Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CCDC27	148870	broad.mit.edu	37	1	3669114	3669114	+	Silent	SNP	C	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3669114C>A	uc001akv.2	+	1	150	c.69C>A	c.(67-69)GGC>GGA	p.G23G		NM_152492	NP_689705	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	23										skin(1)	1	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		AAAAGCCGGGCCTGTCCTCAT	0.572													45	66	---	---	---	---	PASS
CTRC	11330	broad.mit.edu	37	1	15769956	15769956	+	Silent	SNP	G	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15769956G>C	uc001awi.1	+	5	422	c.399G>C	c.(397-399)CTG>CTC	p.L133L	CTRC_uc001awj.1_Silent_p.L133L	NM_007272	NP_009203	Q99895	CTRC_HUMAN	chymotrypsin C preproprotein	133	Peptidase S1.				proteolysis		serine-type endopeptidase activity				0		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATGTGGAGCTGAGTGACACCA	0.607													38	361	---	---	---	---	PASS
EPHA8	2046	broad.mit.edu	37	1	22922656	22922656	+	Silent	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22922656G>A	uc001bfx.1	+	9	1880	c.1755G>A	c.(1753-1755)CAG>CAA	p.Q585Q		NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	585	Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TGCACTATCAGAATGGACAGG	0.657													12	41	---	---	---	---	PASS
HCRTR1	3061	broad.mit.edu	37	1	32089117	32089117	+	Intron	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32089117T>C	uc009vtx.2	+						HCRTR1_uc001btb.2_Intron|HCRTR1_uc001btc.3_Intron|HCRTR1_uc001btd.2_Intron|HCRTR1_uc010ogl.1_Intron	NM_001525	NP_001516	O43613	OX1R_HUMAN	orexin receptor 1						feeding behavior|neuropeptide signaling pathway|synaptic transmission	integral to plasma membrane				ovary(1)	1		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		CTATGTGTGCTGGACAGATCC	0.657													5	29	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34076646	34076646	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34076646T>C	uc001bxn.1	-	41	6247	c.6218A>G	c.(6217-6219)TAT>TGT	p.Y2073C	CSMD2_uc001bxm.1_Missense_Mutation_p.Y2113C|CSMD2_uc001bxo.1_Missense_Mutation_p.Y986C	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2073	CUB 12.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CTTACCCTGATACTCCAGCTT	0.572													5	29	---	---	---	---	PASS
PPAP2B	8613	broad.mit.edu	37	1	56989495	56989495	+	Silent	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56989495C>G	uc001cyj.1	-	5	1134	c.633G>C	c.(631-633)GTG>GTC	p.V211V		NM_177414	NP_803133	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B	211	Helical; (Potential).				canonical Wnt receptor signaling pathway involved in positive regulation of cell-cell adhesion|canonical Wnt receptor signaling pathway involved in positive regulation of endothelial cell migration|canonical Wnt receptor signaling pathway involved in positive regulation of wound healing|germ cell migration|homotypic cell-cell adhesion|negative regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|sphingolipid metabolic process	adherens junction|Golgi apparatus|integral to membrane	phosphatidate phosphatase activity|phosphoprotein phosphatase activity|protein binding|sphingosine-1-phosphate phosphatase activity				0						GGGTACTTACCACCAAATACA	0.488													16	59	---	---	---	---	PASS
ST6GALNAC3	256435	broad.mit.edu	37	1	76878011	76878011	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76878011G>T	uc001dhh.2	+	3	695	c.532G>T	c.(532-534)GGT>TGT	p.G178C	ST6GALNAC3_uc001dhg.3_Missense_Mutation_p.G178C|ST6GALNAC3_uc010orh.1_Missense_Mutation_p.G113C	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1	178	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						AAAGACAGTTGGTATCTATCC	0.423													46	177	---	---	---	---	PASS
USP33	23032	broad.mit.edu	37	1	78177450	78177450	+	Silent	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78177450T>C	uc001dht.2	-	22	2828	c.2481A>G	c.(2479-2481)GAA>GAG	p.E827E	USP33_uc001dhs.2_Silent_p.E548E|USP33_uc001dhu.2_Silent_p.E796E|USP33_uc001dhv.2_Silent_p.E632E|USP33_uc001dhw.2_Silent_p.E819E	NM_015017	NP_055832	Q8TEY7	UBP33_HUMAN	ubiquitin specific protease 33 isoform 1	827	DUSP 2.				axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(2)|ovary(1)	3						AAATTTCCAATTCAGTTTTTC	0.328													23	112	---	---	---	---	PASS
KCNC4	3749	broad.mit.edu	37	1	110765579	110765579	+	Intron	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110765579C>G	uc001dzh.2	+						KCNC4_uc001dzf.2_Intron|KCNC4_uc009wfr.2_Intron|KCNC4_uc001dzg.2_Intron|KCNC4_uc001dzi.2_Intron	NM_004978	NP_004969	Q03721	KCNC4_HUMAN	Shaw-related voltage-gated potassium channel						synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		TCCTCCCCTGCCCATAGGTAG	0.572													15	52	---	---	---	---	PASS
SYCP1	6847	broad.mit.edu	37	1	115428935	115428935	+	Intron	SNP	A	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115428935A>T	uc001efr.2	+						SYCP1_uc010owt.1_Intron|SYCP1_uc001efq.2_Intron|SYCP1_uc009wgw.2_Intron	NM_003176	NP_003167	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1						cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAAAGGtaaaatatttatta	0.294													23	109	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118550722	118550722	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118550722C>A	uc001ehk.2	-	31	4600	c.4532G>T	c.(4531-4533)TGT>TTT	p.C1511F		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1511						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		AAAGGTGGCACAGCAGCTACT	0.512													20	107	---	---	---	---	PASS
POGZ	23126	broad.mit.edu	37	1	151378546	151378546	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151378546T>A	uc001eyd.1	-	19	3271	c.2965A>T	c.(2965-2967)ACA>TCA	p.T989S	POGZ_uc001eye.1_Missense_Mutation_p.T936S|POGZ_uc010pdb.1_Missense_Mutation_p.T980S|POGZ_uc001eyf.1_Missense_Mutation_p.T945S|POGZ_uc010pdc.1_Missense_Mutation_p.T927S|POGZ_uc009wmv.1_Missense_Mutation_p.T894S|POGZ_uc010pdd.1_Missense_Mutation_p.T480S	NM_015100	NP_055915	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	989					cell division|kinetochore assembly|mitotic sister chromatid cohesion|regulation of transcription, DNA-dependent	cytoplasm|nuclear chromatin	DNA binding|protein binding|zinc ion binding			ovary(3)	3	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GCCTGTTCTGTATTGCAGCAT	0.522													12	79	---	---	---	---	PASS
C1orf77	26097	broad.mit.edu	37	1	153610803	153610803	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153610803C>T	uc001fcm.1	+	3	410	c.98C>T	c.(97-99)ACG>ATG	p.T33M	C1orf77_uc001fcn.1_Missense_Mutation_p.T33M|C1orf77_uc001fco.1_Missense_Mutation_p.T8M|C1orf77_uc009woi.1_Missense_Mutation_p.T33M|C1orf77_uc009woj.1_Missense_Mutation_p.T33M	NM_015607	NP_056422	Q9Y3Y2	CHTOP_HUMAN	small protein rich in arginine and glycine	33					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	protein binding|RNA binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAACAGCCGACGCCAGTGAAT	0.428													14	144	---	---	---	---	PASS
CD1C	911	broad.mit.edu	37	1	158259855	158259855	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158259855A>C	uc001fru.2	+	1	293	c.1A>C	c.(1-3)ATG>CTG	p.M1L	CD1C_uc001frv.2_5'Flank	NM_001765	NP_001756	P29017	CD1C_HUMAN	CD1C antigen precursor	1					antigen processing and presentation|T cell activation involved in immune response	endosome membrane|integral to plasma membrane	endogenous lipid antigen binding|exogenous lipid antigen binding|glycolipid binding|lipopeptide binding			ovary(2)|skin(1)|pancreas(1)	4	all_hematologic(112;0.0378)					TGCAAATGACATGCTGTTTCT	0.438													35	127	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158590102	158590102	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158590102A>T	uc001fst.1	-	44	6474	c.6275T>A	c.(6274-6276)CTG>CAG	p.L2092Q		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2092	Spectrin 20.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					AGCCCTAGCCAGGGAGGCCAA	0.493													25	96	---	---	---	---	PASS
F13B	2165	broad.mit.edu	37	1	197030071	197030071	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197030071C>G	uc001gtt.1	-	4	630	c.586G>C	c.(586-588)GAA>CAA	p.E196Q		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	196	Sushi 3.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						GTGAGACATTCTACCTCCTCT	0.398													34	165	---	---	---	---	PASS
ZP4	57829	broad.mit.edu	37	1	238053451	238053451	+	Silent	SNP	C	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238053451C>A	uc001hym.2	-	2	201	c.201G>T	c.(199-201)CTG>CTT	p.L67L	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	67	Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AGTCATTCTGCAGCTCGTGCA	0.557													9	127	---	---	---	---	PASS
SDCCAG8	10806	broad.mit.edu	37	1	243507555	243507555	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243507555C>A	uc001hzw.2	+	12	1551	c.1395C>A	c.(1393-1395)AAC>AAA	p.N465K	SDCCAG8_uc010pyk.1_Missense_Mutation_p.N320K|SDCCAG8_uc010pyl.1_Missense_Mutation_p.N277K|SDCCAG8_uc001hzx.2_Missense_Mutation_p.N277K	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	465	Potential.|Sufficient for homodimerization (By similarity).				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		ATAAAACCAACATGGAGAAGG	0.413													21	71	---	---	---	---	PASS
OR2M2	391194	broad.mit.edu	37	1	248343396	248343396	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248343396G>A	uc010pzf.1	+	1	109	c.109G>A	c.(109-111)GTG>ATG	p.V37M		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	37	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CATCTTTTTAGTGGCCTTCAT	0.517													109	372	---	---	---	---	PASS
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48898734	48898734	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48898734C>T	uc010yol.1	+	7	3262	c.3215C>T	c.(3214-3216)CCT>CTT	p.P1072L	STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.P1119L|GTF2A1L_uc002rws.1_Missense_Mutation_p.P415L|GTF2A1L_uc010yom.1_Missense_Mutation_p.P381L|GTF2A1L_uc002rwt.2_Missense_Mutation_p.P415L	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	1072					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CTTTAGGACCCTTTAAATTCT	0.328													53	212	---	---	---	---	PASS
MDH1	4190	broad.mit.edu	37	2	63834097	63834097	+	Silent	SNP	T	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63834097T>A	uc002scj.1	+	9	1037	c.981T>A	c.(979-981)GCT>GCA	p.A327A	MDH1_uc010ypv.1_Silent_p.A345A|MDH1_uc010ypw.1_Silent_p.A232A	NM_005917	NP_005908	P40925	MDHC_HUMAN	cytosolic malate dehydrogenase	327					gluconeogenesis|tricarboxylic acid cycle	centrosome|cytosol	L-malate dehydrogenase activity|malic enzyme activity			kidney(2)	2					NADH(DB00157)	AAGAAAGTGCTTTTGAATTTC	0.358													39	122	---	---	---	---	PASS
ZNF638	27332	broad.mit.edu	37	2	71607682	71607682	+	Silent	SNP	T	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71607682T>G	uc002shx.2	+	10	2683	c.2364T>G	c.(2362-2364)ACT>ACG	p.T788T	ZNF638_uc010fec.2_Silent_p.T894T|ZNF638_uc010yqw.1_Silent_p.T367T|ZNF638_uc002shw.2_Silent_p.T788T|ZNF638_uc002shy.2_Silent_p.T788T|ZNF638_uc002shz.2_Silent_p.T788T|ZNF638_uc002sia.2_Silent_p.T788T|ZNF638_uc002sib.1_Silent_p.T788T|ZNF638_uc010fed.2_RNA	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638	788					RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						AAATTGTTACTTCAACTTCTG	0.308													25	137	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89417279	89417279	+	RNA	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89417279C>T	uc010ytr.1	-	41		c.4448G>A			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GCAGGAGCCCCAGGAGCTGAG	0.532													58	329	---	---	---	---	PASS
SPOPL	339745	broad.mit.edu	37	2	139308568	139308568	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139308568G>C	uc002tvh.2	+	4	696	c.296G>C	c.(295-297)CGA>CCA	p.R99P		NM_001001664	NP_001001664	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	99	MATH.					nucleus				skin(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0296)		AGTGAAGTTCGAGCAAAATTC	0.368													38	178	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179409130	179409130	+	Silent	SNP	T	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179409130T>A	uc010zfg.1	-	294	88346	c.88122A>T	c.(88120-88122)GTA>GTT	p.V29374V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.V23069V|TTN_uc010zfi.1_Silent_p.V23002V|TTN_uc010zfj.1_Silent_p.V22877V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30301							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAACATATCCTACAATGTCAG	0.463													20	111	---	---	---	---	PASS
TMEFF2	23671	broad.mit.edu	37	2	193049091	193049091	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193049091G>T	uc002utc.2	-	3	795	c.401C>A	c.(400-402)TCA>TAA	p.S134*	TMEFF2_uc002utd.1_Nonsense_Mutation_p.S134*	NM_016192	NP_057276	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two	134	Kazal-like 1.|Extracellular (Potential).					extracellular region|integral to membrane				lung(2)|pancreas(1)|breast(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			TGTGGCACATGATCCTTCTGA	0.443													46	154	---	---	---	---	PASS
NOP58	51602	broad.mit.edu	37	2	203141216	203141216	+	Intron	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203141216G>A	uc002uzb.2	+						NOP58_uc010zhv.1_Intron|SNORD70_uc002uzc.2_RNA	NM_015934	NP_057018	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein homolog						cell growth|rRNA processing|snRNP protein import into nucleus	box C/D snoRNP complex|Cajal body|cytoplasm|pre-snoRNP complex	protein binding|snoRNA binding				0						CTCAATATTCGTCACTACCAC	0.289													7	67	---	---	---	---	PASS
LOC200726	200726	broad.mit.edu	37	2	207509208	207509208	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207509208A>T	uc010fuh.1	+	2	423	c.248A>T	c.(247-249)GAG>GTG	p.E83V		NM_001102659	NP_001096129			hypothetical protein LOC200726												0				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.115)|Lung(261;0.133)		AAGTCATCTGAGAACTTGAAG	0.488													21	80	---	---	---	---	PASS
DYTN	391475	broad.mit.edu	37	2	207558005	207558005	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207558005T>C	uc002vbr.1	-	9	991	c.874A>G	c.(874-876)AGA>GGA	p.R292G		NM_001093730	NP_001087199	A2CJ06	DYTN_HUMAN	dystrotelin	292						plasma membrane	zinc ion binding			ovary(1)|central_nervous_system(1)	2				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		AGGTTGTTTCTGAGGGTCCTG	0.498													16	108	---	---	---	---	PASS
CYP27A1	1593	broad.mit.edu	37	2	219679704	219679704	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219679704T>A	uc002viz.3	+	9	1981	c.1547T>A	c.(1546-1548)CTG>CAG	p.L516Q		NM_000784	NP_000775	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A,	516					bile acid biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	cholestanetriol 26-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Cholecalciferol(DB00169)	CGCATTGTCCTGGTTCCCAAT	0.592													27	103	---	---	---	---	PASS
KIAA1257	57501	broad.mit.edu	37	3	128696888	128696888	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128696888C>G	uc003elj.3	-	5	1004	c.808G>C	c.(808-810)GGT>CGT	p.G270R	KIAA1257_uc003elg.1_Missense_Mutation_p.G270R|KIAA1257_uc003eli.3_Missense_Mutation_p.G158R	NM_020741	NP_065792	Q9ULG3	K1257_HUMAN	hypothetical protein LOC57501	270											0						CTCCGCTCACCTTGCAAAGAC	0.507													16	130	---	---	---	---	PASS
TNIK	23043	broad.mit.edu	37	3	170784432	170784432	+	Silent	SNP	A	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170784432A>G	uc003fhh.2	-	31	4137	c.3792T>C	c.(3790-3792)TAT>TAC	p.Y1264Y	TNIK_uc003fhi.2_Silent_p.Y1209Y|TNIK_uc003fhj.2_Silent_p.Y1235Y|TNIK_uc003fhk.2_Silent_p.Y1256Y|TNIK_uc003fhl.2_Silent_p.Y1180Y|TNIK_uc003fhm.2_Silent_p.Y1201Y|TNIK_uc003fhn.2_Silent_p.Y1227Y|TNIK_uc003fho.2_Silent_p.Y1172Y|TNIK_uc003fhg.2_Silent_p.Y442Y|TNIK_uc003fhp.2_Silent_p.Y196Y	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1	1264	CNH.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			AGGTGTTTACATACACCCCCT	0.453													60	155	---	---	---	---	PASS
LRCH3	84859	broad.mit.edu	37	3	197579450	197579450	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197579450C>G	uc011bul.1	+	13	1554	c.1549C>G	c.(1549-1551)CCA>GCA	p.P517A	LRCH3_uc003fyj.1_Missense_Mutation_p.P517A|LRCH3_uc011bum.1_Missense_Mutation_p.P489A|LRCH3_uc011bun.1_Missense_Mutation_p.P363A|LRCH3_uc003fyk.2_Missense_Mutation_p.P112A	NM_032773	NP_116162	Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH)	517						extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		ATCACAAAGTCCACAAAAACA	0.373													28	320	---	---	---	---	PASS
ADD1	118	broad.mit.edu	37	4	2877845	2877845	+	Intron	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2877845G>T	uc003gfr.2	+						ADD1_uc003gfn.2_Intron|ADD1_uc010ico.1_Intron|ADD1_uc003gfo.2_Intron|ADD1_uc003gfp.2_Intron|ADD1_uc003gfq.2_Intron|ADD1_uc003gfs.2_Intron|ADD1_uc003gft.3_Intron	NM_001119	NP_001110	P35611	ADDA_HUMAN	adducin 1 (alpha) isoform a						actin filament bundle assembly|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|positive regulation of protein binding	cytosol|F-actin capping protein complex|nucleus|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding|transcription factor binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCTGTGAGAAGAGAAGTCTTT	0.448													15	38	---	---	---	---	PASS
MED28	80306	broad.mit.edu	37	4	17616310	17616310	+	Silent	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17616310G>T	uc003gpi.1	+	1	45	c.33G>T	c.(31-33)GGG>GGT	p.G11G	MED28_uc003gpj.2_RNA	NM_025205	NP_079481	Q9H204	MED28_HUMAN	mediator complex subunit 28	11					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|membrane|nucleus	actin binding				0						TGTTTTCTGGGCAGCCACCCG	0.647													17	67	---	---	---	---	PASS
BMP3	651	broad.mit.edu	37	4	81966889	81966889	+	Intron	SNP	T	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81966889T>A	uc003hmg.3	+							NM_001201	NP_001192	P12645	BMP3_HUMAN	bone morphogenetic protein 3 preproprotein						cartilage development|cell differentiation|cell-cell signaling|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(4)|central_nervous_system(1)	5						TTTTCCTTCCTAGAAACTCTT	0.249													23	85	---	---	---	---	PASS
FAM13A	10144	broad.mit.edu	37	4	89950644	89950644	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89950644C>T	uc003hse.1	-	2	392	c.184G>A	c.(184-186)GTG>ATG	p.V62M	FAM13A_uc003hsf.1_Translation_Start_Site|FAM13A_uc003hsh.1_Translation_Start_Site|FAM13A_uc003hsi.2_Missense_Mutation_p.V62M|FAM13A_uc003hsj.2_Missense_Mutation_p.V62M	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1	62	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						ATATTCCACACTACTGCTGGA	0.398													57	183	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183601476	183601476	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183601476G>A	uc003ivd.1	+	8	1650	c.1613G>A	c.(1612-1614)GGA>GAA	p.G538E	ODZ3_uc003ive.1_5'UTR	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	538	Extracellular (Potential).|EGF-like 1.				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		TGTTTTCCAGGATTTCTGGGT	0.413													14	45	---	---	---	---	PASS
MTMR12	54545	broad.mit.edu	37	5	32243668	32243668	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32243668C>G	uc003jhq.2	-	11	1229	c.1059G>C	c.(1057-1059)TGG>TGC	p.W353C	MTMR12_uc010iuk.2_Missense_Mutation_p.W353C|MTMR12_uc010iul.2_Missense_Mutation_p.W353C	NM_001040446	NP_001035536	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	353	Myotubularin phosphatase.					cytoplasm	phosphatase activity			ovary(1)	1						ACAGAGAAAACCATTTTATAT	0.343													37	119	---	---	---	---	PASS
GZMA	3001	broad.mit.edu	37	5	54403616	54403616	+	Intron	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54403616T>C	uc003jpm.2	+							NM_006144	NP_006135	P12544	GRAA_HUMAN	granzyme A precursor						cleavage of lamin|cytolysis|immune response|negative regulation of DNA binding|negative regulation of endodeoxyribonuclease activity|negative regulation of oxidoreductase activity|positive regulation of apoptosis	extracellular region|immunological synapse|nucleus	protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				TTGTGTCTGTTCTCAGGAACA	0.393													23	90	---	---	---	---	PASS
RASA1	5921	broad.mit.edu	37	5	86685301	86685301	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86685301C>G	uc003kiw.2	+	24	3135	c.3017C>G	c.(3016-3018)TCA>TGA	p.S1006*	RASA1_uc010jav.2_RNA|RASA1_uc003kix.2_Nonsense_Mutation_p.S829*|RASA1_uc011ctv.1_Nonsense_Mutation_p.S839*|RASA1_uc011ctw.1_Nonsense_Mutation_p.S840*|RASA1_uc010jaw.2_Nonsense_Mutation_p.S828*	NM_002890	NP_002881	P20936	RASA1_HUMAN	RAS p21 protein activator 1 isoform 1	1006					cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding			upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		GTGGCTCATTCAGATGAACTT	0.458													58	176	---	---	---	---	PASS
SEC24A	10802	broad.mit.edu	37	5	134015299	134015299	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134015299C>T	uc003kzs.2	+	8	1550	c.1262C>T	c.(1261-1263)CCT>CTT	p.P421L	SEC24A_uc011cxu.1_Missense_Mutation_p.P185L	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A	421					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CAGCAATTGCCTGTGGTTACC	0.363													47	140	---	---	---	---	PASS
WDR55	54853	broad.mit.edu	37	5	140048579	140048579	+	Intron	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140048579C>G	uc003lgr.3	+						WDR55_uc011czl.1_Intron	NM_017706	NP_060176	Q9H6Y2	WDR55_HUMAN	WD repeat domain 55						rRNA processing	cytoplasm|nucleolus				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATGAAAGTACAGCTGGTTAT	0.532													20	65	---	---	---	---	PASS
PCDHB16	57717	broad.mit.edu	37	5	140564054	140564054	+	Silent	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140564054G>A	uc003liv.2	+	1	3075	c.1920G>A	c.(1918-1920)CTG>CTA	p.L640L	PCDHB9_uc003liw.1_5'Flank	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	640	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCAGAGGCTGGTGGTGCTGG	0.701													9	16	---	---	---	---	PASS
PCDHB13	56123	broad.mit.edu	37	5	140594628	140594628	+	Silent	SNP	A	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140594628A>G	uc003lja.1	+	1	1120	c.933A>G	c.(931-933)GAA>GAG	p.E311E		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	311	Cadherin 3.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCGATTTCGAAAAACTTCAGT	0.378													37	231	---	---	---	---	PASS
PCDHB15	56121	broad.mit.edu	37	5	140625809	140625809	+	Silent	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140625809C>G	uc003lje.2	+	1	663	c.663C>G	c.(661-663)CCC>CCG	p.P221P		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	221	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCTCCACCCCGATCTGGCA	0.592													14	36	---	---	---	---	PASS
PCDHGA2	56113	broad.mit.edu	37	5	140720501	140720501	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140720501T>C	uc003ljk.1	+	1	2148	c.1963T>C	c.(1963-1965)TCC>CCC	p.S655P	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Missense_Mutation_p.S655P	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	655	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCCCCTCTCTCCGCCACTGT	0.701													18	26	---	---	---	---	PASS
PCDHGB3	56102	broad.mit.edu	37	5	140750023	140750023	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140750023T>C	uc003ljw.1	+	1	62	c.62T>C	c.(61-63)CTG>CCG	p.L21P	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc011dat.1_Missense_Mutation_p.L21P	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3 isoform 1	21					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTCTCTTCCTGCTCTCTTTG	0.582													17	61	---	---	---	---	PASS
ADAM19	8728	broad.mit.edu	37	5	156932793	156932793	+	Silent	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156932793G>T	uc003lwz.2	-	11	1078	c.1014C>A	c.(1012-1014)GGC>GGA	p.G338G	ADAM19_uc003lww.1_Silent_p.G71G|ADAM19_uc003lwy.2_5'Flank|ADAM19_uc011ddr.1_Silent_p.G269G	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19 preproprotein	338	Peptidase M12B.|Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGGCAGCCACGCCAATGGCAT	0.582													8	18	---	---	---	---	PASS
RARS	5917	broad.mit.edu	37	5	167944983	167944983	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167944983C>G	uc003lzx.2	+	14	1830	c.1789C>G	c.(1789-1791)CTC>GTC	p.L597V	RARS_uc011deo.1_Missense_Mutation_p.L391V	NM_002887	NP_002878	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	597					arginyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	arginine-tRNA ligase activity|ATP binding|protein binding			ovary(2)|skin(1)	3	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		TCTCCACACTCTCTGTGATTA	0.398													31	115	---	---	---	---	PASS
RANBP17	64901	broad.mit.edu	37	5	170351426	170351426	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170351426C>T	uc003mba.2	+	12	1356	c.1340C>T	c.(1339-1341)ACG>ATG	p.T447M	RANBP17_uc003max.1_RNA|RANBP17_uc003may.1_RNA|RANBP17_uc003maz.1_RNA|RANBP17_uc010jjr.1_RNA	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	447					mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CAGTTGTGCACGGTCAGCAGA	0.413			T	TRD@	ALL								29	71	---	---	---	---	PASS
ZNF184	7738	broad.mit.edu	37	6	27419665	27419665	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27419665T>C	uc003njj.2	-	5	2484	c.1673A>G	c.(1672-1674)TAT>TGT	p.Y558C	ZNF184_uc010jqv.2_Missense_Mutation_p.Y558C|ZNF184_uc003nji.2_Missense_Mutation_p.Y558C	NM_007149	NP_009080	Q99676	ZN184_HUMAN	zinc finger protein 184	558	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						ATGACACTGATAGGGTTTCTC	0.388													23	142	---	---	---	---	PASS
NEU1	4758	broad.mit.edu	37	6	31829772	31829772	+	Intron	SNP	A	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31829772A>G	uc003nxq.3	-						NEU1_uc010jtg.2_Intron|NEU1_uc003nxr.3_Intron|NEU1_uc010jth.2_Intron|NEU1_uc003nxs.3_Intron	NM_000434	NP_000425	Q99519	NEUR1_HUMAN	neuraminidase precursor							cytoplasmic membrane-bounded vesicle|lysosomal lumen|lysosomal membrane|plasma membrane	exo-alpha-sialidase activity|protein binding			ovary(1)	1					Oseltamivir(DB00198)|Zanamivir(DB00558)	AGACATCTTTATACCCTGGTC	0.597													22	136	---	---	---	---	PASS
PPARD	5467	broad.mit.edu	37	6	35393715	35393715	+	Silent	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35393715C>G	uc003okm.2	+	8	1494	c.1185C>G	c.(1183-1185)CTC>CTG	p.L395L	PPARD_uc003okn.2_Silent_p.L395L|PPARD_uc011dtb.1_Silent_p.L356L|PPARD_uc011dtc.1_Silent_p.L297L	NM_006238	NP_006229	Q03181	PPARD_HUMAN	peroxisome proliferative activated receptor,	395	Ligand-binding.				apoptosis|axon ensheathment|cholesterol metabolic process|decidualization|embryo implantation|fatty acid beta-oxidation|fatty acid transport|generation of precursor metabolites and energy|glucose metabolic process|glucose transport|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fat cell differentiation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|linoleic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1					Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	CCCAGTACCTCTTCCCCAAGC	0.607													19	68	---	---	---	---	PASS
TTBK1	84630	broad.mit.edu	37	6	43250735	43250735	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43250735G>T	uc003ouq.1	+	14	2536	c.2257G>T	c.(2257-2259)GAG>TAG	p.E753*		NM_032538	NP_115927	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	753	Glu-rich.|Potential.					cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			ggaagaagaagaggaggaaga	0.264													9	19	---	---	---	---	PASS
AARS2	57505	broad.mit.edu	37	6	44279932	44279932	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44279932G>C	uc010jza.1	-	2	315	c.312C>G	c.(310-312)AAC>AAG	p.N104K	SPATS1_uc003oxg.2_Intron	NM_020745	NP_065796	Q5JTZ9	SYAM_HUMAN	alanyl-tRNA synthetase 2, mitochondrial	104					alanyl-tRNA aminoacylation	mitochondrion	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			ovary(1)	1	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		L-Alanine(DB00160)	ATTTCTGGCTGTTGGCCACAC	0.542													11	95	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51586818	51586818	+	Intron	SNP	A	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51586818A>C	uc003pah.1	-						PKHD1_uc010jzn.1_Intron|PKHD1_uc003pai.2_Missense_Mutation_p.V3386G	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CTCAGTGGTTACTGAAGTAAA	0.433													25	138	---	---	---	---	PASS
IMPG1	3617	broad.mit.edu	37	6	76713617	76713617	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76713617G>A	uc003pik.1	-	11	1316	c.1186C>T	c.(1186-1188)CCC>TCC	p.P396S		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	396					visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				AAAGATGTGGGCAGCTCTGAT	0.383													20	86	---	---	---	---	PASS
TPBG	7162	broad.mit.edu	37	6	83075249	83075249	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83075249C>T	uc003pjn.3	+	3	1507	c.571C>T	c.(571-573)CAG>TAG	p.Q191*	TPBG_uc010kbj.2_Nonsense_Mutation_p.Q191*|TPBG_uc003pjo.2_Nonsense_Mutation_p.Q191*	NM_006670	NP_006661	Q13641	TPBG_HUMAN	trophoblast glycoprotein precursor	191	Extracellular (Potential).				cell adhesion	integral to plasma membrane				central_nervous_system(1)	1		all_cancers(76;0.000805)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0897)		BRCA - Breast invasive adenocarcinoma(397;0.107)		AGATGAGCGGCAGAACCGGAG	0.652													22	196	---	---	---	---	PASS
DCBLD1	285761	broad.mit.edu	37	6	117862184	117862184	+	Silent	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117862184C>T	uc003pxs.2	+	11	1478	c.1353C>T	c.(1351-1353)TCC>TCT	p.S451S	GOPC_uc003pxq.1_Intron|DCBLD1_uc003pxr.1_Silent_p.S451S|DCBLD1_uc003pxt.1_Silent_p.S106S	NM_173674	NP_775945	Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1	451	Extracellular (Potential).				cell adhesion	integral to membrane				ovary(1)	1		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		AAGAAACATCCACAGGTAGAG	0.418													14	47	---	---	---	---	PASS
DGKB	1607	broad.mit.edu	37	7	14620493	14620493	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14620493C>G	uc003ssz.2	-	18	1793	c.1606G>C	c.(1606-1608)GGA>CGA	p.G536R	DGKB_uc011jxt.1_Missense_Mutation_p.G517R|DGKB_uc003sta.2_Missense_Mutation_p.G536R|DGKB_uc011jxu.1_Missense_Mutation_p.G535R	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1	536	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	TTACCTCCTCCCCATCGCAGG	0.428													11	78	---	---	---	---	PASS
NPVF	64111	broad.mit.edu	37	7	25266624	25266624	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25266624C>T	uc003sxo.2	-	2	207	c.160G>A	c.(160-162)GAA>AAA	p.E54K		NM_022150	NP_071433	Q9HCQ7	RFRP_HUMAN	neuropeptide VF precursor	54					neuropeptide signaling pathway	extracellular region|membrane	G-protein coupled receptor activity			ovary(1)	1						AGGCTTCTTTCCCCTTTTGGG	0.348													48	214	---	---	---	---	PASS
BBS9	27241	broad.mit.edu	37	7	33427616	33427616	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33427616G>T	uc003tdn.1	+	19	2488	c.1975G>T	c.(1975-1977)GGT>TGT	p.G659C	BBS9_uc003tdo.1_Missense_Mutation_p.G624C|BBS9_uc003tdp.1_Missense_Mutation_p.G654C|BBS9_uc003tdq.1_Missense_Mutation_p.G619C|BBS9_uc010kwn.1_RNA|BBS9_uc003tdr.1_Missense_Mutation_p.G183C|BBS9_uc003tds.1_Missense_Mutation_p.G82C|BBS9_uc003tdt.2_RNA	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2	659					fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			ACGGATAAATGGTGAAAAATT	0.333									Bardet-Biedl_syndrome				55	280	---	---	---	---	PASS
SFRP4	6424	broad.mit.edu	37	7	37947080	37947080	+	3'UTR	SNP	C	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37947080C>A	uc003tfo.3	-	6						NM_003014	NP_003005	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related  protein 4 precursor						brain development|cell differentiation|decidualization|embryo development|epithelium development|gonad development|mammary gland involution|menstrual cycle phase|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell proliferation|negative regulation of JNK cascade|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of sodium-dependent phosphate transport|phosphate ion homeostasis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epidermal cell differentiation|positive regulation of gene expression|positive regulation of receptor internalization|vasculature development|Wnt receptor signaling pathway	cell surface|cytoplasm|extracellular space|nucleus	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(1)	1						AACTAGTTAGCTCACACTCTT	0.512													46	202	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43484125	43484125	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43484125G>T	uc003tid.1	+	11	1959	c.1354G>T	c.(1354-1356)GCC>TCC	p.A452S	HECW1_uc011kbi.1_Missense_Mutation_p.A452S	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	452					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						CATCCAGCCTGCCCCCAGTGC	0.642													4	19	---	---	---	---	PASS
ZNF117	51351	broad.mit.edu	37	7	64452868	64452868	+	5'Flank	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64452868C>G	uc003ttr.2	-						ZNF117_uc011kdr.1_Silent_p.G176G	NM_015852	NP_056936	Q03924	ZN117_HUMAN	zinc finger protein 117							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Lung NSC(55;0.0295)|all_lung(88;0.0691)				gcataattggccctagtgatt	0.000													37	184	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82581271	82581271	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82581271C>A	uc003uhx.2	-	5	9287	c.8998G>T	c.(8998-9000)GCA>TCA	p.A3000S	PCLO_uc003uhv.2_Missense_Mutation_p.A3000S|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2931					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CCAGCTTCTGCTAAATTTGTG	0.403													56	327	---	---	---	---	PASS
ABP1	26	broad.mit.edu	37	7	150554527	150554527	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150554527C>G	uc003why.1	+	3	5187	c.969C>G	c.(967-969)AGC>AGG	p.S323R	ABP1_uc003whz.1_Missense_Mutation_p.S323R|ABP1_uc003wia.1_Missense_Mutation_p.S323R	NM_001091	NP_001082	P19801	ABP1_HUMAN	amiloride binding protein 1 precursor	323					amine metabolic process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding			ovary(2)|breast(2)|skin(2)	6	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiloride(DB00594)|Spermine(DB00127)	GCGGCTGGAGCTTTGCCTTCC	0.672													14	13	---	---	---	---	PASS
TNKS	8658	broad.mit.edu	37	8	9634202	9634202	+	Missense_Mutation	SNP	G	A	A	rs140882876		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9634202G>A	uc003wss.2	+	27	3945	c.3940G>A	c.(3940-3942)GAA>AAA	p.E1314K	TNKS_uc011kww.1_Missense_Mutation_p.E1077K	NM_003747	NP_003738	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related	1314	PARP catalytic.				mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)		CATGAAGCCAGAAGCCCCTTC	0.483													8	57	---	---	---	---	PASS
GATA4	2626	broad.mit.edu	37	8	11607664	11607664	+	Silent	SNP	C	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11607664C>A	uc003wuc.2	+	4	1382	c.828C>A	c.(826-828)ACC>ACA	p.T276T	GATA4_uc003wub.1_Silent_p.T70T|GATA4_uc011kxc.1_Silent_p.T277T	NM_002052	NP_002043	P43694	GATA4_HUMAN	GATA binding protein 4	276	GATA-type 2.|Poly-Thr.				atrial septum primum morphogenesis|atrial septum secundum morphogenesis|blood coagulation|cardiac right ventricle morphogenesis|cell-cell signaling|embryonic foregut morphogenesis|embryonic heart tube anterior/posterior pattern formation|endocardial cushion development|endoderm development|heart looping|intestinal epithelial cell differentiation|male gonad development|positive regulation of angiogenesis|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|response to drug|transcription from RNA polymerase II promoter|ventricular septum development	nucleoplasm	activating transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		ACTGCCAGACCACCACCACCA	0.627													13	33	---	---	---	---	PASS
KCNU1	157855	broad.mit.edu	37	8	36746721	36746721	+	Intron	SNP	A	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36746721A>G	uc003xjw.2	+						KCNU1_uc010lvw.2_Intron|uc003xjx.2_Silent_p.K126K			A8MYU2	KCNU1_HUMAN	Homo sapiens cDNA FLJ50072 complete cds, moderately similar to Mus musculus potassium channel, subfamily U, member 1 (Kcnu1), mRNA.							voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TATTGGTGAAAACCTAAATCC	0.234													39	133	---	---	---	---	PASS
COPS5	10987	broad.mit.edu	37	8	67970337	67970337	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67970337T>C	uc003xxe.2	-	3	819	c.488A>G	c.(487-489)GAA>GGA	p.E163G	COPS5_uc003xxd.2_Missense_Mutation_p.E99G|COPS5_uc003xxf.2_Missense_Mutation_p.E208G|COPS5_uc010lyu.1_5'Flank|COPS5_uc010lyv.1_Missense_Mutation_p.E163G	NM_006837	NP_006828	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5	163	MPN.				cullin deneddylation|transcription from RNA polymerase II promoter	eukaryotic translation initiation factor 3 complex|signalosome	metal ion binding|metallopeptidase activity|protein binding|transcription coactivator activity|translation initiation factor activity			ovary(1)|skin(1)	2	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			TACAAATGGTTCCTGGAACTG	0.378													26	139	---	---	---	---	PASS
RDH10	157506	broad.mit.edu	37	8	74209534	74209534	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74209534T>A	uc003xzi.2	+	2	655	c.395T>A	c.(394-396)GTC>GAC	p.V132D	RDH10_uc003xzj.2_5'UTR	NM_172037	NP_742034	Q8IZV5	RDH10_HUMAN	retinol dehydrogenase 10	132					retinal metabolic process|retinol metabolic process|visual perception	endoplasmic reticulum membrane|integral to membrane|microsome	binding|NADP-retinol dehydrogenase activity|retinol dehydrogenase activity				0	Breast(64;0.0954)		Epithelial(68;0.0105)|all cancers(69;0.0465)|BRCA - Breast invasive adenocarcinoma(89;0.0608)			GCTGAAAGAGTCCGCAAGGAG	0.512													36	150	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113256749	113256749	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113256749C>G	uc003ynu.2	-	65	10435	c.10276G>C	c.(10276-10278)GAC>CAC	p.D3426H	CSMD3_uc003yns.2_Missense_Mutation_p.D2628H|CSMD3_uc003ynt.2_Missense_Mutation_p.D3386H|CSMD3_uc011lhx.1_Missense_Mutation_p.D3257H	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3426	Extracellular (Potential).|Sushi 28.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GATGGAAGGTCCATCCCTACG	0.408										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			28	129	---	---	---	---	PASS
EFR3A	23167	broad.mit.edu	37	8	132980672	132980672	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132980672C>G	uc003yte.2	+	9	1187	c.986C>G	c.(985-987)TCC>TGC	p.S329C		NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A	329						plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			GCTAAAGGTTCCATAGGTGAG	0.403													17	58	---	---	---	---	PASS
XPA	7507	broad.mit.edu	37	9	100459559	100459559	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100459559C>T	uc004axr.3	-	1	133	c.16G>A	c.(16-18)GGG>AGG	p.G6R	XPA_uc004axs.3_RNA	NM_000380	NP_000371	P23025	XPA_HUMAN	xeroderma pigmentosum, complementation group A	6	Interaction with CEP164 and required for UV resistance.				nucleotide-excision repair, DNA damage removal	nucleoplasm	damaged DNA binding|metal ion binding|nucleotide binding|protein domain specific binding|protein homodimerization activity			breast(1)	1		Acute lymphoblastic leukemia(62;0.158)				GGCAAAGCCCCGTCGGCCGCC	0.726			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		NER	Xeroderma_Pigmentosum				12	22	---	---	---	---	PASS
GRIN3A	116443	broad.mit.edu	37	9	104433333	104433333	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104433333G>A	uc004bbp.1	-	3	1962	c.1361C>T	c.(1360-1362)TCC>TTC	p.S454F	GRIN3A_uc004bbq.1_Missense_Mutation_p.S454F	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	454	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	GACGATGGTGGAACCTTTTAC	0.493													71	205	---	---	---	---	PASS
GRIN3A	116443	broad.mit.edu	37	9	104433334	104433334	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104433334A>T	uc004bbp.1	-	3	1961	c.1360T>A	c.(1360-1362)TCC>ACC	p.S454T	GRIN3A_uc004bbq.1_Missense_Mutation_p.S454T	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	454	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	ACGATGGTGGAACCTTTTACT	0.498													71	203	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113170734	113170734	+	Silent	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113170734G>A	uc010mtz.2	-	38	7483	c.7146C>T	c.(7144-7146)ACC>ACT	p.T2382T	SVEP1_uc010mty.2_Silent_p.T308T	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	2382	Sushi 17.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						GGGGAGGTGGGGTACAAAGAA	0.458													15	46	---	---	---	---	PASS
SARDH	1757	broad.mit.edu	37	9	136529034	136529034	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136529034T>C	uc004cep.3	-	21	2868	c.2734A>G	c.(2734-2736)AAG>GAG	p.K912E	SARDH_uc004ceo.2_Missense_Mutation_p.K912E|SARDH_uc011mdn.1_Missense_Mutation_p.K912E|SARDH_uc011mdo.1_Missense_Mutation_p.K744E|SARDH_uc004cen.2_Missense_Mutation_p.K362E	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor	912					glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		TTCACCCTCTTGTTGTTGGGG	0.592													61	132	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16882993	16882993	+	Silent	SNP	G	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16882993G>C	uc001ioo.2	-	61	9769	c.9717C>G	c.(9715-9717)TCC>TCG	p.S3239S		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	3239	CUB 24.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAGGTACTGTGGAACCACAAA	0.368													16	62	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25464669	25464669	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25464669G>A	uc001isj.2	+	1	380	c.320G>A	c.(319-321)GGC>GAC	p.G107D	LOC100128811_uc010qde.1_Missense_Mutation_p.P95S	NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	107	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						GAGTTGGCGGGCCTGCCGGGG	0.677													7	39	---	---	---	---	PASS
RET	5979	broad.mit.edu	37	10	43600539	43600539	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43600539G>T	uc001jal.2	+	4	955	c.765G>T	c.(763-765)ATG>ATT	p.M255I	RET_uc001jak.1_Missense_Mutation_p.M255I|RET_uc010qez.1_Missense_Mutation_p.M1I	NM_020975	NP_066124	P07949	RET_HUMAN	ret proto-oncogene isoform a	255	Cadherin.|Extracellular (Potential).				homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity			thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451		Ovarian(717;0.0423)			Sunitinib(DB01268)	AGGTGGTGATGGTGCCCTTCC	0.716		1	T|Mis|N|F	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma	Hirschsprung disease		Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma				5	25	---	---	---	---	PASS
RBP3	5949	broad.mit.edu	37	10	48389921	48389921	+	Silent	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48389921G>T	uc001jez.2	-	1	1071	c.957C>A	c.(955-957)ATC>ATA	p.I319I		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	319	4 X approximate tandem repeats.|1.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)	GCAGAGTGAGGATGGCCAGGG	0.687													10	67	---	---	---	---	PASS
LRIT1	26103	broad.mit.edu	37	10	85991773	85991773	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85991773C>A	uc001kcz.1	-	4	1804	c.1782G>T	c.(1780-1782)GAG>GAT	p.E594D		NM_015613	NP_056428	Q9P2V4	LRIT1_HUMAN	retina specific protein PAL	594	Cytoplasmic (Potential).|LRR 6.					integral to endoplasmic reticulum membrane					0						GCCTGTCAGCCTCGCTGACAC	0.562													9	44	---	---	---	---	PASS
SLIT1	6585	broad.mit.edu	37	10	98816232	98816232	+	Intron	SNP	A	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98816232A>C	uc001kmw.2	-						SLIT1_uc009xvh.1_Intron	NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor						axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CTGTGGGCAGAGCCAGGACCA	0.587													22	110	---	---	---	---	PASS
INPP5F	22876	broad.mit.edu	37	10	121571349	121571349	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121571349G>A	uc001leo.2	+	15	1934	c.1768G>A	c.(1768-1770)GAA>AAA	p.E590K		NM_014937	NP_055752	Q9Y2H2	SAC2_HUMAN	inositol polyphosphate-5-phosphatase F	590							phosphoric ester hydrolase activity			ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		TTTGCATAAGGAAAATCAGAG	0.413													49	186	---	---	---	---	PASS
FGFR2	2263	broad.mit.edu	37	10	123247514	123247514	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123247514C>G	uc010qtk.1	-	15	2624	c.1977G>C	c.(1975-1977)AAG>AAC	p.K659N	FGFR2_uc010qtg.1_Missense_Mutation_p.K547N|FGFR2_uc010qth.1_Missense_Mutation_p.K544N|FGFR2_uc010qti.1_Missense_Mutation_p.K570N|FGFR2_uc010qtj.1_Missense_Mutation_p.K660N|FGFR2_uc010qtl.1_Missense_Mutation_p.K543N|FGFR2_uc010qtm.1_Missense_Mutation_p.K542N|FGFR2_uc001lfl.3_Missense_Mutation_p.K660N|FGFR2_uc001lfm.2_Missense_Mutation_p.K571N|FGFR2_uc001lfg.3_Missense_Mutation_p.K267N	NM_000141	NP_000132	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 1	659	Cytoplasmic (Potential).|Protein kinase.		K -> N (in craniosynostosis).		angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding	p.K659E(1)|p.K659N(1)|p.K659M(1)		endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)	CATTGGTGGTCTTTTTGTAAT	0.448		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				62	260	---	---	---	---	PASS
PWWP2B	170394	broad.mit.edu	37	10	134219581	134219581	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134219581C>T	uc001lll.3	+	2	1606	c.1577C>T	c.(1576-1578)GCG>GTG	p.A526V	PWWP2B_uc009ybe.2_Intron	NM_138499	NP_612508	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2 isoform 1	526	PWWP.										0		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		TGGCGAGAAGCGAAGGTCTCG	0.493													8	115	---	---	---	---	PASS
RAG1	5896	broad.mit.edu	37	11	36595189	36595189	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36595189G>T	uc001mwu.3	+	2	459	c.335G>T	c.(334-336)CGC>CTC	p.R112L	RAG1_uc001mwt.2_RNA	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	112	Interaction with importin alpha-1.				histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5	all_lung(20;0.226)	all_hematologic(20;0.107)				CATCTCTGCCGCATCTGTGGG	0.453									Familial_Hemophagocytic_Lymphohistiocytosis				35	161	---	---	---	---	PASS
OR4C15	81309	broad.mit.edu	37	11	55322705	55322705	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55322705T>C	uc010rig.1	+	1	923	c.923T>C	c.(922-924)ATA>ACA	p.I308T		NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C,	254	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GTCCCATGCATATTTGTATAT	0.413										HNSCC(20;0.049)			76	298	---	---	---	---	PASS
SPRYD5	84767	broad.mit.edu	37	11	55658883	55658883	+	Silent	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55658883T>C	uc010rip.1	+	7	1226	c.1134T>C	c.(1132-1134)TTT>TTC	p.F378F	SPRYD5_uc010riq.1_Silent_p.F235F	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	378	B30.2/SPRY.					intracellular	zinc ion binding				0		all_epithelial(135;0.226)				AGGGACTCTTTCTTCTTGGAT	0.443													22	89	---	---	---	---	PASS
OR5T2	219464	broad.mit.edu	37	11	55999725	55999725	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55999725C>A	uc010rjc.1	-	1	937	c.937G>T	c.(937-939)GTG>TTG	p.V313L		NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T,	313	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					AATATTGACACTATCATGTCA	0.393													45	251	---	---	---	---	PASS
OR5M8	219484	broad.mit.edu	37	11	56258303	56258303	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56258303G>A	uc001nix.1	-	1	544	c.544C>T	c.(544-546)CCA>TCA	p.P182S		NM_001005282	NP_001005282	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M,	182	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	Esophageal squamous(21;0.00352)					TTAATCAGTGGTGGGTCCGCA	0.463													44	117	---	---	---	---	PASS
OR10Q1	219960	broad.mit.edu	37	11	57995454	57995454	+	Missense_Mutation	SNP	C	A	A	rs149201883	byFrequency	TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57995454C>A	uc010rkd.1	-	1	894	c.894G>T	c.(892-894)AGG>AGT	p.R298S		NM_001004471	NP_001004471	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q,	298	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(21;0.0589)				CATCCTTGTTCCTAAGGCTGT	0.542													46	216	---	---	---	---	PASS
OR4D6	219983	broad.mit.edu	37	11	59224673	59224673	+	Missense_Mutation	SNP	G	T	T	rs139230114	byFrequency	TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59224673G>T	uc010rku.1	+	1	240	c.240G>T	c.(238-240)AAG>AAT	p.K80N		NM_001004708	NP_001004708	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D,	80	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CCGTCCCCAAGTTCCTGGTGG	0.448													49	188	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64390513	64390513	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64390513G>C	uc001oap.2	-	6	1258	c.747C>G	c.(745-747)ATC>ATG	p.I249M	NRXN2_uc001oar.2_Missense_Mutation_p.I1295M|NRXN2_uc001oas.2_Missense_Mutation_p.I1225M|NRXN2_uc001oao.2_Translation_Start_Site|NRXN2_uc001oaq.2_Missense_Mutation_p.I962M	NM_138734	NP_620063	P58401	NRX2B_HUMAN	neurexin 2 isoform beta precursor	249	Extracellular (Potential).|Laminin G-like.				cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						CCCCGATCTTGATGGCAGCCT	0.483													7	17	---	---	---	---	PASS
CTTN	2017	broad.mit.edu	37	11	70266527	70266527	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70266527G>A	uc001opv.3	+	10	907	c.701G>A	c.(700-702)GGA>GAA	p.G234E	CTTN_uc001opu.2_Missense_Mutation_p.G234E|CTTN_uc001opw.3_Missense_Mutation_p.G234E|CTTN_uc010rqm.1_5'UTR|CTTN_uc001opx.2_5'Flank	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a	234	Cortactin 5.					cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GGGTTTGGAGGAAAATTTGGT	0.443													19	89	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92087169	92087169	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92087169G>C	uc001pdj.3	+	1	1908	c.1891G>C	c.(1891-1893)GGT>CGT	p.G631R		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	631	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCCAGATTCTGGTGTTTTACA	0.373										TCGA Ovarian(4;0.039)			9	34	---	---	---	---	PASS
ZNF202	7753	broad.mit.edu	37	11	123601319	123601319	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123601319T>A	uc001pzd.1	-	4	678	c.278A>T	c.(277-279)CAA>CTA	p.Q93L	ZNF202_uc001pzc.1_5'UTR|ZNF202_uc001pze.1_Missense_Mutation_p.Q93L|ZNF202_uc001pzf.1_Missense_Mutation_p.Q93L	NM_003455	NP_003446	O95125	ZN202_HUMAN	zinc finger protein 202	93	SCAN box.				lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		GGTAAGAAATTGTTCCAGCAC	0.557													27	109	---	---	---	---	PASS
OR10G8	219869	broad.mit.edu	37	11	123900324	123900324	+	5'Flank	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123900324G>A	uc001pzp.1	+							NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CCAAGGGTGAGAAGAAATGTC	0.517													34	144	---	---	---	---	PASS
ROBO4	54538	broad.mit.edu	37	11	124767626	124767626	+	Silent	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124767626G>A	uc001qbg.2	-	1	206	c.66C>T	c.(64-66)ATC>ATT	p.I22I	ROBO4_uc010sas.1_5'UTR|ROBO4_uc001qbh.2_Silent_p.I22I|ROBO4_uc010sat.1_5'Flank	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	22					angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		ACTCACCCATGATGAGCAGGA	0.632													20	57	---	---	---	---	PASS
CCND2	894	broad.mit.edu	37	12	4383320	4383320	+	Silent	SNP	T	C	C	rs146122734	byFrequency	TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4383320T>C	uc001qmo.2	+	1	419	c.114T>C	c.(112-114)CTT>CTC	p.L38L		NM_001759	NP_001750	P30279	CCND2_HUMAN	cyclin D2	38	Cyclin N-terminal.				cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding			haematopoietic_and_lymphoid_tissue(1)|breast(1)|kidney(1)	3			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			AGCGCTACCTTCCGCAGTGCT	0.657			T	IGL@	NHL,CLL								16	81	---	---	---	---	PASS
CCND2	894	broad.mit.edu	37	12	4383326	4383326	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4383326G>T	uc001qmo.2	+	1	425	c.120G>T	c.(118-120)CAG>CAT	p.Q40H		NM_001759	NP_001750	P30279	CCND2_HUMAN	cyclin D2	40	Cyclin N-terminal.				cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding			haematopoietic_and_lymphoid_tissue(1)|breast(1)|kidney(1)	3			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			ACCTTCCGCAGTGCTCCTACT	0.652			T	IGL@	NHL,CLL								17	85	---	---	---	---	PASS
ACSM4	341392	broad.mit.edu	37	12	7479581	7479581	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7479581G>A	uc001qsx.1	+	12	1546	c.1546G>A	c.(1546-1548)GCT>ACT	p.A516T		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	516					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						GGTGGTGAAAGCTTTTGTTGT	0.363													4	38	---	---	---	---	PASS
APOBEC1	339	broad.mit.edu	37	12	7803649	7803649	+	Silent	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7803649C>T	uc001qtb.2	-	4	565	c.531G>A	c.(529-531)TTG>TTA	p.L177L	APOBEC1_uc001qtc.2_Silent_p.L132L|APOBEC1_uc010sgf.1_Silent_p.L177L	NM_001644	NP_001635	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme	177					cytidine to uridine editing|DNA demethylation|lipid metabolic process|mRNA modification|mRNA processing|negative regulation of methylation-dependent chromatin silencing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0						CCAGTGCGTACAACATCATCC	0.443													57	184	---	---	---	---	PASS
ATF7IP	55729	broad.mit.edu	37	12	14576847	14576847	+	5'UTR	SNP	A	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14576847A>G	uc001rbw.2	+	2					ATF7IP_uc010shs.1_5'UTR|ATF7IP_uc001rbu.2_5'UTR|ATF7IP_uc001rbv.1_5'UTR|ATF7IP_uc001rbx.2_5'UTR|ATF7IP_uc010sht.1_5'UTR|ATF7IP_uc001rby.3_5'UTR|ATF7IP_uc001rbz.1_5'UTR|ATF7IP_uc001rca.2_5'UTR|ATF7IP_uc001rcb.2_5'Flank	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting						DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						TTAAAGATTCAGAATGGACAG	0.363													11	59	---	---	---	---	PASS
PDE3A	5139	broad.mit.edu	37	12	20799885	20799885	+	Splice_Site	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20799885G>T	uc001reh.1	+	12	2587	c.2565_splice	c.e12+1	p.Q855_splice		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A						lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	TGCTCCTCAGGTAAATCTTTA	0.403													41	144	---	---	---	---	PASS
PDE3A	5139	broad.mit.edu	37	12	20799886	20799886	+	Splice_Site	SNP	T	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20799886T>A	uc001reh.1	+	12	2587	c.2565_splice	c.e12+2	p.Q855_splice		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A						lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	GCTCCTCAGGTAAATCTTTAG	0.408													40	144	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49421838	49421838	+	Silent	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49421838G>A	uc001rta.3	-	46	14469	c.14469C>T	c.(14467-14469)CCC>CCT	p.P4823P		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	4823					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CTGCCCGGGCGGGGCTCTCTG	0.622			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			12	66	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49445909	49445909	+	Silent	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49445909G>A	uc001rta.3	-	10	1557	c.1557C>T	c.(1555-1557)CCC>CCT	p.P519P		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	519	15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GTGGAGACAAGGGCGACTCCT	0.607			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			15	54	---	---	---	---	PASS
ERBB3	2065	broad.mit.edu	37	12	56494839	56494839	+	Intron	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56494839C>T	uc001sjh.2	+						ERBB3_uc009zoj.2_Intron|ERBB3_uc010sqb.1_Intron|ERBB3_uc010sqc.1_Intron|ERBB3_uc009zok.2_Intron|ERBB3_uc001sjk.2_Intron|ERBB3_uc001sjl.2_Intron	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor						cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			TTATTTTCTTCCTTAGGAGTC	0.443													14	45	---	---	---	---	PASS
KIF5A	3798	broad.mit.edu	37	12	57974791	57974791	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57974791G>T	uc001sor.1	+	24	2799	c.2591G>T	c.(2590-2592)CGA>CTA	p.R864L	KIF5A_uc010srr.1_Missense_Mutation_p.R775L	NM_004984	NP_004975	Q12840	KIF5A_HUMAN	kinesin family member 5A	864					blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3						TTGGAAAAACGACTTAGGGCT	0.557													11	41	---	---	---	---	PASS
CNOT2	4848	broad.mit.edu	37	12	70740017	70740017	+	Silent	SNP	A	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70740017A>G	uc001svv.2	+	15	2028	c.1449A>G	c.(1447-1449)CCA>CCG	p.P483P	CNOT2_uc009zro.2_Silent_p.P483P|CNOT2_uc009zrp.2_Silent_p.P463P|CNOT2_uc009zrq.2_Silent_p.P483P	NM_014515	NP_055330	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	483					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity				0	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			CCAGGGCACCAGGCATGGAGC	0.373													25	138	---	---	---	---	PASS
MED13L	23389	broad.mit.edu	37	12	116457205	116457205	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116457205A>C	uc001tvw.2	-	7	888	c.833T>G	c.(832-834)ATG>AGG	p.M278R		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	278					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		AGGGTAAACCATCCGAACACC	0.438													16	82	---	---	---	---	PASS
FLT3	2322	broad.mit.edu	37	13	28601260	28601260	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28601260A>T	uc001urw.2	-	17	2254	c.2172T>A	c.(2170-2172)AGT>AGA	p.S724R	FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Missense_Mutation_p.S724R	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor	724	Protein kinase.|Cytoplasmic (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	TGGGGTAAAAACTGAAATTGT	0.383			Mis|O		AML|ALL								64	214	---	---	---	---	PASS
DCLK1	9201	broad.mit.edu	37	13	36521578	36521578	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36521578T>G	uc001uvf.2	-	4	973	c.740A>C	c.(739-741)GAC>GCC	p.D247A		NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1	247	Doublecortin 2.				cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		ACCAAAAAAGTCCTGAAGGCA	0.423													10	29	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22521020	22521020	+	Intron	SNP	G	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22521020G>C	uc001wbw.2	+						uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CTCTTTTTCTGAACAGGGGTG	0.408													23	163	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22932179	22932179	+	Intron	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22932179T>C	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001wdx.3_Missense_Mutation_p.F74S|uc010ajs.1_Missense_Mutation_p.F74S|uc001wdz.3_Missense_Mutation_p.F74S|uc010tms.1_Missense_Mutation_p.F74S|uc010ajt.2_Missense_Mutation_p.F99S|uc010aju.1_Missense_Mutation_p.F99S|uc001wea.3_Missense_Mutation_p.F99S					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TCCACTGACTTTGAAGTGAAG	0.408													25	121	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23894936	23894936	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23894936C>G	uc001wjx.2	-	20	2360	c.2254G>C	c.(2254-2256)GAT>CAT	p.D752H		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	752	Myosin head-like.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TGGTTGTGATCAATGTCCAGG	0.498													24	137	---	---	---	---	PASS
DHRS4L2	317749	broad.mit.edu	37	14	24470139	24470139	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24470139G>A	uc001wli.3	+	4	606	c.476G>A	c.(475-477)CGA>CAA	p.R159Q	DHRS4_uc001wlc.3_Intron|DHRS4L2_uc001wld.3_Intron|DHRS4L2_uc001wle.3_Intron|DHRS4L2_uc001wlg.3_Intron|DHRS4L2_uc001wlh.3_Intron|DHRS4L2_uc010tnt.1_Intron|DHRS4L2_uc010alb.2_Missense_Mutation_p.R33Q	NM_198083	NP_932349	D5KJA1	D5KJA1_HUMAN	dehydrogenase/reductase (SDR family) member 4	97							binding|oxidoreductase activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00962)		ATGGAGAAACGAGGGTACAGA	0.547													11	69	---	---	---	---	PASS
RALGAPA1	253959	broad.mit.edu	37	14	36240136	36240136	+	Intron	SNP	T	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36240136T>A	uc001wti.2	-						RALGAPA1_uc001wtj.2_Intron|RALGAPA1_uc010tpv.1_Intron|RALGAPA1_uc010tpw.1_Intron	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1						activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						AATACATATTTGAATTACTTA	0.244													6	21	---	---	---	---	PASS
LTBP2	4053	broad.mit.edu	37	14	75070376	75070376	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75070376C>G	uc001xqa.2	-	2	914	c.527G>C	c.(526-528)GGA>GCA	p.G176A		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	176					protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TGTTGTCCATCCTGGGCAGCA	0.562													21	54	---	---	---	---	PASS
BDKRB2	624	broad.mit.edu	37	14	96707852	96707852	+	3'UTR	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96707852G>T	uc010avm.1	+	3					BDKRB2_uc010avl.1_3'UTR|BDKRB2_uc010twu.1_3'UTR|BDKRB2_uc001yfg.2_3'UTR	NM_000623	NP_000614	P30411	BKRB2_HUMAN	bradykinin receptor B2						arachidonic acid secretion|elevation of cytosolic calcium ion concentration|transmembrane receptor protein tyrosine kinase signaling pathway	endosome|integral to plasma membrane	bradykinin receptor activity|phosphatidylinositol phospholipase C activity|protease binding|protein heterodimerization activity|type 1 angiotensin receptor binding			ovary(3)|breast(1)|kidney(1)	5		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)		GCAAACGCCAGCAGGGCTGCT	0.542													10	43	---	---	---	---	PASS
PACS2	23241	broad.mit.edu	37	14	105860993	105860993	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105860993C>G	uc001yqt.2	+	24	2829	c.2654C>G	c.(2653-2655)TCC>TGC	p.S885C	PACS2_uc001yqs.2_Missense_Mutation_p.S810C|PACS2_uc001yqv.2_Missense_Mutation_p.S889C|PACS2_uc001yqu.2_Missense_Mutation_p.S900C	NM_015197	NP_056012	Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	885					apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion				pancreas(1)	1		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		TTCGGACACTCCAAGGCCACC	0.597													19	106	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106453064	106453064	+	RNA	SNP	T	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106453064T>A	uc010tyt.1	-	1974		c.37775A>T								Parts of antibodies, mostly variable regions.												0						CTCTTACCTGTGGCTGCTGCC	0.552													11	15	---	---	---	---	PASS
SNRPN	6638	broad.mit.edu	37	15	25220572	25220572	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25220572G>T	uc001ywp.1	+	8	961	c.71G>T	c.(70-72)GGC>GTC	p.G24V	SNRPN_uc001ywq.1_Missense_Mutation_p.G24V|SNRPN_uc001ywr.1_Missense_Mutation_p.G24V|SNRPN_uc001yws.1_Missense_Mutation_p.G24V|SNRPN_uc001ywt.1_Missense_Mutation_p.G24V|SNRPN_uc001ywv.1_Missense_Mutation_p.G27V|SNRPN_uc001yww.1_Missense_Mutation_p.G24V|SNRPN_uc001ywx.1_Missense_Mutation_p.G24V|SNRPN_uc001ywz.1_Intron|PAR-SN_uc001yxa.1_Intron|SNRPN_uc001ywy.1_3'UTR	NM_022807	NP_073718	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	24					RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding			ovary(1)	1		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		CTGCAAGATGGCCGAATCTTC	0.418									Prader-Willi_syndrome				31	174	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31294542	31294542	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31294542C>A	uc001zfm.2	-	27	4423	c.4295G>T	c.(4294-4296)TGT>TTT	p.C1432F	TRPM1_uc010azy.2_Missense_Mutation_p.C1339F|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	1432	Cytoplasmic (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CATTGTTTTACAAGCATTGAT	0.448													52	222	---	---	---	---	PASS
CHRM5	1133	broad.mit.edu	37	15	34356323	34356323	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34356323G>C	uc001zhk.1	+	3	2075	c.1405G>C	c.(1405-1407)GAC>CAC	p.D469H	CHRM5_uc001zhl.1_Missense_Mutation_p.D469H	NM_012125	NP_036257	P08912	ACM5_HUMAN	cholinergic receptor, muscarinic 5	469	Extracellular (By similarity).				cell proliferation|inhibition of adenylate cyclase activity by muscarinic acetylcholine receptor signaling pathway	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;1.76e-08)		all cancers(64;4.82e-17)|GBM - Glioblastoma multiforme(113;2.58e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	Atropine(DB00572)|Benzquinamide(DB00767)|Cryptenamine(DB00785)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Thiethylperazine(DB00372)	TACCTTCTGTGACAAGTGTGT	0.507													30	162	---	---	---	---	PASS
ATPBD4	89978	broad.mit.edu	37	15	35746978	35746978	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35746978G>C	uc001zja.2	-	4	418	c.356C>G	c.(355-357)TCT>TGT	p.S119C	ATPBD4_uc001ziz.2_Missense_Mutation_p.S103C	NM_080650	NP_542381	Q7L8W6	ATBD4_HUMAN	ATP binding domain 4 isoform 1	119											0		all_epithelial(112;2.11e-09)|Lung NSC(122;2.38e-08)|all_lung(180;3.65e-07)		all cancers(64;9.9e-19)|GBM - Glioblastoma multiforme(113;2.01e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)		CTGATAGTCAGAAAGTATAGC	0.284													28	166	---	---	---	---	PASS
ZSCAN29	146050	broad.mit.edu	37	15	43662013	43662013	+	Silent	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43662013C>G	uc001zrk.1	-	1	246	c.99G>C	c.(97-99)CGG>CGC	p.R33R	ZSCAN29_uc001zrj.1_5'Flank|ZSCAN29_uc010bdf.1_Silent_p.R32R|ZSCAN29_uc001zrl.1_RNA|ZSCAN29_uc010bdg.1_Silent_p.R32R|ZSCAN29_uc001zrm.2_Silent_p.R32R|TUBGCP4_uc001zrn.2_5'Flank|TUBGCP4_uc001zro.2_5'Flank	NM_152455	NP_689668	Q8IWY8	ZSC29_HUMAN	zinc finger protein 690	33	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		TGAAAGCCTCCCGCGGCCCAG	0.542													14	97	---	---	---	---	PASS
TP53BP1	7158	broad.mit.edu	37	15	43762214	43762214	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43762214G>A	uc001zrs.2	-	11	1364	c.1216C>T	c.(1216-1218)CAG>TAG	p.Q406*	TP53BP1_uc010udp.1_Nonsense_Mutation_p.Q406*|TP53BP1_uc001zrq.3_Nonsense_Mutation_p.Q411*|TP53BP1_uc001zrr.3_Nonsense_Mutation_p.Q411*|TP53BP1_uc010udq.1_Nonsense_Mutation_p.Q411*	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	406					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		AGTTTCTTCTGAAAAGGCTCT	0.423								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					44	157	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53992045	53992045	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53992045T>G	uc002acj.2	-	13	1709	c.1667A>C	c.(1666-1668)CAC>CCC	p.H556P	WDR72_uc010bfi.1_Missense_Mutation_p.H556P	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	556	WD 8.									lung(1)|skin(1)	2				all cancers(107;0.0511)		AGGAAAAAGGTGCTTCCGGGC	0.468													71	250	---	---	---	---	PASS
IGDCC3	9543	broad.mit.edu	37	15	65623451	65623451	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65623451C>T	uc002aos.2	-	9	1750	c.1498G>A	c.(1498-1500)GCC>ACC	p.A500T	IGDCC3_uc002aor.1_5'Flank	NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule	500	Extracellular (Potential).|Fibronectin type-III 1.									ovary(3)	3						GGTGTGTAGGCCTTGATGTAG	0.607													51	247	---	---	---	---	PASS
TLE3	7090	broad.mit.edu	37	15	70351755	70351755	+	Silent	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70351755G>A	uc002asm.2	-	10	1878	c.759C>T	c.(757-759)TCC>TCT	p.S253S	TLE3_uc002ask.2_Silent_p.S197S|TLE3_uc002asl.2_Silent_p.S258S|TLE3_uc010ukd.1_Silent_p.S246S|TLE3_uc010bik.1_Intron|TLE3_uc010bil.1_Silent_p.S253S|TLE3_uc002asn.2_Silent_p.S253S|TLE3_uc002asp.2_Silent_p.S253S|TLE3_uc002aso.2_Silent_p.S253S	NM_005078	NP_005069	Q04726	TLE3_HUMAN	transducin-like enhancer protein 3 isoform a	253	CCN domain.				organ morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|protein binding			lung(2)	2						ATACCTCATTGGAAACATCCA	0.522													5	24	---	---	---	---	PASS
C15orf60	283677	broad.mit.edu	37	15	73843356	73843356	+	Silent	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73843356T>C	uc002avq.2	+	4	439	c.411T>C	c.(409-411)GTT>GTC	p.V137V	C15orf60_uc010bjb.2_Silent_p.V109V	NM_001042367	NP_001035826	Q7Z4M0	CO060_HUMAN	hypothetical protein LOC283677	137										pancreas(1)	1						GCAGTTGTGTTCAGAAGCTGG	0.502													13	89	---	---	---	---	PASS
SGK269	79834	broad.mit.edu	37	15	77425619	77425619	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77425619G>A	uc002bcm.2	-	5	4113	c.3805C>T	c.(3805-3807)CAG>TAG	p.Q1269*		NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	1269					cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		TGCGGCTTCTGGATGCCTCGG	0.512													46	122	---	---	---	---	PASS
TELO2	9894	broad.mit.edu	37	16	1545551	1545551	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1545551C>A	uc002cly.2	+	3	831	c.540C>A	c.(538-540)TTC>TTA	p.F180L	TELO2_uc010uvg.1_Missense_Mutation_p.F180L	NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog	180						chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)				CCGAGTTCTTCCCCCAGAACT	0.672													9	103	---	---	---	---	PASS
IFT140	9742	broad.mit.edu	37	16	1561094	1561094	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1561094A>G	uc002cmb.2	-	31	4602	c.4240T>C	c.(4240-4242)TAC>CAC	p.Y1414H	IFT140_uc002clz.2_Missense_Mutation_p.Y1027H	NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140	1414										ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				GGGCTCACGTAGTAGGACATG	0.652													5	15	---	---	---	---	PASS
SEZ6L2	26470	broad.mit.edu	37	16	29883585	29883585	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29883585A>G	uc002duq.3	-	16	2866	c.2626T>C	c.(2626-2628)TTC>CTC	p.F876L	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Missense_Mutation_p.F819L|SEZ6L2_uc002dur.3_Missense_Mutation_p.F806L|SEZ6L2_uc002dus.3_Missense_Mutation_p.F775L|SEZ6L2_uc010vec.1_Missense_Mutation_p.F889L|SEZ6L2_uc010ved.1_Missense_Mutation_p.F845L	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform	876	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						GAGAAGCCGAAAAGGGACTTT	0.607													14	52	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49672053	49672053	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49672053C>A	uc002efs.2	-	5	1308	c.1010G>T	c.(1009-1011)GGT>GTT	p.G337V	ZNF423_uc010vgn.1_Missense_Mutation_p.G220V	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	337	C2H2-type 8.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				GCAGTAGACACCTTCCACTGA	0.617													8	41	---	---	---	---	PASS
TXNL4B	54957	broad.mit.edu	37	16	72122950	72122950	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72122950C>G	uc002fca.2	-	3	531	c.220G>C	c.(220-222)GAC>CAC	p.D74H	TXNL4B_uc010cgl.2_RNA|TXNL4B_uc010vmn.1_Missense_Mutation_p.D74H|TXNL4B_uc010vmo.1_Missense_Mutation_p.D74H	NM_017853	NP_060323	Q9NX01	TXN4B_HUMAN	thioredoxin-like 4B	74					mitosis|mRNA processing|RNA splicing	spliceosomal complex				ovary(1)	1						TAACTGATGTCAAAATACTGT	0.378													40	184	---	---	---	---	PASS
NUDT7	283927	broad.mit.edu	37	16	77775789	77775789	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77775789T>C	uc010chd.2	+	4	728	c.659T>C	c.(658-660)TTA>TCA	p.L220S	NUDT7_uc010vnj.1_Missense_Mutation_p.L167S	NM_001105663	NP_001099133	P0C024	NUDT7_HUMAN	nudix motif 7	220					nucleoside diphosphate metabolic process	peroxisome	hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides|magnesium ion binding|manganese ion binding			ovary(1)|kidney(1)	2						AATGATGTATTAGCATCCTCT	0.378													41	151	---	---	---	---	PASS
KIAA0513	9764	broad.mit.edu	37	16	85111096	85111096	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85111096A>T	uc002fiu.2	+	6	860	c.640A>T	c.(640-642)AAA>TAA	p.K214*	KIAA0513_uc002fis.3_Nonsense_Mutation_p.K214*|KIAA0513_uc010voj.1_Nonsense_Mutation_p.K214*|KIAA0513_uc002fit.2_Nonsense_Mutation_p.K214*	NM_014732	NP_055547	O60268	K0513_HUMAN	hypothetical protein LOC9764	214						cytoplasm				breast(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.234)		CTCCTACCTGAAATCCGCAAA	0.607													8	47	---	---	---	---	PASS
GSDMB	55876	broad.mit.edu	37	17	38073396	38073396	+	Silent	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38073396C>T	uc010cwj.2	-	1	179	c.174G>A	c.(172-174)CTG>CTA	p.L58L	GSDMB_uc010cwk.2_RNA|GSDMB_uc010cwl.2_RNA|GSDMB_uc010cwm.2_RNA|GSDMB_uc002htg.2_Silent_p.L58L|GSDMB_uc002hth.2_Silent_p.L58L|GSDMB_uc010wem.1_Silent_p.L58L	NM_001042471	NP_001035936	Q8TAX9	GSDMB_HUMAN	gasdermin B isoform 1	58						cytoplasm				breast(1)|pancreas(1)	2						GAATGTCCATCAGGGTGAGGC	0.517													29	127	---	---	---	---	PASS
KRT20	54474	broad.mit.edu	37	17	39034494	39034494	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39034494G>A	uc002hvl.2	-	6	1084	c.1042C>T	c.(1042-1044)CGC>TGC	p.R348C		NM_019010	NP_061883	P35900	K1C20_HUMAN	keratin 20	348	Rod.|Coil 2.				apoptosis|intermediate filament organization	Golgi apparatus|intermediate filament	protein binding|structural constituent of cytoskeleton			large_intestine(1)|kidney(1)|skin(1)	3		Breast(137;0.000301)|Ovarian(249;0.15)				TTGTTCTGGCGTTCCATGTTA	0.498													66	190	---	---	---	---	PASS
ENGASE	64772	broad.mit.edu	37	17	77073513	77073513	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77073513A>T	uc002jwv.2	+	2	156	c.148A>T	c.(148-150)ATC>TTC	p.I50F	ENGASE_uc002jwu.1_Missense_Mutation_p.I50F|ENGASE_uc010wtz.1_5'UTR|ENGASE_uc002jww.2_5'Flank	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	50						cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						TTTGCTTAGCATCAAAGATGA	0.423													6	56	---	---	---	---	PASS
ENPP7	339221	broad.mit.edu	37	17	77705076	77705076	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77705076C>T	uc002jxa.2	+	1	195	c.175C>T	c.(175-177)CGA>TGA	p.R59*		NM_178543	NP_848638	Q6UWV6	ENPP7_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	59					negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity			central_nervous_system(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CGCCATGGCCCGAGACGGGGT	0.632													6	18	---	---	---	---	PASS
SMAD4	4089	broad.mit.edu	37	18	48581243	48581243	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48581243C>T	uc010xdp.1	+	5	1085	c.547C>T	c.(547-549)CAG>TAG	p.Q183*	SMAD4_uc010xdo.1_RNA|SMAD4_uc002lfb.3_Nonsense_Mutation_p.Q28*	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	183					BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.?(3)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TCAAACCATCCAGCATCCACC	0.468									Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				48	152	---	---	---	---	PASS
TMX3	54495	broad.mit.edu	37	18	66344308	66344308	+	Silent	SNP	T	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66344308T>G	uc002lkf.2	-	16	1362	c.1227A>C	c.(1225-1227)CGA>CGC	p.R409R	TMX3_uc010xez.1_Silent_p.R268R	NM_019022	NP_061895	Q96JJ7	TMX3_HUMAN	thioredoxin domain containing 10 precursor	409	Cytoplasmic (Potential).				cell redox homeostasis|glycerol ether metabolic process	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			skin(1)	1						ACACTTCATATCGTTCTTCTA	0.458													42	182	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9085145	9085145	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9085145C>G	uc002mkp.2	-	1	6874	c.6670G>C	c.(6670-6672)GCA>CCA	p.A2224P		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2224	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGTGGACCTGCGCTGTTTACT	0.483													28	62	---	---	---	---	PASS
OR10H1	26539	broad.mit.edu	37	19	15918457	15918457	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15918457G>T	uc002nbq.2	-	1	480	c.391C>A	c.(391-393)CGC>AGC	p.R131S		NM_013940	NP_039228	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H,	131	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ACGTTGTAGCGCAGGGGGTGG	0.632													11	24	---	---	---	---	PASS
MEGF8	1954	broad.mit.edu	37	19	42839328	42839328	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42839328G>T	uc002otl.3	+	4	1335	c.700G>T	c.(700-702)GCC>TCC	p.A234S	MEGF8_uc002otm.3_5'Flank	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	234	Extracellular (Potential).					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				GGCAGCTGGCGCCTTCCTGTC	0.652													13	21	---	---	---	---	PASS
PSG11	5680	broad.mit.edu	37	19	43523115	43523115	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43523115C>G	uc002ovm.1	-	3	623	c.516G>C	c.(514-516)GAG>GAC	p.E172D	PSG11_uc002ouw.2_Missense_Mutation_p.E178D|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Missense_Mutation_p.E178D|PSG11_uc002ovn.1_Missense_Mutation_p.E178D|PSG11_uc002ovo.1_Missense_Mutation_p.E50D|PSG11_uc002ovp.1_Missense_Mutation_p.E50D	NM_002785	NP_002776	Q9UQ72	PSG11_HUMAN	pregnancy specific beta-1-glycoprotein 11	172	Ig-like C2-type 1.				female pregnancy	extracellular region					0		Prostate(69;0.00682)				CGTCCGGAGTCTCAGGATTAC	0.517													90	375	---	---	---	---	PASS
KLK5	25818	broad.mit.edu	37	19	51453310	51453310	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51453310T>A	uc002pue.2	-	4	354	c.136A>T	c.(136-138)AGC>TGC	p.S46C	KLK5_uc002puf.2_Missense_Mutation_p.S46C|KLK5_uc002pug.2_Missense_Mutation_p.S46C	NM_001077491	NP_001070959	Q9Y337	KLK5_HUMAN	kallikrein-related peptidase 5 preproprotein	46				Missing (in Ref. 3; AAG33358).	epidermis development|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)		TCCTGGTTGCTCCCAGAGGGC	0.617													6	22	---	---	---	---	PASS
SIGLEC8	27181	broad.mit.edu	37	19	51958757	51958757	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51958757A>T	uc002pwt.2	-	4	1033	c.966T>A	c.(964-966)GAT>GAA	p.D322E	SIGLEC8_uc010yda.1_Missense_Mutation_p.D213E|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_Missense_Mutation_p.D229E	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	322	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		ATTCCCCTTCATCCCTCACGT	0.652													12	24	---	---	---	---	PASS
EPS8L1	54869	broad.mit.edu	37	19	55592768	55592768	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55592768C>G	uc002qis.3	+	8	786	c.682C>G	c.(682-684)CCG>GCG	p.P228A	EPS8L1_uc010ess.1_Missense_Mutation_p.P210A|EPS8L1_uc010est.1_Missense_Mutation_p.P228A|EPS8L1_uc010yfr.1_Missense_Mutation_p.P164A|EPS8L1_uc010esu.1_RNA|EPS8L1_uc002qiu.2_Missense_Mutation_p.P101A|EPS8L1_uc002qiv.2_5'Flank|EPS8L1_uc002qiw.2_5'Flank	NM_133180	NP_573441	Q8TE68	ES8L1_HUMAN	epidermal growth factor receptor pathway	228						cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GAGGCCTGAGCCGGTGGGGAC	0.726													4	7	---	---	---	---	PASS
ZNF587	84914	broad.mit.edu	37	19	58301708	58301708	+	5'UTR	SNP	G	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58301708G>C	uc002qqb.2	+	4					ZNF586_uc002qqf.1_RNA	NM_032828	NP_116217	Q96SQ5	ZN587_HUMAN	zinc finger protein 587						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		TCTTAATGAGGCTCAGGGATG	0.453													52	292	---	---	---	---	PASS
C20orf71	128861	broad.mit.edu	37	20	31814274	31814274	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31814274T>A	uc002wyr.2	+	5	807	c.599T>A	c.(598-600)CTC>CAC	p.L200H	C20orf71_uc002wys.2_Missense_Mutation_p.L164H	NM_178466	NP_848561	Q9BQP9	SPLC3_HUMAN	short long palate, lung and nasal epithelium	200						extracellular region	lipid binding			ovary(1)|skin(1)	2						CAAAAAGTTCTCCCACACATG	0.408													50	125	---	---	---	---	PASS
PPP1R16B	26051	broad.mit.edu	37	20	37531333	37531333	+	Silent	SNP	C	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37531333C>T	uc002xje.2	+	6	783	c.594C>T	c.(592-594)AAC>AAT	p.N198N	PPP1R16B_uc010ggc.2_Silent_p.N198N	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor	198					regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				AGAAAATCAACGAGATGCGGG	0.587													93	122	---	---	---	---	PASS
TSHZ2	128553	broad.mit.edu	37	20	51870996	51870996	+	Silent	SNP	C	T	T	rs138194448		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51870996C>T	uc002xwo.2	+	2	1955	c.999C>T	c.(997-999)CCC>CCT	p.P333P		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	333					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			CGTGTTCCCCCGATTCAACCA	0.483													166	158	---	---	---	---	PASS
LZTR1	8216	broad.mit.edu	37	22	21337317	21337317	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21337317C>G	uc002zto.2	+	2	305	c.202C>G	c.(202-204)CGC>GGC	p.R68G	LZTR1_uc002ztn.2_Missense_Mutation_p.R27G|LZTR1_uc011ahy.1_Missense_Mutation_p.R68G	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	68					anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			TCTTTCCAGGCGCAGCAAGCA	0.542													22	90	---	---	---	---	PASS
SEZ6L	23544	broad.mit.edu	37	22	26695130	26695130	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26695130G>A	uc003acb.2	+	5	1499	c.1343G>A	c.(1342-1344)TGC>TAC	p.C448Y	SEZ6L_uc003acc.2_Missense_Mutation_p.C448Y|SEZ6L_uc011akc.1_Missense_Mutation_p.C448Y|SEZ6L_uc003acd.2_Missense_Mutation_p.C448Y|SEZ6L_uc011akd.1_Missense_Mutation_p.C448Y|SEZ6L_uc003ace.2_Missense_Mutation_p.C448Y|SEZ6L_uc003acf.1_Missense_Mutation_p.C221Y|SEZ6L_uc010gvc.1_Missense_Mutation_p.C221Y	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	448	Sushi 1.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						GAGCCCATCTGCTCAGGTATG	0.582													3	6	---	---	---	---	PASS
THOC5	8563	broad.mit.edu	37	22	29924107	29924107	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29924107C>A	uc003afr.2	-	12	1361	c.1026G>T	c.(1024-1026)AAG>AAT	p.K342N	THOC5_uc003afq.2_Missense_Mutation_p.K3N|THOC5_uc003afs.2_Missense_Mutation_p.K342N|THOC5_uc003aft.2_Missense_Mutation_p.K342N|THOC5_uc003afu.2_Missense_Mutation_p.K342N|THOC5_uc010gvo.2_Missense_Mutation_p.K86N	NM_001002878	NP_001002878	Q13769	THOC5_HUMAN	THO complex 5	342					intronless viral mRNA export from host nucleus|monocyte differentiation|mRNA processing|primitive hemopoiesis|RNA splicing	cytoplasm|intermediate filament cytoskeleton|THO complex part of transcription export complex	protein binding|RNA binding			breast(3)	3						GTGGGTGCCTCTTCAGCATCT	0.527													37	104	---	---	---	---	PASS
SOX10	6663	broad.mit.edu	37	22	38369863	38369863	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38369863G>A	uc003aun.1	-	4	1318	c.1040C>T	c.(1039-1041)CCA>CTA	p.P347L	POLR2F_uc003aum.2_Intron|SOX10_uc003auo.1_Missense_Mutation_p.P347L	NM_006941	NP_008872	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	347						cytoplasm|nucleus	DNA binding|identical protein binding|transcription coactivator activity				0	Melanoma(58;0.045)					CACACCAGGTGGTGAGACCGT	0.672													11	55	---	---	---	---	PASS
KLHL34	257240	broad.mit.edu	37	X	21675151	21675151	+	Silent	SNP	G	A	A			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21675151G>A	uc004czz.1	-	1	1298	c.756C>T	c.(754-756)ATC>ATT	p.I252I		NM_153270	NP_695002	Q8N239	KLH34_HUMAN	kelch-like 34	252										ovary(1)	1						GGGCCTGGATGATGAGGCCCT	0.687													7	9	---	---	---	---	PASS
PRRG1	5638	broad.mit.edu	37	X	37312768	37312768	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37312768G>C	uc004ddn.2	+	5	804	c.551G>C	c.(550-552)AGT>ACT	p.S184T	PRRG1_uc004ddo.2_Missense_Mutation_p.S184T	NM_000950	NP_000941	O14668	TMG1_HUMAN	proline rich Gla (G-carboxyglutamic acid) 1	184	Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	calcium ion binding			ovary(1)|breast(1)	2						CTGCAGAGGAGTGAAACAGAA	0.532													14	35	---	---	---	---	PASS
DCAF12L1	139170	broad.mit.edu	37	X	125685455	125685455	+	Silent	SNP	G	C	C	rs149056465	byFrequency	TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125685455G>C	uc004eul.2	-	1	1388	c.1137C>G	c.(1135-1137)GCC>GCG	p.A379A		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	379	WD 4.									skin(3)|ovary(1)	4						GGAATTTCTGGGCCCGGACGT	0.632													24	46	---	---	---	---	PASS
EIF4G3	8672	broad.mit.edu	37	1	21299378	21299378	+	Intron	DEL	A	-	-	rs76449388		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21299378delA	uc001bec.2	-						EIF4G3_uc010odi.1_Intron|EIF4G3_uc010odj.1_Intron|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bef.2_Intron|EIF4G3_uc001bee.2_Intron|EIF4G3_uc001beg.2_Intron|EIF4G3_uc010odk.1_Intron|EIF4G3_uc001beh.2_Intron	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		AGGGAAGAATAAAAAAAAAAA	0.284													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	74320644	74320647	+	IGR	DEL	GAAA	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74320644_74320647delGAAA								None (None upstream) : LRRIQ3 (171057 downstream)																							aggaaggaaggaaagaaagaaaga	0.132													4	2	---	---	---	---	
GIPC2	54810	broad.mit.edu	37	1	78509970	78509970	+	5'Flank	DEL	T	-	-	rs112459517		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78509970delT	uc001dik.2	+							NM_017655	NP_060125	Q8TF65	GIPC2_HUMAN	PDZ domain protein GIPC2							cytoplasm				ovary(1)	1						TATCCTAAAGttttttttttt	0.199													4	2	---	---	---	---	
TUFT1	7286	broad.mit.edu	37	1	151518480	151518480	+	Intron	DEL	T	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151518480delT	uc001eyl.2	+						TUFT1_uc001eym.2_Intron|TUFT1_uc010pdf.1_Intron|TUFT1_uc010pdg.1_Intron	NM_020127	NP_064512	Q9NNX1	TUFT1_HUMAN	tuftelin 1 isoform 1						bone mineralization|odontogenesis	cytoplasm|extracellular region	structural constituent of tooth enamel				0	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			catttttttcttttttttttt	0.139													6	3	---	---	---	---	
MTX1	4580	broad.mit.edu	37	1	155182776	155182776	+	Intron	DEL	G	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155182776delG	uc001fjb.2	+						RAG1AP1_uc010pey.1_Intron|MTX1_uc001fjc.2_Intron	NM_002455	NP_002446	Q13505	MTX1_HUMAN	metaxin 1 isoform 1						protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane	protein binding			skin(1)	1	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AGGCACAGGAGGGGCCTGAAG	0.612													4	2	---	---	---	---	
GAS5	60674	broad.mit.edu	37	1	173836247	173836248	+	RNA	INS	-	A	A	rs145452199	by1000genomes	TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173836247_173836248insA	uc001gji.2	-	1		c.1_2insT			GAS5_uc001gjj.2_Intron|GAS5_uc001gjk.2_Intron|SNORD81_uc009wwi.1_5'Flank|SNORD47_uc001gjl.2_5'Flank|SNORD80_uc009wwj.1_5'Flank|SNORD79_uc009wwk.1_5'Flank|SNORD78_uc009wwl.2_5'Flank|SNORD44_uc001gjn.1_5'Flank|SNORD77_uc009wwm.1_5'Flank|SNORD76_uc009wwn.1_5'Flank|SNORD75_uc009wwo.1_5'Flank|ZBTB37_uc001gjp.1_5'Flank|ZBTB37_uc001gjq.3_5'Flank|ZBTB37_uc009wwp.1_5'Flank|ZBTB37_uc001gjr.2_5'Flank					Homo sapiens mRNA; cDNA DKFZp564D0164 (from clone DKFZp564D0164).												0						GAGTGTTCTTTAAAAAAACGGT	0.381													7	4	---	---	---	---	
LYST	1130	broad.mit.edu	37	1	235856538	235856539	+	Intron	INS	-	C	C	rs145478476	by1000genomes	TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235856538_235856539insC	uc001hxj.2	-						LYST_uc001hxi.2_Intron	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			aatggcgtgagccgggaggtgg	0.000									Chediak-Higashi_syndrome				3	4	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237850666	237850666	+	Intron	DEL	C	-	-	rs41267515		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237850666delC	uc001hyl.1	+						RYR2_uc010pxz.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ttttcttcttctttttttttt	0.328													4	2	---	---	---	---	
SPAST	6683	broad.mit.edu	37	2	32340026	32340027	+	Intron	INS	-	T	T	rs67016851		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32340026_32340027insT	uc002roc.2	+						SPAST_uc002rod.2_Intron	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1						cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					ATAAAGTTAAAttttttttttt	0.114													8	6	---	---	---	---	
UGP2	7360	broad.mit.edu	37	2	64082652	64082654	+	Intron	DEL	CTG	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64082652_64082654delCTG	uc002scm.2	+						UGP2_uc002scl.2_Intron|UGP2_uc010ypx.1_Intron	NM_006759	NP_006750	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2 isoform a						glycogen biosynthetic process|phosphorylation|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	metal ion binding|protein binding|UTP:glucose-1-phosphate uridylyltransferase activity				0						Gtttctttttctgtttttttttt	0.158													6	3	---	---	---	---	
C2orf3	6936	broad.mit.edu	37	2	75921232	75921233	+	Intron	INS	-	CTTA	CTTA	rs146089373	by1000genomes	TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75921232_75921233insCTTA	uc002sno.2	-						C2orf3_uc010ffs.2_Intron|C2orf3_uc002snn.2_Intron|C2orf3_uc010fft.2_Intron	NM_003203	NP_003194	P16383	GCF_HUMAN	hypothetical protein LOC6936						negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						ttaagagaatgCTATCATCTTA	0.139													5	3	---	---	---	---	
KLHL23	151230	broad.mit.edu	37	2	170606424	170606427	+	3'UTR	DEL	TATA	-	-	rs72113382		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170606424_170606427delTATA	uc002ufh.1	+	6					KLHL23_uc002ufi.1_3'UTR|uc002ufj.3_5'Flank	NM_144711	NP_653312	Q8NBE8	KLH23_HUMAN	kelch-like 23												0						AGAAAAATCTtatatatatatata	0.191													4	2	---	---	---	---	
SPATS2L	26010	broad.mit.edu	37	2	201277012	201277012	+	Intron	DEL	T	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201277012delT	uc002uvn.3	+						SPATS2L_uc010fst.2_Intron|SPATS2L_uc002uvo.3_Intron|SPATS2L_uc002uvp.3_Intron|SPATS2L_uc002uvq.3_Intron|SPATS2L_uc002uvr.3_Intron|SPATS2L_uc010zhc.1_Intron	NM_015535	NP_056350	Q9NUQ6	SPS2L_HUMAN	SPATS2-like protein isoform a							cytoplasm|nucleolus				ovary(2)|pancreas(1)	3						TTTCTATTTCTTTTTTTTTTT	0.239													16	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	216590957	216590960	+	Intron	DEL	GGAA	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216590957_216590960delGGAA	uc002vfm.1	-						uc002vfn.1_Intron					Homo sapiens cDNA FLJ34546 fis, clone HLUNG2008959.																		gagggaggagggaaggaaggaagg	0.157													6	3	---	---	---	---	
ILKAP	80895	broad.mit.edu	37	2	239081997	239081997	+	Intron	DEL	C	-	-	rs11309913		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239081997delC	uc002vxv.2	-						ILKAP_uc010zns.1_Intron|ILKAP_uc002vxw.2_Intron	NM_030768	NP_110395	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated protein							cytoplasm|protein serine/threonine phosphatase complex	metal ion binding|protein binding			ovary(3)	3		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		ccccatgtgtccccccctacc	0.070													3	5	---	---	---	---	
GRM7	2917	broad.mit.edu	37	3	7620360	7620361	+	Frame_Shift_Ins	INS	-	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7620360_7620361insT	uc003bqm.2	+	8	2041_2042	c.1767_1768insT	c.(1765-1770)CCCTGGfs	p.P589fs	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Frame_Shift_Ins_p.P589fs|GRM7_uc003bql.2_Frame_Shift_Ins_p.P589fs|GRM7_uc003bqn.1_Frame_Shift_Ins_p.P172fs|GRM7_uc010hch.1_Frame_Shift_Ins_p.P100fs	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	589_590	Extracellular (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	GGCACTCCCCCTGGGCTGTGAT	0.530													83	37	---	---	---	---	
GAP43	2596	broad.mit.edu	37	3	115439895	115439895	+	3'UTR	DEL	A	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115439895delA	uc003ebq.2	+	3					GAP43_uc003ebr.2_3'UTR	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		GCAAACatttaaaaaaaaaaa	0.413													7	4	---	---	---	---	
RAB43	339122	broad.mit.edu	37	3	128875241	128875242	+	Intron	INS	-	A	A	rs76061367		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128875241_128875242insA	uc003elo.1	-						ISY1_uc010hsz.1_Intron|ISY1_uc003elp.1_Intron|ISY1_uc010hta.1_Intron	NM_020701	NP_065752	Q86YS6	RAB43_HUMAN	ISY1 splicing factor homolog						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			lung(1)	1						gactctgtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
LIPH	200879	broad.mit.edu	37	3	185270030	185270030	+	Intron	DEL	T	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185270030delT	uc003fpm.2	-						LIPH_uc010hyh.2_Intron	NM_139248	NP_640341	Q8WWY8	LIPH_HUMAN	lipase, member H precursor						lipid catabolic process	extracellular space|plasma membrane	heparin binding|phospholipase activity			ovary(1)|pancreas(1)	2	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			AACCTGTATCTTTTTTTTTTT	0.274													2	5	---	---	---	---	
CLPTM1L	81037	broad.mit.edu	37	5	1342156	1342157	+	Intron	DEL	CA	-	-	rs31488		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1342156_1342157delCA	uc003jch.2	-						CLPTM1L_uc003jcg.2_5'Flank	NM_030782	NP_110409	Q96KA5	CLP1L_HUMAN	CLPTM1-like						apoptosis	integral to membrane				breast(1)|central_nervous_system(1)	2	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		tgtgtgtgtgCACGCGCACGCG	0.470													5	3	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	32000586	32000597	+	Intron	DEL	TTTGTTTTTGTT	-	-	rs71863988		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32000586_32000597delTTTGTTTTTGTT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CCTTAAGAAGtttgtttttgtttttgtttttg	0.222													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	170183535	170183536	+	IGR	INS	-	GAAG	GAAG			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170183535_170183536insGAAG								KCNIP1 (19901 upstream) : GABRP (27187 downstream)																							agggaaggggagaaggaaggaa	0.119													4	2	---	---	---	---	
LRRC1	55227	broad.mit.edu	37	6	53787794	53787794	+	3'UTR	DEL	T	-	-	rs67155925		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53787794delT	uc003pcd.1	+	14						NM_018214	NP_060684	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1							cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		CCCGGTGTGATTTTTTTTTTT	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	85587216	85587217	+	IGR	DEL	CA	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85587216_85587217delCA								TBX18 (113317 upstream) : NT5E (572085 downstream)																							CACATTTTTCcacacacacaca	0.262													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	98983554	98983557	+	IGR	DEL	AAGG	-	-	rs71784061		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98983554_98983557delAAGG								MIR2113 (511057 upstream) : POU3F2 (299023 downstream)																							acagagaaaaaaggaaggaaggaa	0.000													4	3	---	---	---	---	
TCP10	6953	broad.mit.edu	37	6	167794973	167794974	+	Intron	INS	-	TTTC	TTTC			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167794973_167794974insTTTC	uc003qvv.1	-						TCP10_uc003qvu.2_Intron|TCP10_uc003qvw.2_Intron	NM_004610	NP_004601	Q12799	TCP10_HUMAN	t-complex 10							cytosol				breast(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		ACCGCAGCCTTtttctttcttt	0.238													4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	24355514	24355514	+	IGR	DEL	A	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24355514delA								NPY (24037 upstream) : MPP6 (257571 downstream)																							tgtttttctgaaaaaaaAAAA	0.075													5	5	---	---	---	---	
GTF2IRD1	9569	broad.mit.edu	37	7	73974114	73974114	+	Intron	DEL	T	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73974114delT	uc003uaq.2	+						GTF2IRD1_uc010lbq.2_Intron|GTF2IRD1_uc003uap.2_Intron|GTF2IRD1_uc003uar.1_Intron	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1							nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						CCTGCCtttcttttttttttt	0.313													4	2	---	---	---	---	
CCDC146	57639	broad.mit.edu	37	7	76796901	76796901	+	Intron	DEL	A	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76796901delA	uc003uga.2	+						CCDC146_uc003ufz.1_Intron	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146											ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				GTTTATTTTTATTATTTTCCA	0.264													6	3	---	---	---	---	
TAS2R40	259286	broad.mit.edu	37	7	142919990	142919990	+	Frame_Shift_Del	DEL	T	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142919990delT	uc011ksx.1	+	1	819	c.819delT	c.(817-819)ACTfs	p.T273fs		NM_176882	NP_795363	P59535	T2R40_HUMAN	taste receptor, type 2, member 40	273	Extracellular (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			ovary(1)	1	Melanoma(164;0.059)					TCTTTGACACTTACAGTTCCT	0.478													213	99	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	131035415	131035415	+	IGR	DEL	G	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131035415delG								FAM49B (6518 upstream) : ASAP1 (28938 downstream)																							agaaaACAGAGGGAGAAAGCA	0.219													4	2	---	---	---	---	
ZFAT	57623	broad.mit.edu	37	8	135602974	135602976	+	Intron	DEL	CAA	-	-	rs146800539		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135602974_135602976delCAA	uc003yup.2	-						ZFAT_uc003yun.2_Intron|ZFAT_uc003yuo.2_Intron|ZFAT_uc010meh.2_Intron|ZFAT_uc010mei.2_Intron|ZFAT_uc003yuq.2_Intron|ZFAT_uc010mej.2_Intron	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			ccaccaccaccaacaccaccacc	0.000													5	3	---	---	---	---	
DDX58	23586	broad.mit.edu	37	9	32493620	32493621	+	Intron	INS	-	A	A	rs75982479		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32493620_32493621insA	uc003zra.2	-						DDX58_uc010mjj.2_Intron|DDX58_uc010mjk.1_Intron|DDX58_uc011lnr.1_Intron|DDX58_uc010mji.2_Intron	NM_014314	NP_055129	O95786	DDX58_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide						detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		gactccgtctcaaaaaaaaaaa	0.149													2	4	---	---	---	---	
FAM21C	253725	broad.mit.edu	37	10	46221019	46221022	+	5'Flank	DEL	AAAC	-	-	rs113880906		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46221019_46221022delAAAC	uc001jcu.2	+						FAM21C_uc001jcs.1_5'Flank|FAM21C_uc001jct.2_5'Flank|FAM21C_uc010qfi.1_5'Flank	NM_015262	NP_056077	A8K5W5	A8K5W5_HUMAN	hypothetical protein LOC253725											ovary(1)	1						tccgtctcaaaaacaaacaaacaa	0.127													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	98562644	98562647	+	IGR	DEL	TTCC	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98562644_98562647delTTCC								PIK3AP1 (82365 upstream) : MIR607 (25779 downstream)																							tttcctttctttccttccttcctt	0.020													5	5	---	---	---	---	
NUP98	4928	broad.mit.edu	37	11	3714252	3714256	+	Intron	DEL	TCTGA	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3714252_3714256delTCTGA	uc001lyh.2	-						NUP98_uc001lyi.2_Intron|NUP98_uc001lyg.2_Intron	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1						carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		AGAAGAACCCTCTGATTTAGAGGCA	0.380			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								9	4	---	---	---	---	
WNK1	65125	broad.mit.edu	37	12	947244	947245	+	Intron	INS	-	GTGT	GTGT	rs143597723	by1000genomes	TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:947244_947245insGTGT	uc001qio.3	+						WNK1_uc001qip.3_Intron	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			gtaatattccagtgtgtgtgtg	0.000													4	2	---	---	---	---	
MANSC1	54682	broad.mit.edu	37	12	12482820	12482821	+	3'UTR	INS	-	A	A	rs118108016	by1000genomes	TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12482820_12482821insA	uc001rai.1	-	4					MANSC1_uc010shm.1_3'UTR|MANSC1_uc001raj.1_3'UTR|MANSC1_uc009zht.1_3'UTR	NM_018050	NP_060520	Q9H8J5	MANS1_HUMAN	MANSC domain containing 1 precursor							integral to membrane					0		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		actctgtctccaaaaaaaaaaa	0.188													6	3	---	---	---	---	
LASS5	91012	broad.mit.edu	37	12	50528077	50528078	+	Intron	INS	-	CTT	CTT	rs72518097		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50528077_50528078insCTT	uc001rwd.3	-						LASS5_uc001rwc.2_Intron|LASS5_uc001rwe.3_Intron|LASS5_uc001rwf.3_Intron	NM_147190	NP_671723	Q8N5B7	CERS5_HUMAN	LAG1 homolog, ceramide synthase 5						ceramide biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0						tgggagaatccaagcccaggtg	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31652513	31652520	+	IGR	DEL	AAGAAAGA	-	-	rs7986217		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31652513_31652520delAAGAAAGA								C13orf26 (103362 upstream) : HSPH1 (58245 downstream)																							ggaaggaaggaagaaagaaagaaagaaa	0.192													4	2	---	---	---	---	
NOVA1	4857	broad.mit.edu	37	14	27066713	27066714	+	5'UTR	INS	-	T	T			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27066713_27066714insT	uc001wpy.2	-	1					NOVA1_uc001wpz.2_5'UTR|NOVA1_uc001wqa.2_5'UTR|NOVA1_uc001wqb.2_5'UTR	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1						locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		tttcttttttcttttttttttt	0.356													5	3	---	---	---	---	
C14orf147	171546	broad.mit.edu	37	14	34932101	34932108	+	5'Flank	DEL	CACACACA	-	-	rs36224587		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34932101_34932108delCACACACA	uc001wsc.2	-							NM_138288	NP_612145	Q969W0	SSPTA_HUMAN	hypothetical protein LOC171546						sphingolipid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	protein binding				0	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.000389)|Lung(238;0.000887)|Epithelial(34;0.143)	GBM - Glioblastoma multiforme(112;0.0195)		CCCACCCATGcacacacacacacacaca	0.423													3	3	---	---	---	---	
PCNX	22990	broad.mit.edu	37	14	71572270	71572271	+	Intron	INS	-	T	T	rs79334123		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71572270_71572271insT	uc001xmo.2	+						PCNX_uc010are.1_Intron|PCNX_uc010arf.1_Intron|PCNX_uc001xmp.2_Intron	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1							integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CAGAAATAGAAttttttttttt	0.168													5	4	---	---	---	---	
TTC7B	145567	broad.mit.edu	37	14	91233373	91233373	+	Intron	DEL	A	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91233373delA	uc001xyp.2	-							NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)				TTTATataccaaaaaaaaaaa	0.224													5	3	---	---	---	---	
FBLN5	10516	broad.mit.edu	37	14	92347465	92347466	+	Intron	INS	-	CACC	CACC	rs140834248	by1000genomes	TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92347465_92347466insCACC	uc001xzx.3	-						FBLN5_uc010aud.2_Intron|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				GTTCTATTCTacacacacacac	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	100419376	100419377	+	IGR	INS	-	TGA	TGA	rs113141411	by1000genomes	TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100419376_100419377insTGA								EML1 (10983 upstream) : EVL (18774 downstream)																							gatggtgatggtggtggtaatg	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22118395	22118396	+	IGR	DEL	AC	-	-	rs139043886		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22118395_22118396delAC								CXADRP2 (101517 upstream) : LOC727924 (159636 downstream)																							ATAAATTATAACATTCTTTTTG	0.342													11	6	---	---	---	---	
FLYWCH1	84256	broad.mit.edu	37	16	2988609	2988609	+	Intron	DEL	T	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2988609delT	uc002csd.2	+						FLYWCH1_uc002csb.2_Intron|FLYWCH1_uc002csc.2_Intron|FLYWCH1_uc010bsv.2_Intron|FLYWCH1_uc002cse.2_Intron	NM_032296	NP_115672	Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1 isoform a							nucleus	DNA binding|metal ion binding				0						CCAGtctttgttttttttttt	0.224													6	3	---	---	---	---	
ABCC11	85320	broad.mit.edu	37	16	48265572	48265573	+	Intron	DEL	AA	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48265572_48265573delAA	uc002eff.1	-						ABCC11_uc002efg.1_Intron|ABCC11_uc002efh.1_Intron|ABCC11_uc010vgl.1_Intron	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				accctgagtcaaaaaaaaaaaa	0.134									Cerumen_Type				4	2	---	---	---	---	
ATAD5	79915	broad.mit.edu	37	17	29157882	29157882	+	5'Flank	DEL	A	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29157882delA	uc002hfs.1	+							NM_024857	NP_079133	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5						response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity			ovary(3)	3		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				ACTTTAACGTAAAAAAAAAAG	0.323													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	41796306	41796306	+	IGR	DEL	C	-	-	rs78166835		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41796306delC								MEOX1 (57044 upstream) : SOST (34793 downstream)																							AGACAACAttctttttttttt	0.229													10	7	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64794523	64794525	+	Intron	DEL	TGA	-	-	rs145221234	by1000genomes	TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64794523_64794525delTGA	uc002jfp.1	+							NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	gtggtggtggtgatggtgatggt	0.148													5	3	---	---	---	---	
ABCA6	23460	broad.mit.edu	37	17	67081660	67081661	+	Intron	INS	-	A	A	rs35438104		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67081660_67081661insA	uc002jhw.1	-							NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6						transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					TATCCAAAGGCaaaaaaaaaaa	0.277													10	6	---	---	---	---	
CAPN12	147968	broad.mit.edu	37	19	39232227	39232227	+	Intron	DEL	A	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39232227delA	uc002ojd.1	-							NM_144691	NP_653292	Q6ZSI9	CAN12_HUMAN	calpain 12						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			aaaaaaaaagaaaaaaaaaaa	0.209													4	2	---	---	---	---	
CACNG8	59283	broad.mit.edu	37	19	54483312	54483313	+	Intron	DEL	GT	-	-	rs71949256		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54483312_54483313delGT	uc002qcs.1	+						MIR935_hsa-mir-935|MI0005757_5'Flank	NM_031895	NP_114101	Q8WXS5	CCG8_HUMAN	voltage-dependent calcium channel gamma-8						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic density|postsynaptic membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		GGGCGCGCACgtgtgtgtgtgt	0.530													4	3	---	---	---	---	
PDRG1	81572	broad.mit.edu	37	20	30542460	30542461	+	5'Flank	INS	-	AAGG	AAGG	rs34345343		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30542460_30542461insAAGG	uc002wxd.2	-							NM_030815	NP_110442	Q9NUG6	PDRG1_HUMAN	p53 and DNA damage-regulated protein						protein folding	prefoldin complex	unfolded protein binding				0			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			agaaagaaagaaaggaaggaag	0.005													8	4	---	---	---	---	
C20orf117	140710	broad.mit.edu	37	20	35445891	35445891	+	Intron	DEL	A	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35445891delA	uc002xgd.1	-						C20orf117_uc002xge.1_5'Flank	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2												0		Myeloproliferative disorder(115;0.00874)				AGatttaattaaaaaaaaaaa	0.507													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	28417365	28417368	+	IGR	DEL	GTGT	-	-	rs71333112		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28417365_28417368delGTGT								ADAMTS5 (77926 upstream) : NCRNA00113 (677330 downstream)																							ATGAATATCAgtgtgtgtgtgtgt	0.235													2	4	---	---	---	---	
PNPLA3	80339	broad.mit.edu	37	22	44335671	44335672	+	Intron	DEL	GG	-	-	rs35514853		TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44335671_44335672delGG	uc003bei.1	+						PNPLA3_uc010gzm.1_Intron	NM_025225	NP_079501	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3						triglyceride biosynthetic process|triglyceride catabolic process	integral to membrane	diolein transacylation activity|mono-olein transacylation activity|phospholipase A2 activity|triglyceride lipase activity				0		Ovarian(80;0.024)|all_neural(38;0.0416)				actccagcctgggggcaacaag	0.178													3	4	---	---	---	---	
CSF2RA	1438	broad.mit.edu	37	X	1423083	1423084	+	Intron	INS	-	CT	CT			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1423083_1423084insCT	uc010nct.2	+						CSF2RA_uc011mhb.1_Intron|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Intron|CSF2RA_uc004cpo.2_Intron|CSF2RA_uc010ncu.2_Intron|CSF2RA_uc011mhc.1_Intron|CSF2RA_uc004cpp.2_Intron|CSF2RA_uc010ncv.2_Intron|CSF2RA_uc004cpr.2_Intron	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain							extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	gggtggatcacgaggtcaggag	0.084													5	5	---	---	---	---	
SYTL5	94122	broad.mit.edu	37	X	37984460	37984460	+	Intron	DEL	G	-	-			TCGA-66-2780-01	TCGA-66-2780-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37984460delG	uc004ddu.2	+						SYTL5_uc004ddv.2_Intron|SYTL5_uc004ddx.2_Intron	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1						intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						AGCCTGGGAAGGAAAATCAAA	0.378													6	3	---	---	---	---	
