	NP_001494	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific							extracellular region	glycosylphosphatidylinositol phospholipase D activity			ovary(2)|kidney(1)	3						CCTGAGGGCTGAAGAGGCACA	0.657													27	40	---	---	---	---	PASS
ZKSCAN4	387032	broad.mit.edu	37	6	28213601	28213601	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28213601G>A	uc003nks.1	-	5	1175	c.931C>T	c.(931-933)CAG>TAG	p.Q311*	ZKSCAN4_uc011dlb.1_Nonsense_Mutation_p.Q156*	NM_019110	NP_061983	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4	311	KRAB.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						GCATTTTTCTGCTTTCTTTGT	0.468													22	139	---	---	---	---	PASS
C6orf27	80737	broad.mit.edu	37	6	31736783	31736783	+	Intron	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31736783G>A	uc011dog.1	-						C6orf27_uc003nxd.2_Intron	NM_025258	NP_079534	Q9Y334	G7C_HUMAN	G7c protein precursor							extracellular region				ovary(3)	3						GAGGGCCCTGGCCCCCACTTA	0.562													5	16	---	---	---	---	PASS
PBX2	5089	broad.mit.edu	37	6	32155870	32155870	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32155870C>A	uc003oav.1	-	4	878	c.607G>T	c.(607-609)GTG>TTG	p.V203L	PBX2_uc003oaw.2_Missense_Mutation_p.V203L	NM_002586	NP_002577	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	203							transcription factor binding			ovary(1)	1						TTGGGGGCCACGGGCCTGGTG	0.592													3	16	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33148785	33148785	+	Intron	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33148785G>A	uc003ocx.1	-						COL11A2_uc003ocy.1_Intron|COL11A2_uc003ocz.1_Intron	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1						cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						AGCATACCCTGTGGAGTCAAA	0.542													52	109	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75797406	75797406	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75797406G>A	uc003phs.2	-	65	9234	c.9068C>T	c.(9067-9069)CCT>CTT	p.P3023L	COL12A1_uc003pht.2_Missense_Mutation_p.P1859L	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	3023	Triple-helical region (COL1) with 2 imperfections.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						AGGGGGGCCAGGGGGACCTCT	0.537													23	127	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79725400	79725400	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79725400T>C	uc003pir.2	-	14	1562	c.1336A>G	c.(1336-1338)ATG>GTG	p.M446V	PHIP_uc011dyp.1_Missense_Mutation_p.M446V	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	446	WD 6.				insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TTCAGAGTCATGTTATTAACT	0.328													30	128	---	---	---	---	PASS
TAAR8	83551	broad.mit.edu	37	6	132873902	132873902	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132873902C>G	uc011ecj.1	+	1	71	c.71C>G	c.(70-72)ACT>AGT	p.T24S		NM_053278	NP_444508	Q969N4	TAAR8_HUMAN	trace amine associated receptor 8	24	Extracellular (Potential).					plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00412)|GBM - Glioblastoma multiforme(226;0.00792)		TGTATTGAAACTCCCTATTCT	0.428													38	214	---	---	---	---	PASS
RPS12	6206	broad.mit.edu	37	6	133136222	133136222	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133136222A>C	uc003qdx.2	+	3	208	c.126A>C	c.(124-126)TTA>TTC	p.L42F	RPS12_uc003qdy.1_5'Flank	NM_001016	NP_001007	P25398	RS12_HUMAN	ribosomal protein S12	42					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	structural constituent of ribosome				0	Breast(56;0.214)			OV - Ovarian serous cystadenocarcinoma(155;0.00284)|GBM - Glioblastoma multiforme(226;0.0256)		CCAAAGCCTTAGACAAGTACG	0.488													41	80	---	---	---	---	PASS
KIAA1244	57221	broad.mit.edu	37	6	138655303	138655303	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138655303C>T	uc003qhu.2	+	33	5320	c.5320C>T	c.(5320-5322)CTG>TTG	p.L1774L		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine	1774					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		ATTCGACCTGCTGCTGGACTC	0.552													6	35	---	---	---	---	PASS
HIVEP2	3097	broad.mit.edu	37	6	143093952	143093952	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143093952G>A	uc003qjd.2	-	5	2667	c.1924C>T	c.(1924-1926)CGG>TGG	p.R642W		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	642					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TAGGGTTTCCGACAGACATCA	0.453													42	182	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146480634	146480634	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146480634C>A	uc010khw.1	+	3	1321	c.851C>A	c.(850-852)GCT>GAT	p.A284D	GRM1_uc010khu.1_Missense_Mutation_p.A284D|GRM1_uc010khv.1_Missense_Mutation_p.A284D|GRM1_uc003qll.2_Missense_Mutation_p.A284D|GRM1_uc011edz.1_Missense_Mutation_p.A284D|GRM1_uc011eea.1_Missense_Mutation_p.A284D	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	284	Extracellular (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	CTTCCCAAGGCTAGAGTGGTG	0.572													22	39	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152676045	152676045	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152676045C>A	uc010kiw.2	-	67	11277	c.10675G>T	c.(10675-10677)GTG>TTG	p.V3559L	SYNE1_uc003qot.3_Missense_Mutation_p.V3566L|SYNE1_uc003qou.3_Missense_Mutation_p.V3559L|SYNE1_uc010kja.1_Missense_Mutation_p.V264L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3559	HAT 7.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GATGGGATCACATCCTCTCTG	0.557										HNSCC(10;0.0054)			36	241	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21598522	21598522	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21598522T>C	uc003svc.2	+	3	629	c.598T>C	c.(598-600)TAT>CAT	p.Y200H		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	200	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						AAAGAAGATGTATATTTTTAG	0.363									Kartagener_syndrome				15	23	---	---	---	---	PASS
SKAP2	8935	broad.mit.edu	37	7	26729970	26729970	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26729970C>A	uc003syc.2	-	10	1101	c.808G>T	c.(808-810)GAC>TAC	p.D270Y	SKAP2_uc011jzi.1_Missense_Mutation_p.D98Y|SKAP2_uc011jzj.1_Missense_Mutation_p.D255Y	NM_003930	NP_003921	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	270					B cell activation|cell junction assembly|protein complex assembly|signal transduction	cytosol|plasma membrane	SH3/SH2 adaptor activity			pancreas(1)	1						GGAGCACTGTCCTCTTCTTCT	0.383													49	151	---	---	---	---	PASS
TRIL	9865	broad.mit.edu	37	7	28997605	28997605	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28997605G>T	uc003szt.2	-	1	425	c.58C>A	c.(58-60)CCG>ACG	p.P20T	uc003szu.1_5'Flank	NM_014817	NP_055632	Q7L0X0	TRIL_HUMAN	TLR4 interactor with leucine rich repeats	20					inflammatory response|innate immune response|regulation of cytokine production involved in immune response|toll-like receptor 4 signaling pathway	lipopolysaccharide receptor complex	lipopolysaccharide binding				0						GGCAGCGGCGGGAGCGCGAGG	0.731													14	16	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31815290	31815290	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31815290G>T	uc003tcm.1	-	17	2417	c.1948C>A	c.(1948-1950)CTT>ATT	p.L650I	PDE1C_uc003tcn.1_Missense_Mutation_p.L650I|PDE1C_uc003tco.1_Missense_Mutation_p.L710I	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	650					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			GGCAACGTAAGGCGACACGTG	0.488													21	33	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31876849	31876849	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31876849G>T	uc003tcm.1	-	11	1617	c.1148C>A	c.(1147-1149)GCA>GAA	p.A383E	PDE1C_uc003tcn.1_Missense_Mutation_p.A383E|PDE1C_uc003tco.1_Missense_Mutation_p.A443E|PDE1C_uc003tcr.2_Missense_Mutation_p.A383E|PDE1C_uc003tcs.2_Missense_Mutation_p.A383E	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	383	Catalytic (By similarity).				activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			GAGGTCCCATGCTTTTGCTGG	0.453													47	116	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	71130396	71130396	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71130396G>C	uc003tvy.2	+	7	1081	c.1081G>C	c.(1081-1083)GTA>CTA	p.V361L	WBSCR17_uc003tvz.2_Missense_Mutation_p.V60L	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	361	Catalytic subdomain B.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GTACCCCTAGGTATGGCTCTG	0.502													61	169	---	---	---	---	PASS
SLC12A9	56996	broad.mit.edu	37	7	100459472	100459472	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100459472G>C	uc003uwp.2	+	12	1792	c.1650G>C	c.(1648-1650)TTG>TTC	p.L550F	SLC12A9_uc003uwq.2_Missense_Mutation_p.L461F|SLC12A9_uc011kki.1_Missense_Mutation_p.L81F|SLC12A9_uc003uwr.2_Missense_Mutation_p.L286F|SLC12A9_uc003uws.2_Missense_Mutation_p.L81F|SLC12A9_uc003uwt.2_Missense_Mutation_p.L286F|SLC12A9_uc003uwv.2_Missense_Mutation_p.L81F	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN	solute carrier family 12 (potassium/chloride	550	Extracellular (Potential).					integral to membrane|plasma membrane	cation:chloride symporter activity				0	Lung NSC(181;0.041)|all_lung(186;0.0581)					TGCTGCGGTTGGCCAACCAGC	0.657													17	27	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100551477	100551477	+	RNA	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100551477A>T	uc003uxk.1	+	1		c.728A>T			uc003uxl.1_5'UTR					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		CAACTCGAACACACATCATTT	0.493													36	166	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	119915250	119915250	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119915250C>T	uc003vjj.1	+	1	1529	c.564C>T	c.(562-564)TAC>TAT	p.Y188Y		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	188	Helical; Name=Segment S1; (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					TGGTGTTCTACTATGTCACGG	0.582													31	63	---	---	---	---	PASS
TRIM24	8805	broad.mit.edu	37	7	138252234	138252234	+	Silent	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138252234T>A	uc003vuc.2	+	10	1754	c.1539T>A	c.(1537-1539)CCT>CCA	p.P513P	TRIM24_uc003vub.2_Silent_p.P479P	NM_015905	NP_056989	O15164	TIF1A_HUMAN	transcriptional intermediary factor 1 alpha	513					cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8						AGCAACCGCCTCCACGTTTGA	0.343													35	152	---	---	---	---	PASS
EN2	2020	broad.mit.edu	37	7	155255319	155255319	+	Silent	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155255319C>G	uc003wmb.2	+	2	1188	c.939C>G	c.(937-939)CTC>CTG	p.L313L		NM_001427	NP_001418	P19622	HME2_HUMAN	engrailed homeobox 2	313						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCGTGCACCTCATGGCACAGG	0.597													10	28	---	---	---	---	PASS
MSRA	4482	broad.mit.edu	37	8	10159152	10159152	+	Intron	SNP	G	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10159152G>C	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc011kwy.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463	Q9UJ68	MSRA_HUMAN	methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)	ACCCAAGGTAGAGTGATGAGT	0.463													32	84	---	---	---	---	PASS
USP17L2	377630	broad.mit.edu	37	8	11995293	11995293	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11995293G>A	uc003wvc.1	-	1	977	c.977C>T	c.(976-978)GCT>GTT	p.A326V	FAM66D_uc011kxp.1_Intron|FAM66D_uc011kxo.1_Intron	NM_201402	NP_958804	Q6R6M4	U17L2_HUMAN	deubiquitinating enzyme 3	326					apoptosis|cell cycle|G2/M transition checkpoint|mitotic cell cycle G1/S transition checkpoint|protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)	3						ACTCCACCCAGCGTGGACCAG	0.483													29	70	---	---	---	---	PASS
ADAMDEC1	27299	broad.mit.edu	37	8	24259593	24259593	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24259593T>G	uc003xdz.2	+	12	1528	c.1308T>G	c.(1306-1308)TGT>TGG	p.C436W	ADAMDEC1_uc010lub.2_Missense_Mutation_p.C357W|ADAMDEC1_uc011lab.1_Missense_Mutation_p.C357W	NM_014479	NP_055294	O15204	ADEC1_HUMAN	ADAM-like, decysin 1 isoform 1	436	Disintegrin.				integrin-mediated signaling pathway|negative regulation of cell adhesion|proteolysis	extracellular region|integral to membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)	2		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		ACTGTGATTGTGGCTCTCCTA	0.373													51	119	---	---	---	---	PASS
PBK	55872	broad.mit.edu	37	8	27690580	27690580	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27690580C>T	uc003xgi.2	-	2	252	c.51G>A	c.(49-51)AAG>AAA	p.K17K	PBK_uc011lap.1_Silent_p.K17K	NM_018492	NP_060962	Q96KB5	TOPK_HUMAN	PDZ binding kinase	17					mitosis		ATP binding|protein binding|protein serine/threonine kinase activity				0		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|KIRC - Kidney renal clear cell carcinoma(542;0.101)|Kidney(114;0.121)|Colorectal(74;0.141)		TACCAGATTTCTTTTTTTCTG	0.318													22	54	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30706340	30706340	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30706340C>G	uc003xil.2	-	1	194	c.194G>C	c.(193-195)AGT>ACT	p.S65T	TEX15_uc011lbc.1_Missense_Mutation_p.S452T	NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	65										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GCCTGCAGTACTACTCTGTTC	0.398													65	176	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35542230	35542230	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35542230G>A	uc003xjr.1	+	6	1210	c.882G>A	c.(880-882)ATG>ATA	p.M294I	UNC5D_uc003xjs.1_Missense_Mutation_p.M289I|UNC5D_uc003xjt.1_Missense_Mutation_p.M63I	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	294	TSP type-1 1.|Extracellular (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GTGAGGGAATGTCAGTGCAGA	0.498													53	152	---	---	---	---	PASS
FAM150A	389658	broad.mit.edu	37	8	53452398	53452398	+	Silent	SNP	C	G	G	rs147680673		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53452398C>G	uc003xrd.2	-	3	523	c.318G>C	c.(316-318)ACG>ACC	p.T106T	FAM150A_uc011ldt.1_Silent_p.T106T	NM_207413	NP_997296	Q6UXT8	F150A_HUMAN	hypothetical protein LOC389658 precursor	106						extracellular region					0		Lung NSC(129;0.0919)|all_epithelial(80;0.125)|all_lung(136;0.17)				TACAAGCTGGCGTTGAGCACT	0.388													22	55	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55541754	55541754	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55541754C>T	uc003xsd.1	+	4	5460	c.5312C>T	c.(5311-5313)TCA>TTA	p.S1771L	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1771					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GACACCACATCAGTGGACACC	0.438													14	100	---	---	---	---	PASS
NKAIN3	286183	broad.mit.edu	37	8	63659609	63659609	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63659609C>A	uc010lyq.1	+	4	524	c.392C>A	c.(391-393)ACG>AAG	p.T131K		NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3	131						integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				GACGATTACACGTACGTCTCT	0.498													29	51	---	---	---	---	PASS
VCPIP1	80124	broad.mit.edu	37	8	67578617	67578617	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67578617C>T	uc003xwn.2	-	1	836	c.577G>A	c.(577-579)GAC>AAC	p.D193N	SGK3_uc003xwp.2_5'Flank|C8orf44_uc003xwo.1_5'Flank	NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	193					protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			TCCAGAGTGTCATGCAAATAC	0.542													35	258	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72958829	72958829	+	Silent	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72958829G>A	uc003xza.2	-	17	2155	c.1980C>T	c.(1978-1980)TTC>TTT	p.F660F	uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	660	Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	GAAGATATTTGAAATTATACT	0.299													50	124	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72964929	72964929	+	Silent	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72964929A>T	uc003xza.2	-	14	1891	c.1716T>A	c.(1714-1716)GCT>GCA	p.A572A	uc011lff.1_RNA|uc003xyy.2_RNA	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	572	Cytoplasmic (Potential).|ANK 14.					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	GGACTATGTCAGCATTGTGGC	0.473													57	170	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87680338	87680338	+	Silent	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87680338G>A	uc003ydx.2	-	5	598	c.552C>T	c.(550-552)TAC>TAT	p.Y184Y	CNGB3_uc010maj.2_Silent_p.Y46Y	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	184	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						ACAGCCTGTAGTAATGTTCTG	0.368													85	170	---	---	---	---	PASS
INTS8	55656	broad.mit.edu	37	8	95888702	95888702	+	Silent	SNP	T	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95888702T>C	uc003yhb.2	+	26	2982	c.2856T>C	c.(2854-2856)GAT>GAC	p.D952D	INTS8_uc011lgq.1_RNA|INTS8_uc011lgr.1_RNA|INTS8_uc010mba.2_Silent_p.D762D	NM_017864	NP_060334	Q75QN2	INT8_HUMAN	integrator complex subunit 8	952					snRNA processing	integrator complex	protein binding				0	Breast(36;1.05e-06)					GAGAAACAGATAAAAGACAAA	0.284													23	73	---	---	---	---	PASS
DPYS	1807	broad.mit.edu	37	8	105405020	105405020	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105405020G>A	uc003yly.3	-	8	1564	c.1435C>T	c.(1435-1437)CGA>TGA	p.R479*	DPYS_uc010mcf.1_Nonsense_Mutation_p.R49*	NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase	479					protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ACCCGGTCTCGCTGCTTTATT	0.478													99	281	---	---	---	---	PASS
KCNQ3	3786	broad.mit.edu	37	8	133153486	133153486	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133153486G>A	uc003ytj.2	-	10	1580	c.1355C>T	c.(1354-1356)GCC>GTC	p.A452V	KCNQ3_uc010mdt.2_Missense_Mutation_p.A452V	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein	452					axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TTCTTCTATGGCATCTACATT	0.458													63	182	---	---	---	---	PASS
KLHL9	55958	broad.mit.edu	37	9	21334855	21334855	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21334855T>C	uc003zoy.2	-	1	575	c.4A>G	c.(4-6)AAA>GAA	p.K2E	KLHL9_uc003zow.2_Intron|KLHL9_uc003zox.2_RNA	NM_018847	NP_061335	Q9P2J3	KLHL9_HUMAN	kelch-like 9	2					cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex|midbody				ovary(3)|skin(1)	4				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		AGGGACACTTTCATGTGAAAG	0.468													51	62	---	---	---	---	PASS
PAX5	5079	broad.mit.edu	37	9	37020777	37020777	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37020777A>G	uc003zzo.1	-	2	516	c.68T>C	c.(67-69)CTT>CCT	p.L23P	PAX5_uc011lpw.1_Missense_Mutation_p.L23P|PAX5_uc011lpx.1_Missense_Mutation_p.L23P|PAX5_uc011lpy.1_Intron|PAX5_uc010mls.1_Missense_Mutation_p.L23P|PAX5_uc011lpz.1_Missense_Mutation_p.L23P|PAX5_uc011lqa.1_Intron|PAX5_uc010mlq.1_RNA|PAX5_uc011lqb.1_RNA|PAX5_uc010mlo.1_Missense_Mutation_p.L23P|PAX5_uc010mlp.1_Missense_Mutation_p.L23P|PAX5_uc011lqc.1_Missense_Mutation_p.L23P|PAX5_uc010mlr.1_Missense_Mutation_p.L23P|PAX5_uc011lqd.1_Missense_Mutation_p.L22P|PAX5_uc011lqe.1_Intron|PAX5_uc011lqf.1_Intron|PAX5_uc011lqg.1_Intron	NM_016734	NP_057953	Q02548	PAX5_HUMAN	paired box 5	23	Paired.				cell differentiation|humoral immune response|nervous system development|organ morphogenesis|spermatogenesis|transcription from RNA polymerase II promoter	nucleus	DNA binding	p.?(31)	PAX5/JAK2(18)	haematopoietic_and_lymphoid_tissue(142)|lung(3)|central_nervous_system(2)	147		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		AACCCCCCCAAGCTGATTCAC	0.527			T|Mis|D|F|S	IGH@|ETV6|PML|FOXP1|ZNF521|ELN	NHL|ALL|B-ALL								59	62	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90503380	90503380	+	Silent	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90503380C>A	uc004app.3	+	4	4013	c.3978C>A	c.(3976-3978)ATC>ATA	p.I1326I		NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	1326						integral to membrane				ovary(3)	3						TGGGACAAATCCTGGTGGACA	0.587													25	64	---	---	---	---	PASS
MURC	347273	broad.mit.edu	37	9	103340507	103340507	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103340507G>T	uc004bba.2	+	1	172	c.82G>T	c.(82-84)GAC>TAC	p.D28Y		NM_001018116	NP_001018126	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	28					cell differentiation|muscle organ development|transcription, DNA-dependent					ovary(1)	1		Acute lymphoblastic leukemia(62;0.0461)				TGAAGACCAAGACGCTGCTCT	0.448													66	106	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113139637	113139637	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113139637C>A	uc010mtz.2	-	45	10755	c.10418G>T	c.(10417-10419)CGA>CTA	p.R3473L	SVEP1_uc010mty.2_Missense_Mutation_p.R1399L	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	3473					cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						ACATGGAAATCGACAGACAGC	0.478													45	63	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113228155	113228155	+	Silent	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113228155A>G	uc010mtz.2	-	18	3649	c.3312T>C	c.(3310-3312)TCT>TCC	p.S1104S	SVEP1_uc010mua.1_Silent_p.S1104S	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	1104					cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						CTCCACATGCAGAAATGTTCA	0.433													11	42	---	---	---	---	PASS
TRUB2	26995	broad.mit.edu	37	9	131072155	131072155	+	Intron	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131072155C>T	uc004buq.1	-							NM_015679	NP_056494	O95900	TRUB2_HUMAN	TruB pseudouridine (psi) synthase homolog 2						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(1)	1						CACTGCACCTCTGCCAGGGAC	0.338													21	26	---	---	---	---	PASS
CAMSAP1	157922	broad.mit.edu	37	9	138713130	138713130	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138713130C>T	uc004cgr.3	-	11	3377	c.3377G>A	c.(3376-3378)AGT>AAT	p.S1126N	CAMSAP1_uc004cgq.3_Missense_Mutation_p.S1016N|CAMSAP1_uc010nbg.2_Missense_Mutation_p.S848N	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein	1126						cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		CGTCTCTACACTGGGCGTTGG	0.657													50	93	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139397638	139397638	+	Silent	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139397638C>A	uc004chz.2	-	27	5163	c.5163G>T	c.(5161-5163)GTG>GTT	p.V1721V	NOTCH1_uc004cia.1_Silent_p.V951V	NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	1721	Extracellular (Potential).				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	p.V1722>ARWGSLNIPYLIEA(1)|p.A1721_V1722>YG(1)		haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		ACTTACTCTGCACGGCCTCGA	0.662			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			24	37	---	---	---	---	PASS
PTGDS	5730	broad.mit.edu	37	9	139873756	139873756	+	Intron	SNP	G	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139873756G>C	uc004cke.2	+						PTGDS_uc004ckd.2_Intron|PTGDS_uc004ckf.2_RNA	NM_000954	NP_000945	P41222	PTGDS_HUMAN	prostaglandin D2 synthase, brain						prostaglandin biosynthetic process|regulation of circadian sleep/wake cycle, sleep	Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum	fatty acid binding|prostaglandin-D synthase activity|retinoid binding|transporter activity			ovary(1)	1	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GTCCCCGTGAGTGGGGCCTCC	0.697													20	68	---	---	---	---	PASS
FRMD4A	55691	broad.mit.edu	37	10	13838563	13838563	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13838563C>A	uc001ims.2	-	5	584	c.232G>T	c.(232-234)GAT>TAT	p.D78Y	FRMD4A_uc009xjf.1_Missense_Mutation_p.D78Y|FRMD4A_uc001imt.1_Missense_Mutation_p.D111Y|FRMD4A_uc001imu.1_Missense_Mutation_p.D94Y	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	78	FERM.					cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						ACTCTTCGATCTAGCTGAAGC	0.393													77	101	---	---	---	---	PASS
SLC39A12	221074	broad.mit.edu	37	10	18292244	18292244	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18292244C>T	uc001ipo.2	+	12	2177	c.1904C>T	c.(1903-1905)ACA>ATA	p.T635I	SLC39A12_uc001ipn.2_Missense_Mutation_p.T598I|SLC39A12_uc001ipp.2_Missense_Mutation_p.T634I|SLC39A12_uc010qck.1_Missense_Mutation_p.T501I|uc001ipq.1_RNA	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	635	Helical; (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						TGGATCTTCACAGTCACTGCT	0.398													94	150	---	---	---	---	PASS
PTCHD3	374308	broad.mit.edu	37	10	27703181	27703181	+	Translation_Start_Site	SNP	G	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27703181G>C	uc001itu.2	-	1	117	c.-1C>G	c.(-3-1)ATCAA>ATGAA			NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN	patched domain containing 3						spermatid development	integral to membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|skin(1)	4						CCACGGCATTGATTCTTCCTC	0.637													30	47	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	106849548	106849548	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106849548G>T	uc001kyi.1	+	6	1271	c.1044G>T	c.(1042-1044)TTG>TTT	p.L348F		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	348	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TGGCCGGATTGGATAAGGAGG	0.587													31	22	---	---	---	---	PASS
PNLIP	5406	broad.mit.edu	37	10	118321063	118321063	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118321063T>C	uc001lcm.2	+	12	1292	c.1249T>C	c.(1249-1251)TTT>CTT	p.F417L		NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor	417	PLAT.				lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	GATGGTTAAATTTATTTGGTA	0.368													60	92	---	---	---	---	PASS
SEC23IP	11196	broad.mit.edu	37	10	121662509	121662509	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121662509A>G	uc001leu.1	+	3	967	c.895A>G	c.(895-897)ATC>GTC	p.I299V	SEC23IP_uc010qtc.1_Missense_Mutation_p.I88V	NM_007190	NP_009121	Q9Y6Y8	S23IP_HUMAN	Sec23-interacting protein p125	299	Interaction with SEC23A.				Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding			ovary(3)	3		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		TCTTGAAGAAATCTATAATTC	0.358													32	37	---	---	---	---	PASS
B4GALNT4	338707	broad.mit.edu	37	11	376311	376311	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:376311C>T	uc001lpb.2	+	13	1266	c.1257C>T	c.(1255-1257)GAC>GAT	p.D419D		NM_178537	NP_848632	Q76KP1	B4GN4_HUMAN	beta	419	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			pancreas(1)	1		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ATGAAGAAGACGAGGTGCAGC	0.647													4	74	---	---	---	---	PASS
HBE1	3046	broad.mit.edu	37	11	5289715	5289715	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5289715G>A	uc001mal.1	-	3	681	c.428C>T	c.(427-429)GCC>GTC	p.A143V	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Missense_Mutation_p.A143V	NM_005330	NP_005321	P02100	HBE_HUMAN	epsilon globin	143				A -> G (in Ref. 5; AA sequence).	blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTACTTATGGGCCAGGGCAAT	0.552													41	157	---	---	---	---	PASS
OR52N5	390075	broad.mit.edu	37	11	5798965	5798965	+	Silent	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5798965A>T	uc010qzn.1	-	1	900	c.900T>A	c.(898-900)ATT>ATA	p.I300I	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001922	NP_001001922	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N,	300	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		CTCCATAAACAATAGGGTTTA	0.423													84	165	---	---	---	---	PASS
USH1C	10083	broad.mit.edu	37	11	17544427	17544427	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17544427C>T	uc001mnf.2	-	12	1032	c.923G>A	c.(922-924)CGG>CAG	p.R308Q	USH1C_uc001mne.2_Missense_Mutation_p.R308Q|USH1C_uc009yhb.2_Missense_Mutation_p.R289Q|USH1C_uc001mng.2_RNA|USH1C_uc001mnd.2_Missense_Mutation_p.R272Q	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN	harmonin isoform a	308					equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1						CTCACGCTGCCGCGCCTCTGC	0.657													2	1	---	---	---	---	PASS
E2F8	79733	broad.mit.edu	37	11	19247348	19247348	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19247348T>C	uc001mpm.2	-	11	2479	c.1957A>G	c.(1957-1959)ATT>GTT	p.I653V	E2F8_uc009yhv.2_RNA|E2F8_uc001mpn.3_Missense_Mutation_p.I653V	NM_024680	NP_078956	A0AVK6	E2F8_HUMAN	E2F family member 8	653					cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						CCAGACAAAATGGACTCTGCC	0.458													92	326	---	---	---	---	PASS
ANO3	63982	broad.mit.edu	37	11	26538428	26538428	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26538428A>C	uc001mqt.3	+	6	791	c.646A>C	c.(646-648)ACG>CCG	p.T216P	ANO3_uc010rdr.1_Missense_Mutation_p.T200P|ANO3_uc010rds.1_Missense_Mutation_p.T70P|ANO3_uc010rdt.1_Missense_Mutation_p.T70P	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	216	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TCCATGGGACACGCTGTGCAA	0.358													43	122	---	---	---	---	PASS
C11orf41	25758	broad.mit.edu	37	11	33667414	33667414	+	Silent	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33667414G>A	uc001mup.3	+	16	4843	c.4719G>A	c.(4717-4719)GCG>GCA	p.A1573A		NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	1567						integral to membrane				ovary(2)	2						TGGCATCCGCGGGCCACGCAG	0.677													21	32	---	---	---	---	PASS
OR4C13	283092	broad.mit.edu	37	11	49974139	49974139	+	Silent	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49974139C>A	uc010rhz.1	+	1	165	c.165C>A	c.(163-165)TCC>TCA	p.S55S		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	55	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						CACTGAGATCCCCCATGTACT	0.423													201	368	---	---	---	---	PASS
OR10AG1	282770	broad.mit.edu	37	11	55735597	55735597	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55735597C>A	uc010rit.1	-	1	343	c.343G>T	c.(343-345)GTG>TTG	p.V115L		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	115	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)					CAAATAGCCACGTAGCGGTCA	0.418													40	78	---	---	---	---	PASS
OR5J2	282775	broad.mit.edu	37	11	55944287	55944287	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55944287G>A	uc010rjb.1	+	1	194	c.194G>A	c.(193-195)TGT>TAT	p.C65Y		NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J,	65	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4	Esophageal squamous(21;0.00693)					TTACTCAGCTGTCTTTCATTT	0.443													65	301	---	---	---	---	PASS
OR5J2	282775	broad.mit.edu	37	11	55944701	55944701	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55944701C>A	uc010rjb.1	+	1	608	c.608C>A	c.(607-609)TCC>TAC	p.S203Y		NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J,	203	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4	Esophageal squamous(21;0.00693)					TTAACCTTCTCCGGAGTCATT	0.463													25	146	---	---	---	---	PASS
LRTOMT	220074	broad.mit.edu	37	11	71806464	71806464	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71806464C>T	uc001orr.2	+	6	855	c.477C>T	c.(475-477)TTC>TTT	p.F159F	LRTOMT_uc009ysz.2_RNA|LRTOMT_uc010rqt.1_3'UTR|LRTOMT_uc010rqu.1_Silent_p.F141F|LRTOMT_uc009yta.2_RNA|LRTOMT_uc010rqv.1_Intron|LRTOMT_uc010rqw.1_Intron|LRTOMT_uc001ors.3_Intron|LRTOMT_uc010rqs.1_Intron	NM_145309	NP_660352	Q96E66	LRC51_HUMAN	leucine rich transmembrane and	159	LRRCT.					cytoplasm					0						TCACCACGTTCGACTTCAGTG	0.567													9	62	---	---	---	---	PASS
FOLR1	2348	broad.mit.edu	37	11	71906931	71906931	+	Intron	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71906931C>T	uc001orz.1	+						FOLR1_uc001osa.1_Intron|FOLR1_uc001osb.1_Intron|FOLR1_uc001osc.1_Intron|FOLR1_uc001osd.1_Intron	NM_016724	NP_057936	P15328	FOLR1_HUMAN	folate receptor 1 precursor						cell death|folic acid transport|receptor-mediated endocytosis	anchored to membrane|extracellular region|integral to plasma membrane|membrane fraction	folic acid binding|receptor activity			ovary(1)	1						GTCTTCCCTCCTCTCTACAGG	0.522													64	96	---	---	---	---	PASS
CASP4	837	broad.mit.edu	37	11	104825645	104825645	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104825645C>G	uc001pid.1	-	2	164	c.91G>C	c.(91-93)GAA>CAA	p.E31Q	CASP4_uc001pib.1_5'UTR|CASP4_uc009yxg.1_5'UTR|CASP4_uc010rux.1_Missense_Mutation_p.E31Q|CASP4_uc010ruy.1_Missense_Mutation_p.E31Q	NM_001225	NP_001216	P49662	CASP4_HUMAN	caspase 4 isoform alpha precursor	31	CARD.				apoptosis|induction of apoptosis|proteolysis	intracellular	cysteine-type endopeptidase activity|protein binding			lung(2)|ovary(1)|skin(1)	4		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		ACATTTTGTTCCACCAAGTTA	0.398													26	202	---	---	---	---	PASS
ACAT1	38	broad.mit.edu	37	11	108010931	108010931	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108010931T>A	uc001pjy.2	+	7	795	c.719T>A	c.(718-720)GTT>GAT	p.V240D	ACAT1_uc001pjx.2_Missense_Mutation_p.V114D	NM_000019	NP_000010	P24752	THIL_HUMAN	acetyl-Coenzyme A acetyltransferase 1 precursor	240					acetoacetic acid biosynthetic process|branched chain family amino acid catabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	acetyl-CoA C-acetyltransferase activity|metal ion binding			ovary(3)	3		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	CCTGTCACAGTTACAGTAAAA	0.343													49	92	---	---	---	---	PASS
ABCG4	64137	broad.mit.edu	37	11	119029409	119029409	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119029409C>T	uc001pvs.2	+	11	1646	c.1310C>T	c.(1309-1311)GCC>GTC	p.A437V	ABCG4_uc009zar.2_Missense_Mutation_p.A437V	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN	ATP-binding cassette, subfamily G, member 4	437	Helical; Name=2; (Potential).|ABC transmembrane type-2.				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CTCATGTTCGCCGCCCTCATG	0.627													54	92	---	---	---	---	PASS
OR6T1	219874	broad.mit.edu	37	11	123814097	123814097	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123814097A>G	uc010sab.1	-	1	449	c.449T>C	c.(448-450)CTA>CCA	p.L150P		NM_001005187	NP_001005187	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T,	150	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GAATCCAGCTAGCCAGGAGGC	0.562													14	38	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7649613	7649613	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7649613C>G	uc001qsz.3	-	5	1023	c.895G>C	c.(895-897)GAT>CAT	p.D299H	CD163_uc001qta.3_Missense_Mutation_p.D299H|CD163_uc009zfw.2_Missense_Mutation_p.D299H	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	299	SRCR 3.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						ACAGCAGCATCGTAACTGTCC	0.502													22	103	---	---	---	---	PASS
LST-3TM12	338821	broad.mit.edu	37	12	21205156	21205156	+	Silent	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21205156A>G	uc010sin.1	+	9	1317	c.1317A>G	c.(1315-1317)CTA>CTG	p.L439L	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Silent_p.L486L	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	439						membrane	transporter activity				0						CACCTTGTCTAGCAGGATGCA	0.363													26	183	---	---	---	---	PASS
C12orf77	196415	broad.mit.edu	37	12	25147249	25147249	+	Silent	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25147249A>T	uc001rgf.2	-	4	625	c.420T>A	c.(418-420)GCT>GCA	p.A140A		NM_001101339	NP_001094809	C9JDV5	CL097_HUMAN	hypothetical protein LOC196415	140											0						AAATTGTCATAGCATGATGTA	0.343													7	18	---	---	---	---	PASS
MIP	4284	broad.mit.edu	37	12	56848169	56848169	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56848169C>A	uc001slh.2	-	1	261	c.229G>T	c.(229-231)GTG>TTG	p.V77L		NM_012064	NP_036196	P30301	MIP_HUMAN	major intrinsic protein of lens fiber	77					response to stimulus|visual perception	gap junction|integral to plasma membrane	structural constituent of eye lens			skin(1)	1						TGGGAGCCCACAAGGAAAGCA	0.602													22	99	---	---	---	---	PASS
NACA	4666	broad.mit.edu	37	12	57111991	57111991	+	Intron	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57111991G>A	uc001slz.2	-						NACA_uc001sly.2_Intron|NACA_uc009zoy.1_Missense_Mutation_p.A1108V|NACA_uc001smc.2_Intron|NACA_uc001sma.2_Intron|NACA_uc001smb.2_Intron|NACA_uc010squ.1_Intron	NM_001113201	NP_001106672	Q13765	NACA_HUMAN	nascent polypeptide-associated complex alpha						interspecies interaction between organisms|protein transport|transcription, DNA-dependent|translation	nascent polypeptide-associated complex|nucleus	DNA binding			ovary(1)	1						GGGAGGAGTTGCAGCTGGGGG	0.657			T	BCL6	NHL								54	90	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78400260	78400260	+	Silent	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78400260T>A	uc001syp.2	+	8	1115	c.942T>A	c.(940-942)ACT>ACA	p.T314T	NAV3_uc001syo.2_Silent_p.T314T	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	314						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CTCCCAGTACTGCTGGGCAGC	0.507										HNSCC(70;0.22)			16	76	---	---	---	---	PASS
CEP290	80184	broad.mit.edu	37	12	88502955	88502955	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88502955G>T	uc001tar.2	-	23	2715	c.2371C>A	c.(2371-2373)CTA>ATA	p.L791I	CEP290_uc001tat.2_Missense_Mutation_p.L584I	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa	791	Potential.				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						TTATTTTCTAGTTCCTGAAAA	0.249													3	14	---	---	---	---	PASS
PLXNC1	10154	broad.mit.edu	37	12	94613888	94613888	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94613888C>A	uc001tdc.2	+	6	1900	c.1651C>A	c.(1651-1653)CAG>AAG	p.Q551K		NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	551	Extracellular (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						GAATAAAAGTCAGCCCAACCG	0.448													89	178	---	---	---	---	PASS
AMDHD1	144193	broad.mit.edu	37	12	96359501	96359501	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96359501G>A	uc001tel.1	+	7	1082	c.976G>A	c.(976-978)GGA>AGA	p.G326R	AMDHD1_uc009zth.1_Missense_Mutation_p.G217R	NM_152435	NP_689648	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	326					histidine catabolic process to glutamate and formamide	cytosol	imidazolonepropionase activity|metal ion binding			central_nervous_system(1)	1						GTTAGATGAAGGAGTAATAGT	0.388													50	90	---	---	---	---	PASS
NUP37	79023	broad.mit.edu	37	12	102471234	102471234	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102471234C>A	uc001tjc.2	-	6	653	c.588G>T	c.(586-588)TTG>TTT	p.L196F	NUP37_uc009zub.1_Missense_Mutation_p.L196F	NM_024057	NP_076962	Q8NFH4	NUP37_HUMAN	nucleoporin 37kDa	196	WD 3.				carbohydrate metabolic process|cell division|chromosome segregation|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	protein binding			ovary(1)	1						CCTGTTGGGCCAAAAGATCAT	0.378													54	114	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112667515	112667515	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112667515C>T	uc009zwc.2	-	34	5258	c.5240G>A	c.(5239-5241)GGA>GAA	p.G1747E	C12orf51_uc001ttr.1_5'Flank	NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						AACCTCGGATCCTATCTTGAT	0.453													55	271	---	---	---	---	PASS
SRRM4	84530	broad.mit.edu	37	12	119563223	119563223	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119563223C>A	uc001txa.1	+	7	845	c.553C>A	c.(553-555)CAT>AAT	p.H185N		NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein	185	Ser-rich.				cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						CCGCCACCGCCATCACCGCTG	0.488													18	17	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120588997	120588997	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120588997C>T	uc001txo.2	-	34	4274	c.4261G>A	c.(4261-4263)GCA>ACA	p.A1421T		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	1421					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCAGTCAGTGCCGCCATCATC	0.612													4	78	---	---	---	---	PASS
CHFR	55743	broad.mit.edu	37	12	133424752	133424752	+	Intron	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133424752G>A	uc001ulf.2	-						CHFR_uc001ulc.1_RNA|CHFR_uc001ule.2_Intron|CHFR_uc010tbs.1_Intron|CHFR_uc001uld.2_Intron|CHFR_uc010tbt.1_Intron	NM_001161344	NP_001154816	Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains						cell division|mitosis|mitotic cell cycle checkpoint|modification-dependent protein catabolic process|protein polyubiquitination	PML body	nucleotide binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		CTGCCGAGATGAAGGGGCAAT	0.488													5	48	---	---	---	---	PASS
DIAPH3	81624	broad.mit.edu	37	13	60686259	60686259	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60686259T>G	uc001vht.2	-	3	494	c.275A>C	c.(274-276)AAC>ACC	p.N92T	DIAPH3_uc001vhw.1_Missense_Mutation_p.N81T|DIAPH3_uc010aed.1_Missense_Mutation_p.N81T|DIAPH3_uc010aee.1_Intron	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a	92					actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		AGTCTTCAGGTTGGGAAGTGG	0.433													137	285	---	---	---	---	PASS
PIBF1	10464	broad.mit.edu	37	13	73357625	73357625	+	Silent	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73357625A>G	uc001vjc.2	+	2	323	c.18A>G	c.(16-18)TCA>TCG	p.S6S	PIBF1_uc001vja.1_Silent_p.S6S|PIBF1_uc010aeo.1_RNA|PIBF1_uc001vjb.2_Silent_p.S6S|PIBF1_uc010aep.2_Intron|DIS3_uc001viy.3_5'Flank|DIS3_uc001vix.3_5'Flank|DIS3_uc001viz.2_5'Flank	NM_006346	NP_006337	Q8WXW3	PIBF1_HUMAN	progesterone-induced blocking factor 1	6						centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		GAAAAATTTCAAAGGAGTCAA	0.284													36	95	---	---	---	---	PASS
KLF12	11278	broad.mit.edu	37	13	74420351	74420351	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74420351C>G	uc001vjf.2	-	4	505	c.283G>C	c.(283-285)GCC>CCC	p.A95P	KLF12_uc010aeq.2_Missense_Mutation_p.A95P|KLF12_uc001vjg.3_Missense_Mutation_p.A95P	NM_007249	NP_009180	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12	95					negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		GATGAAACGGCAGTAGGGGAC	0.512													19	113	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	92380805	92380805	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92380805G>T	uc010tif.1	+	4	1406	c.1040G>T	c.(1039-1041)CGC>CTC	p.R347L		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	347						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				ATTTGTGGCCGCCCTGTAAGA	0.418													33	155	---	---	---	---	PASS
IPO5	3843	broad.mit.edu	37	13	98642449	98642449	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98642449G>T	uc001vnf.1	+	5	602	c.537G>T	c.(535-537)CAG>CAT	p.Q179H	IPO5_uc001vne.2_Missense_Mutation_p.Q197H|IPO5_uc010tik.1_Intron|IPO5_uc010til.1_Missense_Mutation_p.Q119H	NM_002271	NP_002262	O00410	IPO5_HUMAN	importin 5	179					interspecies interaction between organisms|NLS-bearing substrate import into nucleus|ribosomal protein import into nucleus	cytoplasm|nuclear pore|nucleolus	GTPase inhibitor activity|protein transporter activity|Ran GTPase binding			ovary(1)|lung(1)|skin(1)	3						TGTTAGTTCAGTGTATGCAAG	0.308													24	71	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101997647	101997647	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101997647C>A	uc001vox.1	-	7	958	c.769G>T	c.(769-771)GAG>TAG	p.E257*	NALCN_uc001voy.2_Intron|NALCN_uc001voz.2_Nonsense_Mutation_p.E257*|NALCN_uc001vpa.2_Nonsense_Mutation_p.E257*	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	257	Extracellular (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TAGCCCAGCTCTTGCCTGCTA	0.418													49	248	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101997649	101997649	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101997649T>G	uc001vox.1	-	7	956	c.767A>C	c.(766-768)CAA>CCA	p.Q256P	NALCN_uc001voy.2_Intron|NALCN_uc001voz.2_Missense_Mutation_p.Q256P|NALCN_uc001vpa.2_Missense_Mutation_p.Q256P	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	256	Extracellular (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GCCCAGCTCTTGCCTGCTAAG	0.428													49	247	---	---	---	---	PASS
TXNDC16	57544	broad.mit.edu	37	14	52899013	52899013	+	3'UTR	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52899013C>T	uc001wzs.2	-	21					TXNDC16_uc010tqu.1_3'UTR|TXNDC16_uc010aoe.2_RNA	NM_020784	NP_065835	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16 isoform 1						cell redox homeostasis	extracellular region					0	Breast(41;0.0716)					AAACCACAGCCCTATAAAATT	0.264													12	73	---	---	---	---	PASS
KIAA0586	9786	broad.mit.edu	37	14	59014620	59014620	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59014620C>A	uc001xdv.3	+	30	4662	c.4389C>A	c.(4387-4389)GAC>GAA	p.D1463E	KIAA0586_uc010trr.1_Missense_Mutation_p.H1609N|KIAA0586_uc001xdt.3_Missense_Mutation_p.D1495E|KIAA0586_uc001xdu.3_Missense_Mutation_p.D1524E|KIAA0586_uc010trs.1_Missense_Mutation_p.D1454E	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN	talpid3 protein	1463										ovary(1)	1						TGCAGGAGGACATGGAGTCTT	0.522													37	68	---	---	---	---	PASS
SMOC1	64093	broad.mit.edu	37	14	70420249	70420249	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70420249G>C	uc001xls.1	+	3	631	c.378G>C	c.(376-378)CAG>CAC	p.Q126H	SMOC1_uc001xlt.1_Missense_Mutation_p.Q126H	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN	secreted modular calcium-binding protein 1	126	Thyroglobulin type-1 1.				cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding			upper_aerodigestive_tract(1)|pancreas(1)	2				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		CCTTTACCCAGGTGAGGCCTC	0.622													37	56	---	---	---	---	PASS
FLRT2	23768	broad.mit.edu	37	14	86088872	86088872	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86088872G>T	uc001xvr.2	+	2	1781	c.1014G>T	c.(1012-1014)ATG>ATT	p.M338I	FLRT2_uc010atd.2_Missense_Mutation_p.M338I	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	338	Extracellular (Potential).|LRRCT.				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GGGGTTTCATGTGCCAAGGTC	0.507													126	182	---	---	---	---	PASS
CHGA	1113	broad.mit.edu	37	14	93397627	93397627	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93397627A>G	uc001ybc.3	+	6	648	c.388A>G	c.(388-390)ATG>GTG	p.M130V	CHGA_uc010aum.2_RNA|CHGA_uc001ybd.3_Intron	NM_001275	NP_001266	P10645	CMGA_HUMAN	chromogranin A precursor	130					regulation of blood pressure	extracellular region|stored secretory granule				skin(2)	2		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		CAAGGATGTTATGGAGAAAAG	0.612													17	16	---	---	---	---	PASS
TCL6	27004	broad.mit.edu	37	14	96137674	96137674	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96137674C>G	uc001yeq.2	+	7	1870	c.401C>G	c.(400-402)ACG>AGG	p.T134R	TCL6_uc001yep.1_RNA|TCL6_uc001yes.2_3'UTR|TCL6_uc001yet.1_Missense_Mutation_p.T76R|TCL6_uc001yeu.2_3'UTR|TCL6_uc001yev.2_3'UTR|TCL1B_uc001yew.2_RNA|TCL1B_uc001yex.2_RNA|TCL1B_uc010avj.2_RNA|TCL6_uc010avk.1_RNA	NM_020554	NP_065579			SubName: Full=T-cell leukemia/lymphoma 6 ORF163;												0		all_cancers(154;0.103)		Epithelial(152;0.0655)|all cancers(159;0.149)|BRCA - Breast invasive adenocarcinoma(234;0.206)|COAD - Colon adenocarcinoma(157;0.207)		ctagaaaggacgtggatgaag	0.000			T	TRA@	T-ALL								17	39	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102476340	102476340	+	Silent	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102476340G>T	uc001yks.2	+	30	6302	c.6138G>T	c.(6136-6138)CGG>CGT	p.R2046R		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	2046	AAA 1 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						AGCCCGACCGGCAGTTAATCG	0.522													51	80	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22368874	22368874	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22368874A>T	uc010tzu.1	+	1	299	c.299A>T	c.(298-300)CAG>CTG	p.Q100L	LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	100	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TGCATTGCACAGCTCTTCTTC	0.463													67	493	---	---	---	---	PASS
INO80	54617	broad.mit.edu	37	15	41289779	41289779	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41289779A>C	uc001zni.2	-	29	3731	c.3518T>G	c.(3517-3519)CTG>CGG	p.L1173R	INO80_uc010ucu.1_RNA	NM_017553	NP_060023	Q9ULG1	INO80_HUMAN	INO80 complex homolog 1	1173	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.|Helicase C-terminal.				cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4						TGTGCTTAACAGGAACACAAA	0.393													53	115	---	---	---	---	PASS
INO80	54617	broad.mit.edu	37	15	41352108	41352108	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41352108C>A	uc001zni.2	-	15	2012	c.1799G>T	c.(1798-1800)GGA>GTA	p.G600V	INO80_uc010ucu.1_RNA	NM_017553	NP_060023	Q9ULG1	INO80_HUMAN	INO80 complex homolog 1	600	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.|Helicase ATP-binding.				cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4						ATGAGGATTTCCCCAATATGG	0.328													52	161	---	---	---	---	PASS
PLA2G4D	283748	broad.mit.edu	37	15	42379860	42379860	+	Silent	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42379860G>T	uc001zox.2	-	2	179	c.84C>A	c.(82-84)GTC>GTA	p.V28V		NM_178034	NP_828848	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD	28	C2.				phospholipid catabolic process	cytoplasmic vesicle membrane|cytosol	metal ion binding|phospholipase A2 activity			large_intestine(1)|skin(1)	2		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		GCGCCTCCAGGACCCTCACTG	0.607													13	37	---	---	---	---	PASS
MAP1A	4130	broad.mit.edu	37	15	43819245	43819245	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43819245C>T	uc001zrt.2	+	4	6041	c.5574C>T	c.(5572-5574)TCC>TCT	p.S1858S		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1858						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CACCCCTCTCCCCAGCTCCTG	0.627													26	19	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48808562	48808562	+	Intron	SNP	A	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48808562A>C	uc001zwx.1	-							NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor						heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GAAATCCTCTAGAAAAACACA	0.413													43	87	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53809956	53809956	+	Intron	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53809956G>A	uc002acj.2	-						WDR72_uc010bfh.1_Intron	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		GCTCACCTAGGAAAAAAGCAG	0.403													35	256	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54860022	54860022	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54860022G>T	uc002ack.2	+	28	5983	c.5983G>T	c.(5983-5985)GGC>TGC	p.G1995C		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1995	MHD2.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AGGAGGAAATGGCCTGAAAAA	0.353													9	29	---	---	---	---	PASS
CSNK1G1	53944	broad.mit.edu	37	15	64551400	64551400	+	Silent	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64551400C>A	uc002anf.2	-	3	702	c.222G>T	c.(220-222)CTG>CTT	p.L74L	CSNK1G1_uc002ane.2_RNA|CSNK1G1_uc002ang.1_Silent_p.L74L|CSNK1G1_uc002anh.1_Silent_p.L74L|CSNK1G1_uc002anj.2_Silent_p.L47L|CSNK1G1_uc010uip.1_RNA	NM_022048	NP_071331	Q9HCP0	KC1G1_HUMAN	casein kinase 1, gamma 1	74	Protein kinase.				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity				0						TTCTACTCACCAGTTTGATTG	0.323													3	49	---	---	---	---	PASS
ITGA11	22801	broad.mit.edu	37	15	68631962	68631962	+	Silent	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68631962G>A	uc002ari.2	-	11	1239	c.1152C>T	c.(1150-1152)GCC>GCT	p.A384A	ITGA11_uc010bib.2_Silent_p.A384A	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor	384	FG-GAP 3.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	AGGCACCGACGGCTCCCAGCA	0.597													21	95	---	---	---	---	PASS
C15orf60	283677	broad.mit.edu	37	15	73843343	73843343	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73843343G>A	uc002avq.2	+	4	426	c.398G>A	c.(397-399)TGC>TAC	p.C133Y	C15orf60_uc010bjb.2_Missense_Mutation_p.C105Y	NM_001042367	NP_001035826	Q7Z4M0	CO060_HUMAN	hypothetical protein LOC283677	133										pancreas(1)	1						CTGGAACACTGCTGCAGTTGT	0.507													25	72	---	---	---	---	PASS
MAN2C1	4123	broad.mit.edu	37	15	75657002	75657002	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75657002T>A	uc002baf.2	-	5	444	c.427A>T	c.(427-429)ACT>TCT	p.T143S	MAN2C1_uc002bag.2_Missense_Mutation_p.T143S|MAN2C1_uc002bah.2_Missense_Mutation_p.T143S|MAN2C1_uc010bkk.2_Missense_Mutation_p.T143S|MAN2C1_uc010umi.1_Intron|MAN2C1_uc010umj.1_RNA|MAN2C1_uc010umk.1_RNA	NM_006715	NP_006706	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	143					mannose metabolic process		alpha-mannosidase activity|carbohydrate binding|protein binding|zinc ion binding				0						ACATAGAGAGTGAGGCTACAA	0.612													16	28	---	---	---	---	PASS
KIAA1199	57214	broad.mit.edu	37	15	81181824	81181824	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81181824C>T	uc002bfw.1	+	9	1237	c.977C>T	c.(976-978)ACG>ATG	p.T326M	KIAA1199_uc010unn.1_Missense_Mutation_p.T326M	NM_018689	NP_061159	Q8WUJ3	K1199_HUMAN	KIAA1199 precursor	326										upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						GTGGAGTGGACGGAGTGGTTC	0.483													32	94	---	---	---	---	PASS
HAPLN3	145864	broad.mit.edu	37	15	89424922	89424922	+	Silent	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89424922T>A	uc002bnc.2	-	3	287	c.159A>T	c.(157-159)ACA>ACT	p.T53T	HAPLN3_uc002bne.2_RNA|HAPLN3_uc002bnd.2_Silent_p.T115T	NM_178232	NP_839946	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	53	Ig-like V-type.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding				0	Lung NSC(78;0.0392)|all_lung(78;0.077)					TCTCCTCGGGTGTCTCCACCA	0.632													30	65	---	---	---	---	PASS
WDR24	84219	broad.mit.edu	37	16	737632	737632	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:737632C>T	uc002ciz.1	-	2	1349	c.589G>A	c.(589-591)GAC>AAC	p.D197N		NM_032259	NP_115635	Q96S15	WDR24_HUMAN	WD repeat domain 24	270										ovary(1)|central_nervous_system(1)	2		Hepatocellular(780;0.0218)				TCGCACCGGTCGGGACGCCGG	0.632													17	35	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2819035	2819035	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2819035C>T	uc002crk.2	+	12	8320	c.7771C>T	c.(7771-7773)CGA>TGA	p.R2591*		NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	2591	Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						GGAGGCTGTTCGAGAGGGACG	0.532													13	65	---	---	---	---	PASS
CLEC16A	23274	broad.mit.edu	37	16	11056455	11056455	+	Intron	SNP	T	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11056455T>C	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A											ovary(1)|central_nervous_system(1)	2						TGTAAGGACATTCCTTGGTAT	0.453													69	204	---	---	---	---	PASS
ZP2	7783	broad.mit.edu	37	16	21221421	21221421	+	Intron	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21221421G>T	uc002dii.2	-						ZP2_uc010bwn.1_Intron|ZP2_uc010bwo.2_Intron	NM_003460	NP_003451	Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 preproprotein						binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(48;0.0573)		GATAACACACGTTACCTACCC	0.507													51	104	---	---	---	---	PASS
ITGAM	3684	broad.mit.edu	37	16	31283176	31283176	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31283176G>T	uc002ebq.2	+	7	665	c.567G>T	c.(565-567)TTG>TTT	p.L189F	ITGAM_uc002ebr.2_Missense_Mutation_p.L189F	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	189	VWFA.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						AGTTCTCTTTGATGCAGTACT	0.517													18	51	---	---	---	---	PASS
CNGB1	1258	broad.mit.edu	37	16	57931765	57931765	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57931765C>T	uc002emt.2	-	30	3095	c.3030G>A	c.(3028-3030)TTG>TTA	p.L1010L	CNGB1_uc010cdh.2_Silent_p.L1004L	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform	1010	Cytoplasmic (Potential).|cAMP (By similarity).				sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						CAGGGCCGCCCAAGACCTGCA	0.552													26	211	---	---	---	---	PASS
WDR59	79726	broad.mit.edu	37	16	74950162	74950162	+	Intron	SNP	A	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74950162A>C	uc002fdh.1	-						WDR59_uc002fdi.2_Intron|WDR59_uc002fdj.2_Intron|WDR59_uc002fdg.1_5'Flank	NM_030581	NP_085058	Q6PJI9	WDR59_HUMAN	WD repeat domain 59											ovary(1)|breast(1)	2						ACAAAGCTGCAACAAAGGGTA	0.423													5	124	---	---	---	---	PASS
WFDC1	58189	broad.mit.edu	37	16	84353145	84353145	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84353145G>A	uc002fhw.2	+	4	707	c.530G>A	c.(529-531)CGT>CAT	p.R177H	WFDC1_uc002fhv.2_Missense_Mutation_p.R177H	NM_021197	NP_067020	Q9HC57	WFDC1_HUMAN	WAP four-disulfide core domain 1 precursor	177					negative regulation of cell growth	extracellular space	serine-type endopeptidase inhibitor activity			breast(1)	1						ATCCCCAACCGTGGGCAGTGC	0.662													11	52	---	---	---	---	PASS
CTU2	348180	broad.mit.edu	37	16	88779197	88779197	+	Silent	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88779197G>T	uc002flm.2	+	7	669	c.621G>T	c.(619-621)CCG>CCT	p.P207P	CTU2_uc002fln.2_Silent_p.P207P|CTU2_uc010chz.2_Silent_p.P278P|CTU2_uc010cia.2_Silent_p.P120P	NM_001012759	NP_001012777	Q2VPK5	CTU2_HUMAN	cytoplasmic tRNA 2-thiolation protein 2 isoform	207					tRNA thio-modification|tRNA wobble uridine modification	cytoplasm|protein complex|soluble fraction	protein binding			skin(1)	1						CCCAGCCCCCGCTGGACCCCC	0.667													7	10	---	---	---	---	PASS
WSCD1	23302	broad.mit.edu	37	17	5993784	5993784	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5993784C>T	uc010cli.2	+	4	1065	c.686C>T	c.(685-687)TCC>TTC	p.S229F	WSCD1_uc002gcn.2_Missense_Mutation_p.S229F|WSCD1_uc002gco.2_Missense_Mutation_p.S229F|WSCD1_uc010clj.2_5'UTR	NM_015253	NP_056068	Q658N2	WSCD1_HUMAN	WSC domain containing 1	229	WSC 1.					integral to membrane	sulfotransferase activity				0						GACCGGCTCTCCGTGTACCGT	0.657													26	41	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577138	7577138	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577138C>G	uc002gim.2	-	8	994	c.800G>C	c.(799-801)CGG>CCG	p.R267P	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R267P|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R135P|TP53_uc010cng.1_Missense_Mutation_p.R135P|TP53_uc002gii.1_Missense_Mutation_p.R135P|TP53_uc010cnh.1_Missense_Mutation_p.R267P|TP53_uc010cni.1_Missense_Mutation_p.R267P|TP53_uc002gij.2_Missense_Mutation_p.R267P	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	267	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> H (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R267W(20)|p.R267P(13)|p.0?(7)|p.R267Q(7)|p.R267R(5)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.R267fs*78(1)|p.N268fs*77(1)|p.L265_K305del41(1)|p.R267G(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.R267L(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AAAGCTGTTCCGTCCCAGTAG	0.527		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			15	31	---	---	---	---	PASS
RASD1	51655	broad.mit.edu	37	17	17398864	17398864	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17398864C>G	uc002gri.2	-	2	633	c.421G>C	c.(421-423)GTC>CTC	p.V141L		NM_016084	NP_057168	Q9Y272	RASD1_HUMAN	RAS, dexamethasone-induced 1 precursor	141					G-protein coupled receptor protein signaling pathway|small GTPase mediated signal transduction	nucleus|perinuclear region of cytoplasm|plasma membrane	GTP binding|GTPase activity				0						CCGCAGATGACCAGGGGCACG	0.632													9	24	---	---	---	---	PASS
ZNF830	91603	broad.mit.edu	37	17	33289390	33289390	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33289390C>T	uc002hih.3	+	1	842	c.805C>T	c.(805-807)CAG>TAG	p.Q269*	CCT6B_uc002hig.2_5'Flank|CCT6B_uc010ctg.2_5'Flank|CCT6B_uc010wcc.1_5'Flank	NM_052857	NP_443089	Q96NB3	ZN830_HUMAN	coiled-coil domain containing 16	269					cell division|mitosis	cytoplasm|nucleus	metal ion binding			breast(1)	1		Ovarian(249;0.17)				TCCAAAAGATCAGATGGACAA	0.493													38	87	---	---	---	---	PASS
AOC3	8639	broad.mit.edu	37	17	41008283	41008283	+	Intron	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41008283C>T	uc002ibv.2	+							NM_003734	NP_003725	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3 precursor						amine metabolic process|cell adhesion|inflammatory response	cell surface|integral to membrane|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|protein homodimerization activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	CTTTCTTCTCCCCTGCTAGGA	0.517													133	343	---	---	---	---	PASS
CA10	56934	broad.mit.edu	37	17	50008401	50008401	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50008401C>A	uc002itw.3	-	3	1214	c.228G>T	c.(226-228)ATG>ATT	p.M76I	CA10_uc002itv.3_Missense_Mutation_p.M82I|CA10_uc002itx.3_Missense_Mutation_p.M76I|CA10_uc002ity.3_Missense_Mutation_p.M76I|CA10_uc002itz.2_Missense_Mutation_p.M76I	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	76					brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			GGTCGAAGATCATGTGACTGG	0.498													107	262	---	---	---	---	PASS
EVPL	2125	broad.mit.edu	37	17	74007920	74007920	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74007920G>A	uc002jqi.2	-	20	2729	c.2501C>T	c.(2500-2502)CCC>CTC	p.P834L	EVPL_uc010wss.1_Missense_Mutation_p.P856L|EVPL_uc010wst.1_Missense_Mutation_p.P304L	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	834	Globular 1.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						TGCCAGGGTGGGCTCCAAAGA	0.642													17	42	---	---	---	---	PASS
MXRA7	439921	broad.mit.edu	37	17	74681210	74681210	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74681210C>T	uc002jsk.1	-	3	472	c.444G>A	c.(442-444)CTG>CTA	p.L148L	MXRA7_uc002jsl.2_Silent_p.L148L|MXRA7_uc002jsm.2_Silent_p.L148L	NM_001008528	NP_001008528	P84157	MXRA7_HUMAN	transmembrane anchor protein 1 isoform 1	148						integral to membrane					0						GGTTTCCCCTCAGCTTCCCGG	0.622													77	222	---	---	---	---	PASS
SEC14L1	6397	broad.mit.edu	37	17	75139682	75139682	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75139682G>T	uc002jto.2	+	3	271	c.4G>T	c.(4-6)GTG>TTG	p.V2L	SEC14L1_uc010dhc.2_Missense_Mutation_p.V2L|SEC14L1_uc010wth.1_Missense_Mutation_p.V2L|SEC14L1_uc002jtm.2_Missense_Mutation_p.V2L	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a	2	PRELI/MSF1.				transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						TGCAATCATGGTGCAGAAATA	0.363													32	89	---	---	---	---	PASS
SLC38A10	124565	broad.mit.edu	37	17	79226320	79226320	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79226320C>T	uc002jzz.1	-	13	1995	c.1620G>A	c.(1618-1620)CCG>CCA	p.P540P	SLC38A10_uc002jzy.1_Silent_p.P458P|SLC38A10_uc002kab.2_Silent_p.P540P	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10 isoform a	540					amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CGGGCAGAGGCGGCGCCATCT	0.622													27	118	---	---	---	---	PASS
HEXDC	284004	broad.mit.edu	37	17	80394540	80394540	+	Intron	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80394540C>A	uc002kew.2	+						HEXDC_uc002kev.3_Intron|HEXDC_uc010diq.2_Intron|HEXDC_uc010wvm.1_Intron|HEXDC_uc010wvn.1_5'Flank			Q8WVB3	HEXDC_HUMAN	SubName: Full=Hexosaminidase (Glycosyl hydrolase family 20, catalytic domain) containing, isoform CRA_c; SubName: Full=Hexosaminidase D;						carbohydrate metabolic process	cytoplasm|nucleus	beta-N-acetylhexosaminidase activity|cation binding			ovary(1)|skin(1)	2	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GCTCTGTCTGCAGCGTCCGGG	0.622													3	32	---	---	---	---	PASS
PIAS2	9063	broad.mit.edu	37	18	44470609	44470609	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44470609C>T	uc002lck.2	-	2	591	c.433G>A	c.(433-435)GAT>AAT	p.D145N	PIAS2_uc010dnp.2_5'UTR|PIAS2_uc002lcl.2_Missense_Mutation_p.D145N|PIAS2_uc010xda.1_Intron|PIAS2_uc002lcm.2_Missense_Mutation_p.D145N|PIAS2_uc002lcn.1_Missense_Mutation_p.D149N	NM_004671	NP_004662	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT X isoform	145	PINIT.				androgen receptor signaling pathway|negative regulation of androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck|PML body	androgen receptor binding|DNA binding|protein binding|SUMO ligase activity|transcription coactivator activity|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						AACTGCACATCAGGATGGACA	0.443													17	61	---	---	---	---	PASS
C18orf54	162681	broad.mit.edu	37	18	51904607	51904607	+	Silent	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51904607G>A	uc002lfn.3	+	8	1226	c.1110G>A	c.(1108-1110)CCG>CCA	p.P370P	C18orf54_uc002lfo.3_Silent_p.P531P	NM_173529	NP_775800	Q8IYD9	CR054_HUMAN	hypothetical protein LOC162681 precursor	370						extracellular region				ovary(1)|skin(1)	2				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)		AACGGTCACCGAAAATGTGAA	0.353													16	65	---	---	---	---	PASS
ONECUT2	9480	broad.mit.edu	37	18	55143879	55143879	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55143879G>A	uc002lgo.2	+	2	1471	c.1439G>A	c.(1438-1440)CGC>CAC	p.R480H		NM_004852	NP_004843	O95948	ONEC2_HUMAN	one cut domain, family member 2	480	Homeobox.				organ morphogenesis	nucleus	sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		GCCCGGCGCCGCAGCCTGGAG	0.582													18	40	---	---	---	---	PASS
CDH19	28513	broad.mit.edu	37	18	64197141	64197141	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64197141C>T	uc002lkc.1	-	9	1537	c.1399G>A	c.(1399-1401)GCT>ACT	p.A467T	CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_Missense_Mutation_p.A467T	NM_021153	NP_066976	Q9H159	CAD19_HUMAN	cadherin 19, type 2 preproprotein	467	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)				AACTCAGGAGCATGATCATTG	0.308													39	194	---	---	---	---	PASS
SBNO2	22904	broad.mit.edu	37	19	1111044	1111044	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1111044C>T	uc002lrk.3	-	25	3096	c.2858G>A	c.(2857-2859)CGG>CAG	p.R953Q	SBNO2_uc002lri.3_5'Flank|SBNO2_uc002lrj.3_Missense_Mutation_p.R896Q|SBNO2_uc010dse.2_Missense_Mutation_p.R936Q|SBNO2_uc010xgj.1_Intron	NM_014963	NP_055778	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 isoform 1	953					macrophage activation involved in immune response|negative regulation of transcription, DNA-dependent|regulation of inflammatory response|transcription, DNA-dependent						0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAGCCATTCCGGGACTCCCG	0.662													4	8	---	---	---	---	PASS
CSNK1G2	1455	broad.mit.edu	37	19	1978856	1978856	+	Splice_Site	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1978856A>T	uc002lul.3	+	7	971	c.448_splice	c.e7-2	p.I150_splice	CSNK1G2_uc010dsu.2_Splice_Site_p.I102_splice	NM_001319	NP_001310	P78368	KC1G2_HUMAN	casein kinase 1, gamma 2						sphingolipid metabolic process|Wnt receptor signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity			stomach(1)	1		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCCCCTGCAGATCACGCGC	0.423													19	36	---	---	---	---	PASS
KDM4B	23030	broad.mit.edu	37	19	5131486	5131486	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5131486G>T	uc002mbq.3	+	12	1941	c.1715G>T	c.(1714-1716)GGG>GTG	p.G572V	KDM4B_uc010xim.1_Missense_Mutation_p.G606V|KDM4B_uc002mbr.3_Missense_Mutation_p.G330V	NM_015015	NP_055830	O94953	KDM4B_HUMAN	jumonji domain containing 2B	572					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1						GAGCTGACGGGGCCAGAGGAC	0.512													24	34	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9048195	9048195	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9048195G>T	uc002mkp.2	-	5	33640	c.33436C>A	c.(33436-33438)CCT>ACT	p.P11146T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11148	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGTACCTCAGGTGAAACAGTT	0.458													22	73	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9066587	9066587	+	Silent	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9066587C>A	uc002mkp.2	-	3	21063	c.20859G>T	c.(20857-20859)CTG>CTT	p.L6953L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6955	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGGTCTCTCTCAGTCCAGGAG	0.458													102	239	---	---	---	---	PASS
CASP14	23581	broad.mit.edu	37	19	15166251	15166251	+	Silent	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15166251C>A	uc010dzv.1	+	6	839	c.531C>A	c.(529-531)GCC>GCA	p.A177A	CASP14_uc002naf.2_Silent_p.A177A	NM_012114	NP_036246	P31944	CASPE_HUMAN	caspase 14 precursor	177					apoptosis|cell differentiation|epidermis development|proteolysis	cytoplasm|nucleus	cysteine-type endopeptidase activity			skin(2)|ovary(1)|lung(1)	4						GATACATCGCCTACCGACATG	0.532													38	93	---	---	---	---	PASS
ZNF98	148198	broad.mit.edu	37	19	22586297	22586297	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22586297C>A	uc002nqt.2	-	2	170	c.48G>T	c.(46-48)AGG>AGT	p.R16S		NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98	16	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				AGGCCACATCCCTAAATGTCA	0.393													47	123	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23544756	23544756	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23544756C>A	uc002nre.2	-	4	1138	c.1025G>T	c.(1024-1026)AGA>ATA	p.R342I	ZNF91_uc010xrj.1_Missense_Mutation_p.R310I	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	342	C2H2-type 7.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				AGTATGAATTCTCTTATGTTT	0.373													8	229	---	---	---	---	PASS
HPN	3249	broad.mit.edu	37	19	35556848	35556848	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35556848G>T	uc002nxq.1	+	13	1372	c.1127G>T	c.(1126-1128)AGT>ATT	p.S376I	HPN_uc002nxr.1_Missense_Mutation_p.S376I|HPN_uc002nxs.1_Missense_Mutation_p.S218I|HPN_uc010xsh.1_Missense_Mutation_p.S345I|HPN_uc002nxt.1_Missense_Mutation_p.S260I|LOC100128675_uc010xsi.1_Intron	NM_002151	NP_002142	P05981	HEPS_HUMAN	hepsin	376	Extracellular (Potential).|Peptidase S1.				cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	GGCATTGTGAGTTGGGGCACT	0.612													57	160	---	---	---	---	PASS
ACTN4	81	broad.mit.edu	37	19	39214345	39214345	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39214345C>G	uc002oja.1	+	13	1593	c.1534C>G	c.(1534-1536)CGC>GGC	p.R512G	ACTN4_uc002ojb.1_5'Flank	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4	512	Spectrin 2.				platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GACACATAGTCGCAGGGAAGC	0.632													9	27	---	---	---	---	PASS
CEACAM21	90273	broad.mit.edu	37	19	42082643	42082643	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42082643C>T	uc002ore.3	+	1	113	c.17C>T	c.(16-18)GCT>GTT	p.A6V	CEACAM21_uc002orc.1_Intron|CEACAM21_uc002ord.1_Intron|CEACAM21_uc002orf.2_RNA|CEACAM21_uc002org.3_Missense_Mutation_p.A6V	NM_001098506	NP_001091976	Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion	6						integral to membrane				ovary(1)	1						CCCCCCTCAGCTTGTCCCCAC	0.627													7	45	---	---	---	---	PASS
ERF	2077	broad.mit.edu	37	19	42752782	42752782	+	Silent	SNP	G	A	A	rs138540323		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42752782G>A	uc002ote.3	-	4	1640	c.1482C>T	c.(1480-1482)CTC>CTT	p.L494L	ERF_uc002otd.3_Silent_p.L225L	NM_006494	NP_006485	P50548	ERF_HUMAN	Ets2 repressor factor	494					cell proliferation|regulation of transcription from RNA polymerase II promoter	nucleus	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			lung(1)|kidney(1)|central_nervous_system(1)|skin(1)	4		Prostate(69;0.00682)				CACCCCCTTCGAGGCGACAGT	0.692													38	95	---	---	---	---	PASS
ZC3H4	23211	broad.mit.edu	37	19	47570607	47570607	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47570607A>T	uc002pga.3	-	15	2956	c.2918T>A	c.(2917-2919)TTC>TAC	p.F973Y	ZC3H4_uc002pgb.1_Intron	NM_015168	NP_055983	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	973							nucleic acid binding|zinc ion binding			skin(4)|ovary(2)	6		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		GGTGCGGGCGAAGCTGGGCTT	0.682													59	189	---	---	---	---	PASS
DHX34	9704	broad.mit.edu	37	19	47870255	47870255	+	Silent	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47870255G>T	uc010xyn.1	+	7	1952	c.1611G>T	c.(1609-1611)GTG>GTT	p.V537V	DHX34_uc010elc.1_Silent_p.V452V	NM_014681	NP_055496	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	537						intracellular	ATP binding|ATP-dependent helicase activity|RNA binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		GCATGAGTGTGGGGGACCCCC	0.592													15	60	---	---	---	---	PASS
CEACAM18	729767	broad.mit.edu	37	19	51986552	51986552	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51986552T>G	uc002pwv.1	+	5	1138	c.1138T>G	c.(1138-1140)TGC>GGC	p.C380G		NM_001080405	NP_001073874	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion	380						integral to membrane				skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CCCCCATGAGTGCAGCAGCTC	0.612													18	46	---	---	---	---	PASS
ZNF616	90317	broad.mit.edu	37	19	52618417	52618417	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52618417C>A	uc002pym.2	-	4	2283	c.2000G>T	c.(1999-2001)GGC>GTC	p.G667V	ZNF616_uc002pyn.2_RNA	NM_178523	NP_848618	Q08AN1	ZN616_HUMAN	zinc finger protein 616	667	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		AAAGGTTTTGCCACACTCATT	0.403													75	310	---	---	---	---	PASS
LENG9	94059	broad.mit.edu	37	19	54973315	54973315	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54973315C>T	uc010yez.1	-	1	1580	c.1461G>A	c.(1459-1461)AGG>AGA	p.R487R		NM_198988	NP_945339	Q96B70	LENG9_HUMAN	leukocyte receptor cluster (LRC) member 9	487					RNA metabolic process	intracellular	catalytic activity|nucleic acid binding|zinc ion binding				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.134)		GCCCCCCTGTCCTCCCTATAC	0.627													48	105	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56490903	56490903	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56490903G>A	uc002qmh.2	+	9	3091	c.3020G>A	c.(3019-3021)AGC>AAC	p.S1007N	NLRP8_uc010etg.2_Missense_Mutation_p.S988N	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	1007	LRR 6.					cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GCCTTCTCAAGCCAAAAGAAG	0.468													64	147	---	---	---	---	PASS
ZNF582	147948	broad.mit.edu	37	19	56895310	56895310	+	Silent	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56895310G>A	uc002qmz.1	-	5	1635	c.1476C>T	c.(1474-1476)TAC>TAT	p.Y492Y	ZNF582_uc002qmy.2_Silent_p.Y523Y	NM_144690	NP_653291	Q96NG8	ZN582_HUMAN	zinc finger protein 582	492					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|large_intestine(1)	4		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		TTAGTAAGGGGTAACTGCTGA	0.388													112	279	---	---	---	---	PASS
ZNF17	7565	broad.mit.edu	37	19	57932022	57932022	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57932022T>A	uc002qoo.1	+	3	1393	c.1162T>A	c.(1162-1164)TGC>AGC	p.C388S	ZNF547_uc002qpm.3_Intron|ZNF17_uc002qop.1_Missense_Mutation_p.C390S	NM_006959	NP_008890	P17021	ZNF17_HUMAN	zinc finger protein 17	388	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		ACCTTATGAATGCAACGAATG	0.393													62	173	---	---	---	---	PASS
ZNF8	7554	broad.mit.edu	37	19	58806661	58806661	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58806661A>T	uc002qry.1	+	4	1617	c.1487A>T	c.(1486-1488)CAT>CTT	p.H496L	ZNF8_uc002qrz.2_RNA	NM_021089	NP_066575	P17098	ZNF8_HUMAN	zinc finger protein 8	496					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		GAGCAGCCCCATGGGCGAAGC	0.552													95	291	---	---	---	---	PASS
DEFB127	140850	broad.mit.edu	37	20	139602	139602	+	Silent	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:139602G>T	uc002wcy.1	+	2	237	c.237G>T	c.(235-237)CTG>CTT	p.L79L		NM_139074	NP_620713	Q9H1M4	DB127_HUMAN	defensin, beta 127 preproprotein	79					defense response to bacterium|innate immune response	extracellular region					0		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			CACTTGCACTGACTCTTCAAG	0.373													37	95	---	---	---	---	PASS
C20orf46	55321	broad.mit.edu	37	20	1161519	1161519	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1161519C>A	uc010gaa.1	-	3	963	c.744G>T	c.(742-744)GAG>GAT	p.E248D	C20orf46_uc002weq.1_Missense_Mutation_p.E248D	NM_018354	NP_060824	Q9NUR3	CT046_HUMAN	hypothetical protein LOC55321	248						integral to membrane	protein binding			ovary(1)	1						TGTGGCTAGTCTCTGAGACCT	0.582													32	45	---	---	---	---	PASS
TGM6	343641	broad.mit.edu	37	20	2375159	2375159	+	Silent	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2375159G>A	uc002wfy.1	+	2	130	c.69G>A	c.(67-69)CAG>CAA	p.Q23Q	TGM6_uc010gal.1_Silent_p.Q23Q	NM_198994	NP_945345	O95932	TGM3L_HUMAN	transglutaminase 6	23					cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(3)|skin(1)	4					L-Glutamine(DB00130)	ACCACACCCAGGAGTACCCCT	0.642													10	44	---	---	---	---	PASS
ASXL1	171023	broad.mit.edu	37	20	31022550	31022550	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31022550G>T	uc002wxs.2	+	12	2461	c.2035G>T	c.(2035-2037)GGA>TGA	p.G679*	ASXL1_uc010geb.2_Nonsense_Mutation_p.G570*	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	679	Gly-rich.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						TGAGCCCAGGGGAGGCCCGAG	0.647			F|N|Mis		MDS|CMML								6	23	---	---	---	---	PASS
DLGAP4	22839	broad.mit.edu	37	20	35154325	35154325	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35154325C>T	uc002xff.2	+	12	3102	c.2667C>T	c.(2665-2667)ATC>ATT	p.I889I	DLGAP4_uc010zvp.1_Silent_p.I889I|DLGAP4_uc002xfg.2_Silent_p.I185I|DLGAP4_uc002xfh.2_Silent_p.I353I|DLGAP4_uc002xfi.2_Silent_p.I198I|DLGAP4_uc002xfj.2_Silent_p.I185I|uc002xfk.3_Intron	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a	892					cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				AGCTGTCCATCGAGGATATCA	0.602													48	142	---	---	---	---	PASS
KCNK15	60598	broad.mit.edu	37	20	43378866	43378866	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43378866G>T	uc002xmr.2	+	2	444	c.380G>T	c.(379-381)AGC>ATC	p.S127I		NM_022358	NP_071753	Q9H427	KCNKF_HUMAN	potassium family, subfamily K, member 15	127	Helical; (Potential).					integral to membrane	potassium channel activity|voltage-gated ion channel activity				0		Myeloproliferative disorder(115;0.0122)				ACTTTCCAGAGCCTGGGCGAA	0.672													4	25	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47266696	47266696	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47266696G>A	uc002xtw.1	-	24	2889	c.2866C>T	c.(2866-2868)CCC>TCC	p.P956S	PREX1_uc002xtv.1_Missense_Mutation_p.P253S	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	956					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GGCTCCAGGGGGGCTTGTTTG	0.592													57	159	---	---	---	---	PASS
CTSZ	1522	broad.mit.edu	37	20	57581398	57581398	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57581398C>T	uc002yai.2	-	2	412	c.286G>A	c.(286-288)GCC>ACC	p.A96T	CTSZ_uc002yaj.3_Missense_Mutation_p.A96T	NM_001336	NP_001327	Q9UBR2	CATZ_HUMAN	cathepsin Z preproprotein	96					proteolysis	endoplasmic reticulum|extracellular space|lysosome	cysteine-type endopeptidase activity			kidney(1)	1	all_lung(29;0.00711)		Colorectal(105;0.109)			CTGGTGCTGGCGTGGGCCCAG	0.647													6	16	---	---	---	---	PASS
KCNQ2	3785	broad.mit.edu	37	20	62076601	62076601	+	Silent	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62076601G>A	uc002yey.1	-	3	681	c.504C>T	c.(502-504)TTC>TTT	p.F168F	KCNQ2_uc002yez.1_Silent_p.F168F|KCNQ2_uc002yfa.1_Silent_p.F168F|KCNQ2_uc002yfb.1_Silent_p.F168F|KCNQ2_uc011aax.1_Silent_p.F168F|KCNQ2_uc002yfc.1_Silent_p.F168F	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein	168	Helical; Name=Segment S3; (Potential).				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	CAATCACACAGAACGGTTTCC	0.657													27	45	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22746235	22746235	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22746235A>T	uc002yld.1	+	9	1346	c.1097A>T	c.(1096-1098)CAT>CTT	p.H366L	NCAM2_uc011acb.1_Missense_Mutation_p.H224L|NCAM2_uc011acc.1_Missense_Mutation_p.H391L	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	366	Ig-like C2-type 4.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TCATCACTGCATATTAAAGAT	0.428													59	145	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22804459	22804459	+	Silent	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22804459C>A	uc002yld.1	+	12	1761	c.1512C>A	c.(1510-1512)ATC>ATA	p.I504I	NCAM2_uc011acb.1_Silent_p.I362I	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	504	Fibronectin type-III 1.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GAGTGAAGATCATAGAGCTGT	0.448													39	98	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22910194	22910194	+	Silent	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22910194G>A	uc002yld.1	+	18	2679	c.2430G>A	c.(2428-2430)GGG>GGA	p.G810G	NCAM2_uc011acb.1_Silent_p.G668G	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	810	Cytoplasmic (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		AAGAAGATGGGAAAGAAGCTC	0.323													7	141	---	---	---	---	PASS
PRDM15	63977	broad.mit.edu	37	21	43248563	43248563	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43248563C>A	uc002yzq.1	-	19	2702	c.2591G>T	c.(2590-2592)CGC>CTC	p.R864L	PRDM15_uc002yzo.2_Missense_Mutation_p.R535L|PRDM15_uc002yzp.2_Missense_Mutation_p.R555L|PRDM15_uc002yzr.1_Missense_Mutation_p.R555L	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	864	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GACGTCCTTGCGGTAGAACAT	0.612													115	255	---	---	---	---	PASS
KRTAP10-10	353333	broad.mit.edu	37	21	46057812	46057812	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46057812G>T	uc002zfq.2	+	1	540	c.478G>T	c.(478-480)GTG>TTG	p.V160L	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_181688	NP_859016	P60014	KR10A_HUMAN	keratin associated protein 10-10	160	15 X 5 AA repeats of C-C-X(3).					keratin filament					0						CTATGTGCCTGTGTGCTCTGG	0.627													111	291	---	---	---	---	PASS
COL18A1	80781	broad.mit.edu	37	21	46932158	46932158	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46932158G>A	uc011afs.1	+	42	5123	c.5102G>A	c.(5101-5103)AGC>AAC	p.S1701N	COL18A1_uc002zhg.2_Missense_Mutation_p.S1286N|COL18A1_uc002zhi.2_Missense_Mutation_p.S1466N|SLC19A1_uc010gpy.1_Intron|COL18A1_uc002zhj.2_Missense_Mutation_p.S267N|COL18A1_uc002zhk.2_Missense_Mutation_p.S111N	NM_130444	NP_569711	P39060	COIA1_HUMAN	alpha 1 type XVIII collagen isoform 3 precursor	1704	Nonhelical region 11 (NC11).				cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CTGACCGAGAGCTACTGTGAG	0.701													7	5	---	---	---	---	PASS
GSC2	2928	broad.mit.edu	37	22	19136551	19136551	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19136551C>A	uc011ags.1	-	3	571	c.571G>T	c.(571-573)GCG>TCG	p.A191S		NM_005315	NP_005306	O15499	GSC2_HUMAN	goosecoid homeobox 2	191					anatomical structure morphogenesis|regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Colorectal(54;0.0993)					AGGAGCCTCGCGGAAGCCGAC	0.652													3	11	---	---	---	---	PASS
GNB1L	54584	broad.mit.edu	37	22	19799846	19799846	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19799846G>A	uc002zqe.1	-	4	773	c.379C>T	c.(379-381)CGC>TGC	p.R127C	GNB1L_uc002zqd.1_Translation_Start_Site|GNB1L_uc002zqf.1_Missense_Mutation_p.R127C	NM_053004	NP_443730	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein	127					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	internal side of plasma membrane|intracellular				breast(1)	1	Colorectal(54;0.0993)					AGCGTCCAGCGTGGCTGGCCC	0.662													3	30	---	---	---	---	PASS
HIC2	23119	broad.mit.edu	37	22	21800819	21800819	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21800819C>T	uc002zur.3	+	3	1865	c.1635C>T	c.(1633-1635)CGC>CGT	p.R545R	HIC2_uc002zus.3_Silent_p.R545R	NM_015094	NP_055909	Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	545	C2H2-type 3.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	focal adhesion|nucleus	DNA binding|protein C-terminus binding|zinc ion binding			skin(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				TCACGCAGCGCGGCACCATGA	0.637													11	61	---	---	---	---	PASS
TUBGCP6	85378	broad.mit.edu	37	22	50665440	50665440	+	Silent	SNP	G	A	A	rs145215576		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50665440G>A	uc003bkb.1	-	6	1991	c.1479C>T	c.(1477-1479)GCC>GCT	p.A493A	TUBGCP6_uc010har.1_Silent_p.A493A|TUBGCP6_uc010has.1_RNA|TUBGCP6_uc010hat.1_5'Flank|TUBGCP6_uc003bkd.1_5'Flank	NM_020461	NP_065194	Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	493					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			ovary(2)|central_nervous_system(2)	4		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TGGGAAACGCGGCCCTGGGGC	0.687													5	9	---	---	---	---	PASS
GYG2	8908	broad.mit.edu	37	X	2773036	2773036	+	Silent	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2773036G>T	uc004cqs.1	+	6	702	c.420G>T	c.(418-420)GTG>GTT	p.V140V	GYG2_uc004cqt.1_Silent_p.V109V|GYG2_uc004cqu.1_Silent_p.V109V|GYG2_uc004cqv.1_5'UTR|GYG2_uc004cqw.1_Silent_p.V100V|GYG2_uc004cqx.1_Silent_p.V109V|GYG2_uc010ndc.1_5'UTR	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b	140					glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TTCACCAGGTGCTGTCCAATG	0.438													39	19	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	29959823	29959823	+	Silent	SNP	T	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29959823T>G	uc004dby.2	+	9	1621	c.1113T>G	c.(1111-1113)CTT>CTG	p.L371L		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	371	Helical; (Potential).				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						TCTTGCTGCTTGTATGTTTGG	0.413													128	129	---	---	---	---	PASS
NAP1L3	4675	broad.mit.edu	37	X	92927259	92927259	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92927259T>G	uc004efq.2	-	1	1350	c.1045A>C	c.(1045-1047)AAA>CAA	p.K349Q	FAM133A_uc004efr.1_5'Flank	NM_004538	NP_004529	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	349					nucleosome assembly	chromatin assembly complex				ovary(1)|skin(1)	2						TGGCCAGGTTTTGAGAACTTC	0.403													38	38	---	---	---	---	PASS
GLUD2	2747	broad.mit.edu	37	X	120181718	120181718	+	Silent	SNP	C	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:120181718C>A	uc004eto.2	+	1	257	c.180C>A	c.(178-180)CGC>CGA	p.R60R		NM_012084	NP_036216	P49448	DHE4_HUMAN	glutamate dehydrogenase 2 precursor	60					glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding			pancreas(1)	1					L-Glutamic Acid(DB00142)|NADH(DB00157)	TGGCCGACCGCGAGGACGACC	0.692													23	19	---	---	---	---	PASS
DCAF12L2	340578	broad.mit.edu	37	X	125298951	125298951	+	Silent	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125298951G>T	uc004euk.1	-	1	984	c.957C>A	c.(955-957)TCC>TCA	p.S319S		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	319										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						CAGCGTACAGGGACAACTCAT	0.622													47	59	---	---	---	---	PASS
DCAF12L2	340578	broad.mit.edu	37	X	125298952	125298952	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125298952G>T	uc004euk.1	-	1	983	c.956C>A	c.(955-957)TCC>TAC	p.S319Y		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	319										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						AGCGTACAGGGACAACTCATC	0.617													46	61	---	---	---	---	PASS
CTAG2	30848	broad.mit.edu	37	X	153880852	153880852	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153880852A>C	uc004fmi.1	-	2	376	c.323T>G	c.(322-324)ATC>AGC	p.I108S	CTAG2_uc004fmh.1_Missense_Mutation_p.I108S	NM_020994	NP_066274	O75638	CTAG2_HUMAN	cancer/testis antigen 2 isoform LAGE-1b	108						centrosome				pancreas(1)	1	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCGGGACAGGATCCTGCGGAC	0.617													14	20	---	---	---	---	PASS
CTAG2	30848	broad.mit.edu	37	X	153880861	153880861	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153880861A>G	uc004fmi.1	-	2	367	c.314T>C	c.(313-315)GTC>GCC	p.V105A	CTAG2_uc004fmh.1_Missense_Mutation_p.V105A	NM_020994	NP_066274	O75638	CTAG2_HUMAN	cancer/testis antigen 2 isoform LAGE-1b	105						centrosome				pancreas(1)	1	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GATCCTGCGGACCAGCTCCGC	0.612													8	21	---	---	---	---	PASS
CTAG2	30848	broad.mit.edu	37	X	153880869	153880869	+	Silent	SNP	C	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153880869C>T	uc004fmi.1	-	2	359	c.306G>A	c.(304-306)GCG>GCA	p.A102A	CTAG2_uc004fmh.1_Silent_p.A102A	NM_020994	NP_066274	O75638	CTAG2_HUMAN	cancer/testis antigen 2 isoform LAGE-1b	102						centrosome				pancreas(1)	1	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGACCAGCTCCGCTTCCATGG	0.612													10	16	---	---	---	---	PASS
C1orf59	113802	broad.mit.edu	37	1	109198471	109198472	+	Intron	DEL	AC	-	-	rs71651954		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109198471_109198472delAC	uc001dvt.3	-						C1orf59_uc001dvu.3_Intron|C1orf59_uc009wer.2_Intron	NM_001102592	NP_001096062	Q5T8I9	HENMT_HUMAN	hypothetical protein LOC113802						gene silencing by RNA|piRNA metabolic process	P granule	metal ion binding|O-methyltransferase activity|RNA binding|RNA methyltransferase activity				0		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0152)|Lung(183;0.0895)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.163)		AGAAGATGCTacacacacacac	0.233													5	3	---	---	---	---	
PAPPA2	60676	broad.mit.edu	37	1	176760310	176760322	+	Intron	DEL	TTTTTTTTTTTTT	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176760310_176760322delTTTTTTTTTTTTT	uc001gkz.2	+						PAPPA2_uc009www.2_Intron	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1						cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						AAGCAAAGAAttttttttttttttttttttttt	0.291													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	189767957	189767973	+	IGR	DEL	AAAGAAAAGAAAGAAAG	-	-	rs71131209		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189767957_189767973delAAAGAAAAGAAAGAAAG								None (None upstream) : FAM5C (298824 downstream)																							aaggaaggaaaaagaaaagaaagaaagggaaggaagg	0.000													4	2	---	---	---	---	
PCNXL2	80003	broad.mit.edu	37	1	233431666	233431669	+	5'Flank	DEL	CTCT	-	-	rs12407520		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233431666_233431669delCTCT	uc001hvl.2	-							NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				tcctccctccctctctctctcttt	0.137													5	3	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237617599	237617600	+	Intron	DEL	GA	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237617599_237617600delGA	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTGATGTAGGGAGAGAGATTAA	0.361													21	12	---	---	---	---	
DNMT3A	1788	broad.mit.edu	37	2	25470586	25470587	+	Frame_Shift_Ins	INS	-	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25470586_25470587insA	uc002rgc.2	-	8	1144_1145	c.887_888insT	c.(886-888)GTGfs	p.V296fs	DNMT3A_uc002rgd.2_Frame_Shift_Ins_p.V296fs|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Frame_Shift_Ins_p.V107fs	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	296	Interaction with DNMT1 and DNMT3B.|PWWP.				regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTTCCCCCACACCAGCTCCCC	0.649			Mis|F|N|S		AML								77	34	---	---	---	---	
PLB1	151056	broad.mit.edu	37	2	28773037	28773038	+	Intron	INS	-	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28773037_28773038insT	uc002rmb.1	+						PLB1_uc010ezj.1_Intron|PLB1_uc002rmc.2_Intron	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					CTTCCACGTGGttttttttttt	0.223													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64893259	64893259	+	IGR	DEL	A	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64893259delA								SERTAD2 (12213 upstream) : SLC1A4 (322320 downstream)																							AACTTAAAATAAAAAAAAAAA	0.269													6	3	---	---	---	---	
REG3G	130120	broad.mit.edu	37	2	79254423	79254423	+	Intron	DEL	A	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79254423delA	uc002snw.2	+						REG3G_uc002snx.2_Intron|REG3G_uc010ffu.2_Intron	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma precursor						acute-phase response	extracellular region	sugar binding				0						TCTGGGGGACATTTGGGAGAA	0.488													29	13	---	---	---	---	
LYG2	254773	broad.mit.edu	37	2	99862076	99862076	+	Intron	DEL	A	-	-	rs144842726		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99862076delA	uc002szw.1	-						MRPL30_uc002szl.1_Intron|LYG2_uc010fip.1_Intron|LYG2_uc002szx.1_Intron	NM_175735	NP_783862	Q86SG7	LYG2_HUMAN	lysozyme G-like 2 precursor						cell wall macromolecule catabolic process|peptidoglycan catabolic process	extracellular region	lysozyme activity			ovary(1)	1						atctctaattaaaaaaaaaaa	0.104													4	2	---	---	---	---	
GALNT5	11227	broad.mit.edu	37	2	158165415	158165416	+	Intron	INS	-	T	T	rs140945706	by1000genomes	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158165415_158165416insT	uc002tzg.2	+						GALNT5_uc010zci.1_Intron	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5						glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						TTGACAAGTCCtttttttttta	0.307													3	7	---	---	---	---	
PDE11A	50940	broad.mit.edu	37	2	178539990	178539991	+	Intron	INS	-	AA	AA	rs79495616		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178539990_178539991insAA	uc002ulq.2	-						PDE11A_uc010zfd.1_Intron|PDE11A_uc002ulp.2_Intron|PDE11A_uc002ulr.2_Intron|PDE11A_uc002uls.1_Intron|PDE11A_uc002ult.1_Intron|PDE11A_uc002ulu.1_Intron	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			GAAAGCACGATAAAAAAAAAAA	0.337									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				3	3	---	---	---	---	
PDCD6IP	10015	broad.mit.edu	37	3	33868211	33868211	+	Intron	DEL	T	-	-	rs35254856		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33868211delT	uc003cfx.2	+						PDCD6IP_uc011axv.1_3'UTR|PDCD6IP_uc003cfy.2_Intron|PDCD6IP_uc011axw.1_5'Flank	NM_013374	NP_037506	Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein						apoptosis|cell cycle|cell division|interspecies interaction between organisms|protein transport	cytosol|melanosome|microtubule organizing center	calcium-dependent protein binding			ovary(1)|skin(1)	2						GTAGAAATAGttttttttttt	0.249													5	3	---	---	---	---	
FHIT	2272	broad.mit.edu	37	3	60349497	60349498	+	Intron	INS	-	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60349497_60349498insT	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		cccccctggcccccctggcttc	0.000			T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				4	2	---	---	---	---	
EPHA3	2042	broad.mit.edu	37	3	89445256	89445256	+	Intron	DEL	T	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89445256delT	uc003dqy.2	+						EPHA3_uc003dqx.1_Intron|EPHA3_uc010hon.1_Intron	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CTTTGATTTATTGGTAGAGGA	0.408										TSP Lung(6;0.00050)			22	12	---	---	---	---	
TM4SF18	116441	broad.mit.edu	37	3	149042947	149042947	+	Intron	DEL	A	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149042947delA	uc003exa.2	-							NM_138786	NP_620141	Q96CE8	T4S18_HUMAN	transmembrane 4 L six family member 18							integral to membrane				ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ACATAGAAATAAAAAAAAAAG	0.313													4	2	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149374544	149374551	+	Intron	DEL	TCTCTCTT	-	-	rs10665547		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374544_149374551delTCTCTCTT	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron|uc010hvg.1_5'Flank|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ACGCACCAtctctctctttctctctctc	0.365													8	4	---	---	---	---	
CCDC39	339829	broad.mit.edu	37	3	180349039	180349040	+	Intron	INS	-	TATAGAATG	TATAGAATG	rs138343088	by1000genomes	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180349039_180349040insTATAGAATG	uc010hxe.2	-						CCDC39_uc003fkn.2_Intron	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GACTAGAGGTATATAGAATGAA	0.391													8	8	---	---	---	---	
POLR2H	5437	broad.mit.edu	37	3	184084317	184084317	+	Intron	DEL	G	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184084317delG	uc003fok.1	+						POLR2H_uc003foj.1_Intron	NM_006232	NP_006223	P52434	RPAB3_HUMAN	RNA polymerase II, polypeptide H						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase I transcription|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex|nucleolus	DNA-directed RNA polymerase activity|protein binding|zinc ion binding				0	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			tagtagagatggggtttcact	0.000													7	4	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194791015	194791015	+	Intron	DEL	C	-	-	rs74504494		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194791015delC	uc003fum.3	-						C3orf21_uc003ful.2_Intron|C3orf21_uc003fuk.2_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		gggctctggaccccaagcctc	0.184													2	4	---	---	---	---	
NSUN7	79730	broad.mit.edu	37	4	40810141	40810142	+	Intron	INS	-	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40810141_40810142insT	uc003gvj.3	+						NSUN7_uc003gvi.3_Intron	NM_024677	NP_078953			NOL1/NOP2/Sun domain family, member 7												0						TTTTTTGTTTGTTTTTTTAAAA	0.248													6	5	---	---	---	---	
RUFY3	22902	broad.mit.edu	37	4	71588132	71588132	+	5'UTR	DEL	T	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71588132delT	uc003hfq.2	+	1					RUFY3_uc003hfp.3_Intron|RUFY3_uc011cax.1_5'UTR|RUFY3_uc003hfr.2_5'UTR	NM_014961	NP_055776	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3 isoform 2						negative regulation of axonogenesis	filopodium|growth cone					0		all_hematologic(202;0.248)	Lung(101;0.235)			GTATTTTTCCTTTTTTTTTTT	0.323													5	3	---	---	---	---	
MTTP	4547	broad.mit.edu	37	4	100495824	100495824	+	Intron	DEL	A	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100495824delA	uc003hvc.3	+						MTTP_uc011cej.1_Intron|MTTP_uc003hvb.2_5'Flank	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large						lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	TCATTGGGTGAAAAAAATTAA	0.373													3	3	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	32000586	32000597	+	Intron	DEL	TTTGTTTTTGTT	-	-	rs71863988		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32000586_32000597delTTTGTTTTTGTT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CCTTAAGAAGtttgtttttgtttttgtttttg	0.222													5	3	---	---	---	---	
C7	730	broad.mit.edu	37	5	40972367	40972368	+	Intron	INS	-	AACAGTG	AACAGTG			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40972367_40972368insAACAGTG	uc003jmh.2	+						C7_uc011cpn.1_Intron	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor						complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				CAGTCCACCCTAACAGTGAACT	0.436													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44716765	44716766	+	IGR	INS	-	GAAG	GAAG	rs144322268	by1000genomes	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44716765_44716766insGAAG								FGF10 (327981 upstream) : MRPS30 (92261 downstream)																							gaaggaagcaagaaggaaggaa	0.000													4	4	---	---	---	---	
GPR98	84059	broad.mit.edu	37	5	89947720	89947720	+	Intron	DEL	A	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89947720delA	uc003kju.2	+						GPR98_uc003kjt.2_Intron	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ACTTATCTTCAAAAAAAAAAA	0.328													3	3	---	---	---	---	
KHDRBS2	202559	broad.mit.edu	37	6	62407271	62407271	+	Intron	DEL	A	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62407271delA	uc003peg.2	-							NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		CAGGAACTTCAAGGCATAAAA	0.328													19	11	---	---	---	---	
SLC26A4	5172	broad.mit.edu	37	7	107315731	107315731	+	Intron	DEL	A	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107315731delA	uc003vep.2	+							NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin						regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7						ctcatctcttaaaaaaaaaaa	0.000									Pendred_syndrome				10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155907140	155907140	+	IGR	DEL	A	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155907140delA								SHH (302173 upstream) : C7orf4 (426045 downstream)																							gaggaagattaaaaaaaaaaa	0.005													5	3	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110539000	110539000	+	Intron	DEL	T	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110539000delT	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ACTATGATGCTTTTTTTTTCC	0.323										HNSCC(38;0.096)			4	2	---	---	---	---	
VPS13A	23230	broad.mit.edu	37	9	79954410	79954410	+	Intron	DEL	G	-	-	rs55937672	by1000genomes	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79954410delG	uc004akr.2	+						VPS13A_uc004akp.3_Intron|VPS13A_uc004akq.3_Intron|VPS13A_uc004aks.2_Intron	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						attttgttttgtttttttttt	0.299													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	81731532	81731533	+	IGR	INS	-	AC	AC	rs149190461	by1000genomes	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81731532_81731533insAC								PSAT1 (786525 upstream) : TLE4 (455345 downstream)																							cacacacacagacacacacaca	0.257													3	4	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140610912	140610913	+	Intron	INS	-	GG	GG	rs112796338		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140610912_140610913insGG	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		ggtgtcatggtgggggaggaag	0.000													4	4	---	---	---	---	
ANKRD1	27063	broad.mit.edu	37	10	92676188	92676189	+	Intron	DEL	TG	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92676188_92676189delTG	uc001khe.1	-							NM_014391	NP_055206	Q15327	ANKR1_HUMAN	cardiac ankyrin repeat protein						cellular lipid metabolic process|defense response|signal transduction		DNA binding				0		Colorectal(252;0.0475)				CTAAATTACAtgtgtgtgtgtg	0.248													5	3	---	---	---	---	
TRPM5	29850	broad.mit.edu	37	11	2428308	2428337	+	Intron	DEL	CTCGGCCTCACCCAGGTGCTCCCGCTTGTG	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2428308_2428337delCTCGGCCTCACCCAGGTGCTCCCGCTTGTG	uc001lwm.3	-						TRPM5_uc010qxl.1_Intron|TRPM5_uc009ydn.2_Intron	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,							integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		GACCCGCCACCTCGGCCTCACCCAGGTGCTCCCGCTTGTGCTCGGCCTCA	0.696													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13779097	13779097	+	IGR	DEL	A	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13779097delA								FAR1 (25206 upstream) : SPON1 (204817 downstream)																							TCAATTAGAGAAGCTCCTTGA	0.358													4	2	---	---	---	---	
ARFGAP2	84364	broad.mit.edu	37	11	47189416	47189417	+	Intron	INS	-	A	A	rs34204386		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47189416_47189417insA	uc001ndt.2	-						ARFGAP2_uc010rha.1_Intron|ARFGAP2_uc010rhb.1_Intron|ARFGAP2_uc001ndu.2_Intron|ARFGAP2_uc010rhc.1_Intron	NM_032389	NP_115765	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating						protein transport|regulation of ARF GTPase activity|vesicle-mediated transport	Golgi membrane|nucleolus|plasma membrane	ARF GTPase activator activity|zinc ion binding			ovary(1)	1						TCAGCTTGTTTaaaaaaaaaaa	0.243													8	7	---	---	---	---	
PDE2A	5138	broad.mit.edu	37	11	72307501	72307508	+	Intron	DEL	ATCTCTCT	-	-	rs145397044		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72307501_72307508delATCTCTCT	uc010rrc.1	-						PDE2A_uc001oso.2_Intron|PDE2A_uc010rra.1_Intron|PDE2A_uc001osn.2_Intron|PDE2A_uc010rrb.1_Intron|PDE2A_uc010rrd.1_Intron	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	TATGGCTCCCAtctctctctctctctct	0.447													4	2	---	---	---	---	
FDXACB1	91893	broad.mit.edu	37	11	111745485	111745485	+	3'UTR	DEL	A	-	-	rs76503924		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111745485delA	uc001pmc.3	-	5					ALG9_uc010rwo.1_Intron|FDXACB1_uc009yyi.2_3'UTR	NM_138378	NP_612387	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain						phenylalanyl-tRNA aminoacylation|tRNA processing		ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0						actccgtctcaaaaaaaaaaa	0.144													3	3	---	---	---	---	
SORL1	6653	broad.mit.edu	37	11	121475640	121475640	+	Intron	DEL	T	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121475640delT	uc001pxx.2	+						SORL1_uc010rzp.1_Intron|SORL1_uc010rzq.1_Intron	NM_003105	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor containing LDLR class						cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity			ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		AAGATGTAACTTTTTTTtttt	0.169													3	3	---	---	---	---	
PZP	5858	broad.mit.edu	37	12	9313876	9313877	+	Intron	INS	-	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9313876_9313877insA	uc001qvl.2	-						PZP_uc009zgl.2_Intron|PZP_uc010sgo.1_Intron|PZP_uc009zgm.1_Intron	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						aaaacacatgtaaaacattcag	0.040													8	6	---	---	---	---	
LRMP	4033	broad.mit.edu	37	12	25245808	25245809	+	Intron	DEL	TC	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25245808_25245809delTC	uc001rgh.2	+						LRMP_uc010sja.1_Intron|LRMP_uc010sjb.1_Intron|LRMP_uc001rgi.2_Intron|LRMP_uc010sjc.1_Intron|LRMP_uc010sjd.1_Intron	NM_006152	NP_006143	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein						vesicle fusion|vesicle targeting	endoplasmic reticulum membrane|integral to plasma membrane				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					GGAAGACTGTTCTCTCCTTAAG	0.376													4	4	---	---	---	---	
EPYC	1833	broad.mit.edu	37	12	91395966	91395967	+	Intron	INS	-	AAAAA	AAAAA	rs72227749		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91395966_91395967insAAAAA	uc001tbk.2	-							NM_004950	NP_004941	Q99645	EPYC_HUMAN	dermatan sulfate proteoglycan 3 precursor						female pregnancy	proteinaceous extracellular matrix	glycosaminoglycan binding			skin(1)	1						gacactgtctcaaaaaaaaaaa	0.129													4	3	---	---	---	---	
NCOR2	9612	broad.mit.edu	37	12	124868080	124868080	+	Intron	DEL	A	-	-	rs148277001		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124868080delA	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CTTCCAACTCAAAAAAAAAAA	0.488													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	51441577	51441580	+	IGR	DEL	CTTC	-	-	rs71742306		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51441577_51441580delCTTC								DLEU7 (23692 upstream) : RNASEH2B (42312 downstream)																							ttctttctttcttccttccttcct	0.034													4	2	---	---	---	---	
DHRS4	10901	broad.mit.edu	37	14	24473479	24473479	+	Intron	DEL	A	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24473479delA	uc001wlc.3	+						DHRS4L2_uc001wld.3_Intron|DHRS4L2_uc001wle.3_Intron|DHRS4L2_uc001wlg.3_Intron|DHRS4L2_uc001wlh.3_Intron|DHRS4L2_uc010tnt.1_Intron|DHRS4L2_uc001wli.3_Intron|DHRS4L2_uc010alb.2_Intron	NM_021004	NP_066284	Q9BTZ2	DHRS4_HUMAN	peroxisomal short-chain alcohol dehydrogenase							mitochondrion|nuclear membrane|peroxisome	binding|carbonyl reductase (NADPH) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	ctccgtctctaaaaaaaaaaa	0.134													6	3	---	---	---	---	
PSME1	5720	broad.mit.edu	37	14	24605456	24605457	+	5'UTR	INS	-	C	C	rs143873682	by1000genomes	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24605456_24605457insC	uc001wmg.2	+	1					PSME1_uc001wmh.2_5'UTR	NM_006263	NP_006254	Q06323	PSME1_HUMAN	proteasome activator subunit 1 isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|proteasome activator complex				ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00831)		GCGGCGCTAGGCCCCCCGTCCC	0.708													6	4	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106993634	106993634	+	Intron	DEL	C	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106993634delC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						TGGAGAAGTTCCCTGGGGAAA	0.458													15	7	---	---	---	---	
WDR72	256764	broad.mit.edu	37	15	53906143	53906144	+	Intron	INS	-	TTAT	TTAT	rs138717914	by1000genomes	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53906143_53906144insTTAT	uc002acj.2	-							NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		CACCTAAAATCTTATTTATTTA	0.307													7	4	---	---	---	---	
SLC28A1	9154	broad.mit.edu	37	15	85443186	85443187	+	Intron	INS	-	GAAGGAAGGAAG	GAAGGAAGGAAG			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85443186_85443187insGAAGGAAGGAAG	uc002blg.2	+						SLC28A1_uc010upd.1_Intron|SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			aaggaaggaaggaaggaaggaa	0.025													5	3	---	---	---	---	
NR2F2	7026	broad.mit.edu	37	15	96881051	96881051	+	3'UTR	DEL	A	-	-	rs140647786		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96881051delA	uc010uri.1	+	3					NR2F2_uc002btp.2_3'UTR|NR2F2_uc010urj.1_3'UTR|NR2F2_uc010urk.1_3'UTR	NM_021005	NP_066285	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2						lipid metabolic process|negative regulation of cyclin-dependent protein kinase activity|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment	nucleus	ligand-regulated transcription factor activity|protein homodimerization activity|retinoic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(1)	3	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			AGAATGCATTAAAAAAAAAAA	0.269													3	3	---	---	---	---	
SHISA9	729993	broad.mit.edu	37	16	13267235	13267236	+	Intron	DEL	AC	-	-	rs66910345		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13267235_13267236delAC	uc010uyy.1	+							NM_001145204	NP_001138676	B4DS77	SHSA9_HUMAN	shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0						GTGTGCATGTacacacacacac	0.183													3	3	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700252	14700252	+	Intron	DEL	G	-	-	rs62037478		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700252delG	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						aagaccctgagggaaaaaaaa	0.139													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	28617930	28617931	+	Intron	INS	-	G	G	rs143299878	by1000genomes	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28617930_28617931insG	uc010vct.1	-						SULT1A1_uc002dqi.2_Intron|SULT1A1_uc002dqj.2_Intron|SULT1A1_uc002dqk.2_Intron|SULT1A1_uc002dql.2_Intron|SULT1A1_uc002dqm.2_Intron|SULT1A1_uc002dqn.2_Intron|SULT1A1_uc002dqo.2_Intron|SULT1A1_uc002dqp.2_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		AGGTGGGGCCTTAGTGGGGAGG	0.653													3	3	---	---	---	---	
MYH10	4628	broad.mit.edu	37	17	8395949	8395950	+	Intron	INS	-	T	T			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8395949_8395950insT	uc002gll.2	-						MYH10_uc002glm.2_Intron|MYH10_uc010cnx.2_Intron	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle						actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						cttgtatttccttttttttttt	0.262													11	5	---	---	---	---	
MED13	9969	broad.mit.edu	37	17	60070140	60070141	+	Intron	INS	-	T	T	rs138009503	by1000genomes	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60070140_60070141insT	uc002izo.2	-							NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						cttattattacttttttttgag	0.000													3	3	---	---	---	---	
C17orf99	100141515	broad.mit.edu	37	17	76154380	76154381	+	Intron	INS	-	A	A	rs113477288		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76154380_76154381insA	uc002jus.3	+						C17orf99_uc010wts.1_5'Flank	NM_001163075	NP_001156547	Q6UX52	CQ099_HUMAN	hypothetical protein LOC100141515 precursor							extracellular region					0						TCCTCCTACACAtttttttttt	0.342													8	4	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78674255	78674257	+	Intron	DEL	TGG	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78674255_78674257delTGG	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						gtggtggtgatggtggtggtggt	0.000													4	2	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3742949	3742950	+	Intron	INS	-	CTTC	CTTC	rs143048862	by1000genomes	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3742949_3742950insCTTC	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron|DLGAP1_uc002kmk.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				TATCAATTTATcttccttcctt	0.223													4	2	---	---	---	---	
PIGN	23556	broad.mit.edu	37	18	59712910	59712911	+	3'UTR	INS	-	A	A	rs145916087	by1000genomes	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59712910_59712911insA	uc002lii.3	-	32					PIGN_uc002lij.3_3'UTR	NM_176787	NP_789744	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5		Colorectal(73;0.187)				GCAAAACCTAGAAAAAAAAAGA	0.366													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	65042306	65042307	+	IGR	INS	-	T	T	rs75002100		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65042306_65042307insT								CDH19 (771090 upstream) : DSEL (131512 downstream)																							tgtcttcttcattttttttttt	0.183													4	2	---	---	---	---	
VAV1	7409	broad.mit.edu	37	19	6856887	6856888	+	Intron	DEL	GT	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6856887_6856888delGT	uc002mfu.1	+						VAV1_uc010xjh.1_Intron|VAV1_uc010dva.1_Intron|VAV1_uc002mfv.1_Intron	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						gaggtaatgggtgtgtgtgtgt	0.000													5	3	---	---	---	---	
LGALS14	56891	broad.mit.edu	37	19	40196817	40196817	+	Intron	DEL	C	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40196817delC	uc002omg.2	+						LGALS14_uc002omf.2_Intron	NM_020129	NP_064514	Q8TCE9	PPL13_HUMAN	lectin, galactoside-binding, soluble, 14 isoform							nucleus	sugar binding			ovary(1)|skin(1)	2	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)			CAGGAGGACTCCCCTGTTCTG	0.274													4	3	---	---	---	---	
SEPW1	6415	broad.mit.edu	37	19	48284025	48284026	+	Intron	INS	-	G	G	rs141714572	by1000genomes	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48284025_48284026insG	uc010xyw.1	+						SEPW1_uc002pho.1_5'Flank	NM_003009	NP_003000	P63302	SELW_HUMAN	selenoprotein W, 1						cell redox homeostasis	cytoplasm	selenium binding				0		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		all cancers(93;0.000291)|OV - Ovarian serous cystadenocarcinoma(262;0.000305)|Epithelial(262;0.0146)|GBM - Glioblastoma multiforme(486;0.0273)		AGTGGATGCCCGGGGGGCATTC	0.594													7	5	---	---	---	---	
NUCB1	4924	broad.mit.edu	37	19	49416101	49416101	+	Intron	DEL	A	-	-	rs72240043		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49416101delA	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		actccctctcaaaaaaaaaaa	0.249													4	2	---	---	---	---	
NOP56	10528	broad.mit.edu	37	20	2633326	2633331	+	Intron	DEL	GGGCGC	-	-	rs28970277	byFrequency	TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2633326_2633331delGGGCGC	uc002wgh.2	+						NOP56_uc010zpy.1_Intron|MIR1292_hsa-mir-1292|MI0006433_5'Flank|NOP56_uc002wgi.2_5'Flank|SNORD110_uc002wgj.2_5'Flank|SNORA51_uc002wgk.1_5'Flank|NOP56_uc002wgm.1_5'Flank	NM_006392	NP_006383	O00567	NOP56_HUMAN	nucleolar protein 5A						rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding			ovary(1)|pancreas(1)	2						AGTGGTTGCGGGGCGCGGGCGACGCG	0.573													6	4	---	---	---	---	
SPTLC3	55304	broad.mit.edu	37	20	13140592	13140592	+	Intron	DEL	A	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13140592delA	uc002wod.1	+							NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base						sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)	TTGTCAGGATAATTTTGTCTT	0.269													117	53	---	---	---	---	
C21orf99	149992	broad.mit.edu	37	21	14423994	14423994	+	Intron	DEL	A	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14423994delA	uc002yiy.3	+						C21orf99_uc002yja.3_Intron					Homo sapiens C21orf99 protein (C21orf99) mRNA, complete cds.												0						aaaaaaaaGGAGAAAACAAAA	0.179													4	2	---	---	---	---	
DGCR5	26220	broad.mit.edu	37	22	18976301	18976324	+	Intron	DEL	TATTTATTTATTTATTTATTTATT	-	-	rs111433751		TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18976301_18976324delTATTTATTTATTTATTTATTTATT	uc002zom.1	+						DGCR5_uc002zon.1_Intron	NR_002733				Homo sapiens mRNA for KIAA1647 protein, partial cds.												0						TGGCTGGACAtatttatttatttatttatttatttatttattta	0.219													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	42720077	42720079	+	IGR	DEL	TGG	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42720077_42720079delTGG								TCF20 (108632 upstream) : NFAM1 (56336 downstream)																							atggaggttatggtggtggtggt	0.000													4	2	---	---	---	---	
DMD	1756	broad.mit.edu	37	X	32456493	32456494	+	Frame_Shift_Ins	INS	-	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32456493_32456494insA	uc004dda.1	-	29	4179_4180	c.3935_3936insT	c.(3934-3936)TTGfs	p.L1312fs	DMD_uc004dcz.2_Frame_Shift_Ins_p.L1189fs|DMD_uc004dcy.1_Frame_Shift_Ins_p.L1308fs|DMD_uc004ddb.1_Frame_Shift_Ins_p.L1304fs|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1312	Spectrin 9.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AATGTCGCATCAAATTTTCAAG	0.361													46	69	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53587474	53587474	+	Intron	DEL	C	-	-			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53587474delC	uc004dsp.2	-						HUWE1_uc004dsn.2_Intron	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						CTTCCTCACACGGAAACCTGA	0.289													0	11	---	---	---	---	
OCRL	4952	broad.mit.edu	37	X	128695431	128695432	+	Intron	INS	-	A	A			TCGA-66-2770-01	TCGA-66-2770-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128695431_128695432insA	uc004euq.2	+						OCRL_uc004eur.2_Intron	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						TTATTTCCTAGAAAAAAAAATC	0.292													4	2	---	---	---	---	
