Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
PTEN	5728	broad.mit.edu	36	10	89701871	89701871	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:89701871G>A	uc001kfb.1	+	c.509G>A	c.(508-510)AGT>AAT	p.S170N		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	170	Phosphatase tensin-type.		S -> N (loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|S -> R (in BZS; severely reduced protein phosphatase activity; loss of phosphatase activity towards Ins(1,3,4,5)P4).		apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of focal adhesion assembly|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of cyclin-dependent protein kinase activity|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.V166fs*17(3)|p.S170N(3)|p.S170I(3)|p.G165fs*9(3)|p.Y27_N212>Y(2)|p.V166fs*10(1)|p.G165_K342del(1)|p.G165_*404del(1)		endometrium(831)|central_nervous_system(654)|skin(119)|haematopoietic_and_lymphoid_tissue(101)|prostate(97)|large_intestine(90)|breast(67)|lung(63)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(21)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(12)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2308		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)						31		264	TCGA GBM(2;<1E-8)|TSP Lung(26;0.18)			0.843137	152.05891	157.788903	43	8	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)	Missense_Mutation	SNP	89701871	89701871	13192	10	G	A	A	36	36	PTEN	A	2	2
ANO1	55107	broad.mit.edu	36	11	69687062	69687062	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:69687062G>A	uc001opj.1	+	c.1918G>A	c.(1918-1920)GTG>ATG	p.V640M	ANO1_uc001opi.1_Missense_Mutation_p.V614M|ANO1_uc001opk.1_Missense_Mutation_p.V582M|ANO1_uc001opl.1_Non-coding_Transcript	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	transmembrane protein 16A	640	Extracellular (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2														0.37931	30.61597	30.987214	11	18	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69687062	69687062	703	11	G	A	A	40	40	ANO1	A	1	1
STAB2	55576	broad.mit.edu	36	12	102626403	102626403	+	Missense_Mutation	SNP	G	T	T			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:102626403G>T	uc001tjw.1	+	c.4247G>T	c.(4246-4248)TGT>TTT	p.C1416F		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1416	Extracellular (Potential).				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(1)	10														0.230769	31.172851	34.626838	12	40	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	102626403	102626403	15756	12	G	T	T	48	48	STAB2	T	3	3
CACNA1C	775	broad.mit.edu	36	12	2472660	2472660	+	Silent	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:2472660G>A	uc009zdu.1	+	c.960G>A	c.(958-960)ACG>ACA	p.T320T	CACNA1C_uc009zdv.1_Silent_p.T317T|CACNA1C_uc001qkb.2_Silent_p.T320T|CACNA1C_uc001qkc.2_Silent_p.T320T|CACNA1C_uc001qke.2_Silent_p.T320T|CACNA1C_uc001qkf.2_Silent_p.T320T|CACNA1C_uc001qjz.2_Silent_p.T320T|CACNA1C_uc001qkd.2_Silent_p.T320T|CACNA1C_uc001qkg.2_Silent_p.T320T|CACNA1C_uc009zdw.1_Silent_p.T320T|CACNA1C_uc001qkh.2_Silent_p.T320T|CACNA1C_uc001qkl.2_Silent_p.T320T|CACNA1C_uc001qkn.2_Silent_p.T320T|CACNA1C_uc001qko.2_Silent_p.T320T|CACNA1C_uc001qkp.2_Silent_p.T320T|CACNA1C_uc001qkr.2_Silent_p.T320T|CACNA1C_uc001qku.2_Silent_p.T320T|CACNA1C_uc001qkq.2_Silent_p.T320T|CACNA1C_uc001qks.2_Silent_p.T320T|CACNA1C_uc001qkt.2_Silent_p.T320T|CACNA1C_uc001qka.1_5'UTR|CACNA1C_uc001qki.1_Silent_p.T56T|CACNA1C_uc001qkj.1_Silent_p.T56T|CACNA1C_uc001qkk.1_Silent_p.T56T|CACNA1C_uc001qkm.1_Silent_p.T56T	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	320	I.|Extracellular (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11					Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)									0.394366	80.850203	81.552975	28	43	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Silent	SNP	2472660	2472660	2656	12	G	A	A	39	39	CACNA1C	A	1	1
CCDC41	51134	broad.mit.edu	36	12	93286024	93286024	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:93286024C>T	uc001tdd.1	-	c.1133G>A	c.(1132-1134)CGT>CAT	p.R378H	CCDC41_uc001tde.1_Missense_Mutation_p.R378H|CCDC41_uc009zsw.1_Non-coding_Transcript	NM_016122	NP_057206	Q9Y592	CCD41_HUMAN	NY-REN-58 antigen	370	Potential.										0														0.321429	25.866059	26.658586	9	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	93286024	93286024	2935	12	C	T	T	19	19	CCDC41	T	1	1
PCID2	55795	broad.mit.edu	36	13	112900565	112900565	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:112900565C>T	uc001vtc.1	-	c.141G>A	c.(139-141)GAG>GAA	p.E47E	PCID2_uc001vtd.1_5'UTR|PCID2_uc001vte.1_5'UTR|PCID2_uc001vtf.1_5'UTR|PCID2_uc001vtg.1_Non-coding_Transcript	NM_018386	NP_060856	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	47					negative regulation of apoptosis|negative regulation of cysteine-type endopeptidase activity|positive regulation of gene-specific transcription|positive regulation of mitotic cell cycle spindle assembly checkpoint|regulation of mRNA stability|spleen development		protein binding|transcription activator activity				0	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)												0.419355	83.937327	84.289754	26	36	CC		KEEP	---	---	---	---	capture	all cancers(43;0.104)		Silent	SNP	112900565	112900565	11999	13	C	T	T	24	24	PCID2	T	2	2
LRFN5	145581	broad.mit.edu	36	14	41426530	41426530	+	Missense_Mutation	SNP	A	G	G			TCGA-81-5910-01	TCGA-81-5910-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:41426530A>G	uc001wvm.1	+	c.952A>G	c.(952-954)ATT>GTT	p.I318V	LRFN5_uc010ana.1_Missense_Mutation_p.I318V	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	318	Extracellular (Potential).|Ig-like.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8														0.296296	74.076272	77.077592	24	57	AA		KEEP	---	---	---	---	capture	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)	Missense_Mutation	SNP	41426530	41426530	9314	14	A	G	G	4	4	LRFN5	G	4	4
POTEB	339010	broad.mit.edu	36	15	19307269	19307269	+	Missense_Mutation	SNP	C	A	A			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:19307269C>A	uc001ytu.1	-	c.1431G>T	c.(1429-1431)CAG>CAT	p.Q477H	POTEB_uc010axv.1_Non-coding_Transcript	NM_207355	NP_997238	Q6S5H4	POTEB_HUMAN	protein expressed in prostate, ovary, testis,	477											0														0.224	62.62499	71.385887	28	97	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19307269	19307269	12691	15	C	A	A	32	32	POTEB	A	3	3
NDN	4692	broad.mit.edu	36	15	21482831	21482831	+	Silent	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:21482831G>A	uc001ywk.1	-	c.627C>T	c.(625-627)GCC>GCT	p.A209A		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	209	MAGE.				negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)												0.555556	48.230366	48.303738	15	12	GG		KEEP	---	---	---	---	capture		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)	Silent	SNP	21482831	21482831	10646	15	G	A	A	39	39	NDN	A	1	1
ACSM1	116285	broad.mit.edu	36	16	20559284	20559284	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:20559284C>T	uc002dhm.1	-	c.1116G>A	c.(1114-1116)ACG>ACA	p.T372T	ACSM1_uc002dhn.1_Intron|ACSM1_uc010bwg.1_Silent_p.T372T	NM_052956	NP_443188	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member	372					benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			central_nervous_system(1)	1														0.30303	30.037199	31.180098	10	23	CC		KEEP	---	---	---	---	capture			Silent	SNP	20559284	20559284	183	16	C	T	T	23	23	ACSM1	T	1	1
SCNN1B	6338	broad.mit.edu	36	16	23294660	23294660	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:23294660G>A	uc002dln.1	+	c.1253G>A	c.(1252-1254)CGG>CAG	p.R418Q		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	418	Extracellular (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7					Amiloride(DB00594)|Triamterene(DB00384)									0.533333	51.934742	51.968304	16	14	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(48;0.0465)	Missense_Mutation	SNP	23294660	23294660	14410	16	G	A	A	39	39	SCNN1B	A	1	1
MTHFSD	64779	broad.mit.edu	36	16	85143160	85143160	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:85143160C>T	uc002fjn.1	-	c.217G>A	c.(217-219)GTT>ATT	p.V73I	MTHFSD_uc002fjm.1_Missense_Mutation_p.V72I|MTHFSD_uc002fjo.1_Intron|MTHFSD_uc002fjp.2_Missense_Mutation_p.V53I	NM_022764	NP_073601	Q2M296	MTHSD_HUMAN	methenyltetrahydrofolate synthetase domain	73					folic acid-containing compound biosynthetic process		5-formyltetrahydrofolate cyclo-ligase activity|ATP binding|RNA binding				0														0.230769	58.57445	66.343129	27	90	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	85143160	85143160	10326	16	C	T	T	19	19	MTHFSD	T	1	1
USP43	124739	broad.mit.edu	36	17	9556054	9556054	+	Missense_Mutation	SNP	G	C	C			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:9556054G>C	uc010cod.1	+	c.2215G>C	c.(2215-2217)GGG>CGG	p.G739R	USP43_uc002gma.2_Missense_Mutation_p.G428R|USP43_uc010coe.1_Missense_Mutation_p.G536R|USP43_uc002gmc.2_Missense_Mutation_p.G251R	NM_153210	NP_694942	Q70EL4	UBP43_HUMAN	ubiquitin specific protease 43	739					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|central_nervous_system(1)	2														0.3	13.21458	13.891941	6	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9556054	9556054	17638	17	G	C	C	39	39	USP43	C	3	3
SETBP1	26040	broad.mit.edu	36	18	40786156	40786156	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:40786156C>T	uc010dni.1	+	c.2691C>T	c.(2689-2691)CTC>CTT	p.L897L	SETBP1_uc002laz.1_Silent_p.L897L	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	951						nucleus	DNA binding			large_intestine(1)	1														0.530612	83.051413	83.091227	26	23	CC		KEEP	---	---	---	---	capture		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	Silent	SNP	40786156	40786156	14617	18	C	T	T	30	30	SETBP1	T	2	2
LAMA1	284217	broad.mit.edu	36	18	6946725	6946725	+	Silent	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:6946725G>A	uc002knm.1	-	c.8004C>T	c.(8002-8004)GTC>GTT	p.V2668V	LAMA1_uc002knl.1_Silent_p.V121V|LAMA1_uc002knk.1_5'Flank	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2668	Laminin G-like 3.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|breast(2)|pancreas(2)|central_nervous_system(1)	17		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)					1597				0.425	50.131165	50.334256	17	23	GG		KEEP	---	---	---	---	capture			Silent	SNP	6946725	6946725	8928	18	G	A	A	37	37	LAMA1	A	1	1
ZNF536	9745	broad.mit.edu	36	19	35626630	35626630	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:35626630C>T	uc002nsu.1	+	c.321C>T	c.(319-321)AAC>AAT	p.N107N	ZNF536_uc010edd.1_Silent_p.N107N	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	107					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)	9	Esophageal squamous(110;0.0834)													0.428571	24.769459	24.863282	9	12	CC		KEEP	---	---	---	---	capture			Silent	SNP	35626630	35626630	18568	19	C	T	T	19	19	ZNF536	T	1	1
RYR1	6261	broad.mit.edu	36	19	43682116	43682116	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:43682116C>T	uc002oit.1	+	c.7029C>T	c.(7027-7029)GGC>GGT	p.G2343G	RYR1_uc002oiu.1_Silent_p.G2343G|RYR1_uc002oiv.1_Non-coding_Transcript	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2343	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)	10	all_cancers(60;7.91e-06)				Dantrolene(DB01219)									0.272727	13.583255	14.58224	6	16	CC		KEEP	---	---	---	---	capture	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Silent	SNP	43682116	43682116	14248	19	C	T	T	27	27	RYR1	T	1	1
NLRP12	91662	broad.mit.edu	36	19	59004710	59004710	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:59004710G>A	uc002qcj.2	-	c.2015C>T	c.(2014-2016)GCG>GTG	p.A672V	NLRP12_uc010eqw.1_5'Flank|NLRP12_uc002qch.2_Missense_Mutation_p.A672V|NLRP12_uc002qci.2_Missense_Mutation_p.A672V|NLRP12_uc002qck.2_Non-coding_Transcript|NLRP12_uc010eqx.1_Missense_Mutation_p.A672V	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	672					activation of caspase activity|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|lung(1)	5	Ovarian(34;0.19)													0.409091	25.571185	25.72987	9	13	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(134;0.026)	Missense_Mutation	SNP	59004710	59004710	10877	19	G	A	A	38	38	NLRP12	A	1	1
FBN3	84467	broad.mit.edu	36	19	8036913	8036913	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:8036913G>A	uc002mjf.1	-	c.8320C>T	c.(8320-8322)CGG>TGG	p.R2774W	FBN3_uc002mje.1_Missense_Mutation_p.R570W	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	2774						proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|central_nervous_system(1)|pancreas(1)	8														0.638889	70.944187	71.565977	23	13	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8036913	8036913	5940	19	G	A	A	39	39	FBN3	A	1	1
OR6N1	128372	broad.mit.edu	36	1	157002568	157002568	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:157002568C>T	uc001fsx.1	-	c.529G>A	c.(529-531)GTC>ATC	p.V177I		NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N,	177	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)													0.438356	96.065403	96.309169	32	41	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	157002568	157002568	11616	1	C	T	T	19	19	OR6N1	T	1	1
USH2A	7399	broad.mit.edu	36	1	214486582	214486582	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:214486582C>T	uc001hku.1	-	c.2777G>A	c.(2776-2778)CGT>CAT	p.R926H	USH2A_uc001hkv.1_Missense_Mutation_p.R926H	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	926	Laminin EGF-like 8.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|kidney(1)|central_nervous_system(1)	22														0.414286	86.865586	87.313737	29	41	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	Missense_Mutation	SNP	214486582	214486582	17598	1	C	T	T	19	19	USH2A	T	1	1
HMGB4	127540	broad.mit.edu	36	1	34102860	34102860	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:34102860C>T	uc001bxp.1	+	c.481C>T	c.(481-483)CGT>TGT	p.R161C	CSMD2_uc001bxm.1_Intron|CSMD2_uc001bxn.1_Intron|HMGB4_uc001bxq.1_Missense_Mutation_p.R87C|HMGB4_uc009vuj.1_Missense_Mutation_p.R161C	NM_145205	NP_001008728	B2R4X7	B2R4X7_HUMAN	HMG2 like isoform 1	161						nucleus	DNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)												0.387097	35.492	35.838512	12	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	34102860	34102860	7519	1	C	T	T	23	23	HMGB4	T	1	1
STK40	83931	broad.mit.edu	36	1	36593491	36593491	+	Missense_Mutation	SNP	T	C	C			TCGA-81-5910-01	TCGA-81-5910-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:36593491T>C	uc001cal.1	-	c.488A>G	c.(487-489)AAC>AGC	p.N163S	STK40_uc001cak.1_Missense_Mutation_p.N158S|STK40_uc001cam.1_Missense_Mutation_p.N158S|STK40_uc009vva.1_Missense_Mutation_p.N158S|STK40_uc001can.1_Missense_Mutation_p.N158S	NM_032017	NP_114406	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	158	Protein kinase.				protein phosphorylation	cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1		Myeloproliferative disorder(586;0.0393)								230				0.460733	302.450517	302.709016	88	103	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36593491	36593491	15827	1	T	C	C	60	60	STK40	C	4	4
IFI44L	10964	broad.mit.edu	36	1	78867243	78867243	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:78867243C>T	uc001dio.2	+	c.381C>T	c.(379-381)GAC>GAT	p.D127D		NM_006820	NP_006811	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	166						cytoplasm					0														0.441176	46.420513	46.523033	15	19	CC		KEEP	---	---	---	---	capture			Silent	SNP	78867243	78867243	7819	1	C	T	T	19	19	IFI44L	T	1	1
RRBP1	6238	broad.mit.edu	36	20	17588820	17588820	+	Silent	SNP	T	G	G			TCGA-81-5910-01	TCGA-81-5910-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr20:17588820T>G	uc002wpv.1	-	c.333A>C	c.(331-333)CCA>CCC	p.P111P	RRBP1_uc002wpu.2_5'Flank|RRBP1_uc002wpw.1_Silent_p.P111P|RRBP1_uc010gcl.1_Intron|RRBP1_uc002wpx.2_Silent_p.P111P|RRBP1_uc002wpy.2_Silent_p.P111P	NM_001042576	NP_004578	Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	559	Cytoplasmic (Potential).|37.|41 X 10 AA approximate tandem repeats of [TN]-Q-[GSA]-[KRQT]-K-[ATGSV]-[ED]- [GTAS]-[ATIS]-[PQTAS].				protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1														0.416667	10.35288	10.429528	5	7	TT		KEEP	---	---	---	---	capture			Silent	SNP	17588820	17588820	14158	20	T	G	G	55	55	RRBP1	G	4	4
MYH9	4627	broad.mit.edu	36	22	35044275	35044275	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:35044275C>T	uc003apg.1	-	c.1150G>A	c.(1150-1152)GAT>AAT	p.D384N	MYH9_uc003aph.1_Missense_Mutation_p.D248N	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	384	Myosin head-like.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	10										1624				0.438356	193.27998	193.763285	64	82	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35044275	35044275	10437	22	C	T	T	31	31	MYH9	T	1	1
CELSR1	9620	broad.mit.edu	36	22	45207988	45207988	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:45207988C>T	uc003bhw.1	-	c.4577G>A	c.(4576-4578)CGG>CAG	p.R1526Q		NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	1526	Extracellular (Potential).|Laminin G-like 1.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			pancreas(2)|skin(1)	3		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)												0.1875	7.016205	8.478671	3	13	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)	Missense_Mutation	SNP	45207988	45207988	3354	22	C	T	T	23	23	CELSR1	T	1	1
XIRP2	129446	broad.mit.edu	36	2	167808356	167808356	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:167808356C>T	uc002udx.1	+	c.2208C>T	c.(2206-2208)TTC>TTT	p.F736F	XIRP2_uc010fpn.1_Intron|XIRP2_uc010fpo.1_Intron|XIRP2_uc010fpp.1_Intron|XIRP2_uc002udy.2_Silent_p.F561F|XIRP2_uc010fpq.1_Silent_p.F514F|XIRP2_uc010fpr.1_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	561	Xin 6.				actin cytoskeleton organization	cell junction	actin binding			ovary(6)|pancreas(1)|skin(1)	8														0.526316	64.649989	64.677934	20	18	CC		KEEP	---	---	---	---	capture			Silent	SNP	167808356	167808356	18011	2	C	T	T	31	31	XIRP2	T	1	1
LRP2	4036	broad.mit.edu	36	2	169853794	169853794	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:169853794G>A	uc002ues.1	-	c.1030C>T	c.(1030-1032)CGT>TGT	p.R344C		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	344	EGF-like 1.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	23					Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)					2055				0.407895	95.173679	95.71812	31	45	GG		KEEP	---	---	---	---	capture		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Missense_Mutation	SNP	169853794	169853794	9329	2	G	A	A	39	39	LRP2	A	1	1
TTN	7273	broad.mit.edu	36	2	179206440	179206440	+	Silent	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179206440G>A	uc002umr.1	-	c.35187C>T	c.(35185-35187)GGC>GGT	p.G11729G	TTN_uc002ums.1_Silent_p.G5424G|TTN_uc010frc.1_Silent_p.G5357G|TTN_uc010frd.1_Silent_p.G5232G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12656										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153									p.G11729G(NCIH2110-Tumor)	8722				0.608696	84.800707	85.27545	28	18	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		Silent	SNP	179206440	179206440	17290	2	G	A	A	38	38	TTN	A	1	1
MPP4	58538	broad.mit.edu	36	2	202253872	202253872	+	Missense_Mutation	SNP	T	G	G			TCGA-81-5910-01	TCGA-81-5910-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:202253872T>G	uc002uyk.2	-	c.863A>C	c.(862-864)CAG>CCG	p.Q288P	MPP4_uc010ftj.1_Missense_Mutation_p.Q288P|MPP4_uc002uyj.2_Missense_Mutation_p.Q244P|MPP4_uc002uyl.2_Non-coding_Transcript|MPP4_uc010ftk.1_Missense_Mutation_p.Q275P|MPP4_uc002uym.1_Missense_Mutation_p.Q257P|MPP4_uc002uyn.2_Missense_Mutation_p.Q244P	NM_033066	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4	288	SH3.					cytoplasm	protein binding				0												OREG0015145	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.5	30.148281	30.148281	10	10	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	202253872	202253872	10128	2	T	G	G	55	55	MPP4	G	4	4
PAX3	5077	broad.mit.edu	36	2	222775136	222775136	+	Silent	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:222775136G>A	uc002vmt.1	-	c.1191C>T	c.(1189-1191)ACC>ACT	p.T397T	PAX3_uc002vmy.1_Silent_p.T396T|PAX3_uc002vmv.1_Silent_p.T397T|PAX3_uc002vmw.1_Intron|PAX3_uc002vmx.1_Intron|PAX3_uc010fwo.1_Silent_p.T397T	NM_181459	NP_852124	P23760	PAX3_HUMAN	paired box 3 isoform PAX3e	397					apoptosis|organ morphogenesis|positive regulation of gene-specific transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription activator activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)	765		Renal(207;0.0183)								141				0.333333	8.12097	8.342891	3	6	GG		KEEP	---	---	---	---	capture		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Silent	SNP	222775136	222775136	11900	2	G	A	A	47	47	PAX3	A	2	2
AFF3	3899	broad.mit.edu	36	2	99576286	99576286	+	Missense_Mutation	SNP	G	C	C	rs56151323	unknown	TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:99576286G>C	uc002taf.1	-	c.2344C>G	c.(2344-2346)CTA>GTA	p.L782V	AFF3_uc002tag.1_Missense_Mutation_p.L757V|AFF3_uc010fiq.1_Missense_Mutation_p.L757V|AFF3_uc002tah.1_Missense_Mutation_p.L782V	NM_001025108	NP_001020279	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 2	757					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6										693				0.416667	67.60191	67.890133	20	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99576286	99576286	359	2	G	C	C	33	33	AFF3	C	3	3
STXBP5L	9515	broad.mit.edu	36	3	122458859	122458859	+	Missense_Mutation	SNP	T	G	G			TCGA-81-5910-01	TCGA-81-5910-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr3:122458859T>G	uc003eec.2	+	c.1821T>G	c.(1819-1821)ATT>ATG	p.I607M		NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	607	WD 9.				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)	7														0.276923	57.223816	60.133557	18	47	TT		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(114;0.0694)	Missense_Mutation	SNP	122458859	122458859	15877	3	T	G	G	62	62	STXBP5L	G	4	4
TGM4	7047	broad.mit.edu	36	3	44901941	44901941	+	Missense_Mutation	SNP	T	G	G			TCGA-81-5910-01	TCGA-81-5910-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr3:44901941T>G	uc003coc.2	+	c.140T>G	c.(139-141)GTG>GGG	p.V47G	TGM4_uc003coa.2_Missense_Mutation_p.V47G|TGM4_uc003cob.2_Non-coding_Transcript	NM_003241	NP_003232	P49221	TGM4_HUMAN	transglutaminase 4 (prostate)	47					peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(1)	1					L-Glutamine(DB00130)									0.266667	8.292614	9.031076	4	11	TT		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	Missense_Mutation	SNP	44901941	44901941	16360	3	T	G	G	59	59	TGM4	G	4	4
CRELD1	78987	broad.mit.edu	36	3	9951243	9951243	+	Missense_Mutation	SNP	C	A	A			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:9951243C>A	uc003buf.1	+	c.121C>A	c.(121-123)CCT>ACT	p.P41T	CIDEC_uc003bto.1_Intron|CRELD1_uc003bug.1_Missense_Mutation_p.P41T|CRELD1_uc003buh.1_Missense_Mutation_p.P41T|CRELD1_uc003bui.1_Missense_Mutation_p.P41T|CRELD1_uc003buj.1_Non-coding_Transcript	NM_001031717	NP_001026887	Q96HD1	CREL1_HUMAN	cysteine-rich with EGF-like domains 1 isoform 1	41	Pro-rich.|Extracellular (Potential).				cardiac septum development|endocardial cushion development	integral to membrane	calcium ion binding			ovary(1)	1														0.37037	27.641508	28.040743	10	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9951243	9951243	4005	3	C	A	A	26	26	CRELD1	A	3	3
ANAPC4	29945	broad.mit.edu	36	4	25025107	25025107	+	Splice_Site_SNP	SNP	T	C	C			TCGA-81-5910-01	TCGA-81-5910-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:25025107T>C	uc003gro.1	+	c.1685_splice	c.e23+2	p.S562_splice	ANAPC4_uc003grp.1_Splice_Site_SNP_p.S448_splice|ANAPC4_uc003grq.1_Splice_Site_SNP_p.S15_splice	NM_013367	NP_037499			anaphase-promoting complex subunit 4						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	ubiquitin-protein ligase activity			ovary(2)|large_intestine(1)|pancreas(1)	4		Breast(46;0.0503)												0.423077	37.4239	37.557353	11	15	TT		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	25025107	25025107	607	4	T	C	C	57	57	ANAPC4	C	5	4
KDR	3791	broad.mit.edu	36	4	55641068	55641068	+	Missense_Mutation	SNP	T	G	G	rs66480054	unknown	TCGA-81-5910-01	TCGA-81-5910-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:55641068T>G	uc003has.1	-	c.3868A>C	c.(3868-3870)AGC>CGC	p.S1290R	KDR_uc003hat.1_Missense_Mutation_p.S1290R	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III	1290	Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|protein phosphorylation|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(9)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|ovary(2)|kidney(1)	22	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)				Sorafenib(DB00398)|Sunitinib(DB01268)					1022	TSP Lung(20;0.16)			0.34	54.860417	55.991563	17	33	TT		KEEP	---	---	---	---	capture	Epithelial(7;0.189)		Missense_Mutation	SNP	55641068	55641068	8445	4	T	G	G	56	56	KDR	G	4	4
CARD6	84674	broad.mit.edu	36	5	40889217	40889217	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:40889217G>A	uc003jmg.1	+	c.2026G>A	c.(2026-2028)GCT>ACT	p.A676T		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	676					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5														0.432692	136.020214	136.417291	45	59	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40889217	40889217	2769	5	G	A	A	42	42	CARD6	A	2	2
BVES	11149	broad.mit.edu	36	6	105683987	105683987	+	Missense_Mutation	SNP	T	C	C			TCGA-81-5910-01	TCGA-81-5910-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:105683987T>C	uc003pqw.1	-	c.311A>G	c.(310-312)AAC>AGC	p.N104S	BVES_uc003pqx.1_Missense_Mutation_p.N104S|BVES_uc003pqy.1_Missense_Mutation_p.N104S	NM_147147	NP_671488	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance isoform 5	104	Helical; (Potential).				epithelial cell-cell adhesion|muscle organ development|positive regulation of locomotion|positive regulation of receptor recycling|regulation of Cdc42 GTPase activity|regulation of cell shape|regulation of Rac GTPase activity|substrate adhesion-dependent cell spreading|vesicle-mediated transport	integral to membrane|lateral plasma membrane|tight junction	structural molecule activity				0		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)												0.435897	60.172058	60.311284	17	22	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	105683987	105683987	1609	6	T	C	C	60	60	BVES	C	4	4
FBXL13	222235	broad.mit.edu	36	7	102457093	102457093	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:102457093C>T	uc003vaq.2	-	c.9G>A	c.(7-9)CCG>CCA	p.P3P	FBXL13_uc010lir.1_Silent_p.P3P|FBXL13_uc003var.2_Non-coding_Transcript|FBXL13_uc003vas.2_Silent_p.P3P|FBXL13_uc003vav.2_Non-coding_Transcript	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13 isoform	3											0														0.181818	8.686798	10.779054	4	18	CC		KEEP	---	---	---	---	capture			Silent	SNP	102457093	102457093	5946	7	C	T	T	23	23	FBXL13	T	1	1
RELN	5649	broad.mit.edu	36	7	103021405	103021405	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:103021405C>T	uc003vca.1	-	c.3872G>A	c.(3871-3873)CGA>CAA	p.R1291Q	RELN_uc010liz.1_Missense_Mutation_p.R1291Q	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	1291					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|large_intestine(2)|central_nervous_system(2)|pancreas(1)|skin(1)	14						NSCLC(146;835 1944 15585 22231 52158)								0.240602	82.437244	90.601135	32	101	CC		KEEP	---	---	---	---	capture		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	Missense_Mutation	SNP	103021405	103021405	13689	7	C	T	T	31	31	RELN	T	1	1
NOBOX	135935	broad.mit.edu	36	7	143729487	143729487	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:143729487C>T	uc003wen.1	-	c.429G>A	c.(427-429)CCG>CCA	p.P143P		NM_001080413	NP_001073882			NOBOX oogenesis homeobox											ovary(1)	1	Melanoma(164;0.14)													0.25	22.225881	24.503388	10	30	CC		KEEP	---	---	---	---	capture			Silent	SNP	143729487	143729487	10915	7	C	T	T	27	27	NOBOX	T	1	1
EGFR	1956	broad.mit.edu	36	7	55189204	55189204	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:55189204C>T	uc003tqk.1	+	c.754C>T	c.(754-756)CGC>TGC	p.R252C	EGFR_uc003tqh.1_Missense_Mutation_p.R252C|EGFR_uc003tqi.1_Missense_Mutation_p.R252C|EGFR_uc003tqj.1_Missense_Mutation_p.R252C|EGFR_uc010kzg.1_Missense_Mutation_p.R207C	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	252	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(10)|p.R252C(1)		lung(8200)|central_nervous_system(103)|upper_aerodigestive_tract(37)|prostate(32)|ovary(31)|thyroid(23)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|stomach(6)|urinary_tract(6)|skin(5)|adrenal_gland(5)|kidney(4)|soft_tissue(4)|bone(3)|NS(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)|pancreas(1)	8515	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)				Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)			8		608	TCGA GBM(3;<1E-8)|TSP Lung(4;<1E-8)			0.105932	74.954202	184.140175	75	633	CC		KEEP	---	---	---	---	capture	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Missense_Mutation	SNP	55189204	55189204	5156	7	C	T	T	23	23	EGFR	T	1	1
SUMF2	25870	broad.mit.edu	36	7	56108284	56108284	+	Missense_Mutation	SNP	A	C	C			TCGA-81-5910-01	TCGA-81-5910-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:56108284A>C	uc003trp.1	+	c.334A>C	c.(334-336)ACC>CCC	p.T112P	PSPH_uc003trj.1_Intron|SUMF2_uc003tro.1_Missense_Mutation_p.T128P|SUMF2_uc003trq.1_Missense_Mutation_p.T109P|SUMF2_uc003trr.1_Missense_Mutation_p.T109P|SUMF2_uc003trs.1_Missense_Mutation_p.T109P|SUMF2_uc003trt.1_Missense_Mutation_p.T21P|SUMF2_uc003tru.1_Non-coding_Transcript|SUMF2_uc003trv.1_Missense_Mutation_p.T128P|SUMF2_uc003trw.1_Intron|SUMF2_uc003trx.1_Non-coding_Transcript	NM_001042468	NP_001035933	Q8NBJ7	SUMF2_HUMAN	sulfatase modifying factor 2 isoform a	109						endoplasmic reticulum lumen	metal ion binding			ovary(1)	1	Breast(14;0.214)													0.346154	9.187778	9.860691	9	17	AA		KEEP	---	---	---	---	capture	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		Missense_Mutation	SNP	56108284	56108284	15906	7	A	C	C	6	6	SUMF2	C	4	4
MCM7	4176	broad.mit.edu	36	7	99529825	99529825	+	Silent	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:99529825G>A	uc003usw.1	-	c.1755C>T	c.(1753-1755)TAC>TAT	p.Y585Y	MCM7_uc003usv.1_Silent_p.Y409Y|MCM7_uc003usx.1_Silent_p.Y409Y|MIR25_hsa-mir-25|MI0000082_5'Flank|MIR93_hsa-mir-93|MI0000095_5'Flank|MIR106B_hsa-mir-106b|MI0000734_5'Flank	NM_005916	NP_005907	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	585	Interaction with ATRIP.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of phosphorylation|response to DNA damage stimulus|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				Atorvastatin(DB01076)									0.263736	58.765746	63.35501	24	67	GG		KEEP	---	---	---	---	capture			Silent	SNP	99529825	99529825	9781	7	G	A	A	40	40	MCM7	A	1	1
OR13F1	138805	broad.mit.edu	36	9	106307031	106307031	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:106307031G>A	uc004bbz.1	+	c.667G>A	c.(667-669)GCC>ACC	p.A223T		NM_001004485	NP_001004485	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F,	223	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2														0.457627	157.946923	158.129538	54	64	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	106307031	106307031	11347	9	G	A	A	38	38	OR13F1	A	1	1
RALGDS	5900	broad.mit.edu	36	9	134965535	134965535	+	Missense_Mutation	SNP	T	C	C			TCGA-81-5910-01	TCGA-81-5910-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:134965535T>C	uc004cco.1	-	c.2510A>G	c.(2509-2511)AAC>AGC	p.N837S	RALGDS_uc004ccs.1_Missense_Mutation_p.N782S|RALGDS_uc004ccn.1_Missense_Mutation_p.N25S|RALGDS_uc004ccp.1_Non-coding_Transcript|RALGDS_uc004ccq.1_Missense_Mutation_p.N825S|RALGDS_uc004ccr.1_Missense_Mutation_p.N836S|RALGDS_uc004cct.1_5'Flank|RALGDS_uc004ccu.1_3'UTR|RALGDS_uc004ccv.1_3'UTR	NM_006266	NP_006257	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	837	Ras-associating.				nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	Ral guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)	2						Melanoma(189;762 2088 15384 21931 52515)				815				0.376	160.073132	161.729845	47	78	TT		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)	Missense_Mutation	SNP	134965535	134965535	13476	9	T	C	C	60	60	RALGDS	C	4	4
FREM1	158326	broad.mit.edu	36	9	14838723	14838723	+	Missense_Mutation	SNP	T	A	A			TCGA-81-5910-01	TCGA-81-5910-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:14838723T>A	uc003zlm.1	-	c.1201A>T	c.(1201-1203)ACA>TCA	p.T401S	FREM1_uc010mic.1_Non-coding_Transcript	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	401	CSPG 2.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5														0.741935	75.938282	77.582495	23	8	TT		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(50;3.53e-06)	Missense_Mutation	SNP	14838723	14838723	6291	9	T	A	A	58	58	FREM1	A	4	4
C9orf66	157983	broad.mit.edu	36	9	205042	205042	+	Missense_Mutation	SNP	C	A	A			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:205042C>A	uc003zge.2	-	c.355G>T	c.(355-357)GGG>TGG	p.G119W	DOCK8_uc003zgf.1_Intron	NM_152569	NP_689782	Q5T8R8	CI066_HUMAN	hypothetical protein LOC157983	119										central_nervous_system(1)	1	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)												0.5	10.190512	10.190512	4	4	CC		KEEP	---	---	---	---	capture	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)	Missense_Mutation	SNP	205042	205042	2606	9	C	A	A	22	22	C9orf66	A	3	3
STAG2	10735	broad.mit.edu	36	X	122999097	122999097	+	Nonsense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:122999097C>T	uc004eua.1	+	c.328C>T	c.(328-330)CGA>TGA	p.R110*	STAG2_uc004etz.2_Nonsense_Mutation_p.R110*|STAG2_uc004eub.1_Nonsense_Mutation_p.R110*|STAG2_uc004euc.1_Nonsense_Mutation_p.R110*|STAG2_uc004eud.1_Nonsense_Mutation_p.R110*|STAG2_uc004eue.1_Nonsense_Mutation_p.R110*	NM_001042749	NP_001036215	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform a	110					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5														0.866667	87.761279	91.671741	26	4	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	122999097	122999097	15761	23	C	T	T	23	23	STAG2	T	5	1
PHKA2	5256	broad.mit.edu	36	X	18825301	18825301	+	Silent	SNP	A	C	C			TCGA-81-5910-01	TCGA-81-5910-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:18825301A>C	uc004cyv.2	-	c.3183T>G	c.(3181-3183)GGT>GGG	p.G1061G	PHKA2_uc004cyu.2_Silent_p.G367G|PHKA2_uc010nfe.1_Silent_p.G93G|PHKA2_uc010nff.1_Non-coding_Transcript	NM_000292	NP_000283	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	1061	Calmodulin-binding (Potential).				glucose metabolic process|glycogen catabolic process|protein modification process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)													0.277778	6.931511	7.76288	5	13	AA		KEEP	---	---	---	---	capture			Silent	SNP	18825301	18825301	12268	23	A	C	C	6	6	PHKA2	C	4	4
KRTAP5-5	439915	broad.mit.edu	36	11	1608162	1608191	+	In_Frame_Del	DEL	CTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	-	-			TCGA-81-5910-01	TCGA-81-5910-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:1608162_1608191delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	uc001lty.1	+	c.516_545delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	c.(514-546)TCCTGCTGCCAGTCCAGCTGCTGTAAGCCTTAC>TCC	p.CCQSSCCKPY183del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	183_192	8 X 4 AA repeats of C-C-X-P.					keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)										0.63			38	22				---	---	---	---	capture_indel			In_Frame_Del	DEL	1608162	1608191	8886	11	CTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	-	-	24	24	KRTAP5-5	-	5	5
TSC22D1	8848	broad.mit.edu	36	13	43908189	43908202	+	Frame_Shift_Del	DEL	CTCGATTTTGTTGT	-	-			TCGA-81-5910-01	TCGA-81-5910-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:43908189_43908202delCTCGATTTTGTTGT	uc001uzn.2	-	c.2942_2955delACAACAAAATCGAG	c.(2941-2955)GACAACAAAATCGAGfs	p.D981fs	TSC22D1_uc001uzo.1_Intron|TSC22D1_uc001uzm.2_Frame_Shift_Del_p.D52fs	NM_183422	NP_904358	Q15714	T22D1_HUMAN	TSC22 domain family, member 1 isoform 1	981_985					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)										0.31			4	9				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	43908189	43908202	17158	13	CTCGATTTTGTTGT	-	-	28	28	TSC22D1	-	5	5
CTPS	1503	broad.mit.edu	36	1	41234291	41234292	+	Frame_Shift_Ins	INS	-	A	A			TCGA-81-5910-01	TCGA-81-5910-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:41234291_41234292insA	uc001cgk.2	+	c.836_837insA	c.(835-837)AGAfs	p.R279fs	CTPS_uc001cgl.2_Frame_Shift_Ins_p.R279fs|CTPS_uc009vwe.1_5'UTR	NM_001905	NP_001896	P17812	PYRG1_HUMAN	CTP synthase	279					CTP biosynthetic process|glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|response to drug	cytosol	ATP binding|CTP synthase activity|protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)			L-Glutamine(DB00130)									0.47			19	21				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	41234291	41234292	4181	1	-	A	A	33	33	CTPS	A	5	5
