Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRDM2	7799	broad.mit.edu	37	1	14105511	14105511	+	Silent	SNP	A	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14105511A>C	uc001avi.2	+	8	2077	c.1221A>C	c.(1219-1221)CGA>CGC	p.R407R	PRDM2_uc001avg.2_Intron|PRDM2_uc001avh.2_Silent_p.R407R|PRDM2_uc001avj.2_Intron|PRDM2_uc009vod.1_Silent_p.R164R|PRDM2_uc001avk.2_Silent_p.R206R|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	NM_012231	NP_036363	Q13029	PRDM2_HUMAN	retinoblastoma protein-binding zinc finger	407	C2H2-type 2.					Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		ACCGGCGGCGACATGAGCGGC	0.512													23	31	---	---	---	---	PASS
RPRD2	23248	broad.mit.edu	37	1	150429919	150429919	+	Silent	SNP	A	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150429919A>T	uc009wlr.2	+	8	1227	c.1026A>T	c.(1024-1026)GGA>GGT	p.G342G	RPRD2_uc010pcc.1_Silent_p.G316G|RPRD2_uc001eup.3_Silent_p.G316G	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing	342							protein binding			ovary(1)	1						AGGGAATGGGAGGTGAGGAAT	0.512													108	244	---	---	---	---	PASS
ILF2	3608	broad.mit.edu	37	1	153635213	153635213	+	Missense_Mutation	SNP	C	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153635213C>G	uc001fcr.2	-	13	1061	c.980G>C	c.(979-981)AGG>ACG	p.R327T	ILF2_uc010pdy.1_Missense_Mutation_p.R289T|ILF2_uc009wok.2_Missense_Mutation_p.R305T	NM_004515	NP_004506	Q12905	ILF2_HUMAN	interleukin enhancer binding factor 2	327	DZF.				immune response|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|ribonucleoprotein complex	ATP binding|DNA binding|double-stranded RNA binding|protein binding|transferase activity				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAGGATCTTCCTAAAGCCACC	0.478													4	220	---	---	---	---	PASS
C1orf92	149499	broad.mit.edu	37	1	156897713	156897713	+	Missense_Mutation	SNP	C	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156897713C>G	uc001fqm.2	+	9	1085	c.913C>G	c.(913-915)CGC>GGC	p.R305G	C1orf92_uc001fql.2_Missense_Mutation_p.R90G	NM_144702	NP_653303	Q8N4P6	LRC71_HUMAN	hypothetical protein LOC149499	305											0	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCAGGTCCTGCGCGCCTTCGA	0.697											OREG0013892	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	24	---	---	---	---	PASS
PEX19	5824	broad.mit.edu	37	1	160252819	160252819	+	Silent	SNP	G	A	A	rs146644725	byFrequency	TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160252819G>A	uc001fvs.2	-	3	288	c.261C>T	c.(259-261)TTC>TTT	p.F87F	DCAF8_uc010pjc.1_5'UTR|PEX19_uc010pje.1_RNA|PEX19_uc001fvt.2_5'UTR	NM_002857	NP_002848	P40855	PEX19_HUMAN	peroxisomal biogenesis factor 19 isoform a	87	Necessary for PEX19 function on peroxisome biogenesis.				peroxisome membrane biogenesis|peroxisome organization|protein targeting to peroxisome|transmembrane transport	brush border membrane|cytosol|integral to membrane|nucleus|peroxisomal membrane	protein binding|protein N-terminus binding				0	all_cancers(52;1.27e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TTGCCTTCTCGAACTCCGCAG	0.567													4	144	---	---	---	---	PASS
PRDX6	9588	broad.mit.edu	37	1	173454500	173454500	+	Missense_Mutation	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173454500G>T	uc001giy.1	+	3	304	c.253G>T	c.(253-255)GAT>TAT	p.D85Y		NM_004905	NP_004896	P30041	PRDX6_HUMAN	peroxiredoxin 6	85	Thioredoxin.				cell redox homeostasis|phospholipid catabolic process	cytoplasmic membrane-bounded vesicle|cytosol|lysosome	peroxiredoxin activity|phospholipase A2 activity|protein binding			central_nervous_system(1)	1						TGTGTTTCAGGATATCAATGC	0.443													11	110	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175325553	175325553	+	Missense_Mutation	SNP	C	A	A	rs112059746	byFrequency	TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175325553C>A	uc001gkp.1	-	14	3101	c.3020G>T	c.(3019-3021)CGG>CTG	p.R1007L	TNR_uc009wwu.1_Missense_Mutation_p.R1007L	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	1007	Fibronectin type-III 8.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					GTCAACAAGCCGAAATTCCTC	0.473													107	60	---	---	---	---	PASS
NMNAT2	23057	broad.mit.edu	37	1	183253165	183253165	+	Missense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183253165G>A	uc001gqc.1	-	7	874	c.539C>T	c.(538-540)GCC>GTC	p.A180V	NMNAT2_uc001gqb.1_Missense_Mutation_p.A175V|NMNAT2_uc001gqd.2_Missense_Mutation_p.A75V	NM_015039	NP_055854	Q9BZQ4	NMNA2_HUMAN	nicotinamide mononucleotide adenylyltransferase	180					water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1						GCCCAGATTGGCATTCTCATC	0.527													37	156	---	---	---	---	PASS
FAM129A	116496	broad.mit.edu	37	1	184764867	184764867	+	Silent	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184764867C>T	uc001gra.2	-	14	2225	c.2031G>A	c.(2029-2031)CCG>CCA	p.P677P	FAM129A_uc001grb.1_Intron	NM_052966	NP_443198	Q9BZQ8	NIBAN_HUMAN	niban protein isoform 2	677					negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)|skin(1)	4						AGCATGTGCCCGGGAGTCCTG	0.577													31	71	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197073677	197073677	+	Silent	SNP	T	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197073677T>A	uc001gtu.2	-	18	4961	c.4704A>T	c.(4702-4704)TCA>TCT	p.S1568S	ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	1568					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						TTCTCCAGTATGACTGAATAA	0.358													17	56	---	---	---	---	PASS
HHIPL2	79802	broad.mit.edu	37	1	222721202	222721202	+	Missense_Mutation	SNP	G	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222721202G>C	uc001hnh.1	-	1	243	c.185C>G	c.(184-186)TCT>TGT	p.S62C		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	62					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		CTCATAGTCAGAGCAAAACTC	0.562													5	61	---	---	---	---	PASS
CAPN2	824	broad.mit.edu	37	1	223947191	223947191	+	Intron	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223947191G>A	uc001hob.3	+						CAPN2_uc010puy.1_Intron|CAPN2_uc001hoc.2_Intron	NM_001748	NP_001739	P17655	CAN2_HUMAN	calpain 2 isoform 1						proteolysis	cytoplasm|plasma membrane				lung(3)|breast(1)|skin(1)	5				GBM - Glioblastoma multiforme(131;0.109)		CCAGTAGGCGGTTTGGTCCCT	0.527													29	17	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1653341	1653341	+	Missense_Mutation	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1653341G>T	uc002qxa.2	-	17	2275	c.2211C>A	c.(2209-2211)TTC>TTA	p.F737L		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	737					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		ACTTCTGGTGGAAGCACATGT	0.612													19	180	---	---	---	---	PASS
RRM2	6241	broad.mit.edu	37	2	10267220	10267220	+	Missense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10267220G>A	uc002rah.2	+	7	862	c.671G>A	c.(670-672)CGT>CAT	p.R224H		NM_001034	NP_001025	P31350	RIR2_HUMAN	ribonucleotide reductase M2 polypeptide isoform	224					deoxyribonucleoside diphosphate metabolic process|deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol	ribonucleoside-diphosphate reductase activity|transition metal ion binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)		ATAGGTGAACGTGTTGTAGCC	0.423													93	153	---	---	---	---	PASS
ZNF513	130557	broad.mit.edu	37	2	27601720	27601720	+	Missense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27601720G>A	uc002rkk.2	-	3	613	c.413C>T	c.(412-414)CCG>CTG	p.P138L	ZNF513_uc002rkj.2_Missense_Mutation_p.P76L	NM_144631	NP_653232	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	138	Gly-rich.				regulation of transcription, DNA-dependent|response to stimulus|retina development in camera-type eye|transcription, DNA-dependent|visual perception	nucleus	transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCCCCACCCGGCCCTCCTGC	0.706													4	14	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33246095	33246095	+	Missense_Mutation	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33246095C>T	uc002ros.2	+	3	685	c.685C>T	c.(685-687)CCA>TCA	p.P229S		NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	229					negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CACCTCGTCACCAGTCTTTGG	0.552													108	156	---	---	---	---	PASS
PIGF	5281	broad.mit.edu	37	2	46842099	46842099	+	Missense_Mutation	SNP	T	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46842099T>C	uc002rvd.2	-	2	369	c.205A>G	c.(205-207)AAA>GAA	p.K69E	PIGF_uc002rvc.2_Missense_Mutation_p.K69E|CRIPT_uc002rve.2_5'Flank	NM_002643	NP_002634	Q07326	PIGF_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	69					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	ethanolaminephosphotransferase activity				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			GAACTTCTTTTAGAGGATGTA	0.328													32	27	---	---	---	---	PASS
FOXN2	3344	broad.mit.edu	37	2	48602579	48602579	+	Silent	SNP	A	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48602579A>G	uc002rwh.1	+	7	1608	c.1293A>G	c.(1291-1293)AAA>AAG	p.K431K		NM_002158	NP_002149	P32314	FOXN2_HUMAN	T-cell leukemia virus enhancer factor	431					embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			AACGGAAAAAATAGAAATACT	0.378													14	8	---	---	---	---	PASS
FSHR	2492	broad.mit.edu	37	2	49295406	49295406	+	Missense_Mutation	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49295406C>T	uc002rww.2	-	2	250	c.176G>A	c.(175-177)CGA>CAA	p.R59Q	FSHR_uc002rwx.2_Missense_Mutation_p.R59Q|FSHR_uc010fbn.2_Missense_Mutation_p.R59Q|FSHR_uc010fbo.1_RNA	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1	59	Extracellular (Potential).|LRR 1.				female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	TTGGATGACTCGAAGCTTGGT	0.418									Gonadal_Dysgenesis_46_XX				92	109	---	---	---	---	PASS
KIAA1841	84542	broad.mit.edu	37	2	61333753	61333753	+	Missense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61333753G>A	uc002saw.3	+	14	1870	c.1567G>A	c.(1567-1569)GAG>AAG	p.E523K	KIAA1841_uc002sax.3_Missense_Mutation_p.E377K|KIAA1841_uc002say.2_Missense_Mutation_p.E523K	NM_001129993	NP_001123465	Q6NSI8	K1841_HUMAN	KIAA1841 protein isoform a	523											0			Epithelial(17;0.193)			TGTTTTACTGGAGCCAAATAC	0.348													148	173	---	---	---	---	PASS
DCTN1	1639	broad.mit.edu	37	2	74605229	74605229	+	Silent	SNP	G	A	A	rs72466484		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74605229G>A	uc002skx.2	-	2	488	c.177C>T	c.(175-177)GGC>GGT	p.G59G	DCTN1_uc002skw.1_Silent_p.G42G|DCTN1_uc010ffd.2_Silent_p.G59G|DCTN1_uc002sky.2_Silent_p.G42G	NM_004082	NP_004073	Q14203	DCTN1_HUMAN	dynactin 1 isoform 1	59	CAP-Gly.		G -> S (in HMN7B; shows a modestly reduced affinity for microtubules which has been suggested to impair axonal transport; the effect is identical to that of complete loss of the CAP-Gly domain).		cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding			ovary(3)|skin(2)	5						CCAGAATCACGCCTACCCATT	0.537													73	76	---	---	---	---	PASS
C2orf55	343990	broad.mit.edu	37	2	99438711	99438711	+	Silent	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99438711C>A	uc002szf.1	-	7	2319	c.2025G>T	c.(2023-2025)CCG>CCT	p.P675P		NM_207362	NP_997245	Q6NV74	CB055_HUMAN	hypothetical protein LOC343990	675											0						TGTCCTCACTCGGGGCCGGCT	0.711													17	26	---	---	---	---	PASS
BUB1	699	broad.mit.edu	37	2	111399373	111399373	+	Missense_Mutation	SNP	T	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111399373T>G	uc002tgc.2	-	21	2583	c.2471A>C	c.(2470-2472)AAG>ACG	p.K824T	BUB1_uc010yxh.1_Missense_Mutation_p.K804T|BUB1_uc010fkb.2_Missense_Mutation_p.K824T	NM_004336	NP_004327	O43683	BUB1_HUMAN	budding uninhibited by benzimidazoles 1	824	Protein kinase.				apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		GTTGGCAGGCTTTTGGACCTG	0.403													66	245	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168102627	168102627	+	Missense_Mutation	SNP	T	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168102627T>A	uc002udx.2	+	8	4743	c.4725T>A	c.(4723-4725)GAT>GAA	p.D1575E	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.D1400E|XIRP2_uc010fpq.2_Missense_Mutation_p.D1353E|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1400					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TTGAAGCTGATGAAATAGGGG	0.358													18	57	---	---	---	---	PASS
MIR10B	406903	broad.mit.edu	37	2	177015104	177015104	+	RNA	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177015104G>A	hsa-mir-10b|MI0000267	+			c.74G>A			uc010zey.1_RNA|HOXD4_uc002uks.2_5'Flank																	0						TCACAGATTCGATTCTAGGGG	0.478													15	41	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179528601	179528601	+	Silent	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179528601G>A	uc010zfk.1	-	15	1379	c.831C>T	c.(829-831)CGC>CGT	p.R277R	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron			Q8WZ42	TITIN_HUMAN	SubName: Full=Titin; Flags: Fragment;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTCTCTTCGCGGATAACCT	0.423													79	319	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185801424	185801424	+	Missense_Mutation	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185801424C>A	uc002uph.2	+	4	1895	c.1301C>A	c.(1300-1302)TCT>TAT	p.S434Y		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	434						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						AAACACAGATCTACAGTTCTT	0.353													103	137	---	---	---	---	PASS
PPIL3	53938	broad.mit.edu	37	2	201746158	201746158	+	Missense_Mutation	SNP	T	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201746158T>A	uc002uwh.2	-	5	467	c.226A>T	c.(226-228)AGT>TGT	p.S76C	PPIL3_uc002uwi.2_Missense_Mutation_p.S80C|PPIL3_uc002uwj.2_Silent_p.T44T|PPIL3_uc002uwk.2_Missense_Mutation_p.S76C	NM_130906	NP_570981	Q9H2H8	PPIL3_HUMAN	peptidylprolyl isomerase-like 3 isoform PPIL3b	76	PPIase cyclophilin-type.				protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity|protein binding				0						AGATATTCACTGTATTCATCC	0.333													144	38	---	---	---	---	PASS
PTH2R	5746	broad.mit.edu	37	2	209292980	209292980	+	Missense_Mutation	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209292980G>T	uc002vdb.2	+	2	343	c.130G>T	c.(130-132)GCG>TCG	p.A44S	PTH2R_uc010zjb.1_Missense_Mutation_p.A55S	NM_005048	NP_005039	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor precursor	44	Extracellular (Potential).					integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		TGTGCTGAAAGCGAAAGTACA	0.403													3	47	---	---	---	---	PASS
CUL3	8452	broad.mit.edu	37	2	225365207	225365207	+	Intron	SNP	A	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225365207A>T	uc002vny.2	-						CUL3_uc010zls.1_Intron|CUL3_uc010fwy.1_Intron|CUL3_uc002vnz.1_5'Flank	NM_003590	NP_003581	Q13618	CUL3_HUMAN	cullin 3						cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		AAAGATACCTATGTAAAACAG	0.433													46	6	---	---	---	---	PASS
ALCAM	214	broad.mit.edu	37	3	105250904	105250904	+	Silent	SNP	A	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105250904A>G	uc003dvx.2	+	4	993	c.453A>G	c.(451-453)CTA>CTG	p.L151L	ALCAM_uc003dvw.1_Silent_p.L151L|ALCAM_uc003dvy.2_Silent_p.L151L|ALCAM_uc011bhh.1_Silent_p.L100L|ALCAM_uc010hpp.2_5'Flank	NM_001627	NP_001618	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	151	Extracellular (Potential).|Ig-like V-type 2.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(2)|breast(1)	3						CAGAGCAGCTAAAAAAGGTAA	0.343													109	26	---	---	---	---	PASS
LRRC58	116064	broad.mit.edu	37	3	120053955	120053955	+	Missense_Mutation	SNP	T	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120053955T>A	uc003edr.2	-	3	757	c.661A>T	c.(661-663)AAT>TAT	p.N221Y		NM_001099678	NP_001093148	Q96CX6	LRC58_HUMAN	leucine rich repeat containing 58	221	LRR 8.										0				GBM - Glioblastoma multiforme(114;0.147)		AGCAAGTTATTGTGAAGACTT	0.343													60	13	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164735558	164735558	+	Missense_Mutation	SNP	T	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164735558T>A	uc003fei.2	-	30	3686	c.3624A>T	c.(3622-3624)CAA>CAT	p.Q1208H		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1208	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	CTTCATGGTATTGCTTTGTTG	0.313										HNSCC(35;0.089)			15	72	---	---	---	---	PASS
PDCD10	11235	broad.mit.edu	37	3	167402119	167402119	+	Missense_Mutation	SNP	G	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167402119G>C	uc003fex.2	-	9	1014	c.616C>G	c.(616-618)CAG>GAG	p.Q206E	PDCD10_uc003fez.2_Missense_Mutation_p.Q206E|PDCD10_uc003fey.2_Missense_Mutation_p.Q206E	NM_007217	NP_009148	Q9BUL8	PDC10_HUMAN	programmed cell death 10	206					angiogenesis|apoptosis|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of MAP kinase activity	cytosol|Golgi membrane|plasma membrane	protein homodimerization activity|protein N-terminus binding			lung(1)|central_nervous_system(1)	2						TTGAAGGTCTGAAGTATTAAG	0.328									Familial_Cerebral_Cavernous_Angioma				9	266	---	---	---	---	PASS
MIR551B	693136	broad.mit.edu	37	3	168269673	168269673	+	RNA	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168269673G>A	hsa-mir-551b|MI0003575	+			c.32G>A																				0						GAAATCAAGCGTGGGTGAGAC	0.463													12	197	---	---	---	---	PASS
MECOM	2122	broad.mit.edu	37	3	168834261	168834261	+	Missense_Mutation	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168834261C>A	uc003ffi.3	-	7	1104	c.835G>T	c.(835-837)GCT>TCT	p.A279S	MECOM_uc010hwk.1_Missense_Mutation_p.A302S|MECOM_uc003ffj.3_Missense_Mutation_p.A344S|MECOM_uc011bpi.1_Missense_Mutation_p.A280S|MECOM_uc003ffn.3_Missense_Mutation_p.A279S|MECOM_uc003ffk.2_Missense_Mutation_p.A279S|MECOM_uc003ffl.2_Missense_Mutation_p.A439S|MECOM_uc011bpj.1_Missense_Mutation_p.A467S|MECOM_uc011bpk.1_Missense_Mutation_p.A269S|MECOM_uc010hwn.2_Missense_Mutation_p.A467S	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	279					apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						AAATAGTCAGCAAGGCCCGGG	0.493													36	135	---	---	---	---	PASS
TNIK	23043	broad.mit.edu	37	3	170843789	170843789	+	Missense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170843789G>A	uc003fhh.2	-	17	2270	c.1925C>T	c.(1924-1926)CCC>CTC	p.P642L	TNIK_uc003fhi.2_Missense_Mutation_p.P587L|TNIK_uc003fhj.2_Missense_Mutation_p.P613L|TNIK_uc003fhk.2_Missense_Mutation_p.P642L|TNIK_uc003fhl.2_Missense_Mutation_p.P558L|TNIK_uc003fhm.2_Missense_Mutation_p.P587L|TNIK_uc003fhn.2_Missense_Mutation_p.P613L|TNIK_uc003fho.2_Missense_Mutation_p.P558L	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1	642	Mediates interaction with NEDD4.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			TTCCGAGGTGGGATCTGAGTT	0.532													12	214	---	---	---	---	PASS
UNC5C	8633	broad.mit.edu	37	4	96104068	96104068	+	Missense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96104068G>A	uc003htp.1	-	14	2585	c.2431C>T	c.(2431-2433)CTC>TTC	p.L811F		NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor	811	Cytoplasmic (Potential).				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		GTGCAGTTGAGCTGGAAGATC	0.527													39	53	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113539801	113539801	+	Missense_Mutation	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113539801C>A	uc003iau.2	-	6	1608	c.1397G>T	c.(1396-1398)GGA>GTA	p.G466V	C4orf21_uc003iaw.2_Missense_Mutation_p.G466V	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	Error:Variant_position_missing_in_Q6ZU11_after_alignment						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TTCCAGTGTTCCACATGTATT	0.338													75	18	---	---	---	---	PASS
GUCY1A3	2982	broad.mit.edu	37	4	156651263	156651263	+	Silent	SNP	C	T	T	rs150400396		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156651263C>T	uc003iov.2	+	11	2489	c.1953C>T	c.(1951-1953)CCC>CCT	p.P651P	GUCY1A3_uc003iow.2_Silent_p.P651P|GUCY1A3_uc010iqd.2_Silent_p.P650P|GUCY1A3_uc003iox.2_Silent_p.P651P|GUCY1A3_uc003ioz.2_Silent_p.P416P|GUCY1A3_uc003ioy.2_Silent_p.P651P|GUCY1A3_uc010iqe.2_Silent_p.P416P|GUCY1A3_uc003ipa.2_RNA|GUCY1A3_uc003ipb.2_Silent_p.P651P	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A	651					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GTGAAATCCCCGGAATCTGCC	0.403													74	11	---	---	---	---	PASS
NKD2	85409	broad.mit.edu	37	5	1037916	1037916	+	Intron	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1037916G>A	uc003jbt.1	+						NKD2_uc010itf.1_Intron	NM_033120	NP_149111	Q969F2	NKD2_HUMAN	naked cuticle homolog 2						exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding				0	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			ACCTGTGTCCGCAGGGTCCCC	0.672													34	36	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41017993	41017993	+	Missense_Mutation	SNP	T	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41017993T>C	uc003jmj.3	-	28	3333	c.2843A>G	c.(2842-2844)CAG>CGG	p.Q948R	HEATR7B2_uc003jmi.3_Missense_Mutation_p.Q503R	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	948							binding			ovary(6)|central_nervous_system(2)	8						AGCAGCCGCCTGACGGATGGT	0.468													12	3	---	---	---	---	PASS
TRIM23	373	broad.mit.edu	37	5	64905275	64905275	+	Missense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64905275G>A	uc003jty.2	-	6	925	c.839C>T	c.(838-840)ACT>ATT	p.T280I	TRIM23_uc003jtw.2_Missense_Mutation_p.T280I|TRIM23_uc003jtx.2_Missense_Mutation_p.T280I	NM_001656	NP_001647	P36406	TRI23_HUMAN	ADP-ribosylation factor domain protein 1 isoform	280					interspecies interaction between organisms|small GTPase mediated signal transduction	Golgi membrane|lysosomal membrane	enzyme activator activity|GDP binding|GTP binding|GTPase activity|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|lung(1)	4		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		ATTCTCTGCAGTCCCTGGTAC	0.299													15	17	---	---	---	---	PASS
RASGRF2	5924	broad.mit.edu	37	5	80515598	80515598	+	Splice_Site	SNP	G	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80515598G>C	uc003kha.1	+	26	3621	c.3621_splice	c.e26+1	p.K1207_splice	RNU5E_uc011cto.1_Intron|RASGRF2_uc011ctn.1_Splice_Site	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TCAGCCAAAGGTAATATTATG	0.219													11	17	---	---	---	---	PASS
PCSK1	5122	broad.mit.edu	37	5	95748167	95748167	+	Missense_Mutation	SNP	G	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95748167G>C	uc003kls.1	-	7	943	c.737C>G	c.(736-738)ACG>AGG	p.T246R	PCSK1_uc010jbi.1_Missense_Mutation_p.T7R	NM_000439	NP_000430	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	246	Catalytic.				cell-cell signaling|cellular nitrogen compound metabolic process|energy reserve metabolic process|hormone biosynthetic process|peptide biosynthetic process|peptide hormone processing|regulation of insulin secretion	extracellular space|stored secretory granule|transport vesicle	serine-type endopeptidase activity			ovary(2)	2		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AATAGCATCCGTCACAATGCC	0.438													19	15	---	---	---	---	PASS
ACSL6	23305	broad.mit.edu	37	5	131310653	131310653	+	Intron	SNP	A	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131310653A>C	uc010jdo.1	-						ACSL6_uc003kvv.1_Intron|ACSL6_uc003kvx.1_Intron|ACSL6_uc003kvy.1_Missense_Mutation_p.F334C|ACSL6_uc003kwb.2_Intron|ACSL6_uc003kvz.1_Intron|ACSL6_uc003kwa.1_Missense_Mutation_p.F320C|ACSL6_uc003kvw.1_5'Flank|ACSL6_uc010jdn.1_Missense_Mutation_p.F324C|ACSL6_uc010jdp.1_Intron	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTGTCTCGGAAAGATCACTTT	0.493													14	7	---	---	---	---	PASS
PCDHA8	56140	broad.mit.edu	37	5	140221314	140221314	+	Silent	SNP	A	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140221314A>G	uc003lhs.2	+	1	408	c.408A>G	c.(406-408)AAA>AAG	p.K136K	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Silent_p.K136K	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	136	Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCGGGTAAAAGACCAAAAGC	0.532													42	61	---	---	---	---	PASS
PCDHGB6	56100	broad.mit.edu	37	5	140788883	140788883	+	Silent	SNP	C	A	A	rs114361948	by1000genomes	TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140788883C>A	uc003lkj.1	+	1	1114	c.1114C>A	c.(1114-1116)CGG>AGG	p.R372R	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lki.1_Silent_p.R372R	NM_018926	NP_061749	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6 isoform 1	372	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTCAAAACACGGGATCTGGA	0.393													14	20	---	---	---	---	PASS
SLC6A7	6534	broad.mit.edu	37	5	149584177	149584177	+	Missense_Mutation	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149584177C>T	uc003lrr.2	+	11	1786	c.1415C>T	c.(1414-1416)GCC>GTC	p.A472V		NM_014228	NP_055043	Q99884	SC6A7_HUMAN	solute carrier family 6, member 7	472	Helical; Name=10; (Potential).					integral to plasma membrane|membrane fraction	neurotransmitter:sodium symporter activity|proline:sodium symporter activity				0		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Proline(DB00172)	ACGTGCCTTGCCGTGACACGG	0.592													3	51	---	---	---	---	PASS
TCOF1	6949	broad.mit.edu	37	5	149740740	149740740	+	Missense_Mutation	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149740740G>T	uc003lry.2	+	2	238	c.130G>T	c.(130-132)GTA>TTA	p.V44L	TCOF1_uc003lrw.2_Missense_Mutation_p.V44L|TCOF1_uc011dch.1_Missense_Mutation_p.V44L|TCOF1_uc003lrz.2_Missense_Mutation_p.V44L|TCOF1_uc003lrx.2_Missense_Mutation_p.V44L|TCOF1_uc003lsa.2_Missense_Mutation_p.V44L	NM_001135243	NP_001128715	Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	44					skeletal system development	nucleolus	protein binding|transporter activity			ovary(2)|large_intestine(1)	3		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGCTCAGCCCGTAACCCTTCT	0.517													31	41	---	---	---	---	PASS
FAM71B	153745	broad.mit.edu	37	5	156592796	156592796	+	Silent	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156592796C>A	uc003lwn.2	-	1	484	c.384G>T	c.(382-384)GTG>GTT	p.V128V		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	128						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGGAGATCTTCACAAATTTCA	0.537													22	36	---	---	---	---	PASS
CYFIP2	26999	broad.mit.edu	37	5	156747731	156747731	+	Missense_Mutation	SNP	G	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156747731G>C	uc003lwq.2	+	17	1730	c.1592G>C	c.(1591-1593)TGC>TCC	p.C531S	CYFIP2_uc011ddn.1_Missense_Mutation_p.C505S|CYFIP2_uc011ddo.1_Missense_Mutation_p.C335S|CYFIP2_uc003lwr.2_Missense_Mutation_p.C531S|CYFIP2_uc003lws.2_Missense_Mutation_p.C531S|CYFIP2_uc003lwt.2_Missense_Mutation_p.C409S|CYFIP2_uc011ddp.1_Missense_Mutation_p.C265S	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2	531					apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AATGACCCATGCTTGAGAGGG	0.582													18	24	---	---	---	---	PASS
GABRA6	2559	broad.mit.edu	37	5	161116353	161116353	+	Intron	SNP	A	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161116353A>G	uc003lyu.2	+						GABRA6_uc003lyv.2_5'Flank	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	GTAAGTTACAACAGGCTTCTG	0.383										TCGA Ovarian(5;0.080)			23	46	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168096991	168096991	+	Missense_Mutation	SNP	T	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168096991T>A	uc003mab.2	-	35	4553	c.4133A>T	c.(4132-4134)CAC>CTC	p.H1378L	SLIT3_uc010jjg.2_Missense_Mutation_p.H1385L	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	1378	EGF-like 8.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTTTCCATGGTGGCATCTAGG	0.577													19	17	---	---	---	---	PASS
TRIM7	81786	broad.mit.edu	37	5	180625213	180625213	+	Missense_Mutation	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180625213G>T	uc003mmz.1	-	6	1061	c.994C>A	c.(994-996)CTT>ATT	p.L332I	TRIM7_uc003mmv.1_Missense_Mutation_p.L150I|TRIM7_uc003mmw.1_Missense_Mutation_p.L124I|TRIM7_uc003mmx.1_Missense_Mutation_p.L124I|TRIM7_uc003mmy.1_Missense_Mutation_p.L124I	NM_203293	NP_976038	Q9C029	TRIM7_HUMAN	tripartite motif-containing 7 isoform 1	332	B30.2/SPRY.					cytoplasm|nucleus	zinc ion binding			ovary(2)|skin(1)	3	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		TCTCCCCGAAGGTCCTCTGAG	0.522													11	16	---	---	---	---	PASS
UHRF1BP1	54887	broad.mit.edu	37	6	34838857	34838857	+	Missense_Mutation	SNP	G	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34838857G>C	uc003oju.3	+	18	4179	c.3945G>C	c.(3943-3945)ATG>ATC	p.M1315I	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	1315										ovary(3)	3						TAGTCCCCATGCAGATTGAGC	0.512													160	8	---	---	---	---	PASS
CRISP3	10321	broad.mit.edu	37	6	49696477	49696477	+	Missense_Mutation	SNP	T	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49696477T>A	uc003ozs.2	-	8	719	c.704A>T	c.(703-705)AAG>ATG	p.K235M		NM_006061	NP_006052	P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3 precursor	235					innate immune response	proteinaceous extracellular matrix|specific granule				skin(2)	2	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			GCAGGAGGCCTTGCAACTGTC	0.403													195	8	---	---	---	---	PASS
KIAA1009	22832	broad.mit.edu	37	6	84865079	84865079	+	Missense_Mutation	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84865079C>T	uc010kbp.2	-	22	3029	c.2932G>A	c.(2932-2934)GGC>AGC	p.G978S	KIAA1009_uc003pkj.3_Missense_Mutation_p.G902S|KIAA1009_uc003pki.3_Missense_Mutation_p.G364S	NM_014895	NP_055710	Q5TB80	QN1_HUMAN	KIAA1009 protein	978	Potential.				cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding			ovary(1)	1		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		TCATCTTTGCCCTCCAGATCA	0.393													28	206	---	---	---	---	PASS
FYN	2534	broad.mit.edu	37	6	111995783	111995783	+	Missense_Mutation	SNP	T	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111995783T>C	uc003pvj.2	-	12	1664	c.1324A>G	c.(1324-1326)AGG>GGG	p.R442G	FYN_uc003pvi.2_Missense_Mutation_p.R387G|FYN_uc003pvk.2_Missense_Mutation_p.R442G|FYN_uc003pvh.2_Missense_Mutation_p.R439G	NM_002037	NP_002028	P06241	FYN_HUMAN	protein-tyrosine kinase fyn isoform a	442	Protein kinase.				axon guidance|calcium ion transport|feeding behavior|interspecies interaction between organisms|intracellular protein kinase cascade|learning|leukocyte migration|platelet activation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|endosome|plasma membrane	ATP binding|glycoprotein binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|central_nervous_system(1)|skin(1)	7		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	ATTGTGAACCTCCCGTACAGG	0.537													102	16	---	---	---	---	PASS
PDE7B	27115	broad.mit.edu	37	6	136468511	136468511	+	Silent	SNP	T	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136468511T>C	uc003qgp.2	+	4	492	c.189T>C	c.(187-189)ATT>ATC	p.I63I	uc003qgq.1_Intron|PDE7B_uc003qgr.2_Silent_p.I115I	NM_018945	NP_061818	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B	63					signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)	CAGGGGAGATTGGCACCAAGA	0.388													80	12	---	---	---	---	PASS
FOXK1	221937	broad.mit.edu	37	7	4798980	4798980	+	Missense_Mutation	SNP	C	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4798980C>G	uc003snc.1	+	7	1460	c.1450C>G	c.(1450-1452)CCT>GCT	p.P484A	FOXK1_uc003sna.1_Missense_Mutation_p.P321A	NM_001037165	NP_001032242	P85037	FOXK1_HUMAN	forkhead box K1	484					cell differentiation|embryo development|muscle organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			upper_aerodigestive_tract(1)|skin(1)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		CATGGCCGTGCCTCCCCGACC	0.677													5	7	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31855724	31855724	+	Missense_Mutation	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31855724C>A	uc003tcm.1	-	15	2096	c.1627G>T	c.(1627-1629)GCA>TCA	p.A543S	PDE1C_uc003tcn.1_Missense_Mutation_p.A543S|PDE1C_uc003tco.1_Missense_Mutation_p.A603S|PDE1C_uc003tcr.2_Missense_Mutation_p.A543S|PDE1C_uc003tcs.2_Missense_Mutation_p.A543S	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	543					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			TGCTCCTCTGCGGCCAGGCGA	0.502													40	79	---	---	---	---	PASS
PSPH	5723	broad.mit.edu	37	7	56085002	56085002	+	Missense_Mutation	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56085002C>T	uc003trg.2	-	5	709	c.346G>A	c.(346-348)GTA>ATA	p.V116I	PSPH_uc003trh.2_Missense_Mutation_p.V116I|PSPH_uc003tri.2_Missense_Mutation_p.V116I|PSPH_uc003trj.2_Missense_Mutation_p.V145I	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase	116					L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACATGCTCTACAATACTCCTA	0.393													4	86	---	---	---	---	PASS
ZNF117	51351	broad.mit.edu	37	7	64452696	64452696	+	5'Flank	SNP	G	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64452696G>C	uc003ttr.2	-						ZNF117_uc011kdr.1_Missense_Mutation_p.L234V	NM_015852	NP_056936	Q03924	ZN117_HUMAN	zinc finger protein 117							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Lung NSC(55;0.0295)|all_lung(88;0.0691)				atgatatatagatagacatag	0.000													48	249	---	---	---	---	PASS
CDHR3	222256	broad.mit.edu	37	7	105671280	105671280	+	Missense_Mutation	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105671280G>T	uc003vdl.3	+	18	2455	c.2347G>T	c.(2347-2349)GAT>TAT	p.D783Y	CDHR3_uc003vdk.2_3'UTR|CDHR3_uc003vdm.3_Missense_Mutation_p.D770Y|CDHR3_uc011klt.1_Missense_Mutation_p.D695Y|CDHR3_uc003vdn.2_3'UTR	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor	783	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						AGAAGCCATAGATCCAGGTAA	0.408													6	40	---	---	---	---	PASS
IQUB	154865	broad.mit.edu	37	7	123142697	123142697	+	Missense_Mutation	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123142697C>T	uc003vkn.2	-	6	1554	c.977G>A	c.(976-978)GGA>GAA	p.G326E	IQUB_uc003vko.2_Missense_Mutation_p.G326E|IQUB_uc010lkt.2_RNA|IQUB_uc003vkp.1_Missense_Mutation_p.G326E|IQUB_uc003vkq.2_3'UTR	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	326										ovary(3)|large_intestine(1)	4						AAAATACTTTCCTGGTGTTAC	0.328													23	57	---	---	---	---	PASS
MGAM	8972	broad.mit.edu	37	7	141768484	141768484	+	Intron	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141768484G>A	uc003vwy.2	+							NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase						polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCTAGAGCCCGTTGGTACGAT	0.313													4	78	---	---	---	---	PASS
PRSS1	5644	broad.mit.edu	37	7	142458536	142458536	+	Missense_Mutation	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142458536G>T	uc003wak.2	+	2	188	c.171G>T	c.(169-171)TGG>TGT	p.W57C	uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_Missense_Mutation_p.G33C|PRSS1_uc003wam.2_5'Flank	NM_002769	NP_002760	P07477	TRY1_HUMAN	protease, serine, 1 preproprotein	57	Peptidase S1.				digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)			ACGAACAGTGGGTGGTATCAG	0.587									Hereditary_Pancreatitis				63	76	---	---	---	---	PASS
RPS20	6224	broad.mit.edu	37	8	56985729	56985729	+	Missense_Mutation	SNP	G	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56985729G>C	uc003xsn.2	-	4	478	c.280C>G	c.(280-282)CCT>GCT	p.P94A	RPS20_uc003xsm.2_Missense_Mutation_p.P94A	NM_001023	NP_001014	P60866	RS20_HUMAN	ribosomal protein S20 isoform 2	94					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.155)	Epithelial(17;0.00117)|all cancers(17;0.00879)			ATCTCAGAAGGACTGTGCAAG	0.398													17	93	---	---	---	---	PASS
OXR1	55074	broad.mit.edu	37	8	107719314	107719314	+	Missense_Mutation	SNP	A	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107719314A>G	uc011lht.1	+	8	1667	c.1568A>G	c.(1567-1569)CAA>CGA	p.Q523R	OXR1_uc003ymf.2_Missense_Mutation_p.Q522R|OXR1_uc011lhu.1_Missense_Mutation_p.Q515R|OXR1_uc010mcg.2_Intron|OXR1_uc010mch.2_Missense_Mutation_p.Q220R|OXR1_uc003ymg.1_Missense_Mutation_p.Q455R|OXR1_uc003ymi.1_Missense_Mutation_p.Q434R	NM_018002	NP_060472	Q8N573	OXR1_HUMAN	oxidation resistance 1 isoform 1	523					cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			GAAAATATTCAACAAGTGTCA	0.363													24	30	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113256656	113256656	+	Missense_Mutation	SNP	T	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113256656T>A	uc003ynu.2	-	65	10528	c.10369A>T	c.(10369-10371)AAC>TAC	p.N3457Y	CSMD3_uc003yns.2_Missense_Mutation_p.N2659Y|CSMD3_uc003ynt.2_Missense_Mutation_p.N3417Y|CSMD3_uc011lhx.1_Missense_Mutation_p.N3288Y	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3457	Extracellular (Potential).|Sushi 28.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GTCCAGGTGTTATCGGATCTA	0.408										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			40	31	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113256659	113256659	+	Missense_Mutation	SNP	C	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113256659C>G	uc003ynu.2	-	65	10525	c.10366G>C	c.(10366-10368)GAT>CAT	p.D3456H	CSMD3_uc003yns.2_Missense_Mutation_p.D2658H|CSMD3_uc003ynt.2_Missense_Mutation_p.D3416H|CSMD3_uc011lhx.1_Missense_Mutation_p.D3287H	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3456	Extracellular (Potential).|Sushi 28.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CAGGTGTTATCGGATCTACAC	0.418										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			39	31	---	---	---	---	PASS
WDR67	93594	broad.mit.edu	37	8	124132320	124132320	+	Missense_Mutation	SNP	T	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124132320T>A	uc003ypp.1	+	11	1552	c.1462T>A	c.(1462-1464)TCT>ACT	p.S488T	WDR67_uc011lig.1_Missense_Mutation_p.S488T|WDR67_uc011lih.1_Missense_Mutation_p.S378T|WDR67_uc003ypq.1_RNA|WDR67_uc003yps.1_Missense_Mutation_p.S201T	NM_145647	NP_663622	Q96DN5	WDR67_HUMAN	WD repeat domain 67 isoform 1	488	Rab-GAP TBC.					centrosome	Rab GTPase activator activity			skin(1)	1	Lung NSC(37;7e-10)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			AGCTCACTGGTCTGTCATTTT	0.294													37	26	---	---	---	---	PASS
PHF20L1	51105	broad.mit.edu	37	8	133844622	133844622	+	Silent	SNP	A	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133844622A>G	uc003ytt.2	+	15	2212	c.1887A>G	c.(1885-1887)CTA>CTG	p.L629L	PHF20L1_uc011lja.1_Silent_p.L603L	NM_016018	NP_057102	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1 isoform 1	629							nucleic acid binding|zinc ion binding			ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GGGCAATTCTATCCGTTGATC	0.403													13	83	---	---	---	---	PASS
FAM154A	158297	broad.mit.edu	37	9	18950777	18950777	+	Missense_Mutation	SNP	A	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18950777A>G	uc003zni.1	-	2	475	c.197T>C	c.(196-198)ATG>ACG	p.M66T	FAM154A_uc010mip.1_5'UTR	NM_153707	NP_714918	Q8IYX7	F154A_HUMAN	hypothetical protein LOC158297	66										pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.53e-16)		CAGGCCTTCCATTGGTATAGG	0.443													116	17	---	---	---	---	PASS
FRMPD1	22844	broad.mit.edu	37	9	37729734	37729734	+	Missense_Mutation	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37729734C>A	uc004aag.1	+	8	666	c.622C>A	c.(622-624)CTC>ATC	p.L208I	FRMPD1_uc004aah.1_Missense_Mutation_p.L208I|FRMPD1_uc011lqm.1_Missense_Mutation_p.L30I|FRMPD1_uc011lqn.1_Missense_Mutation_p.L77I	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	208	FERM.					cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		GGACATCATCCTCACCGTGAA	0.557													73	14	---	---	---	---	PASS
PAPPA	5069	broad.mit.edu	37	9	118997489	118997489	+	Missense_Mutation	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118997489C>T	uc004bjn.2	+	7	2686	c.2305C>T	c.(2305-2307)CAC>TAC	p.H769Y	PAPPA_uc011lxp.1_Missense_Mutation_p.H464Y|PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	769					cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						TGTCAACCCACACACGGTTCC	0.552													94	43	---	---	---	---	PASS
LCN2	3934	broad.mit.edu	37	9	130911868	130911868	+	Missense_Mutation	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130911868G>T	uc004bto.1	+	1	137	c.64G>T	c.(64-66)GAC>TAC	p.D22Y	LCN2_uc010mxq.1_Missense_Mutation_p.D22Y|LCN2_uc011map.1_Missense_Mutation_p.D22Y	NM_005564	NP_005555	P80188	NGAL_HUMAN	lipocalin 2 precursor	22					apoptosis|innate immune response|regulation of apoptosis|siderophore transport		iron ion binding|transporter activity				0						CCAGGCCCAGGACTCCACCTC	0.637													27	70	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7682733	7682733	+	Missense_Mutation	SNP	T	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7682733T>G	uc001ijq.2	-	4	464	c.385A>C	c.(385-387)ACC>CCC	p.T129P	ITIH5_uc001ijr.1_Missense_Mutation_p.T129P	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	129	VIT.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						TCTTCTGTGGTTTTATTCCTT	0.373													46	50	---	---	---	---	PASS
GAD2	2572	broad.mit.edu	37	10	26589812	26589812	+	Silent	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26589812C>A	uc001isp.2	+	16	2183	c.1680C>A	c.(1678-1680)GTC>GTA	p.V560V	GAD2_uc001isq.2_Silent_p.V560V	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN	glutamate decarboxylase 2	560					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)	TCCGCATGGTCATCTCAAACC	0.458													50	68	---	---	---	---	PASS
CDHR1	92211	broad.mit.edu	37	10	85973973	85973973	+	Missense_Mutation	SNP	C	T	T	rs141706561		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85973973C>T	uc001kcv.2	+	17	2176	c.2176C>T	c.(2176-2178)CGC>TGC	p.R726C	CDHR1_uc001kcw.2_Intron|CDHR1_uc009xst.2_Missense_Mutation_p.R430C|CDHR1_uc001kcx.2_Missense_Mutation_p.R40C	NM_033100	NP_149091	Q96JP9	CDHR1_HUMAN	protocadherin 21 precursor	726	Cytoplasmic (Potential).				homophilic cell adhesion		calcium ion binding|receptor activity			ovary(1)	1						CACCTTCTGGCGCAACAAGAA	0.637													20	47	---	---	---	---	PASS
NOLC1	9221	broad.mit.edu	37	10	103917285	103917285	+	Missense_Mutation	SNP	G	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103917285G>C	uc001kuo.2	+	4	649	c.414G>C	c.(412-414)GAG>GAC	p.E138D	NOLC1_uc001kup.2_Missense_Mutation_p.E138D|NOLC1_uc001kuq.2_Missense_Mutation_p.E139D|NOLC1_uc009xxb.1_5'UTR|NOLC1_uc001kur.2_Intron	NM_004741	NP_004732	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	138	11 X 12 AA approximate repeats of an acidic serine cluster.				mitosis|rRNA processing	cytoplasm|nucleolus	ATP binding|GTP binding|protein binding			ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		ATGATGATGAGGAGGACCAAA	0.493													12	18	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1262892	1262892	+	Silent	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1262892G>A	uc009ycr.1	+	47	6987	c.6861G>A	c.(6859-6861)CGG>CGA	p.R2287R	MUC5B_uc001ltb.2_Silent_p.R1597R	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	1594	7 X Cys-rich subdomain repeats.|Cys-rich subdomain 2.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACAGGATCCGGGTCCTCTGCT	0.637													10	1	---	---	---	---	PASS
HBB	3043	broad.mit.edu	37	11	5247920	5247920	+	Missense_Mutation	SNP	C	A	A	rs36008922		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5247920C>A	uc001mae.1	-	2	252	c.202G>T	c.(202-204)GTG>TTG	p.V68L		NM_000518	NP_000509	P68871	HBB_HUMAN	beta globin	68			V -> D (in Bristol).|V -> A (in Sydney; unstable).|V -> M (in Alesha; unstable).		blood coagulation|hydrogen peroxide catabolic process|nitric oxide transport|positive regulation of cell death|positive regulation of nitric oxide biosynthetic process|protein heterooligomerization|regulation of blood pressure|regulation of blood vessel size	haptoglobin-hemoglobin complex|hemoglobin complex	heme binding|hemoglobin binding|oxygen binding|oxygen transporter activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	Iron Dextran(DB00893)	GCACCGAGCACTTTCTTGCCA	0.552									Sickle_Cell_Trait				87	13	---	---	---	---	PASS
C11orf16	56673	broad.mit.edu	37	11	8950936	8950936	+	Missense_Mutation	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8950936C>A	uc001mhb.3	-	3	436	c.312G>T	c.(310-312)AAG>AAT	p.K104N	C11orf16_uc001mhc.3_Missense_Mutation_p.K104N	NM_020643	NP_065694	Q9NQ32	CK016_HUMAN	hypothetical protein LOC56673	104										upper_aerodigestive_tract(1)|pancreas(1)	2				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		CGGGAGTGGCCTTTATTTGGG	0.577													3	45	---	---	---	---	PASS
OR1S1	219959	broad.mit.edu	37	11	57982553	57982553	+	Missense_Mutation	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57982553C>A	uc010rkc.1	+	1	337	c.337C>A	c.(337-339)CAG>AAG	p.Q113K		NM_001004458	NP_001004458	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S,	113	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1		Breast(21;0.0589)				CTGCATCACACAGATGTACTT	0.428													66	49	---	---	---	---	PASS
OR10Q1	219960	broad.mit.edu	37	11	57995570	57995570	+	Missense_Mutation	SNP	A	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57995570A>T	uc010rkd.1	-	1	778	c.778T>A	c.(778-780)TGC>AGC	p.C260S		NM_001004471	NP_001004471	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q,	260	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(21;0.0589)				ACGAGGCTGCAGCAGCCATAC	0.617													22	44	---	---	---	---	PASS
MS4A3	932	broad.mit.edu	37	11	59828629	59828629	+	5'UTR	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59828629C>T	uc001nom.2	+	2					MS4A3_uc001non.2_5'UTR|MS4A3_uc001noo.2_Intron	NM_006138	NP_006129	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member							endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity			ovary(2)|skin(1)	3		all_epithelial(135;0.245)				CCATAAACAACCCCAATGGCC	0.473													11	47	---	---	---	---	PASS
UBXN1	51035	broad.mit.edu	37	11	62445480	62445480	+	Missense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62445480G>A	uc001nul.1	-	5	533	c.401C>T	c.(400-402)GCA>GTA	p.A134V	UBXN1_uc001nuj.2_Missense_Mutation_p.A134V|UBXN1_uc001num.1_Missense_Mutation_p.A134V|UBXN1_uc001nuk.2_Missense_Mutation_p.A99V|UBXN1_uc010rme.1_Missense_Mutation_p.A134V|UBXN1_uc010rmf.1_3'UTR	NM_015853	NP_056937	Q04323	UBXN1_HUMAN	UBX domain protein 1	134	Potential.|Interaction with BRCA1.				negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process	cytoplasm	ATPase binding|K6-linked polyubiquitin binding				0						CCGCTGTCGTGCTGCTGACAA	0.617													15	58	---	---	---	---	PASS
CCDC88B	283234	broad.mit.edu	37	11	64111617	64111617	+	Missense_Mutation	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64111617C>T	uc001nzy.2	+	14	1648	c.1604C>T	c.(1603-1605)CCG>CTG	p.P535L	CCDC88B_uc009ypo.1_Missense_Mutation_p.P532L|CCDC88B_uc001nzz.1_Missense_Mutation_p.P184L	NM_032251	NP_115627	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88	535					microtubule cytoskeleton organization	cytoplasm	microtubule binding			ovary(3)|skin(1)	4						TTGGCTCCCCCGGCATTAGAC	0.632													14	109	---	---	---	---	PASS
KDM2A	22992	broad.mit.edu	37	11	66995566	66995566	+	Missense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66995566G>A	uc001ojw.2	+	11	1880	c.1016G>A	c.(1015-1017)CGC>CAC	p.R339H	KDM2A_uc001ojx.2_RNA|KDM2A_uc001ojy.2_Missense_Mutation_p.R33H	NM_012308	NP_036440	Q9Y2K7	KDM2A_HUMAN	F-box and leucine-rich repeat protein 11	339					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			ovary(4)|lung(3)|breast(1)|skin(1)	9						GTGTTGGAGCGCTATGTGTAC	0.408													6	311	---	---	---	---	PASS
CTTN	2017	broad.mit.edu	37	11	70256077	70256077	+	Intron	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70256077C>T	uc001opv.3	+						CTTN_uc001opu.2_Intron|CTTN_uc001opw.3_Intron	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a							cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GTAAGTGGCCCGCGGCTGCCT	0.517													30	670	---	---	---	---	PASS
PGM2L1	283209	broad.mit.edu	37	11	74049611	74049611	+	Silent	SNP	T	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74049611T>C	uc001ovb.1	-	13	1964	c.1668A>G	c.(1666-1668)ACA>ACG	p.T556T		NM_173582	NP_775853	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	556					glucose 1-phosphate metabolic process	cytosol	glucose-1,6-bisphosphate synthase activity|phosphoglucomutase activity			ovary(1)	1	Breast(11;3.32e-06)					GAAAAGTAAATGTAATCATTT	0.383													33	87	---	---	---	---	PASS
MYO7A	4647	broad.mit.edu	37	11	76867112	76867112	+	Missense_Mutation	SNP	A	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76867112A>G	uc001oyb.2	+	5	717	c.445A>G	c.(445-447)AGC>GGC	p.S149G	MYO7A_uc010rsl.1_Missense_Mutation_p.S149G|MYO7A_uc010rsm.1_Missense_Mutation_p.S138G|MYO7A_uc001oyc.2_Missense_Mutation_p.S149G	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1	149	Myosin head-like.				actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						GAAACGCAACAGCCGAGACCA	0.562													30	1	---	---	---	---	PASS
ZC3H12C	85463	broad.mit.edu	37	11	110036409	110036409	+	Missense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110036409G>A	uc009yxw.2	+	6	2650	c.2599G>A	c.(2599-2601)GCC>ACC	p.A867T	ZC3H12C_uc010rwc.1_Missense_Mutation_p.A868T|ZC3H12C_uc010rwd.1_Missense_Mutation_p.A868T|ZC3H12C_uc001pkr.3_Missense_Mutation_p.A836T	NM_033390	NP_203748	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	867							endonuclease activity|nucleic acid binding|zinc ion binding				0		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		CATGACAGACGCCCAGCAGCT	0.428													3	8	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117389387	117389387	+	Missense_Mutation	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117389387G>T	uc001prh.1	-	7	1486	c.1484C>A	c.(1483-1485)CCG>CAG	p.P495Q	DSCAML1_uc001pri.1_Missense_Mutation_p.P299Q	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	435	Extracellular (Potential).|Ig-like C2-type 5.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CGTGGGGGGCGGGGCGCCCTT	0.672													3	43	---	---	---	---	PASS
AKAP3	10566	broad.mit.edu	37	12	4737325	4737325	+	Missense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4737325G>A	uc001qnb.3	-	4	972	c.743C>T	c.(742-744)TCT>TTT	p.S248F		NM_006422	NP_006413	O75969	AKAP3_HUMAN	A-kinase anchor protein 3	248					acrosome reaction|cellular component movement	acrosomal vesicle	protein kinase A binding			skin(3)|large_intestine(1)|ovary(1)|kidney(1)	6						TCCATTACGAGATTCAAACAC	0.458													73	47	---	---	---	---	PASS
CSDA	8531	broad.mit.edu	37	12	10868337	10868337	+	Missense_Mutation	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10868337C>T	uc001qyt.2	-	4	649	c.406G>A	c.(406-408)GGA>AGA	p.G136R	CSDA_uc001qyu.2_Missense_Mutation_p.G136R	NM_003651	NP_003642	P16989	DBPA_HUMAN	cold shock domain protein A isoform a	136	CSD.				negative regulation of transcription from RNA polymerase II promoter|response to cold	cytoplasm|nucleus	double-stranded DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)|lung(1)|large_intestine(1)	4	Glioma(1;0.155)					TCTCCATCTCCTACACTGCGC	0.408													81	61	---	---	---	---	PASS
TMTC1	83857	broad.mit.edu	37	12	29665061	29665061	+	Intron	SNP	A	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29665061A>C	uc001rjb.2	-						TMTC1_uc001riz.2_Intron|TMTC1_uc001rja.2_Intron|TMTC1_uc001riy.2_Intron	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat							integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GCTCTAAATAAATAAGAAATA	0.398													44	288	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49444814	49444814	+	Silent	SNP	A	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49444814A>G	uc001rta.3	-	10	2652	c.2652T>C	c.(2650-2652)CCT>CCC	p.P884P		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	884	Pro-rich.			Missing (in Ref. 1; AAC51734).	chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CCCCAGGGGGAGGGAACAAGG	0.642			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			3	119	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112685957	112685957	+	Nonsense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112685957G>A	uc009zwc.2	-	20	2914	c.2896C>T	c.(2896-2898)CAA>TAA	p.Q966*		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						TGCCATTTTTGTTCCAGTTCT	0.299													24	10	---	---	---	---	PASS
MCF2L	23263	broad.mit.edu	37	13	113740555	113740555	+	Missense_Mutation	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113740555G>T	uc001vsu.2	+	21	2558	c.2536G>T	c.(2536-2538)GGC>TGC	p.G846C	MCF2L_uc001vsq.2_Missense_Mutation_p.G846C|MCF2L_uc010tjr.1_Missense_Mutation_p.G789C|MCF2L_uc001vsr.2_Missense_Mutation_p.G793C|MCF2L_uc001vss.3_Missense_Mutation_p.G787C|MCF2L_uc010tjs.1_Missense_Mutation_p.G787C|MCF2L_uc001vst.1_Missense_Mutation_p.G751C	NM_001112732	NP_001106203	O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming	819					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(1)|kidney(1)	2	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				CGCTATCACCGGCTATGACGT	0.652													21	42	---	---	---	---	PASS
OR4K14	122740	broad.mit.edu	37	14	20483135	20483135	+	Missense_Mutation	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20483135C>A	uc010tky.1	-	1	218	c.218G>T	c.(217-219)TGG>TTG	p.W73L		NM_001004712	NP_001004712	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K,	73	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		TGAGGCCAGCCACATGTCCAG	0.478													48	34	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22265828	22265828	+	Intron	SNP	A	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22265828A>C	uc010tmf.1	+						uc010air.1_Silent_p.S37S					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		AAGCAGCCTCACTGGAGTTGG	0.453													292	199	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22466394	22466394	+	Intron	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22466394C>T	uc001wbw.2	+						uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Silent_p.F108F|uc001wcp.2_Silent_p.F108F|uc001wcr.1_Silent_p.F68F|uc001wcs.1_Silent_p.F68F|uc010ajf.1_Silent_p.F68F|uc001wcq.2_Silent_p.F108F|uc010ajd.1_Silent_p.F108F					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CTTCTTACTTCTGTGCTACGG	0.502													35	78	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94053012	94053012	+	Silent	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94053012C>T	uc001ybv.1	+	18	2426	c.2343C>T	c.(2341-2343)ACC>ACT	p.T781T	KIAA1409_uc001ybs.1_Silent_p.T781T	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	958						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		TAATATATACCATTTTCCAGG	0.328													52	8	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22369023	22369023	+	Missense_Mutation	SNP	A	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22369023A>T	uc010tzu.1	+	1	448	c.448A>T	c.(448-450)AGG>TGG	p.R150W	LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	150	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TCTCTCCTGGAGGGGGGGCTT	0.498													47	472	---	---	---	---	PASS
OR4N4	283694	broad.mit.edu	37	15	22382725	22382725	+	Missense_Mutation	SNP	T	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22382725T>A	uc001yuc.1	+	7	1234	c.253T>A	c.(253-255)TTC>ATC	p.F85I	LOC727924_uc001yub.1_RNA|OR4N4_uc010tzv.1_Missense_Mutation_p.F85I	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		GTTGGTGGACTTCCTCTCTGA	0.507													36	339	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28380782	28380782	+	Silent	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28380782C>T	uc001zbj.2	-	79	12178	c.12072G>A	c.(12070-12072)TCG>TCA	p.S4024S		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	4024	RCC1 14.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GGGTGGACACCGACTCTGTCC	0.448													35	54	---	---	---	---	PASS
CASC5	57082	broad.mit.edu	37	15	40917450	40917450	+	Missense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40917450G>A	uc010bbs.1	+	11	5227	c.5066G>A	c.(5065-5067)TGT>TAT	p.C1689Y	CASC5_uc010ucq.1_Missense_Mutation_p.C1513Y|CASC5_uc001zme.2_Missense_Mutation_p.C1663Y|CASC5_uc010bbt.1_Missense_Mutation_p.C1663Y	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1	1689					acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AAGAGAAATTGTAGTGTCACT	0.408													74	75	---	---	---	---	PASS
MAP1A	4130	broad.mit.edu	37	15	43818760	43818760	+	Missense_Mutation	SNP	T	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43818760T>A	uc001zrt.2	+	4	5556	c.5089T>A	c.(5089-5091)TGG>AGG	p.W1697R		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1697						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GGACACATACTGGAGGGAGCT	0.582													30	34	---	---	---	---	PASS
NOX5	79400	broad.mit.edu	37	15	69327710	69327710	+	Missense_Mutation	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69327710G>T	uc002ars.1	+	6	892	c.872G>T	c.(871-873)CGC>CTC	p.R291L	NOX5_uc002arp.1_Missense_Mutation_p.R273L|NOX5_uc002arq.1_Missense_Mutation_p.R245L|NOX5_uc010bid.1_Missense_Mutation_p.R256L|NOX5_uc002arr.1_Missense_Mutation_p.R263L|NOX5_uc010bie.1_Missense_Mutation_p.R91L|NOX5_uc010bif.1_RNA	NM_024505	NP_078781	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	291	Cytoplasmic (Potential).				angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity			breast(1)|pancreas(1)	2						ATGCTCAGACGCTGCCTCACC	0.617													10	17	---	---	---	---	PASS
AP3S2	10239	broad.mit.edu	37	15	90447114	90447114	+	Missense_Mutation	SNP	C	A	A	rs61731919		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90447114C>A	uc002bos.3	-	4	558	c.403G>T	c.(403-405)GAC>TAC	p.D135Y	C15orf38_uc002bot.1_RNA|C15orf38_uc002bou.2_Missense_Mutation_p.D135Y	NM_182616	NP_872422	P59780	AP3S2_HUMAN	hypothetical protein LOC348110	Error:Variant_position_missing_in_P59780_after_alignment					intracellular protein transport|vesicle-mediated transport	cytoplasmic vesicle membrane|Golgi apparatus|membrane coat	protein transporter activity				0	Lung NSC(78;0.0181)|all_lung(78;0.0384)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.223)			ACTGTGTGGTCGGGGGTGAGG	0.652													3	68	---	---	---	---	PASS
HS3ST2	9956	broad.mit.edu	37	16	22926572	22926572	+	Missense_Mutation	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22926572C>T	uc002dli.2	+	2	865	c.793C>T	c.(793-795)CCG>TCG	p.P265S	HS3ST2_uc002dlj.2_RNA	NM_006043	NP_006034	Q9Y278	HS3S2_HUMAN	heparan sulfate D-glucosaminyl	265	Lumenal (Potential).					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(48;0.0299)		GCAGTACTTCCCGCTAGCTCA	0.607													45	66	---	---	---	---	PASS
SULT1A2	6799	broad.mit.edu	37	16	28604868	28604868	+	Missense_Mutation	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28604868C>T	uc002dqg.1	-	5	745	c.394G>A	c.(394-396)GCA>ACA	p.A132T	uc010vct.1_Intron|SULT1A2_uc002dqh.1_Missense_Mutation_p.A132T	NM_177528	NP_803564	P50226	ST1A2_HUMAN	sulfotransferase family, cytosolic, 1A,	132	PAPS (By similarity).				3'-phosphoadenosine 5'-phosphosulfate metabolic process|amine biosynthetic process|catecholamine metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity|flavonol 3-sulfotransferase activity				0						ACATCCTTTGCGTTGCGGGCA	0.552													4	72	---	---	---	---	PASS
SPNS1	83985	broad.mit.edu	37	16	28990770	28990770	+	Missense_Mutation	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28990770G>A	uc010vdi.1	+	6	781	c.641G>A	c.(640-642)GGA>GAA	p.G214E	uc010vct.1_Intron|SPNS1_uc002dry.2_Missense_Mutation_p.G214E|SPNS1_uc002drx.2_Missense_Mutation_p.G141E|SPNS1_uc002dsa.2_Missense_Mutation_p.G214E|SPNS1_uc002drz.2_Missense_Mutation_p.G214E|SPNS1_uc010byp.2_Missense_Mutation_p.G192E|SPNS1_uc010byq.1_Missense_Mutation_p.G141E	NM_001142448	NP_001135920	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 isoform 1	214					lipid transport|transmembrane transport	integral to membrane|mitochondrial inner membrane	protein binding				0						GATATGGCTGGAGACTGGCAC	0.592													21	28	---	---	---	---	PASS
GPT2	84706	broad.mit.edu	37	16	46952534	46952534	+	Missense_Mutation	SNP	T	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46952534T>A	uc002eel.2	+	8	996	c.902T>A	c.(901-903)GTG>GAG	p.V301E	GPT2_uc002eem.2_Missense_Mutation_p.V201E	NM_133443	NP_597700	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase 2 isoform 1	301					2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	CCCCCGCAGGTGTACCAGGAC	0.612													75	62	---	---	---	---	PASS
TAT	6898	broad.mit.edu	37	16	71610074	71610074	+	Intron	SNP	C	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71610074C>G	uc002fap.2	-						TAT_uc002faq.2_Intron|TAT_uc002far.2_Missense_Mutation_p.G82A	NM_000353	NP_000344	P17735	ATTY_HUMAN	tyrosine aminotransferase						2-oxoglutarate metabolic process|glutamate metabolic process|L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	1-aminocyclopropane-1-carboxylate synthase activity|L-tyrosine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(2)	2		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Glutamic Acid(DB00142)|L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Pyridoxal Phosphate(DB00114)	CAGTAGTGTCCCCAACTCACC	0.493													7	12	---	---	---	---	PASS
PITPNM3	83394	broad.mit.edu	37	17	6428755	6428755	+	Silent	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6428755G>A	uc002gdd.3	-	3	298	c.147C>T	c.(145-147)ATC>ATT	p.I49I	PITPNM3_uc010cln.2_Intron	NM_031220	NP_112497	Q9BZ71	PITM3_HUMAN	PITPNM family member 3 isoform 1	49					phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding			ovary(2)|central_nervous_system(2)	4				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		TCCCAATGAGGATGGCATTCT	0.537													203	16	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578370	7578370	+	Splice_Site	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578370C>A	uc002gim.2	-	5	753	c.559_splice	c.e5+1	p.G187_splice	TP53_uc002gig.1_Splice_Site_p.G187_splice|TP53_uc002gih.2_Splice_Site_p.G187_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Intron|TP53_uc010cng.1_Intron|TP53_uc002gii.1_Intron|TP53_uc010cnh.1_Splice_Site_p.G187_splice|TP53_uc010cni.1_Splice_Site_p.G187_splice|TP53_uc002gij.2_Splice_Site_p.G187_splice|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Splice_Site_p.G94_splice|TP53_uc002gio.2_Splice_Site_p.G55_splice|TP53_uc010vug.1_Splice_Site_p.G148_splice	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.?(24)|p.0?(7)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAGCTGCTCACCATCGCTATC	0.632		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			85	9	---	---	---	---	PASS
MFSD6L	162387	broad.mit.edu	37	17	8701182	8701182	+	Silent	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8701182C>A	uc002glp.1	-	1	1405	c.1257G>T	c.(1255-1257)CCG>CCT	p.P419P		NM_152599	NP_689812	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing	419	Helical; (Potential).					integral to membrane				central_nervous_system(1)	1						TAGCTTTGAACGGATGAAGCA	0.572													137	156	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11701032	11701032	+	Missense_Mutation	SNP	T	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11701032T>C	uc002gne.2	+	43	8410	c.8342T>C	c.(8341-8343)CTG>CCG	p.L2781P	DNAH9_uc010coo.2_Missense_Mutation_p.L2075P	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2781					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ACCCAGACTCTGGTGGAGGCC	0.498													28	98	---	---	---	---	PASS
KCNJ12	3768	broad.mit.edu	37	17	21319683	21319683	+	Silent	SNP	G	A	A	rs111482429	byFrequency	TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21319683G>A	uc002gyv.1	+	3	1734	c.1029G>A	c.(1027-1029)TCG>TCA	p.S343S		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	343	Cytoplasmic (By similarity).			S -> L (in Ref. 2; AAC50615).	blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity	p.S343L(2)		ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	TTGACTACTCGCACTTCCACA	0.582										Prostate(3;0.18)			53	249	---	---	---	---	PASS
HSD17B1	3292	broad.mit.edu	37	17	40706825	40706825	+	Missense_Mutation	SNP	G	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40706825G>C	uc002hzw.2	+	6	1824	c.856G>C	c.(856-858)GGC>CGC	p.G286R	HSD17B1_uc002hzx.2_Missense_Mutation_p.G287R|HSD17B1_uc010wgm.1_RNA|uc002hzy.2_5'Flank|HSD17B1_uc010cyi.2_Missense_Mutation_p.G317R	NM_000413	NP_000404	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1	286					estrogen biosynthetic process	cytosol	binding|estradiol 17-beta-dehydrogenase activity				0		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	NADH(DB00157)	GGAAGTGTTCGGCGACGTTCC	0.537													6	46	---	---	---	---	PASS
ATXN7L3	56970	broad.mit.edu	37	17	42271707	42271707	+	Missense_Mutation	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42271707C>A	uc002iga.2	-	12	1059	c.968G>T	c.(967-969)GGC>GTC	p.G323V	ATXN7L3_uc010wiv.1_Missense_Mutation_p.G105V|ATXN7L3_uc002ifz.2_Missense_Mutation_p.G330V	NM_001098833	NP_001092303	Q14CW9	AT7L3_HUMAN	ataxin 7-like 3 isoform b	323					histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|metal ion binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GGAACCTAGGCCGGAGGCAGT	0.522													70	62	---	---	---	---	PASS
HLF	3131	broad.mit.edu	37	17	53398125	53398125	+	Missense_Mutation	SNP	C	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53398125C>G	uc002iug.1	+	4	1298	c.773C>G	c.(772-774)TCG>TGG	p.S258W	HLF_uc010dce.1_Missense_Mutation_p.S173W|HLF_uc002iuh.2_Missense_Mutation_p.S173W|HLF_uc010wni.1_Missense_Mutation_p.S205W	NM_002126	NP_002117	Q16534	HLF_HUMAN	hepatic leukemia factor	258	Leucine-zipper.				multicellular organismal development|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						ATCCGGGCCTCGTTCCTGGAG	0.592			T	TCF3	ALL								6	38	---	---	---	---	PASS
ITGB4	3691	broad.mit.edu	37	17	73736517	73736517	+	Missense_Mutation	SNP	A	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73736517A>T	uc002jpg.2	+	21	2712	c.2525A>T	c.(2524-2526)CAG>CTG	p.Q842L	ITGB4_uc002jph.2_Missense_Mutation_p.Q842L|ITGB4_uc010dgo.2_Missense_Mutation_p.Q842L|ITGB4_uc002jpi.3_Missense_Mutation_p.Q842L|ITGB4_uc010dgp.1_Missense_Mutation_p.Q842L|ITGB4_uc002jpj.2_Missense_Mutation_p.Q842L	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor	842	Cytoplasmic (Potential).				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GAGTGCGCCCAGCTGCGCCAG	0.657													56	30	---	---	---	---	PASS
MGAT5B	146664	broad.mit.edu	37	17	74901247	74901247	+	Intron	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74901247C>A	uc002jti.2	+						MGAT5B_uc002jth.2_Intron	NM_198955	NP_945193	Q3V5L5	MGT5B_HUMAN	N-acetylglucosaminyltranferase VB isoform 2							Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3						CTGGACCCCTCCAGGCAGTTT	0.637													12	46	---	---	---	---	PASS
AATK	9625	broad.mit.edu	37	17	79095665	79095665	+	Missense_Mutation	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79095665G>T	uc010dia.2	-	11	2151	c.2071C>A	c.(2071-2073)CGC>AGC	p.R691S	AATK_uc010dhz.2_RNA	NM_001080395	NP_001073864	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	691						integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TCTGGACAGCGGCTGCCGCTG	0.716													4	20	---	---	---	---	PASS
EMILIN2	84034	broad.mit.edu	37	18	2892173	2892173	+	Nonsense_Mutation	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2892173C>A	uc002kln.2	+	4	2207	c.2048C>A	c.(2047-2049)TCG>TAG	p.S683*		NM_032048	NP_114437	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2 precursor	683					cell adhesion	collagen	extracellular matrix constituent conferring elasticity|protein binding			skin(2)|ovary(1)	3				READ - Rectum adenocarcinoma(2;0.1)		CAGGTCATCTCGGAGCTGGAT	0.602													41	157	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5395708	5395708	+	Splice_Site	SNP	T	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5395708T>G	uc002kmt.1	-	20	3060	c.2974_splice	c.e20-1	p.V992_splice	EPB41L3_uc010wzh.1_Splice_Site_p.V823_splice|EPB41L3_uc002kmu.1_Splice_Site_p.V770_splice|EPB41L3_uc010dkq.1_Splice_Site_p.V661_splice|EPB41L3_uc002kms.1_Splice_Site_p.V227_splice|EPB41L3_uc010wze.1_Splice_Site_p.V297_splice|EPB41L3_uc010wzf.1_Splice_Site_p.V289_splice|EPB41L3_uc010wzg.1_Splice_Site_p.V264_splice|EPB41L3_uc010dkr.2_Splice_Site_p.V384_splice	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3						cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						TGGATCGACCTAAAGCAGCAG	0.498													54	203	---	---	---	---	PASS
ARHGAP28	79822	broad.mit.edu	37	18	6898528	6898528	+	Intron	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6898528C>A	uc010wzi.1	+						ARHGAP28_uc002knc.2_Silent_p.P656P|ARHGAP28_uc002knd.2_Silent_p.P549P|ARHGAP28_uc002kne.2_Intron|ARHGAP28_uc002knf.2_Silent_p.P540P			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				ACAGGAGCCCCAAACATGTAT	0.299													80	63	---	---	---	---	PASS
CD226	10666	broad.mit.edu	37	18	67531632	67531632	+	Missense_Mutation	SNP	G	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67531632G>C	uc010dqo.2	-	6	1376	c.929C>G	c.(928-930)ACC>AGC	p.T310S	CD226_uc002lkm.3_Missense_Mutation_p.T310S	NM_006566	NP_006557	Q15762	CD226_HUMAN	CD226 molecule precursor	310	Cytoplasmic (Potential).				cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity				0		Esophageal squamous(42;0.129)				GGATTGATTGGTAGGTTGACT	0.388													28	11	---	---	---	---	PASS
DAPK3	1613	broad.mit.edu	37	19	3969742	3969742	+	5'UTR	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3969742G>T	uc002lzc.1	-	1					DAPK3_uc002lzd.1_5'UTR	NM_001348	NP_001339	O43293	DAPK3_HUMAN	death-associated protein kinase 3						apoptosis|chromatin modification|induction of apoptosis|intracellular protein kinase cascade	cytoplasm|PML body	ATP binding|leucine zipper domain binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|ovary(1)|large_intestine(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGGCGGCCGGTCCGCCTTCC	0.637											OREG0025158	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	1	---	---	---	---	PASS
FSD1	79187	broad.mit.edu	37	19	4310281	4310281	+	Missense_Mutation	SNP	A	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4310281A>T	uc002lzy.2	+	5	510	c.357A>T	c.(355-357)CAA>CAT	p.Q119H	FSD1_uc010xie.1_Missense_Mutation_p.Q106H|FSD1_uc010xif.1_Missense_Mutation_p.N103Y|FSD1_uc002lzz.2_Missense_Mutation_p.Q119H|FSD1_uc002maa.2_5'Flank	NM_024333	NP_077309	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing	119	COS.				cell division|mitosis	cleavage furrow|microtubule|microtubule organizing center|nucleus				skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCCAAGCAAATCAAAGATG	0.398													139	31	---	---	---	---	PASS
APLP1	333	broad.mit.edu	37	19	36369793	36369793	+	Missense_Mutation	SNP	T	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36369793T>A	uc002oce.2	+	15	1787	c.1649T>A	c.(1648-1650)GTG>GAG	p.V550E	APLP1_uc010xsz.1_Missense_Mutation_p.V511E|APLP1_uc002ocf.2_Missense_Mutation_p.V551E|APLP1_uc002ocg.2_Missense_Mutation_p.V454E|APLP1_uc010xta.1_Missense_Mutation_p.V544E	NM_005166	NP_005157	P51693	APLP1_HUMAN	amyloid precursor-like protein 1 isoform 2	550	Extracellular (Potential).				apoptosis|cell adhesion|cellular response to norepinephrine stimulus|endocytosis|negative regulation of cAMP biosynthetic process|nervous system development|organ morphogenesis	basement membrane|integral to membrane|perinuclear region of cytoplasm|plasma membrane	alpha-2A adrenergic receptor binding|alpha-2B adrenergic receptor binding|alpha-2C adrenergic receptor binding|heparin binding|identical protein binding|metal ion binding			ovary(2)	2	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTCCCCCAGGTGAATGCGTCT	0.512													55	53	---	---	---	---	PASS
CYP2F1	1572	broad.mit.edu	37	19	41633927	41633927	+	Silent	SNP	A	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41633927A>G	uc002opu.1	+	10	1472	c.1416A>G	c.(1414-1416)CCA>CCG	p.P472P	CYP2F1_uc010xvw.1_Intron|CYP2F1_uc002opv.1_RNA	NM_000774	NP_000765	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F,	472					naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						ACCTGACCCCACTCAGCTCAG	0.652													5	35	---	---	---	---	PASS
C20orf27	54976	broad.mit.edu	37	20	3734752	3734752	+	Nonsense_Mutation	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3734752C>A	uc002wji.1	-	6	707	c.478G>T	c.(478-480)GAG>TAG	p.E160*	C20orf27_uc002wjf.1_3'UTR|C20orf27_uc002wjh.1_Nonsense_Mutation_p.E185*	NM_001039140	NP_001034229	Q9GZN8	CT027_HUMAN	hypothetical protein LOC54976	160											0						TATTCCAGCTCGGCGCCCACA	0.682													11	7	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	21	10863075	10863075	+	IGR	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10863075C>A								None (None upstream) : TPTE (43668 downstream)																							TGAAAACCCACATCTTGAGAG	0.473													28	836	---	---	---	---	PASS
NPTXR	23467	broad.mit.edu	37	22	39224455	39224455	+	Silent	SNP	G	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39224455G>A	uc003awk.2	-	2	841	c.687C>T	c.(685-687)ACC>ACT	p.T229T		NM_014293	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	229	Extracellular (Potential).					integral to membrane	metal ion binding			central_nervous_system(2)|skin(1)	3	Melanoma(58;0.04)					AGTGTAGGCCGGTGGGCACAG	0.647													6	8	---	---	---	---	PASS
MAGEB18	286514	broad.mit.edu	37	X	26157145	26157145	+	Missense_Mutation	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26157145C>A	uc004dbq.1	+	2	230	c.43C>A	c.(43-45)CGC>AGC	p.R15S		NM_173699	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	15							protein binding			central_nervous_system(1)	1						CCGTGAGAAACGCCACCAGGC	0.532													8	6	---	---	---	---	PASS
MAGEB18	286514	broad.mit.edu	37	X	26157185	26157185	+	Missense_Mutation	SNP	C	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26157185C>A	uc004dbq.1	+	2	270	c.83C>A	c.(82-84)ACG>AAG	p.T28K		NM_173699	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	28							protein binding			central_nervous_system(1)	1						CTGGGAGCTACGCAGGCCACT	0.552													12	4	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	26178727	26178727	+	IGR	SNP	G	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26178727G>T								MAGEB18 (19875 upstream) : MAGEB6 (31830 downstream)																							CATGCCTCGGGGTCAGAAGAG	0.582													29	6	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32662275	32662275	+	Missense_Mutation	SNP	C	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32662275C>G	uc004dda.1	-	11	1549	c.1305G>C	c.(1303-1305)AGG>AGC	p.R435S	DMD_uc004dcz.2_Missense_Mutation_p.R312S|DMD_uc004dcy.1_Missense_Mutation_p.R431S|DMD_uc004ddb.1_Missense_Mutation_p.R427S|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Missense_Mutation_p.R427S|DMD_uc010ngp.1_Intron|DMD_uc010ngq.1_Intron|MIR548F5_hsa-mir-548f-5|MI0006378_5'Flank	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	435	Spectrin 1.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGCTAGCTACCCTGAGGCATT	0.353													40	6	---	---	---	---	PASS
MED14	9282	broad.mit.edu	37	X	40562733	40562733	+	Silent	SNP	T	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40562733T>C	uc004dex.3	-	11	1514	c.1374A>G	c.(1372-1374)TTA>TTG	p.L458L		NM_004229	NP_004220	O60244	MED14_HUMAN	mediator complex subunit 14	458	Interaction with STAT2.				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			breast(2)|kidney(1)|skin(1)	4						TTCCAGAATGTAAATCTACAA	0.333													30	5	---	---	---	---	PASS
APEX2	27301	broad.mit.edu	37	X	55033379	55033379	+	Silent	SNP	G	C	C			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55033379G>C	uc004dtz.2	+	6	1144	c.1068G>C	c.(1066-1068)ACG>ACC	p.T356T	APEX2_uc011mom.1_Silent_p.T185T	NM_014481	NP_055296	Q9UBZ4	APEX2_HUMAN	apurinic/apyrimidinic endonuclease 2	356					cell cycle|DNA recombination|DNA repair	nucleus	DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|endonuclease activity|exonuclease activity|zinc ion binding			breast(1)	1						AGCAGTCGACGCTGCAGCACA	0.567								Other_BER_factors					21	4	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73071409	73071409	+	RNA	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73071409C>T	uc004ebm.1	-	1		c.1180G>A				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						AGCCCTGCACCTTAGTCTTTC	0.453													36	38	---	---	---	---	PASS
NAP1L3	4675	broad.mit.edu	37	X	92927282	92927282	+	Nonsense_Mutation	SNP	G	T	T	rs139021145	byFrequency	TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92927282G>T	uc004efq.2	-	1	1327	c.1022C>A	c.(1021-1023)TCG>TAG	p.S341*	FAM133A_uc004efr.1_5'Flank	NM_004538	NP_004529	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	341					nucleosome assembly	chromatin assembly complex				ovary(1)|skin(1)	2						GCTAACATCCGACAAGAACTT	0.428													38	5	---	---	---	---	PASS
NOX1	27035	broad.mit.edu	37	X	100117172	100117172	+	Silent	SNP	C	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100117172C>T	uc004egj.2	-	7	998	c.792G>A	c.(790-792)GGG>GGA	p.G264G	uc010nnf.2_Intron|NOX1_uc004egl.3_Silent_p.G264G|NOX1_uc010nne.2_Silent_p.G227G	NM_007052	NP_008983	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1 isoform long	264	Ferric oxidoreductase.|Extracellular (Potential).				angiogenesis|cell migration|electron transport chain|FADH2 metabolic process|hydrogen peroxide metabolic process|inflammatory response|intracellular pH elevation|positive regulation of integrin biosynthetic process|positive regulation of smooth muscle cell proliferation|positive regulation vascular endothelial growth factor production|respiratory burst|response to pH|signal transduction|superoxide anion generation	cell junction|early endosome|invadopodium membrane|NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|Rac GTPase binding|superoxide-generating NADPH oxidase activity|voltage-gated proton channel activity			ovary(1)	1						CAGGGGGATGCCCTTCAAACT	0.413													100	6	---	---	---	---	PASS
BTK	695	broad.mit.edu	37	X	100604918	100604918	+	Missense_Mutation	SNP	T	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100604918T>G	uc004ehg.2	-	19	2128	c.1935A>C	c.(1933-1935)AAA>AAC	p.K645N	TIMM8A_uc004ehd.2_5'Flank|TIMM8A_uc011mri.1_5'Flank|BTK_uc004ehf.2_Missense_Mutation_p.K145N|BTK_uc010nnh.2_RNA|BTK_uc010nni.2_RNA|BTK_uc004ehe.2_RNA|BTK_uc010nnj.2_RNA|BTK_uc010nnk.2_RNA|BTK_uc010nnl.2_Missense_Mutation_p.K121N|BTK_uc010nnm.2_Missense_Mutation_p.K204N|BTK_uc010nnn.2_Missense_Mutation_p.K469N|BTK_uc010nno.2_Missense_Mutation_p.K679N	NM_000061	NP_000052	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	645	Protein kinase.				calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding			lung(3)|central_nervous_system(2)|ovary(1)	6						TCAGAAGAATTTTGAAAGTGG	0.403									Agammaglobulinemia_X-linked				130	13	---	---	---	---	PASS
TRPC5	7224	broad.mit.edu	37	X	111195615	111195615	+	Missense_Mutation	SNP	A	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111195615A>T	uc004epl.1	-	2	953	c.34T>A	c.(34-36)TCA>ACA	p.S12T	TRPC5_uc004epm.1_Missense_Mutation_p.S12T	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	12	Cytoplasmic (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						CTGTACGGTGAGTAGTTGACC	0.488													39	3	---	---	---	---	PASS
FAM131C	348487	broad.mit.edu	37	1	16386305	16386306	+	Intron	INS	-	C	C	rs143272992		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16386305_16386306insC	uc001axz.3	-						FAM131C_uc010obz.1_Intron	NM_182623	NP_872429	Q96AQ9	F131C_HUMAN	hypothetical protein LOC348487												0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		AGTGATCTGGGCCCCCAAGGAC	0.599													4	2	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144852877	144852877	+	Intron	DEL	T	-	-	rs71909310		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144852877delT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AAACAGCCTGTTTGTAGGAAG	0.443			T	PDGFRB	MPD								3	3	---	---	---	---	
LOC728855	728855	broad.mit.edu	37	1	149649078	149649079	+	Intron	INS	-	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149649078_149649079insA	uc009wlc.2	+						LOC728855_uc009wld.2_Intron|uc001eso.1_RNA					Homo sapiens mRNA, chromosome 1 specific transcript KIAA0493.												0						AGAGAGCCTTCAAAACCTCTTA	0.426													6	4	---	---	---	---	
FCAMR	83953	broad.mit.edu	37	1	207132837	207132837	+	Intron	DEL	G	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207132837delG	uc001hfa.3	-						FCAMR_uc001hfb.2_Intron|FCAMR_uc009xca.1_Intron|FCAMR_uc001hfc.2_Intron	NM_001122980	NP_001116452	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity isoform 2							integral to membrane|plasma membrane	receptor activity			ovary(1)	1						aaaaaaaaaagaaaagaaaag	0.134													4	2	---	---	---	---	
OR2B11	127623	broad.mit.edu	37	1	247614957	247614957	+	Frame_Shift_Del	DEL	A	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247614957delA	uc010pyx.1	-	1	328	c.328delT	c.(328-330)TGGfs	p.W110fs		NM_001004492	NP_001004492	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B,	110	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CATCCCAGCCAGTGGAAGACT	0.597													45	62	---	---	---	---	
MATN3	4148	broad.mit.edu	37	2	20205423	20205424	+	Intron	INS	-	AAAG	AAAG	rs140894448	by1000genomes	TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20205423_20205424insAAAG	uc002rdl.2	-						MATN3_uc010exu.1_Intron	NM_002381	NP_002372	O15232	MATN3_HUMAN	matrilin 3 precursor						skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCACCAAAAAAGAATAATACT	0.267													6	5	---	---	---	---	
MEMO1	51072	broad.mit.edu	37	2	32168371	32168371	+	Frame_Shift_Del	DEL	G	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32168371delG	uc002rnx.2	-	2	525	c.143delC	c.(142-144)CCCfs	p.P48fs	MEMO1_uc010ymu.1_Frame_Shift_Del_p.P48fs|MEMO1_uc010ezq.2_Frame_Shift_Del_p.P48fs|MEMO1_uc002rny.2_RNA|MEMO1_uc002rnz.2_RNA|MEMO1_uc010ymv.1_RNA	NM_015955	NP_057039	Q9Y316	MEMO1_HUMAN	mediator of cell motility 1 isoform 1	48					regulation of microtubule-based process	cytosol|nucleus				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)					aaaGACTTACGGGGCAATAAT	0.239													143	88	---	---	---	---	
CRIM1	51232	broad.mit.edu	37	2	36726430	36726435	+	In_Frame_Del	DEL	GACTGC	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36726430_36726435delGACTGC	uc002rpd.2	+	8	1480_1485	c.1441_1446delGACTGC	c.(1441-1446)GACTGCdel	p.DC481del		NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN	cysteine-rich motor neuron 1 precursor	481_482	Antistasin-like 1.|Extracellular (Potential).				nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				GACAGGGAAGGACTGCATTAATGGTT	0.403													93	45	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91801285	91801285	+	IGR	DEL	T	-	-	rs56833157		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91801285delT								None (None upstream) : LOC654342 (3907 downstream)																							cctctccccctagtagtccct	0.000													9	11	---	---	---	---	
ITGA6	3655	broad.mit.edu	37	2	173368990	173368990	+	3'UTR	DEL	A	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173368990delA	uc002uhp.1	+	25					ITGA6_uc010zdy.1_3'UTR|ITGA6_uc002uho.1_3'UTR|ITGA6_uc010fqm.1_3'UTR	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a						blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			GCGGGGGCCTAAAAAAAAAAA	0.378													4	3	---	---	---	---	
ANKMY1	51281	broad.mit.edu	37	2	241468325	241468325	+	Intron	DEL	G	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241468325delG	uc002vyz.1	-						ANKMY1_uc002vza.1_Intron|ANKMY1_uc010fzd.1_Intron|ANKMY1_uc002vzb.1_Intron|ANKMY1_uc002vzc.1_Intron|ANKMY1_uc002vzd.1_Intron|ANKMY1_uc010fze.1_Intron|ANKMY1_uc002vze.2_Intron	NM_016552	NP_057636	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1								zinc ion binding			central_nervous_system(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		GTCACTTAATGGGAGGAGTGT	0.637													1	6	---	---	---	---	
INPP4B	8821	broad.mit.edu	37	4	143326271	143326272	+	Intron	INS	-	GGG	GGG			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143326271_143326272insGGG	uc003iix.3	-						INPP4B_uc003iiw.3_Intron|INPP4B_uc011chm.1_Intron|INPP4B_uc011cho.1_Intron	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					GGGGCGGGGGTGGGGGGgaggg	0.332													6	3	---	---	---	---	
IL6ST	3572	broad.mit.edu	37	5	55260199	55260199	+	Intron	DEL	A	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55260199delA	uc003jqq.2	-						IL6ST_uc010iwb.2_Intron|IL6ST_uc010iwc.2_Intron|IL6ST_uc010iwd.2_Intron|IL6ST_uc011cqk.1_Intron|IL6ST_uc003jqr.2_Intron|IL6ST_uc010iwf.1_Intron	NM_002184	NP_002175	P40189	IL6RB_HUMAN	interleukin 6 signal transducer isoform 1						interleukin-6-mediated signaling pathway|leukemia inhibitory factor signaling pathway|negative regulation of interleukin-6-mediated signaling pathway|positive regulation of anti-apoptosis|positive regulation of cardiac muscle hypertrophy|positive regulation of osteoblast differentiation|positive regulation of T cell proliferation|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation vascular endothelial growth factor production	ciliary neurotrophic factor receptor complex|extracellular region|extracellular space|interleukin-6 receptor complex|oncostatin-M receptor complex	ciliary neurotrophic factor receptor activity|ciliary neurotrophic factor receptor binding|growth factor binding|protein homodimerization activity			large_intestine(1)|ovary(1)	2		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				AATTAGAGTGAAAAAAATTAC	0.308			O		hepatocellular ca								4	2	---	---	---	---	
PCDH12	51294	broad.mit.edu	37	5	141328799	141328799	+	Intron	DEL	A	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141328799delA	uc003llx.2	-							NM_016580	NP_057664	Q9NPG4	PCD12_HUMAN	protocadherin 12 precursor						neuron recognition	integral to plasma membrane	calcium ion binding			ovary(3)	3		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			gaccctgtctaaaaaaaaaaa	0.179													5	4	---	---	---	---	
RPS14	6208	broad.mit.edu	37	5	149826951	149826952	+	Intron	INS	-	T	T	rs141773002	by1000genomes	TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149826951_149826952insT	uc003lsh.2	-						RPS14_uc003lsi.2_Intron|RPS14_uc003lsj.2_Intron	NM_001025071	NP_001020242	P62263	RS14_HUMAN	ribosomal protein S14						endocrine pancreas development|erythrocyte differentiation|maturation of SSU-rRNA|negative regulation of transcription from RNA polymerase II promoter|ribosomal small subunit assembly|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	mRNA 5'-UTR binding|protein binding|structural constituent of ribosome|translation regulator activity			central_nervous_system(1)	1		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCATCACGCTGTAAGGACGAAG	0.381													3	3	---	---	---	---	
CCDC99	54908	broad.mit.edu	37	5	169015404	169015404	+	5'UTR	DEL	A	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169015404delA	uc003mae.3	+	2					CCDC99_uc010jjj.2_5'UTR|CCDC99_uc011deq.1_5'UTR|CCDC99_uc010jjk.2_5'UTR	NM_017785	NP_060255	Q96EA4	SPDLY_HUMAN	coiled-coil domain containing 99						cell division|establishment of mitotic spindle orientation|mitotic metaphase plate congression|mitotic prometaphase|protein localization to kinetochore	condensed chromosome outer kinetochore|cytosol|microtubule organizing center|nucleus|spindle pole	kinetochore binding|protein binding			ovary(1)|liver(1)	2	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACAGTTGGCTAAAAAAAAGAA	0.333													30	18	---	---	---	---	
HLA-G	3135	broad.mit.edu	37	6	29894350	29894360	+	Intron	DEL	GGTAGGGGCCC	-	-	rs115025406	by1000genomes	TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29894350_29894360delGGTAGGGGCCC	uc011dmb.1	+						HCG4P6_uc003nog.1_Intron|HCG4P6_uc003noh.1_5'Flank|uc003noi.2_RNA	NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						GCGGGGAGGAGGTAGGGGCCCGCGCACTGGG	0.697													4	10	---	---	---	---	
C6orf10	10665	broad.mit.edu	37	6	32267548	32267549	+	Intron	INS	-	G	G	rs150721951	by1000genomes	TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32267548_32267549insG	uc011dpy.1	-							NM_006781	NP_006772	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10							integral to membrane				skin(1)	1						aaGTGGAGGGCGGGGGGGAACC	0.262													1	5	---	---	---	---	
PSPH	5723	broad.mit.edu	37	7	56088983	56088984	+	Intron	INS	-	C	C	rs148993783	by1000genomes	TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56088983_56088984insC	uc003trg.2	-						PSPH_uc003trh.2_Intron|PSPH_uc003tri.2_Intron|PSPH_uc003trj.2_Intron	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			AAAAGATCCCACCTTGCCTACT	0.351													4	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56193766	56193767	+	IGR	INS	-	T	T	rs149113283	by1000genomes	TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56193766_56193767insT								PSPH (9676 upstream) : DKFZp434L192 (370149 downstream)																							GTTGGTCTTTGTCTCTTAGAAG	0.480													14	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	63033167	63033168	+	IGR	INS	-	GAG	GAG	rs141286287	by1000genomes	TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63033167_63033168insGAG								LOC100287704 (221016 upstream) : ZNF727 (472653 downstream)																							aggaggaggatgaggaggagga	0.277													4	2	---	---	---	---	
GTF2I	2969	broad.mit.edu	37	7	74148109	74148110	+	Intron	INS	-	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74148109_74148110insA	uc003uau.2	+						GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						tccgtctcaggaaaaaaaaaaa	0.139													2	4	---	---	---	---	
RAD54B	25788	broad.mit.edu	37	8	95412414	95412415	+	Intron	INS	-	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95412414_95412415insA	uc003ygk.2	-						RAD54B_uc010may.1_Intron|RAD54B_uc003ygl.1_Intron	NM_012415	NP_036547	O95073	FSBP_HUMAN	RAD54 homolog B						double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			TTACTGATTTGAAAAACTAGAT	0.272								Direct_reversal_of_damage|Homologous_recombination					12	8	---	---	---	---	
MED30	90390	broad.mit.edu	37	8	118535435	118535435	+	Intron	DEL	T	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118535435delT	uc003yoj.2	+						MED30_uc011lib.1_Intron	NM_080651	NP_542382	Q96HR3	MED30_HUMAN	TRAP/Mediator complex component TRAP25						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding				0	all_cancers(13;3.41e-25)|Lung NSC(37;3.02e-05)|Ovarian(258;0.00163)		STAD - Stomach adenocarcinoma(47;0.0266)			CAAAGCCAACTTTTTTTTTTT	0.303													5	3	---	---	---	---	
SCRIB	23513	broad.mit.edu	37	8	144873992	144873993	+	Intron	INS	-	C	C	rs143315468	by1000genomes	TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144873992_144873993insC	uc003yzp.1	-						SCRIB_uc003yzn.1_Intron|SCRIB_uc003yzo.1_Intron	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	scribble isoform b						activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GGCAGGCCAGACCCCACCCCCA	0.678													10	6	---	---	---	---	
MCM10	55388	broad.mit.edu	37	10	13233564	13233567	+	Intron	DEL	AAGC	-	-	rs112703555		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13233564_13233567delAAGC	uc001ima.2	+						MCM10_uc001imb.2_Intron|MCM10_uc001imc.2_Intron	NM_182751	NP_877428	Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						ATAAATAAATaagcaagcaagcaa	0.137													4	2	---	---	---	---	
PRKG1	5592	broad.mit.edu	37	10	52912754	52912754	+	Intron	DEL	G	-	-	rs75959880		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52912754delG	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron|PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		TTTTTTTTTTGTTTTGCTGCC	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130262702	130262703	+	IGR	INS	-	A	A	rs66538679		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130262702_130262703insA								MKI67 (338234 upstream) : None (None downstream)																							cctcctcctccccatccttccc	0.040													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135524666	135524667	+	IGR	INS	-	G	G			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135524666_135524667insG								LOC653544 (29473 upstream) : None (None downstream)																							ggtgagggttagggtgagggtt	0.000													4	2	---	---	---	---	
SOX6	55553	broad.mit.edu	37	11	16036672	16036673	+	Intron	INS	-	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16036672_16036673insA	uc001mme.2	-						SOX6_uc001mmd.2_Intron|SOX6_uc001mmf.2_Intron|SOX6_uc001mmg.2_Intron	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						CTATCTTGCTTAATGGCCAAAA	0.391													5	8	---	---	---	---	
DCDC1	341019	broad.mit.edu	37	11	31349900	31349900	+	Intron	DEL	G	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31349900delG	uc001msv.2	-						DCDC1_uc001msu.1_Intron	NM_181807	NP_861523	P59894	DCDC1_HUMAN	doublecortin domain containing 1						intracellular signal transduction					skin(1)	1	Lung SC(675;0.225)					AATAGAGGCTGGGCATTAAAC	0.303													13	12	---	---	---	---	
SF3B2	10992	broad.mit.edu	37	11	65825456	65825458	+	Intron	DEL	AAG	-	-	rs60074596		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65825456_65825458delAAG	uc001ogy.1	+							NM_006842	NP_006833	Q13435	SF3B2_HUMAN	splicing factor 3B subunit 2						interspecies interaction between organisms	catalytic step 2 spliceosome|nucleoplasm|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(2)|breast(1)	3						aaaaaaaaaaaagaaagaaagaa	0.232													4	2	---	---	---	---	
FMNL3	91010	broad.mit.edu	37	12	50045326	50045327	+	Intron	INS	-	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50045326_50045327insA	uc001ruv.1	-						FMNL3_uc001ruw.1_Intron|FMNL3_uc001rut.1_Intron|FMNL3_uc001ruu.1_Intron	NM_175736	NP_783863	Q8IVF7	FMNL3_HUMAN	formin-like 3 isoform 1						actin cytoskeleton organization		actin binding|Rho GTPase binding			breast(2)|pancreas(2)	4						CTCTGAGAGTTAAAAAAAAAaa	0.267													5	3	---	---	---	---	
GLT8D2	83468	broad.mit.edu	37	12	104396751	104396752	+	Intron	DEL	AG	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104396751_104396752delAG	uc001tkh.1	-						GLT8D2_uc001tki.1_Intron	NM_031302	NP_112592	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2							integral to membrane	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2						agagaaagacagagagagagag	0.000													4	2	---	---	---	---	
GPR81	27198	broad.mit.edu	37	12	123201446	123201447	+	Intron	DEL	AA	-	-	rs35024436		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123201446_123201447delAA	uc001ucw.1	-						GPR109B_uc001ucy.3_5'Flank	NM_032554		Q9BXC0	HCAR1_HUMAN	G protein-coupled receptor 81						response to estradiol stimulus	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.14e-05)|Epithelial(86;3.25e-05)|BRCA - Breast invasive adenocarcinoma(302;0.197)		CGAAATCTCTAAAAAAAAAAAA	0.401													4	2	---	---	---	---	
NDRG2	57447	broad.mit.edu	37	14	21491190	21491191	+	Intron	INS	-	AA	AA			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21491190_21491191insAA	uc001vyy.2	-						NDRG2_uc010tll.1_Intron|NDRG2_uc001vyt.2_5'Flank|NDRG2_uc001vyu.2_Intron|NDRG2_uc001vyv.2_Intron|NDRG2_uc001vyw.2_Intron|NDRG2_uc001vzb.2_Intron|NDRG2_uc001vyx.2_Intron|NDRG2_uc001vza.2_Intron|NDRG2_uc001vyz.2_Intron|NDRG2_uc001vzc.2_Intron|NDRG2_uc001vze.2_Intron|NDRG2_uc001vzd.2_Intron|NDRG2_uc001vzg.2_Intron|NDRG2_uc001vzf.2_Intron|NDRG2_uc010aig.2_Intron	NM_201540	NP_963834	Q9UN36	NDRG2_HUMAN	N-myc downstream-regulated gene 2 isoform a						cell differentiation|nervous system development	centrosome|cytosol|Golgi apparatus|nucleus|perinuclear region of cytoplasm				ovary(1)|breast(1)	2	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		GAAAGAGATTGACAAAGAGAGA	0.460													4	3	---	---	---	---	
SNX6	58533	broad.mit.edu	37	14	35037841	35037841	+	Intron	DEL	T	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35037841delT	uc001wsf.1	-						SNX6_uc001wse.1_Intron|SNX6_uc010tpm.1_Intron|SNX6_uc010amm.1_Intron	NM_152233	NP_689419	Q9UNH7	SNX6_HUMAN	sorting nexin 6 isoform b						cell communication|intracellular protein transport|negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent|negative regulation of transforming growth factor beta receptor signaling pathway|retrograde transport, endosome to Golgi	cytoplasmic vesicle membrane|early endosome membrane|nucleus	phosphatidylinositol binding|protein homodimerization activity				0	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		actcagccTGTTTTTTTTTTT	0.194													5	3	---	---	---	---	
SMOC1	64093	broad.mit.edu	37	14	70351983	70351984	+	Intron	INS	-	T	T			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70351983_70351984insT	uc001xls.1	+						SMOC1_uc001xlt.1_Intron	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN	secreted modular calcium-binding protein 1						cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding			upper_aerodigestive_tract(1)|pancreas(1)	2				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		CGAACAACTTCttttttttttt	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95193579	95193580	+	IGR	INS	-	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95193579_95193580insA								SERPINA13 (80249 upstream) : GSC (40981 downstream)																							ATCAGTTTCTTAAaaaaaaaaa	0.361													4	2	---	---	---	---	
C15orf55	256646	broad.mit.edu	37	15	34646003	34646003	+	Frame_Shift_Del	DEL	C	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34646003delC	uc001zif.2	+	4	1076	c.921delC	c.(919-921)GGCfs	p.G307fs	C15orf55_uc010ucc.1_Frame_Shift_Del_p.G335fs|C15orf55_uc010ucd.1_Frame_Shift_Del_p.G325fs	NM_175741	NP_786883	Q86Y26	NUT_HUMAN	nuclear protein in testis	307						cytoplasm|nucleus			BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	midline_organs(25)|ovary(2)|lung(2)|skin(1)	30		all_lung(180;2.78e-08)		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)		GGTCTCAGGGCCTGTCTCCTG	0.542			T	BRD3|BRD4	lethal midline carcinoma								66	69	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	97170609	97170610	+	IGR	INS	-	CC	CC	rs34979441		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97170609_97170610insCC								NR2F2 (287119 upstream) : SPATA8 (156069 downstream)																							TCACCGCACCGCCCCCCCCTTC	0.421													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	13947872	13947875	+	IGR	DEL	GAAG	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13947872_13947875delGAAG								SHISA9 (613600 upstream) : ERCC4 (66139 downstream)																							tggagtgagagaaggaaggaagga	0.000													4	3	---	---	---	---	
SMG6	23293	broad.mit.edu	37	17	2202012	2202012	+	Intron	DEL	A	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2202012delA	uc002fub.1	-							NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						actccgtcttaaaaaaaaaaa	0.169													5	3	---	---	---	---	
MYH10	4628	broad.mit.edu	37	17	8464961	8464962	+	Intron	INS	-	A	A	rs71359702		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8464961_8464962insA	uc002gll.2	-						MYH10_uc002glm.2_Intron|MYH10_uc010cnx.2_Intron|MYH10_uc010cny.1_Intron	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle						actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						AAATTGTACTTAAAAAAAAAAA	0.371													8	4	---	---	---	---	
TMEM97	27346	broad.mit.edu	37	17	26653806	26653807	+	Frame_Shift_Ins	INS	-	A	A			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26653806_26653807insA	uc002hat.2	+	3	663_664	c.518_519insA	c.(517-519)AGAfs	p.R173fs		NM_014573	NP_055388	Q5BJF2	TMM97_HUMAN	transmembrane protein 97	173	Cytoplasmic (Potential).				cholesterol homeostasis|regulation of cell growth	integral to membrane|lysosome|nuclear membrane|plasma membrane|rough endoplasmic reticulum	protein binding				0	all_lung(13;0.000238)|Lung NSC(42;0.000789)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		GAAGAGAAAAGAAAAAAAAAAT	0.441													53	26	---	---	---	---	
RAPGEFL1	51195	broad.mit.edu	37	17	38347825	38347826	+	Intron	DEL	CC	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38347825_38347826delCC	uc010cwu.1	+						RAPGEFL1_uc010wfd.1_Intron	NM_016339	NP_057423	Q9UHV5	RPGFL_HUMAN	Rap guanine nucleotide exchange factor						G-protein coupled receptor protein signaling pathway|nervous system development|small GTPase mediated signal transduction	intracellular|membrane fraction	guanyl-nucleotide exchange factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3						CCGCCTCCCACCCCCGCAGCTG	0.525													20	11	---	---	---	---	
MYST2	11143	broad.mit.edu	37	17	47893106	47893107	+	Intron	INS	-	TTT	TTT			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47893106_47893107insTTT	uc002ipm.2	+						MYST2_uc002ipl.1_Intron|MYST2_uc010wma.1_Intron|MYST2_uc010wmb.1_Intron|MYST2_uc010wmc.1_Intron|MYST2_uc010wmd.1_Intron|MYST2_uc010wme.1_Intron|MYST2_uc010wmf.1_Intron|MYST2_uc010wmg.1_Intron	NM_007067	NP_008998	O95251	MYST2_HUMAN	MYST histone acetyltransferase 2						DNA replication|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	histone acetyltransferase activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						AATGAAATAGATTAAAAAGTTC	0.317													57	29	---	---	---	---	
SEPT4	5414	broad.mit.edu	37	17	56603935	56603938	+	Intron	DEL	ACAC	-	-	rs112819371		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56603935_56603938delACAC	uc002iwm.1	-						SEPT4_uc002iwk.1_Intron|SEPT4_uc010wnw.1_Intron|SEPT4_uc002iwl.1_5'UTR|SEPT4_uc002iwn.1_Intron|SEPT4_uc002iwo.1_Intron|SEPT4_uc002iwp.1_Intron|SEPT4_uc010wnx.1_Intron|SEPT4_uc010wny.1_Intron|SEPT4_uc010dcy.1_Intron	NM_004574	NP_004565	O43236	SEPT4_HUMAN	septin 4 isoform 1						apoptosis|cell cycle|cytokinesis|regulation of apoptosis	cytoskeleton|mitochondrion|nucleus	GTP binding|GTPase activity|protein binding|structural molecule activity				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)					acacacacaaacacacacacacac	0.422													8	4	---	---	---	---	
HAUS1	115106	broad.mit.edu	37	18	43702272	43702272	+	Intron	DEL	A	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43702272delA	uc002lbu.2	+						HAUS1_uc002lbv.2_Intron	NM_138443	NP_612452	Q96CS2	HAUS1_HUMAN	coiled-coil domain containing 5						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle pole				ovary(1)	1						ctcatctcttaaaaaaaaaaa	0.204													4	2	---	---	---	---	
BSG	682	broad.mit.edu	37	19	580992	581005	+	Intron	DEL	CCCGGACCCAGCCC	-	-	rs12977361		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:580992_581005delCCCGGACCCAGCCC	uc002loz.2	+						BSG_uc002loy.2_Intron|BSG_uc002lpa.2_Intron|BSG_uc002lpb.2_Intron|BSG_uc010drr.2_Intron|BSG_uc002lpc.2_Intron|BSG_uc002lpd.2_5'Flank	NM_001728	NP_001719	P35613	BASI_HUMAN	basigin isoform 1 precursor						blood coagulation|cell surface receptor linked signaling pathway|leukocyte migration|pyruvate metabolic process	Golgi membrane|integral to membrane|melanosome	lactate transmembrane transporter activity|mannose binding|protein binding				0		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACTGGGGGTCCCGGACCCAGCCCTCCGGACTGG	0.729													5	4	---	---	---	---	
EMR3	84658	broad.mit.edu	37	19	14761748	14761748	+	Intron	DEL	T	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14761748delT	uc002mzi.3	-						EMR3_uc010dzp.2_Intron|EMR3_uc010xnv.1_Intron	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						GGAAAATGTCTTTTTTTTTTT	0.413													4	2	---	---	---	---	
AKAP8	10270	broad.mit.edu	37	19	15473194	15473195	+	Intron	INS	-	TT	TT	rs12980485		TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15473194_15473195insTT	uc002nav.2	-						AKAP8_uc010dzy.2_Intron|AKAP8_uc010dzz.1_Intron|AKAP8_uc010xog.1_Intron	NM_005858	NP_005849	O43823	AKAP8_HUMAN	A-kinase anchor protein 8						signal transduction	nuclear matrix				ovary(1)|breast(1)	2						ctctccctctccccacggtctc	0.198													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48305869	48305869	+	IGR	DEL	T	-	-			TCGA-70-6723-01	TCGA-70-6723-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48305869delT								SSX4 (53084 upstream) : SLC38A5 (11059 downstream)																							ATAATACCCATTTTTTTTCTG	0.353													4	2	---	---	---	---	
