Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NPPB	4879	broad.mit.edu	37	1	11918893	11918893	+	5'UTR	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11918893C>T	uc001atj.2	-	1						NM_002521	NP_002512	P16860	ANFB_HUMAN	natriuretic peptide precursor B preproprotein						body fluid secretion|cGMP biosynthetic process|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation	extracellular space	diuretic hormone activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	Carvedilol(DB01136)|Nesiritide(DB04899)|Testosterone(DB00624)	GGATCCATGTCTCTGGAGGGA	0.542													5	116	---	---	---	---	PASS
KAZ	23254	broad.mit.edu	37	1	14925537	14925537	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14925537C>T	uc001avm.3	+	1	325	c.44C>T	c.(43-45)GCG>GTG	p.A15V	KAZ_uc009vog.1_Missense_Mutation_p.A15V|KAZ_uc010obj.1_Missense_Mutation_p.A15V	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E	15					keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						ATCGATGGGGCGGTCCAGTCG	0.517													22	19	---	---	---	---	PASS
EPHB2	2048	broad.mit.edu	37	1	23219320	23219320	+	Intron	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23219320G>A	uc009vqj.1	+						EPHB2_uc001bge.2_Intron|EPHB2_uc001bgf.2_Intron|EPHB2_uc010odu.1_Intron	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor						axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		CAGGCAGTGGGCTCTGGACCC	0.413									Hereditary_Prostate_Cancer				59	43	---	---	---	---	PASS
PIGV	55650	broad.mit.edu	37	1	27121695	27121695	+	Silent	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27121695G>T	uc001bmz.2	+	3	1501	c.1170G>T	c.(1168-1170)CTG>CTT	p.L390L	PIGV_uc001bmy.2_Silent_p.L155L|PIGV_uc009vso.2_Silent_p.L390L|PIGV_uc010ofg.1_Silent_p.L155L|PIGV_uc001bna.2_Silent_p.L390L	NM_017837	NP_060307	Q9NUD9	PIGV_HUMAN	phosphatidylinositol glycan class V	390	Helical; (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	glycolipid mannosyltransferase activity			ovary(1)	1		all_cancers(24;3.93e-26)|all_epithelial(13;3.96e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.26e-54)|Epithelial(14;2.85e-53)|OV - Ovarian serous cystadenocarcinoma(117;1.91e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000504)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.0222)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		CAGTGCTGCTGCTGTTTGGAG	0.527													20	286	---	---	---	---	PASS
C8B	732	broad.mit.edu	37	1	57395227	57395227	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57395227G>A	uc001cyp.2	-	12	1693	c.1626C>T	c.(1624-1626)ACC>ACT	p.T542T	C8B_uc010oon.1_Silent_p.T480T|C8B_uc010ooo.1_Silent_p.T490T	NM_000066	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	542					complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex				central_nervous_system(2)|large_intestine(1)|ovary(1)	4						CATCAATGGGGGTATCTATAA	0.438													34	51	---	---	---	---	PASS
FGGY	55277	broad.mit.edu	37	1	59922755	59922755	+	Intron	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59922755G>C	uc001czi.3	+						FGGY_uc001czg.2_Intron|FGGY_uc001czh.2_Intron|FGGY_uc009wac.2_Intron|FGGY_uc001czj.3_Intron|FGGY_uc001czk.3_Intron|FGGY_uc001czl.3_Intron	NM_018291	NP_060761	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing						carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)					ATAGGTAAAAGAATAAAACAT	0.353													17	47	---	---	---	---	PASS
ZNF326	284695	broad.mit.edu	37	1	90470764	90470764	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90470764A>G	uc001dnq.2	+	4	309	c.170A>G	c.(169-171)TAT>TGT	p.Y57C	ZNF326_uc001dnp.3_Missense_Mutation_p.Y57C|ZNF326_uc009wda.1_Missense_Mutation_p.Y57C|ZNF326_uc001dnr.2_Intron	NM_182976	NP_892021	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326 isoform 1	57	Mediates transcriptional activation (By similarity).|Gly-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	DNA binding			ovary(1)	1		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		AACCAGTCATATGGCATGGAC	0.388													79	51	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92187507	92187507	+	Intron	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92187507C>T	uc001doh.2	-						TGFBR3_uc009wde.2_Intron|TGFBR3_uc010osy.1_Intron|TGFBR3_uc001doi.2_Intron|TGFBR3_uc001doj.2_Intron	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III						BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		AAACTTCTAACTTACCATTAT	0.368													9	35	---	---	---	---	PASS
MOV10	4343	broad.mit.edu	37	1	113231671	113231671	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113231671C>A	uc001eck.2	+	3	522	c.252C>A	c.(250-252)GAC>GAA	p.D84E	MOV10_uc001ecl.2_Missense_Mutation_p.D84E|MOV10_uc001ecn.2_Missense_Mutation_p.D84E|MOV10_uc001ecm.2_Missense_Mutation_p.D24E|MOV10_uc009wgj.1_Missense_Mutation_p.D24E	NM_001130079	NP_001123551	Q9HCE1	MOV10_HUMAN	Mov10, Moloney leukemia virus 10, homolog	84					mRNA cleavage involved in gene silencing by miRNA|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body	ATP binding|helicase activity|protein binding|RNA binding			ovary(4)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		GCTGGGCCGACGTGCGGTTCC	0.522													3	83	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144886121	144886121	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144886121C>G	uc001elw.3	-	23	3404	c.3113G>C	c.(3112-3114)GGA>GCA	p.G1038A	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.G1104A|PDE4DIP_uc001elv.3_Missense_Mutation_p.G45A	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1038	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGAGGAGAATCCTGCTTCCTC	0.542			T	PDGFRB	MPD								23	184	---	---	---	---	PASS
CHD1L	9557	broad.mit.edu	37	1	146714352	146714352	+	5'UTR	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146714352C>A	uc001epm.3	+	1					CHD1L_uc001epn.3_5'UTR|CHD1L_uc010ozo.1_RNA|CHD1L_uc009wjg.2_RNA|CHD1L_uc009wjh.2_5'UTR|CHD1L_uc010ozp.1_5'UTR|CHD1L_uc001epo.3_5'UTR	NM_004284	NP_004275	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein						chromatin remodeling|DNA repair	cytoplasm|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(3)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(923;0.0487)					TCTACCGGCCCGATGGAGCGC	0.751													9	5	---	---	---	---	PASS
GABPB2	126626	broad.mit.edu	37	1	151060740	151060740	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151060740G>T	uc001ewr.2	+	2	406	c.75G>T	c.(73-75)TTG>TTT	p.L25F	GABPB2_uc010pcp.1_Missense_Mutation_p.L25F|GABPB2_uc001ews.2_Missense_Mutation_p.L25F	NM_144618	NP_653219	Q8TAK5	GABP2_HUMAN	GA repeat binding protein, beta 2	25	ANK 1.				positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	protein heterodimerization activity|transcription regulatory region DNA binding				0				all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)		TGAGAACGTTGATGGCAAATG	0.413													28	28	---	---	---	---	PASS
IVL	3713	broad.mit.edu	37	1	152883951	152883951	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152883951C>A	uc001fau.2	+	2	1724	c.1678C>A	c.(1678-1680)CCC>ACC	p.P560T		NM_005547	NP_005538	P07476	INVO_HUMAN	involucrin	560					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine|keratinization|response to UV-B	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity			ovary(3)	3	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ACCAGCCCTGCCCACAAAGGG	0.423													116	138	---	---	---	---	PASS
ILF2	3608	broad.mit.edu	37	1	153637754	153637754	+	Silent	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153637754C>T	uc001fcr.2	-	8	600	c.519G>A	c.(517-519)GTG>GTA	p.V173V	ILF2_uc010pdy.1_Silent_p.V135V|ILF2_uc009wok.2_Silent_p.V151V|ILF2_uc009wol.1_3'UTR	NM_004515	NP_004506	Q12905	ILF2_HUMAN	interleukin enhancer binding factor 2	173	DZF.				immune response|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|ribonucleoprotein complex	ATP binding|DNA binding|double-stranded RNA binding|protein binding|transferase activity				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGAGAATCTTCACTGTAGCAT	0.358													6	198	---	---	---	---	PASS
ATP8B2	57198	broad.mit.edu	37	1	154317830	154317830	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154317830G>T	uc001fex.2	+	23	2602	c.2602G>T	c.(2602-2604)GAA>TAA	p.E868*		NM_020452	NP_065185	P98198	AT8B2_HUMAN	ATPase, class I, type 8B, member 2 isoform a	854	Cytoplasmic (Potential).				ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(1)|skin(1)	2	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CAGTGGGCAGGAAGGGATCCA	0.577											OREG0013835	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	559	287	---	---	---	---	PASS
UBE2Q1	55585	broad.mit.edu	37	1	154524669	154524669	+	Intron	SNP	A	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154524669A>T	uc001fff.1	-							NM_017582	NP_060052	Q7Z7E8	UB2Q1_HUMAN	ubiquitin-conjugating enzyme E2Q								ATP binding|protein binding|ubiquitin-protein ligase activity				0	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TCTAAGAAGCAACAAGCCTGG	0.527													241	138	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175092654	175092654	+	Silent	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175092654C>T	uc001gkl.1	+	12	2882	c.2769C>T	c.(2767-2769)GAC>GAT	p.D923D		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	923	Fibronectin type-III 8.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CCTCTGCTGACGGAGAGACCA	0.602													34	142	---	---	---	---	PASS
QSOX1	5768	broad.mit.edu	37	1	180135629	180135629	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180135629G>T	uc001gnz.2	+	2	344	c.269G>T	c.(268-270)TGG>TTG	p.W90L	QSOX1_uc001gny.2_Missense_Mutation_p.W90L|QSOX1_uc001goa.2_Missense_Mutation_p.W90L	NM_002826	NP_002817	O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1 isoform a	90	Thioredoxin.				cell redox homeostasis|protein thiol-disulfide exchange	extracellular space|integral to Golgi membrane	flavin-linked sulfhydryl oxidase activity			ovary(1)|central_nervous_system(1)	2						CTTTCAGCCTGGAGGCCGGCC	0.597													24	200	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197390726	197390726	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197390726A>G	uc001gtz.2	+	6	1903	c.1768A>G	c.(1768-1770)AAA>GAA	p.K590E	CRB1_uc010poz.1_Missense_Mutation_p.K521E|CRB1_uc010ppa.1_Intron|CRB1_uc009wza.2_Missense_Mutation_p.K478E|CRB1_uc010ppb.1_Missense_Mutation_p.K590E|CRB1_uc010ppc.1_Intron|CRB1_uc010ppd.1_Missense_Mutation_p.K71E|CRB1_uc001gub.1_Missense_Mutation_p.K239E	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	590	Extracellular (Potential).|Laminin G-like 1.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						CTGTAAGGAGAAATGCATCGC	0.458													4	415	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200567388	200567388	+	Silent	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200567388C>A	uc010ppk.1	-	14	2965	c.2526G>T	c.(2524-2526)GGG>GGT	p.G842G	KIF14_uc010ppj.1_Silent_p.G351G	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	842	FHA.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						CAATCAGCACCCCAGATAACT	0.353													18	39	---	---	---	---	PASS
PIK3C2B	5287	broad.mit.edu	37	1	204429749	204429749	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204429749G>A	uc001haw.2	-	7	1830	c.1351C>T	c.(1351-1353)CGC>TGC	p.R451C	PIK3C2B_uc010pqv.1_Missense_Mutation_p.R451C|PIK3C2B_uc001hax.1_Missense_Mutation_p.R451C|PIK3C2B_uc009xbd.1_RNA	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	451					cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			TCAAACTTGCGGCAGTATTGG	0.562													19	107	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216219911	216219911	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216219911C>A	uc001hku.1	-	32	6574	c.6187G>T	c.(6187-6189)GTA>TTA	p.V2063L		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2063	Extracellular (Potential).|Fibronectin type-III 7.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GATTTGGCTACTGGTGGCTGA	0.403										HNSCC(13;0.011)			15	104	---	---	---	---	PASS
C1orf58	148362	broad.mit.edu	37	1	222904850	222904850	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222904850G>A	uc001hnq.1	+	12	1536	c.1141G>A	c.(1141-1143)GAT>AAT	p.D381N	C1orf58_uc010put.1_Missense_Mutation_p.D349N|C1orf58_uc010puu.1_Intron|C1orf58_uc010puv.1_Missense_Mutation_p.D349N|uc001hnr.1_Intron|uc001hns.1_5'Flank	NM_144695	NP_653296	Q5VW32	BROX_HUMAN	Bro1-domain-containing protein	381	BRO1.					membrane					0				GBM - Glioblastoma multiforme(131;0.0667)		AAGACCCAAGGATGACAGTGT	0.353													37	147	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947189	237947189	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947189G>A	uc001hyl.1	+	90	12297	c.12177G>A	c.(12175-12177)ACG>ACA	p.T4059T	RYR2_uc010pya.1_Silent_p.T474T	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4059					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGCACTACACGCAGTCAGAAA	0.483													9	43	---	---	---	---	PASS
TRIM58	25893	broad.mit.edu	37	1	248023911	248023911	+	Intron	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248023911C>T	uc001ido.2	+							NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58							intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TGAAATGTTCCCAAACAGGTA	0.458													13	60	---	---	---	---	PASS
OR2M2	391194	broad.mit.edu	37	1	248343413	248343413	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248343413C>A	uc010pzf.1	+	1	126	c.126C>A	c.(124-126)AAC>AAA	p.N42K		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	42	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCATGGGAAACTCTGTCATGG	0.522													12	829	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1653368	1653368	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1653368G>A	uc002qxa.2	-	17	2248	c.2184C>T	c.(2182-2184)CGC>CGT	p.R728R		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	728					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		AGTTGTTCACGCGCCGGTGGG	0.602													10	236	---	---	---	---	PASS
MFSD2B	388931	broad.mit.edu	37	2	24245357	24245357	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24245357C>T	uc002reo.1	+	9	963	c.949C>T	c.(949-951)CAC>TAC	p.H317Y		NM_001080473	NP_001073942	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing	317					transport	integral to membrane				ovary(2)	2						GCTACACGACCACGTCCAGGG	0.607													23	39	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26739434	26739434	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26739434T>G	uc002rhk.2	-	5	488	c.361A>C	c.(361-363)ACT>CCT	p.T121P	OTOF_uc010ylb.1_RNA	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	121	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGCCGTCAGTGGCCTGATAC	0.607													113	169	---	---	---	---	PASS
XDH	7498	broad.mit.edu	37	2	31588405	31588405	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31588405C>A	uc002rnv.1	-	23	2541	c.2462G>T	c.(2461-2463)GGC>GTC	p.G821V		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	821					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	CACAGGGCGGCCGGTCCTGGG	0.547													92	154	---	---	---	---	PASS
FSHR	2492	broad.mit.edu	37	2	49190321	49190321	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49190321C>A	uc002rww.2	-	10	1713	c.1639G>T	c.(1639-1641)GGC>TGC	p.G547C	FSHR_uc002rwx.2_Missense_Mutation_p.G485C|FSHR_uc010fbn.2_Missense_Mutation_p.G521C	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1	547	Helical; Name=5; (Potential).				female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	ATATAGCAGCCACAGATGACC	0.537									Gonadal_Dysgenesis_46_XX				32	57	---	---	---	---	PASS
GKN2	200504	broad.mit.edu	37	2	69173523	69173523	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69173523C>A	uc002sfa.2	-	5	494	c.385G>T	c.(385-387)GAC>TAC	p.D129Y	GKN2_uc002sfb.3_Missense_Mutation_p.D129Y	NM_182536	NP_872342	Q86XP6	GKN2_HUMAN	trefoil factor interactions(z) 1 precursor	129	BRICHOS.					extracellular region					0						CAATCCACGTCTTTGATCAGA	0.443													8	376	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90121855	90121855	+	RNA	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90121855C>T	uc010fhm.2	+	16		c.1724C>T								Parts of antibodies, mostly variable regions.																		ATGTAACATCCAGATGACCCA	0.438													133	339	---	---	---	---	PASS
VWA3B	200403	broad.mit.edu	37	2	98797501	98797501	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98797501G>T	uc002syo.2	+	9	1401	c.1137G>T	c.(1135-1137)GAG>GAT	p.E379D	VWA3B_uc010yvh.1_Missense_Mutation_p.E229D|VWA3B_uc002syj.2_RNA|VWA3B_uc002syk.1_RNA|VWA3B_uc002syl.1_5'UTR|VWA3B_uc002sym.2_Missense_Mutation_p.E379D|VWA3B_uc002syn.1_RNA|VWA3B_uc010yvi.1_Missense_Mutation_p.E36D	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	379										ovary(3)|large_intestine(2)|skin(1)	6						CCTCTGTTGAGATTGCATCGA	0.448													39	96	---	---	---	---	PASS
TBC1D8	11138	broad.mit.edu	37	2	101656738	101656738	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101656738G>A	uc010fiv.2	-	6	1068	c.937C>T	c.(937-939)CGC>TGC	p.R313C	TBC1D8_uc010yvw.1_Missense_Mutation_p.R328C|TBC1D8_uc002tau.3_Missense_Mutation_p.R70C	NM_001102426	NP_001095896	O95759	TBCD8_HUMAN	TBC1 domain family, member 8	313	GRAM 2.				blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3						GTGTGACAGCGACTGAACGGC	0.567													35	169	---	---	---	---	PASS
SLC9A4	389015	broad.mit.edu	37	2	103148906	103148906	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103148906G>A	uc002tbz.3	+	12	2613	c.2156G>A	c.(2155-2157)GGA>GAA	p.G719E		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	719	Cytoplasmic (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						CTACACAGAGGAAGGAAGGCA	0.478													6	165	---	---	---	---	PASS
IL1A	3552	broad.mit.edu	37	2	113532838	113532838	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113532838G>A	uc002tig.2	-	7	1582	c.622C>T	c.(622-624)CCT>TCT	p.P208S		NM_000575	NP_000566	P01583	IL1A_HUMAN	interleukin 1, alpha proprotein	208					anti-apoptosis|apoptosis|cell proliferation|cellular response to heat|cytokine-mediated signaling pathway|fever generation|immune response|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of cell division|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of mitosis|positive regulation vascular endothelial growth factor production|response to copper ion	cytosol|extracellular space	copper ion binding|cytokine activity|interleukin-1 receptor binding			lung(1)	1						GGTATCTCAGGCATCTCCTAT	0.428													6	148	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116503762	116503762	+	Intron	SNP	A	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116503762A>G	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						AAATCAAGGTATGCAATTTCA	0.363													29	79	---	---	---	---	PASS
RALB	5899	broad.mit.edu	37	2	121036296	121036296	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121036296T>C	uc002tmk.2	+	2	246	c.56T>C	c.(55-57)ATG>ACG	p.M19T	RALB_uc010yys.1_Missense_Mutation_p.M41T|RALB_uc002tml.2_Missense_Mutation_p.M19T|RALB_uc002tmm.2_Intron|RALB_uc010yyt.1_RNA	NM_002881	NP_002872	P11234	RALB_HUMAN	v-ral simian leukemia viral oncogene homolog B	19					apoptosis|cell cycle|cytokinesis|nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of exocyst assembly|regulation of exocyst localization	cytosol|midbody|plasma membrane	GTP binding|GTPase activity|protein binding			lung(3)	3		Prostate(154;0.122)				AAGGTGATCATGGTTGGCAGC	0.567													35	76	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136562337	136562337	+	Silent	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136562337C>T	uc002tuu.1	-	10	4475	c.4464G>A	c.(4462-4464)CAG>CAA	p.Q1488Q		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1488	Extracellular (Potential).|4.|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		CCCACCATACCTGGGGCTGGA	0.542													43	60	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162751189	162751189	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162751189G>T	uc002ubx.3	+	11	1379	c.1195G>T	c.(1195-1197)GTA>TTA	p.V399L	SLC4A10_uc010fpa.1_Missense_Mutation_p.V411L|SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Missense_Mutation_p.V369L|SLC4A10_uc010zcs.1_Missense_Mutation_p.V380L	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	399	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						TCTTCTAAAGGTATTTCATGA	0.294													5	7	---	---	---	---	PASS
SP3	6670	broad.mit.edu	37	2	174820742	174820742	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174820742G>A	uc002uig.2	-	4	662	c.498C>T	c.(496-498)TCC>TCT	p.S166S	SP3_uc002uie.2_Silent_p.S98S|SP3_uc002uif.2_Silent_p.S113S|SP3_uc010zel.1_Silent_p.S163S	NM_003111	NP_003102	Q02447	SP3_HUMAN	Sp3 transcription factor isoform 1	166	Transactivation domain (Gln-rich).				negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	protein binding|zinc ion binding		EWSR1/SP3(3)	soft_tissue(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.185)			ATTGAACACTGGACACTGTAC	0.418													314	261	---	---	---	---	PASS
CWC22	57703	broad.mit.edu	37	2	180815589	180815589	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180815589T>C	uc010frh.1	-	18	2182	c.1882A>G	c.(1882-1884)ATC>GTC	p.I628V	CWC22_uc002uno.2_Missense_Mutation_p.I150V|CWC22_uc002unp.2_Missense_Mutation_p.I628V	NM_020943	NP_065994	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein homolog	628						catalytic step 2 spliceosome	protein binding|RNA binding				0						AAGAAGTTGATGGCAAACCGA	0.313													5	4	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186673252	186673252	+	Intron	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186673252G>A	uc002upm.2	+						uc010zfu.1_Missense_Mutation_p.E905K					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		TGATCCTGAAGAGCACTGTTT	0.333													27	25	---	---	---	---	PASS
ZSWIM2	151112	broad.mit.edu	37	2	187694599	187694599	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187694599T>C	uc002upu.1	-	8	990	c.950A>G	c.(949-951)TAC>TGC	p.Y317C		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	317					apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			TTTTGGTGTGTAAACTTGGCT	0.373													84	76	---	---	---	---	PASS
CRYGA	1418	broad.mit.edu	37	2	209028060	209028060	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209028060G>T	uc002vcq.3	-	2	137	c.120C>A	c.(118-120)AGC>AGA	p.S40R		NM_014617	NP_055432	P11844	CRGA_HUMAN	crystallin, gamma A	40	Beta/gamma crystallin 'Greek key' 1.				visual perception		structural constituent of eye lens				0				Epithelial(149;0.067)|LUSC - Lung squamous cell carcinoma(261;0.0708)|Lung(261;0.135)		TCCAGCAGCCGCTGTCTACTC	0.592													9	81	---	---	---	---	PASS
IDH1	3417	broad.mit.edu	37	2	209103872	209103872	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209103872C>A	uc002vcs.2	-	9	1323	c.1077G>T	c.(1075-1077)TTG>TTT	p.L359F	IDH1_uc002vct.2_Missense_Mutation_p.L359F|IDH1_uc002vcu.2_Missense_Mutation_p.L359F	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	359					2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity			central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		AGACTTCTTCCAAAGCATTTG	0.428			Mis		gliobastoma 								4	113	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216288136	216288136	+	Nonsense_Mutation	SNP	T	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216288136T>A	uc002vfa.2	-	9	1596	c.1330A>T	c.(1330-1332)AAG>TAG	p.K444*	FN1_uc002vfb.2_Nonsense_Mutation_p.K444*|FN1_uc002vfc.2_Nonsense_Mutation_p.K444*|FN1_uc002vfd.2_Nonsense_Mutation_p.K444*|FN1_uc002vfe.2_Nonsense_Mutation_p.K444*|FN1_uc002vff.2_Nonsense_Mutation_p.K444*|FN1_uc002vfg.2_Nonsense_Mutation_p.K444*|FN1_uc002vfh.2_Nonsense_Mutation_p.K444*|FN1_uc002vfi.2_Nonsense_Mutation_p.K444*|FN1_uc002vfj.2_Nonsense_Mutation_p.K444*|FN1_uc002vfl.2_Nonsense_Mutation_p.K444*	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	444	Fibronectin type-II 2.|Collagen-binding.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCACACCACTTCATGTTGTCT	0.488													80	79	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216299559	216299559	+	Intron	SNP	T	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216299559T>A	uc002vfa.2	-						FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Intron|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Intron|FN1_uc002vfj.2_Intron|FN1_uc002vfl.2_Intron	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein						acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGCAAATAATTGAAGGAAAAC	0.348													45	88	---	---	---	---	PASS
STK16	8576	broad.mit.edu	37	2	220111955	220111955	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220111955G>T	uc002vko.2	+	4	584	c.427G>T	c.(427-429)GGT>TGT	p.G143C	GLB1L_uc002vkm.2_5'Flank|GLB1L_uc002vkn.2_5'Flank|STK16_uc002vks.2_Intron|STK16_uc010zky.1_Missense_Mutation_p.G143C|STK16_uc010fwf.2_Missense_Mutation_p.G143C|STK16_uc002vkp.2_Missense_Mutation_p.G143C|STK16_uc002vkr.2_Missense_Mutation_p.G76C|STK16_uc002vkq.2_Missense_Mutation_p.G188C	NM_001008910	NP_001008910	O75716	STK16_HUMAN	serine/threonine kinase 16	143	Protein kinase.				protein complex assembly	membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCATGCCAAGGGTTATGCCCA	0.562													21	141	---	---	---	---	PASS
CUL3	8452	broad.mit.edu	37	2	225378357	225378357	+	Splice_Site	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225378357T>C	uc002vny.2	-	5	924	c.540_splice	c.e5-1	p.R180_splice	CUL3_uc010zls.1_Splice_Site_p.R114_splice|CUL3_uc010fwy.1_Splice_Site_p.R186_splice	NM_003590	NP_003581	Q13618	CUL3_HUMAN	cullin 3						cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		ATTGCGCCTCTGTCGAAAAAA	0.303													7	43	---	---	---	---	PASS
ASB1	51665	broad.mit.edu	37	2	239344490	239344490	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239344490A>C	uc002vyg.2	+	3	416	c.330A>C	c.(328-330)AAA>AAC	p.K110N		NM_001040445	NP_001035535	Q9Y576	ASB1_HUMAN	ankyrin repeat and SOCS box-containing protein	110	ANK 3.				intracellular signal transduction|negative regulation of cytokine biosynthetic process						0		all_epithelial(40;2.65e-14)|Breast(86;7.61e-05)|Renal(207;0.00183)|all_lung(227;0.0283)|Ovarian(221;0.0365)|Lung NSC(271;0.0941)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)		TGGACGTAAAAGGACAGACGG	0.627													8	98	---	---	---	---	PASS
PASK	23178	broad.mit.edu	37	2	242066525	242066525	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242066525G>A	uc002wao.1	-	10	1897	c.1805C>T	c.(1804-1806)GCG>GTG	p.A602V	PASK_uc010zol.1_Missense_Mutation_p.A416V|PASK_uc010zom.1_Missense_Mutation_p.A567V|PASK_uc010fzl.1_Missense_Mutation_p.A602V|PASK_uc010zon.1_Missense_Mutation_p.A383V|PASK_uc002wap.2_Missense_Mutation_p.A145V|PASK_uc002waq.2_Missense_Mutation_p.A602V	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	602					regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GCTGCCCCCCGCCAGCTGACC	0.672													12	160	---	---	---	---	PASS
CNTN6	27255	broad.mit.edu	37	3	1262456	1262456	+	Silent	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1262456C>A	uc003boz.2	+	3	408	c.141C>A	c.(139-141)ATC>ATA	p.I47I	CNTN6_uc010hbo.2_Silent_p.I42I|CNTN6_uc011asj.1_5'UTR|CNTN6_uc003bpa.2_Silent_p.I47I	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	47	Ig-like C2-type 1.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CTGAGGTCATCCTGAATTGTG	0.383													98	71	---	---	---	---	PASS
TBC1D5	9779	broad.mit.edu	37	3	17279903	17279903	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17279903G>C	uc003cbf.2	-	17	3005	c.1340C>G	c.(1339-1341)GCC>GGC	p.A447G	TBC1D5_uc010heu.2_Missense_Mutation_p.A34G|TBC1D5_uc010hev.2_Missense_Mutation_p.A447G|TBC1D5_uc003cbe.2_Missense_Mutation_p.A447G|TBC1D5_uc010hew.1_Missense_Mutation_p.A399G	NM_014744	NP_055559	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5 isoform b	447						intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1						AGCACCTTTGGCATTGGTCCT	0.383													40	27	---	---	---	---	PASS
KCNH8	131096	broad.mit.edu	37	3	19190249	19190249	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19190249C>T	uc003cbk.1	+	1	233	c.38C>T	c.(37-39)ACC>ATC	p.T13I	KCNH8_uc011awe.1_Missense_Mutation_p.T13I|KCNH8_uc010hex.1_5'UTR	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	13	Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						CCGCAAAACACCTTCCTGGAC	0.458													102	56	---	---	---	---	PASS
SGOL1	151648	broad.mit.edu	37	3	20225133	20225133	+	Silent	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20225133T>C	uc003cbs.2	-	3	493	c.306A>G	c.(304-306)AAA>AAG	p.K102K	SGOL1_uc003cbr.2_Silent_p.K102K|SGOL1_uc010hfa.2_Silent_p.K102K|SGOL1_uc003cbt.2_Silent_p.K102K|SGOL1_uc003cbu.2_Silent_p.K102K|SGOL1_uc003cbv.2_Silent_p.K102K|SGOL1_uc003cbw.2_Silent_p.K102K|SGOL1_uc003cbx.2_Silent_p.K102K|SGOL1_uc003cby.2_Silent_p.K102K|SGOL1_uc003cbz.2_Silent_p.K102K|SGOL1_uc003cca.2_Silent_p.K102K|SGOL1_uc003ccb.2_Silent_p.K102K|SGOL1_uc003ccc.2_Silent_p.K102K	NM_001012410	NP_001012410	Q5FBB7	SGOL1_HUMAN	shugoshin-like 1 isoform A2	102	Necessary for interaction with PPP2CA and PPP2R1A.				attachment of spindle microtubules to kinetochore|cell division|centriole-centriole cohesion|meiotic chromosome segregation|mitotic prometaphase	centrosome|condensed chromosome kinetochore|cytosol|mitotic cohesin complex|spindle pole	protein binding				0						GTGATGTAAGTTTTCCTTTCA	0.333													7	122	---	---	---	---	PASS
RARB	5915	broad.mit.edu	37	3	25542676	25542676	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25542676T>C	uc011awl.1	+	3	397	c.331T>C	c.(331-333)TTT>CTT	p.F111L	RARB_uc003cdi.1_5'UTR|RARB_uc003cdh.2_Missense_Mutation_p.F104L	NM_016152	NP_057236	P10826	RARB_HUMAN	retinoic acid receptor, beta isoform 2	111	Nuclear receptor.				embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CTTGCAGGGCTTTTTCCGCAG	0.368													3	154	---	---	---	---	PASS
LRRC3B	116135	broad.mit.edu	37	3	26751352	26751352	+	Silent	SNP	T	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:26751352T>A	uc003cdp.2	+	2	778	c.189T>A	c.(187-189)CCT>CCA	p.P63P	LRRC3B_uc003cdq.2_Silent_p.P63P	NM_052953	NP_443185	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B precursor	63	LRRNT.					integral to membrane				pancreas(2)|ovary(1)|skin(1)	4						GAGATCTTCCTCCTGAAACAG	0.433													65	47	---	---	---	---	PASS
DLEC1	9940	broad.mit.edu	37	3	38159350	38159350	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38159350G>A	uc003cho.1	+	33	4560	c.4539G>A	c.(4537-4539)GAG>GAA	p.E1513E	DLEC1_uc003chp.1_Silent_p.E1513E|DLEC1_uc010hgv.1_Silent_p.E1516E|DLEC1_uc003chr.1_Silent_p.E584E|DLEC1_uc003chs.1_Silent_p.E70E	NM_007335	NP_031361	Q9Y238	DLEC1_HUMAN	deleted in lung and esophageal cancer 1 isoform	1513					negative regulation of cell proliferation	cytoplasm				ovary(2)|pancreas(2)|central_nervous_system(2)|skin(2)|breast(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		ACACTACAGAGATCCCACACT	0.592											OREG0015476	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	343	---	---	---	---	PASS
ERC2	26059	broad.mit.edu	37	3	55922517	55922517	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55922517G>A	uc003dhr.1	-	14	2720	c.2464C>T	c.(2464-2466)CGC>TGC	p.R822C	ERC2_uc003dhq.1_RNA|ERC2_uc003dht.1_Missense_Mutation_p.R301C	NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110	822	Potential.					cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		GAGGCGAGGCGTGCTTTGGTG	0.522													32	382	---	---	---	---	PASS
PDE12	201626	broad.mit.edu	37	3	57542759	57542759	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57542759C>T	uc003diw.3	+	1	779	c.653C>T	c.(652-654)CCC>CTC	p.P218L	PDE12_uc003div.2_Missense_Mutation_p.P218L	NM_177966	NP_808881	Q6L8Q7	PDE12_HUMAN	phosphodiesterase 12	218							hydrolase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)		TCATTGTCTCCCTCCTCACCT	0.597													88	236	---	---	---	---	PASS
SLMAP	7871	broad.mit.edu	37	3	57835536	57835536	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57835536A>G	uc003dje.1	+	5	717	c.512A>G	c.(511-513)TAT>TGT	p.Y171C	SLMAP_uc003djc.1_Missense_Mutation_p.Y171C|SLMAP_uc003djd.1_Missense_Mutation_p.Y171C|SLMAP_uc003djf.1_Missense_Mutation_p.Y171C	NM_007159	NP_009090	Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	171	Cytoplasmic (Potential).|Potential.				muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		CTTTCTCAGTATCTACAGGTA	0.299													51	48	---	---	---	---	PASS
SENP7	57337	broad.mit.edu	37	3	101086710	101086710	+	Silent	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101086710T>C	uc003dut.2	-	8	1053	c.942A>G	c.(940-942)CAA>CAG	p.Q314Q	SENP7_uc003duu.2_Silent_p.Q249Q|SENP7_uc003duv.2_Silent_p.Q281Q|SENP7_uc003duw.2_Silent_p.Q248Q|SENP7_uc003dux.2_Silent_p.Q150Q	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1	314					proteolysis	nucleus	cysteine-type peptidase activity			ovary(3)|lung(2)	5						AAGTACAATATTGAGAATCAG	0.323													22	23	---	---	---	---	PASS
BBX	56987	broad.mit.edu	37	3	107491664	107491664	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107491664G>A	uc010hpr.2	+	11	1423	c.1096G>A	c.(1096-1098)GAT>AAT	p.D366N	BBX_uc003dwk.3_Missense_Mutation_p.D366N|BBX_uc003dwl.3_Intron|BBX_uc010hps.1_Missense_Mutation_p.D387N|BBX_uc003dwm.3_Missense_Mutation_p.D366N|BBX_uc003dwo.3_5'Flank	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1	366	Potential.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			AAATTTAAGAGATTCTAAGGA	0.318													5	91	---	---	---	---	PASS
CCDC52	152185	broad.mit.edu	37	3	113172482	113172482	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113172482G>C	uc003eag.3	-	14	2264	c.1973C>G	c.(1972-1974)ACA>AGA	p.T658R	CCDC52_uc003eaf.3_RNA|CCDC52_uc003eah.1_Missense_Mutation_p.T554R	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52	658					cell division|mitosis	centriole|spindle	protein binding				0						TGACTCATTTGTTCTCAGCTG	0.423													84	175	---	---	---	---	PASS
ATP6V1A	523	broad.mit.edu	37	3	113514756	113514756	+	Silent	SNP	A	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113514756A>C	uc003eao.2	+	11	1326	c.1260A>C	c.(1258-1260)CCA>CCC	p.P420P	ATP6V1A_uc011bik.1_Silent_p.P387P	NM_001690	NP_001681	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit A	420					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			ovary(2)|skin(1)	3						TTTCTGATCCAGTTACATCTG	0.378													62	37	---	---	---	---	PASS
ATP6V1A	523	broad.mit.edu	37	3	113514757	113514757	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113514757G>A	uc003eao.2	+	11	1327	c.1261G>A	c.(1261-1263)GTT>ATT	p.V421I	ATP6V1A_uc011bik.1_Missense_Mutation_p.V388I	NM_001690	NP_001681	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit A	421					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			ovary(2)|skin(1)	3						TTCTGATCCAGTTACATCTGC	0.383													59	36	---	---	---	---	PASS
EAF2	55840	broad.mit.edu	37	3	121591526	121591526	+	Silent	SNP	A	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121591526A>G	uc003een.2	+	5	726	c.627A>G	c.(625-627)ACA>ACG	p.T209T	EAF2_uc003eeo.2_Silent_p.T79T	NM_018456	NP_060926	Q96CJ1	EAF2_HUMAN	ELL associated factor 2	209	Necessary for transactivation activity.				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	protein binding				0				GBM - Glioblastoma multiforme(114;0.0972)		CTTCTGATACAGGGAATTGTG	0.403													4	60	---	---	---	---	PASS
ALDH1L1	10840	broad.mit.edu	37	3	125844456	125844456	+	Intron	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125844456C>A	uc003eim.1	-						ALDH1L1_uc010hse.1_Intron|ALDH1L1_uc011bki.1_Intron	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1						10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	AACCCACGCTCACCTGAGCAG	0.592													20	199	---	---	---	---	PASS
TF	7018	broad.mit.edu	37	3	133485154	133485154	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133485154G>T	uc003epu.1	+	17	3091	c.1363G>T	c.(1363-1365)GCT>TCT	p.A455S	TF_uc011blt.1_Missense_Mutation_p.A328S|TF_uc003epw.1_Intron|TF_uc003epv.1_Missense_Mutation_p.A455S	NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor	455	Transferrin-like 2.				cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)	GAAGAAATCAGCTTCTGACCT	0.498													182	387	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154832874	154832874	+	Silent	SNP	C	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154832874C>G	uc010hvr.1	+	4	499	c.288C>G	c.(286-288)GTC>GTG	p.V96V	MME_uc003fab.1_Silent_p.V96V|MME_uc003fac.1_Silent_p.V96V|MME_uc003fad.1_Silent_p.V96V|MME_uc003fae.1_Silent_p.V96V	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	96	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	AACGTAATGTCATTCCCGAGA	0.448													12	302	---	---	---	---	PASS
PDCD10	11235	broad.mit.edu	37	3	167422680	167422680	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167422680C>A	uc003fex.2	-	4	498	c.100G>T	c.(100-102)GAA>TAA	p.E34*	PDCD10_uc003fez.2_Nonsense_Mutation_p.E34*|PDCD10_uc003fey.2_Nonsense_Mutation_p.E34*	NM_007217	NP_009148	Q9BUL8	PDC10_HUMAN	programmed cell death 10	34					angiogenesis|apoptosis|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of MAP kinase activity	cytosol|Golgi membrane|plasma membrane	protein homodimerization activity|protein N-terminus binding			lung(1)|central_nervous_system(1)	2						TTTACTCGTTCTAGCTGCaat	0.328									Familial_Cerebral_Cavernous_Angioma				11	86	---	---	---	---	PASS
NLGN1	22871	broad.mit.edu	37	3	173997009	173997009	+	Silent	SNP	A	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173997009A>T	uc003fio.1	+	6	1641	c.1218A>T	c.(1216-1218)ATA>ATT	p.I406I	NLGN1_uc010hww.1_Silent_p.I446I|NLGN1_uc003fip.1_Silent_p.I406I	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	423	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			ATGATGGTATATCAGCTAGTG	0.333													7	409	---	---	---	---	PASS
ZNF639	51193	broad.mit.edu	37	3	179051102	179051102	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179051102C>T	uc003fjq.1	+	6	693	c.350C>T	c.(349-351)CCT>CTT	p.P117L	ZNF639_uc003fjr.1_Missense_Mutation_p.P117L	NM_016331	NP_057415	Q9UID6	ZN639_HUMAN	zinc finger protein 639	117					initiation of viral infection|negative regulation by host of viral transcription|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of cell growth|positive regulation of transcription, DNA-dependent	nucleus	protein self-association|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			TGTGACTCACCTGAATCAGTC	0.358													41	109	---	---	---	---	PASS
YEATS2	55689	broad.mit.edu	37	3	183491565	183491565	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183491565G>A	uc003fly.2	+	17	2546	c.2351G>A	c.(2350-2352)CGA>CAA	p.R784Q	YEATS2_uc003flz.2_5'Flank	NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	784					histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GCCATCCTGCGAGCTACGAAC	0.453													7	379	---	---	---	---	PASS
IGF2BP2	10644	broad.mit.edu	37	3	185407394	185407394	+	Silent	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185407394C>T	uc003fpo.2	-	6	505	c.426G>A	c.(424-426)GGG>GGA	p.G142G	IGF2BP2_uc010hyi.2_Silent_p.G85G|IGF2BP2_uc010hyj.2_Silent_p.G79G|IGF2BP2_uc010hyk.2_Silent_p.G6G|IGF2BP2_uc010hyl.2_Silent_p.G79G|IGF2BP2_uc003fpp.2_Silent_p.G142G|IGF2BP2_uc003fpq.2_Silent_p.G147G	NM_006548	NP_006539	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding	142	RRM 2.				anatomical structure morphogenesis|negative regulation of translation	cytoskeletal part|cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity				0	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			CAAACTGATGCCCGCTTAGCT	0.498													6	684	---	---	---	---	PASS
LPP	4026	broad.mit.edu	37	3	188124045	188124045	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188124045C>T	uc003frs.1	+	3	383	c.137C>T	c.(136-138)GCC>GTC	p.A46V	LPP_uc011bsg.1_Missense_Mutation_p.A46V|LPP_uc011bsi.1_Missense_Mutation_p.A46V|LPP_uc003frt.2_Missense_Mutation_p.A46V	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation	46	Pro-rich.				cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		AAAAAGTTTGCCCCGGTAGTT	0.512			T	HMGA2|MLL|C12orf9	lipoma|leukemia								8	765	---	---	---	---	PASS
LRRC15	131578	broad.mit.edu	37	3	194080189	194080189	+	Missense_Mutation	SNP	G	C	C	rs115511298	byFrequency	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194080189G>C	uc003ftu.2	-	2	1670	c.1584C>G	c.(1582-1584)AGC>AGG	p.S528R	LRRC15_uc003ftt.2_Missense_Mutation_p.S534R	NM_130830	NP_570843	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15 isoform b	528	Extracellular (Potential).					integral to membrane				ovary(3)	3	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		TGCCCCAAACGCTGCGGTCAT	0.587													80	230	---	---	---	---	PASS
UBXN7	26043	broad.mit.edu	37	3	196094906	196094906	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196094906G>A	uc003fwm.3	-	8	902	c.827C>T	c.(826-828)GCC>GTC	p.A276V	UBXN7_uc003fwn.3_Missense_Mutation_p.A128V|UBXN7_uc010iae.2_Missense_Mutation_p.A114V	NM_015562	NP_056377	O94888	UBXN7_HUMAN	UBX domain containing 7	276							protein binding			ovary(2)|pancreas(1)	3						TACTGAACGGGCACATTTTTT	0.388													6	544	---	---	---	---	PASS
SH3TC1	54436	broad.mit.edu	37	4	8229064	8229064	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8229064G>T	uc003gkv.3	+	12	1744	c.1643G>T	c.(1642-1644)GGG>GTG	p.G548V	SH3TC1_uc003gkw.3_Missense_Mutation_p.G472V|SH3TC1_uc003gkx.3_RNA|SH3TC1_uc003gky.2_5'Flank	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	548							binding			large_intestine(2)|pancreas(1)	3						CAGGCCCGGGGGGCGGCCAAG	0.697													17	30	---	---	---	---	PASS
PROM1	8842	broad.mit.edu	37	4	16037384	16037384	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16037384G>T	uc003goo.2	-	3	489	c.277C>A	c.(277-279)CCA>ACA	p.P93T	PROM1_uc003gor.2_Missense_Mutation_p.P93T|PROM1_uc003gos.2_Intron|PROM1_uc003got.2_Missense_Mutation_p.P93T|PROM1_uc003gou.2_Intron|PROM1_uc003gop.2_Intron|PROM1_uc003goq.3_Intron|PROM1_uc010iec.1_Intron	NM_006017	NP_006008	O43490	PROM1_HUMAN	prominin 1 isoform 1	93	Extracellular (Potential).				camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7						ACAGTTTCTGGCTGTAGAAGT	0.408													41	144	---	---	---	---	PASS
GPR125	166647	broad.mit.edu	37	4	22390725	22390725	+	Silent	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22390725C>T	uc003gqm.1	-	18	2974	c.2709G>A	c.(2707-2709)CGG>CGA	p.R903R	GPR125_uc010ieo.1_Silent_p.R759R|GPR125_uc003gql.1_Silent_p.R30R	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor	903	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				GTGCGTTTGGCCGACTGCCGT	0.418													5	432	---	---	---	---	PASS
C4orf19	55286	broad.mit.edu	37	4	37592256	37592256	+	Silent	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37592256C>A	uc003gsw.3	+	4	762	c.579C>A	c.(577-579)GGC>GGA	p.G193G	C4orf19_uc003gsy.3_Silent_p.G193G	NM_001104629	NP_001098099	Q8IY42	CD019_HUMAN	hypothetical protein LOC55286	193											0						AGCATTGGGGCCCAGCTGGAG	0.498													47	64	---	---	---	---	PASS
DCAF4L1	285429	broad.mit.edu	37	4	41984871	41984871	+	Silent	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41984871C>A	uc003gwk.2	+	1	1159	c.1062C>A	c.(1060-1062)TCC>TCA	p.S354S		NM_001029955	NP_001025126	Q3SXM0	DC4L1_HUMAN	WD repeat domain 21B	354										skin(1)	1						CCATCCCTTCCCCGTACTCTG	0.637													44	101	---	---	---	---	PASS
SHISA3	152573	broad.mit.edu	37	4	42403075	42403075	+	Silent	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42403075G>T	uc003gwp.2	+	2	542	c.324G>T	c.(322-324)GCG>GCT	p.A108A		NM_001080505	NP_001073974	A0PJX4	SHSA3_HUMAN	shisa homolog 3 precursor	108	Helical; (Potential).				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane				ovary(1)|skin(1)	2						TCTTCATTGCGTTCATCATCC	0.502													134	290	---	---	---	---	PASS
GRXCR1	389207	broad.mit.edu	37	4	43022436	43022436	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43022436G>C	uc003gwt.2	+	3	693	c.693G>C	c.(691-693)GAG>GAC	p.E231D		NM_001080476	NP_001073945	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	231	Glutaredoxin.				cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity			ovary(1)	1						CCAAAATTGAGGTAAATGTGC	0.333													11	48	---	---	---	---	PASS
ODAM	54959	broad.mit.edu	37	4	71063746	71063746	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71063746T>G	uc003hfc.2	+	4	264	c.247T>G	c.(247-249)TTT>GTT	p.F83V		NM_017855	NP_060325	A1E959	ODAM_HUMAN	odontogenic ameloblast-associated protein	83	Gln-rich.				biomineral tissue development|odontogenesis of dentine-containing tooth	fibril				ovary(3)|large_intestine(1)	4						TCTAGACCAGTTTGCTGGACT	0.483													126	769	---	---	---	---	PASS
FGF5	2250	broad.mit.edu	37	4	81207593	81207593	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81207593C>A	uc003hmd.2	+	3	811	c.574C>A	c.(574-576)CTG>ATG	p.L192M	FGF5_uc003hme.2_3'UTR	NM_004464	NP_004455	P12034	FGF5_HUMAN	fibroblast growth factor 5 isoform 1 precursor	192					cell proliferation|cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell division|positive regulation of cell proliferation	extracellular space	fibroblast growth factor receptor binding|growth factor activity			ovary(1)|breast(1)	2						GTATGTGGCCCTGAATAAAAG	0.478													260	91	---	---	---	---	PASS
HERC3	8916	broad.mit.edu	37	4	89591400	89591400	+	Silent	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89591400G>T	uc003hrw.1	+	16	2074	c.1908G>T	c.(1906-1908)GGG>GGT	p.G636G	HERC3_uc011cdn.1_Silent_p.G518G|HERC3_uc011cdo.1_Silent_p.G80G	NM_014606	NP_055421	Q15034	HERC3_HUMAN	hect domain and RLD 3	636					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		ATCAAGCAGGGATGGTAAGAA	0.353													26	55	---	---	---	---	PASS
SPATA4	132851	broad.mit.edu	37	4	177113858	177113858	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177113858A>G	uc003iuo.1	-	4	717	c.608T>C	c.(607-609)ATG>ACG	p.M203T		NM_144644	NP_653245	Q8NEY3	SPAT4_HUMAN	spermatogenesis associated 4	203					apoptosis|spermatogenesis						0		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.9e-20)|Epithelial(43;1.99e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.58e-09)|GBM - Glioblastoma multiforme(59;0.000162)|STAD - Stomach adenocarcinoma(60;0.000543)|LUSC - Lung squamous cell carcinoma(193;0.096)		ATTGGTCAGCATGTTGGGATT	0.368													14	50	---	---	---	---	PASS
LOC285501	285501	broad.mit.edu	37	4	178882064	178882064	+	Intron	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178882064G>T	uc010iru.2	+							NR_028342				Homo sapiens cDNA clone IMAGE:4828874.												0		all_lung(41;6.03e-08)|Lung NSC(41;4.26e-07)|Breast(14;0.00066)|Melanoma(52;0.00168)|Prostate(90;0.0129)|all_hematologic(60;0.0202)|Renal(120;0.0246)|Colorectal(36;0.0508)|Hepatocellular(41;0.236)		all cancers(43;9.24e-25)|Epithelial(43;6.28e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.29e-10)|LUSC - Lung squamous cell carcinoma(1;2.61e-05)|Lung(1;3.22e-05)|GBM - Glioblastoma multiforme(59;0.000185)|Colorectal(24;0.000244)|STAD - Stomach adenocarcinoma(60;0.000777)|COAD - Colon adenocarcinoma(29;0.000884)		GAAAAAGTACGGGATTTCTCA	0.328													15	28	---	---	---	---	PASS
PLEKHG4B	153478	broad.mit.edu	37	5	151718	151718	+	Intron	SNP	A	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151718A>G	uc003jak.2	+							NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		AATTCAGGTAATGGTTTAGAC	0.343													40	38	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7826899	7826899	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7826899A>G	uc003jdz.1	+	25	3258	c.3191A>G	c.(3190-3192)AAC>AGC	p.N1064S	ADCY2_uc011cmo.1_Missense_Mutation_p.N884S|ADCY2_uc010itm.1_Missense_Mutation_p.N260S	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	1064	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						GGAATAATCAACGTGAAAGGA	0.517													127	140	---	---	---	---	PASS
FAM105B	90268	broad.mit.edu	37	5	14678872	14678872	+	Silent	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14678872G>T	uc003jfk.2	+	3	464	c.312G>T	c.(310-312)ACG>ACT	p.T104T		NM_138348	NP_612357	Q96BN8	F105B_HUMAN	hypothetical protein LOC90268	104										ovary(2)	2	Lung NSC(4;0.00696)					AGAAAGCAACGTGTATGAAAA	0.328													27	62	---	---	---	---	PASS
GPBP1	65056	broad.mit.edu	37	5	56558513	56558513	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56558513A>T	uc003jrh.3	+	12	2630	c.1356A>T	c.(1354-1356)AAA>AAT	p.K452N	GPBP1_uc010iwg.2_Missense_Mutation_p.K472N|GPBP1_uc003jri.3_Missense_Mutation_p.K281N|GPBP1_uc003jrj.3_Missense_Mutation_p.K444N|GPBP1_uc003jrk.3_Missense_Mutation_p.K459N|GPBP1_uc003jrl.3_RNA	NM_022913	NP_075064	Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1 isoform 1	452					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			large_intestine(1)|central_nervous_system(1)	2		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		GCACTTTCAAACCCACAACTG	0.388													84	61	---	---	---	---	PASS
APC	324	broad.mit.edu	37	5	112164609	112164609	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112164609G>C	uc010jby.2	+	14	2063	c.1683G>C	c.(1681-1683)AAG>AAC	p.K561N	APC_uc011cvt.1_Missense_Mutation_p.K543N|APC_uc003kpz.3_Missense_Mutation_p.K561N|APC_uc003kpy.3_Missense_Mutation_p.K561N|APC_uc010jbz.2_Missense_Mutation_p.K278N|APC_uc010jca.2_Intron	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	561	ARM 3.|Leu-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.T562fs*19(1)|p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ATAGTAAAAAGACGTTGCGAG	0.299		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			11	102	---	---	---	---	PASS
MCC	4163	broad.mit.edu	37	5	112720749	112720749	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112720749G>A	uc003kql.3	-	2	747	c.331C>T	c.(331-333)CTT>TTT	p.L111F	MCC_uc003kqk.3_RNA	NM_001085377	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 1	Error:Variant_position_missing_in_P23508_after_alignment					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		TTTGCAGAAAGATCTACTTCC	0.458													12	149	---	---	---	---	PASS
PCDHA2	56146	broad.mit.edu	37	5	140175108	140175108	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140175108G>A	uc003lhd.2	+	1	665	c.559G>A	c.(559-561)GAA>AAA	p.E187K	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.E187K|PCDHA2_uc011czy.1_Missense_Mutation_p.E187K	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	187	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCAAATGATGAACTAAGCGA	0.458													15	178	---	---	---	---	PASS
PCDHA6	56142	broad.mit.edu	37	5	140209869	140209869	+	Silent	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140209869G>T	uc003lho.2	+	1	2220	c.2193G>T	c.(2191-2193)GCG>GCT	p.A731A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc011dab.1_Silent_p.A731A	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	731	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	p.A731A(1)		haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGAGGGCGCGTGCACGGCGG	0.687													15	81	---	---	---	---	PASS
PCDH12	51294	broad.mit.edu	37	5	141335730	141335730	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141335730G>T	uc003llx.2	-	1	2898	c.1687C>A	c.(1687-1689)CCA>ACA	p.P563T		NM_016580	NP_057664	Q9NPG4	PCD12_HUMAN	protocadherin 12 precursor	563	Extracellular (Potential).|Cadherin 5.				neuron recognition	integral to plasma membrane	calcium ion binding			ovary(3)	3		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCACCTCTGGGGCATTATCA	0.587													38	44	---	---	---	---	PASS
DDX41	51428	broad.mit.edu	37	5	176940853	176940853	+	Intron	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176940853G>A	uc003mho.2	-						DDX41_uc003mhm.2_Intron|DDX41_uc003mhn.2_Intron|DDX41_uc003mhp.2_Intron|DDX41_uc003mhq.1_Intron	NM_016222	NP_057306	Q9UJV9	DDX41_HUMAN	DEAD-box protein abstrakt						apoptosis|multicellular organismal development	catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|zinc ion binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			ACACCGCTGGGGACCAAGGAG	0.587													36	26	---	---	---	---	PASS
DUSP22	56940	broad.mit.edu	37	6	335143	335143	+	Silent	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:335143G>T	uc003msx.2	+	4	607	c.168G>T	c.(166-168)GCG>GCT	p.A56A	DUSP22_uc011dhn.1_Silent_p.A56A|DUSP22_uc003msy.1_Silent_p.A13A	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	56					apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		TCCCAGCAGCGGATTCACCAT	0.318													5	130	---	---	---	---	PASS
ZNF323	64288	broad.mit.edu	37	6	28294622	28294622	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28294622C>T	uc003nla.2	-	4	942	c.542G>A	c.(541-543)AGT>AAT	p.S181N	ZNF323_uc003nld.2_Missense_Mutation_p.S181N|ZNF323_uc010jra.2_Missense_Mutation_p.S181N|ZNF323_uc003nlb.2_Missense_Mutation_p.S22N|ZNF323_uc010jrb.2_Missense_Mutation_p.S22N|ZNF323_uc003nlc.2_Missense_Mutation_p.S181N	NM_001135216	NP_001128688	Q96LW9	ZN323_HUMAN	zinc finger protein 323	181					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						CTCAGGTATACTTTCACCATC	0.343													34	105	---	---	---	---	PASS
NCR3	259197	broad.mit.edu	37	6	31556856	31556856	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31556856G>A	uc003nuv.2	-	4	858	c.594C>T	c.(592-594)GTC>GTT	p.V198V	NCR3_uc003nuw.2_3'UTR	NM_147130	NP_667341	O14931	NCTR3_HUMAN	natural cytotoxicity triggering receptor 3	198	Cytoplasmic (Potential).				cell recognition|immune response|inflammatory response|positive regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane	receptor activity			ovary(1)|skin(1)	2						AGCCTCCTGGGACTGGGGGAA	0.597													16	85	---	---	---	---	PASS
TRERF1	55809	broad.mit.edu	37	6	42214277	42214277	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42214277C>A	uc003osd.2	-	14	3225	c.2662G>T	c.(2662-2664)GAC>TAC	p.D888Y	TRERF1_uc011duq.1_Missense_Mutation_p.D805Y|TRERF1_uc003osb.2_Missense_Mutation_p.D644Y|TRERF1_uc003osc.2_Missense_Mutation_p.D644Y|TRERF1_uc003ose.2_Missense_Mutation_p.D908Y	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	888	SANT.|Interacts with CREBBP.				cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GTCCACTTGTCCGAACCTACA	0.373													43	124	---	---	---	---	PASS
MEP1A	4224	broad.mit.edu	37	6	46761185	46761185	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46761185C>T	uc010jzh.1	+	1	92	c.50C>T	c.(49-51)GCC>GTC	p.A17V	MEP1A_uc011dwg.1_5'UTR|MEP1A_uc011dwh.1_Missense_Mutation_p.A17V|MEP1A_uc011dwi.1_5'UTR	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	meprin A alpha precursor	17					digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding			pancreas(2)|ovary(1)	3			Lung(136;0.192)			TTGCTTTTTGCCCACATAGCA	0.348													7	816	---	---	---	---	PASS
MEP1A	4224	broad.mit.edu	37	6	46803248	46803248	+	Silent	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46803248C>T	uc010jzh.1	+	13	2088	c.2046C>T	c.(2044-2046)GAC>GAT	p.D682D	MEP1A_uc011dwg.1_Silent_p.D404D|MEP1A_uc011dwh.1_Silent_p.D710D|MEP1A_uc011dwi.1_Silent_p.D582D	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	meprin A alpha precursor	682	EGF-like.|Extracellular (Potential).				digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding			pancreas(2)|ovary(1)	3			Lung(136;0.192)			GCCAAAATGACGGCATCTGTG	0.607													236	31	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51774096	51774096	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51774096C>A	uc003pah.1	-	40	6943	c.6667G>T	c.(6667-6669)GTG>TTG	p.V2223L	PKHD1_uc010jzn.1_Missense_Mutation_p.V248L|PKHD1_uc003pai.2_Missense_Mutation_p.V2223L	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2223	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					ATAGCTCCCACCAGAGTGAGT	0.502													49	189	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51924782	51924782	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51924782G>A	uc003pah.1	-	15	1453	c.1177C>T	c.(1177-1179)CAG>TAG	p.Q393*	PKHD1_uc003pai.2_Nonsense_Mutation_p.Q393*	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	393	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CTATCTGCCTGAATCCAGAAA	0.453													29	72	---	---	---	---	PASS
BMP5	653	broad.mit.edu	37	6	55639028	55639028	+	Missense_Mutation	SNP	G	T	T	rs41271330	byFrequency	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55639028G>T	uc003pcq.2	-	4	1558	c.846C>A	c.(844-846)AAC>AAA	p.N282K	BMP5_uc011dxf.1_Missense_Mutation_p.N282K	NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein	282					cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			CAGATTTTACGTTGATACTGC	0.423													42	146	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56482017	56482017	+	Intron	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56482017C>A	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Intron|DST_uc003pdc.3_Missense_Mutation_p.R2083M	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTCATCATCCCTGACTGAACA	0.473													145	232	---	---	---	---	PASS
SIM1	6492	broad.mit.edu	37	6	100838774	100838774	+	Silent	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100838774G>T	uc003pqj.3	-	11	1971	c.1764C>A	c.(1762-1764)CCC>CCA	p.P588P	SIM1_uc010kcu.2_Silent_p.P588P	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	588	Single-minded C-terminal.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		GTTGGTCTGAGGGGGCTTTCC	0.458													45	155	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	101054613	101054613	+	Intron	SNP	T	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101054613T>A	uc003pqk.2	-							NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TTAAGAAAATTACCTGTAATG	0.308													6	20	---	---	---	---	PASS
MAN1A1	4121	broad.mit.edu	37	6	119525941	119525941	+	Missense_Mutation	SNP	G	C	C	rs140726044		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119525941G>C	uc003pym.1	-	7	1541	c.1099C>G	c.(1099-1101)CCC>GCC	p.P367A		NM_005907	NP_005898	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	367	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum|ER-Golgi intermediate compartment|Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		GCAAAGATGGGGTTTCCTGAT	0.458													96	136	---	---	---	---	PASS
TCF21	6943	broad.mit.edu	37	6	134210895	134210895	+	Silent	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134210895G>T	uc003qei.3	+	1	636	c.360G>T	c.(358-360)ACG>ACT	p.T120T	uc003qeg.1_5'Flank|TCF21_uc003qej.2_Silent_p.T120T	NM_003206	NP_003197	O43680	TCF21_HUMAN	transcription factor 21	120	Helix-loop-helix motif.				branching involved in ureteric bud morphogenesis|mesoderm development|negative regulation of androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus	androgen receptor binding|E-box binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity				0	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)		AGCTGGACACGCTCAGGCTGG	0.617													130	182	---	---	---	---	PASS
MAP3K5	4217	broad.mit.edu	37	6	136926462	136926462	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136926462G>C	uc003qhc.2	-	19	2925	c.2564C>G	c.(2563-2565)CCA>CGA	p.P855R	MAP3K5_uc011edj.1_Missense_Mutation_p.P102R|MAP3K5_uc011edk.1_Missense_Mutation_p.P700R	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase	855	Protein kinase.				activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		GTAGCCTCTTGGTCCTTTATC	0.403													65	69	---	---	---	---	PASS
HIVEP2	3097	broad.mit.edu	37	6	143094104	143094104	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143094104C>T	uc003qjd.2	-	5	2515	c.1772G>A	c.(1771-1773)AGA>AAA	p.R591K		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	591					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CGCTTGTCTTCTTAGCATGCG	0.527													4	265	---	---	---	---	PASS
SYNJ2	8871	broad.mit.edu	37	6	158502168	158502168	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158502168A>C	uc003qqx.1	+	19	2670	c.2595A>C	c.(2593-2595)GAA>GAC	p.E865D	SYNJ2_uc003qqw.1_Missense_Mutation_p.E865D|SYNJ2_uc003qqy.1_Missense_Mutation_p.E578D|SYNJ2_uc003qqz.1_Missense_Mutation_p.E482D|SYNJ2_uc003qra.1_Missense_Mutation_p.E208D	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2	865	Catalytic (By similarity).						nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		TGGAGGTGGAAGTTCAGGAAG	0.572													4	172	---	---	---	---	PASS
TMEM195	392636	broad.mit.edu	37	7	15427122	15427122	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15427122G>C	uc003stb.1	-	9	1036	c.866C>G	c.(865-867)CCT>CGT	p.P289R		NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195	289					ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0						GAAGAATCCAGGTGTGGCCCA	0.358													6	213	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20698286	20698286	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20698286C>G	uc003suw.3	+	5	905	c.359C>G	c.(358-360)GCT>GGT	p.A120G	ABCB5_uc010kuh.2_Missense_Mutation_p.A565G|ABCB5_uc003suv.3_Missense_Mutation_p.A120G|ABCB5_uc011jyi.1_Missense_Mutation_p.A120G	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	120	ABC transporter 1.|Extracellular (Potential).				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						GCTGTTCAAGCTGCACTGGAG	0.408													36	77	---	---	---	---	PASS
SNX10	29887	broad.mit.edu	37	7	26400587	26400587	+	Intron	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26400587C>T	uc003sxx.2	+						SNX10_uc011jzg.1_Intron|SNX10_uc010kuu.2_Intron|SNX10_uc010kuv.2_Missense_Mutation_p.P2L	NM_013322	NP_037454	Q9Y5X0	SNX10_HUMAN	sorting nexin 10						cell communication|endosome organization|protein transport	extrinsic to endosome membrane	1-phosphatidylinositol binding				0						TTTATGATGCCATTACAGGAA	0.368													29	68	---	---	---	---	PASS
WIPF3	644150	broad.mit.edu	37	7	29928944	29928944	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29928944G>A	uc003taj.1	+	6	1272	c.1272G>A	c.(1270-1272)ACG>ACA	p.T424T		NM_001080529	NP_001073998	A6NGB9	WIPF3_HUMAN	WAS/WASL interacting protein family, member 3	424										ovary(1)	1						CTAAATTCACGTTCCATTCTG	0.438													30	79	---	---	---	---	PASS
TBX20	57057	broad.mit.edu	37	7	35289660	35289660	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35289660C>A	uc011kas.1	-	2	294	c.283G>T	c.(283-285)GAG>TAG	p.E95*		NM_001077653	NP_001071121	Q9UMR3	TBX20_HUMAN	T-box transcription factor TBX20	95						nucleus	DNA binding			central_nervous_system(1)	1						GCCATTTCCTCACTGGGGATG	0.582													31	74	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42005053	42005053	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42005053C>A	uc011kbh.1	-	15	3709	c.3618G>T	c.(3616-3618)AGG>AGT	p.R1206S	GLI3_uc011kbg.1_Missense_Mutation_p.R1147S	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	1206					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						CAGGCCCGCTCCTCAAGGGGT	0.662									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				98	156	---	---	---	---	PASS
SAMD9L	219285	broad.mit.edu	37	7	92761600	92761600	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92761600C>G	uc003umh.1	-	5	4901	c.3685G>C	c.(3685-3687)GTG>CTG	p.V1229L	SAMD9L_uc003umj.1_Missense_Mutation_p.V1229L|SAMD9L_uc003umi.1_Missense_Mutation_p.V1229L|SAMD9L_uc010lfb.1_Missense_Mutation_p.V1229L|SAMD9L_uc003umk.1_Missense_Mutation_p.V1229L|SAMD9L_uc010lfc.1_Missense_Mutation_p.V1229L|SAMD9L_uc010lfd.1_Missense_Mutation_p.V1229L|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1229										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			AAAAATTGCACCATATGTTTT	0.358													67	141	---	---	---	---	PASS
ZNF655	79027	broad.mit.edu	37	7	99170395	99170395	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99170395C>T	uc003urh.2	+	3	1057	c.664C>T	c.(664-666)CAT>TAT	p.H222Y	ZNF655_uc010lga.2_Missense_Mutation_p.H257Y|ZNF655_uc010lgc.2_Missense_Mutation_p.H257Y|ZNF655_uc003urj.2_Missense_Mutation_p.H222Y|ZNF655_uc003urk.2_Missense_Mutation_p.H59Y|ZNF655_uc010lgd.2_Missense_Mutation_p.H59Y	NM_138494	NP_612503	Q8N720	ZN655_HUMAN	zinc finger protein 655 isoform a	222	C2H2-type 1.				G1 phase|regulation of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding			ovary(1)	1	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					GAAAATTTTCCATCAGAGCTC	0.393													9	36	---	---	---	---	PASS
ZNF498	221785	broad.mit.edu	37	7	99221744	99221744	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99221744C>T	uc003url.1	+	7	1073	c.746C>T	c.(745-747)CCA>CTA	p.P249L	ZNF498_uc003urm.1_Missense_Mutation_p.P85L|ZNF498_uc010lge.1_Missense_Mutation_p.P85L|ZNF498_uc003urn.2_RNA|ZNF498_uc010lgf.1_Intron|ZNF498_uc003uro.1_Missense_Mutation_p.P33L	NM_145115	NP_660090	Q6NSZ9	ZN498_HUMAN	zinc finger and SCAN domain containing 25	249					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_epithelial(64;1.95e-08)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					CATGTGACCCCAGCCCAGATA	0.537													158	276	---	---	---	---	PASS
ACTL6B	51412	broad.mit.edu	37	7	100244174	100244174	+	Silent	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100244174C>A	uc003uvy.2	-	12	1220	c.1113G>T	c.(1111-1113)CCG>CCT	p.P371P	ACTL6B_uc003uvx.1_Silent_p.P162P|ACTL6B_uc003uvz.2_RNA	NM_016188	NP_057272	O94805	ACL6B_HUMAN	actin-like 6B	371					chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex|SWI/SNF complex	ATP binding|protein binding|structural constituent of cytoskeleton			ovary(1)	1	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					GGGCTCCTACCGGTGGGGTCT	0.607													4	186	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100361796	100361796	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100361796C>A	uc003uwj.2	+	22	4409	c.4244C>A	c.(4243-4245)CCC>CAC	p.P1415H	ZAN_uc003uwk.2_Missense_Mutation_p.P1415H|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kkd.1_Intron	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	1415	Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GCTGTGAAGCCCTGGAGGGAA	0.443													18	26	---	---	---	---	PASS
LRWD1	222229	broad.mit.edu	37	7	102108810	102108810	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102108810C>T	uc003uzn.2	+	7	1043	c.905C>T	c.(904-906)CCG>CTG	p.P302L	LRWD1_uc003uzo.2_Missense_Mutation_p.P150L	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain	302					chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding			skin(1)	1						GCCTTCGAGCCGGCCTGGGAG	0.652													4	23	---	---	---	---	PASS
DNAJC2	27000	broad.mit.edu	37	7	102956328	102956328	+	Intron	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102956328G>A	uc003vbo.2	-						PMPCB_uc011kll.1_Intron|DNAJC2_uc003vbn.2_Intron|DNAJC2_uc010lix.2_Intron|DNAJC2_uc003vbp.2_Intron	NM_014377	NP_055192	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2						'de novo' cotranslational protein folding|chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane	chromatin binding|DNA binding|histone binding|Hsp70 protein binding|ubiquitin binding			kidney(1)	1						TCTGAGAAATGAAAAAAATTT	0.294													7	32	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106513331	106513331	+	Silent	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106513331C>A	uc003vdv.3	+	4	2320	c.2235C>A	c.(2233-2235)GTC>GTA	p.V745V	PIK3CG_uc003vdu.2_Silent_p.V745V|PIK3CG_uc003vdw.2_Silent_p.V745V	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	745					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						TACAAAAAGTCACCCTTGATA	0.458													67	102	---	---	---	---	PASS
MEST	4232	broad.mit.edu	37	7	130137087	130137087	+	Intron	SNP	C	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130137087C>G	uc003vqg.2	+						MEST_uc003vqc.2_Intron|MEST_uc003vqd.2_Intron|MEST_uc003vqf.2_Intron|MEST_uc011kph.1_Intron|MEST_uc010lmg.2_Intron	NM_002402	NP_002393	Q5EB52	MEST_HUMAN	mesoderm specific transcript isoform a						mesoderm development	endoplasmic reticulum membrane|integral to membrane	hydrolase activity|protein binding			ovary(2)	2	Melanoma(18;0.0435)					GTAATGAAGTCAGACTTCTAC	0.289													30	98	---	---	---	---	PASS
TAS2R38	5726	broad.mit.edu	37	7	141672606	141672606	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141672606G>T	uc003vwx.1	-	1	968	c.884C>A	c.(883-885)GCC>GAC	p.A295D		NM_176817	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	295	Helical; Name=7; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			kidney(1)|skin(1)	2	Melanoma(164;0.0171)					GATCAGGATGGCTGCATGCCC	0.542													67	123	---	---	---	---	PASS
KRBA1	84626	broad.mit.edu	37	7	149431068	149431068	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149431068G>C	uc003wfz.2	+	18	3424	c.3025G>C	c.(3025-3027)GTG>CTG	p.V1009L	KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_Missense_Mutation_p.V616L	NM_032534	NP_115923	A5PL33	KRBA1_HUMAN	KRAB A domain containing 1	1009										ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCTGGGAGGAGTGCAGAGGGC	0.642													19	20	---	---	---	---	PASS
ARHGEF10	9639	broad.mit.edu	37	8	1882037	1882037	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1882037A>T	uc003wpr.2	+	26	3329	c.3151A>T	c.(3151-3153)ATG>TTG	p.M1051L	ARHGEF10_uc003wps.2_Missense_Mutation_p.M1013L|ARHGEF10_uc010lre.2_Missense_Mutation_p.M702L	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	1076					centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		TCTACTCATGATGGAAGACAC	0.443													121	68	---	---	---	---	PASS
DOCK5	80005	broad.mit.edu	37	8	25232132	25232132	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25232132G>T	uc003xeg.2	+	37	3915	c.3778G>T	c.(3778-3780)GCT>TCT	p.A1260S	DOCK5_uc003xeh.1_Missense_Mutation_p.A974S|PPP2R2A_uc003xek.2_Missense_Mutation_p.A49S|DOCK5_uc003xei.2_Missense_Mutation_p.A830S|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1260	DHR-2.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CTACACAGAAGCTGCCTACAC	0.468													5	307	---	---	---	---	PASS
ESCO2	157570	broad.mit.edu	37	8	27646495	27646495	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27646495G>A	uc003xgg.2	+	7	1346	c.1263G>A	c.(1261-1263)GTG>GTA	p.V421V	ESCO2_uc010luy.1_RNA	NM_001017420	NP_001017420	Q56NI9	ESCO2_HUMAN	establishment of cohesion 1 homolog 2	421					cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding			central_nervous_system(1)	1		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|KIRC - Kidney renal clear cell carcinoma(542;0.0955)|Kidney(114;0.115)|Colorectal(74;0.132)		TCAAATATGTGGTGAGCCAAA	0.398									SC_Phocomelia_syndrome				45	51	---	---	---	---	PASS
FUT10	84750	broad.mit.edu	37	8	33230216	33230216	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33230216C>A	uc003xje.2	-	5	1675	c.1319G>T	c.(1318-1320)CGA>CTA	p.R440L	FUT10_uc003xjc.2_Missense_Mutation_p.R447L|FUT10_uc003xjd.2_Missense_Mutation_p.R412L|FUT10_uc011lbi.1_Missense_Mutation_p.R490L	NM_032664	NP_116053	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10	440	Lumenal (Potential).				embryo development|fertilization|hemopoiesis|L-fucose catabolic process|nervous system development|protein folding|protein glycosylation|protein targeting|wound healing	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			ovary(1)|pancreas(1)	2				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		CCACATCTCTCGCAAAGAGCT	0.488													45	44	---	---	---	---	PASS
SNAI2	6591	broad.mit.edu	37	8	49832654	49832654	+	Silent	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49832654C>T	uc003xqp.2	-	2	590	c.426G>A	c.(424-426)GGG>GGA	p.G142G		NM_003068	NP_003059	O43623	SNAI2_HUMAN	snail 2	142	C2H2-type 1.				canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				GTTTGGCCAGCCCAGAAAAAG	0.448													180	295	---	---	---	---	PASS
ASPH	444	broad.mit.edu	37	8	62430122	62430122	+	Silent	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62430122C>T	uc003xuj.2	-	24	2360	c.2091G>A	c.(2089-2091)AAG>AAA	p.K697K	ASPH_uc011leg.1_Silent_p.K668K	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a	697	Lumenal (Potential).				muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	TGCAGCCTTCCTTGGGAATCA	0.527													88	139	---	---	---	---	PASS
SGK3	23678	broad.mit.edu	37	8	67753278	67753278	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67753278A>G	uc003xwr.2	+	13	1210	c.911A>G	c.(910-912)GAT>GGT	p.D304G	SGK3_uc003xwp.2_Missense_Mutation_p.D298G|SGK3_uc003xwt.2_Missense_Mutation_p.D304G|SGK3_uc003xwu.2_Missense_Mutation_p.D304G	NM_001033578	NP_001028750	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase 3 isoform	304	Protein kinase.				cell communication|response to stress	cytoplasmic membrane-bounded vesicle|early endosome	ATP binding|phosphatidylinositol binding|protein serine/threonine kinase activity			ovary(1)|large_intestine(1)|lung(1)|breast(1)	4	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GTCTTAACAGATTTTGGGCTT	0.303													13	80	---	---	---	---	PASS
SLC7A13	157724	broad.mit.edu	37	8	87229738	87229738	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87229738C>A	uc003ydq.1	-	3	1238	c.1140G>T	c.(1138-1140)AGG>AGT	p.R380S	SLC7A13_uc003ydr.1_Missense_Mutation_p.R371S	NM_138817	NP_620172	Q8TCU3	S7A13_HUMAN	solute carrier family 7, (cationic amino acid	380	Cytoplasmic (Potential).					integral to membrane	amino acid transmembrane transporter activity			central_nervous_system(1)	1						GGTATCTCCGCCTTAGTATTC	0.294													6	13	---	---	---	---	PASS
KIAA1429	25962	broad.mit.edu	37	8	95547246	95547246	+	Intron	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95547246G>A	uc003ygo.1	-						KIAA1429_uc003ygp.2_Intron	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1						mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CTGATTTTCAGGGAGGGCAAA	0.368													68	91	---	---	---	---	PASS
PTDSS1	9791	broad.mit.edu	37	8	97318741	97318741	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97318741G>T	uc003yht.1	+	8	1066	c.964G>T	c.(964-966)GGT>TGT	p.G322C	PTDSS1_uc003yhu.1_Missense_Mutation_p.G176C	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	322	Helical; (Potential).				phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	ATTAAGTTGGGGTAGAATTCT	0.418													13	412	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113301698	113301698	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113301698G>A	uc003ynu.2	-	57	9203	c.9044C>T	c.(9043-9045)TCT>TTT	p.S3015F	CSMD3_uc003yns.2_Missense_Mutation_p.S2217F|CSMD3_uc003ynt.2_Missense_Mutation_p.S2975F|CSMD3_uc011lhx.1_Missense_Mutation_p.S2846F	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3015	Sushi 21.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GTGAACAGTAGACCCAAAAGT	0.423										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			52	68	---	---	---	---	PASS
ZHX2	22882	broad.mit.edu	37	8	123964048	123964048	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123964048C>A	uc003ypk.1	+	3	865	c.298C>A	c.(298-300)CAG>AAG	p.Q100K		NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	100	C2H2-type 1.					cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			TGTCGACATGCAGCATCCCAA	0.498													5	223	---	---	---	---	PASS
ZHX2	22882	broad.mit.edu	37	8	123964939	123964939	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123964939G>A	uc003ypk.1	+	3	1756	c.1189G>A	c.(1189-1191)GTG>ATG	p.V397M		NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	397	Required for interaction with NFYA.|Required for repressor activity.|Required for nuclear localization.					cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			CACACTTGCCGTGGCAGGAGT	0.632													30	151	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	132051973	132051973	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132051973G>A	uc003ytd.3	-	1	863	c.607C>T	c.(607-609)CTG>TTG	p.L203L	ADCY8_uc010mds.2_Silent_p.L203L	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	203	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GCCGAGGCCAGGCTCAAGTGT	0.587										HNSCC(32;0.087)			69	126	---	---	---	---	PASS
ZFAT	57623	broad.mit.edu	37	8	135613997	135613997	+	Silent	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135613997C>A	uc003yup.2	-	6	2140	c.1965G>T	c.(1963-1965)GGG>GGT	p.G655G	ZFAT_uc003yun.2_Silent_p.G643G|ZFAT_uc003yuo.2_Silent_p.G643G|ZFAT_uc010meh.2_Silent_p.G643G|ZFAT_uc010mei.2_RNA|ZFAT_uc003yuq.2_Silent_p.G643G|ZFAT_uc010mej.2_Silent_p.G593G|ZFAT_uc003yur.2_Silent_p.G643G	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1	655					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			TCTGCCCTTCCCCTAGGGGGC	0.597													74	137	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139151265	139151265	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139151265G>C	uc003yuy.2	-	18	4036	c.3865C>G	c.(3865-3867)CGC>GGC	p.R1289G	FAM135B_uc003yux.2_Missense_Mutation_p.R1190G|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	1289										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AAACATTTGCGCAAATCAGCA	0.423										HNSCC(54;0.14)			54	147	---	---	---	---	PASS
IFNA16	3449	broad.mit.edu	37	9	21217288	21217288	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21217288G>C	uc003zor.1	-	1	23	c.17C>G	c.(16-18)TCT>TGT	p.S6C	IFNA14_uc003zoo.1_Intron	NM_002173	NP_002164	P05015	IFN16_HUMAN	interferon, alpha 16 precursor	6					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding			skin(1)	1				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		CATCAGTAAAGAAAAGGACAG	0.488													32	78	---	---	---	---	PASS
KIAA1539	80256	broad.mit.edu	37	9	35107389	35107389	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35107389C>A	uc003zwl.2	-	3	1208	c.883G>T	c.(883-885)GAG>TAG	p.E295*	KIAA1539_uc003zwm.2_Nonsense_Mutation_p.E295*|KIAA1539_uc003zwn.2_5'UTR|KIAA1539_uc003zwo.2_Nonsense_Mutation_p.E295*|KIAA1539_uc003zwp.1_Nonsense_Mutation_p.E295*|KIAA1539_uc010mkk.1_RNA	NM_025182	NP_079458	Q7L5A3	K1539_HUMAN	hypothetical protein LOC80256	295						nucleus				ovary(2)	2	all_epithelial(49;0.217)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AAAACAGGCTCTTTGGGCCCA	0.413													8	613	---	---	---	---	PASS
ALDH1B1	219	broad.mit.edu	37	9	38396346	38396346	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38396346G>A	uc004aay.2	+	2	713	c.601G>A	c.(601-603)GCC>ACC	p.A201T		NM_000692	NP_000683	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1B1 precursor	201					carbohydrate metabolic process	mitochondrial matrix|nucleus	aldehyde dehydrogenase (NAD) activity			skin(1)	1				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)	NADH(DB00157)	CCCGGCACTCGCCACAGGCAA	0.597													13	443	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90501261	90501261	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90501261C>G	uc004app.3	+	4	1894	c.1859C>G	c.(1858-1860)ACC>AGC	p.T620S	C9orf79_uc004apo.1_Missense_Mutation_p.T432S	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	620						integral to membrane				ovary(3)	3						GGGGTTGTCACCAGCCCTGAG	0.642													5	193	---	---	---	---	PASS
ALG2	85365	broad.mit.edu	37	9	101984110	101984110	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101984110C>A	uc004azf.2	-	1	137	c.67G>T	c.(67-69)GAC>TAC	p.D23Y	ALG2_uc004azg.2_5'UTR|SEC61B_uc004azh.2_5'Flank	NM_033087	NP_149078	Q9H553	ALG2_HUMAN	alpha-1,3-mannosyltransferase ALG2	23					dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in endoplasmic reticulum|protein N-linked glycosylation via asparagine|response to calcium ion	endoplasmic reticulum membrane|integral to membrane|membrane fraction|nucleus|perinuclear region of cytoplasm	alpha-1,3-mannosyltransferase activity|calcium-dependent protein binding|glycolipid 3-alpha-mannosyltransferase activity|protein anchor|protein heterodimerization activity|protein N-terminus binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.0559)				ACGCCCAGGTCTGGGTGGAGG	0.711													6	31	---	---	---	---	PASS
KIAA0368	23392	broad.mit.edu	37	9	114246723	114246723	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114246723G>A	uc004bfe.1	-	2	190	c.190C>T	c.(190-192)CGG>TGG	p.R64W	KIAA0368_uc010muc.1_5'Flank	NM_001080398	NP_001073867			KIAA0368 protein												0						GCCTCCCGCCGAACTTCTCGG	0.692													10	13	---	---	---	---	PASS
CAMSAP1	157922	broad.mit.edu	37	9	138715863	138715863	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138715863T>A	uc004cgr.3	-	10	1333	c.1333A>T	c.(1333-1335)AAT>TAT	p.N445Y	CAMSAP1_uc004cgq.3_Missense_Mutation_p.N335Y|CAMSAP1_uc010nbg.2_Missense_Mutation_p.N167Y	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein	445						cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		GTCAAAGAATTCGATCGATGT	0.418													3	3	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17157571	17157571	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17157571C>G	uc001ioo.2	-	7	671	c.619G>C	c.(619-621)GGA>CGA	p.G207R		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	207	EGF-like 2; calcium-binding (Potential).				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CACTGGGGTCCGTACGTCTCA	0.522													80	71	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17157572	17157572	+	Nonsense_Mutation	SNP	G	T	T	rs41289313	byFrequency	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17157572G>T	uc001ioo.2	-	7	670	c.618C>A	c.(616-618)TAC>TAA	p.Y206*		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	206	EGF-like 2; calcium-binding (Potential).				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACTGGGGTCCGTACGTCTCAG	0.522													80	71	---	---	---	---	PASS
LYZL1	84569	broad.mit.edu	37	10	29578106	29578106	+	Silent	SNP	A	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29578106A>T	uc001iul.2	+	1	117	c.60A>T	c.(58-60)GCA>GCT	p.A20A		NM_032517	NP_115906	Q6UWQ5	LYZL1_HUMAN	lysozyme-like 1	Error:Variant_position_missing_in_Q6UWQ5_after_alignment					cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0		Breast(68;0.203)				TTTCTTCCGCAGACTCAACTG	0.522													21	16	---	---	---	---	PASS
SGPL1	8879	broad.mit.edu	37	10	72619134	72619134	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72619134G>C	uc001jrm.2	+	7	715	c.493G>C	c.(493-495)GGA>CGA	p.G165R		NM_003901	NP_003892	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	165	Cytoplasmic (Potential).				apoptosis|carboxylic acid metabolic process|ceramide metabolic process|sphingolipid catabolic process	integral to endoplasmic reticulum membrane	carboxy-lyase activity|pyridoxal phosphate binding|sphinganine-1-phosphate aldolase activity				0					Pyridoxal Phosphate(DB00114)	GCAGGCTTATGGAGATTTTGC	0.408													30	17	---	---	---	---	PASS
ARL3	403	broad.mit.edu	37	10	104445666	104445666	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104445666G>A	uc001kwa.2	-	5	566	c.408C>T	c.(406-408)GCC>GCT	p.A136A		NM_004311	NP_004302	P36405	ARL3_HUMAN	ADP-ribosylation factor-like 3	136					cell cycle|cytokinesis|small GTPase mediated signal transduction	centrosome|cytoplasmic microtubule|Golgi membrane|midbody|nucleus|photoreceptor connecting cilium|spindle microtubule	GDP binding|GTP binding|metal ion binding|microtubule binding				0		Colorectal(252;0.122)		Epithelial(162;4.88e-09)|all cancers(201;1.29e-07)|BRCA - Breast invasive adenocarcinoma(275;0.22)		CAATTTCAGAGGCAGGGGCTG	0.502													6	163	---	---	---	---	PASS
OR51F2	119694	broad.mit.edu	37	11	4842815	4842815	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4842815G>C	uc010qyn.1	+	1	200	c.200G>C	c.(199-201)CGG>CCG	p.R67P		NM_001004753	NP_001004753	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F,	67	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTCTGTGAACGGAGCCTCCAT	0.478													10	402	---	---	---	---	PASS
OR51I2	390064	broad.mit.edu	37	11	5475618	5475618	+	Silent	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5475618C>A	uc010qzf.1	+	1	900	c.900C>A	c.(898-900)CGC>CGA	p.R300R	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004754	NP_001004754	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I,	300	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGAAATCCGCCGAGCCATTT	0.438													84	81	---	---	---	---	PASS
TRIM5	85363	broad.mit.edu	37	11	5877968	5877968	+	Intron	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5877968C>A	uc001mbq.1	-							NM_033093	NP_149084	Q9C035	TRIM5_HUMAN	tripartite motif protein TRIM5 isoform delta						interspecies interaction between organisms|protein trimerization|response to virus	cytoplasm|cytoplasmic mRNA processing body	ligase activity|protein binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		GACTCTCCAACCTCCAACTGG	0.418													66	57	---	---	---	---	PASS
OR2D2	120776	broad.mit.edu	37	11	6913740	6913740	+	5'Flank	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6913740G>T	uc010rau.1	-							NM_003700	NP_003691	Q9H210	OR2D2_HUMAN	olfactory receptor, family 2, subfamily D,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ATAGTTTGTTGTCCTTTTCAG	0.408													24	81	---	---	---	---	PASS
ST5	6764	broad.mit.edu	37	11	8751700	8751700	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8751700G>A	uc001mgt.2	-	3	1323	c.1137C>T	c.(1135-1137)TCC>TCT	p.S379S	ST5_uc009yfr.2_Intron|ST5_uc001mgu.2_Intron|ST5_uc001mgv.2_Silent_p.S379S|ST5_uc010rbq.1_Intron|ST5_uc001mgw.1_Silent_p.S379S	NM_213618	NP_998783	P78524	ST5_HUMAN	suppression of tumorigenicity 5 isoform 1	379	Pro-rich.				positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		CGGGATCGAGGGAACTCTTCG	0.602													12	203	---	---	---	---	PASS
OR4C12	283093	broad.mit.edu	37	11	50003668	50003668	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50003668T>C	uc010ria.1	-	1	370	c.370A>G	c.(370-372)ATC>GTC	p.I124V		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	124	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						GGTTTGCAGATGGCCACATAG	0.493													76	299	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55594695	55594695	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55594695A>T	uc001nhy.1	+	1	1	c.1A>T	c.(1-3)ATG>TTG	p.M1L		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	1	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				AATTGGAGACATGGGCAAGGA	0.393										HNSCC(27;0.073)			11	371	---	---	---	---	PASS
OR8J3	81168	broad.mit.edu	37	11	55904489	55904489	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55904489T>C	uc010riz.1	-	1	706	c.706A>G	c.(706-708)AAA>GAA	p.K236E		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	236	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					GAAAAGGCTTTTTTCCTTCCT	0.393													11	70	---	---	---	---	PASS
OR5M10	390167	broad.mit.edu	37	11	56344385	56344385	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56344385G>A	uc001niz.1	-	1	813	c.813C>T	c.(811-813)TCC>TCT	p.S271S		NM_001004741	NP_001004741	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M,	271	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CAATTATTTTGGACTCCTCTA	0.413													7	423	---	---	---	---	PASS
OR5M1	390168	broad.mit.edu	37	11	56380583	56380583	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56380583G>A	uc001nja.1	-	1	396	c.396C>T	c.(394-396)TAC>TAT	p.Y132Y		NM_001004740	NP_001004740	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M,	132	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						TCCTGGAACTGTAATGCAAAG	0.458													25	127	---	---	---	---	PASS
DDB1	1642	broad.mit.edu	37	11	61106912	61106912	+	Intron	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61106912G>T	uc010rlf.1	-						DAK_uc001nre.2_Intron|DAK_uc009ynm.1_Intron	NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1						cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4						CACAAGGTGGGCTTCCACCGG	0.537								NER					18	108	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64434732	64434732	+	Silent	SNP	A	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64434732A>G	uc001oar.2	-	10	2227	c.1788T>C	c.(1786-1788)GAT>GAC	p.D596D	NRXN2_uc001oas.2_Silent_p.D565D|NRXN2_uc001oaq.2_Silent_p.D263D	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						CTTTTCGCCCATCCCTCTGGA	0.592													30	129	---	---	---	---	PASS
MRGPRD	116512	broad.mit.edu	37	11	68748336	68748336	+	Silent	SNP	G	A	A	rs148272462		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68748336G>A	uc010rqf.1	-	1	120	c.120C>T	c.(118-120)TGC>TGT	p.C40C		NM_198923	NP_944605	Q8TDS7	MRGRD_HUMAN	MAS-related GPR, member D	40	Helical; Name=1; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(1)	1			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CTGCCATCCCGCACAGGCAGG	0.602													4	138	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71726893	71726893	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71726893C>A	uc001orl.1	-	15	1828	c.1656G>T	c.(1654-1656)CAG>CAT	p.Q552H	NUMA1_uc009ysw.1_Missense_Mutation_p.Q115H|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Missense_Mutation_p.Q552H|NUMA1_uc001orn.2_Missense_Mutation_p.Q115H|NUMA1_uc009ysx.1_Missense_Mutation_p.Q552H|NUMA1_uc001oro.1_Missense_Mutation_p.Q552H	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	552	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						GCTGCTCCACCTGGTGGCGGA	0.602			T	RARA	APL						OREG0021187	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	132	585	---	---	---	---	PASS
C2CD3	26005	broad.mit.edu	37	11	73849786	73849786	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73849786G>C	uc001ouu.2	-	5	1161	c.934C>G	c.(934-936)CCT>GCT	p.P312A	C2CD3_uc001ouv.2_Missense_Mutation_p.P312A	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	312						centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					TCCTTGGTAGGGAGGTTGTTT	0.423													82	79	---	---	---	---	PASS
GDPD4	220032	broad.mit.edu	37	11	76980007	76980007	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76980007G>T	uc001oyf.2	-	8	837	c.586C>A	c.(586-588)CCC>ACC	p.P196T		NM_182833	NP_878253	Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain	196	Extracellular (Potential).				glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding			skin(1)	1						GTTGGCTTGGGCCCCAAATTC	0.458													225	185	---	---	---	---	PASS
SLC36A4	120103	broad.mit.edu	37	11	92881946	92881946	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92881946G>C	uc001pdn.2	-	11	1369	c.1272C>G	c.(1270-1272)AGC>AGG	p.S424R	uc001pdl.1_5'Flank|SLC36A4_uc001pdm.2_Missense_Mutation_p.S289R	NM_152313	NP_689526	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid	424	Helical; (Potential).				L-alanine transport|proline transport|tryptophan transport	integral to membrane	symporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CCAATGTGCTGCTGCTCACAG	0.353													46	41	---	---	---	---	PASS
AMOTL1	154810	broad.mit.edu	37	11	94602404	94602404	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94602404C>T	uc001pfb.2	+	12	2700	c.2530C>T	c.(2530-2532)CCA>TCA	p.P844S	AMOTL1_uc001pfc.2_Missense_Mutation_p.P794S	NM_130847	NP_570899	Q8IY63	AMOL1_HUMAN	angiomotin like 1	844						cytoplasm|tight junction	identical protein binding			ovary(1)|breast(1)	2		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				TGCCTCTGCCCCACTGCTGCC	0.532													21	18	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108119810	108119810	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108119810G>A	uc001pkb.1	+	9	1601	c.1216G>A	c.(1216-1218)GAT>AAT	p.D406N	ATM_uc009yxr.1_Missense_Mutation_p.D406N	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	406					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		GTCACAGAATGATTTTGATCT	0.343			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			18	88	---	---	---	---	PASS
C11orf57	55216	broad.mit.edu	37	11	111946377	111946377	+	Intron	SNP	A	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111946377A>T	uc001pmr.3	+						PIH1D2_uc009yyl.2_5'Flank|PIH1D2_uc001pmq.3_5'Flank|PIH1D2_uc001pmp.3_5'Flank|PIH1D2_uc010rws.1_5'Flank|C11orf57_uc001pmu.2_Intron|C11orf57_uc001pmw.3_Intron|C11orf57_uc001pmt.3_Intron|C11orf57_uc001pmv.3_Intron|C11orf57_uc001pms.3_5'UTR	NM_001082970	NP_001076439	Q6ZUT1	CK057_HUMAN	hypothetical protein LOC55216 isoform b											breast(2)|ovary(1)	3		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		GGTGGGAGGTACAACCTAGTT	0.443													14	15	---	---	---	---	PASS
CLDN25	644672	broad.mit.edu	37	11	113650575	113650575	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113650575G>T	uc009yyw.1	+	1	58	c.58G>T	c.(58-60)GGC>TGC	p.G20C		NM_001101389	NP_001094859	C9JDP6	CLD25_HUMAN	claudin 25	20	Helical; (Potential).					integral to membrane|tight junction	structural molecule activity				0						CTCCCTCCTTGGCTGGGTCTG	0.547													61	247	---	---	---	---	PASS
NLRX1	79671	broad.mit.edu	37	11	119054075	119054075	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119054075G>A	uc001pvu.2	+	10	3070	c.2855G>A	c.(2854-2856)CGC>CAC	p.R952H	NLRX1_uc001pvv.2_Intron|NLRX1_uc001pvw.2_Missense_Mutation_p.R952H|NLRX1_uc001pvx.2_Missense_Mutation_p.R952H|PDZD3_uc001pvy.2_5'Flank|PDZD3_uc001pvz.2_5'Flank|PDZD3_uc010rzd.1_5'Flank|PDZD3_uc001pwa.2_5'Flank|PDZD3_uc001pwb.2_5'Flank	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1	952	Required for the repression of MAVS- induced interferon signaling.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		AATCCTTGGCGCAAGGCCCAG	0.637													6	145	---	---	---	---	PASS
GRAMD1B	57476	broad.mit.edu	37	11	123448068	123448068	+	Intron	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123448068G>T	uc001pyx.2	+						GRAMD1B_uc001pyw.2_Intron|GRAMD1B_uc010rzw.1_Intron|GRAMD1B_uc010rzx.1_Intron|GRAMD1B_uc009zbe.1_Intron	NM_020716	NP_065767	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B							integral to membrane				ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		TCCATCTGCCGCTGCAGCACT	0.647											OREG0021454	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	8	---	---	---	---	PASS
CHEK1	1111	broad.mit.edu	37	11	125513737	125513737	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125513737G>T	uc009zbo.2	+	9	1757	c.865G>T	c.(865-867)GGA>TGA	p.G289*	CHEK1_uc010sbh.1_Nonsense_Mutation_p.G305*|CHEK1_uc010sbi.1_Nonsense_Mutation_p.G289*|CHEK1_uc001qcf.3_Nonsense_Mutation_p.G289*|CHEK1_uc009zbp.2_Nonsense_Mutation_p.G289*|CHEK1_uc001qcg.3_Nonsense_Mutation_p.G289*|CHEK1_uc009zbq.2_Nonsense_Mutation_p.G289*|CHEK1_uc001qci.1_RNA|CHEK1_uc001qcj.2_5'Flank	NM_001114122	NP_001107594	O14757	CHK1_HUMAN	checkpoint kinase 1	289					cellular response to mechanical stimulus|DNA repair|DNA replication|gamete generation|negative regulation of cell proliferation|reciprocal meiotic recombination|regulation of cyclin-dependent protein kinase activity|replicative senescence	condensed nuclear chromosome|microtubule organizing center|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|skin(1)	6	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		GTCTCCCAGTGGATTTTCTAA	0.388								Other_conserved_DNA_damage_response_genes					22	39	---	---	---	---	PASS
ST14	6768	broad.mit.edu	37	11	130079551	130079551	+	Intron	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130079551G>A	uc001qfw.2	+							NM_021978	NP_068813	Q9Y5Y6	ST14_HUMAN	matriptase						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	GCTTGTCTCCGCCCAGGGTGA	0.736													8	19	---	---	---	---	PASS
IQSEC3	440073	broad.mit.edu	37	12	280292	280292	+	Missense_Mutation	SNP	G	A	A	rs113137859		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:280292G>A	uc001qhw.1	+	10	2176	c.2170G>A	c.(2170-2172)GCG>ACG	p.A724T	IQSEC3_uc001qhu.1_Missense_Mutation_p.A724T	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	1027					regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		AAGGGAAGCCGCGCTCAGGGA	0.622													9	183	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2224643	2224643	+	Silent	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2224643C>A	uc009zdu.1	+	2	616	c.303C>A	c.(301-303)CCC>CCA	p.P101P	CACNA1C_uc009zdv.1_Silent_p.P101P|CACNA1C_uc001qkb.2_Silent_p.P101P|CACNA1C_uc001qkc.2_Silent_p.P101P|CACNA1C_uc001qke.2_Silent_p.P101P|CACNA1C_uc001qkf.2_Silent_p.P101P|CACNA1C_uc001qjz.2_Silent_p.P101P|CACNA1C_uc001qkd.2_Silent_p.P101P|CACNA1C_uc001qkg.2_Silent_p.P101P|CACNA1C_uc009zdw.1_Silent_p.P101P|CACNA1C_uc001qkh.2_Silent_p.P101P|CACNA1C_uc001qkl.2_Silent_p.P101P|CACNA1C_uc001qkn.2_Silent_p.P101P|CACNA1C_uc001qko.2_Silent_p.P101P|CACNA1C_uc001qkp.2_Silent_p.P101P|CACNA1C_uc001qkr.2_Silent_p.P101P|CACNA1C_uc001qku.2_Silent_p.P101P|CACNA1C_uc001qkq.2_Silent_p.P101P|CACNA1C_uc001qks.2_Silent_p.P101P|CACNA1C_uc001qkt.2_Silent_p.P101P	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	101	Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	p.A101E(1)		ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	CACGCCCGCCCCGAGCCCTGC	0.617													55	17	---	---	---	---	PASS
EFCAB4B	84766	broad.mit.edu	37	12	3763445	3763445	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3763445G>A	uc001qmj.2	-	10	1551	c.979C>T	c.(979-981)CAG>TAG	p.Q327*	EFCAB4B_uc010sen.1_Nonsense_Mutation_p.Q327*|EFCAB4B_uc010seo.1_Nonsense_Mutation_p.Q327*|EFCAB4B_uc001qmi.1_RNA	NM_032680	NP_116069	Q9BSW2	EFC4B_HUMAN	EF-hand calcium binding domain 4B isoform c	327	Potential.				activation of store-operated calcium channel activity|store-operated calcium entry	cytoplasm	calcium ion binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			TGAGCATCCTGGAGCTCCCAG	0.562													9	158	---	---	---	---	PASS
GPRC5A	9052	broad.mit.edu	37	12	13061273	13061273	+	Silent	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13061273C>T	uc001rba.2	+	2	740	c.90C>T	c.(88-90)GTC>GTT	p.V30V	GPRC5A_uc001raz.2_Silent_p.V30V	NM_003979	NP_003970	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, family C, group 5,	30	Extracellular (Potential).					cytoplasmic vesicle membrane|Golgi apparatus|integral to plasma membrane	G-protein coupled receptor activity				0		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	GGGGCATCGTCCTAGAAACGG	0.552													144	62	---	---	---	---	PASS
KIAA0528	9847	broad.mit.edu	37	12	22676469	22676469	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22676469C>A	uc001rfq.2	-	7	919	c.691G>T	c.(691-693)GAG>TAG	p.E231*	KIAA0528_uc010sir.1_Nonsense_Mutation_p.E33*|KIAA0528_uc010sis.1_Nonsense_Mutation_p.E231*|KIAA0528_uc010sit.1_Nonsense_Mutation_p.E231*|KIAA0528_uc010siu.1_Nonsense_Mutation_p.E231*|KIAA0528_uc001rfr.2_Nonsense_Mutation_p.E231*|KIAA0528_uc009ziy.1_Nonsense_Mutation_p.E231*	NM_014802	NP_055617	Q86YS7	K0528_HUMAN	hypothetical protein LOC9847	231							protein binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						AACCCAGACTCGCCCTCCAGA	0.473													86	55	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48390401	48390401	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48390401G>A	uc001rqu.2	-	8	720	c.539C>T	c.(538-540)GCT>GTT	p.A180V	COL2A1_uc001rqv.2_Missense_Mutation_p.A111V	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	180					axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CATCTGGGCAGCAAAGTTCTG	0.468													6	806	---	---	---	---	PASS
NUP107	57122	broad.mit.edu	37	12	69126449	69126449	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69126449G>T	uc001suf.2	+	23	2146	c.2031G>T	c.(2029-2031)TGG>TGT	p.W677C	NUP107_uc001sug.2_Missense_Mutation_p.W436C|NUP107_uc010stj.1_Missense_Mutation_p.W648C	NM_020401	NP_065134	P57740	NU107_HUMAN	nucleoporin 107kDa	677					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			skin(1)	1	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			TAATTGACTGGTTGGTATTTG	0.289													43	58	---	---	---	---	PASS
CNOT2	4848	broad.mit.edu	37	12	70731262	70731262	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70731262A>C	uc001svv.2	+	9	1448	c.869A>C	c.(868-870)GAT>GCT	p.D290A	CNOT2_uc009zro.2_Missense_Mutation_p.D290A|CNOT2_uc009zrp.2_Missense_Mutation_p.D270A|CNOT2_uc009zrq.2_Missense_Mutation_p.D290A|CNOT2_uc001svw.1_Missense_Mutation_p.D30A	NM_014515	NP_055330	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	290					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity				0	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			AGCTATAAAGATCCAACATCA	0.353													12	57	---	---	---	---	PASS
ACSS3	79611	broad.mit.edu	37	12	81545793	81545793	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81545793C>T	uc001szl.1	+	7	1107	c.1016C>T	c.(1015-1017)GCT>GTT	p.A339V	ACSS3_uc001szm.1_Missense_Mutation_p.A338V|ACSS3_uc001szn.1_Missense_Mutation_p.A21V	NM_024560	NP_078836	Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	339						mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						TGGTGGGCAGCTTCTGACTTA	0.333													28	33	---	---	---	---	PASS
HSPB8	26353	broad.mit.edu	37	12	119617322	119617322	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119617322G>T	uc001txb.2	+	1	728	c.205G>T	c.(205-207)GTG>TTG	p.V69L	HSPB8_uc001txc.2_Missense_Mutation_p.V69L	NM_014365	NP_055180	Q9UJY1	HSPB8_HUMAN	heat shock 22kDa protein 8	69					cell death|response to heat	cytoplasm|nucleus	identical protein binding|protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTCGGGCATGGTGCCCCGGGG	0.682													78	75	---	---	---	---	PASS
ANAPC5	51433	broad.mit.edu	37	12	121773465	121773465	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121773465A>G	uc001uag.2	-	7	943	c.821T>C	c.(820-822)CTC>CCC	p.L274P	ANAPC5_uc001uae.2_5'UTR|ANAPC5_uc010szv.1_5'UTR|ANAPC5_uc001uaf.2_RNA|ANAPC5_uc001uah.2_Missense_Mutation_p.L175P|ANAPC5_uc001uai.1_5'UTR	NM_016237	NP_057321	Q9UJX4	APC5_HUMAN	anaphase-promoting complex subunit 5 isoform a	274					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			skin(3)|breast(2)|kidney(1)	6	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ATAATGGAGGAGACTGTGTGT	0.413													5	211	---	---	---	---	PASS
LRRC43	254050	broad.mit.edu	37	12	122685401	122685401	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122685401G>A	uc009zxm.2	+	10	1754	c.1729G>A	c.(1729-1731)GCC>ACC	p.A577T	LRRC43_uc001ubw.3_Missense_Mutation_p.A392T|LRRC43_uc009zxn.2_Missense_Mutation_p.A338T|B3GNT4_uc001ubx.2_5'Flank|B3GNT4_uc001uby.2_5'Flank	NM_001098519	NP_001091989	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43 isoform 1	577											0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		GCCCCTGCTCGCCGGGGAGCC	0.672													7	125	---	---	---	---	PASS
FAM123A	219287	broad.mit.edu	37	13	25745389	25745389	+	Silent	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25745389C>A	uc001uqb.2	-	1	469	c.369G>T	c.(367-369)CCG>CCT	p.P123P	FAM123A_uc001uqa.2_Silent_p.P123P|FAM123A_uc001uqc.2_Silent_p.P123P	NM_152704	NP_689917	Q8N7J2	F123A_HUMAN	hypothetical protein LOC219287 isoform 1	123	Gly-rich.									ovary(2)|large_intestine(1)|lung(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		ccccgccgcGCGGCTCCTCCT	0.602													9	3	---	---	---	---	PASS
KL	9365	broad.mit.edu	37	13	33635674	33635674	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33635674G>C	uc001uus.2	+	4	2466	c.2458G>C	c.(2458-2460)GAT>CAT	p.D820H	KL_uc001uur.1_3'UTR	NM_004795	NP_004786	Q9UEF7	KLOT_HUMAN	klotho precursor	820	Glycosyl hydrolase-1 2.|Extracellular (Potential).				aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding			large_intestine(1)|ovary(1)|skin(1)	3	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		AGAAAAAGAAGATCCAATAAA	0.438													52	54	---	---	---	---	PASS
HTR2A	3356	broad.mit.edu	37	13	47409423	47409423	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47409423C>T	uc001vbq.2	-	3	1099	c.965G>A	c.(964-966)TGC>TAC	p.C322Y	HTR2A_uc001vbr.2_Missense_Mutation_p.C222Y|HTR2A_uc010acr.2_Missense_Mutation_p.C322Y	NM_000621	NP_000612	P28223	5HT2A_HUMAN	5-hydroxytryptamine receptor 2A isoform 1	322	Cytoplasmic (By similarity).				ERK1 and ERK2 cascade|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	integral to plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|serotonin binding|serotonin receptor activity			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Aripiprazole(DB01238)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Dihydroergotamine(DB00320)|Donepezil(DB00843)|Epinastine(DB00751)|Ergotamine(DB00696)|Fluvoxamine(DB00176)|Mesoridazine(DB00933)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	CAGCACCTTGCATGCCTTTTG	0.512													69	46	---	---	---	---	PASS
CDADC1	81602	broad.mit.edu	37	13	49852631	49852631	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49852631C>A	uc001vcu.2	+	7	1272	c.1196C>A	c.(1195-1197)GCG>GAG	p.A399E	CDADC1_uc010tgk.1_Missense_Mutation_p.A201E|CDADC1_uc001vcv.2_RNA	NM_030911	NP_112173	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1	399							hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		ATCATACATGCGGAACAGAAT	0.353													137	119	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101756667	101756667	+	Silent	SNP	T	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101756667T>A	uc001vox.1	-	25	3057	c.2868A>T	c.(2866-2868)GTA>GTT	p.V956V		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	956	Helical; Name=S3 of repeat III; (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ATATGTCCATTACTCCACCGA	0.353													43	48	---	---	---	---	PASS
OR11H6	122748	broad.mit.edu	37	14	20692373	20692373	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20692373G>A	uc010tlc.1	+	1	505	c.505G>A	c.(505-507)GGC>AGC	p.G169S		NM_001004480	NP_001004480	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H,	169	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		ATGCTGGGTAGGCGGATTTCT	0.493													166	324	---	---	---	---	PASS
BAZ1A	11177	broad.mit.edu	37	14	35280155	35280155	+	Silent	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35280155T>C	uc001wsk.2	-	5	1192	c.624A>G	c.(622-624)AAA>AAG	p.K208K	BAZ1A_uc001wsl.2_Silent_p.K208K|BAZ1A_uc001wsm.1_Silent_p.K208K	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	208					chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		TTTGTGTTGCTTTAACAATAG	0.308													43	18	---	---	---	---	PASS
SEC23A	10484	broad.mit.edu	37	14	39560828	39560828	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39560828C>G	uc001wup.1	-	5	679	c.456G>C	c.(454-456)CAG>CAC	p.Q152H	SEC23A_uc010tqa.1_Missense_Mutation_p.Q14H|SEC23A_uc010tqb.1_Missense_Mutation_p.Q123H|SEC23A_uc010tqc.1_Missense_Mutation_p.Q14H	NM_006364	NP_006355	Q15436	SC23A_HUMAN	SEC23-related protein A	152					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|Golgi membrane|smooth endoplasmic reticulum membrane	protein binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		TTAATGACATCTGCATGGATT	0.383													4	170	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64687205	64687205	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64687205C>A	uc001xgm.2	+	110	20072	c.19842C>A	c.(19840-19842)AAC>AAA	p.N6614K	SYNE2_uc001xgl.2_Missense_Mutation_p.N6637K|SYNE2_uc010apy.2_Missense_Mutation_p.N2999K|SYNE2_uc001xgn.2_Missense_Mutation_p.N1576K|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_Missense_Mutation_p.N584K|SYNE2_uc001xgq.2_Missense_Mutation_p.N979K|SYNE2_uc001xgr.2_Missense_Mutation_p.N397K|SYNE2_uc010tsi.1_Missense_Mutation_p.N271K|SYNE2_uc001xgs.2_Missense_Mutation_p.N271K|SYNE2_uc001xgt.2_Missense_Mutation_p.N145K	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6614	Cytoplasmic (Potential).|Spectrin 9.				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCTCTGTCAACGTGAGCAGCA	0.522													42	39	---	---	---	---	PASS
ITPK1	3705	broad.mit.edu	37	14	93424701	93424701	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93424701A>C	uc001ybg.2	-	8	804	c.515T>G	c.(514-516)GTG>GGG	p.V172G	ITPK1_uc001ybe.2_Missense_Mutation_p.V172G|ITPK1_uc001ybf.2_Missense_Mutation_p.V53G|ITPK1_uc001ybh.2_Missense_Mutation_p.V172G	NM_014216	NP_055031	Q13572	ITPK1_HUMAN	inositol 1,3,4-triphosphate 5/6 kinase isoform	172	ATP-grasp.				blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		CTGGTTGAACACGATAGCCAT	0.562													78	41	---	---	---	---	PASS
SERPINA5	5104	broad.mit.edu	37	14	95054287	95054287	+	Silent	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95054287C>A	uc001ydm.2	+	3	798	c.588C>A	c.(586-588)GTC>GTA	p.V196V	SERPINA5_uc010ave.2_Silent_p.V196V|SERPINA5_uc001ydn.1_Silent_p.V196V	NM_000624	NP_000615	P05154	IPSP_HUMAN	serine (or cysteine) proteinase inhibitor, clade	196					fusion of sperm to egg plasma membrane|regulation of proteolysis|spermatogenesis	extracellular region|membrane|protein complex	acrosin binding|heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(2)	2				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	GCAATGCGGTCGTGATCATGG	0.453													5	399	---	---	---	---	PASS
MIR380	494329	broad.mit.edu	37	14	101491380	101491380	+	RNA	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101491380T>C	hsa-mir-380|MI0000788	+			c.27T>C			uc010awb.1_RNA|MIR1197_hsa-mir-1197|MI0006656_5'Flank|uc001yjy.1_5'Flank|MIR323_hsa-mir-323|MI0000807_5'Flank|MIR758_hsa-mir-758|MI0003757_5'Flank|MIR329-1_hsa-mir-329-1|MI0001725_5'Flank|MIR329-2_hsa-mir-329-2|MI0001726_5'Flank																	0						GAACATGCGCTATCTCTGTGT	0.493													16	4	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34151810	34151810	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34151810C>A	uc001zhi.2	+	100	14247	c.14177C>A	c.(14176-14178)GCA>GAA	p.A4726E	RYR3_uc010bar.2_Missense_Mutation_p.A4721E	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	4726	Helical; Name=M9; (Potential).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGAGTGAGAGCAGGAGGTGGC	0.413													7	92	---	---	---	---	PASS
LTK	4058	broad.mit.edu	37	15	41800368	41800368	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41800368T>C	uc001zoa.3	-	9	1326	c.1148A>G	c.(1147-1149)CAC>CGC	p.H383R	LTK_uc001zob.3_Missense_Mutation_p.H322R|LTK_uc010ucx.1_Missense_Mutation_p.H322R|LTK_uc010bcg.2_Missense_Mutation_p.H65R	NM_002344	NP_002335	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase isoform 1	383	Extracellular (Potential).				apoptosis|cell proliferation|phosphatidylinositol 3-kinase cascade|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|central_nervous_system(1)	7		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CAAAGGGCAGTGACTGCAGTT	0.532										TSP Lung(18;0.14)			76	89	---	---	---	---	PASS
C15orf21	283651	broad.mit.edu	37	15	45848083	45848083	+	RNA	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45848083C>A	uc010beg.1	+	6		c.1078C>A			C15orf21_uc010beh.1_RNA|C15orf21_uc010bei.1_RNA|C15orf21_uc010bej.1_RNA|C15orf21_uc001zvm.1_RNA|C15orf21_uc001zvn.1_RNA					Homo sapiens cDNA FLJ39426 fis, clone PROST2000505.												0		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;3.03e-17)|GBM - Glioblastoma multiforme(94;7.36e-07)		AATGGAGATGCCAAAACAGAC	0.453			T	ETV1	prostate								17	116	---	---	---	---	PASS
LIPC	3990	broad.mit.edu	37	15	58853108	58853108	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58853108C>A	uc010bga.1	+	9	1705	c.1097C>A	c.(1096-1098)ACA>AAA	p.T366K	LIPC_uc010bfz.1_Missense_Mutation_p.T366K|LIPC_uc002afa.1_Missense_Mutation_p.T366K|LIPC_uc010bgb.1_Missense_Mutation_p.T264K|LIPC_uc010ugy.1_Missense_Mutation_p.T305K	NM_000236	NP_000227	P11150	LIPC_HUMAN	lipase C precursor	366	PLAT.				cholesterol homeostasis|chylomicron remnant clearance|fatty acid biosynthetic process|high-density lipoprotein particle remodeling|intermediate-density lipoprotein particle remodeling|low-density lipoprotein particle remodeling|phosphatidylcholine catabolic process|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle	apolipoprotein binding|heparin binding|low-density lipoprotein particle binding|phospholipase activity|triglyceride lipase activity			ovary(1)	1		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		CAAACTGAGACACCAATACAA	0.323													12	29	---	---	---	---	PASS
IGDCC3	9543	broad.mit.edu	37	15	65625636	65625636	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65625636G>A	uc002aos.2	-	6	1193	c.941C>T	c.(940-942)ACC>ATC	p.T314I		NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule	314	Extracellular (Potential).|Ig-like C2-type 3.									ovary(3)	3						CCTCACCCGGGTGCCAGGTCT	0.632													52	50	---	---	---	---	PASS
ZNF592	9640	broad.mit.edu	37	15	85327839	85327839	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85327839G>A	uc002bld.2	+	4	2269	c.1933G>A	c.(1933-1935)GTC>ATC	p.V645I	ZNF592_uc010upb.1_RNA	NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592	645					cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(2)	6			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CAAGGGGCTCGTCATGCAGTG	0.602													5	92	---	---	---	---	PASS
TELO2	9894	broad.mit.edu	37	16	1545579	1545579	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1545579G>A	uc002cly.2	+	3	859	c.568G>A	c.(568-570)GAG>AAG	p.E190K	TELO2_uc010uvg.1_Missense_Mutation_p.E190K	NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog	190						chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)				CCTGCTCGGCGAGGAGGTCGT	0.667													4	176	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	10031933	10031933	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10031933C>A	uc002czo.3	-	3	1438	c.890G>T	c.(889-891)GGC>GTC	p.G297V	GRIN2A_uc010uym.1_Missense_Mutation_p.G297V|GRIN2A_uc010uyn.1_Missense_Mutation_p.G140V|GRIN2A_uc002czr.3_Missense_Mutation_p.G297V	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	297	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GGTTAGGATGCCAATGCCGTC	0.572													78	53	---	---	---	---	PASS
GP2	2813	broad.mit.edu	37	16	20329723	20329723	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20329723C>T	uc002dgv.2	-	8	1129	c.1046G>A	c.(1045-1047)GGA>GAA	p.G349E	GP2_uc002dgw.2_Missense_Mutation_p.G346E|GP2_uc002dgx.2_Missense_Mutation_p.G202E|GP2_uc002dgy.2_Missense_Mutation_p.G199E	NM_001007240	NP_001007241	P55259	GP2_HUMAN	zymogen granule membrane glycoprotein 2 isoform	349	ZP.					anchored to membrane|extracellular region|plasma membrane				ovary(3)|skin(1)	4						AATGAACTCTCCATTCCCGTC	0.473													175	162	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20570631	20570631	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20570631C>T	uc002dhj.3	-	4	526	c.316G>A	c.(316-318)GGG>AGG	p.G106R	ACSM2B_uc002dhk.3_Missense_Mutation_p.G106R|ACSM2B_uc010bwf.1_Missense_Mutation_p.G106R	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	106					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						ACACGATCCCCACGCTGCAGG	0.562													4	86	---	---	---	---	PASS
SLC5A11	115584	broad.mit.edu	37	16	24918057	24918057	+	Silent	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24918057C>A	uc002dmu.2	+	11	1318	c.1086C>A	c.(1084-1086)CCC>CCA	p.P362P	SLC5A11_uc002dms.2_Silent_p.P298P|SLC5A11_uc010vcd.1_Silent_p.P327P|SLC5A11_uc002dmt.2_Missense_Mutation_p.Q230K|SLC5A11_uc010vce.1_Silent_p.P292P|SLC5A11_uc010bxt.2_Silent_p.P298P|SLC5A11_uc002dmv.2_5'Flank	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose	362	Extracellular (Potential).				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)		TCGCGTATCCCAAACTCGTGC	0.557											OREG0023688	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	113	---	---	---	---	PASS
FUK	197258	broad.mit.edu	37	16	70504960	70504960	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70504960G>A	uc002eyy.2	+	12	1213	c.1155G>A	c.(1153-1155)CAG>CAA	p.Q385Q	FUK_uc010cft.2_Silent_p.Q417Q|FUK_uc002eyz.2_5'UTR	NM_145059	NP_659496	Q8N0W3	FUK_HUMAN	fucokinase	385						cytoplasm	ATP binding|fucokinase activity			ovary(1)	1		Ovarian(137;0.0694)				GCGTCCTGCAGCACTGCCACC	0.687													3	17	---	---	---	---	PASS
GLG1	2734	broad.mit.edu	37	16	74487200	74487200	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74487200G>A	uc002fcy.3	-	26	3455	c.3405C>T	c.(3403-3405)GCC>GCT	p.A1135A	GLG1_uc002fcx.2_Silent_p.A1135A|GLG1_uc002fcw.3_Silent_p.A1124A|GLG1_uc002fcz.3_Silent_p.A552A	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3	1135	Extracellular (Potential).					Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						TTACTTGCATGGCAAGATCAG	0.488													6	137	---	---	---	---	PASS
MLKL	197259	broad.mit.edu	37	16	74725174	74725174	+	Splice_Site	SNP	C	T	T	rs144019045	byFrequency	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74725174C>T	uc002fdb.2	-	4	1163	c.722_splice	c.e4+1	p.A241_splice	MLKL_uc002fdc.2_Intron	NM_152649	NP_689862	Q8NB16	MLKL_HUMAN	mixed lineage kinase domain-like isoform 1								ATP binding|protein binding|protein kinase activity			stomach(2)	2						aaacaacttacgcaatgcTGC	0.194													16	617	---	---	---	---	PASS
KLHDC4	54758	broad.mit.edu	37	16	87795545	87795545	+	Intron	SNP	A	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87795545A>G	uc002fki.2	-						KLHDC4_uc002fkj.2_Intron|KLHDC4_uc002fkk.2_Intron|KLHDC4_uc002fkl.2_Intron|KLHDC4_uc010chu.1_Intron	NM_017566	NP_060036	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4											pancreas(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0283)		GAAAAATGCTACTTGCTCACC	0.453													21	270	---	---	---	---	PASS
FAM57A	79850	broad.mit.edu	37	17	641210	641210	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:641210C>T	uc002frp.2	+	3	372	c.331C>T	c.(331-333)CGA>TGA	p.R111*	FAM57A_uc002frq.2_Nonsense_Mutation_p.R111*|FAM57A_uc002frr.2_Nonsense_Mutation_p.R21*	NM_024792	NP_079068	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A	111	TLC.					integral to membrane|plasma membrane					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		CCTCACTCTTCGAAACTTCCT	0.517													9	390	---	---	---	---	PASS
RPA1	6117	broad.mit.edu	37	17	1792101	1792101	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1792101T>C	uc002fto.2	+	14	1622	c.1507T>C	c.(1507-1509)TGC>CGC	p.C503R		NM_002945	NP_002936	P27694	RFA1_HUMAN	replication protein A1	503	C4-type (Potential).				cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	actin cytoskeleton|cytoplasm|DNA replication factor A complex|PML body	metal ion binding|protein binding|single-stranded DNA binding				0						CTGTGAGAAGTGCGACACCGA	0.493								NER					64	102	---	---	---	---	PASS
METT10D	79066	broad.mit.edu	37	17	2323574	2323574	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2323574G>C	uc002fut.2	-	10	1527	c.1379C>G	c.(1378-1380)CCG>CGG	p.P460R	METT10D_uc002fuu.3_RNA|METT10D_uc010cka.2_RNA|METT10D_uc002fuv.2_Intron|METT10D_uc010vqx.1_RNA|METT10D_uc010vqy.1_Missense_Mutation_p.P242R	NM_024086	NP_076991	Q86W50	MET16_HUMAN	methyltransferase 10 domain containing	460							methyltransferase activity				0						CGTGGGTTCCGGGTTTTCCTC	0.632													193	308	---	---	---	---	PASS
TRPV3	162514	broad.mit.edu	37	17	3419752	3419752	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3419752G>A	uc002fvt.1	-	16	2519	c.2197C>T	c.(2197-2199)CGG>TGG	p.R733W	SPATA22_uc010vrg.1_5'Flank|TRPV3_uc002fvs.1_RNA|TRPV3_uc010vrh.1_Missense_Mutation_p.R717W|TRPV3_uc010vri.1_Missense_Mutation_p.R688W|TRPV3_uc010vrj.1_Missense_Mutation_p.R717W|TRPV3_uc010vrk.1_RNA|TRPV3_uc010vrl.1_Missense_Mutation_p.R717W|TRPV3_uc010vrm.1_RNA|TRPV3_uc002fvr.2_Missense_Mutation_p.R733W|TRPV3_uc002fvu.2_Missense_Mutation_p.R733W	NM_145068	NP_659505	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel,	733	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(4)	4					Menthol(DB00825)	CTTTGTTACCGCAAACACAGT	0.537													4	174	---	---	---	---	PASS
SLC16A13	201232	broad.mit.edu	37	17	6939691	6939691	+	5'UTR	SNP	T	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6939691T>A	uc002geh.2	+	1						NM_201566	NP_963860	Q7RTY0	MOT13_HUMAN	monocarboxylate transporter 13							integral to membrane|plasma membrane	symporter activity			ovary(1)|skin(1)	2						AGCAGCCCTGTTACCGCTTAG	0.701													88	144	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577547	7577547	+	Missense_Mutation	SNP	C	A	A	rs121912656		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577547C>A	uc002gim.2	-	7	928	c.734G>T	c.(733-735)GGC>GTC	p.G245V	TP53_uc002gig.1_Missense_Mutation_p.G245V|TP53_uc002gih.2_Missense_Mutation_p.G245V|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G113V|TP53_uc010cng.1_Missense_Mutation_p.G113V|TP53_uc002gii.1_Missense_Mutation_p.G113V|TP53_uc010cnh.1_Missense_Mutation_p.G245V|TP53_uc010cni.1_Missense_Mutation_p.G245V|TP53_uc002gij.2_Missense_Mutation_p.G245V|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.G152V|TP53_uc002gio.2_Missense_Mutation_p.G113V	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	245	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> A (in sporadic cancers; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> E (in a sporadic cancer; somatic mutation).|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.G245S(274)|p.G245D(93)|p.G245V(50)|p.G245C(47)|p.G245R(10)|p.G245A(8)|p.0?(7)|p.G245G(3)|p.G245fs*2(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245del(1)|p.C242fs*98(1)|p.G245fs*22(1)|p.M243fs*18(1)|p.S241_G245delSCMGG(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CCGGTTCATGCCGCCCATGCA	0.582		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			82	56	---	---	---	---	PASS
CNTROB	116840	broad.mit.edu	37	17	7837842	7837842	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7837842G>A	uc002gjq.2	+	4	1334	c.415G>A	c.(415-417)GAT>AAT	p.D139N	TRAPPC1_uc002gjo.1_5'Flank|CNTROB_uc002gjp.2_Missense_Mutation_p.D139N|CNTROB_uc002gjr.2_Missense_Mutation_p.D41N|CNTROB_uc010vum.1_5'Flank	NM_053051	NP_444279	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	139					centriole replication|centrosome separation|cytokinesis	centriole	protein domain specific binding			breast(1)|central_nervous_system(1)	2		Prostate(122;0.173)				CTTTGACAGTGATAGCACAGC	0.512													17	163	---	---	---	---	PASS
CNTROB	116840	broad.mit.edu	37	17	7840481	7840481	+	Splice_Site	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7840481G>A	uc002gjq.2	+	8	1748	c.829_splice	c.e8-1	p.T277_splice	CNTROB_uc002gjp.2_Splice_Site_p.T277_splice|CNTROB_uc002gjr.2_Splice_Site_p.T179_splice|CNTROB_uc010vum.1_5'Flank	NM_053051	NP_444279	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein						centriole replication|centrosome separation|cytokinesis	centriole	protein domain specific binding			breast(1)|central_nervous_system(1)	2		Prostate(122;0.173)				CTTCCTGAAAGACAGTAACCC	0.468													40	654	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	16004652	16004652	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16004652C>A	uc002gpo.2	-	20	2842	c.2602G>T	c.(2602-2604)GCC>TCC	p.A868S	NCOR1_uc002gpn.2_Missense_Mutation_p.A884S|NCOR1_uc002gpp.1_Missense_Mutation_p.A775S|NCOR1_uc002gpr.2_Missense_Mutation_p.A775S	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	868					cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GGCCTTTGGGCATTTATTTGC	0.498													51	247	---	---	---	---	PASS
LGALS9C	654346	broad.mit.edu	37	17	18380162	18380162	+	5'UTR	SNP	T	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18380162T>A	uc002gtw.2	+	1					LGALS9C_uc010vyb.1_5'UTR	NM_001040078	NP_001035167	Q6DKI2	LEG9C_HUMAN	galectin 9 like								sugar binding			ovary(1)	1						ACAGAGGCGGTGGAGAGATGG	0.572													23	28	---	---	---	---	PASS
PSMD3	5709	broad.mit.edu	37	17	38152592	38152592	+	Splice_Site	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38152592G>A	uc002htn.1	+	10	1640	c.1476_splice	c.e10+1	p.K492_splice	PSMD3_uc010wen.1_Splice_Site|PSMD3_uc010weo.1_Splice_Site_p.K393_splice	NM_002809	NP_002800	O43242	PSMD3_HUMAN	proteasome 26S non-ATPase subunit 3						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	enzyme regulator activity|protein binding			ovary(1)|pancreas(1)	2	Colorectal(19;0.000442)					GTCTGTCAAGGTGAGAAGCCC	0.552													12	394	---	---	---	---	PASS
KRT9	3857	broad.mit.edu	37	17	39727856	39727856	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39727856C>A	uc002hxe.3	-	1	455	c.389G>T	c.(388-390)GGG>GTG	p.G130V	JUP_uc010wfs.1_Intron	NM_000226	NP_000217	P35527	K1C9_HUMAN	keratin 9	130	Head.				intermediate filament organization|skin development		protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Breast(137;0.000307)				ccccccaaacccactcccata	0.109													18	43	---	---	---	---	PASS
KLHL11	55175	broad.mit.edu	37	17	40021156	40021156	+	Silent	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40021156G>T	uc002hyf.1	-	1	474	c.468C>A	c.(466-468)GCC>GCA	p.A156A		NM_018143	NP_060613	Q9NVR0	KLH11_HUMAN	kelch-like 11 precursor	156	BTB.					extracellular region					0		Breast(137;0.00156)				ACTCGATTACGGCTTCCACTG	0.687													38	37	---	---	---	---	PASS
HSD17B1	3292	broad.mit.edu	37	17	40705530	40705530	+	Silent	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40705530C>T	uc002hzw.2	+	3	1307	c.339C>T	c.(337-339)GAC>GAT	p.D113D	HSD17B1_uc002hzx.2_Silent_p.D113D|HSD17B1_uc010wgm.1_RNA|uc002hzy.2_Silent_p.T17T|HSD17B1_uc010cyi.2_Silent_p.D144D	NM_000413	NP_000404	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1	113					estrogen biosynthetic process	cytosol	binding|estradiol 17-beta-dehydrogenase activity				0		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	NADH(DB00157)	CTGTGCTGGACGTGAATGTAG	0.672													6	137	---	---	---	---	PASS
SLC4A1	6521	broad.mit.edu	37	17	42328845	42328845	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42328845C>T	uc002igf.3	-	18	2572	c.2423G>A	c.(2422-2424)CGC>CAC	p.R808H		NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	808	Membrane (anion exchange).		R -> H (in SPH4; Nara).|R -> C (in SPH4; Jablonec).		bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		AAGCAAGATGCGGTCAAAGAG	0.587													4	209	---	---	---	---	PASS
VEZF1	7716	broad.mit.edu	37	17	56051849	56051849	+	Silent	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56051849T>C	uc002ivf.1	-	6	1694	c.1551A>G	c.(1549-1551)ACA>ACG	p.T517T		NM_007146	NP_009077	Q14119	VEZF1_HUMAN	zinc finger protein 161	517					cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						AAGGCGGTGATGTAGGCAAAG	0.383													70	127	---	---	---	---	PASS
TEX14	56155	broad.mit.edu	37	17	56738051	56738051	+	Intron	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56738051C>A	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron|TEX14_uc010wnz.1_Missense_Mutation_p.D304Y	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTTTCTTGATCTTCCTGTTGC	0.483													109	826	---	---	---	---	PASS
GH1	2688	broad.mit.edu	37	17	61995723	61995723	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61995723C>A	uc002jdj.2	-	2	216	c.154G>T	c.(154-156)GAC>TAC	p.D52Y	GH1_uc002jdi.2_Missense_Mutation_p.D52Y|GH1_uc002jdk.2_Missense_Mutation_p.D52Y|GH1_uc002jdl.2_Missense_Mutation_p.D52Y|GH1_uc002jdm.2_Intron|GH1_uc002jdn.2_Missense_Mutation_p.D52Y	NM_000515	NP_000506	P01241	SOMA_HUMAN	growth hormone 1 isoform 1	52					glucose transport|growth hormone receptor signaling pathway|JAK-STAT cascade|positive regulation of activation of JAK2 kinase activity|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of MAP kinase activity|positive regulation of multicellular organism growth|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|response to estradiol stimulus	extracellular space	growth factor activity|growth hormone receptor binding|hormone activity|metal ion binding|prolactin receptor binding				0						TGGTAGGTGTCAAAGGCCAGC	0.572													75	618	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62045698	62045698	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62045698C>A	uc002jds.1	-	6	798	c.721G>T	c.(721-723)GGG>TGG	p.G241W		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	241	I.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	ATCAGGGCCCCCACGATCGTC	0.607													48	78	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5428395	5428395	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5428395G>A	uc002kmt.1	-	9	1068	c.982C>T	c.(982-984)CGA>TGA	p.R328*	EPB41L3_uc010wzh.1_Nonsense_Mutation_p.R328*|EPB41L3_uc002kmu.1_Nonsense_Mutation_p.R328*|EPB41L3_uc010dkq.1_Nonsense_Mutation_p.R219*|EPB41L3_uc010dks.1_Nonsense_Mutation_p.R350*	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	328	FERM.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						CTGTTTATTCGCAGCCGGTCG	0.418													156	260	---	---	---	---	PASS
MIB1	57534	broad.mit.edu	37	18	19345762	19345762	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19345762A>T	uc002ktq.2	+	2	259	c.259A>T	c.(259-261)ACC>TCC	p.T87S	MIB1_uc002ktp.2_5'UTR	NM_020774	NP_065825	Q86YT6	MIB1_HUMAN	mindbomb homolog 1	87	ZZ-type.				Notch signaling pathway	centrosome|nuclear membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(4)	4			STAD - Stomach adenocarcinoma(5;0.212)			CATGTGTGATACCTGCCGCCA	0.373													50	107	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21523757	21523757	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21523757A>T	uc002kuq.2	+	69	9118	c.9032A>T	c.(9031-9033)CAG>CTG	p.Q3011L	LAMA3_uc002kur.2_Missense_Mutation_p.Q2955L|LAMA3_uc002kus.3_Missense_Mutation_p.Q1402L|LAMA3_uc002kut.3_Missense_Mutation_p.Q1346L	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	3011	Laminin G-like 4.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AACAGGTCACAGTTTGCTGTG	0.502													104	159	---	---	---	---	PASS
C18orf34	374864	broad.mit.edu	37	18	30825250	30825250	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30825250C>A	uc002kxn.2	-	14	1694	c.1552G>T	c.(1552-1554)GAA>TAA	p.E518*	C18orf34_uc010dme.1_Nonsense_Mutation_p.E32*|C18orf34_uc010xbr.1_Nonsense_Mutation_p.E518*|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Nonsense_Mutation_p.E518*|C18orf34_uc002kxp.2_Nonsense_Mutation_p.E518*	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	518										ovary(1)	1						TCTTCCATTTCATCTGTCTTG	0.333													15	30	---	---	---	---	PASS
ONECUT2	9480	broad.mit.edu	37	18	55143669	55143669	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55143669C>T	uc002lgo.2	+	2	1261	c.1229C>T	c.(1228-1230)GCG>GTG	p.A410V		NM_004852	NP_004843	O95948	ONEC2_HUMAN	one cut domain, family member 2	410	CUT.				organ morphogenesis	nucleus	sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		TCCCTTCAAGCGTGCAAACGC	0.483													28	56	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56274624	56274624	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56274624C>T	uc002lhj.3	-	3	371	c.157G>A	c.(157-159)GAT>AAT	p.D53N		NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	53	Ig-like 1.						ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						CCACTCCCATCGATGGCCTGA	0.373													30	65	---	---	---	---	PASS
POLR2E	5434	broad.mit.edu	37	19	1094003	1094003	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1094003A>C	uc002lre.3	-	2	209	c.132T>G	c.(130-132)TTT>TTG	p.F44L	POLR2E_uc010xgf.1_Intron	NM_002695	NP_002686	P19388	RPAB1_HUMAN	DNA directed RNA polymerase II polypeptide E	44					interspecies interaction between organisms|mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTTGTCCCCAGATTGGGCTT	0.617													8	77	---	---	---	---	PASS
PIAS4	51588	broad.mit.edu	37	19	4012993	4012993	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4012993C>G	uc002lzg.2	+	2	110	c.100C>G	c.(100-102)CTG>GTG	p.L34V		NM_015897	NP_056981	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4	34	SAP.				positive regulation of protein sumoylation|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|PML body	DNA binding|SUMO ligase activity|ubiquitin protein ligase binding|zinc ion binding			pancreas(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		TAAGAGTGGACTGAAGCACGA	0.562													118	192	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9063009	9063009	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9063009G>T	uc002mkp.2	-	3	24641	c.24437C>A	c.(24436-24438)CCC>CAC	p.P8146H		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8148	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGCACCAGTGGGCACTCCAGA	0.547													12	269	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10071107	10071107	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10071107G>A	uc002mmq.1	-	67	5304	c.5218C>T	c.(5218-5220)CCC>TCC	p.P1740S		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	1740	Fibrillar collagen NC1.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			AAGCAGACGGGGCCCAGTTCA	0.572													38	101	---	---	---	---	PASS
RDH8	50700	broad.mit.edu	37	19	10131387	10131387	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10131387G>T	uc002mmr.2	+	4	694	c.445G>T	c.(445-447)GTC>TTC	p.V149F		NM_015725	NP_056540	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	149	Helical; (Potential).				estrogen biosynthetic process|response to stimulus|visual perception	cytoplasm|integral to plasma membrane	binding|estradiol 17-beta-dehydrogenase activity|NADP-retinol dehydrogenase activity|retinol dehydrogenase activity			ovary(3)|pancreas(1)	4			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	CCTCACAGGTGTCATCTTCAA	0.552													10	14	---	---	---	---	PASS
OR10H3	26532	broad.mit.edu	37	19	15852965	15852965	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15852965A>T	uc010xoq.1	+	1	763	c.763A>T	c.(763-765)AGT>TGT	p.S255C		NM_013938	NP_039226	O60404	O10H3_HUMAN	olfactory receptor, family 10, subfamily H,	255	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CATGCACTATAGTTTTGCCTC	0.512													7	401	---	---	---	---	PASS
OR10H1	26539	broad.mit.edu	37	19	15918197	15918197	+	Silent	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15918197G>T	uc002nbq.2	-	1	740	c.651C>A	c.(649-651)CTC>CTA	p.L217L		NM_013940	NP_039228	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H,	217	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AGGCATAGGAGAGGAGGATGA	0.577													88	135	---	---	---	---	PASS
HAUS8	93323	broad.mit.edu	37	19	17169361	17169361	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17169361G>A	uc002nfe.2	-	8	754	c.643C>T	c.(643-645)CAG>TAG	p.Q215*	HAUS8_uc002nff.2_Nonsense_Mutation_p.Q214*|HAUS8_uc002nfg.1_Nonsense_Mutation_p.Q154*|HAUS8_uc002nfh.1_Nonsense_Mutation_p.Q215*	NM_033417	NP_219485	Q9BT25	HAUS8_HUMAN	sarcoma antigen NY-SAR-48 isoform a	215					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle pole					0						CAACTGACCTGGGCATCCAGG	0.532													41	94	---	---	---	---	PASS
FAM129C	199786	broad.mit.edu	37	19	17648193	17648193	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17648193A>T	uc010xpr.1	+	6	667	c.529A>T	c.(529-531)ACT>TCT	p.T177S	FAM129C_uc010xpq.1_Missense_Mutation_p.T177S|FAM129C_uc010xps.1_Missense_Mutation_p.T146S|FAM129C_uc010xpt.1_RNA|FAM129C_uc002ngy.3_5'Flank|FAM129C_uc010xpu.1_5'Flank|FAM129C_uc002ngz.3_5'Flank|FAM129C_uc010eaw.2_5'Flank|FAM129C_uc002nhb.2_5'Flank	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN	B-cell novel protein 1 isoform a	177											0						AGGAGACCATACTCAGGAAGA	0.433													151	287	---	---	---	---	PASS
CRTC1	23373	broad.mit.edu	37	19	18888149	18888149	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18888149C>T	uc002nkb.3	+	14	1950	c.1862C>T	c.(1861-1863)GCC>GTC	p.A621V	CRTC1_uc010ebv.2_Missense_Mutation_p.A637V|CRTC1_uc010ebw.2_Missense_Mutation_p.A457V|CRTC1_uc002nkc.3_Missense_Mutation_p.A319V	NM_015321	NP_056136	Q6UUV9	CRTC1_HUMAN	mucoepidermoid carcinoma translocated 1 isoform	621					interspecies interaction between organisms|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	cAMP response element binding protein binding|protein binding		CRTC1/MAML2(516)	salivary_gland(474)|lung(35)|thyroid(4)|breast(3)|skin(2)|ovary(1)	519						ATGGTTCTGGCCGACCCAGCC	0.687													6	706	---	---	---	---	PASS
PRODH2	58510	broad.mit.edu	37	19	36303539	36303539	+	Missense_Mutation	SNP	G	T	T	rs150476704		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36303539G>T	uc002obx.1	-	2	415	c.397C>A	c.(397-399)CTG>ATG	p.L133M		NM_021232	NP_067055	Q9UF12	PROD2_HUMAN	kidney and liver proline oxidase 1	133					glutamate biosynthetic process|proline catabolic process		proline dehydrogenase activity			ovary(2)	2	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTCACCAACAGCCCGTGAGTG	0.657													18	119	---	---	---	---	PASS
ZNF382	84911	broad.mit.edu	37	19	37118098	37118098	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37118098G>T	uc002oek.2	+	5	1412	c.1299G>T	c.(1297-1299)GAG>GAT	p.E433D	ZNF382_uc010efa.2_Missense_Mutation_p.E384D|ZNF382_uc010efb.2_Missense_Mutation_p.E432D|ZNF382_uc002oel.2_Missense_Mutation_p.E432D	NM_032825	NP_116214	Q96SR6	ZN382_HUMAN	zinc finger protein 382	433	Required for transcriptional repression activity; probably mediates sequence- specific DNA-binding (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			ACACAGGAGAGAAACCCTATA	0.448													42	255	---	---	---	---	PASS
HNRNPL	3191	broad.mit.edu	37	19	39330739	39330739	+	Silent	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39330739C>T	uc010xul.1	-	8	1241	c.1230G>A	c.(1228-1230)GAG>GAA	p.E410E	HNRNPL_uc010ege.1_Silent_p.E66E|HNRNPL_uc002ojj.1_Silent_p.E66E|HNRNPL_uc002ojo.1_5'Flank|HNRNPL_uc002ojk.2_Silent_p.E66E|HNRNPL_uc002ojl.2_Silent_p.E66E|HNRNPL_uc010xum.1_Silent_p.E277E|HNRNPL_uc002ojp.1_Silent_p.E66E|HNRNPL_uc010xun.1_3'UTR	NM_001533	NP_001524	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	410	RRM 3.				nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			AGCTCACCTTCTCCACATTGC	0.577													11	318	---	---	---	---	PASS
CYP2S1	29785	broad.mit.edu	37	19	41703718	41703718	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41703718G>A	uc002opw.2	+	3	433	c.378G>A	c.(376-378)CAG>CAA	p.Q126Q	CYP2F1_uc010xvw.1_Intron|CYP2S1_uc010xvx.1_Intron	NM_030622	NP_085125	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S,	126					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity			skin(1)	1						GGTGGAGGCAGCTGAGGAAGT	0.587													11	337	---	---	---	---	PASS
CD177	57126	broad.mit.edu	37	19	43864424	43864424	+	Silent	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43864424G>T	uc002owi.2	+	6	669	c.627G>T	c.(625-627)CTG>CTT	p.L209L	CD177_uc010eis.2_RNA|CD177_uc002owj.2_RNA	NM_020406	NP_065139	Q8N6Q3	CD177_HUMAN	CD177 molecule precursor	209	UPAR/Ly6 1.				blood coagulation|leukocyte migration	anchored to membrane|plasma membrane				central_nervous_system(1)	1		Prostate(69;0.00682)				CAGATTTTCTGACCTGTCATC	0.552													18	70	---	---	---	---	PASS
SYMPK	8189	broad.mit.edu	37	19	46320221	46320221	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46320221G>A	uc002pdn.2	-	24	3338	c.3093C>T	c.(3091-3093)TAC>TAT	p.Y1031Y	RSPH6A_uc002pdm.2_5'Flank	NM_004819	NP_004810	Q92797	SYMPK_HUMAN	symplekin	1031					cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		ACACCTTGGGGTACTTCCACA	0.632											OREG0025562	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	12	---	---	---	---	PASS
SIGLEC11	114132	broad.mit.edu	37	19	50461997	50461997	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50461997C>G	uc010ybh.1	-	7	1357	c.1266G>C	c.(1264-1266)GAG>GAC	p.E422D	SIGLEC11_uc010ybi.1_Missense_Mutation_p.E422D	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11 isoform 1	422	Ig-like C2-type 3.|Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|central_nervous_system(2)|pancreas(1)	6		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		TGGGTGGCAGCTCCAGGACCC	0.667													118	70	---	---	---	---	PASS
ZIM2	23619	broad.mit.edu	37	19	57293332	57293332	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57293332A>T	uc002qnr.2	-	9	1017	c.635T>A	c.(634-636)CTG>CAG	p.L212Q	uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_Missense_Mutation_p.L8Q|ZIM2_uc010ygr.1_Missense_Mutation_p.L8Q|ZIM2_uc002qnq.2_Missense_Mutation_p.L212Q|ZIM2_uc010etp.2_Missense_Mutation_p.L212Q|ZIM2_uc010ygs.1_Missense_Mutation_p.L212Q	NM_015363	NP_056178	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	212	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		CAGGGAGACCAGGTTCCGGTA	0.517													95	81	---	---	---	---	PASS
CHMP2A	27243	broad.mit.edu	37	19	59063771	59063771	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59063771C>T	uc002qti.2	-	2	629	c.203G>A	c.(202-204)CGC>CAC	p.R68H	CHMP2A_uc002qtj.2_Missense_Mutation_p.R68H|CHMP2A_uc002qtk.2_Missense_Mutation_p.R68H	NM_198426	NP_940818	O43633	CHM2A_HUMAN	chromatin modifying protein 2A	68	Interaction with VPS4B.				cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein domain specific binding				0		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GCGCCGGGTGCGCACCAAGTC	0.507													7	203	---	---	---	---	PASS
ANGPT4	51378	broad.mit.edu	37	20	865720	865720	+	Splice_Site	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:865720C>A	uc002wei.2	-	4	938	c.835_splice	c.e4+1	p.A279_splice	ANGPT4_uc010zpn.1_Splice_Site_p.A273_splice	NM_015985	NP_057069	Q9Y264	ANGP4_HUMAN	angiopoietin 4 precursor						anti-apoptosis|blood coagulation|cellular response to hypoxia|leukocyte migration|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of peptidyl-tyrosine phosphorylation|signal transduction	extracellular space	receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			ovary(2)	2						CGCTCACTCACCCGGGGCCGA	0.667													41	59	---	---	---	---	PASS
HSPA12B	116835	broad.mit.edu	37	20	3730636	3730636	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3730636G>C	uc002wjd.2	+	11	1166	c.1063G>C	c.(1063-1065)GGC>CGC	p.G355R	HSPA12B_uc010zqi.1_Missense_Mutation_p.G354R|HSPA12B_uc002wje.2_Missense_Mutation_p.G268R|HSPA12B_uc010zqj.1_Missense_Mutation_p.G189R	NM_052970	NP_443202	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B	355							ATP binding				0						TGGCGCGGTGGGCGTGGACCT	0.716													8	18	---	---	---	---	PASS
PLUNC	51297	broad.mit.edu	37	20	31827670	31827670	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31827670C>A	uc002wyv.2	+	4	452	c.382C>A	c.(382-384)CGT>AGT	p.R128S	PLUNC_uc002wyt.3_Missense_Mutation_p.R128S|PLUNC_uc002wyu.3_Missense_Mutation_p.R128S	NM_130852	NP_570913	Q9NP55	PLUNC_HUMAN	palate, lung and nasal epithelium associated	128					innate immune response	extracellular region	lipid binding				0						TGATGGCCACCGTCTCTATGT	0.512													6	717	---	---	---	---	PASS
MYH7B	57644	broad.mit.edu	37	20	33586326	33586326	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33586326G>A	uc002xbi.1	+	32	4105	c.4013G>A	c.(4012-4014)CGC>CAC	p.R1338H		NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	1296	Potential.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GAGCTGAGTCGCCTGCTAGAG	0.642													7	174	---	---	---	---	PASS
CPNE1	8904	broad.mit.edu	37	20	34219505	34219505	+	Intron	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34219505G>C	uc002xdf.2	-						CPNE1_uc002xdc.2_5'Flank|CPNE1_uc010zvj.1_Intron|CPNE1_uc002xde.2_Intron|CPNE1_uc002xdg.2_Intron|CPNE1_uc010gfi.2_Intron|CPNE1_uc010gfj.2_Intron|CPNE1_uc002xdh.2_Intron|CPNE1_uc002xdi.2_Intron|CPNE1_uc002xdj.2_Intron|CPNE1_uc002xdk.2_Intron|CPNE1_uc002xdl.2_Intron|CPNE1_uc002xdm.2_Intron|CPNE1_uc010gfk.1_Intron	NM_152931	NP_690908	Q99829	CPNE1_HUMAN	copine I isoform a						lipid metabolic process|vesicle-mediated transport		calcium-dependent phospholipid binding|phosphatidylserine binding|transporter activity			upper_aerodigestive_tract(1)	1	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			TTGCACCTGAGGGAAAGGTGT	0.562													34	58	---	---	---	---	PASS
IFT52	51098	broad.mit.edu	37	20	42252561	42252561	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42252561G>A	uc002xkw.2	+	10	921	c.799G>A	c.(799-801)GCC>ACC	p.A267T	IFT52_uc002xky.2_Missense_Mutation_p.A267T|IFT52_uc002xkx.2_RNA|IFT52_uc010ggn.2_Missense_Mutation_p.A243T|IFT52_uc002xkz.2_Missense_Mutation_p.A267T	NM_016004	NP_057088	Q9Y366	IFT52_HUMAN	intraflagellar transport 52 homolog	267						intraflagellar transport particle B|microtubule-based flagellum	protein C-terminus binding			ovary(2)	2		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GCCCTACACAGCCACCCTATC	0.493													125	180	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47297836	47297836	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47297836T>G	uc002xtw.1	-	11	1395	c.1372A>C	c.(1372-1374)AGC>CGC	p.S458R		NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	458	DEP 1.				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TCCGTCTTGCTGATTTCACCA	0.542													225	485	---	---	---	---	PASS
LSM14B	149986	broad.mit.edu	37	20	60699680	60699680	+	Silent	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60699680C>T	uc010gjy.1	+	2	341	c.135C>T	c.(133-135)TCC>TCT	p.S45S	LSM14B_uc002ybt.2_Silent_p.S45S|LSM14B_uc010gjx.1_Silent_p.S45S|LSM14B_uc002ybv.2_Silent_p.S45S|LSM14B_uc010gjz.1_5'UTR|LSM14B_uc010zzz.1_5'UTR	NM_144703	NP_653304	Q9BX40	LS14B_HUMAN	LSM14 homolog B	45					multicellular organismal development|regulation of translation	ribonucleoprotein complex					0	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			AAGTGAGGTCCTTTGGCACTG	0.502											OREG0026104	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	155	---	---	---	---	PASS
OGFR	11054	broad.mit.edu	37	20	61444505	61444505	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61444505G>A	uc002ydj.2	+	7	1573	c.1538G>A	c.(1537-1539)GGT>GAT	p.G513D	OGFR_uc002ydk.2_Missense_Mutation_p.G496D|OGFR_uc002ydl.2_Missense_Mutation_p.G461D|uc011aam.1_Silent_p.Y46Y	NM_007346	NP_031372	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	513					regulation of cell growth	cytoplasm|membrane|nucleus	opioid receptor activity				0	Breast(26;3.65e-08)					CCCAAAGAAGGTACCCCTGGG	0.701													4	18	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19716261	19716261	+	Intron	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19716261C>A	uc002ykw.2	-							NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor						proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						AAACAGGTGTCTACAACATAC	0.463													200	131	---	---	---	---	PASS
TIAM1	7074	broad.mit.edu	37	21	32624423	32624423	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32624423C>A	uc002yow.1	-	6	1518	c.1046G>T	c.(1045-1047)CGA>CTA	p.R349L	TIAM1_uc011adk.1_Missense_Mutation_p.R349L|TIAM1_uc011adl.1_Missense_Mutation_p.R349L|TIAM1_uc002yox.1_5'UTR	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	349					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						GGCATTAGATCGCCTGGACAG	0.617													28	455	---	---	---	---	PASS
PRDM15	63977	broad.mit.edu	37	21	43236175	43236175	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43236175C>T	uc002yzq.1	-	26	3487	c.3376G>A	c.(3376-3378)GCG>ACG	p.A1126T	PRDM15_uc002yzo.2_Missense_Mutation_p.A797T|PRDM15_uc002yzp.2_Missense_Mutation_p.A817T|PRDM15_uc002yzr.1_Missense_Mutation_p.A817T	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	1126	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TGGCGCAGCGCGTGCTTGGTC	0.637													4	104	---	---	---	---	PASS
RTDR1	27156	broad.mit.edu	37	22	23476328	23476328	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23476328G>A	uc002zwt.2	-	4	464	c.306C>T	c.(304-306)TAC>TAT	p.Y102Y	RTDR1_uc010gtv.1_Silent_p.Y102Y	NM_014433	NP_055248	Q9UHP6	RTDR1_HUMAN	rhabdoid tumor deletion region protein 1	102							binding			ovary(1)	1	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		CTAGAAAGGCGTATCTAGGGA	0.557													73	105	---	---	---	---	PASS
CRYBB3	1417	broad.mit.edu	37	22	25601324	25601324	+	Silent	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25601324C>T	uc003abo.1	+	5	537	c.465C>T	c.(463-465)AAC>AAT	p.N155N		NM_004076	NP_004067	P26998	CRBB3_HUMAN	crystallin, beta B3	155	Beta/gamma crystallin 'Greek key' 3.				visual perception		protein binding|structural constituent of eye lens				0						GTGCCATCAACGGGACGTAAG	0.542													5	82	---	---	---	---	PASS
SEZ6L	23544	broad.mit.edu	37	22	26747016	26747016	+	Splice_Site	SNP	A	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26747016A>C	uc003acb.2	+	12	2564	c.2408_splice	c.e12-2	p.I803_splice	SEZ6L_uc003acc.2_Splice_Site_p.I803_splice|SEZ6L_uc011akc.1_Splice_Site_p.I803_splice|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Splice_Site_p.I803_splice|SEZ6L_uc003ace.2_Splice_Site_p.I803_splice|SEZ6L_uc003acf.1_Splice_Site_p.I576_splice|SEZ6L_uc010gvc.1_Splice_Site_p.I576_splice|SEZ6L_uc011ake.1_Splice_Site	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						CATCCCGTGTAGTTATGTACT	0.493													71	144	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29091238	29091238	+	Intron	SNP	T	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29091238T>A	uc003adu.1	-						CHEK2_uc003ads.1_Intron|CHEK2_uc010gvh.1_Intron|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_Intron|CHEK2_uc010gvk.1_Intron|CHEK2_uc003adt.1_Intron|CHEK2_uc003adv.1_Intron|CHEK2_uc003adw.1_Intron|CHEK2_uc003adx.1_Intron|CHEK2_uc003ady.1_Intron|CHEK2_uc003adz.1_Intron	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a						cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						AGGCTTAATATTGGTAGAGAG	0.368			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				4	59	---	---	---	---	PASS
SLC5A1	6523	broad.mit.edu	37	22	32445945	32445945	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32445945A>C	uc003amc.2	+	2	383	c.151A>C	c.(151-153)AAT>CAT	p.N51H		NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	51	Cytoplasmic (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						GTTTTCCACCAATCGTGGGAC	0.473													366	484	---	---	---	---	PASS
CACNA1I	8911	broad.mit.edu	37	22	40074003	40074003	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40074003G>A	uc003ayc.2	+	31	4945	c.4945G>A	c.(4945-4947)GAG>AAG	p.E1649K	CACNA1I_uc003ayd.2_Missense_Mutation_p.E1614K|CACNA1I_uc003aye.2_Missense_Mutation_p.E1564K|CACNA1I_uc003ayf.2_Missense_Mutation_p.E1529K	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,	1649	Extracellular (Potential).|IV.				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	CTGCAACGACGAGAACCCGTG	0.657													4	6	---	---	---	---	PASS
PNPLA5	150379	broad.mit.edu	37	22	44285214	44285214	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44285214G>T	uc003beg.2	-	4	794	c.697C>A	c.(697-699)CTC>ATC	p.L233I	PNPLA5_uc011aqc.1_Missense_Mutation_p.L93I|PNPLA5_uc003beh.2_Missense_Mutation_p.L119I	NM_138814	NP_620169	Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	233					lipid catabolic process		hydrolase activity				0		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				CCTACCTCGAGGCTGGGGGGT	0.577													102	154	---	---	---	---	PASS
CELSR1	9620	broad.mit.edu	37	22	46759089	46759089	+	Intron	SNP	T	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46759089T>G	uc003bhw.1	-							NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1						central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GGTTTCCTGATGGTTCAAATT	0.552													10	213	---	---	---	---	PASS
GLRA2	2742	broad.mit.edu	37	X	14550411	14550411	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14550411A>T	uc010nep.2	+	3	451	c.119A>T	c.(118-120)CAG>CTG	p.Q40L	GLRA2_uc010neq.2_Missense_Mutation_p.Q40L|GLRA2_uc004cwe.3_Missense_Mutation_p.Q40L|GLRA2_uc011mio.1_5'UTR|GLRA2_uc011mip.1_Missense_Mutation_p.Q18L	NM_001118885	NP_001112357	P23416	GLRA2_HUMAN	glycine receptor, alpha 2 isoform A	40	Extracellular (Probable).				neuropeptide signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(1)|lung(1)	2	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)	CAACCTTCACAGACCCTATCT	0.403													69	33	---	---	---	---	PASS
RAI2	10742	broad.mit.edu	37	X	17820021	17820021	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17820021G>T	uc004cyf.2	-	3	680	c.110C>A	c.(109-111)GCC>GAC	p.A37D	RAI2_uc004cyg.2_Missense_Mutation_p.A37D|RAI2_uc010nfa.2_Missense_Mutation_p.A37D|RAI2_uc004cyh.3_Missense_Mutation_p.A37D|RAI2_uc011miy.1_Missense_Mutation_p.A37D	NM_021785	NP_068557	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	37					embryo development					ovary(1)|breast(1)	2	Hepatocellular(33;0.183)					GATGTTCCAGGCCTCGGTGGT	0.577													236	111	---	---	---	---	PASS
MAP7D2	256714	broad.mit.edu	37	X	20030581	20030581	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20030581T>C	uc004czr.1	-	14	1854	c.1835A>G	c.(1834-1836)GAC>GGC	p.D612G	MAP7D2_uc004czq.1_Missense_Mutation_p.D497G|MAP7D2_uc011mji.1_Missense_Mutation_p.D560G|MAP7D2_uc010nfo.1_Missense_Mutation_p.D653G|MAP7D2_uc011mjj.1_Missense_Mutation_p.D567G	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	612										ovary(2)|breast(1)	3						AGAGAAAATGTCTTGGGGATA	0.458													107	51	---	---	---	---	PASS
MAP7D2	256714	broad.mit.edu	37	X	20034289	20034289	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20034289G>A	uc004czr.1	-	10	1463	c.1444C>T	c.(1444-1446)CGG>TGG	p.R482W	MAP7D2_uc004czq.1_Missense_Mutation_p.R367W|MAP7D2_uc011mji.1_Missense_Mutation_p.R430W|MAP7D2_uc010nfo.1_Missense_Mutation_p.R523W|MAP7D2_uc011mjj.1_Missense_Mutation_p.R437W	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	482										ovary(2)|breast(1)	3						tcagccttccgcttggcctcc	0.090													11	8	---	---	---	---	PASS
OTC	5009	broad.mit.edu	37	X	38240688	38240688	+	Intron	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38240688T>C	uc004def.3	+							NM_000531	NP_000522	P00480	OTC_HUMAN	ornithine carbamoyltransferase precursor						arginine biosynthetic process|urea cycle	mitochondrial matrix|ornithine carbamoyltransferase complex	ornithine carbamoyltransferase activity			ovary(1)|breast(1)	2					L-Citrulline(DB00155)|L-Ornithine(DB00129)	GCCCGGTTTGTAAATATTTTC	0.353													6	50	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53659447	53659447	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53659447C>T	uc004dsp.2	-	9	1039	c.637G>A	c.(637-639)GAG>AAG	p.E213K		NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	213					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						ACCCTTTTCTCAATTTTGACC	0.388													41	18	---	---	---	---	PASS
RPS6KA6	27330	broad.mit.edu	37	X	83319290	83319290	+	Silent	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83319290G>A	uc004eej.1	-	22	2310	c.2233C>T	c.(2233-2235)CTG>TTG	p.L745L	RPS6KA6_uc011mqt.1_Silent_p.L745L|RPS6KA6_uc011mqu.1_Silent_p.L642L	NM_014496	NP_055311	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase polypeptide 6	745					axon guidance|central nervous system development|intracellular protein kinase cascade|synaptic transmission	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|central_nervous_system(1)|skin(1)	8						AAATCTTACAGGCCAGTTGAT	0.448													5	17	---	---	---	---	PASS
NGFRAP1	27018	broad.mit.edu	37	X	102632595	102632595	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102632595G>C	uc004eki.2	+	3	558	c.176G>C	c.(175-177)GGG>GCG	p.G59A	NGFRAP1_uc004ekh.2_Missense_Mutation_p.G49A|NGFRAP1_uc004ekj.1_Missense_Mutation_p.G59A	NM_206915	NP_996798	Q00994	BEX3_HUMAN	nerve growth factor receptor (TNFRSF16)	59					apoptosis|multicellular organismal development|nerve growth factor receptor signaling pathway	cytosol|nucleus	caspase regulator activity|metal ion binding				0						ATCAATGATGGGATGGGTGGA	0.502													213	119	---	---	---	---	PASS
NGFRAP1	27018	broad.mit.edu	37	X	102632596	102632596	+	Silent	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102632596G>C	uc004eki.2	+	3	559	c.177G>C	c.(175-177)GGG>GGC	p.G59G	NGFRAP1_uc004ekh.2_Silent_p.G49G|NGFRAP1_uc004ekj.1_Silent_p.G59G	NM_206915	NP_996798	Q00994	BEX3_HUMAN	nerve growth factor receptor (TNFRSF16)	59					apoptosis|multicellular organismal development|nerve growth factor receptor signaling pathway	cytosol|nucleus	caspase regulator activity|metal ion binding				0						TCAATGATGGGATGGGTGGAG	0.502													216	120	---	---	---	---	PASS
UTP14A	10813	broad.mit.edu	37	X	129042041	129042041	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129042041C>A	uc004euz.2	+	3	136	c.108C>A	c.(106-108)GAC>GAA	p.D36E	UTP14A_uc011mup.1_Missense_Mutation_p.D36E|UTP14A_uc011muq.1_Missense_Mutation_p.T4K	NM_006649	NP_006640	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	36					rRNA processing	nucleolus|small-subunit processome	protein binding			ovary(2)	2						CTTAGGGGGACAATGATGGAG	0.398													3	119	---	---	---	---	PASS
MST4	51765	broad.mit.edu	37	X	131206391	131206391	+	Splice_Site	SNP	T	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131206391T>C	uc004ewk.1	+	9	1327	c.1026_splice	c.e9+2	p.A342_splice	MST4_uc004ewl.1_Splice_Site_p.A265_splice|MST4_uc011mux.1_Splice_Site_p.A364_splice|MST4_uc010nrj.1_Splice_Site_p.A342_splice|MST4_uc004ewm.1_Splice_Site_p.A280_splice	NM_016542	NP_057626	Q9P289	MST4_HUMAN	serine/threonine protein kinase MST4 isoform 1						cellular component disassembly involved in apoptosis|regulation of apoptosis	cytosol|Golgi membrane	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(3)|stomach(2)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(192;0.000127)					AATGGGGCAGTATGTATATGG	0.388													34	13	---	---	---	---	PASS
FGF13	2258	broad.mit.edu	37	X	137791014	137791014	+	Silent	SNP	G	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:137791014G>C	uc004fam.2	-	2	926	c.264C>G	c.(262-264)ACC>ACG	p.T88T	FGF13_uc004fan.2_Silent_p.T35T|FGF13_uc011mwi.1_Silent_p.T69T|FGF13_uc004faq.2_Silent_p.T98T|FGF13_uc004far.2_Silent_p.T69T|FGF13_uc011mwj.1_Silent_p.T98T|FGF13_uc011mwk.1_Silent_p.T42T	NM_004114	NP_004105	Q92913	FGF13_HUMAN	fibroblast growth factor 13 isoform 1	88					cell-cell signaling|MAPKKK cascade|nervous system development	cytoplasm|nucleus	growth factor activity|protein kinase activator activity			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					TGCCATCAATGGTTCCATCCG	0.408													130	54	---	---	---	---	PASS
CDR1	1038	broad.mit.edu	37	X	139865876	139865876	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139865876C>G	uc004fbg.1	-	1	848	c.656G>C	c.(655-657)GGA>GCA	p.G219A	uc004fbf.1_RNA	NM_004065	NP_004056	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1,	219											0	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				TCCACCAAATCCAGGTCTTCC	0.438													7	229	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140996561	140996561	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140996561C>A	uc004fbt.2	+	4	3657	c.3371C>A	c.(3370-3372)TCG>TAG	p.S1124*	MAGEC1_uc010nsl.1_Nonsense_Mutation_p.S191*	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1124							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					ACAGATGATTCGACTGCCACA	0.483										HNSCC(15;0.026)			131	45	---	---	---	---	PASS
SPANXN3	139067	broad.mit.edu	37	X	142596999	142596999	+	Intron	SNP	G	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142596999G>A	uc004fbw.2	-							NM_001009609	NP_001009609	Q5MJ09	SPXN3_HUMAN	SPANX-N3 protein											ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CATCTGGTAAGAAAATAGGGA	0.423													5	114	---	---	---	---	PASS
CELA2A	63036	broad.mit.edu	37	1	15783097	15783097	+	5'Flank	DEL	A	-	-	rs34325326		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15783097delA	uc001awk.2	+							NM_033440	NP_254275	P08217	CEL2A_HUMAN	elastase 2A preproprotein						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2						AGGAAATGGGAAAAAAAAAAT	0.383													4	3	---	---	---	---	
NBPF3	84224	broad.mit.edu	37	1	21808931	21808932	+	Intron	INS	-	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21808931_21808932insT	uc001ber.2	+						NBPF3_uc001bes.2_Intron|NBPF3_uc009vqb.2_Intron|NBPF3_uc010odm.1_Intron	NM_032264	NP_115640	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3							cytoplasm				upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TTATGTGTGTAGGGGAATCAGC	0.441													4	2	---	---	---	---	
EPB41	2035	broad.mit.edu	37	1	29338634	29338635	+	Intron	INS	-	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29338634_29338635insT	uc001brm.1	+						EPB41_uc001brg.1_Intron|EPB41_uc001brh.1_Intron|EPB41_uc001bri.1_Intron|EPB41_uc001brj.1_Intron|EPB41_uc009vtk.1_Intron|EPB41_uc001brk.2_Intron|EPB41_uc001brl.1_Intron|EPB41_uc009vtl.1_Intron|EPB41_uc009vtm.1_Intron	NM_203342	NP_976217	P11171	41_HUMAN	erythrocyte membrane protein band 4.1						blood circulation|cortical actin cytoskeleton organization|positive regulation of protein binding	extrinsic to membrane|Golgi apparatus|nucleus|plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	1-phosphatidylinositol binding|actin binding|spectrin binding|structural constituent of cytoskeleton			ovary(1)	1		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		GATTTTGTTGATTTTTTTTTTT	0.356													3	3	---	---	---	---	
SLC35D1	23169	broad.mit.edu	37	1	67487400	67487401	+	Intron	DEL	AG	-	-	rs72407410		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67487400_67487401delAG	uc001ddk.2	-						SLC35D1_uc010oph.1_Intron	NM_015139	NP_055954	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-glucuronic						chondroitin sulfate biosynthetic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	integral to endoplasmic reticulum membrane	UDP-glucuronic acid transmembrane transporter activity|UDP-N-acetylgalactosamine transmembrane transporter activity				0					Lorazepam(DB00186)	acacagacacagacacagacac	0.248													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	74420128	74420129	+	IGR	INS	-	TTCC	TTCC	rs35908625		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74420128_74420129insTTCC								None (None upstream) : LRRIQ3 (71575 downstream)																							tccttccttccttcccttctct	0.000													7	4	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144825139	144825140	+	Intron	DEL	CT	-	-	rs33954645		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144825139_144825140delCT	uc009wig.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						tcactttctcctctctctctct	0.371													4	2	---	---	---	---	
NFASC	23114	broad.mit.edu	37	1	204816081	204816082	+	Intron	DEL	GT	-	-	rs111723969		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204816081_204816082delGT	uc001hbj.2	+						NFASC_uc001hbh.2_Intron|NFASC_uc010pqz.1_Intron|NFASC_uc010pra.1_Intron|NFASC_uc001hbi.2_Intron	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor						axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			gtgtgtacgcgtgtgtgtgtgt	0.401													3	3	---	---	---	---	
CEP170	9859	broad.mit.edu	37	1	243332885	243332886	+	Intron	DEL	AG	-	-	rs140816120		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243332885_243332886delAG	uc001hzs.2	-						CEP170_uc001hzt.2_Intron|CEP170_uc001hzu.2_Intron	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha							centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			aaatggagaaagagaagaaaaa	0.218													2	7	---	---	---	---	
C1orf150	148823	broad.mit.edu	37	1	247719791	247719791	+	Intron	DEL	T	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247719791delT	uc001idf.2	+						C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron	NM_145278	NP_660321	Q5JQS6	CA150_HUMAN	hypothetical protein LOC148823												0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CATCTCAGAGTTTttttgttt	0.373													15	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	36120001	36120006	+	IGR	DEL	GTGTGT	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36120001_36120006delGTGTGT								None (None upstream) : CRIM1 (463391 downstream)																							gtgagtgtgagtgtgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
NRXN1	9378	broad.mit.edu	37	2	50504538	50504549	+	Intron	DEL	CCTCCCTCCTTC	-	-	rs145171946	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50504538_50504549delCCTCCCTCCTTC	uc010fbp.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ttccttccttcctccctccttcccttccttcc	0.175													6	6	---	---	---	---	
C2orf86	51057	broad.mit.edu	37	2	63589393	63589394	+	Intron	INS	-	TT	TT	rs67493046		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63589393_63589394insTT	uc002sch.2	-						C2orf86_uc002sce.2_Intron|C2orf86_uc002scf.2_Intron|C2orf86_uc010ypu.1_Intron|C2orf86_uc002scg.2_Intron	NM_015910	NP_056994	O95876	FRITZ_HUMAN	hypothetical protein LOC51057 isoform 2						cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0						GGTAGAATCCCTTTTTTTTTTT	0.119													4	2	---	---	---	---	
SPRED2	200734	broad.mit.edu	37	2	65618330	65618331	+	Intron	DEL	AC	-	-	rs72185023		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65618330_65618331delAC	uc002sdr.3	-						SPRED2_uc010fcx.1_Intron	NM_181784	NP_861449	Q7Z698	SPRE2_HUMAN	sprouty-related protein with EVH-1 domain 2						inactivation of MAPK activity|multicellular organismal development	transport vesicle membrane	stem cell factor receptor binding			ovary(1)|lung(1)|central_nervous_system(1)	3						CTTAATGTGTacacacacacac	0.248													4	2	---	---	---	---	
PLEK	5341	broad.mit.edu	37	2	68608266	68608267	+	Intron	DEL	AG	-	-	rs10538878		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68608266_68608267delAG	uc002sen.3	+						PLEK_uc010fde.2_Intron	NM_002664	NP_002655	P08567	PLEK_HUMAN	pleckstrin						actin cytoskeleton reorganization|cortical actin cytoskeleton organization|hemopoietic progenitor cell differentiation|inhibition of phospholipase C activity involved in G-protein coupled receptor signaling pathway|integrin-mediated signaling pathway|negative regulation of calcium-mediated signaling|negative regulation of inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|platelet aggregation|positive regulation of actin filament bundle assembly|positive regulation of actin filament depolymerization|positive regulation of inositol-polyphosphate 5-phosphatase activity|positive regulation of integrin activation|positive regulation of platelet activation|protein kinase C signaling cascade|protein secretion by platelet|regulation of cell diameter|ruffle organization|thrombin receptor signaling pathway|vesicle docking involved in exocytosis	cytosol|extracellular region|membrane fraction|ruffle membrane|soluble fraction	phosphatidylinositol-3,4-bisphosphate binding|protein homodimerization activity|protein kinase C binding			ovary(1)	1		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		ACTGGGTACCagagagagagag	0.337													5	6	---	---	---	---	
SMYD1	150572	broad.mit.edu	37	2	88409717	88409718	+	Intron	INS	-	GA	GA			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88409717_88409718insGA	uc002ssr.2	+						SMYD1_uc002ssq.1_Intron|SMYD1_uc002sss.2_Intron	NM_198274	NP_938015	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)|skin(1)	4						CCTTGATGAATGAgtgtgtgtg	0.406													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	155477445	155477445	+	IGR	DEL	C	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155477445delC								GALNT13 (166957 upstream) : KCNJ3 (77648 downstream)																							tttcttccttccctccctccc	0.000													4	2	---	---	---	---	
EEF1B2	1933	broad.mit.edu	37	2	207026490	207026491	+	Intron	INS	-	T	T	rs142413994	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207026490_207026491insT	uc002vbf.1	+						NDUFS1_uc010ziq.1_5'Flank|NDUFS1_uc002vbe.2_5'Flank|NDUFS1_uc010zir.1_5'Flank|NDUFS1_uc010zis.1_5'Flank|NDUFS1_uc010zit.1_5'Flank|NDUFS1_uc010ziu.1_5'Flank|EEF1B2_uc002vbg.1_Intron|EEF1B2_uc002vbh.1_Intron|SNORD51_uc002vbi.1_5'Flank|SNORA41_uc002vbj.2_5'Flank	NM_001037663	NP_001032752	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta							cytosol|eukaryotic translation elongation factor 1 complex	protein binding|translation elongation factor activity				0						gagactccgtcccaaaaaaaaa	0.069													7	5	---	---	---	---	
ABCA12	26154	broad.mit.edu	37	2	215823928	215823928	+	Intron	DEL	T	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215823928delT	uc002vew.2	-						ABCA12_uc002vev.2_Intron|ABCA12_uc010zjn.1_Intron	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TTGGGGGACCTTTTTTTTTTA	0.284													4	3	---	---	---	---	
ZFAND2B	130617	broad.mit.edu	37	2	220071880	220071880	+	Intron	DEL	G	-	-	rs66491679		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220071880delG	uc002vka.2	+						ZFAND2B_uc010zkt.1_Intron|ZFAND2B_uc010fwd.1_Intron|ZFAND2B_uc002vjy.1_Intron|ZFAND2B_uc002vjz.1_Intron|ZFAND2B_uc002vkb.1_5'Flank	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B							endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCTTGAAGCTGGGGGGGGGTG	0.607													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241580401	241580404	+	IGR	DEL	TCCC	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241580401_241580404delTCCC								GPR35 (9726 upstream) : AQP12B (35432 downstream)																							cctccttccttccctgacctacct	0.123													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	36980752	36980753	+	IGR	DEL	AC	-	-	rs71937663		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36980752_36980753delAC								TRANK1 (78341 upstream) : EPM2AIP1 (46605 downstream)																							ATTCTAacatacacacacacac	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	94043078	94043081	+	IGR	DEL	GTGT	-	-	rs6147955		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94043078_94043081delGTGT								NSUN3 (197448 upstream) : LOC255025 (614026 downstream)																							tactcaacACgtgtgtgtgtgtgt	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	95233979	95233980	+	IGR	DEL	CA	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95233979_95233980delCA								LOC255025 (338900 upstream) : None (None downstream)																							GACAGACAGGcacacacacaca	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	147140581	147140584	+	IGR	DEL	TGTG	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147140581_147140584delTGTG								ZIC1 (6077 upstream) : None (None downstream)																							GAGATTCATAtgtgtgtgtgtgtg	0.309													5	3	---	---	---	---	
NAALADL2	254827	broad.mit.edu	37	3	174997573	174997576	+	Intron	DEL	GTGA	-	-	rs147941843	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174997573_174997576delGTGA	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron|NAALADL2_uc010hwz.1_Intron	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		TGCATAgtgtgtgagtgtgtgtgt	0.265													4	3	---	---	---	---	
ETV5	2119	broad.mit.edu	37	3	185821410	185821421	+	Intron	DEL	ACACACACACAC	-	-	rs10534124		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185821410_185821421delACACACACACAC	uc003fpz.2	-						ETV5_uc003fpy.2_Intron	NM_004454	NP_004445	P41161	ETV5_HUMAN	ets variant gene 5 (ets-related molecule)						cellular response to oxidative stress	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)|skin(2)|breast(1)	5	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			CATCTTGCAAacacacacacacacacacacac	0.316			T	TMPRSS2|SCL45A3	Prostate 								4	2	---	---	---	---	
ADIPOQ	9370	broad.mit.edu	37	3	186566180	186566181	+	Intron	INS	-	TA	TA			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186566180_186566181insTA	uc003fra.2	+						ADIPOQ_uc010hyy.2_Intron	NM_004797	NP_004788	Q15848	ADIPO_HUMAN	adiponectin precursor						brown fat cell differentiation|cellular response to drug|cellular response to insulin stimulus|detection of oxidative stress|fatty acid beta-oxidation|generation of precursor metabolites and energy|glucose homeostasis|glucose metabolic process|low-density lipoprotein particle clearance|negative regulation of blood pressure|negative regulation of DNA biosynthetic process|negative regulation of ERK1 and ERK2 cascade|negative regulation of eukaryotic cell surface binding|negative regulation of fat cell differentiation|negative regulation of gluconeogenesis|negative regulation of granulocyte differentiation|negative regulation of heterotypic cell-cell adhesion|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of intracellular protein transport|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|negative regulation of macrophage differentiation|negative regulation of MAP kinase activity|negative regulation of phagocytosis|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein autophosphorylation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|negative regulation of synaptic transmission|negative regulation of transcription, DNA-dependent|negative regulation of tumor necrosis factor production|negative regulation of tumor necrosis factor-mediated signaling pathway|positive regulation of cAMP-dependent protein kinase activity|positive regulation of cholesterol efflux|positive regulation of fatty acid metabolic process|positive regulation of glucose import|positive regulation of glycogen (starch) synthase activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of metanephric glomerular visceral epithelial cell development|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myeloid cell apoptosis|positive regulation of protein kinase A signaling cascade|positive regulation of renal albumin absorption|protein homooligomerization|protein localization in plasma membrane|response to glucose stimulus|response to tumor necrosis factor	collagen|endoplasmic reticulum|extracellular space	cytokine activity|eukaryotic cell surface binding|hormone activity|protein homodimerization activity			ovary(1)	1	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		GTTTGTCGTTTTATATAtatga	0.223													6	3	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195512373	195512374	+	In_Frame_Ins	INS	-	GAT	GAT	rs140335395	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195512373_195512374insGAT	uc011bto.1	-	2	6537_6538	c.6077_6078insATC	c.(6076-6078)TCC>TCATCC	p.2026_2026S>SS	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	798	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTCACCAGTGGATGCTGAGGA	0.579													4	3	---	---	---	---	
FAM157A	728262	broad.mit.edu	37	3	197900031	197900036	+	Intron	DEL	GGGTGA	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197900031_197900036delGGGTGA	uc011bup.1	+						FAM157A_uc011buq.1_Intron	NM_001145248	NP_001138720	C9JC47	F157A_HUMAN	family with sequence similarity 157, member A												0						gaggggtgaggggtgagggtgagggt	0.000													4	2	---	---	---	---	
SLC2A9	56606	broad.mit.edu	37	4	9982876	9982878	+	Intron	DEL	ATG	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9982876_9982878delATG	uc003gmc.2	-						SLC2A9_uc003gmd.2_Intron	NM_020041	NP_064425	Q9NRM0	GTR9_HUMAN	solute carrier family 2, member 9 protein						glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3						ggttgtggcaatgatgatgatgg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190514045	190514046	+	IGR	INS	-	TG	TG	rs139239251	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190514045_190514046insTG								None (None upstream) : FRG1 (347928 downstream)																							CACTTTTCTGTtgtgtgtggtg	0.178													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190588713	190588716	+	IGR	DEL	GTAG	-	-	rs72082312		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190588713_190588716delGTAG								None (None upstream) : FRG1 (273258 downstream)																							gtgtgtgtgtgtagagagagatta	0.059													6	3	---	---	---	---	
PDCD6	10016	broad.mit.edu	37	5	302186	302187	+	Intron	DEL	TG	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:302186_302187delTG	uc003jat.1	+						AHRR_uc003jav.2_5'Flank|AHRR_uc003jaw.2_5'Flank|AHRR_uc010isy.2_5'Flank|PDCD6_uc003jau.1_Intron	NM_013232	NP_037364	O75340	PDCD6_HUMAN	programmed cell death 6						induction of apoptosis by extracellular signals|response to calcium ion	endoplasmic reticulum membrane|nuclear membrane	binding, bridging|calcium ion binding|calcium-dependent protein binding			breast(1)	1			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			AGTGCTGCTCtgtgtgtgtgtg	0.460													4	2	---	---	---	---	
SPEF2	79925	broad.mit.edu	37	5	35736571	35736572	+	Intron	DEL	GT	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35736571_35736572delGT	uc003jjo.2	+						SPEF2_uc003jjp.1_Intron	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			aagtgacagagtgtgtgtgtgt	0.000													6	3	---	---	---	---	
MAST4	375449	broad.mit.edu	37	5	66440286	66440293	+	Intron	DEL	ACACACAC	-	-	rs71841721		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66440286_66440293delACACACAC	uc003jut.1	+						MAST4_uc003juu.1_Intron|MAST4_uc011cra.1_Intron|MAST4_uc003juv.2_Intron|MAST4_uc003juw.2_Intron	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		GTATATATGTacacacacacacacacac	0.317													3	3	---	---	---	---	
GLRA1	2741	broad.mit.edu	37	5	151228709	151228710	+	Intron	INS	-	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151228709_151228710insT	uc003lut.2	-						GLRA1_uc003lur.2_Intron|GLRA1_uc003lus.2_Intron	NM_001146040	NP_001139512	P23415	GLRA1_HUMAN	glycine receptor, alpha 1 isoform 1 precursor						muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity			ovary(1)|central_nervous_system(1)	2		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	ttctttctttctttcttttctt	0.050													4	2	---	---	---	---	
BTN2A3	54718	broad.mit.edu	37	6	26422627	26422628	+	Intron	INS	-	A	A	rs147936124	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26422627_26422628insA	uc011dkl.1	+						BTN2A3_uc011dkm.1_Intron					RecName: Full=Butyrophilin subfamily 2 member A3; Flags: Precursor;												0						gcaaattttccaaaaaaattaa	0.054													3	3	---	---	---	---	
HIST1H2BJ	8970	broad.mit.edu	37	6	27099962	27099962	+	Intron	DEL	A	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27099962delA	uc003niu.1	-						HIST1H2AG_uc003niw.2_5'Flank			P06899	H2B1J_HUMAN	Homo sapiens histone cluster 1, H2bj, mRNA (cDNA clone IMAGE:4048288), with apparent retained intron.						defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding				0						TGGCAGATCTAAAAAAAAAAA	0.328													4	3	---	---	---	---	
TINAG	27283	broad.mit.edu	37	6	54174874	54174875	+	Intron	INS	-	GTGTGT	GTGTGT	rs138971244	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54174874_54174875insGTGTGT	uc003pcj.2	+						TINAG_uc003pci.2_Intron|TINAG_uc010jzt.2_Intron	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen						cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			cttttttttccgtgtgtgtgtg	0.054													4	3	---	---	---	---	
CASP8AP2	9994	broad.mit.edu	37	6	90583665	90583665	+	3'UTR	DEL	T	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90583665delT	uc003pnr.2	+	11					CASP8AP2_uc003pnt.2_3'UTR|CASP8AP2_uc011dzz.1_3'UTR	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN	caspase 8 associated protein 2						cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity			ovary(2)	2		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TTGTTATTACTCAGTGACTCT	0.323													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134269798	134269799	+	IGR	INS	-	AC	AC	rs142749236	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134269798_134269799insAC								TCF21 (50641 upstream) : TBPL1 (3554 downstream)																							TGCATGCATGAacacacacaca	0.252													3	3	---	---	---	---	
UST	10090	broad.mit.edu	37	6	149188462	149188465	+	Intron	DEL	ACAT	-	-	rs71738751		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149188462_149188465delACAT	uc003qmg.2	+							NM_005715	NP_005706	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase						protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		acacacacacacaTATATATGTAC	0.250													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	156975030	156975035	+	IGR	DEL	GTGTGT	-	-	rs10527616		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156975030_156975035delGTGTGT								MIR1202 (707017 upstream) : ARID1B (124051 downstream)																							acatacagaagtgtgtgtgtgtgtgt	0.000													10	5	---	---	---	---	
KIAA0415	9907	broad.mit.edu	37	7	4825391	4825392	+	Intron	INS	-	TT	TT			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4825391_4825392insTT	uc003sne.2	+						KIAA0415_uc010ksp.2_Intron|KIAA0415_uc003snf.2_5'Flank	NM_014855	NP_055670	O43299	K0415_HUMAN	hypothetical protein LOC9907						cell death|double-strand break repair via homologous recombination	cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.091)|OV - Ovarian serous cystadenocarcinoma(56;8.35e-15)		TTCTTCTTCCCTTTTTtttttt	0.292													4	2	---	---	---	---	
C7orf30	115416	broad.mit.edu	37	7	23340877	23340877	+	Intron	DEL	T	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23340877delT	uc003swd.1	+							NM_138446	NP_612455	Q96EH3	CG030_HUMAN	hypothetical protein LOC115416							mitochondrion					0			GBM - Glioblastoma multiforme(13;0.154)			GCAAGGAAGAttttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	70385731	70385732	+	IGR	INS	-	AC	AC			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70385731_70385732insAC								AUTS2 (127847 upstream) : WBSCR17 (212057 downstream)																							ctactaaaacaatacacacaca	0.000													4	3	---	---	---	---	
PLAG1	5324	broad.mit.edu	37	8	57123328	57123330	+	Intron	DEL	GAG	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57123328_57123330delGAG	uc003xsr.3	-						PLAG1_uc010lyi.2_Intron|PLAG1_uc010lyj.2_Intron|CHCHD7_uc003xss.2_5'Flank|CHCHD7_uc003xst.2_5'Flank|CHCHD7_uc003xsu.2_5'Flank|CHCHD7_uc003xsv.2_5'Flank|CHCHD7_uc003xsw.2_5'Flank|CHCHD7_uc003xsx.2_5'Flank	NM_002655	NP_002646	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding		CTNNB1/PLAG1(60)|FGFR1_ENST00000447712/PLAG1(28)|CHCHD7/PLAG1(12)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|COL1A2/PLAG1(3)|TCEA1_ENST00000521604/PLAG1(3)	salivary_gland(113)|soft_tissue(13)|lung(1)|central_nervous_system(1)|breast(1)	129		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			CAGCACCAGAgaggaggaggagg	0.379			T	TCEA1|LIFR|CTNNB1|CHCHD7	salivary adenoma								3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	64231810	64231811	+	IGR	INS	-	CTTTCTTC	CTTTCTTC	rs142119314	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64231810_64231811insCTTTCTTC								YTHDF3 (106465 upstream) : None (None downstream)																							tttctttctttcttccttcctt	0.000													4	5	---	---	---	---	
OXR1	55074	broad.mit.edu	37	8	107634682	107634683	+	Intron	DEL	CA	-	-	rs145152270	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107634682_107634683delCA	uc011lht.1	+						OXR1_uc003ymf.2_Intron|OXR1_uc003ymg.1_Intron	NM_018002	NP_060472	Q8N573	OXR1_HUMAN	oxidation resistance 1 isoform 1						cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			tcacccccagcacacacacaca	0.000													3	4	---	---	---	---	
SNTB1	6641	broad.mit.edu	37	8	121823372	121823372	+	Intron	DEL	C	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121823372delC	uc010mdg.2	-						SNTB1_uc003ype.2_Intron	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin						muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CGCCACCCTTCCCCCCCCCCC	0.622													11	6	---	---	---	---	
TMEM71	137835	broad.mit.edu	37	8	133770870	133770870	+	Intron	DEL	T	-	-	rs11334814		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133770870delT	uc003ytp.2	-						TMEM71_uc003ytn.2_Intron|TMEM71_uc003yto.2_Intron	NM_144649	NP_653250	Q6P5X7	TMM71_HUMAN	transmembrane protein 71 isoform 1							integral to membrane				ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			AAAACGGTGATTTTTTTTTTT	0.294													6	3	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139701401	139701402	+	Intron	INS	-	G	G	rs149093007	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139701401_139701402insG	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCTGCTCTCCCGGGGGGGGGGC	0.545										HNSCC(7;0.00092)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143103306	143103307	+	IGR	INS	-	CACACA	CACACA	rs34198035		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143103306_143103307insCACACA								MIR1302-7 (235632 upstream) : NCRNA00051 (176410 downstream)																							ATATGAATGCGcacacacacac	0.426													4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	9091181	9091182	+	Intron	INS	-	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9091181_9091182insA	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CGCAAGGACCGAACACCCCCAC	0.510										TSP Lung(15;0.13)			56	36	---	---	---	---	
SEMA4D	10507	broad.mit.edu	37	9	92017598	92017598	+	Intron	DEL	A	-	-	rs72143240		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92017598delA	uc004aqo.1	-						SEMA4D_uc011ltm.1_Intron|SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqp.1_Intron	NM_006378	NP_006369	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 1						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						TAAAAAGTTCAAAAAAAAAAA	0.483													2	4	---	---	---	---	
C9orf130	100128782	broad.mit.edu	37	9	98576952	98576953	+	Intron	INS	-	AC	AC	rs148074064		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98576952_98576953insAC	uc004avp.3	-							NR_023390				Homo sapiens cDNA FLJ34818 fis, clone NT2NE2008077.												0						CAGCTCCCTAAacacacacaca	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	22552072	22552073	+	IGR	INS	-	GGACGGAAGGAAGGAAGGAA	GGACGGAAGGAAGGAAGGAA	rs137928413	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22552072_22552073insGGACGGAAGGAAGGAAGGAA								DNAJC1 (259422 upstream) : COMMD3 (53226 downstream)																							gagggaggaagggaaggaagga	0.104													4	2	---	---	---	---	
C10orf11	83938	broad.mit.edu	37	10	78138920	78138921	+	Intron	DEL	TG	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78138920_78138921delTG	uc001jxi.2	+							NM_032024	NP_114413	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)					tggccTTCTTtgtgtgtgtgtg	0.005													4	2	---	---	---	---	
H19	283120	broad.mit.edu	37	11	2016657	2016657	+	3'UTR	DEL	C	-	-	rs72556550		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2016657delC	uc001lvc.1	-	5					H19_uc001luz.1_RNA|H19_uc001lva.3_RNA|H19_uc001lvd.2_RNA|H19_uc001lve.2_RNA|H19_uc001lvb.1_RNA					SubName: Full=cDNA FLJ32212 fis, clone PLACE6003399, weakly similar to SPIDROIN 1;												0						CACGCACACTCGTACTGAGAC	0.607									Beckwith-Wiedemann_syndrome				18	10	---	---	---	---	
CARS	833	broad.mit.edu	37	11	3026862	3026862	+	Intron	DEL	T	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3026862delT	uc001lxh.2	-						CARS_uc009ydu.2_Intron|CARS_uc001lxe.2_Intron|CARS_uc001lxf.2_Intron|CARS_uc001lxg.2_Intron|CARS_uc010qxo.1_Intron|CARS_uc010qxp.1_Intron	NM_001751	NP_001742	P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase isoform b						cysteinyl-tRNA aminoacylation	cytoplasm|cytosol	ATP binding|cysteine-tRNA ligase activity|metal ion binding|protein homodimerization activity|protein homodimerization activity|tRNA binding|tRNA binding		CARS/ALK(5)	soft_tissue(5)|ovary(2)	7		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	GTGTGTGTGAttttttttttt	0.244			T	ALK	ALCL								4	3	---	---	---	---	
ABCC8	6833	broad.mit.edu	37	11	17452095	17452095	+	Intron	DEL	T	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17452095delT	uc001mnc.2	-							NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	tcaacaCTGGTTTTTTTTTTT	0.244													5	3	---	---	---	---	
E2F8	79733	broad.mit.edu	37	11	19255692	19255693	+	Intron	INS	-	A	A	rs76020624		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19255692_19255693insA	uc001mpm.2	-						E2F8_uc009yhv.2_Intron|E2F8_uc001mpn.3_Intron	NM_024680	NP_078956	A0AVK6	E2F8_HUMAN	E2F family member 8						cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						agactccgtctaaaaaaaaaaa	0.119													4	2	---	---	---	---	
GDPD5	81544	broad.mit.edu	37	11	75152589	75152590	+	Intron	DEL	GT	-	-	rs34643232		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75152589_75152590delGT	uc001owo.3	-						GDPD5_uc001owp.3_Intron|GDPD5_uc001own.3_Intron|GDPD5_uc009yuc.2_Intron|GDPD5_uc009yud.2_Intron	NM_030792	NP_110419	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process|nervous system development	endomembrane system|growth cone|integral to membrane|perinuclear region of cytoplasm	glycerophosphodiester phosphodiesterase activity			ovary(1)	1						CTGCCCGACCgtgtgtgtgtgt	0.569													4	2	---	---	---	---	
NOX4	50507	broad.mit.edu	37	11	89125120	89125123	+	Intron	DEL	TCCT	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89125120_89125123delTCCT	uc001pct.2	-						NOX4_uc009yvr.2_Intron|NOX4_uc001pcu.2_Intron|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Intron|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Intron|NOX4_uc009yvq.2_Intron	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				cttccccttctccttccttccttc	0.201													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	124144175	124144175	+	IGR	DEL	T	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124144175delT								OR8G2 (47865 upstream) : OR8D1 (35562 downstream)																							CCATCATTCCTTTTTTTTTTT	0.413													4	4	---	---	---	---	
PLEKHG6	55200	broad.mit.edu	37	12	6427413	6427413	+	Intron	DEL	G	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6427413delG	uc001qnr.2	+						PLEKHG6_uc001qns.2_Intron|PLEKHG6_uc010sew.1_Intron|PLEKHG6_uc010sex.1_Intron	NM_018173	NP_060643	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain-containing family G						regulation of Rho protein signal transduction	cleavage furrow|cytoplasm|spindle pole	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|skin(1)	2						CCCTTGGCCAGGAAGTCCAGG	0.622													24	80	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	10392080	10392081	+	IGR	INS	-	CTT	CTT	rs143361134		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10392080_10392081insCTT								GABARAPL1 (16358 upstream) : KLRD1 (64969 downstream)																							ttccttccttccttcttccttc	0.045													4	2	---	---	---	---	
CELA1	1990	broad.mit.edu	37	12	51736597	51736597	+	Intron	DEL	T	-	-	rs5798169		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51736597delT	uc001ryi.1	-							NM_001971	NP_001962	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1						proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			breast(1)	1						ATTTAGGAAAttttttttttt	0.174													4	2	---	---	---	---	
OR6C76	390326	broad.mit.edu	37	12	55819934	55819935	+	5'Flank	INS	-	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55819934_55819935insA	uc010spm.1	+							NM_001005183	NP_001005183	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AATAGTATTTGAAAAAAAAATG	0.262													14	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	60564483	60564484	+	IGR	INS	-	AC	AC	rs145084660	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60564483_60564484insAC								SLC16A7 (389076 upstream) : None (None downstream)																							cacacacacatacacacacaca	0.000													4	2	---	---	---	---	
GLIPR1	11010	broad.mit.edu	37	12	75884362	75884363	+	Intron	DEL	AC	-	-	rs150016880		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75884362_75884363delAC	uc001sxs.2	+						GLIPR1_uc009zsb.1_Intron	NM_006851	NP_006842	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1 precursor						cellular lipid metabolic process	extracellular region|integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3						AAAAACAACAACAAAAAAAAAC	0.282													9	9	---	---	---	---	
NAV3	89795	broad.mit.edu	37	12	78224970	78224975	+	5'Flank	DEL	AGAGAC	-	-	rs72186592	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78224970_78224975delAGAGAC	uc001syp.2	+						NAV3_uc001syo.2_5'Flank	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						agagagagagagagacagagagagag	0.204										HNSCC(70;0.22)			2	5	---	---	---	---	
PMCH	5367	broad.mit.edu	37	12	102591380	102591381	+	Frame_Shift_Ins	INS	-	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102591380_102591381insT	uc001tjl.2	-	1	234_235	c.168_169insA	c.(166-171)AAATCAfs	p.K56fs		NM_002674	NP_002665	P20382	MCH_HUMAN	pro-melanin-concentrating hormone	56_57					cell differentiation|neuropeptide signaling pathway|spermatogenesis|synaptic transmission		melanin-concentrating hormone activity				0						GCAATAACTGATTTTTCTGCAG	0.366													39	27	---	---	---	---	
GCN1L1	10985	broad.mit.edu	37	12	120602670	120602670	+	Intron	DEL	T	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120602670delT	uc001txo.2	-							NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis						regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ttacagcttgttttttttttt	0.000													4	2	---	---	---	---	
FLT3	2322	broad.mit.edu	37	13	28585821	28585822	+	Intron	INS	-	T	T	rs71703461		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28585821_28585822insT	uc001urw.2	-						FLT3_uc010aao.2_Intron|FLT3_uc010tdn.1_Intron	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	tccttccctcctccttccttcc	0.109			Mis|O		AML|ALL								2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31652509	31652516	+	IGR	DEL	AAGGAAGA	-	-	rs148041842	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31652509_31652516delAAGGAAGA								C13orf26 (103358 upstream) : HSPH1 (58249 downstream)																							ggaaggaaggaaggaagaaagaaagaaa	0.192													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	38559347	38559358	+	IGR	DEL	AGGCAGGCAGGC	-	-	rs71677886	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38559347_38559358delAGGCAGGCAGGC								TRPC4 (115408 upstream) : UFM1 (364584 downstream)																							gaaggaaggaaggcaggcaggcaggcaggcag	0.118													5	3	---	---	---	---	
SUCLA2	8803	broad.mit.edu	37	13	48570880	48570881	+	Intron	INS	-	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48570880_48570881insA	uc001vbs.2	-						SUCLA2_uc010tgb.1_Intron|SUCLA2_uc010tgc.1_Intron|SUCLA2_uc010tgd.1_Intron|SUCLA2_uc001vbt.1_Intron|SUCLA2_uc001vbu.1_Intron	NM_003850	NP_003841	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit						succinyl-CoA pathway|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			central_nervous_system(1)	1		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	GTATTTTTTTTAAAAAAAAGCT	0.243													9	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20647247	20647248	+	IGR	INS	-	AGAG	AGAG	rs5004153		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20647247_20647248insAGAG								OR4N5 (34427 upstream) : OR11G2 (18247 downstream)																							tgtgtATATATAGAGAGAGAGA	0.208													6	4	---	---	---	---	
ACIN1	22985	broad.mit.edu	37	14	23550267	23550268	+	Intron	DEL	TT	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23550267_23550268delTT	uc001wit.3	-						ACIN1_uc001wis.3_5'Flank|ACIN1_uc010akg.2_Intron|ACIN1_uc010tnj.1_Intron	NM_014977	NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1						apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		AAGCACCCCCTTTTTTTTTTTT	0.347													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	29849327	29849334	+	IGR	DEL	ACACACAC	-	-	rs72101563		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29849327_29849334delACACACAC								C14orf23 (585328 upstream) : PRKD1 (196355 downstream)																							ATACATTGTAacacacacacacacacac	0.322													3	4	---	---	---	---	
NPAS3	64067	broad.mit.edu	37	14	34029215	34029216	+	Intron	INS	-	AA	AA			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34029215_34029216insAA	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron|NPAS3_uc001wrw.2_Intron	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		gactctgtctcaaaaaaaaaaa	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	35931741	35931742	+	IGR	INS	-	TTCC	TTCC	rs79264834		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35931741_35931742insTTCC								NFKBIA (57781 upstream) : INSM2 (71506 downstream)																							tccttccttcctcccttcctcc	0.079													4	4	---	---	---	---	
DAPK2	23604	broad.mit.edu	37	15	64217874	64217875	+	Intron	INS	-	GCGC	GCGC	rs147933961	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64217874_64217875insGCGC	uc002amr.2	-						DAPK2_uc010uim.1_Intron	NM_014326	NP_055141	Q9UIK4	DAPK2_HUMAN	death-associated kinase 2						apoptosis|induction of apoptosis|intracellular protein kinase cascade	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding			stomach(1)|central_nervous_system(1)	2				LUAD - Lung adenocarcinoma(2;0.215)		GCTGACTTGTAGCGcacacaca	0.327													4	3	---	---	---	---	
ZNF710	374655	broad.mit.edu	37	15	90617221	90617222	+	Intron	INS	-	A	A	rs35145118		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90617221_90617222insA	uc002bov.1	+							NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			gagtctgtctcaaaaaaaaaac	0.223													9	7	---	---	---	---	
CLEC16A	23274	broad.mit.edu	37	16	11071363	11071363	+	Intron	DEL	T	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11071363delT	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A											ovary(1)|central_nervous_system(1)	2						AGGACTGAGGttttttttttg	0.308													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15081850	15081852	+	Intron	DEL	TTT	-	-	rs112580671		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15081850_15081852delTTT	uc002dda.3	+						PDXDC1_uc010uzl.1_Intron|PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TATACAATTCTTTTTTTTTTTTT	0.305													3	3	---	---	---	---	
MYH11	4629	broad.mit.edu	37	16	15829034	15829034	+	Intron	DEL	A	-	-	rs34752846		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15829034delA	uc002ddy.2	-						MYH11_uc002ddv.2_Intron|MYH11_uc002ddw.2_Intron|MYH11_uc002ddx.2_Intron|MYH11_uc010bvg.2_Intron	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform						axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						agactgcctcaaaaaaaaaaa	0.179			T	CBFB	AML								4	4	---	---	---	---	
GGA2	23062	broad.mit.edu	37	16	23498305	23498306	+	Intron	INS	-	TTT	TTT	rs116219854		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23498305_23498306insTTT	uc002dlq.2	-						GGA2_uc010bxo.1_Intron	NM_015044	NP_055859	Q9UJY4	GGA2_HUMAN	ADP-ribosylation factor binding protein 2						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|clathrin-coated vesicle|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.0386)		cttttctgttgttttttttttt	0.030													6	3	---	---	---	---	
GPT2	84706	broad.mit.edu	37	16	46950266	46950267	+	Intron	INS	-	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46950266_46950267insA	uc002eel.2	+						GPT2_uc002eem.2_Intron	NM_133443	NP_597700	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase 2 isoform 1						2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	tcaaaaaaattaaaaaaaaaaa	0.252													4	2	---	---	---	---	
RPH3AL	9501	broad.mit.edu	37	17	165325	165325	+	Intron	DEL	T	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:165325delT	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		GTCCCTGTGCTCCCACCTCCA	0.577													4	2	---	---	---	---	
TRPV3	162514	broad.mit.edu	37	17	3427188	3427189	+	Intron	DEL	AC	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3427188_3427189delAC	uc002fvt.1	-						TRPV3_uc002fvs.1_Intron|TRPV3_uc010vrh.1_Intron|TRPV3_uc010vri.1_Intron|TRPV3_uc010vrj.1_Intron|TRPV3_uc010vrk.1_Intron|TRPV3_uc010vrl.1_Intron|TRPV3_uc010vrm.1_Intron|TRPV3_uc002fvr.2_Intron|TRPV3_uc002fvu.2_Intron|TRPV3_uc010vrn.1_Intron	NM_145068	NP_659505	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(4)	4					Menthol(DB00825)	tattccacctacacacacacac	0.104													4	2	---	---	---	---	
CAMTA2	23125	broad.mit.edu	37	17	4882803	4882804	+	Intron	INS	-	A	A	rs5819002		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4882803_4882804insA	uc002gah.1	-						CAMTA2_uc010cku.1_Intron|CAMTA2_uc002gag.1_Intron|CAMTA2_uc002gai.1_Intron|CAMTA2_uc010ckv.1_Intron	NM_015099	NP_055914	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2						cardiac muscle hypertrophy in response to stress|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	calmodulin binding|chromatin binding|histone deacetylase binding|transcription factor binding			ovary(1)	1						gaaactgtctcaaaaaaaaaaa	0.168													4	3	---	---	---	---	
GAS7	8522	broad.mit.edu	37	17	9837542	9837542	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9837542delC	uc002gmg.1	-	9	987	c.826delG	c.(826-828)GCCfs	p.A276fs	GAS7_uc010vvc.1_Frame_Shift_Del_p.A90fs|GAS7_uc002gmh.1_Frame_Shift_Del_p.A136fs|GAS7_uc010vvd.1_Frame_Shift_Del_p.A228fs|GAS7_uc002gmi.2_Frame_Shift_Del_p.A212fs|GAS7_uc002gmj.1_Frame_Shift_Del_p.A216fs|GAS7_uc010coh.1_Frame_Shift_Del_p.A216fs	NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c	276	FCH.				cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						TTCACCTGGGCCCACGCCTCT	0.577			T	MLL	AML*								57	29	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20446724	20446724	+	5'Flank	DEL	C	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20446724delC	uc002gxg.2	+						uc010vzj.1_5'Flank					DQ584075																		GGTTGCTGGTCCGGGGCACTC	0.592													20	36	---	---	---	---	
FLJ36000	284124	broad.mit.edu	37	17	21904445	21904446	+	Intron	DEL	TG	-	-	rs111648393		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21904445_21904446delTG	uc002gza.2	+							NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						TCTTTCCCTCtgtgtgtgtgtg	0.455													3	3	---	---	---	---	
MYO19	80179	broad.mit.edu	37	17	34855111	34855111	+	Intron	DEL	T	-	-	rs111268012		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34855111delT	uc010wcy.1	-						MYO19_uc002hmw.2_Intron|MYO19_uc010cuu.2_Intron|ZNHIT3_uc010cut.1_RNA	NM_001163735	NP_001157207	Q96H55	MYO19_HUMAN	myosin XIX isoform 2							mitochondrial outer membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)	1		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TTCAAATACGTTTTTTTTTTT	0.378													4	2	---	---	---	---	
APPBP2	10513	broad.mit.edu	37	17	58539019	58539019	+	Intron	DEL	A	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58539019delA	uc002iys.1	-						APPBP2_uc010ddl.1_Intron	NM_006380	NP_006371	Q92624	APBP2_HUMAN	amyloid beta precursor protein-binding protein						intracellular protein transport	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|nucleus	microtubule motor activity|protein binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			TACACCTTCTAGGTAATACTT	0.333													6	3	---	---	---	---	
TBX2	6909	broad.mit.edu	37	17	59482166	59482166	+	Intron	DEL	C	-	-	rs66504335		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59482166delC	uc010wox.1	+						TBX2_uc002ize.2_Frame_Shift_Del_p.R353fs|TBX2_uc002izg.2_Intron	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						AGGGAGGTGGCGGCGGGGGGT	0.706													4	3	---	---	---	---	
SCN4A	6329	broad.mit.edu	37	17	62043429	62043435	+	Intron	DEL	TAGGGTT	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62043429_62043435delTAGGGTT	uc002jds.1	-							NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha						muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	GGAGTGGCTGTAGGGTTGGGGGGCAGG	0.628													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70313863	70313864	+	IGR	DEL	AC	-	-	rs34367034		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70313863_70313864delAC								SOX9 (191311 upstream) : SLC39A11 (328222 downstream)																							TCCCTGCTAAacacacacacac	0.381													8	4	---	---	---	---	
RECQL5	9400	broad.mit.edu	37	17	73626918	73626919	+	Splice_Site	INS	-	TG	TG	rs142406301	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73626918_73626919insTG	uc010dgl.2	-	12	1742	c.1586_splice	c.e12-1	p.D529_splice	RECQL5_uc010dgk.2_Splice_Site_p.D502_splice|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1						DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CAGTTCTCATCTGTGGGGGGGG	0.644								Other_identified_genes_with_known_or_suspected_DNA_repair_function					9	7	---	---	---	---	
ZNF271	10778	broad.mit.edu	37	18	32886765	32886765	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32886765delG	uc002kyq.3	+	3	1169	c.177delG	c.(175-177)GTGfs	p.V59fs	ZNF271_uc002kyp.3_Frame_Shift_Del_p.V59fs|ZNF271_uc002kyr.3_Frame_Shift_Del_p.V59fs	NR_024565				SubName: Full=cDNA FLJ13394 fis, clone PLACE1001304, highly similar to Homo sapiens zinc finger protein 271 (ZNF271), mRNA;												0						TAATGAGTGTGGGAAAGCTTT	0.388													77	36	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	49539365	49539366	+	IGR	INS	-	TGTGTGTG	TGTGTGTG	rs140617102	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49539365_49539366insTGTGTGTG								MEX3C (815675 upstream) : DCC (327205 downstream)																							TGTGATTATGAtgtgtgtgtgt	0.327													4	3	---	---	---	---	
PIGN	23556	broad.mit.edu	37	18	59739963	59739963	+	Intron	DEL	A	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59739963delA	uc002lii.3	-						PIGN_uc002lij.3_Intron	NM_176787	NP_789744	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5		Colorectal(73;0.187)				AAAATGCTGTAAAAAAAAAAA	0.264													10	5	---	---	---	---	
ZFR2	23217	broad.mit.edu	37	19	3819298	3819299	+	Intron	INS	-	GGGCAGGT	GGGCAGGT	rs146619879	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3819298_3819299insGGGCAGGT	uc002lyw.2	-							NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1							intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GCTGGGCAGGCGGGCAGGTGGG	0.728													4	3	---	---	---	---	
UHRF1	29128	broad.mit.edu	37	19	4960949	4960950	+	3'UTR	DEL	TT	-	-	rs146145010		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4960949_4960950delTT	uc002mbo.2	+	19					UHRF1_uc010xik.1_RNA|UHRF1_uc010duf.2_RNA|UHRF1_uc002mbp.2_3'UTR	NM_001048201	NP_001041666	Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains						cell cycle|cell proliferation|DNA repair|regulation of transcription from RNA polymerase II promoter	nucleus	acid-amino acid ligase activity|methyl-CpG binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		TTTGTCTTCCttttttttttta	0.342													6	4	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13345563	13345564	+	Intron	INS	-	GCC	GCC	rs146596202	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13345563_13345564insGCC	uc010dze.2	-						CACNA1A_uc010xnd.1_Intron|CACNA1A_uc002mwx.3_Intron|CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc002mwv.3_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	CGGAAGAGAAGGGCACGCCCCC	0.614											OREG0025293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	3	---	---	---	---	
IL12RB1	3594	broad.mit.edu	37	19	18174949	18174949	+	Intron	DEL	T	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18174949delT	uc002nhw.1	-						IL12RB1_uc010xqb.1_Intron|IL12RB1_uc002nhx.1_Intron	NM_005535	NP_005526	P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1 isoform 1						cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1						tctttctttcttttttttttt	0.244													4	2	---	---	---	---	
ZNF790	388536	broad.mit.edu	37	19	37309182	37309184	+	3'UTR	DEL	CTG	-	-	rs142103405		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37309182_37309184delCTG	uc002oew.2	-	5					uc002oev.1_Intron	NM_206894	NP_996777	Q6PG37	ZN790_HUMAN	zinc finger protein 790						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|skin(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GATGAATTCTctgctgctgctgc	0.261													4	2	---	---	---	---	
DLL3	10683	broad.mit.edu	37	19	39994556	39994556	+	Intron	DEL	G	-	-			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39994556delG	uc002olx.2	+						DLL3_uc010egq.2_Intron|DLL3_uc002olw.2_Intron	NM_016941	NP_058637	Q9NYJ7	DLL3_HUMAN	delta-like 3 protein isoform 1 precursor						Notch signaling pathway|skeletal system development	integral to membrane	Notch binding			central_nervous_system(2)|breast(1)	3	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			ctgggggggcggtcacagtac	0.070													5	5	---	---	---	---	
HSPBP1	23640	broad.mit.edu	37	19	55777911	55777912	+	Intron	INS	-	C	C			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55777911_55777912insC	uc002qjx.2	-						HSPBP1_uc002qjy.2_Intron|HSPBP1_uc002qkb.2_Intron|HSPBP1_uc002qka.2_Intron|HSPBP1_uc002qkd.2_Intron|HSPBP1_uc002qkc.2_Intron|uc002qke.2_5'Flank	NM_012267	NP_036399	Q9NZL4	HPBP1_HUMAN	hsp70-interacting protein						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		catcaccatgacatcaccaaca	0.030													3	3	---	---	---	---	
CABLES2	81928	broad.mit.edu	37	20	60972983	60972984	+	Intron	INS	-	GGTGGTGGTGATGGC	GGTGGTGGTGATGGC	rs146308567	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60972983_60972984insGGTGGTGGTGATGGC	uc002ycv.2	-							NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2						cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			gtggtgatggtggtggtggtga	0.168													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11144769	11144772	+	IGR	DEL	TGTC	-	-	rs55756166		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11144769_11144772delTGTC								BAGE (45832 upstream) : None (None downstream)																							GGGGTGGAtgtgtctgtgtgtgtg	0.373													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44756088	44756096	+	IGR	DEL	CACCACCAA	-	-	rs72268009	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44756088_44756096delCACCACCAA								CRYAA (163175 upstream) : SIK1 (78302 downstream)																							tcaccaccaccaccaccaacaccaccacc	0.000													2	4	---	---	---	---	
THOC5	8563	broad.mit.edu	37	22	29938752	29938753	+	Intron	INS	-	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29938752_29938753insA	uc003afr.2	-						THOC5_uc003afs.2_Intron|THOC5_uc003aft.2_Intron|THOC5_uc003afu.2_Intron|THOC5_uc010gvo.2_Intron|THOC5_uc003afv.1_Intron|THOC5_uc003afw.1_Intron	NM_001002878	NP_001002878	Q13769	THOC5_HUMAN	THO complex 5						intronless viral mRNA export from host nucleus|monocyte differentiation|mRNA processing|primitive hemopoiesis|RNA splicing	cytoplasm|intermediate filament cytoskeleton|THO complex part of transcription export complex	protein binding|RNA binding			breast(3)	3						gactccgtctcaaaaaaaaaaa	0.198													8	4	---	---	---	---	
DEPDC5	9681	broad.mit.edu	37	22	32180607	32180607	+	Intron	DEL	A	-	-	rs36118041		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32180607delA	uc003als.2	+						DEPDC5_uc011als.1_Intron|DEPDC5_uc011alu.1_Intron|DEPDC5_uc011alv.1_Intron|DEPDC5_uc003alt.2_Intron|DEPDC5_uc003alr.1_Intron|DEPDC5_uc011alt.1_Intron	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						ctcccatctcaaaaaaaaaaa	0.154													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34574209	34574210	+	IGR	INS	-	TTCC	TTCC	rs138260951	by1000genomes	TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34574209_34574210insTTCC								LARGE (255625 upstream) : ISX (887919 downstream)																							cccttccttctttccttccttc	0.000													2	5	---	---	---	---	
LGALS2	3957	broad.mit.edu	37	22	37967847	37967848	+	Intron	INS	-	T	T			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37967847_37967848insT	uc003ata.2	-							NM_006498	NP_006489	P05162	LEG2_HUMAN	lectin, galactoside-binding, soluble, 2											breast(1)|skin(1)	2	Melanoma(58;0.0574)					ACCCTGAAACCTTGCTCACCCA	0.619													133	87	---	---	---	---	
MEI1	150365	broad.mit.edu	37	22	42128781	42128781	+	Intron	DEL	T	-	-	rs34396284		TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42128781delT	uc003baz.1	+						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc003bay.3_Intron|MEI1_uc011apd.1_Intron	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2						gattgaaaaattttttttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	67696587	67696588	+	IGR	INS	-	A	A			TCGA-66-2800-01	TCGA-66-2800-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67696587_67696588insA								OPHN1 (43288 upstream) : YIPF6 (22298 downstream)																							gagactgtctcaaaaaaaaaaa	0.213													4	2	---	---	---	---	
