Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
Unknown	0	broad.mit.edu	37	1	1853772	1853772	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1853772T>C	uc001aik.2	-	11	1722	c.872A>G	c.(871-873)GAG>GGG	p.E291G	uc001ail.2_Missense_Mutation_p.E291G					RecName: Full=Uncharacterized protein C1orf222;																		CTTGTAGGTCTCCTTCACATC	0.617													13	64	---	---	---	---	PASS
C1orf93	127281	broad.mit.edu	37	1	2520063	2520063	+	Missense_Mutation	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2520063A>C	uc001aju.1	+	5	535	c.459A>C	c.(457-459)AAA>AAC	p.K153N	C1orf93_uc001ajw.1_Missense_Mutation_p.K153N|C1orf93_uc001ajv.1_Missense_Mutation_p.K171N|C1orf93_uc010nzd.1_Missense_Mutation_p.K160T|C1orf93_uc010nze.1_Intron|C1orf93_uc010nzf.1_Intron|C1orf93_uc001ajx.1_Silent_p.R37R	NM_152371	NP_689584	Q8TBF2	PGFS_HUMAN	hypothetical protein LOC127281	153					prostaglandin biosynthetic process	cytosol	oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor			central_nervous_system(1)	1	all_cancers(77;0.000167)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.97e-16)|all_lung(118;3.05e-07)|Lung NSC(185;2.8e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Lung SC(97;0.109)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		Epithelial(90;4.76e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.19e-23)|GBM - Glioblastoma multiforme(42;1.13e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.00205)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.199)		TGGTCAGCAAAGGTGGGTCGA	0.637													41	170	---	---	---	---	PASS
PTCHD2	57540	broad.mit.edu	37	1	11589694	11589694	+	Silent	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11589694C>A	uc001ash.3	+	14	3018	c.2880C>A	c.(2878-2880)TCC>TCA	p.S960S		NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	960	Extracellular (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TGCTTAGCTCCAGCCCCGATG	0.627													8	58	---	---	---	---	PASS
AGMAT	79814	broad.mit.edu	37	1	15905419	15905419	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15905419C>T	uc001awv.1	-	4	798	c.655G>A	c.(655-657)GTG>ATG	p.V219M	DNAJC16_uc001awu.2_Intron	NM_024758	NP_079034	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase) precursor	219					putrescine biosynthetic process|spermidine biosynthetic process	mitochondrion	agmatinase activity|metal ion binding			skin(1)	1		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		ATCTGCACCACACGCTTACAG	0.627													5	36	---	---	---	---	PASS
SLC25A34	284723	broad.mit.edu	37	1	16064496	16064496	+	Intron	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16064496C>T	uc001axb.1	+						SLC25A34_uc009vok.1_5'Flank	NM_207348	NP_997231	Q6PIV7	S2534_HUMAN	solute carrier family 25, member 34						transport	integral to membrane|mitochondrial inner membrane					0		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCAGGTGAGGCCTGCCACTCT	0.637													17	23	---	---	---	---	PASS
ZBTB17	7709	broad.mit.edu	37	1	16269916	16269916	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16269916C>T	uc001axl.3	-	12	1914	c.1675G>A	c.(1675-1677)GTC>ATC	p.V559I	ZBTB17_uc010obq.1_Missense_Mutation_p.V476I|ZBTB17_uc010obr.1_Missense_Mutation_p.V559I|ZBTB17_uc010obs.1_Missense_Mutation_p.V483I	NM_003443	NP_003434	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17	559	C2H2-type 10.				negative regulation of cell cycle	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		CGCTCGCAGACGTAGGGCTTC	0.657													11	90	---	---	---	---	PASS
KIF17	57576	broad.mit.edu	37	1	21014254	21014254	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21014254G>T	uc001bdr.3	-	8	1683	c.1565C>A	c.(1564-1566)GCG>GAG	p.A522E	KIF17_uc001bdp.3_5'Flank|KIF17_uc001bdq.3_5'Flank|KIF17_uc009vpx.2_Intron|KIF17_uc001bds.3_Missense_Mutation_p.A522E	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	522					microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		GGGCAGCTCCGCAAACCTGGA	0.542													27	86	---	---	---	---	PASS
ALPL	249	broad.mit.edu	37	1	21904050	21904050	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21904050G>A	uc001bet.2	+	12	1741	c.1484G>A	c.(1483-1485)GGC>GAC	p.G495D	ALPL_uc010odn.1_Missense_Mutation_p.G443D|ALPL_uc010odo.1_Missense_Mutation_p.G440D|ALPL_uc010odp.1_Missense_Mutation_p.G418D|ALPL_uc001beu.3_Missense_Mutation_p.G495D	NM_000478	NP_000469	P05186	PPBT_HUMAN	tissue-nonspecific alkaline phosphatase	495					response to vitamin D|skeletal system development	anchored to membrane|cytoplasm|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)	GCCAACCTCGGCCACTGTGCT	0.687													11	15	---	---	---	---	PASS
EPHB2	2048	broad.mit.edu	37	1	23191524	23191524	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23191524C>T	uc009vqj.1	+	5	1267	c.1122C>T	c.(1120-1122)CGC>CGT	p.R374R	EPHB2_uc001bge.2_Silent_p.R374R|EPHB2_uc001bgf.2_Silent_p.R374R|EPHB2_uc010odu.1_Silent_p.R374R|hsa-mir-4253|MI0015860_5'Flank	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor	374	Extracellular (Potential).|Fibronectin type-III 1.				axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		CCTGCACCCGCTGCGGGGACA	0.637									Hereditary_Prostate_Cancer				4	81	---	---	---	---	PASS
SERINC2	347735	broad.mit.edu	37	1	31906004	31906004	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31906004G>T	uc010ogh.1	+	9	1417	c.1216G>T	c.(1216-1218)GTC>TTC	p.V406F	SERINC2_uc010ogg.1_Missense_Mutation_p.V403F|SERINC2_uc001bst.2_Missense_Mutation_p.V402F|SERINC2_uc001bsu.2_Missense_Mutation_p.V347F|SERINC2_uc001bsv.2_Missense_Mutation_p.V347F	NM_178865	NP_849196	Q96SA4	SERC2_HUMAN	tumor differentially expressed 2-like	403	Helical; (Potential).					integral to membrane					0		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		CTCACTGCACGTCATGATGAC	0.627													17	57	---	---	---	---	PASS
ADC	113451	broad.mit.edu	37	1	33557648	33557648	+	Intron	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33557648T>C	uc001bwr.2	+						ADC_uc001bws.2_Intron|ADC_uc009vue.2_Intron|ADC_uc001bwt.1_Intron|ADC_uc001bwu.2_Intron|ADC_uc001bwv.2_Intron|ADC_uc001bww.2_Intron|ADC_uc001bwx.1_Intron|ADC_uc001bwz.1_Intron|ADC_uc009vuf.1_Intron|ADC_uc001bwy.1_Intron|ADC_uc009vug.2_Intron	NM_052998	NP_443724	Q96A70	ADC_HUMAN	ODC antizyme inhibitor-2						polyamine biosynthetic process|spermatogenesis	cytosol	arginine decarboxylase activity			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)			L-Arginine(DB00125)|Pyridoxal Phosphate(DB00114)	TGGGGCCCCATAGGCAGAGAT	0.532													41	71	---	---	---	---	PASS
HMGB4	127540	broad.mit.edu	37	1	34330145	34330145	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34330145G>C	uc001bxp.2	+	2	2096	c.353G>C	c.(352-354)TGG>TCG	p.W118S	CSMD2_uc001bxm.1_Intron|CSMD2_uc001bxn.1_Intron|HMGB4_uc001bxq.2_Missense_Mutation_p.W44S	NM_145205	NP_660206	Q8WW32	HMGB4_HUMAN	HMG2 like isoform 1	118						nucleus	DNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AACCCGAACTGGTCGGTGGTG	0.577													15	73	---	---	---	---	PASS
EIF2C3	192669	broad.mit.edu	37	1	36411284	36411284	+	Intron	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36411284C>T	uc001bzp.2	+						EIF2C3_uc001bzn.1_Intron|EIF2C3_uc001bzo.2_Intron|EIF2C3_uc001bzq.2_Intron	NM_024852	NP_079128	Q9H9G7	AGO3_HUMAN	eukaryotic translation initiation factor 2C, 3						mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTTCCCTTTCCCCTGGCAGGA	0.473													67	103	---	---	---	---	PASS
THRAP3	9967	broad.mit.edu	37	1	36759544	36759544	+	Intron	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36759544G>A	uc001cae.3	+						THRAP3_uc001caf.3_Intron	NM_005119	NP_005110	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ATP binding|ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(5)|lung(3)|breast(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AAGGTGAACTGTTGATTTGAT	0.373			T	USP6	aneurysmal bone cysts								4	72	---	---	---	---	PASS
GRIK3	2899	broad.mit.edu	37	1	37270665	37270665	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37270665C>A	uc001caz.2	-	15	2623	c.2488G>T	c.(2488-2490)GCC>TCC	p.A830S	GRIK3_uc001cba.1_Missense_Mutation_p.A830S	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	830	Helical; (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	ACCAGCCCGGCGGCCAGGACA	0.607													39	58	---	---	---	---	PASS
IPO13	9670	broad.mit.edu	37	1	44415611	44415611	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44415611C>A	uc001ckx.2	+	2	1402	c.607C>A	c.(607-609)CCG>ACG	p.P203T		NM_014652	NP_055467	O94829	IPO13_HUMAN	importin 13	203	HEAT 2.				protein import into nucleus	cytoplasm|nucleus	protein binding|protein transporter activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				GGCTGTCTTCCCGCTGCTGGA	0.637													5	16	---	---	---	---	PASS
ERI3	79033	broad.mit.edu	37	1	44687311	44687311	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44687311G>A	uc001clt.2	-	9	1174	c.933C>T	c.(931-933)GAC>GAT	p.D311D	ERI3_uc010okv.1_Silent_p.D134D|ERI3_uc009vxg.2_Silent_p.D339D|ERI3_uc010okw.1_Silent_p.D233D|ERI3_uc001clu.2_Missense_Mutation_p.T200M	NM_024066	NP_076971	O43414	ERI3_HUMAN	prion protein interacting protein	311	Exonuclease.					intracellular	exonuclease activity|metal ion binding|nucleic acid binding			ovary(2)|large_intestine(1)	3						TCTTGCAGTCGTCTAAAAAGG	0.522													14	50	---	---	---	---	PASS
PTCH2	8643	broad.mit.edu	37	1	45292393	45292393	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45292393G>A	uc010olf.1	-	18	2755	c.2743C>T	c.(2743-2745)CGT>TGT	p.R915C	PTCH2_uc010olg.1_Missense_Mutation_p.R613C	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2	915	Extracellular (Potential).				protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity			lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18	Acute lymphoblastic leukemia(166;0.155)					TGGAGGCCACGCAGCAGGAAG	0.532									Basal_Cell_Nevus_syndrome				4	29	---	---	---	---	PASS
ECHDC2	55268	broad.mit.edu	37	1	53370344	53370344	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53370344C>A	uc001cup.3	-	7	922	c.676G>T	c.(676-678)GCA>TCA	p.A226S	ECHDC2_uc001cun.2_Missense_Mutation_p.A149S|ECHDC2_uc001cuo.3_Missense_Mutation_p.A195S|ECHDC2_uc010onk.1_Missense_Mutation_p.A180S	NM_018281	NP_060751	Q86YB7	ECHD2_HUMAN	enoyl Coenzyme A hydratase domain containing 2	226					fatty acid metabolic process	mitochondrion	lyase activity			central_nervous_system(1)	1						TGGGCCAGTGCTCGTGCCCGC	0.672													8	22	---	---	---	---	PASS
C1orf87	127795	broad.mit.edu	37	1	60538308	60538308	+	Nonsense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60538308G>C	uc001czs.1	-	2	100	c.8C>G	c.(7-9)TCA>TGA	p.S3*		NM_152377	NP_689590	Q8N0U7	CA087_HUMAN	hypothetical protein LOC127795	3							calcium ion binding			ovary(1)|breast(1)	2						CTTCCAGGCTGAAGACATGAT	0.428													30	70	---	---	---	---	PASS
INADL	10207	broad.mit.edu	37	1	62503707	62503707	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62503707C>G	uc001dab.2	+	30	4132	c.4018C>G	c.(4018-4020)CCA>GCA	p.P1340A	INADL_uc009waf.1_Missense_Mutation_p.P1340A|INADL_uc001daa.2_Missense_Mutation_p.P1340A|INADL_uc001dad.3_Missense_Mutation_p.P1037A|INADL_uc001dac.2_RNA|INADL_uc010oot.1_Missense_Mutation_p.P124A|INADL_uc009wag.2_Missense_Mutation_p.P124A|INADL_uc010oou.1_Missense_Mutation_p.P13A	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	1340					intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						ATCAAGTTCTCCATCTTCTAT	0.383													8	61	---	---	---	---	PASS
L1TD1	54596	broad.mit.edu	37	1	62675738	62675738	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62675738G>T	uc001dae.3	+	4	1594	c.1292G>T	c.(1291-1293)GGG>GTG	p.G431V		NM_019079	NP_061952	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	431	Glu-rich.									ovary(1)|skin(1)	2						gaggcctcagggctagaggag	0.224													13	39	---	---	---	---	PASS
DNAJC6	9829	broad.mit.edu	37	1	65855271	65855271	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65855271T>C	uc001dcd.1	+	11	1422	c.1258T>C	c.(1258-1260)TAC>CAC	p.Y420H	DNAJC6_uc001dcc.1_Missense_Mutation_p.Y451H|DNAJC6_uc010opc.1_Missense_Mutation_p.Y407H|DNAJC6_uc001dce.1_Missense_Mutation_p.Y477H	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	420					cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3						CCCCAGGCATTACGGACAAAG	0.403													16	119	---	---	---	---	PASS
IL23R	149233	broad.mit.edu	37	1	67724192	67724192	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67724192G>A	uc001ddo.2	+	11	1356	c.1271G>A	c.(1270-1272)AGT>AAT	p.S424N	IL23R_uc009waz.2_Missense_Mutation_p.S221N|IL23R_uc001ddp.2_Intron|IL23R_uc010opi.1_RNA|IL23R_uc010opj.1_Missense_Mutation_p.S22N|IL23R_uc010opk.1_3'UTR|IL23R_uc010opl.1_Missense_Mutation_p.S6N|IL23R_uc010opm.1_RNA|IL23R_uc001ddq.2_Missense_Mutation_p.S170N|IL23R_uc010opn.1_Missense_Mutation_p.S269N|IL23R_uc001ddr.2_RNA|IL23R_uc010opo.1_Intron|IL23R_uc010opp.1_Intron|IL23R_uc010opq.1_Intron|IL23R_uc010opr.1_Intron|IL23R_uc010ops.1_Missense_Mutation_p.S221N|IL23R_uc010opt.1_Missense_Mutation_p.S65N|IL23R_uc010opu.1_Missense_Mutation_p.S120N|IL23R_uc010opv.1_Missense_Mutation_p.S182N|IL23R_uc010opw.1_Missense_Mutation_p.S59N|IL23R_uc010opx.1_Missense_Mutation_p.S65N|IL23R_uc010opy.1_Missense_Mutation_p.S191N|IL23R_uc010opz.1_Missense_Mutation_p.S65N|IL23R_uc010oqa.1_Missense_Mutation_p.S65N|IL23R_uc010oqb.1_Missense_Mutation_p.S253N|IL23R_uc010oqc.1_Missense_Mutation_p.S140N|IL23R_uc010oqd.1_Missense_Mutation_p.S59N|IL23R_uc010oqe.1_Missense_Mutation_p.S22N|IL23R_uc010oqf.1_Missense_Mutation_p.S22N|IL23R_uc010oqg.1_Missense_Mutation_p.S22N|IL23R_uc010oqh.1_Missense_Mutation_p.S65N|IL23R_uc001dds.2_Missense_Mutation_p.S169N|IL23R_uc001ddt.2_Missense_Mutation_p.S22N	NM_144701	NP_653302	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor precursor	424	Cytoplasmic (Potential).				inflammatory response|negative regulation of interleukin-10 production|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of interleukin-12 production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|response to interferon-gamma|response to lipopolysaccharide	interleukin-23 receptor complex	receptor activity				0						AATAATTCCAGTGAGCAGGTC	0.343													11	246	---	---	---	---	PASS
RPE65	6121	broad.mit.edu	37	1	68910529	68910529	+	Missense_Mutation	SNP	C	G	G	rs61752874		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68910529C>G	uc001dei.1	-	4	337	c.283G>C	c.(283-285)GAG>CAG	p.E95Q		NM_000329	NP_000320	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein	95			E -> Q (in RP20).		visual perception	cytoplasm|plasma membrane	all-trans-retinyl-palmitate hydrolase activity|metal ion binding|retinol isomerase activity			ovary(1)	1						ATCCTTTTCTCAGTCATTGCC	0.448													17	93	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70477548	70477548	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70477548A>T	uc001dep.2	+	10	989	c.959A>T	c.(958-960)TAC>TTC	p.Y320F	LRRC7_uc009wbg.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	320	LRR 13.					centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						ACTATTGGCTACCTTCATAGT	0.308													13	50	---	---	---	---	PASS
LRRIQ3	127255	broad.mit.edu	37	1	74507411	74507411	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74507411G>A	uc001dfy.3	-	7	1396	c.1204C>T	c.(1204-1206)CGG>TGG	p.R402W	LRRIQ3_uc001dfz.3_RNA	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	402										ovary(2)	2						TTCATACTCCGCTCCAATCGT	0.348													42	64	---	---	---	---	PASS
ASB17	127247	broad.mit.edu	37	1	76384686	76384686	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76384686G>A	uc001dhe.1	-	3	979	c.839C>T	c.(838-840)TCA>TTA	p.S280L	ASB17_uc001dhf.1_RNA	NM_080868	NP_543144	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box-containing 17	280	SOCS box.				intracellular signal transduction					ovary(1)	1						AATTAGAAGTGAAAATATTCC	0.348													23	81	---	---	---	---	PASS
PTGFR	5737	broad.mit.edu	37	1	78959186	78959186	+	Missense_Mutation	SNP	C	A	A	rs145816454		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78959186C>A	uc001din.2	+	2	1024	c.758C>A	c.(757-759)GCG>GAG	p.A253E	PTGFR_uc001dim.2_Missense_Mutation_p.A253E	NM_000959	NP_000950	P43088	PF2R_HUMAN	prostaglandin F receptor isoform a precursor	253	Helical; Name=6; (Potential).				parturition	extracellular region|integral to plasma membrane	prostaglandin F receptor activity	p.A253V(2)		ovary(3)|breast(2)|skin(1)	6				Colorectal(170;0.248)	Bimatoprost(DB00905)|Latanoprost(DB00654)|Travoprost(DB00287)	CAGCTCCTGGCGATAATGTGT	0.393													10	73	---	---	---	---	PASS
CLCA1	1179	broad.mit.edu	37	1	86965439	86965439	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86965439C>T	uc001dlt.2	+	14	2585	c.2456C>T	c.(2455-2457)GCC>GTC	p.A819V		NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor	819					calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		CCAAAGGAAGCCAACTCTGAG	0.363													35	117	---	---	---	---	PASS
GLMN	11146	broad.mit.edu	37	1	92763522	92763522	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92763522C>T	uc001dor.2	-	2	150	c.35G>A	c.(34-36)AGA>AAA	p.R12K	RPAP2_uc001dot.2_5'Flank|RPAP2_uc009wdh.2_5'Flank|GLMN_uc009wdg.2_RNA|GLMN_uc001dos.2_Missense_Mutation_p.R12K	NM_053274	NP_444504	Q92990	GLMN_HUMAN	glomulin	12					muscle cell differentiation|negative regulation of T cell proliferation|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of phosphorylation|regulation of gene expression, epigenetic|vasculogenesis	intracellular	hepatocyte growth factor receptor binding			skin(1)	1		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		ACTTACACATCTCTTTATTAT	0.294									Multiple_Glomus_Tumors_(of_the_Skin)_Familial				10	53	---	---	---	---	PASS
BCAR3	8412	broad.mit.edu	37	1	94037322	94037322	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94037322G>C	uc001dpz.2	-	9	2154	c.1879C>G	c.(1879-1881)CTG>GTG	p.L627V	BCAR3_uc001dqa.2_Missense_Mutation_p.L627V|BCAR3_uc001dqb.2_Missense_Mutation_p.L627V|BCAR3_uc001dpx.3_Missense_Mutation_p.L303V|BCAR3_uc001dpy.2_Missense_Mutation_p.L536V|BCAR3_uc009wdm.1_Missense_Mutation_p.L303V	NM_003567	NP_003558	O75815	BCAR3_HUMAN	breast cancer antiestrogen resistance 3	627	Ras-GEF.				response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		ATCTTACTCAGAGTGGCCGCT	0.542													31	133	---	---	---	---	PASS
F3	2152	broad.mit.edu	37	1	94998715	94998715	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94998715G>C	uc001dqr.2	-	4	701	c.522C>G	c.(520-522)AGC>AGG	p.S174R	F3_uc001dqp.2_RNA|F3_uc001dqq.2_RNA|F3_uc001dqs.2_Missense_Mutation_p.S174R	NM_001993	NP_001984	P13726	TF_HUMAN	coagulation factor III precursor	174	Extracellular (Potential).				activation of caspase activity|activation of plasma proteins involved in acute inflammatory response|anti-apoptosis|blood coagulation, extrinsic pathway|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of protein kinase B signaling cascade	extracellular matrix|extracellular space|integral to membrane	cell surface binding|phospholipid binding|protease binding			central_nervous_system(1)	1		all_lung(203;0.00106)|Lung NSC(277;0.00475)		all cancers(265;0.0232)|Epithelial(280;0.121)	Coagulation factor VIIa(DB00036)	CATCCCGGAGGCTTAGGAAAG	0.373													10	57	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103540304	103540304	+	Missense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103540304T>A	uc001dul.2	-	4	839	c.521A>T	c.(520-522)AAA>ATA	p.K174I	COL11A1_uc001dum.2_Missense_Mutation_p.K174I|COL11A1_uc001dun.2_Missense_Mutation_p.K174I|COL11A1_uc009weh.2_Missense_Mutation_p.K174I	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	174	TSP N-terminal.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TGTCACAGTTTTCTTCTCCAC	0.383													19	46	---	---	---	---	PASS
GPSM2	29899	broad.mit.edu	37	1	109441604	109441604	+	Nonsense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109441604C>A	uc010ovc.1	+	7	1281	c.785C>A	c.(784-786)TCG>TAG	p.S262*	AKNAD1_uc010ovb.1_Intron|GPSM2_uc010ovd.1_Nonsense_Mutation_p.S262*|GPSM2_uc010ove.1_Nonsense_Mutation_p.S262*	NM_013296	NP_037428	P81274	GPSM2_HUMAN	LGN protein	262	TPR 6.				G-protein coupled receptor protein signaling pathway	cell cortex|nucleus	GTPase activator activity|identical protein binding			central_nervous_system(1)	1		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		GAAACTGCCTCGGAATACTAC	0.323													3	36	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109794997	109794997	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109794997G>A	uc001dxa.3	+	1	2357	c.2296G>A	c.(2296-2298)GCT>ACT	p.A766T		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	766	Cadherin 6.|Extracellular (Potential).				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		AGACACGGGGGCTGTCACCAC	0.582													15	35	---	---	---	---	PASS
PROK1	84432	broad.mit.edu	37	1	110996617	110996617	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110996617C>A	uc001dzs.2	+	2	158	c.107C>A	c.(106-108)ACC>AAC	p.T36N		NM_032414	NP_115790	P58294	PROK1_HUMAN	prokineticin 1 precursor	36					angiogenesis|positive regulation of cell division	extracellular region	growth factor activity				0		all_cancers(81;6.23e-06)|all_epithelial(167;2.12e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0239)|all cancers(265;0.0699)|Epithelial(280;0.0753)|Colorectal(144;0.105)|LUSC - Lung squamous cell carcinoma(189;0.135)		GGGGCAGGCACCTGCTGTGCC	0.627													23	45	---	---	---	---	PASS
CHIA	27159	broad.mit.edu	37	1	111854348	111854348	+	Intron	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111854348A>G	uc001eas.2	+						CHIA_uc001ear.2_Intron|CHIA_uc001eaq.2_Intron|CHIA_uc009wgc.2_Intron|CHIA_uc001eat.2_Intron|CHIA_uc001eav.2_Intron|CHIA_uc001eau.2_Intron|CHIA_uc009wgd.2_Intron	NM_201653	NP_970615	Q9BZP6	CHIA_HUMAN	acidic chitinase isoform c						apoptosis|cell wall chitin metabolic process|chitin catabolic process|digestion|immune response|positive regulation of chemokine secretion|production of molecular mediator involved in inflammatory response|response to acid|response to fungus	cytoplasm|extracellular space	cation binding|chitin binding|chitinase activity|kinase binding|lysozyme activity|sugar binding			ovary(1)	1		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		TCGGTAAGTCATGGACTCCAT	0.393													5	215	---	---	---	---	PASS
RSBN1	54665	broad.mit.edu	37	1	114308980	114308980	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114308980G>A	uc001edq.2	-	7	2067	c.2031C>T	c.(2029-2031)TTC>TTT	p.F677F	RSBN1_uc001edr.2_RNA	NM_018364	NP_060834	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	677						nucleus				ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCTAGGGATGAAGTAGATAT	0.443													56	86	---	---	---	---	PASS
PIP5K1A	8394	broad.mit.edu	37	1	151214676	151214676	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151214676A>G	uc001exj.2	+	13	1893	c.1441A>G	c.(1441-1443)ATT>GTT	p.I481V	PIP5K1A_uc001exi.2_Missense_Mutation_p.I468V|PIP5K1A_uc010pcu.1_Missense_Mutation_p.I441V|PIP5K1A_uc001exk.2_Intron|PIP5K1A_uc010pcv.1_Intron	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	481					phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding			ovary(1)|central_nervous_system(1)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			CAACTCCTGCATTACTTACCA	0.542													47	187	---	---	---	---	PASS
PSMD4	5710	broad.mit.edu	37	1	151237918	151237918	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151237918A>G	uc001exl.2	+	6	549	c.487A>G	c.(487-489)AAA>GAA	p.K163E	PSMD4_uc001exn.2_Missense_Mutation_p.K163E	NM_002810	NP_002801	P55036	PSMD4_HUMAN	proteasome 26S non-ATPase subunit 4	163	VWFA.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding|zinc ion binding				0	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GTTGAATGGCAAAGATGGAAC	0.517													22	72	---	---	---	---	PASS
PSMB4	5692	broad.mit.edu	37	1	151372480	151372480	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151372480C>T	uc001eyc.1	+	2	187	c.164C>T	c.(163-165)TCA>TTA	p.S55L	PSMB4_uc010pda.1_Missense_Mutation_p.S55L|PSMB4_uc001eyb.1_Missense_Mutation_p.S55L	NM_002796	NP_002787	P28070	PSB4_HUMAN	proteasome beta 4 subunit	55					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity			ovary(2)	2	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			ACCGGGACCTCAGTCCTCGGC	0.597													17	94	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152192197	152192197	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152192197G>C	uc001ezt.1	-	3	1984	c.1908C>G	c.(1906-1908)CAC>CAG	p.H636Q		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	636	6.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGCTGACCGTGGCTGGAAG	0.572													57	298	---	---	---	---	PASS
LCE2D	353141	broad.mit.edu	37	1	152636715	152636715	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152636715C>G	uc001fag.2	+	2	189	c.134C>G	c.(133-135)TCT>TGT	p.S45C		NM_178430	NP_848517	Q5TA82	LCE2D_HUMAN	late cornified envelope 2D	45	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGCAGTCTCTTCCTGCTGT	0.637													30	142	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	154029319	154029319	+	Missense_Mutation	SNP	T	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154029319T>G	uc001fdw.2	-	23	3284	c.3212A>C	c.(3211-3213)AAA>ACA	p.K1071T	NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Missense_Mutation_p.K1071T	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	1071						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TGATGTGTATTTTCTTCCCAT	0.368													34	64	---	---	---	---	PASS
HAX1	10456	broad.mit.edu	37	1	154245903	154245903	+	Missense_Mutation	SNP	C	A	A	rs11556344		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154245903C>A	uc001fes.2	+	2	306	c.145C>A	c.(145-147)CCA>ACA	p.P49T	HAX1_uc001fet.2_Intron|HAX1_uc010peo.1_Missense_Mutation_p.P49T|HAX1_uc009wou.2_5'UTR|HAX1_uc009wov.2_Missense_Mutation_p.P23T	NM_006118	NP_006109	O00165	HAX1_HUMAN	HCLS1 associated protein X-1 isoform a	49						actin cytoskeleton|cytoplasmic membrane-bounded vesicle|lamellipodium|mitochondrion|nuclear membrane|sarcoplasmic reticulum|soluble fraction	interleukin-1 binding|protein N-terminus binding				0	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCGTGGGAACCCAAGGTTCCA	0.532									Kostmann_syndrome				4	59	---	---	---	---	PASS
CHRNB2	1141	broad.mit.edu	37	1	154544245	154544245	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154544245G>A	uc001ffg.2	+	5	1210	c.946G>A	c.(946-948)GTG>ATG	p.V316M		NM_000748	NP_000739	P17787	ACHB2_HUMAN	neuronal nicotinic acetylcholine receptor beta 2	316	Helical; (Potential).				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Nicotine(DB00184)	CGTCACCAGCGTGTGCGTGCT	0.622													10	54	---	---	---	---	PASS
CD1A	909	broad.mit.edu	37	1	158226630	158226630	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158226630A>G	uc001frt.2	+	4	1192	c.659A>G	c.(658-660)CAG>CGG	p.Q220R		NM_001763	NP_001754	P06126	CD1A_HUMAN	CD1A antigen precursor	220	Extracellular (Potential).|Ig-like.				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex				pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	GGCCATCTGCAGCTTGTGTGC	0.567													18	79	---	---	---	---	PASS
OR6Y1	391112	broad.mit.edu	37	1	158517747	158517747	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158517747A>T	uc010pil.1	-	1	149	c.149T>A	c.(148-150)ATC>AAC	p.I50N		NM_001005189	NP_001005189	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y,	50	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					AGCTAAGATGATAAGAAGATT	0.478													13	54	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158655087	158655087	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158655087C>T	uc001fst.1	-	2	274	c.75G>A	c.(73-75)CAG>CAA	p.Q25Q		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	25	Spectrin 1.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GACGCCTCTCCTGGATCTCTT	0.353													37	154	---	---	---	---	PASS
FCRL6	343413	broad.mit.edu	37	1	159779427	159779427	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159779427C>T	uc001fud.3	+	5	882	c.840C>T	c.(838-840)AAC>AAT	p.N280N	FCRL6_uc001fuc.2_Silent_p.N287N|FCRL6_uc009wsz.1_Silent_p.N185N|FCRL6_uc009wta.2_Silent_p.N280N	NM_001004310	NP_001004310	Q6DN72	FCRL6_HUMAN	Fc receptor-like 6 precursor	280	Ig-like C2-type 3.|Extracellular (Potential).					integral to membrane				ovary(2)|skin(1)	3	all_hematologic(112;0.0597)					AGGCTGAGAACAGTGTCTCCA	0.562													21	42	---	---	---	---	PASS
IGSF9	57549	broad.mit.edu	37	1	159900553	159900553	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159900553T>C	uc001fur.2	-	14	1940	c.1742A>G	c.(1741-1743)CAG>CGG	p.Q581R	IGSF9_uc001fuq.2_Missense_Mutation_p.Q565R|IGSF9_uc001fup.2_5'UTR	NM_001135050	NP_001128522	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9 isoform a	581	Fibronectin type-III 1.|Extracellular (Potential).					cell junction|integral to membrane|synapse				ovary(2)|central_nervous_system(2)|large_intestine(1)	5	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			CACGCTGAACTGGTACTGGGT	0.597													15	63	---	---	---	---	PASS
LY9	4063	broad.mit.edu	37	1	160784267	160784267	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160784267A>G	uc001fwu.2	+	4	838	c.788A>G	c.(787-789)GAG>GGG	p.E263G	LY9_uc010pjs.1_Missense_Mutation_p.E263G|LY9_uc001fwv.2_Missense_Mutation_p.E263G|LY9_uc001fww.2_Missense_Mutation_p.E263G|LY9_uc001fwx.2_Missense_Mutation_p.E263G|LY9_uc001fwy.1_Missense_Mutation_p.E165G|LY9_uc001fwz.2_5'UTR	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	263	Extracellular (Potential).|Ig-like V-type 2.				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GTCCTGGGAGAGCCAGTCACC	0.557													16	73	---	---	---	---	PASS
FCGR3A	2214	broad.mit.edu	37	1	161518451	161518451	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161518451C>T	uc001gat.3	-	4	216	c.79G>A	c.(79-81)GTG>ATG	p.V27M	FCGR3A_uc001gar.2_Missense_Mutation_p.V63M|FCGR3A_uc001gas.2_Missense_Mutation_p.V62M|FCGR3A_uc009wuh.2_Missense_Mutation_p.V26M|FCGR3A_uc009wui.2_Missense_Mutation_p.V27M	NM_001127595	NP_001121067	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor	27	Ig-like C2-type 1.|Extracellular (Potential).				immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AGGAACACCACAGCCTTTGGG	0.562													5	80	---	---	---	---	PASS
FCGR3B	2215	broad.mit.edu	37	1	161599808	161599808	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161599808C>T	uc009wul.2	-	3	353	c.79G>A	c.(79-81)GTG>ATG	p.V27M		NM_000570	NP_000561	O75015	FCG3B_HUMAN	low affinity immunoglobulin gamma Fc region	27					immune response	anchored to membrane|extracellular region|plasma membrane	IgG binding|receptor activity				0	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AGGAACACCACAGCCTTTGGG	0.557													33	35	---	---	---	---	PASS
TBX19	9095	broad.mit.edu	37	1	168260434	168260434	+	Silent	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168260434G>T	uc001gfl.2	+	2	291	c.240G>T	c.(238-240)GGG>GGT	p.G80G	TBX19_uc001gfj.3_Silent_p.G11G	NM_005149	NP_005140	O60806	TBX19_HUMAN	T-box 19	80	T-box.				anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)					GTGTCACAGGGTTGGACCCCA	0.542													52	166	---	---	---	---	PASS
SELE	6401	broad.mit.edu	37	1	169696587	169696587	+	Nonsense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169696587G>T	uc001ggm.3	-	10	1705	c.1548C>A	c.(1546-1548)TGC>TGA	p.C516*	C1orf112_uc001ggj.2_Intron	NM_000450	NP_000441	P16581	LYAM2_HUMAN	selectin E precursor	516	Extracellular (Potential).|Sushi 6.				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity			ovary(3)|skin(2)	5	all_hematologic(923;0.208)					AGGCGAACTTGCACACAGTGC	0.547													35	51	---	---	---	---	PASS
KIFAP3	22920	broad.mit.edu	37	1	169930205	169930205	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169930205C>G	uc001ggv.2	-	18	2426	c.2155G>C	c.(2155-2157)GAC>CAC	p.D719H	KIFAP3_uc010plx.1_Missense_Mutation_p.D421H	NM_014970	NP_055785	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	719					blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TAGAAAAGGTCAGGTCTTTCG	0.413													7	57	---	---	---	---	PASS
FMO2	2327	broad.mit.edu	37	1	171173031	171173031	+	Missense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171173031T>A	uc001ghk.1	+	6	772	c.655T>A	c.(655-657)TGG>AGG	p.W219R	FMO2_uc010pmd.1_5'UTR	NM_001460	NP_001451	Q99518	FMO2_HUMAN	flavin containing monooxygenase 2	219					drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GCATGGCACCTGGGTCATGAG	0.478													13	60	---	---	---	---	PASS
C1orf9	51430	broad.mit.edu	37	1	172555011	172555011	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172555011A>G	uc001giq.3	+	17	1897	c.1581A>G	c.(1579-1581)ATA>ATG	p.I527M	C1orf9_uc010pmm.1_Missense_Mutation_p.I527M|C1orf9_uc009wwd.2_Missense_Mutation_p.I483M|C1orf9_uc010pmn.1_Missense_Mutation_p.I490M|C1orf9_uc010pmo.1_Intron	NM_014283	NP_055098	Q9UBS9	OSPT_HUMAN	chromosome 1 open reading frame 9 protein	527					multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane				ovary(2)	2		Breast(1374;0.212)		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)		ATAAAAGTATATCTGAGAATG	0.254													93	137	---	---	---	---	PASS
C1orf9	51430	broad.mit.edu	37	1	172558043	172558043	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172558043A>T	uc001giq.3	+	18	2118	c.1802A>T	c.(1801-1803)CAG>CTG	p.Q601L	C1orf9_uc010pmm.1_Missense_Mutation_p.Q601L|C1orf9_uc009wwd.2_Missense_Mutation_p.Q557L|C1orf9_uc010pmn.1_Missense_Mutation_p.Q564L|C1orf9_uc010pmo.1_RNA	NM_014283	NP_055098	Q9UBS9	OSPT_HUMAN	chromosome 1 open reading frame 9 protein	601					multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane				ovary(2)	2		Breast(1374;0.212)		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)		AGCGGTGAACAGGAAGATGAA	0.418													19	69	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175048476	175048476	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175048476C>A	uc001gkl.1	+	3	530	c.417C>A	c.(415-417)AGC>AGA	p.S139R	TNN_uc010pmx.1_Missense_Mutation_p.S139R	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	139					cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CAGATCTAAGCCGCCACTGCA	0.637													10	28	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175067548	175067548	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175067548G>A	uc001gkl.1	+	9	2049	c.1936G>A	c.(1936-1938)GCC>ACC	p.A646T	TNN_uc010pmx.1_Missense_Mutation_p.A557T	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	646	Fibronectin type-III 5.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GGTGCAGGCCGCCATTGACAA	0.582													30	84	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177249537	177249537	+	Intron	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177249537T>A	uc001glf.2	+						FAM5B_uc001glg.2_Intron	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B							extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						ATTTTATCTCTGCTCCCCAAG	0.498													20	64	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177250324	177250324	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177250324C>A	uc001glf.2	+	8	2324	c.2012C>A	c.(2011-2013)CCC>CAC	p.P671H	FAM5B_uc001glg.2_Missense_Mutation_p.P566H	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	671						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						ATGACTGATCCCTCTAAGAAT	0.463													44	73	---	---	---	---	PASS
FAM163A	148753	broad.mit.edu	37	1	179782944	179782944	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179782944G>T	uc009wxj.2	+	6	583	c.124G>T	c.(124-126)GTT>TTT	p.V42F	FAM163A_uc001gnj.2_Missense_Mutation_p.V42F|FAM163A_uc009wxk.2_Missense_Mutation_p.V42F	NM_173509	NP_775780	Q96GL9	F163A_HUMAN	hypothetical protein LOC148753	42						integral to membrane				ovary(1)	1						CGGAACCGAGGTTGCAGACGA	0.632													31	45	---	---	---	---	PASS
ZNF648	127665	broad.mit.edu	37	1	182026108	182026108	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182026108G>A	uc001goz.2	-	2	1246	c.1038C>T	c.(1036-1038)CGC>CGT	p.R346R		NM_001009992	NP_001009992	Q5T619	ZN648_HUMAN	zinc finger protein 648	346	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GGTCCGAAGAGCGCACGAAGG	0.622													13	25	---	---	---	---	PASS
C1orf26	54823	broad.mit.edu	37	1	185159726	185159726	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185159726G>C	uc001grg.3	+	10	1589	c.1475G>C	c.(1474-1476)TGT>TCT	p.C492S	C1orf26_uc001grh.3_Missense_Mutation_p.C492S	NM_001105518	NP_001098988	Q5T5J6	SWT1_HUMAN	hypothetical protein LOC54823	492	PINc.										0						CTAAAATGCTGTCTCCAGCAC	0.333													11	70	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186114606	186114606	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186114606C>T	uc001grq.1	+	92	14567	c.14338C>T	c.(14338-14340)CGG>TGG	p.R4780W	HMCN1_uc001grs.1_Missense_Mutation_p.R349W	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4780	TSP type-1 5.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GCAGATGCGGCGGTACCGCAC	0.557													33	41	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197112556	197112556	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197112556C>A	uc001gtu.2	-	3	1083	c.826G>T	c.(826-828)GTA>TTA	p.V276L	ASPM_uc001gtv.2_Missense_Mutation_p.V276L|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	276					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						GTTTCAGTTACAGCTTTCTCA	0.353													22	92	---	---	---	---	PASS
TNNT2	7139	broad.mit.edu	37	1	201333496	201333496	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201333496C>A	uc001gwf.2	-	11	488	c.419G>T	c.(418-420)CGT>CTT	p.R140L	TNNT2_uc009wzn.2_5'Flank|TNNT2_uc009wzo.2_5'Flank|TNNT2_uc009wzp.2_5'Flank|TNNT2_uc001gwg.2_Missense_Mutation_p.R130L|TNNT2_uc001gwh.2_Missense_Mutation_p.R125L|TNNT2_uc001gwi.2_Missense_Mutation_p.R100L|TNNT2_uc009wzr.2_Missense_Mutation_p.R71L|TNNT2_uc001gwj.1_5'Flank|TNNT2_uc009wzs.1_Missense_Mutation_p.R105L|TNNT2_uc001gwk.1_Missense_Mutation_p.R71L|TNNT2_uc009wzt.1_Missense_Mutation_p.R130L	NM_000364	NP_000355	P45379	TNNT2_HUMAN	troponin T type 2, cardiac isoform 1	140			R -> C (in CMH2).		ATP catabolic process|muscle filament sliding|negative regulation of ATPase activity|positive regulation of ATPase activity|regulation of heart contraction|response to calcium ion|response to calcium ion|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|tropomyosin binding|troponin C binding|troponin I binding				0						CTCTGCCCGACGTCTCTCCTA	0.622													14	20	---	---	---	---	PASS
PRELP	5549	broad.mit.edu	37	1	203455862	203455862	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203455862C>T	uc001gzs.2	+	3	1202	c.1002C>T	c.(1000-1002)AAC>AAT	p.N334N	PRELP_uc001gzt.2_Silent_p.N334N	NM_002725	NP_002716	P51888	PRELP_HUMAN	proline arginine-rich end leucine-rich repeat	334	LRR 11.				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent			ovary(1)|central_nervous_system(1)|pancreas(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.109)			TTTGCCCCAACGACCTAGTGG	0.572													14	89	---	---	---	---	PASS
PIK3C2B	5287	broad.mit.edu	37	1	204438248	204438248	+	Missense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204438248T>A	uc001haw.2	-	3	1162	c.683A>T	c.(682-684)TAT>TTT	p.Y228F	PIK3C2B_uc010pqv.1_Missense_Mutation_p.Y228F|PIK3C2B_uc001hax.1_Missense_Mutation_p.Y228F|PIK3C2B_uc009xbd.1_RNA	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	228	Interaction with GRB2.				cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GATACCATCATAGTCCACAGA	0.562													198	301	---	---	---	---	PASS
LAMB3	3914	broad.mit.edu	37	1	209795922	209795922	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209795922C>T	uc001hhg.2	-	17	3050	c.2660G>A	c.(2659-2661)CGC>CAC	p.R887H	LAMB3_uc009xco.2_Missense_Mutation_p.R887H|LAMB3_uc001hhh.2_Missense_Mutation_p.R887H	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	887	Domain I.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		GAGCCGTGTGCGTCTGACATC	0.617													6	173	---	---	---	---	PASS
LAMB3	3914	broad.mit.edu	37	1	209796418	209796418	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209796418A>T	uc001hhg.2	-	16	2855	c.2465T>A	c.(2464-2466)CTT>CAT	p.L822H	LAMB3_uc009xco.2_Missense_Mutation_p.L822H|LAMB3_uc001hhh.2_Missense_Mutation_p.L822H|LAMB3_uc010psl.1_RNA	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	822	Domain I.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		GGCCCTGGGAAGGACACCCCT	0.637													13	64	---	---	---	---	PASS
HSD11B1	3290	broad.mit.edu	37	1	209907787	209907787	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209907787T>C	uc001hhj.2	+	7	907	c.800T>C	c.(799-801)CTG>CCG	p.L267P	HSD11B1_uc001hhk.2_Missense_Mutation_p.L267P	NM_181755	NP_861420	P28845	DHI1_HUMAN	11-beta-hydroxysteroid dehydrogenase 1	267	Lumenal (Potential).				glucocorticoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	11-beta-hydroxysteroid dehydrogenase (NADP+) activity|11-beta-hydroxysteroid dehydrogenase|binding			breast(1)	1				OV - Ovarian serous cystadenocarcinoma(81;1.04e-55)|Epithelial(68;1.57e-52)|all cancers(67;1.83e-46)|Colorectal(1306;0.115)	NADH(DB00157)	ACCACTCTTCTGATCAGAAAT	0.478													43	61	---	---	---	---	PASS
LEFTY2	7044	broad.mit.edu	37	1	226128595	226128595	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226128595G>T	uc001hpt.1	-	1	326	c.246C>A	c.(244-246)TTC>TTA	p.F82L	LEFTY2_uc010pvk.1_Missense_Mutation_p.F82L|LEFTY2_uc009xek.1_Missense_Mutation_p.F82L	NM_003240	NP_003231	O00292	LFTY2_HUMAN	endometrial bleeding associated factor	82					cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)					TCTCACCTCGGAAGCTCTGGC	0.687													35	43	---	---	---	---	PASS
ZNF678	339500	broad.mit.edu	37	1	227842954	227842954	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227842954C>T	uc001hqw.1	+	4	1348	c.1003C>T	c.(1003-1005)CAC>TAC	p.H335Y	ZNF678_uc009xet.1_Intron|ZNF678_uc009xeu.1_Intron	NM_178549	NP_848644	F5GXA7	F5GXA7_HUMAN	zinc finger protein 678	390					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			pancreas(1)	1		Prostate(94;0.0885)				TCGGTGTTCACACCTAAGTAG	0.383													9	47	---	---	---	---	PASS
TAF5L	27097	broad.mit.edu	37	1	229730793	229730793	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229730793G>A	uc001htq.2	-	5	1187	c.1021C>T	c.(1021-1023)CAC>TAC	p.H341Y		NM_014409	NP_055224	O75529	TAF5L_HUMAN	PCAF associated factor 65 beta isoform a	341	WD 2.				histone H3 acetylation|transcription from RNA polymerase II promoter	STAGA complex|transcription factor TFTC complex	sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)	1	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				GGTCCGCAGTGGCCCCGCAGT	0.522													39	48	---	---	---	---	PASS
KIAA1383	54627	broad.mit.edu	37	1	232941915	232941915	+	Silent	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232941915A>G	uc001hvh.2	+	1	1278	c.1146A>G	c.(1144-1146)CCA>CCG	p.P382P		NM_019090	NP_061963	Q9P2G4	K1383_HUMAN	hypothetical protein LOC54627	240										ovary(1)	1		all_cancers(173;0.00528)|Prostate(94;0.122)|all_epithelial(177;0.169)				TAGAAATCCCAGAGGCACAGA	0.488													96	157	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235892930	235892930	+	Silent	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235892930T>C	uc001hxj.2	-	37	9247	c.9072A>G	c.(9070-9072)GCA>GCG	p.A3024A	LYST_uc001hxi.2_Silent_p.A248A	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	3024					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CTCTAGATGGTGCAACACTGA	0.323									Chediak-Higashi_syndrome				5	65	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237919650	237919650	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237919650G>A	uc001hyl.1	+	81	11328	c.11208G>A	c.(11206-11208)GCG>GCA	p.A3736A	RYR2_uc010pya.1_Silent_p.A151A	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3736					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATCGTGGCGCGGCTGAGATGG	0.478													14	60	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237948177	237948177	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237948177G>C	uc001hyl.1	+	90	13285	c.13165G>C	c.(13165-13167)GGA>CGA	p.G4389R	RYR2_uc010pya.1_Missense_Mutation_p.G804R	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4389					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAGAGAAGGAGGACAGTACAA	0.507													5	25	---	---	---	---	PASS
WDR64	128025	broad.mit.edu	37	1	241904845	241904845	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241904845T>C	uc001hze.1	+	11	1526	c.1319T>C	c.(1318-1320)TTG>TCG	p.L440S	WDR64_uc001hzf.1_Missense_Mutation_p.L160S			B1ANS9	WDR64_HUMAN	RecName: Full=WD repeat-containing protein 64;	440	WD 5.									skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			ATGTATCCTTTGACTAGGATG	0.348													10	55	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004752	248004752	+	Missense_Mutation	SNP	C	A	A	rs148330672		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004752C>A	uc001idn.1	-	1	447	c.447G>T	c.(445-447)TGG>TGT	p.W149C		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	149	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CCCCTGTGCACCAGGAGACCA	0.577													18	61	---	---	---	---	PASS
OR2AK2	391191	broad.mit.edu	37	1	248129099	248129099	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248129099T>C	uc010pzd.1	+	1	466	c.466T>C	c.(466-468)TGC>CGC	p.C156R	OR2L13_uc001ids.2_Intron	NM_001004491	NP_001004491	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK,	156	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			CAAGAAGATCTGCTGCCTCAT	0.433													86	120	---	---	---	---	PASS
OR2T33	391195	broad.mit.edu	37	1	248436296	248436296	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248436296G>T	uc010pzi.1	-	1	821	c.821C>A	c.(820-822)GCC>GAC	p.A274D		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	274	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			AGTATAGAAGGCTGACACAAC	0.483													37	183	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685153	248685153	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685153T>C	uc001ien.1	+	1	206	c.206T>C	c.(205-207)GTG>GCG	p.V69A		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTCTCGTGTGTGGACATCTGC	0.502													5	71	---	---	---	---	PASS
SNTG2	54221	broad.mit.edu	37	2	1204851	1204851	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1204851C>A	uc002qwq.2	+	9	782	c.654C>A	c.(652-654)GAC>GAA	p.D218E	SNTG2_uc010ewi.2_Missense_Mutation_p.D91E	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	218					central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GCTGGCTGGACACCTTGTCCG	0.522													55	106	---	---	---	---	PASS
COLEC11	78989	broad.mit.edu	37	2	3685129	3685129	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3685129T>C	uc002qya.2	+	4	357	c.209T>C	c.(208-210)ATG>ACG	p.M70T	COLEC11_uc002qxz.2_Missense_Mutation_p.M67T|COLEC11_uc002qyb.2_Missense_Mutation_p.M46T|COLEC11_uc002qyc.2_Intron|COLEC11_uc010ewo.2_Intron|COLEC11_uc010ewp.2_Missense_Mutation_p.M44T|COLEC11_uc010ewq.2_Missense_Mutation_p.M20T|COLEC11_uc010ewr.2_Intron|COLEC11_uc010ews.2_Intron	NM_024027	NP_076932	Q9BWP8	COL11_HUMAN	collectin sub-family member 11 isoform a	70	Collagen-like.					collagen	mannose binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		ACAGGAGACATGGGGGACAAA	0.522													4	110	---	---	---	---	PASS
KIDINS220	57498	broad.mit.edu	37	2	8940553	8940553	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8940553C>T	uc002qzc.2	-	9	1059	c.877G>A	c.(877-879)GCT>ACT	p.A293T	KIDINS220_uc010yiv.1_Missense_Mutation_p.A59T|KIDINS220_uc002qzd.2_Missense_Mutation_p.A251T|KIDINS220_uc010yiw.1_Missense_Mutation_p.A294T	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa	293	Cytoplasmic (Potential).|ANK 9.				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TCTATATCAGCATATTTTTGG	0.373													89	250	---	---	---	---	PASS
MYCN	4613	broad.mit.edu	37	2	16082189	16082189	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16082189G>A	uc002rci.2	+	2	303	c.3G>A	c.(1-3)ATG>ATA	p.M1I	MYCNOS_uc002rch.1_5'Flank|MYCN_uc010yjr.1_5'UTR	NM_005378	NP_005369	P04198	MYCN_HUMAN	v-myc myelocytomatosis viral related oncogene,	1					regulation of transcription from RNA polymerase II promoter	chromatin|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			GCGAGCCGATGCCGAGCTGCT	0.647			A		neuroblastoma								20	37	---	---	---	---	PASS
CAD	790	broad.mit.edu	37	2	27440793	27440793	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27440793C>T	uc002rji.2	+	2	293	c.131C>T	c.(130-132)TCC>TTC	p.S44F	CAD_uc010eyw.2_Missense_Mutation_p.S44F	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	44	GATase (Glutamine amidotransferase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	ACCGATCCCTCCTACAAGGCA	0.567													15	130	---	---	---	---	PASS
GTF3C2	2976	broad.mit.edu	37	2	27560185	27560185	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27560185C>A	uc002rjv.1	-	8	1416	c.1053G>T	c.(1051-1053)CAG>CAT	p.Q351H	GTF3C2_uc010eyy.1_5'Flank|GTF3C2_uc002rju.1_Missense_Mutation_p.Q362H|GTF3C2_uc002rjw.1_Missense_Mutation_p.Q351H|GTF3C2_uc010eyz.1_Missense_Mutation_p.Q351H|uc002rjy.1_RNA	NM_001521	NP_001512	Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide	351						transcription factor TFIIIC complex				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACTTCTCCTCCTGGGGCAGGT	0.502													9	66	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32725073	32725073	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32725073G>A	uc010ezu.2	+	46	9062	c.8928G>A	c.(8926-8928)TCG>TCA	p.S2976S		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	2976					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					TTCAAGGATCGCCTGCATATG	0.438													62	124	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33500091	33500091	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33500091G>A	uc002ros.2	+	17	2806	c.2806G>A	c.(2806-2808)GAG>AAG	p.E936K	LTBP1_uc002rot.2_Missense_Mutation_p.E610K|LTBP1_uc002rou.2_Missense_Mutation_p.E609K|LTBP1_uc002rov.2_Missense_Mutation_p.E556K|LTBP1_uc010ymz.1_Missense_Mutation_p.E609K|LTBP1_uc010yna.1_Missense_Mutation_p.E556K	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	935	EGF-like 5; calcium-binding (Potential).				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TGAAAACACCGAGGGAAGTTT	0.428													53	81	---	---	---	---	PASS
RASGRP3	25780	broad.mit.edu	37	2	33784046	33784046	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33784046G>A	uc002rox.2	+	18	2640	c.2013G>A	c.(2011-2013)ACG>ACA	p.T671T	RASGRP3_uc010ync.1_Silent_p.T671T|RASGRP3_uc002roy.2_Silent_p.T670T	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and	671					MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)					ACCGGGGCACGGAGTTTGAAC	0.498													4	38	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37302672	37302672	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37302672G>C	uc002rpp.1	-	5	649	c.553C>G	c.(553-555)CTC>GTC	p.L185V		NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	185							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				TCAGTCAAGAGAGACCTGGCA	0.443													63	158	---	---	---	---	PASS
CEBPZ	10153	broad.mit.edu	37	2	37455705	37455705	+	Nonsense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37455705T>A	uc002rpz.2	-	2	661	c.631A>T	c.(631-633)AAG>TAG	p.K211*		NM_005760	NP_005751	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein zeta	211					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding			pancreas(1)	1		all_hematologic(82;0.21)				TGATACAGCTTCTGAGCAAGG	0.428													57	96	---	---	---	---	PASS
PKDCC	91461	broad.mit.edu	37	2	42284382	42284382	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42284382G>T	uc002rsg.2	+	6	1423	c.1244G>T	c.(1243-1245)AGC>ATC	p.S415I		NM_138370	NP_612379	Q504Y2	PKDCC_HUMAN	protein kinase-like protein SgK493	415	Protein kinase.				cell differentiation|embryonic digestive tract development|lung alveolus development|negative regulation of Golgi to plasma membrane protein transport|ossification|palate development|positive regulation of bone mineralization|positive regulation of chondrocyte differentiation|protein transport	Golgi apparatus	ATP binding|protein kinase activity			breast(1)	1						ATCCCAGACAGCACCATCCCC	0.537													58	114	---	---	---	---	PASS
LHCGR	3973	broad.mit.edu	37	2	48915920	48915920	+	Missense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48915920T>A	uc002rwu.3	-	11	1086	c.1016A>T	c.(1015-1017)AAG>ATG	p.K339M	GTF2A1L_uc002rwt.2_Intron	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	339	Extracellular (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TCGGGGTGTCTTGGGTAAGCA	0.428									Familial_Male-Limited_Precocious_Puberty				37	170	---	---	---	---	PASS
XPO1	7514	broad.mit.edu	37	2	61717766	61717766	+	Intron	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61717766G>C	uc002sbj.2	-						XPO1_uc010fcl.2_Intron|XPO1_uc010ypn.1_Intron|XPO1_uc002sbk.2_Intron|XPO1_uc002sbh.2_Intron	NM_003400	NP_003391	O14980	XPO1_HUMAN	exportin 1						intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			AGAAAAGGTAGAAATACTTAC	0.338													33	69	---	---	---	---	PASS
DOK1	1796	broad.mit.edu	37	2	74783971	74783971	+	Silent	SNP	G	T	T	rs139633219		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74783971G>T	uc002sms.2	+	5	1198	c.1176G>T	c.(1174-1176)CGG>CGT	p.R392R	LOXL3_uc002smp.1_5'Flank|LOXL3_uc002smq.1_5'Flank|LOXL3_uc010ffn.1_5'Flank|DOK1_uc002smr.2_Silent_p.R253R|DOK1_uc010ffo.2_Silent_p.R253R|DOK1_uc002smt.2_Silent_p.R178R|DOK1_uc002smu.2_Silent_p.R178R|DOK1_uc010yrz.1_Silent_p.R381R|DOK1_uc002smv.2_Silent_p.R253R|DOK1_uc002smw.1_Silent_p.R178R	NM_001381	NP_001372	Q99704	DOK1_HUMAN	docking protein 1	392	Pro-rich.				fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol|perinuclear region of cytoplasm	insulin receptor binding				0						GCCAAGCTCGGGTGAAGGAGG	0.622													65	112	---	---	---	---	PASS
REG1B	5968	broad.mit.edu	37	2	79313498	79313498	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79313498T>C	uc002sny.2	-	4	428	c.316A>G	c.(316-318)AAA>GAA	p.K106E	REG1B_uc010ffv.1_Missense_Mutation_p.K106E|REG1B_uc010ffw.2_3'UTR	NM_006507	NP_006498	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta precursor	106	C-type lectin.				cell proliferation	extracellular region	sugar binding			central_nervous_system(1)|skin(1)	2						CTGACCTTTTTTGGGTCATGG	0.493													31	55	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80136890	80136890	+	Silent	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80136890G>C	uc010ysh.1	+	6	1028	c.1023G>C	c.(1021-1023)GCG>GCC	p.A341A	CTNNA2_uc010yse.1_Silent_p.A341A|CTNNA2_uc010ysf.1_Silent_p.A341A|CTNNA2_uc010ysg.1_Silent_p.A341A	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	341					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						TGCGGCAGGCGCTCCAGGACC	0.582													23	46	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80782831	80782831	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80782831G>A	uc010ysh.1	+	11	1559	c.1554G>A	c.(1552-1554)TTG>TTA	p.L518L	CTNNA2_uc010yse.1_Silent_p.L518L|CTNNA2_uc010ysf.1_Silent_p.L518L|CTNNA2_uc010ysg.1_Silent_p.L518L|CTNNA2_uc010ysi.1_Silent_p.L150L	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	518					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						ATCACATCTTGGAGGATGTGA	0.473													21	54	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89976481	89976481	+	Intron	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89976481C>A	uc010fhm.2	+						uc010ytu.1_RNA					Parts of antibodies, mostly variable regions.																		GCAAGGTACACACTGGCCTCC	0.562													44	107	---	---	---	---	PASS
MRPS5	64969	broad.mit.edu	37	2	95770424	95770424	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95770424G>A	uc002sub.2	-	7	942	c.724C>T	c.(724-726)CGT>TGT	p.R242C	MRPS5_uc002suc.2_Intron|MRPS5_uc010yud.1_Missense_Mutation_p.R242C	NM_031902	NP_114108	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	242	S5 DRBM.				translation	mitochondrion|ribosome	protein binding|RNA binding|structural constituent of ribosome			ovary(2)|central_nervous_system(1)	3						ACCAAGACACGGATCGATTTC	0.483													31	96	---	---	---	---	PASS
MAP4K4	9448	broad.mit.edu	37	2	102480484	102480484	+	Intron	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102480484A>C	uc002tbg.2	+						MAP4K4_uc002tbc.2_Silent_p.R690R|MAP4K4_uc002tbd.2_Intron|MAP4K4_uc002tbe.2_Intron|MAP4K4_uc002tbf.2_Intron|MAP4K4_uc010yvy.1_Silent_p.R605R|MAP4K4_uc002tbh.2_Intron|MAP4K4_uc002tbi.2_Intron|MAP4K4_uc010yvz.1_Silent_p.R585R|MAP4K4_uc002tbk.2_Intron|MAP4K4_uc002tbl.2_5'Flank	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase						intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						GGCTTGGTCTAGATCAGACAG	0.458													12	72	---	---	---	---	PASS
IL18R1	8809	broad.mit.edu	37	2	102984394	102984394	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102984394G>T	uc002tbw.3	+	3	318	c.168G>T	c.(166-168)TGG>TGT	p.W56C	IL18R1_uc010ywb.1_Missense_Mutation_p.W56C|IL18R1_uc010ywc.1_Missense_Mutation_p.W56C|IL18R1_uc010ywd.1_Intron|IL18R1_uc010fiy.2_Missense_Mutation_p.W56C	NM_003855	NP_003846	Q13478	IL18R_HUMAN	interleukin 18 receptor 1 precursor	56	Ig-like C2-type 1.|Extracellular (Potential).				innate immune response	integral to membrane|plasma membrane	interleukin-1 receptor activity			ovary(2)|pancreas(1)	3						CCAAAAGCTGGTACAAAAGCA	0.453													25	42	---	---	---	---	PASS
SLC20A1	6574	broad.mit.edu	37	2	113405296	113405296	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113405296G>A	uc002tib.2	+	4	988	c.542G>A	c.(541-543)CGT>CAT	p.R181H	uc010fkq.1_5'Flank	NM_005415	NP_005406	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate	181	Cytoplasmic (Potential).				phosphate metabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to plasma membrane	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity			ovary(2)	2						TTCCTGGTTCGTGCATTCATC	0.413													65	246	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125261973	125261973	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125261973G>A	uc002tno.2	+	8	1528	c.1164G>A	c.(1162-1164)GGG>GGA	p.G388G	CNTNAP5_uc010flu.2_Silent_p.G389G	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	388	Laminin G-like 2.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		AAATTGATGGGCTCTCAGTGA	0.547													36	61	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136552233	136552233	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136552233T>C	uc002tuu.1	-	14	5100	c.5089A>G	c.(5089-5091)ATC>GTC	p.I1697V		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1697	Extracellular (Potential).|4.|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		AAAGAAGAGATGGCAGTGGCA	0.517													37	72	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155099274	155099274	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155099274G>T	uc002tyr.3	+	6	1109	c.542G>T	c.(541-543)AGG>ATG	p.R181M	GALNT13_uc002tyt.3_Missense_Mutation_p.R181M|GALNT13_uc010foc.1_Translation_Start_Site	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	181	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						AAAATTATTAGGATGGAAGAA	0.368													14	26	---	---	---	---	PASS
PDE11A	50940	broad.mit.edu	37	2	178565854	178565854	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178565854T>C	uc002ulq.2	-	14	2557	c.2239A>G	c.(2239-2241)AGT>GGT	p.S747G	PDE11A_uc002ulp.2_Missense_Mutation_p.S303G|PDE11A_uc002ulr.2_Missense_Mutation_p.S497G|PDE11A_uc002uls.1_Missense_Mutation_p.S389G|PDE11A_uc002ult.1_Missense_Mutation_p.S497G|PDE11A_uc002ulu.1_Missense_Mutation_p.S389G	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4	747	Catalytic (By similarity).				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			TGTACCTCACTTTGAAGGATC	0.502									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				27	76	---	---	---	---	PASS
PDE11A	50940	broad.mit.edu	37	2	178565890	178565890	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178565890G>T	uc002ulq.2	-	14	2521	c.2203C>A	c.(2203-2205)CAT>AAT	p.H735N	PDE11A_uc002ulp.2_Missense_Mutation_p.H291N|PDE11A_uc002ulr.2_Missense_Mutation_p.H485N|PDE11A_uc002uls.1_Missense_Mutation_p.H377N|PDE11A_uc002ult.1_Missense_Mutation_p.H485N|PDE11A_uc002ulu.1_Missense_Mutation_p.H377N	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4	735	Catalytic (By similarity).				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			AAATGGTGATGCTCCAAGGTA	0.522									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				25	76	---	---	---	---	PASS
OSBPL6	114880	broad.mit.edu	37	2	179196319	179196319	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179196319A>G	uc002ulx.2	+	6	737	c.359A>G	c.(358-360)AAG>AGG	p.K120R	OSBPL6_uc002ulw.2_Missense_Mutation_p.K120R|OSBPL6_uc002uly.2_Missense_Mutation_p.K120R|OSBPL6_uc010zfe.1_Missense_Mutation_p.K120R|OSBPL6_uc002ulz.2_Missense_Mutation_p.K120R|OSBPL6_uc002uma.2_Missense_Mutation_p.K99R	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform	120	PH.				lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			AAGTATTCAAAGGCACCACTC	0.383													26	102	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179410595	179410595	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179410595G>T	uc010zfg.1	-	292	87888	c.87664C>A	c.(87664-87666)CCT>ACT	p.P29222T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P22917T|TTN_uc010zfi.1_Missense_Mutation_p.P22850T|TTN_uc010zfj.1_Missense_Mutation_p.P22725T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30149							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCACACCAGGGCCATATTTG	0.398													34	138	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179453963	179453963	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179453963G>T	uc010zfg.1	-	253	55009	c.54785C>A	c.(54784-54786)TCT>TAT	p.S18262Y	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S11957Y|TTN_uc010zfi.1_Missense_Mutation_p.S11890Y|TTN_uc010zfj.1_Missense_Mutation_p.S11765Y	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	19189							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTAGTAAGAGAAAATTTAGA	0.433													35	153	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179494177	179494177	+	Intron	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179494177G>C	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGTGCTTTTCGAGAGGGAAGA	0.433													14	74	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179643974	179643974	+	Silent	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179643974A>T	uc010zfg.1	-	23	4169	c.3945T>A	c.(3943-3945)TCT>TCA	p.S1315S	TTN_uc010zfh.1_Silent_p.S1269S|TTN_uc010zfi.1_Silent_p.S1269S|TTN_uc010zfj.1_Silent_p.S1269S|TTN_uc002unb.2_Silent_p.S1315S|uc002unc.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1315							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGGATATCCAGACATCTTGC	0.308													12	61	---	---	---	---	PASS
ALS2	57679	broad.mit.edu	37	2	202593831	202593831	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202593831T>C	uc002uyo.2	-	14	3012	c.2656A>G	c.(2656-2658)AGG>GGG	p.R886G	ALS2_uc002uyp.3_Missense_Mutation_p.R886G|ALS2_uc010ftl.2_RNA	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	886					cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7						GCTTCCTTCCTTTTCCTGCCG	0.458													4	165	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207174722	207174722	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207174722C>T	uc002vbp.2	+	5	5720	c.5470C>T	c.(5470-5472)CCT>TCT	p.P1824S		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1824							nucleic acid binding|zinc ion binding			ovary(3)	3						GCCTCATGTACCTCCTTCATT	0.413													7	72	---	---	---	---	PASS
ADAM23	8745	broad.mit.edu	37	2	207412220	207412220	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207412220A>T	uc002vbq.2	+	7	1011	c.788A>T	c.(787-789)AAT>ATT	p.N263I	ADAM23_uc010ziv.1_RNA	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein	263					cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		CAAATGAAGAATCTCAGTAAG	0.353													8	46	---	---	---	---	PASS
LOC200726	200726	broad.mit.edu	37	2	207509077	207509077	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207509077G>T	uc010fuh.1	+	2	292	c.117G>T	c.(115-117)TTG>TTT	p.L39F		NM_001102659	NP_001096129			hypothetical protein LOC200726												0				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.115)|Lung(261;0.133)		AGACAGACTTGCTGGCTCTTA	0.532													16	18	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211460258	211460258	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211460258G>T	uc002vee.3	+	13	1443	c.1311G>T	c.(1309-1311)CAG>CAT	p.Q437H	CPS1_uc010fur.2_Missense_Mutation_p.Q443H|CPS1_uc010fus.2_Translation_Start_Site	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	437					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		CCATTGGTCAGGCTGGAGAAT	0.368													35	144	---	---	---	---	PASS
SLC4A3	6508	broad.mit.edu	37	2	220501521	220501521	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220501521G>A	uc002vmp.3	+	16	2729	c.2460G>A	c.(2458-2460)TCG>TCA	p.S820S	SLC4A3_uc002vmo.3_Silent_p.S847S|SLC4A3_uc010fwm.2_Silent_p.S370S|SLC4A3_uc010fwn.1_Silent_p.S329S	NM_005070	NP_005061	P48751	B3A3_HUMAN	solute carrier family 4, anion exchanger, member	820	Membrane (anion exchange).				bicarbonate transport	integral to plasma membrane|membrane fraction	inorganic anion exchanger activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	5		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCTACATCTCGCCTTTCACCC	0.572													67	127	---	---	---	---	PASS
FARSB	10056	broad.mit.edu	37	2	223436659	223436659	+	Silent	SNP	G	A	A	rs141929079	byFrequency	TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223436659G>A	uc002vne.1	-	17	1736	c.1701C>T	c.(1699-1701)GAC>GAT	p.D567D	FARSB_uc010zlq.1_Silent_p.D587D|FARSB_uc002vnf.1_Silent_p.D468D	NM_005687	NP_005678	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	567					phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|RNA binding			ovary(1)	1		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	TGGTGATAACGTCAGGATGAA	0.502													4	45	---	---	---	---	PASS
INPP5D	3635	broad.mit.edu	37	2	234072343	234072343	+	Intron	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234072343G>T	uc010zmo.1	+						INPP5D_uc010zmp.1_Intron	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN	SH2 containing inositol phosphatase isoform a						apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		GTTGGGTTTTGCTGTTGAAGG	0.537													33	66	---	---	---	---	PASS
INPP5D	3635	broad.mit.edu	37	2	234091054	234091054	+	Splice_Site	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234091054A>T	uc010zmo.1	+	18	2225	c.2072_splice	c.e18-2	p.G691_splice	INPP5D_uc010zmp.1_Splice_Site_p.G690_splice	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN	SH2 containing inositol phosphatase isoform a						apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		CCTCCCCTGCAGGCAGTACCA	0.517													20	100	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238275720	238275720	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238275720C>T	uc002vwl.2	-	11	5395	c.5110G>A	c.(5110-5112)GAC>AAC	p.D1704N	COL6A3_uc002vwo.2_Missense_Mutation_p.D1498N|COL6A3_uc010znj.1_Missense_Mutation_p.D1097N	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1704	VWFA 9.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TTGATGGCGTCAATAATCTGC	0.527													4	38	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238289868	238289868	+	Silent	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238289868T>C	uc002vwl.2	-	5	1872	c.1587A>G	c.(1585-1587)CTA>CTG	p.L529L	COL6A3_uc002vwo.2_Silent_p.L323L|COL6A3_uc010znj.1_Silent_p.L122L|COL6A3_uc002vwq.2_Silent_p.L323L|COL6A3_uc002vwr.2_Silent_p.L122L|COL6A3_uc010znk.1_Silent_p.L529L	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	529	VWFA 3.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GAACAAAGTCTAGAGCAGAGC	0.512													25	151	---	---	---	---	PASS
SEPT2	4735	broad.mit.edu	37	2	242287601	242287601	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242287601G>C	uc002wbc.2	+	12	1400	c.979G>C	c.(979-981)GCT>CCT	p.A327P	SEPT2_uc002wbd.2_Missense_Mutation_p.A327P|SEPT2_uc002wbf.2_Missense_Mutation_p.A327P|SEPT2_uc002wbg.2_Missense_Mutation_p.A327P|SEPT2_uc002wbh.2_Missense_Mutation_p.A337P|SEPT2_uc010zop.1_Missense_Mutation_p.A362P	NM_001008491	NP_001008491	Q15019	SEPT2_HUMAN	septin 2	327					cell division|mitosis	actin cytoskeleton|cleavage furrow|condensed chromosome kinetochore|midbody|nucleolus|septin complex|spindle	GTP binding			central_nervous_system(1)	1		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		GGAAAAAGAAGCTGAGGTAAG	0.219													43	58	---	---	---	---	PASS
LOC401052	401052	broad.mit.edu	37	3	10049250	10049250	+	Silent	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10049250G>T	uc003bur.1	-	4	749	c.135C>A	c.(133-135)ACC>ACA	p.T45T	CIDEC_uc003bto.2_Intron	NM_001008737	NP_001008737	B3KMQ7	B3KMQ7_HUMAN	hypothetical protein LOC401052	45											0						AGTGCTTCTGGGTGAGGCAGG	0.572													6	135	---	---	---	---	PASS
IQSEC1	9922	broad.mit.edu	37	3	12954962	12954962	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12954962T>C	uc003bxt.2	-	9	2333	c.2324A>G	c.(2323-2325)CAG>CGG	p.Q775R	IQSEC1_uc003bxu.3_Missense_Mutation_p.Q653R|IQSEC1_uc011auw.1_Missense_Mutation_p.Q761R	NM_014869	NP_055684	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1 isoform b	775	PH.				regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1						GATTTCTCGCTGGTGTAGTCC	0.582													11	13	---	---	---	---	PASS
CLASP2	23122	broad.mit.edu	37	3	33602366	33602366	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33602366T>C	uc003cfu.2	-	27	3218	c.2864A>G	c.(2863-2865)AAA>AGA	p.K955R	CLASP2_uc003cfs.2_Missense_Mutation_p.K162R|CLASP2_uc003cft.2_RNA|CLASP2_uc010hgb.2_RNA|CLASP2_uc011axt.1_Missense_Mutation_p.K555R	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2	964										ovary(3)|central_nervous_system(1)	4						ACCCATTTTTTTTAGTAGTTG	0.353													104	93	---	---	---	---	PASS
ARPP21	10777	broad.mit.edu	37	3	35758790	35758790	+	Missense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35758790T>A	uc003cgb.2	+	13	1200	c.936T>A	c.(934-936)AGT>AGA	p.S312R	ARPP21_uc003cga.2_Intron|ARPP21_uc011axy.1_Missense_Mutation_p.S278R|ARPP21_uc003cgf.2_Intron	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN	cyclic AMP-regulated phosphoprotein, 21 kD	312				Missing (in Ref. 6; CAB61414).		cytoplasm	nucleic acid binding			ovary(2)|skin(1)	3						TCATTTCCAGTAGGCTCTTGG	0.343													25	32	---	---	---	---	PASS
CCBP2	1238	broad.mit.edu	37	3	42906393	42906393	+	Missense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42906393T>A	uc003cme.2	+	3	578	c.399T>A	c.(397-399)TTT>TTA	p.F133L	CCBP2_uc003cmd.1_Intron|CCBP2_uc003cmf.2_Missense_Mutation_p.F133L|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Intron	NM_001296	NP_001287	O00590	CCBP2_HUMAN	chemokine binding protein 2	133	Helical; Name=3; (Potential).				chemotaxis|immune response|multicellular organismal development	integral to plasma membrane	C-X-C chemokine receptor activity			lung(4)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.241)		GTGGCATCTTTTTCATTAGCT	0.522													35	106	---	---	---	---	PASS
C3orf67	200844	broad.mit.edu	37	3	58899596	58899596	+	Intron	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58899596A>C	uc003dkt.1	-						uc003dku.1_Intron|C3orf67_uc003dkv.1_Intron|C3orf67_uc003dkw.2_Intron|C3orf67_uc011bfg.1_Intron	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844												0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		CACCACTAAAATAGAGAGATG	0.378													7	31	---	---	---	---	PASS
ADAMTS9	56999	broad.mit.edu	37	3	64587633	64587633	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64587633C>G	uc003dmg.2	-	26	4036	c.4004G>C	c.(4003-4005)GGC>GCC	p.G1335A	ADAMTS9_uc011bfo.1_Missense_Mutation_p.G1307A|ADAMTS9_uc003dmh.1_Missense_Mutation_p.G1164A|ADAMTS9_uc011bfp.1_Missense_Mutation_p.G246A	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1335	TSP type-1 9.				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TCCCCAGGGGCCAGTTCTCCA	0.532													29	35	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89176407	89176407	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89176407C>G	uc003dqy.2	+	2	362	c.137C>G	c.(136-138)TCT>TGT	p.S46C	EPHA3_uc003dqx.1_Missense_Mutation_p.S46C|EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	46	Extracellular (Potential).					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GGCTGGATCTCTTATCCATCA	0.333										TSP Lung(6;0.00050)			40	89	---	---	---	---	PASS
OR5H6	79295	broad.mit.edu	37	3	97983199	97983199	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97983199T>C	uc003dsi.1	+	1	71	c.71T>C	c.(70-72)TTG>TCG	p.L24S		NM_001005479	NP_001005479	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H,	24	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3						AATGCAACATTGCTGACAGAG	0.408													18	197	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108773610	108773610	+	Missense_Mutation	SNP	T	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108773610T>G	uc003dxl.2	-	14	1382	c.1295A>C	c.(1294-1296)CAG>CCG	p.Q432P	MORC1_uc011bhn.1_Missense_Mutation_p.Q432P	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	432					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						GACCAAGTACTGTCCCATGAC	0.383													56	107	---	---	---	---	PASS
GRAMD1C	54762	broad.mit.edu	37	3	113658813	113658813	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113658813G>A	uc003eaq.3	+	16	1848	c.1772G>A	c.(1771-1773)CGT>CAT	p.R591H	GRAMD1C_uc011bil.1_RNA|GRAMD1C_uc003ear.2_Missense_Mutation_p.R424H|GRAMD1C_uc003eas.2_Missense_Mutation_p.R386H|GRAMD1C_uc003eat.2_Missense_Mutation_p.R250H	NM_017577	NP_060047	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	591						integral to membrane				ovary(2)|skin(1)	3						TCCTTTTACCGTCTCCGCCTC	0.368													6	107	---	---	---	---	PASS
ZBTB20	26137	broad.mit.edu	37	3	114069951	114069951	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114069951C>G	uc003ebi.2	-	4	1154	c.974G>C	c.(973-975)GGC>GCC	p.G325A	ZBTB20_uc003ebj.2_Missense_Mutation_p.G252A|ZBTB20_uc010hqp.2_Missense_Mutation_p.G252A|ZBTB20_uc003ebk.2_Missense_Mutation_p.G252A|ZBTB20_uc003ebl.2_Missense_Mutation_p.G252A|ZBTB20_uc003ebm.2_Missense_Mutation_p.G252A|ZBTB20_uc003ebn.2_Missense_Mutation_p.G252A|uc003ebo.1_5'Flank	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform	325					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GTGGATGTTGCCCACTAGGGT	0.612													45	149	---	---	---	---	PASS
C3orf15	89876	broad.mit.edu	37	3	119459492	119459492	+	Missense_Mutation	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119459492A>C	uc003ede.3	+	13	1707	c.1630A>C	c.(1630-1632)AAG>CAG	p.K544Q	C3orf15_uc010hqy.1_Missense_Mutation_p.K544Q|C3orf15_uc010hqz.2_Missense_Mutation_p.K482Q|C3orf15_uc011bjd.1_Missense_Mutation_p.K418Q|C3orf15_uc011bje.1_Missense_Mutation_p.K524Q|C3orf15_uc010hra.1_Missense_Mutation_p.K305Q	NM_033364	NP_203528	Q7Z4T9	AAT1_HUMAN	AAT1-alpha	380	Potential.					mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		AAAAGCCGAGAAGCAAGTGAC	0.443													17	36	---	---	---	---	PASS
STXBP5L	9515	broad.mit.edu	37	3	121126218	121126218	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121126218A>G	uc003eec.3	+	24	2928	c.2788A>G	c.(2788-2790)AGA>GGA	p.R930G	STXBP5L_uc011bji.1_Missense_Mutation_p.R906G	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	930	WD 12.				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		AAAATCTTGGAGAAGGAAAGT	0.393													21	55	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121228452	121228452	+	Missense_Mutation	SNP	T	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121228452T>G	uc003eee.3	-	12	2044	c.1915A>C	c.(1915-1917)ATG>CTG	p.M639L		NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	639					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		AAGCCCTTCATTGCTCTTTGC	0.348								DNA_polymerases_(catalytic_subunits)					28	90	---	---	---	---	PASS
HCLS1	3059	broad.mit.edu	37	3	121354578	121354578	+	Intron	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121354578T>C	uc003eeh.3	-						HCLS1_uc011bjj.1_Intron|HCLS1_uc011bjk.1_Intron	NM_005335	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1						erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(114;0.0912)		TCACTAAGCCTCACCGGCTTC	0.502													15	143	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121448165	121448165	+	Missense_Mutation	SNP	T	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121448165T>G	uc003eei.3	-	4	398	c.272A>C	c.(271-273)AAC>ACC	p.N91T	GOLGB1_uc010hrc.2_Missense_Mutation_p.N91T|GOLGB1_uc003eej.3_Missense_Mutation_p.N52T|GOLGB1_uc011bjm.1_Missense_Mutation_p.N52T|GOLGB1_uc010hrd.1_Missense_Mutation_p.N91T	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	91	Potential.|Cytoplasmic (Potential).				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		TTTAATTTTGTTATCAGCAGC	0.318													30	101	---	---	---	---	PASS
CASR	846	broad.mit.edu	37	3	121980410	121980410	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121980410C>T	uc003eev.3	+	4	900	c.528C>T	c.(526-528)AAC>AAT	p.N176N	CASR_uc003eew.3_Silent_p.N176N	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	176	Extracellular (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TCCTCAGCAACAAGAATCAAT	0.463													34	197	---	---	---	---	PASS
ZNF148	7707	broad.mit.edu	37	3	124953165	124953165	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124953165G>C	uc003ehx.3	-	8	1162	c.676C>G	c.(676-678)CCA>GCA	p.P226A	SLC12A8_uc003ehw.3_Intron|ZNF148_uc003ehz.3_Missense_Mutation_p.P226A|ZNF148_uc010hsa.2_Missense_Mutation_p.P226A|ZNF148_uc003eia.3_Missense_Mutation_p.P226A|ZNF148_uc003ehy.2_Missense_Mutation_p.P21A	NM_021964	NP_068799	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	226					cellular defense response|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4						CAGCGAAATGGTTTTTCACCT	0.299													52	116	---	---	---	---	PASS
CNBP	7555	broad.mit.edu	37	3	128890383	128890383	+	Splice_Site	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128890383T>C	uc003elq.3	-	3	331	c.125_splice	c.e3-1	p.G42_splice	CNBP_uc003elr.3_Splice_Site_p.G35_splice|CNBP_uc011bku.1_Intron	NM_003418	NP_003409	P62633	CNBP_HUMAN	zinc finger protein 9 isoform 3						cholesterol biosynthetic process	endoplasmic reticulum	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ACTGGAAACCTGTTTTGAGCA	0.393													22	53	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134967229	134967229	+	Silent	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134967229C>A	uc003eqt.2	+	14	2788	c.2568C>A	c.(2566-2568)CTC>CTA	p.L856L	EPHB1_uc003equ.2_Silent_p.L417L	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	856	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						TACACCAGCTCATGCTGGACT	0.572													37	60	---	---	---	---	PASS
ARMC8	25852	broad.mit.edu	37	3	137907372	137907372	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137907372G>A	uc003esa.1	+	2	370	c.3G>A	c.(1-3)ATG>ATA	p.M1I	ARMC8_uc003erw.2_Missense_Mutation_p.M1I|ARMC8_uc003erx.2_Missense_Mutation_p.M1I|ARMC8_uc003ery.2_5'UTR|ARMC8_uc003erz.2_Intron|ARMC8_uc011bmf.1_Intron|ARMC8_uc011bmg.1_Intron|ARMC8_uc011bmh.1_Intron|ARMC8_uc003esb.1_5'UTR	NM_015396	NP_056211	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8 isoform 2	Error:Variant_position_missing_in_Q8IUR7_after_alignment							binding				0						ctctgagaatggtcagtttac	0.030													37	99	---	---	---	---	PASS
CHST2	9435	broad.mit.edu	37	3	142840794	142840794	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142840794A>G	uc003evm.2	+	2	2025	c.1136A>G	c.(1135-1137)AAG>AGG	p.K379R		NM_004267	NP_004258	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O)	379	Lumenal (Potential).				inflammatory response|multicellular organismal development|N-acetylglucosamine metabolic process|sulfur compound metabolic process	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity			ovary(3)	3						CTTGGCGCCAAGAAGGAGGGC	0.662													19	61	---	---	---	---	PASS
SERP1	27230	broad.mit.edu	37	3	150263884	150263884	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150263884C>A	uc003exy.2	-	1	545	c.39G>T	c.(37-39)AAG>AAT	p.K13N	SERP1_uc003exz.2_RNA|EIF2A_uc003eya.2_5'Flank|EIF2A_uc003eyb.2_5'Flank|EIF2A_uc003eyc.2_5'Flank|EIF2A_uc011bnv.1_5'Flank|EIF2A_uc011bnw.1_5'Flank	NM_014445	NP_055260	Q9Y6X1	SERP1_HUMAN	stress-associated endoplasmic reticulum protein	13	Cytoplasmic (Potential).				plasma membrane organization|protein glycosylation|protein transport|transmembrane transport	endoplasmic reticulum membrane|integral to membrane|ribosome					0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TCTTGCTGTGCTTCTCGTTGG	0.662													36	92	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155232542	155232542	+	Silent	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155232542C>A	uc011bok.1	-	11	1843	c.1566G>T	c.(1564-1566)ACG>ACT	p.T522T	PLCH1_uc011boj.1_Silent_p.T522T|PLCH1_uc011bol.1_Silent_p.T504T	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	522					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			AGCCTTCATGCGTGGCCTTCA	0.388													49	76	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164764764	164764764	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164764764G>C	uc003fei.2	-	16	1814	c.1752C>G	c.(1750-1752)TTC>TTG	p.F584L		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	584	Lumenal.|Isomaltase.			F -> L (in Ref. 3; AAI15035).	carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	GGGTAAGAATGAAGCTTCTCT	0.323										HNSCC(35;0.089)			10	62	---	---	---	---	PASS
BCHE	590	broad.mit.edu	37	3	165547903	165547903	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165547903C>T	uc003fem.3	-	2	1079	c.919G>A	c.(919-921)GTT>ATT	p.V307I	BCHE_uc003fen.3_Intron	NM_000055	NP_000046	P06276	CHLE_HUMAN	butyrylcholinesterase precursor	307					choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding			ovary(3)|pancreas(1)	4					Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)	TAGGGGACAACAAATGCTTCA	0.393													19	72	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936099	178936099	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936099G>C	uc003fjk.2	+	10	1798	c.1641G>C	c.(1639-1641)GAG>GAC	p.E547D		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	547	PI3K helical.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E547K(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			CTGAGCAGGAGAAAGATTTTC	0.363		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			39	63	---	---	---	---	PASS
ST6GAL1	6480	broad.mit.edu	37	3	186790609	186790609	+	Intron	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186790609G>A	uc003frb.2	+						ST6GAL1_uc003frc.2_Intron|ST6GAL1_uc003frd.2_Intron	NM_173216	NP_775323	P15907	SIAT1_HUMAN	ST6 beta-galactosamide						humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			central_nervous_system(1)	1	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		GAATGTTCAAGCGACAGCTTA	0.448													7	279	---	---	---	---	PASS
CPN2	1370	broad.mit.edu	37	3	194062093	194062093	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194062093C>T	uc003fts.2	-	2	1429	c.1339G>A	c.(1339-1341)GTC>ATC	p.V447I		NM_001080513	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	447	LRRCT.				protein stabilization	extracellular region	enzyme regulator activity			ovary(5)	5	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		TCCCGGGTGACGGGACACACC	0.647													16	110	---	---	---	---	PASS
HTRA3	94031	broad.mit.edu	37	4	8294050	8294050	+	Nonsense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8294050C>A	uc003gla.2	+	5	1110	c.906C>A	c.(904-906)TAC>TAA	p.Y302*	HTRA3_uc003gkz.2_Nonsense_Mutation_p.Y302*	NM_053044	NP_444272	P83110	HTRA3_HUMAN	HtrA serine peptidase 3 precursor	302	Serine protease.				proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity			ovary(1)	1						CCTTGCAGTACGGGAACTCCG	0.572													5	61	---	---	---	---	PASS
CPZ	8532	broad.mit.edu	37	4	8621111	8621111	+	Missense_Mutation	SNP	C	T	T	rs147183461		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8621111C>T	uc003glm.2	+	11	1852	c.1726C>T	c.(1726-1728)CGT>TGT	p.R576C	CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Missense_Mutation_p.R439C|CPZ_uc003glo.2_Missense_Mutation_p.R565C|CPZ_uc003glp.2_RNA	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	576					proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3						GAGGGCTGGCCGTGTGGACTT	0.592													21	26	---	---	---	---	PASS
C1QTNF7	114905	broad.mit.edu	37	4	15443952	15443952	+	Silent	SNP	G	C	C	rs150846082		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15443952G>C	uc011bxb.1	+	3	626	c.399G>C	c.(397-399)CCG>CCC	p.P133P	C1QTNF7_uc003gno.2_Silent_p.P140P|C1QTNF7_uc003gnp.2_Silent_p.P133P	NM_001135171	NP_001128643	Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7	133	Collagen-like.					collagen					0						AAGGGGACCCGGGGCTGCCTG	0.517													89	126	---	---	---	---	PASS
LDB2	9079	broad.mit.edu	37	4	16597389	16597389	+	Silent	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16597389G>C	uc003goz.2	-	3	661	c.345C>G	c.(343-345)TCC>TCG	p.S115S	LDB2_uc003gpa.2_Silent_p.S115S|LDB2_uc003gpb.2_Silent_p.S115S|LDB2_uc011bxh.1_Silent_p.S115S|LDB2_uc010iee.2_Silent_p.S115S|LDB2_uc003goy.2_5'UTR|LDB2_uc011bxi.1_5'UTR	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a	115							LIM domain binding|transcription cofactor activity				0						CCACCGTGATGGATGAGTTGT	0.527													13	98	---	---	---	---	PASS
PGM2	55276	broad.mit.edu	37	4	37831659	37831659	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37831659G>C	uc011byb.1	+	2	228	c.155G>C	c.(154-156)GGG>GCG	p.G52A	PGM2_uc011bya.1_5'UTR|PGM2_uc011byc.1_5'UTR	NM_018290	NP_060760	Q96G03	PGM2_HUMAN	phosphoglucomutase 2	52					glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity|phosphopentomutase activity			ovary(1)	1						AAATGTTTTGGGGCCCGAATG	0.433													23	30	---	---	---	---	PASS
KLHL5	51088	broad.mit.edu	37	4	39082828	39082828	+	Silent	SNP	G	A	A	rs143433133	byFrequency	TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39082828G>A	uc003gts.2	+	3	885	c.810G>A	c.(808-810)TCG>TCA	p.S270S	KLHL5_uc003gtp.2_Silent_p.S224S|KLHL5_uc003gtq.2_Silent_p.S83S|KLHL5_uc003gtr.1_Silent_p.S270S|KLHL5_uc003gtt.2_Silent_p.S209S	NM_015990	NP_057074	Q96PQ7	KLHL5_HUMAN	kelch-like 5 isoform 1	270	BTB.					cytoplasm|cytoskeleton	actin binding			ovary(1)	1						AACCAAATTCGTTGTGGTCCT	0.353													26	27	---	---	---	---	PASS
KLB	152831	broad.mit.edu	37	4	39436041	39436041	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39436041A>T	uc003gua.2	+	2	1134	c.1037A>T	c.(1036-1038)AAG>ATG	p.K346M	KLB_uc011byj.1_Missense_Mutation_p.K346M	NM_175737	NP_783864	Q86Z14	KLOTB_HUMAN	klotho beta	346	Extracellular (Potential).|Glycosyl hydrolase-1 1.				carbohydrate metabolic process	integral to membrane|plasma membrane	cation binding|fibroblast growth factor binding|hydrolase activity, hydrolyzing O-glycosyl compounds			skin(1)	1						GGGATGAGAAAGAAGTTGTTC	0.448													44	42	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47570958	47570958	+	Silent	SNP	T	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47570958T>G	uc003gxk.1	+	16	3122	c.2958T>G	c.(2956-2958)CCT>CCG	p.P986P	ATP10D_uc003gxl.1_Silent_p.P234P	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	986	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						TTCAGCCTCCTGTCCCCCGGG	0.488													57	40	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	69342005	69342005	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69342005C>G	uc003hdz.3	+	7	620	c.556C>G	c.(556-558)CTA>GTA	p.L186V		NM_014058	NP_054777			transmembrane protease, serine 11E																		AAGTAAAACTCTAGGTCAGAG	0.517													82	90	---	---	---	---	PASS
ENPEP	2028	broad.mit.edu	37	4	111441232	111441232	+	Intron	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111441232A>T	uc003iab.3	+							NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase						cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	TGGAAGAGGTAAGGAAGAGTA	0.313													7	40	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123175391	123175391	+	Silent	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123175391T>C	uc003ieh.2	+	36	6009	c.5964T>C	c.(5962-5964)CCT>CCC	p.P1988P	KIAA1109_uc003iel.1_5'Flank|KIAA1109_uc003iek.2_Silent_p.P607P	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	1988					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						AAGATCTACCTCTGATGCCTC	0.378													3	66	---	---	---	---	PASS
NAA15	80155	broad.mit.edu	37	4	140297638	140297638	+	Intron	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140297638A>T	uc003ihu.1	+							NM_057175	NP_476516	Q9BXJ9	NAA15_HUMAN	NMDA receptor regulated 1						angiogenesis|cell differentiation|N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	protein binding			ovary(1)|skin(1)	2						GTAGGCAATTAGGGTACAGTG	0.378													20	43	---	---	---	---	PASS
RAB33B	83452	broad.mit.edu	37	4	140393857	140393857	+	Silent	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140393857A>T	uc003ihv.2	+	2	656	c.267A>T	c.(265-267)ACA>ACT	p.T89T		NM_031296	NP_112586	Q9H082	RB33B_HUMAN	RAB33B, member RAS oncogene family	89	GTP (By similarity).				protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding				0	all_hematologic(180;0.162)					TATGGGACACAGCAGGACAAG	0.378													7	55	---	---	---	---	PASS
RNF150	57484	broad.mit.edu	37	4	141847239	141847239	+	Intron	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141847239A>G	uc003iio.1	-						RNF150_uc010iok.1_Intron|RNF150_uc003iip.1_Intron	NM_020724	NP_065775	Q9ULK6	RN150_HUMAN	ring finger protein 150 precursor							integral to membrane	zinc ion binding			ovary(1)	1	all_hematologic(180;0.162)					TGCAATGAGAACCATACATCT	0.388													35	66	---	---	---	---	PASS
HHIP	64399	broad.mit.edu	37	4	145567964	145567964	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145567964A>G	uc003ijs.1	+	1	792	c.137A>G	c.(136-138)AAG>AGG	p.K46R	uc003ijq.1_5'Flank|HHIP_uc003ijr.1_Missense_Mutation_p.K46R	NM_022475	NP_071920	Q96QV1	HHIP_HUMAN	hedgehog-interacting protein precursor	46	Arg-rich.					cytoplasm|extracellular region	catalytic activity|protein binding|zinc ion binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		AACCCCCCGAAGCGCCTGAAA	0.592													24	42	---	---	---	---	PASS
GUCY1B3	2983	broad.mit.edu	37	4	156721210	156721210	+	Missense_Mutation	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156721210A>C	uc003ipc.2	+	9	1326	c.1159A>C	c.(1159-1161)AAG>CAG	p.K387Q	GUCY1B3_uc011cio.1_Missense_Mutation_p.K409Q|GUCY1B3_uc011cip.1_Missense_Mutation_p.K367Q|GUCY1B3_uc003ipd.2_Missense_Mutation_p.K315Q|GUCY1B3_uc010iqf.2_Missense_Mutation_p.K387Q|GUCY1B3_uc010iqg.2_Missense_Mutation_p.K315Q|GUCY1B3_uc011ciq.1_Missense_Mutation_p.K315Q	NM_000857	NP_000848	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	387					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		GGAAGATGAAAAGAAAAAGAC	0.383													7	41	---	---	---	---	PASS
GPM6A	2823	broad.mit.edu	37	4	176572976	176572976	+	Intron	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176572976T>A	uc003iuf.2	-						GPM6A_uc011ckj.1_Intron|GPM6A_uc003iug.2_Intron|GPM6A_uc003iuh.2_Intron	NM_201591	NP_963885	P51674	GPM6A_HUMAN	glycoprotein M6A isoform 2							cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		AGATCCAATATCCACTTACCA	0.408													26	82	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177072999	177072999	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177072999A>G	uc003iuj.2	+	18	2569	c.2413A>G	c.(2413-2415)AAA>GAA	p.K805E	WDR17_uc003iuk.2_Missense_Mutation_p.K781E|WDR17_uc003ium.3_Missense_Mutation_p.K781E|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_Missense_Mutation_p.K24E	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	805										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CAAGATGTCTAAATTTGGTGG	0.333													16	40	---	---	---	---	PASS
ENPP6	133121	broad.mit.edu	37	4	185038118	185038118	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185038118A>G	uc003iwc.2	-	5	888	c.746T>C	c.(745-747)ATG>ACG	p.M249T		NM_153343	NP_699174	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	249	Extracellular (Potential).				lipid catabolic process	extracellular region|integral to membrane|plasma membrane				central_nervous_system(1)	1		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		CACTTTGTCCATCCAGAAAAT	0.542													17	54	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187541653	187541653	+	Silent	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187541653T>C	uc003izf.2	-	10	6275	c.6087A>G	c.(6085-6087)TCA>TCG	p.S2029S		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	2029	Extracellular (Potential).|Cadherin 18.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						ACAGAACTCCTGAAGTGCGGC	0.463										HNSCC(5;0.00058)			63	192	---	---	---	---	PASS
NKD2	85409	broad.mit.edu	37	5	1034432	1034432	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1034432A>G	uc003jbt.1	+	6	418	c.413A>G	c.(412-414)AAG>AGG	p.K138R	NKD2_uc010itf.1_Missense_Mutation_p.K138R	NM_033120	NP_149111	Q969F2	NKD2_HUMAN	naked cuticle homolog 2	138	Targeting to the basolateral cell membrane.|EF-hand.|Potential.|Interaction with DVL1, DVL2 and DVL3 (By similarity).				exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding				0	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			AACTGCGGGAAGGTCACCAGG	0.617													20	61	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13866338	13866338	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13866338G>A	uc003jfd.2	-	26	4149	c.4107C>T	c.(4105-4107)ATC>ATT	p.I1369I		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1369	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CCTGAAACATGATAAGCCTGT	0.353									Kartagener_syndrome				11	100	---	---	---	---	PASS
RAI14	26064	broad.mit.edu	37	5	34813695	34813695	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34813695A>T	uc003jir.2	+	11	978	c.782A>T	c.(781-783)AAA>ATA	p.K261I	RAI14_uc010iur.2_Intron|RAI14_uc011coj.1_Missense_Mutation_p.K261I|RAI14_uc010ius.1_Missense_Mutation_p.K190I|RAI14_uc003jis.2_Missense_Mutation_p.K264I|RAI14_uc003jit.2_Missense_Mutation_p.K261I|RAI14_uc011cok.1_Missense_Mutation_p.K253I	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a	261						cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					CAAGTCTCTAAAATAAGCTCA	0.403													20	69	---	---	---	---	PASS
AGXT2	64902	broad.mit.edu	37	5	35010097	35010097	+	Intron	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35010097G>C	uc003jjf.2	-						AGXT2_uc003jje.1_Intron|AGXT2_uc011com.1_Intron	NM_031900	NP_114106	Q9BYV1	AGT2_HUMAN	alanine-glyoxylate aminotransferase 2 precursor						glyoxylate metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity|alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(3)|skin(1)	4	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)	GGGCAGATTAGCACCTACCTT	0.463													24	105	---	---	---	---	PASS
DAB2	1601	broad.mit.edu	37	5	39390671	39390671	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39390671C>T	uc003jlx.2	-	5	868	c.337G>A	c.(337-339)GAG>AAG	p.E113K	DAB2_uc003jlw.2_Missense_Mutation_p.E113K	NM_001343	NP_001334	P98082	DAB2_HUMAN	disabled homolog 2	113	PID.				cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding			kidney(2)|skin(1)	3	all_lung(31;0.000197)		Epithelial(62;0.137)			TGTTCATGCTCTATTACCTTA	0.393													45	48	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262720	45262720	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262720C>A	uc003jok.2	-	8	2001	c.1976G>T	c.(1975-1977)CGC>CTC	p.R659L		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	659	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						TGTCCTCATGCGGGAGGTCGG	0.567													74	76	---	---	---	---	PASS
FST	10468	broad.mit.edu	37	5	52781529	52781529	+	Intron	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52781529A>G	uc003jpd.2	+						FST_uc003jpc.2_3'UTR	NM_013409	NP_037541	P19883	FST_HUMAN	follistatin isoform FST344 precursor						hemopoietic progenitor cell differentiation|negative regulation of activin receptor signaling pathway|negative regulation of follicle-stimulating hormone secretion|negative regulation of transcription from RNA polymerase II promoter|positive regulation of hair follicle development	extracellular region	activin binding|protein binding|signal transducer activity				0		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				ATCTGCCCGTAAAACCTGAGC	0.358													4	182	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82808109	82808109	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82808109G>T	uc003kii.3	+	6	1292	c.936G>T	c.(934-936)AGG>AGT	p.R312S	VCAN_uc003kij.3_Missense_Mutation_p.R312S|VCAN_uc010jau.2_Missense_Mutation_p.R312S|VCAN_uc003kik.3_Missense_Mutation_p.R312S|VCAN_uc003kih.3_Missense_Mutation_p.R312S	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	312	Link 2.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		CTGTGGCCAGGGCCCAGTGTG	0.597													20	16	---	---	---	---	PASS
EDIL3	10085	broad.mit.edu	37	5	83360526	83360526	+	Missense_Mutation	SNP	T	A	A	rs143816596		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83360526T>A	uc003kio.1	-	8	1364	c.945A>T	c.(943-945)GAA>GAT	p.E315D	EDIL3_uc003kip.1_Missense_Mutation_p.E305D|EDIL3_uc011ctt.1_Missense_Mutation_p.E92D	NM_005711	NP_005702	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like	315					cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		TACCCGACAGTTCACAGCCAA	0.368													16	27	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90016835	90016835	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90016835G>A	uc003kju.2	+	45	9803	c.9707G>A	c.(9706-9708)AGT>AAT	p.S3236N	GPR98_uc003kjt.2_Missense_Mutation_p.S942N|GPR98_uc003kjv.2_Missense_Mutation_p.S836N	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	3236	Extracellular (Potential).|EAR 1.				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTGGCTGTGAGTGTGCAGTGG	0.383													27	84	---	---	---	---	PASS
ELL2	22936	broad.mit.edu	37	5	95224661	95224661	+	Nonsense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95224661T>A	uc003klr.3	-	12	2187	c.1837A>T	c.(1837-1839)AGA>TGA	p.R613*		NM_012081	NP_036213	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	613					regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		TATTCACATCTGTATTTTTCT	0.368													24	22	---	---	---	---	PASS
APC	324	broad.mit.edu	37	5	112174043	112174043	+	Nonsense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112174043G>T	uc010jby.2	+	16	3132	c.2752G>T	c.(2752-2754)GAG>TAG	p.E918*	APC_uc011cvt.1_Nonsense_Mutation_p.E900*|APC_uc003kpz.3_Nonsense_Mutation_p.E918*|APC_uc003kpy.3_Nonsense_Mutation_p.E918*|APC_uc010jbz.2_Nonsense_Mutation_p.E635*|APC_uc010jca.2_Nonsense_Mutation_p.E218*	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	918	Ser-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.E918*(1)|p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGTGACAGATGAGAGAAATGC	0.413		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			24	31	---	---	---	---	PASS
APC	324	broad.mit.edu	37	5	112177057	112177057	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112177057G>T	uc010jby.2	+	16	6146	c.5766G>T	c.(5764-5766)CAG>CAT	p.Q1922H	APC_uc011cvt.1_Missense_Mutation_p.Q1904H|APC_uc003kpz.3_Missense_Mutation_p.Q1922H|APC_uc003kpy.3_Missense_Mutation_p.Q1922H|APC_uc010jbz.2_Missense_Mutation_p.Q1639H|APC_uc010jca.2_Missense_Mutation_p.Q1222H	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	1922	Ser-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ATCGAGGTCAGCCTAAACCCA	0.423		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			19	22	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	128863463	128863463	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128863463A>G	uc003kvb.1	+	5	1091	c.1091A>G	c.(1090-1092)AAG>AGG	p.K364R	ADAMTS19_uc003kvc.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	364	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TTCCAACACAAGAGTCTGAGT	0.318													16	98	---	---	---	---	PASS
FSTL4	23105	broad.mit.edu	37	5	132556550	132556550	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132556550C>T	uc003kyn.1	-	12	1566	c.1348G>A	c.(1348-1350)GTG>ATG	p.V450M	FSTL4_uc003kym.1_Missense_Mutation_p.V99M	NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4 precursor	450						extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATGTTTCCCACGCTGAGGCCT	0.552													10	47	---	---	---	---	PASS
ARHGEF37	389337	broad.mit.edu	37	5	149001624	149001624	+	Missense_Mutation	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149001624A>C	uc003lra.1	+	9	1398	c.1334A>C	c.(1333-1335)CAG>CCG	p.Q445P		NM_001001669	NP_001001669	A1IGU5	ARH37_HUMAN	hypothetical protein LOC389337	445	BAR.				regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0						AGCATGGCCCAGGTAAGGCCT	0.607													6	6	---	---	---	---	PASS
LARP1	23367	broad.mit.edu	37	5	154169899	154169899	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154169899G>A	uc003lvp.2	+	2	880	c.451G>A	c.(451-453)GCC>ACC	p.A151T	LARP1_uc003lvo.2_Missense_Mutation_p.A74T|LARP1_uc010jie.1_5'UTR	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	la related protein isoform 2	151							protein binding|RNA binding			ovary(2)|pancreas(1)|skin(1)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CTCTGCTCCAGCCAAGGTGGT	0.552													7	53	---	---	---	---	PASS
LARP1	23367	broad.mit.edu	37	5	154183316	154183316	+	Intron	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154183316C>T	uc003lvp.2	+						LARP1_uc003lvo.2_Intron	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	la related protein isoform 2								protein binding|RNA binding			ovary(2)|pancreas(1)|skin(1)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GTGAGGCATTCCTGTCGGGCT	0.527													6	21	---	---	---	---	PASS
EBF1	1879	broad.mit.edu	37	5	158135176	158135176	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158135176G>T	uc010jip.2	-	15	1857	c.1555C>A	c.(1555-1557)CCA>ACA	p.P519T	EBF1_uc011ddw.1_Missense_Mutation_p.P387T|EBF1_uc011ddx.1_Missense_Mutation_p.P520T|EBF1_uc003lxl.3_Missense_Mutation_p.P488T	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor	519	Pro/Ser/Thr-rich.				multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGGCTGGATGGCACTACTGAG	0.567			T	HMGA2	lipoma								5	5	---	---	---	---	PASS
RANBP17	64901	broad.mit.edu	37	5	170725835	170725835	+	Silent	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170725835A>G	uc003mba.2	+	28	3256	c.3240A>G	c.(3238-3240)GAA>GAG	p.E1080E	RANBP17_uc003mbb.2_Silent_p.E405E|RANBP17_uc010jjs.2_RNA	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	1080					mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GCAACACTGAACCATGCAGTC	0.507			T	TRD@	ALL								23	33	---	---	---	---	PASS
DOK3	79930	broad.mit.edu	37	5	176931447	176931447	+	Missense_Mutation	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176931447A>C	uc003mhk.2	-	6	1033	c.1028T>G	c.(1027-1029)ATG>AGG	p.M343R	DOK3_uc003mhh.3_Intron|DOK3_uc003mhi.3_Intron|DOK3_uc003mhj.3_Intron|DOK3_uc003mhl.2_Missense_Mutation_p.M287R	NM_024872	NP_079148	Q7L591	DOK3_HUMAN	docking protein 3 isoform 1	343	Pro-rich.					cytoplasm|plasma membrane	insulin receptor binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			TCCTGGTGGCATCTCCCGAAG	0.706													17	16	---	---	---	---	PASS
IRF4	3662	broad.mit.edu	37	6	398903	398903	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:398903G>T	uc003msz.3	+	6	826	c.713G>T	c.(712-714)AGC>ATC	p.S238I	IRF4_uc010jne.1_Missense_Mutation_p.S238I|IRF4_uc003mta.3_RNA|IRF4_uc003mtb.3_Missense_Mutation_p.S237I|IRF4_uc003mtc.1_Missense_Mutation_p.S68I	NM_002460	NP_002451	Q15306	IRF4_HUMAN	interferon regulatory factor 4	238					interferon-gamma-mediated signaling pathway|positive regulation of interleukin-10 biosynthetic process|positive regulation of interleukin-13 biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of transcription, DNA-dependent|regulation of T-helper cell differentiation|T cell activation|type I interferon-mediated signaling pathway	cytoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(1)	1		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		ACAGAGCCAAGCATAAGGTCT	0.562			T	IGH@	MM 								19	21	---	---	---	---	PASS
MYLK4	340156	broad.mit.edu	37	6	2680468	2680468	+	Nonsense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2680468C>A	uc003mty.3	-	8	1042	c.745G>T	c.(745-747)GGA>TGA	p.G249*	MYLK4_uc003mtx.3_5'Flank	NM_001012418	NP_001012418	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	249	Protein kinase.						ATP binding|protein serine/threonine kinase activity			breast(3)|ovary(1)	4	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				CTGGCCAATCCAAAATCAATA	0.418													34	327	---	---	---	---	PASS
NRSN1	140767	broad.mit.edu	37	6	24134684	24134684	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24134684G>T	uc010jpq.1	+	3	366	c.129G>T	c.(127-129)GAG>GAT	p.E43D		NM_080723	NP_542454	Q8IZ57	NRSN1_HUMAN	neurensin 1	43					nervous system development	growth cone|integral to membrane|neuronal cell body|transport vesicle					0						CAATTTGGGAGTATGAGGATG	0.493													19	43	---	---	---	---	PASS
HIST1H2AC	8334	broad.mit.edu	37	6	26124828	26124828	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26124828G>C	uc003ngm.2	+	1	456	c.368G>C	c.(367-369)AGT>ACT	p.S123T	HIST1H2BC_uc003ngk.3_5'Flank|HIST1H2BC_uc003ngl.2_5'Flank|HIST1H2AC_uc003ngn.2_RNA|HIST1H2AC_uc003ngo.2_RNA|HIST1H2AC_uc003ngp.2_Missense_Mutation_p.S123T	NM_003512	NP_003503	Q93077	H2A1C_HUMAN	histone cluster 1, H2ac	123					nucleosome assembly	nucleosome|nucleus	DNA binding				0						AAGACCGAGAGTCACCACAAG	0.547													24	103	---	---	---	---	PASS
HIST1H3D	8351	broad.mit.edu	37	6	26197191	26197191	+	Silent	SNP	G	T	T	rs138527852	byFrequency	TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26197191G>T	uc003ngv.2	-	2	685	c.288C>A	c.(286-288)GCC>GCA	p.A96A	HIST1H2BF_uc003ngx.2_5'Flank	NM_003530	NP_003521	P68431	H31_HUMAN	histone cluster 1, H3d	96					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0		all_hematologic(11;0.196)				AGGCCTCGCAGGCCTCCTGCA	0.587													11	112	---	---	---	---	PASS
BTN2A3	54718	broad.mit.edu	37	6	26423264	26423264	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26423264G>T	uc011dkl.1	+	2	213	c.183G>T	c.(181-183)ATG>ATT	p.M61I	BTN2A3_uc011dkm.1_RNA					RecName: Full=Butyrophilin subfamily 2 member A3; Flags: Precursor;												0						CTGAGGACATGGAGGTGCGGT	0.547													36	69	---	---	---	---	PASS
OR2J2	26707	broad.mit.edu	37	6	29141839	29141839	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29141839C>A	uc011dlm.1	+	1	529	c.427C>A	c.(427-429)CAC>AAC	p.H143N		NM_030905	NP_112167	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J,	143	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCGTTTCTGCCACTTGTTGGT	0.463													158	343	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32036726	32036726	+	Silent	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32036726G>C	uc003nzl.2	-	16	5977	c.5775C>G	c.(5773-5775)GTC>GTG	p.V1925V		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	2007	Fibronectin type-III 12.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						CTCCTATGCGGACCATTTGGA	0.527													14	144	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38691140	38691140	+	5'UTR	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38691140C>T	uc003ooe.1	+	2					DNAH8_uc003ood.1_Nonsense_Mutation_p.R140*	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						AAGGGAAAGCCGAAGACTGAA	0.318													58	140	---	---	---	---	PASS
TFEB	7942	broad.mit.edu	37	6	41653913	41653913	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41653913T>C	uc003oqs.1	-	9	1168	c.866A>G	c.(865-867)CAG>CGG	p.Q289R	TFEB_uc003oqt.1_Missense_Mutation_p.Q289R|TFEB_uc003oqu.1_Missense_Mutation_p.Q303R|TFEB_uc003oqr.1_Missense_Mutation_p.Q204R	NM_007162	NP_009093	P19484	TFEB_HUMAN	transcription factor EB	289	Helix-loop-helix motif.				embryonic placenta development|humoral immune response|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(1)	1	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;7.61e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			CAGGTCCTTCTGCATCCTCCG	0.582			T	ALPHA	renal (childhood epithelioid)								48	63	---	---	---	---	PASS
TTBK1	84630	broad.mit.edu	37	6	43227316	43227316	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43227316C>A	uc003ouq.1	+	12	1575	c.1296C>A	c.(1294-1296)AGC>AGA	p.S432R		NM_032538	NP_115927	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	432						cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			GGGTCCCCAGCTCCCCAGTGC	0.682													4	26	---	---	---	---	PASS
CAPN11	11131	broad.mit.edu	37	6	44137691	44137691	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44137691G>C	uc003owt.1	+	4	426	c.388G>C	c.(388-390)GAC>CAC	p.D130H		NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11	130	Calpain catalytic.				proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TTCTCCAACAGACATCTGCCA	0.562													9	17	---	---	---	---	PASS
GPR115	221393	broad.mit.edu	37	6	47682358	47682358	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47682358A>G	uc003oza.1	+	6	1635	c.1377A>G	c.(1375-1377)ATA>ATG	p.I459M	GPR115_uc003oyz.1_Missense_Mutation_p.I516M|GPR115_uc003ozb.1_Missense_Mutation_p.I457M	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN	G-protein coupled receptor 115 precursor	459	Helical; Name=2; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						GGTTTATCATAGGCTCTCACT	0.458													9	234	---	---	---	---	PASS
C6orf138	442213	broad.mit.edu	37	6	47847436	47847436	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47847436T>C	uc011dwm.1	-	3	1178	c.1093A>G	c.(1093-1095)ATT>GTT	p.I365V	C6orf138_uc011dwn.1_Missense_Mutation_p.I129V	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN	hypothetical protein LOC442213	382	Helical; (Potential).|SSD.					integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1						AAGGAGAAAATGTAGAAGTAG	0.453													5	38	---	---	---	---	PASS
MUT	4594	broad.mit.edu	37	6	49421411	49421411	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49421411C>T	uc003ozg.3	-	5	1225	c.970G>A	c.(970-972)GCT>ACT	p.A324T		NM_000255	NP_000246	P22033	MUTA_HUMAN	methylmalonyl Coenzyme A mutase precursor	324			A -> T (in MMAM; mut-).		fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity				0	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTTCTACCAGCTCTCATCTTT	0.363													20	78	---	---	---	---	PASS
GSTA2	2939	broad.mit.edu	37	6	52616444	52616444	+	Missense_Mutation	SNP	G	T	T	rs140075572	byFrequency	TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52616444G>T	uc003pay.2	-	6	627	c.477C>A	c.(475-477)CAC>CAA	p.H159Q		NM_000846	NP_000837	P09210	GSTA2_HUMAN	glutathione S-transferase alpha 2	159	GST C-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)	1	Lung NSC(77;0.118)				Aminophenazone(DB01424)|Amsacrine(DB00276)|Busulfan(DB01008)|Chlorambucil(DB00291)|Chloroquine(DB00608)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Ethacrynic acid(DB00903)|Glutathione(DB00143)|Mechlorethamine(DB00888)|Praziquantel(DB01058)|Vitamin E(DB00163)	GTTCCACCAGGTGAATGTCAG	0.512													29	134	---	---	---	---	PASS
COL21A1	81578	broad.mit.edu	37	6	55925686	55925686	+	Intron	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55925686T>C	uc003pcs.2	-						COL21A1_uc010jzz.2_Intron|COL21A1_uc011dxg.1_Intron|COL21A1_uc011dxh.1_Intron|COL21A1_uc003pcr.2_Intron	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			GCAGAATACATACGGGCTTCC	0.488													12	43	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57472362	57472362	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57472362G>A	uc003pdx.2	+	13	1238	c.1151G>A	c.(1150-1152)TGC>TAC	p.C384Y		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	384		Iron-sulfur (4Fe-4S).			DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTGTCAGGGTGCCCATTCCGT	0.443													6	76	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69653721	69653721	+	Splice_Site	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69653721G>C	uc003pev.3	+	6	1479	c.1031_splice	c.e6-1	p.V344_splice	BAI3_uc010kak.2_Splice_Site_p.V344_splice	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				CTTTATTACAGTACACGGAGT	0.363													19	86	---	---	---	---	PASS
COL9A1	1297	broad.mit.edu	37	6	70992689	70992689	+	Intron	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70992689C>T	uc003pfg.3	-						COL9A1_uc003pfe.3_5'Flank|COL9A1_uc003pff.3_Missense_Mutation_p.A23T	NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor						axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						CTTACTTGAGCCGCGCACAAG	0.647													19	46	---	---	---	---	PASS
COL9A1	1297	broad.mit.edu	37	6	71004114	71004114	+	Missense_Mutation	SNP	T	A	A	rs149389568		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71004114T>A	uc003pfg.3	-	5	611	c.452A>T	c.(451-453)CAA>CTA	p.Q151L		NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor	151	Nonhelical region (NC4).|TSP N-terminal.				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						TACAACAGATTGTGTTTGGCC	0.428													70	90	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	73102433	73102433	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73102433C>G	uc003pga.2	+	31	4616	c.4539C>G	c.(4537-4539)GAC>GAG	p.D1513E	RIMS1_uc011dyb.1_Missense_Mutation_p.D910E|RIMS1_uc003pgc.2_Missense_Mutation_p.D962E|RIMS1_uc010kaq.2_Missense_Mutation_p.D833E|RIMS1_uc011dyc.1_Missense_Mutation_p.D638E|RIMS1_uc010kar.2_Missense_Mutation_p.D581E|RIMS1_uc011dyd.1_Missense_Mutation_p.D647E|RIMS1_uc003pgf.2_Missense_Mutation_p.D513E|RIMS1_uc003pgg.2_Missense_Mutation_p.D409E|RIMS1_uc003pgi.2_Missense_Mutation_p.D329E|RIMS1_uc003pgh.2_Missense_Mutation_p.D380E|RIMS1_uc003pgd.2_Missense_Mutation_p.D579E|RIMS1_uc003pge.2_Missense_Mutation_p.D553E|RIMS1_uc011dye.1_Missense_Mutation_p.D319E|RIMS1_uc011dyf.1_Missense_Mutation_p.D137E|RIMS1_uc011dyg.1_Missense_Mutation_p.D40E	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1513					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TGGGAGCTGACAGTCAATTCA	0.413													40	87	---	---	---	---	PASS
KCNQ5	56479	broad.mit.edu	37	6	73843173	73843173	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73843173G>A	uc003pgk.2	+	10	1624	c.1277G>A	c.(1276-1278)CGC>CAC	p.R426H	KCNQ5_uc011dyh.1_Missense_Mutation_p.R445H|KCNQ5_uc011dyi.1_Missense_Mutation_p.R436H|KCNQ5_uc010kat.2_Missense_Mutation_p.R417H|KCNQ5_uc011dyj.1_Intron|KCNQ5_uc011dyk.1_Missense_Mutation_p.R176H	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	426					protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		GAGCGAGTGCGCATGGCTAGC	0.512													11	56	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75893688	75893688	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75893688A>T	uc003phs.2	-	9	1336	c.1170T>A	c.(1168-1170)AGT>AGA	p.S390R	COL12A1_uc003pht.2_Intron|COL12A1_uc003phu.1_Missense_Mutation_p.S48R	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	390	Fibronectin type-III 2.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						GGTCGCGAACACTGAGCGTGG	0.522													24	112	---	---	---	---	PASS
KIAA1009	22832	broad.mit.edu	37	6	84910621	84910621	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84910621C>A	uc010kbp.2	-	9	818	c.721G>T	c.(721-723)GTG>TTG	p.V241L	KIAA1009_uc003pkj.3_Missense_Mutation_p.V165L|KIAA1009_uc003pkk.2_Missense_Mutation_p.V241L	NM_014895	NP_055710	Q5TB80	QN1_HUMAN	KIAA1009 protein	241					cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding			ovary(1)	1		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		TCAAGCAGCACAACTGGAAGA	0.323													55	89	---	---	---	---	PASS
TBX18	9096	broad.mit.edu	37	6	85457787	85457787	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85457787G>T	uc003pkl.1	-	5	790	c.790C>A	c.(790-792)CAC>AAC	p.H264N	TBX18_uc010kbq.1_Missense_Mutation_p.H106N	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	264	T-box.				multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		TGGTATTTGTGCATAGAATGA	0.428													10	47	---	---	---	---	PASS
TBX18	9096	broad.mit.edu	37	6	85472268	85472268	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85472268G>T	uc003pkl.1	-	2	491	c.491C>A	c.(490-492)GCC>GAC	p.A164D	TBX18_uc010kbq.1_Missense_Mutation_p.A6D	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	164	T-box.				multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		TTACCTGCCGGCCTTGGTGAT	0.627													28	155	---	---	---	---	PASS
HTR1E	3354	broad.mit.edu	37	6	87725570	87725570	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87725570G>T	uc003pli.2	+	2	1221	c.518G>T	c.(517-519)TGC>TTC	p.C173F		NM_000865	NP_000856	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E	173	Extracellular (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity			ovary(2)|skin(1)	3		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Eletriptan(DB00216)	CCTAGTCAGTGCACCATCCAG	0.512													43	71	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112575362	112575362	+	5'UTR	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112575362G>T	uc003pvu.2	-	2					LAMA4_uc003pvv.2_5'UTR|LAMA4_uc003pvt.2_5'UTR|LAMA4_uc003pvw.2_5'UTR|LAMA4_uc010kdz.1_5'UTR|LAMA4_uc010kea.1_5'UTR	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TTTCTCCGCTGACATCCAGTA	0.662													5	30	---	---	---	---	PASS
SLC35F1	222553	broad.mit.edu	37	6	118596642	118596642	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118596642G>T	uc003pxx.3	+	5	859	c.658G>T	c.(658-660)GAC>TAC	p.D220Y	SLC35F1_uc003pxy.1_Missense_Mutation_p.D25Y	NM_001029858	NP_001025029	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	220					transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)		GCTGGTAGGGGACCTTCTGGT	0.448													13	61	---	---	---	---	PASS
EPB41L2	2037	broad.mit.edu	37	6	131215519	131215519	+	Silent	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131215519T>C	uc003qch.2	-	10	1634	c.1452A>G	c.(1450-1452)CTA>CTG	p.L484L	EPB41L2_uc003qcg.1_Silent_p.L484L|EPB41L2_uc011eby.1_Silent_p.L484L|EPB41L2_uc003qci.2_Silent_p.L484L|EPB41L2_uc010kfk.2_Silent_p.L484L|EPB41L2_uc010kfl.1_Silent_p.L484L	NM_001431	NP_001422	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	484	FERM.				cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		ACACTTTCCATAGTCTTTTCG	0.333													55	140	---	---	---	---	PASS
ENPP1	5167	broad.mit.edu	37	6	132168977	132168977	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132168977G>T	uc011ecf.1	+	2	322	c.302G>T	c.(301-303)TGT>TTT	p.C101F		NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	101	Extracellular (Potential).				3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	AAACCAAGCTGTGCCAAAGAA	0.264													12	20	---	---	---	---	PASS
ENPP1	5167	broad.mit.edu	37	6	132172345	132172345	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132172345C>A	uc011ecf.1	+	4	514	c.494C>A	c.(493-495)GCC>GAC	p.A165D		NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	165	Extracellular (Potential).|SMB 2.				3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	AGCCTCTGTGCCTGTTCAGAT	0.468													22	92	---	---	---	---	PASS
TAAR9	134860	broad.mit.edu	37	6	132860118	132860118	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132860118G>C	uc011eci.1	+	2	692	c.690G>C	c.(688-690)AAG>AAC	p.K230N		NM_175057	NP_778227	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9	230	Cytoplasmic (Potential).					plasma membrane	G-protein coupled receptor activity				0	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)		AGGCTAGGAAGATAGAAAGTA	0.423													51	65	---	---	---	---	PASS
VNN1	8876	broad.mit.edu	37	6	133015200	133015200	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133015200C>G	uc003qdo.2	-	3	483	c.463G>C	c.(463-465)GAT>CAT	p.D155H		NM_004666	NP_004657	O95497	VNN1_HUMAN	vanin 1 precursor	155	CN hydrolase.				acute inflammatory response|anti-apoptosis|cell-cell adhesion|cellular component movement|chronic inflammatory response|innate immune response|pantothenate metabolic process|positive regulation of T cell differentiation in thymus|response to oxidative stress	anchored to membrane|integral to membrane|plasma membrane	GPI anchor binding|pantetheine hydrolase activity			ovary(3)	3	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		TAACGGCCATCAGGGGGACAC	0.428													14	90	---	---	---	---	PASS
PEX7	5191	broad.mit.edu	37	6	137219304	137219304	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137219304C>G	uc003qhd.2	+	9	930	c.828C>G	c.(826-828)GAC>GAG	p.D276E	PEX7_uc010kgx.2_RNA	NM_000288	NP_000279	O00628	PEX7_HUMAN	peroxisomal biogenesis factor 7	276					ether lipid biosynthetic process|protein import into peroxisome matrix	peroxisome	peroxisome matrix targeting signal-2 binding				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000257)|OV - Ovarian serous cystadenocarcinoma(155;0.00492)		CAAAGCCTGACTCTCTTCTTG	0.328													19	61	---	---	---	---	PASS
ECT2L	345930	broad.mit.edu	37	6	139204005	139204005	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139204005G>T	uc003qif.1	+	14	2128	c.2025G>T	c.(2023-2025)GAG>GAT	p.E675D	ECT2L_uc011edq.1_Missense_Mutation_p.E606D	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2	675	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						AAACTATTGAGAAGGTAAATG	0.393													6	36	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146720571	146720571	+	Missense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146720571T>A	uc010khw.1	+	8	2866	c.2396T>A	c.(2395-2397)CTA>CAA	p.L799Q	GRM1_uc010khv.1_Missense_Mutation_p.L799Q|GRM1_uc003qll.2_Missense_Mutation_p.L799Q|GRM1_uc011edz.1_Missense_Mutation_p.L799Q|GRM1_uc011eea.1_Missense_Mutation_p.L799Q	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	799	Helical; Name=6; (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	ATCATCTGGCTAGCTTTTGTG	0.488													20	109	---	---	---	---	PASS
UST	10090	broad.mit.edu	37	6	149342530	149342530	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149342530C>A	uc003qmg.2	+	7	1146	c.850C>A	c.(850-852)CTT>ATT	p.L284I		NM_005715	NP_005706	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	284	Lumenal (Potential).				protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		CGTGGGGATTCTTGAAGAGTT	0.413													22	42	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152477094	152477094	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152477094C>A	uc010kiw.2	-	132	24531	c.23929G>T	c.(23929-23931)GAC>TAC	p.D7977Y	SYNE1_uc010kiv.2_Missense_Mutation_p.D2501Y|SYNE1_uc003qos.3_Missense_Mutation_p.D2501Y|SYNE1_uc003qot.3_Missense_Mutation_p.D7906Y|SYNE1_uc003qou.3_Missense_Mutation_p.D7977Y|SYNE1_uc003qop.3_Missense_Mutation_p.D139Y|SYNE1_uc011eez.1_Missense_Mutation_p.D179Y|SYNE1_uc003qoq.3_Missense_Mutation_p.D179Y|SYNE1_uc003qor.3_Missense_Mutation_p.D877Y	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7977	Spectrin 28.|Cytoplasmic (Potential).|HAT 12.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CACCGCCGGTCCAGGTTTCTC	0.512										HNSCC(10;0.0054)			31	74	---	---	---	---	PASS
SYTL3	94120	broad.mit.edu	37	6	159166690	159166690	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159166690C>T	uc003qrp.2	+	11	1278	c.1034C>T	c.(1033-1035)CCG>CTG	p.P345L	SYTL3_uc011efp.1_Missense_Mutation_p.P345L|SYTL3_uc003qro.2_Missense_Mutation_p.P277L|SYTL3_uc003qrq.2_Missense_Mutation_p.P277L|SYTL3_uc003qrr.2_Missense_Mutation_p.P345L|SYTL3_uc003qrs.2_Missense_Mutation_p.P277L|SYTL3_uc011efq.1_Missense_Mutation_p.P71L	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	345	C2 1.				intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		AAGTGCAATCCGTAAGTTGTT	0.214													9	33	---	---	---	---	PASS
PHF10	55274	broad.mit.edu	37	6	170112605	170112605	+	Silent	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170112605T>A	uc011egy.1	-	8	913	c.834A>T	c.(832-834)CCA>CCT	p.P278P	PHF10_uc011egz.1_Silent_p.P276P|PHF10_uc011eha.1_Silent_p.P129P	NM_018288	NP_060758	Q8WUB8	PHF10_HUMAN	PHD finger protein 10 isoform a	278	SAY.				nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	npBAF complex	zinc ion binding			urinary_tract(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		CTGTGTTTAATGGCAGATACC	0.443													27	64	---	---	---	---	PASS
COX19	90639	broad.mit.edu	37	7	1009036	1009036	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1009036C>G	uc003sjp.1	-	3	341	c.251G>C	c.(250-252)GGA>GCA	p.G84A	ADAP1_uc010ksc.2_Intron	NM_001031617	NP_001026788	Q49B96	COX19_HUMAN	COX19 cytochrome c oxidase assembly homolog	84						cytosol					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;2.15e-15)		CTCTGATTTTCCACTAGTCAA	0.468													73	270	---	---	---	---	PASS
SNX8	29886	broad.mit.edu	37	7	2296508	2296508	+	Splice_Site	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2296508C>T	uc003slw.2	-	10	1327	c.1284_splice	c.e10+1	p.E428_splice		NM_013321	NP_037453	Q9Y5X2	SNX8_HUMAN	sorting nexin 8						cell communication|early endosome to Golgi transport|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		GGCGGACTCACCTCCTTGTGC	0.672													4	21	---	---	---	---	PASS
PAPOLB	56903	broad.mit.edu	37	7	4901033	4901033	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4901033T>C	uc003snk.2	-	1	593	c.409A>G	c.(409-411)AAA>GAA	p.K137E	RADIL_uc003sng.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snj.1_Intron	NM_020144	NP_064529	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	136					mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		AGTTTCAGTTTAGCATAGAAT	0.418													8	23	---	---	---	---	PASS
TNRC18	84629	broad.mit.edu	37	7	5348574	5348574	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5348574C>T	uc003soi.3	-	29	8981	c.8632G>A	c.(8632-8634)GAC>AAC	p.D2878N		NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2878	BAH.						DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GACTTCTGGTCCCAGTGCTGT	0.627													7	15	---	---	---	---	PASS
EIF2AK1	27102	broad.mit.edu	37	7	6089541	6089541	+	Splice_Site	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6089541A>T	uc003spp.2	-	3	557	c.411_splice	c.e3+1	p.Q137_splice	EIF2AK1_uc003spq.2_Splice_Site_p.Q137_splice|EIF2AK1_uc011jwm.1_Intron	NM_014413	NP_055228	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha						negative regulation of hemoglobin biosynthetic process|negative regulation of translational initiation by iron|protein autophosphorylation|response to external stimulus|response to stress	cytoplasm	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|heme binding|protein homodimerization activity			upper_aerodigestive_tract(1)|stomach(1)|lung(1)|central_nervous_system(1)	4		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		TTTAGGGCTTACCTGACGAAC	0.299													16	63	---	---	---	---	PASS
SCIN	85477	broad.mit.edu	37	7	12665380	12665380	+	Intron	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12665380A>G	uc003ssn.3	+						SCIN_uc010ktt.2_Intron|SCIN_uc003sso.3_Intron	NM_001112706	NP_001106177	Q9Y6U3	ADSV_HUMAN	scinderin isoform 1						actin filament capping|actin filament severing|actin nucleation|calcium ion-dependent exocytosis|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of megakaryocyte differentiation|positive regulation of secretion|regulation of chondrocyte differentiation	cell cortex|cytoskeleton	1-phosphatidylinositol binding|actin filament binding|calcium ion binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding			ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TTTACCTTGTATTTTAGGTAA	0.318													6	43	---	---	---	---	PASS
CPVL	54504	broad.mit.edu	37	7	29160628	29160628	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29160628G>T	uc003szv.2	-	2	169	c.50C>A	c.(49-51)CCT>CAT	p.P17H	CPVL_uc003szw.2_Missense_Mutation_p.P17H|CPVL_uc003szx.2_Missense_Mutation_p.P17H	NM_031311	NP_112601	Q9H3G5	CPVL_HUMAN	serine carboxypeptidase vitellogenic-like	17					proteolysis		protein binding|serine-type carboxypeptidase activity			ovary(2)	2						ACAGGGGCCAGGCATCAACAG	0.468													3	29	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43506060	43506060	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43506060G>A	uc003tid.1	+	15	3411	c.2806G>A	c.(2806-2808)GGG>AGG	p.G936R	HECW1_uc011kbi.1_Missense_Mutation_p.G902R	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	936					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						AAGGAGAGAAGGGTCACTTTC	0.473													18	57	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43547726	43547726	+	Nonsense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43547726G>T	uc003tid.1	+	23	4467	c.3862G>T	c.(3862-3864)GAG>TAG	p.E1288*	HECW1_uc011kbi.1_Nonsense_Mutation_p.E1254*	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	1288	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						TGTTGGAGAGGAGGGGTGAGG	0.537													15	34	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48314310	48314310	+	Nonsense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48314310G>T	uc003toq.2	+	17	5072	c.5047G>T	c.(5047-5049)GAA>TAA	p.E1683*	ABCA13_uc010kyr.2_Nonsense_Mutation_p.E1186*	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	1683					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						GGATCAGCTTGAACAAGTTAG	0.378													29	111	---	---	---	---	PASS
ZNF107	51427	broad.mit.edu	37	7	64152319	64152319	+	5'UTR	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64152319G>A	uc003ttd.2	+	6					ZNF107_uc003tte.2_5'UTR	NM_016220	NP_057304	Q9UII5	ZN107_HUMAN	zinc finger protein 107						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.00948)|all_lung(88;0.0249)				AAAGACATGAGATGGTAGCCA	0.368													23	83	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82583933	82583933	+	Silent	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82583933T>A	uc003uhx.2	-	5	6625	c.6336A>T	c.(6334-6336)TCA>TCT	p.S2112S	PCLO_uc003uhv.2_Silent_p.S2112S	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2043					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GAGACGCTCCTGAGAGAACAC	0.453													14	43	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88964849	88964849	+	Missense_Mutation	SNP	C	A	A	rs10251768		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88964849C>A	uc011khi.1	+	4	3091	c.2553C>A	c.(2551-2553)CAC>CAA	p.H851Q		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	851						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GAACTCAGCACGACAGATTGG	0.398										HNSCC(36;0.09)			12	42	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100678368	100678368	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100678368T>C	uc003uxp.1	+	3	3724	c.3671T>C	c.(3670-3672)ATG>ACG	p.M1224T	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1224	Extracellular (Potential).|Ser-rich.|18.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TTAACAAGTATGCCTGTCAGA	0.522													91	334	---	---	---	---	PASS
FBXL13	222235	broad.mit.edu	37	7	102669193	102669193	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102669193G>C	uc003vaq.2	-	4	498	c.71C>G	c.(70-72)ACT>AGT	p.T24S	FBXL13_uc010lir.1_Missense_Mutation_p.T24S|FBXL13_uc003var.2_RNA|FBXL13_uc003vas.2_Missense_Mutation_p.T24S|FBXL13_uc003vav.2_Intron	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13 isoform	24											0						GTCTCTCCAAGTGCTGCAGGC	0.313													14	23	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103252103	103252103	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103252103C>T	uc003vca.2	-	21	3010	c.2850G>A	c.(2848-2850)CTG>CTA	p.L950L	RELN_uc010liz.2_Silent_p.L950L	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	950					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TTGAGTACTCCAGCTTCACCT	0.468													8	33	---	---	---	---	PASS
SLC26A4	5172	broad.mit.edu	37	7	107329636	107329636	+	Silent	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107329636T>C	uc003vep.2	+	9	1364	c.1140T>C	c.(1138-1140)GAT>GAC	p.D380D	SLC26A4_uc011kmb.1_5'Flank|SLC26A4_uc011kmc.1_5'Flank	NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin	380	Cytoplasmic (Potential).				regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7						ACACCATCGATGGGAACCAGG	0.438									Pendred_syndrome				41	99	---	---	---	---	PASS
LRRN3	54674	broad.mit.edu	37	7	110763776	110763776	+	Silent	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110763776T>C	uc003vft.3	+	4	1994	c.948T>C	c.(946-948)GCT>GCC	p.A316A	IMMP2L_uc003vfq.1_Intron|IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron|LRRN3_uc003vfu.3_Silent_p.A316A|LRRN3_uc003vfs.3_Silent_p.A316A	NM_001099660	NP_001093130	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3 precursor	316	Extracellular (Potential).|LRR 11.					integral to membrane				skin(3)|ovary(2)|pancreas(2)|central_nervous_system(1)	8				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		AAATAGAAGCTACTAACAACC	0.418													20	70	---	---	---	---	PASS
OR2A12	346525	broad.mit.edu	37	7	143792811	143792811	+	Missense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143792811T>A	uc011kty.1	+	1	611	c.611T>A	c.(610-612)TTC>TAC	p.F204Y		NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A,	204	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	Melanoma(164;0.0783)					GGTTCTGCGTTCATCTTAGTG	0.532													37	128	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147815244	147815244	+	Silent	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147815244A>T	uc003weu.1	+	16	2934	c.2418A>T	c.(2416-2418)CCA>CCT	p.P806P		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	806	Laminin G-like 3.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TCCCAAACCCATCCTCCTACC	0.428										HNSCC(39;0.1)			36	131	---	---	---	---	PASS
GIMAP5	55340	broad.mit.edu	37	7	150440023	150440023	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150440023A>T	uc003whr.1	+	3	1148	c.796A>T	c.(796-798)AAC>TAC	p.N266Y	GIMAP5_uc010lpu.2_Missense_Mutation_p.N124Y	NM_018384	NP_060854	Q96F15	GIMA5_HUMAN	GTPase, IMAP family member 5	266	Cytoplasmic (Potential).					integral to membrane|mitochondrial outer membrane	GTP binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GAACGAGAGTAACTGGGCATA	0.463													18	38	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154561157	154561157	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154561157G>T	uc003wlk.2	+	9	1043	c.914G>T	c.(913-915)TGG>TTG	p.W305L	DPP6_uc003wli.2_Missense_Mutation_p.W241L|DPP6_uc003wlm.2_Missense_Mutation_p.W243L|DPP6_uc011kvq.1_Missense_Mutation_p.W198L	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	305	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			ATCGCACACTGGTGGTCTCCG	0.522													9	48	---	---	---	---	PASS
ERICH1	157697	broad.mit.edu	37	8	614632	614632	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:614632G>T	uc003wph.2	-	6	1368	c.1303C>A	c.(1303-1305)CAT>AAT	p.H435N	ERICH1_uc011kwh.1_Intron|ERICH1_uc003wpe.1_Intron	NM_207332	NP_997215	Q86X53	ERIC1_HUMAN	glutamate-rich 1	435										large_intestine(2)	2		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)		GGAAGGATATGTGTGATCCAG	0.289													55	51	---	---	---	---	PASS
SLC39A14	23516	broad.mit.edu	37	8	22262248	22262248	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22262248G>T	uc003xbq.3	+	2	200	c.25G>T	c.(25-27)GCC>TCC	p.A9S	SLC39A14_uc011kzg.1_Missense_Mutation_p.A9S|SLC39A14_uc003xbp.3_Missense_Mutation_p.A9S|SLC39A14_uc011kzh.1_Missense_Mutation_p.A9S	NM_001128431	NP_001121903	Q15043	S39AE_HUMAN	solute carrier family 39 (zinc transporter),	9						endoplasmic reticulum|Golgi apparatus|integral to membrane|lamellipodium|plasma membrane	zinc ion transmembrane transporter activity				0				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)		GCTGCACCCGGCCTTCCAGAG	0.602													78	63	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35606178	35606178	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35606178C>G	uc003xjr.1	+	12	2228	c.1900C>G	c.(1900-1902)CAT>GAT	p.H634D	UNC5D_uc003xjs.1_Missense_Mutation_p.H629D|UNC5D_uc003xju.1_Missense_Mutation_p.H210D	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	634	ZU5.|Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TTGGAATATCCATTTAAAGAA	0.463													53	86	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38157060	38157060	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38157060T>C	uc003xli.2	-	15	3178	c.2660A>G	c.(2659-2661)TAT>TGT	p.Y887C	WHSC1L1_uc011lbm.1_Missense_Mutation_p.Y887C|WHSC1L1_uc010lwe.2_Intron	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	887	PHD-type 3.				cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			GTGGGACTTATAGGCATATGA	0.403			T	NUP98	AML								247	51	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41753903	41753903	+	Silent	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41753903C>G	uc003xom.2	-	1	378	c.96G>C	c.(94-96)CGG>CGC	p.R32R		NM_001142446	NP_001135918	P16157	ANK1_HUMAN	ankyrin 1 isoform 9	Error:Variant_position_missing_in_P16157_after_alignment					axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			AGCGGTTTCTCCGCTTCCTGT	0.612													20	74	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41792162	41792162	+	Silent	SNP	G	A	A	rs61753682		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41792162G>A	uc010lxb.2	-	18	4120	c.3576C>T	c.(3574-3576)ATC>ATT	p.I1192I	MYST3_uc010lxc.2_Silent_p.I1192I|MYST3_uc003xon.3_Silent_p.I1192I	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	1192					histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			GAATGGAAACGATGGGCTCAA	0.428													216	138	---	---	---	---	PASS
TGS1	96764	broad.mit.edu	37	8	56698931	56698931	+	Silent	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56698931T>C	uc003xsj.3	+	4	861	c.474T>C	c.(472-474)TCT>TCC	p.S158S	TGS1_uc010lyh.2_Silent_p.S62S	NM_024831	NP_079107	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase homolog	158					cellular lipid metabolic process|ncRNA metabolic process|regulation of transcription, DNA-dependent|RNA capping|spliceosomal snRNP assembly|transcription, DNA-dependent	Cajal body|cytosol	RNA trimethylguanosine synthase activity			ovary(1)|lung(1)|breast(1)	3		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			ATGATCCATCTTCAATTGAAC	0.328													15	49	---	---	---	---	PASS
TRIM55	84675	broad.mit.edu	37	8	67047317	67047317	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67047317C>A	uc003xvv.2	+	3	660	c.434C>A	c.(433-435)TCT>TAT	p.S145Y	TRIM55_uc003xvu.2_Missense_Mutation_p.S145Y|TRIM55_uc003xvw.2_Missense_Mutation_p.S145Y|TRIM55_uc003xvx.2_Missense_Mutation_p.S145Y	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	tripartite motif-containing 55 isoform 1	145	B box-type.					cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			CCCACCTGCTCTCTGTGCAAG	0.557													31	125	---	---	---	---	PASS
C8orf45	157777	broad.mit.edu	37	8	67809057	67809057	+	Missense_Mutation	SNP	T	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67809057T>G	uc003xwz.3	+	12	1660	c.1489T>G	c.(1489-1491)TTA>GTA	p.L497V	C8orf45_uc011lev.1_Missense_Mutation_p.L497V|C8orf45_uc011lew.1_Missense_Mutation_p.L428V|C8orf45_uc011lex.1_Missense_Mutation_p.L255V|C8orf45_uc003xwy.3_Missense_Mutation_p.L497V	NM_173518	NP_775789	Q4G0Z9	CH045_HUMAN	minichromosome maintenance complex	497					DNA replication		ATP binding|DNA binding			ovary(1)	1	Breast(64;0.186)		Epithelial(68;0.00384)|OV - Ovarian serous cystadenocarcinoma(28;0.00913)|all cancers(69;0.0175)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GGCATTTGGTTTATTGATTAA	0.398													8	288	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77767580	77767580	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77767580C>A	uc003yav.2	+	10	8675	c.8288C>A	c.(8287-8289)ACG>AAG	p.T2763K	ZFHX4_uc003yau.1_Missense_Mutation_p.T2808K|ZFHX4_uc003yaw.1_Missense_Mutation_p.T2763K	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2763						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCGATTAATACGGCAATCAGT	0.473										HNSCC(33;0.089)			21	54	---	---	---	---	PASS
WWP1	11059	broad.mit.edu	37	8	87423845	87423845	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87423845C>T	uc003ydt.2	+	9	1083	c.803C>T	c.(802-804)GCC>GTC	p.A268V	WWP1_uc010mai.2_Missense_Mutation_p.A44V	NM_007013	NP_008944	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase	268					central nervous system development|entry of virus into host cell|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|signal transduction	cytoplasm|nucleus|plasma membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			lung(1)|liver(1)	2						GAAGAAAATGCCTTGTCTCCA	0.393													11	96	---	---	---	---	PASS
RAD54B	25788	broad.mit.edu	37	8	95416346	95416346	+	Silent	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95416346T>C	uc003ygk.2	-	6	1001	c.903A>G	c.(901-903)AAA>AAG	p.K301K	RAD54B_uc010may.1_Silent_p.K108K|RAD54B_uc003ygl.1_RNA	NM_012415	NP_036547	O95073	FSBP_HUMAN	RAD54 homolog B	Error:Variant_position_missing_in_O95073_after_alignment					double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			TGATTCCTTCTTTCTGATGTG	0.333								Direct_reversal_of_damage|Homologous_recombination					23	22	---	---	---	---	PASS
MATN2	4147	broad.mit.edu	37	8	98973703	98973703	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98973703C>G	uc003yic.2	+	5	1134	c.903C>G	c.(901-903)TTC>TTG	p.F301L	MATN2_uc003yib.1_Missense_Mutation_p.F301L|MATN2_uc010mbh.1_Missense_Mutation_p.F301L|MATN2_uc003yid.2_Missense_Mutation_p.F301L|MATN2_uc003yie.1_Missense_Mutation_p.F301L|MATN2_uc010mbi.1_Intron	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor	301	EGF-like 2.					proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			CGGGCTCCTTCGTCTGCCAGT	0.557													23	99	---	---	---	---	PASS
POP1	10940	broad.mit.edu	37	8	99168342	99168342	+	Missense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99168342T>A	uc003yij.3	+	15	2222	c.2122T>A	c.(2122-2124)TGG>AGG	p.W708R	POP1_uc011lgv.1_Missense_Mutation_p.W708R|POP1_uc003yik.2_Missense_Mutation_p.W708R	NM_001145860	NP_001139332	Q99575	POP1_HUMAN	processing of precursor 1	708					tRNA 5'-leader removal|tRNA catabolic process	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease MRP activity|ribonuclease P activity			ovary(1)|breast(1)	2	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			CTGCTGTCCCTGGGAGCAGTT	0.478													33	125	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100654301	100654301	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100654301G>T	uc003yiv.2	+	34	5669	c.5558G>T	c.(5557-5559)TGT>TTT	p.C1853F	VPS13B_uc003yiw.2_Missense_Mutation_p.C1828F	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	1853					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ACCTATTCCTGTATGGCCTTA	0.353													21	55	---	---	---	---	PASS
ODF1	4956	broad.mit.edu	37	8	103564205	103564205	+	Nonsense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103564205C>T	uc003ykt.2	+	1	358	c.250C>T	c.(250-252)CGA>TGA	p.R84*		NM_024410	NP_077721	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	84					cell differentiation|multicellular organismal development|spermatogenesis	outer dense fiber	structural molecule activity			ovary(2)	2	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			TTACTGTCTGCGACCATCTCT	0.428													17	135	---	---	---	---	PASS
TM7SF4	81501	broad.mit.edu	37	8	105361137	105361137	+	Silent	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105361137A>G	uc003ylx.1	+	2	406	c.357A>G	c.(355-357)AAA>AAG	p.K119K		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	119					osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ACAACTTTAAAGGTCTCCTAG	0.408													29	50	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110488812	110488812	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110488812G>T	uc003yne.2	+	52	8937	c.8833G>T	c.(8833-8835)GGT>TGT	p.G2945C		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2945	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TATGAGGAATGGTTCCTCAAA	0.333										HNSCC(38;0.096)			3	21	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113253944	113253944	+	Intron	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113253944C>A	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AATGACATTACTAACCACTTA	0.299										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			50	123	---	---	---	---	PASS
COL14A1	7373	broad.mit.edu	37	8	121327837	121327837	+	Intron	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121327837G>T	uc003yox.2	+						COL14A1_uc003yoz.2_Intron	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor						cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TATTATTTTTGTTTTTTAAGT	0.388													9	9	---	---	---	---	PASS
SNTB1	6641	broad.mit.edu	37	8	121644760	121644760	+	Missense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121644760T>A	uc010mdg.2	-	3	1146	c.920A>T	c.(919-921)GAG>GTG	p.E307V	SNTB1_uc003ype.2_Missense_Mutation_p.E307V	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin	307					muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CTCTCTGACCTCAGCAATCAC	0.532													25	36	---	---	---	---	PASS
ST3GAL1	6482	broad.mit.edu	37	8	134472094	134472094	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134472094C>A	uc003yuk.2	-	10	1765	c.936G>T	c.(934-936)AAG>AAT	p.K312N	ST3GAL1_uc003yum.2_Missense_Mutation_p.K312N	NM_173344	NP_775479	Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	312	Lumenal (Potential).				protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			GCACCCCCGTCTTGCGAAAAG	0.572													64	137	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139164107	139164107	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139164107G>A	uc003yuy.2	-	13	2782	c.2611C>T	c.(2611-2613)CCA>TCA	p.P871S	FAM135B_uc003yux.2_Missense_Mutation_p.P772S|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.P433S|FAM135B_uc003yvb.2_Missense_Mutation_p.P433S	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	871										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TCAACACCTGGAGTGTTCTCA	0.488										HNSCC(54;0.14)			58	87	---	---	---	---	PASS
RHPN1	114822	broad.mit.edu	37	8	144461552	144461552	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144461552C>T	uc003yyb.2	+	8	952	c.819C>T	c.(817-819)CTC>CTT	p.L273L		NM_052924	NP_443156	Q8TCX5	RHPN1_HUMAN	rhophilin 1	273	BRO1.				signal transduction	intracellular				large_intestine(1)	1	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			CTGCGTCCCTCTGCGCACTGG	0.667													3	12	---	---	---	---	PASS
GPT	2875	broad.mit.edu	37	8	145732168	145732168	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145732168G>A	uc011lli.1	+	11	1499	c.1342G>A	c.(1342-1344)GGC>AGC	p.G448S	GPT_uc003zdh.3_Missense_Mutation_p.G448S|MFSD3_uc003zdi.1_5'Flank	NM_005309	NP_005300	P24298	ALAT1_HUMAN	glutamic pyruvate transaminase	448					gluconeogenesis	cytosol	1-aminocyclopropane-1-carboxylate synthase activity|L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|central_nervous_system(1)	2	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	GGAGGAGACCGGCATCTGCGT	0.701													13	35	---	---	---	---	PASS
ADAMTSL1	92949	broad.mit.edu	37	9	18504834	18504834	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18504834G>T	uc003zne.3	+	2	198	c.71G>T	c.(70-72)AGG>ATG	p.R24M	ADAMTSL1_uc003znb.2_Missense_Mutation_p.R24M|ADAMTSL1_uc003znc.3_Missense_Mutation_p.R24M	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	24						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		CAGAGTTCCAGGACCGCACGC	0.567													50	59	---	---	---	---	PASS
HAUS6	54801	broad.mit.edu	37	9	19089443	19089443	+	Missense_Mutation	SNP	T	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19089443T>G	uc003znk.2	-	5	804	c.551A>C	c.(550-552)GAT>GCT	p.D184A	HAUS6_uc003znl.1_Missense_Mutation_p.D48A	NM_017645	NP_060115	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	184					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleus|spindle				ovary(2)	2						GGTAACACAATCTTGTCTTTG	0.333													10	36	---	---	---	---	PASS
MOBKL2B	79817	broad.mit.edu	37	9	27455301	27455301	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27455301G>A	uc003zqn.2	-	2	744	c.248C>T	c.(247-249)ACC>ATC	p.T83I		NM_024761	NP_079037	Q86TA1	MOL2B_HUMAN	MOB1, Mps One Binder kinase activator-like 2B	83							metal ion binding|protein binding			ovary(1)|pleura(1)	2		all_neural(11;9.12e-11)		Lung(218;6.54e-05)|LUSC - Lung squamous cell carcinoma(38;0.000397)		GGTCCGCTCGGTGCAGAACTC	0.547													14	55	---	---	---	---	PASS
UNC13B	10497	broad.mit.edu	37	9	35398283	35398283	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35398283G>A	uc003zwq.2	+	30	3875	c.3583G>A	c.(3583-3585)GAG>AAG	p.E1195K	UNC13B_uc003zwr.2_Missense_Mutation_p.E1195K	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	1195	Potential.				excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GGGAGGCAAGGAGGTAGGTCT	0.507													16	18	---	---	---	---	PASS
HRCT1	646962	broad.mit.edu	37	9	35906398	35906398	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35906398C>A	uc003zyr.1	+	1	210	c.114C>A	c.(112-114)GAC>GAA	p.D38E		NM_001039792	NP_001034881	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	38						integral to membrane					0						GACGGCAGGACTGTGACGTGG	0.602													4	45	---	---	---	---	PASS
APBA1	320	broad.mit.edu	37	9	72131330	72131330	+	Missense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72131330T>A	uc004ahh.2	-	2	1073	c.797A>T	c.(796-798)CAG>CTG	p.Q266L		NM_001163	NP_001154	Q02410	APBA1_HUMAN	amyloid beta A4 precursor protein-binding,	266	Munc-18-1 binding.				axon cargo transport|cell adhesion|intracellular protein transport|nervous system development|protein complex assembly|synaptic transmission	synaptic vesicle				lung(1)	1						GTCCTCCTCCTGCTCGTAGCT	0.662													10	14	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73458055	73458055	+	Intron	SNP	A	G	G	rs57188233		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73458055A>G	uc004aid.2	-						TRPM3_uc004ahu.2_Intron|TRPM3_uc004ahv.2_Intron|TRPM3_uc004ahw.2_Intron|TRPM3_uc004ahx.2_Intron|TRPM3_uc004ahy.2_Intron|TRPM3_uc004ahz.2_Intron|TRPM3_uc004aia.2_Intron|TRPM3_uc004aib.2_Intron|TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron|TRPM3_uc004aie.2_Intron|TRPM3_uc004aif.2_Intron|TRPM3_uc004aig.2_Intron|TRPM3_uc004aii.2_Intron	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						TAAAAAAAAAAGAGAAGCATT	0.363													6	27	---	---	---	---	PASS
GDA	9615	broad.mit.edu	37	9	74860170	74860170	+	Silent	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74860170G>T	uc004aiq.2	+	12	1425	c.1242G>T	c.(1240-1242)GGG>GGT	p.G414G	GDA_uc011lse.1_Silent_p.G340G|GDA_uc011lsf.1_Silent_p.G340G|GDA_uc004air.2_Silent_p.G414G|GDA_uc010mow.1_RNA|GDA_uc004ais.2_Silent_p.G336G	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN	guanine deaminase	414					nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		TGTTTTATGGGGACTTTTTTG	0.388													52	63	---	---	---	---	PASS
RORB	6096	broad.mit.edu	37	9	77282715	77282715	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77282715G>T	uc004aji.2	+	8	1091	c.1042G>T	c.(1042-1044)GAC>TAC	p.D348Y	RORB_uc004ajh.2_Missense_Mutation_p.D337Y	NM_006914	NP_008845	Q92753	RORB_HUMAN	RAR-related orphan receptor B	348	Ligand-binding (Potential).				eye photoreceptor cell development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|visual perception	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(2)|lung(1)|skin(1)	4						AGGTTCTGATGACCTAGTGAA	0.378													52	46	---	---	---	---	PASS
TRPM6	140803	broad.mit.edu	37	9	77416851	77416851	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77416851C>A	uc004ajl.1	-	16	2210	c.1972G>T	c.(1972-1974)GTG>TTG	p.V658L	TRPM6_uc004ajk.1_Missense_Mutation_p.V653L|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_Missense_Mutation_p.V36L	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	658	Cytoplasmic (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						GCATCATCCACCATGTGACTC	0.443													31	48	---	---	---	---	PASS
TLE1	7088	broad.mit.edu	37	9	84231614	84231614	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84231614C>A	uc004aly.2	-	10	1153	c.712G>T	c.(712-714)GAC>TAC	p.D238Y	TLE1_uc004alz.2_Missense_Mutation_p.D248Y|TLE1_uc011lsr.1_Missense_Mutation_p.D238Y|TLE1_uc004ama.1_Missense_Mutation_p.D238Y|TLE1_uc011lss.1_Missense_Mutation_p.D164Y	NM_005077	NP_005068	Q04724	TLE1_HUMAN	transducin-like enhancer protein 1	238	CCN domain.				negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding			ovary(1)|skin(1)	2						CCATCACTGTCCTGGAAAAAA	0.353													4	82	---	---	---	---	PASS
HNRNPK	3190	broad.mit.edu	37	9	86584346	86584346	+	Intron	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86584346C>T	uc004ang.3	-						HNRNPK_uc011lsw.1_Silent_p.Q217Q|HNRNPK_uc004and.3_Intron|HNRNPK_uc004ank.3_Silent_p.Q456Q|HNRNPK_uc004anf.3_Silent_p.Q457Q|HNRNPK_uc004anh.3_Silent_p.Q433Q|HNRNPK_uc011lsx.1_Intron|HNRNPK_uc004ani.3_Silent_p.Q456Q|HNRNPK_uc004anj.3_Intron|HNRNPK_uc004ann.3_Intron|HNRNPK_uc004anl.3_Silent_p.Q457Q|HNRNPK_uc004anm.3_Intron	NM_031262	NP_112552	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K						interspecies interaction between organisms|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of receptor-mediated endocytosis|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of low-density lipoprotein particle clearance|signal transduction	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nuclear chromatin|nucleoplasm	protein binding|RNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|single-stranded DNA binding			skin(1)	1						CATCTGCATACTGCTTCACAC	0.289													54	51	---	---	---	---	PASS
GRIN3A	116443	broad.mit.edu	37	9	104432353	104432353	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104432353G>A	uc004bbp.1	-	3	2942	c.2341C>T	c.(2341-2343)CAT>TAT	p.H781Y	GRIN3A_uc004bbq.1_Missense_Mutation_p.H781Y	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	781	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	TTGGGGTCATGTATTCCAGAA	0.398													13	43	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119976772	119976772	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119976772C>T	uc004bjs.1	-	3	981	c.880G>A	c.(880-882)GAC>AAC	p.D294N	ASTN2_uc004bjr.1_Missense_Mutation_p.D294N|ASTN2_uc004bjt.1_Missense_Mutation_p.D294N	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	294	Cytoplasmic (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						TCCTCACAGTCATAGTCATCC	0.622													28	35	---	---	---	---	PASS
SLC25A25	114789	broad.mit.edu	37	9	130860954	130860954	+	Missense_Mutation	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130860954A>C	uc004bte.2	+	1	138	c.109A>C	c.(109-111)AGT>CGT	p.S37R	SLC25A25_uc004btb.2_Intron|SLC25A25_uc004btc.2_Intron|SLC25A25_uc004btd.2_Intron|SLC25A25_uc004btf.2_5'UTR	NM_052901	NP_443133	Q6KCM7	SCMC2_HUMAN	solute carrier family 25, member 25 isoform a	37	Mitochondrial intermembrane (Potential).				transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding				0						TTTCAAGCTCAGTGTCTTCAT	0.582													73	67	---	---	---	---	PASS
CIZ1	25792	broad.mit.edu	37	9	130947849	130947849	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130947849A>G	uc004btt.2	-	5	728	c.565T>C	c.(565-567)TCC>CCC	p.S189P	CIZ1_uc004btr.2_Missense_Mutation_p.S189P|CIZ1_uc004bts.2_Missense_Mutation_p.S165P|CIZ1_uc011maq.1_Missense_Mutation_p.S189P|CIZ1_uc004btu.2_Missense_Mutation_p.S165P|CIZ1_uc011mar.1_Missense_Mutation_p.S88P|CIZ1_uc011mas.1_Missense_Mutation_p.S219P|CIZ1_uc004btw.2_Missense_Mutation_p.S189P|CIZ1_uc004btv.2_Missense_Mutation_p.S189P|CIZ1_uc004btx.2_Missense_Mutation_p.S165P	NM_001131016	NP_001124488	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1 isoform	189						nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4						GTGGTAGAGGAGGAGGTCCGG	0.368													3	62	---	---	---	---	PASS
TTF1	7270	broad.mit.edu	37	9	135277211	135277211	+	Missense_Mutation	SNP	T	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135277211T>G	uc004cbl.2	-	2	1050	c.998A>C	c.(997-999)AAG>ACG	p.K333T	TTF1_uc011mcp.1_RNA|TTF1_uc004cbm.2_Intron	NM_007344	NP_031370	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase	333	Poly-Lys.				negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		CTTTTTTTTCTTAGACTTGTT	0.512													21	93	---	---	---	---	PASS
C9orf9	11092	broad.mit.edu	37	9	135763718	135763718	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135763718C>G	uc004cbx.1	+	4	500	c.389C>G	c.(388-390)GCC>GGC	p.A130G	C9orf9_uc004cby.1_Missense_Mutation_p.A130G|C9orf9_uc004cbz.1_Missense_Mutation_p.A130G	NM_018956	NP_061829	Q96E40	CI009_HUMAN	Rsb-66 protein	130								p.?(1)			0				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|GBM - Glioblastoma multiforme(294;4.84e-07)|Epithelial(140;1.28e-06)		TGTGACGAGGCCCGGAACCAC	0.612													12	30	---	---	---	---	PASS
SNAPC4	6621	broad.mit.edu	37	9	139276418	139276418	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139276418C>G	uc004chh.2	-	17	2184	c.2175G>C	c.(2173-2175)CAG>CAC	p.Q725H		NM_003086	NP_003077	Q5SXM2	SNPC4_HUMAN	small nuclear RNA activating complex,	725					snRNA transcription from RNA polymerase II promoter|snRNA transcription from RNA polymerase III promoter	snRNA-activating protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		GCTGCCCACTCTGGGTGGCTC	0.677													8	15	---	---	---	---	PASS
TAF3	83860	broad.mit.edu	37	10	8055795	8055795	+	Nonsense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8055795C>G	uc010qbd.1	+	6	2670	c.2670C>G	c.(2668-2670)TAC>TAG	p.Y890*		NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140	890	PHD-type.				maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1						ATGACTGGTACCACTGGTGAG	0.577													20	153	---	---	---	---	PASS
FAM188A	80013	broad.mit.edu	37	10	15885221	15885221	+	Silent	SNP	C	A	A	rs144611478	byFrequency	TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15885221C>A	uc001iod.1	-	3	446	c.225G>T	c.(223-225)CGG>CGT	p.R75R	FAM188A_uc001ioe.1_5'UTR|FAM188A_uc001iof.1_Silent_p.R75R	NM_024948	NP_079224	Q9H8M7	F188A_HUMAN	chromosome 10 open reading frame 97	75					apoptosis	nucleus	calcium ion binding			ovary(1)	1						CTGAACAATCCCGCCAAGAAG	0.348													61	156	---	---	---	---	PASS
SLC39A12	221074	broad.mit.edu	37	10	18270262	18270262	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18270262C>G	uc001ipo.2	+	6	1219	c.946C>G	c.(946-948)CTG>GTG	p.L316V	SLC39A12_uc001ipn.2_Missense_Mutation_p.L316V|SLC39A12_uc001ipp.2_Missense_Mutation_p.L316V|SLC39A12_uc010qck.1_Missense_Mutation_p.L182V	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	316	Cytoplasmic (Potential).			L -> R (in Ref. 3; AAH47635).	zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						TGCTAGGCAGCTGGTGGAGAT	0.453													26	75	---	---	---	---	PASS
NRP1	8829	broad.mit.edu	37	10	33486646	33486646	+	Intron	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33486646C>G	uc001iwx.3	-						NRP1_uc001iwv.3_Intron|NRP1_uc009xlz.2_Intron|NRP1_uc001iww.3_Intron|NRP1_uc001iwy.3_Intron|NRP1_uc001iwz.2_Intron|NRP1_uc001ixa.2_Intron	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a						axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)	ACCTGAAAAACAAAAACAGGA	0.378													25	33	---	---	---	---	PASS
PARD3	56288	broad.mit.edu	37	10	34573094	34573094	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34573094C>T	uc010qej.1	-	21	3154	c.3154G>A	c.(3154-3156)GAG>AAG	p.E1052K	PARD3_uc010qek.1_Missense_Mutation_p.E1049K|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Missense_Mutation_p.E1036K|PARD3_uc010qen.1_Missense_Mutation_p.E1006K|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Missense_Mutation_p.E962K|PARD3_uc010qeq.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog	1052	Potential.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				CGTATCCTCTCCTCTTCTGAT	0.343													25	241	---	---	---	---	PASS
FXYD4	53828	broad.mit.edu	37	10	43869928	43869928	+	Silent	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43869928C>A	uc001jaq.1	+	4	380	c.48C>A	c.(46-48)GCC>GCA	p.A16A		NM_173160	NP_775183	P59646	FXYD4_HUMAN	FXYD domain containing ion transport regulator 4	16						integral to membrane					0						GCCTGACTGCCTTGGAAGCCA	0.577													58	125	---	---	---	---	PASS
ERCC6	2074	broad.mit.edu	37	10	50708747	50708747	+	Intron	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50708747G>A	uc001jhs.3	-						ERCC6_uc010qgr.1_Intron|ERCC6_uc001jhr.3_5'UTR	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent						base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						TGGTACCTATGACAACAAACA	0.433								Direct_reversal_of_damage|NER					23	72	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50827942	50827942	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50827942C>A	uc001jhz.2	+	3	712	c.559C>A	c.(559-561)CAG>AAG	p.Q187K	CHAT_uc001jhv.1_Missense_Mutation_p.Q69K|CHAT_uc001jhx.1_Missense_Mutation_p.Q69K|CHAT_uc001jhy.1_Missense_Mutation_p.Q69K|CHAT_uc001jia.2_Missense_Mutation_p.Q69K|CHAT_uc010qgs.1_Missense_Mutation_p.Q69K	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	187					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	CCTGGAGCGGCAGGAGAAGAC	0.622													12	24	---	---	---	---	PASS
A1CF	29974	broad.mit.edu	37	10	52610520	52610520	+	Intron	SNP	G	A	A	rs149647072		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52610520G>A	uc001jjj.2	-						A1CF_uc010qhn.1_Missense_Mutation_p.P10S|A1CF_uc001jji.2_Intron|A1CF_uc001jjh.2_Missense_Mutation_p.P10S|A1CF_uc010qho.1_Missense_Mutation_p.P10S|A1CF_uc009xov.2_Intron|A1CF_uc001jjk.1_Intron	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2						cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1						TCTGGCTCTGGGCATGTGCCC	0.433													49	162	---	---	---	---	PASS
DNA2	1763	broad.mit.edu	37	10	70176536	70176536	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70176536C>G	uc001jof.2	-	20	3302	c.3302G>C	c.(3301-3303)GGG>GCG	p.G1101A	DNA2_uc001jog.1_Missense_Mutation_p.G777A|DNA2_uc001joh.1_RNA	NM_001080449	NP_001073918	P51530	DNA2L_HUMAN	DNA replication helicase 2 homolog	1015					base-excision repair|DNA replication, removal of RNA primer|mitochondrial DNA repair|mitochondrial DNA replication|positive regulation of DNA replication|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	mitochondrial nucleoid|nucleoplasm	5'-flap endonuclease activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|site-specific endodeoxyribonuclease activity, specific for altered base				0						GGGCACACACCCCAGAAGAAT	0.353													4	84	---	---	---	---	PASS
TET1	80312	broad.mit.edu	37	10	70451518	70451518	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70451518G>A	uc001jok.3	+	12	6863	c.6358G>A	c.(6358-6360)GTG>ATG	p.V2120M		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	2120					DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						TGTTGTCACCGTGTCCCCTTA	0.443													5	158	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89690791	89690791	+	Intron	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89690791C>G	uc001kfb.2	+							NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.L70fs*7(2)|p.Y27fs*1(2)|p.?(2)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CACTTTTAAACTTTTCTTTTA	0.234		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			19	15	---	---	---	---	PASS
LIPA	3988	broad.mit.edu	37	10	90986679	90986679	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90986679C>T	uc001kga.3	-	5	679	c.511G>A	c.(511-513)GTG>ATG	p.V171M	LIPA_uc001kgb.3_Missense_Mutation_p.V115M|LIPA_uc001kgc.3_Missense_Mutation_p.V173M|LIPA_uc010qnf.1_5'Flank|LIPA_uc009xtq.2_Missense_Mutation_p.V171M	NM_000235	NP_000226	P38571	LICH_HUMAN	lipase A precursor	171					lipid catabolic process	lysosome	lipase activity|sterol esterase activity				0		Colorectal(252;0.0162)		GBM - Glioblastoma multiforme(2;0.00406)		GAATGACCCACATAATACACT	0.333													32	45	---	---	---	---	PASS
BTAF1	9044	broad.mit.edu	37	10	93768864	93768864	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93768864G>A	uc001khr.2	+	28	4100	c.4002G>A	c.(4000-4002)CCG>CCA	p.P1334P		NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription	1334	Helicase ATP-binding.				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				TGGTTTGTCCGCCAACATTAA	0.408													16	51	---	---	---	---	PASS
PNLIP	5406	broad.mit.edu	37	10	118314758	118314758	+	Nonsense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118314758A>T	uc001lcm.2	+	7	683	c.640A>T	c.(640-642)AAA>TAA	p.K214*		NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor	214					lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	CAGCGATGCCAAATTTGTGGA	0.478													28	23	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1080602	1080602	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1080602A>G	uc001lsx.1	+	9	1271	c.1244A>G	c.(1243-1245)TAT>TGT	p.Y415C		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	415	VWFD 2.					inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GACTGCTACTATGTCCTGGCC	0.667													8	30	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1263832	1263832	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1263832A>G	uc009ycr.1	+	47	7927	c.7801A>G	c.(7801-7803)ACA>GCA	p.T2601A	MUC5B_uc001ltb.2_Missense_Mutation_p.T1911A	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	1908	7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTGGATCCTCACAAAGCCGAC	0.642													48	70	---	---	---	---	PASS
KRTAP5-5	439915	broad.mit.edu	37	11	1651380	1651380	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1651380G>T	uc001lty.2	+	1	348	c.310G>T	c.(310-312)GTG>TTG	p.V104L		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	104	8 X 4 AA repeats of C-C-X-P.					keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CTCCTGTGGGGTGTCCAAGGG	0.682													65	81	---	---	---	---	PASS
CTSD	1509	broad.mit.edu	37	11	1780299	1780299	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1780299T>C	uc001luc.1	-	4	504	c.371A>G	c.(370-372)AAC>AGC	p.N124S	CTSD_uc009yda.1_RNA	NM_001909	NP_001900	P07339	CATD_HUMAN	cathepsin D preproprotein	124					cell death|proteolysis	extracellular space|lysosome|melanosome	aspartic-type endopeptidase activity				0		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CTTGTCGCTGTTGTACTTGTG	0.627													87	113	---	---	---	---	PASS
TH	7054	broad.mit.edu	37	11	2189775	2189775	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2189775G>A	uc001lvq.2	-	4	545	c.526C>T	c.(526-528)CTC>TTC	p.L176F	TH_uc001lvp.2_Missense_Mutation_p.L172F|TH_uc001lvr.2_Missense_Mutation_p.L145F|TH_uc010qxj.1_Missense_Mutation_p.L149F|TH_uc001lvs.2_Missense_Mutation_p.L145F|TH_uc001lvt.2_Missense_Mutation_p.L149F|TH_uc009ydh.1_5'Flank	NM_199292	NP_954986	P07101	TY3H_HUMAN	tyrosine hydroxylase isoform a	176					dopamine biosynthetic process from tyrosine|embryonic camera-type eye morphogenesis|epinephrine biosynthetic process|eye photoreceptor cell development|heart morphogenesis|hormone biosynthetic process|learning|locomotory behavior|memory|neurotransmitter biosynthetic process|neurotransmitter secretion|norepinephrine biosynthetic process|pigmentation|regulation of heart contraction|response to ethanol|response to hypoxia|synaptic transmission, dopaminergic|visual perception	cytosol|internal side of plasma membrane|melanosome membrane|nucleus|perikaryon|smooth endoplasmic reticulum	protein binding|tyrosine 3-monooxygenase activity				0		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	ACACCACTGAGCAGGGCGGCC	0.697													12	20	---	---	---	---	PASS
OR52I1	390037	broad.mit.edu	37	11	4615690	4615690	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4615690C>G	uc010qyi.1	+	1	422	c.422C>G	c.(421-423)ACG>AGG	p.T141R		NM_001005169	NP_001005169	Q8NGK6	O52I1_HUMAN	olfactory receptor, family 52, subfamily I,	141	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;7.98e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGAATTCTCACGCCTCAAGTG	0.512													36	62	---	---	---	---	PASS
OR51A4	401666	broad.mit.edu	37	11	4967584	4967584	+	Silent	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4967584C>G	uc010qys.1	-	1	747	c.747G>C	c.(745-747)GTG>GTC	p.V249V		NM_001005329	NP_001005329	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A,	249	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGAAGATGATCACTGCACAGA	0.483													45	126	---	---	---	---	PASS
OR51Q1	390061	broad.mit.edu	37	11	5444139	5444139	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5444139C>A	uc010qzd.1	+	1	709	c.709C>A	c.(709-711)CTC>ATC	p.L237I	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004757	NP_001004757	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q,	237	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCTGAGCGACTCCGTGCCCT	0.483													53	93	---	---	---	---	PASS
ZNF215	7762	broad.mit.edu	37	11	6977277	6977277	+	Missense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6977277T>A	uc001mey.2	+	7	1657	c.1069T>A	c.(1069-1071)TAT>AAT	p.Y357N	ZNF215_uc010raw.1_3'UTR|ZNF215_uc010rax.1_Missense_Mutation_p.Y119N|ZNF215_uc001mez.1_Intron	NM_013250	NP_037382	Q9UL58	ZN215_HUMAN	zinc finger protein 215	357					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		AGAATATGAATATGGGAATGA	0.348													20	65	---	---	---	---	PASS
IPO7	10527	broad.mit.edu	37	11	9450367	9450367	+	Intron	SNP	T	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9450367T>G	uc001mho.2	+						SNORA23_uc001mhp.1_RNA	NM_006391	NP_006382	O95373	IPO7_HUMAN	importin 7						interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity			lung(1)|breast(1)	2				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		GCAGTGTCTGTCTGTGTTTTT	0.408													15	71	---	---	---	---	PASS
GTF2H1	2965	broad.mit.edu	37	11	18362877	18362877	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18362877A>G	uc001moi.2	+	7	1371	c.677A>G	c.(676-678)CAG>CGG	p.Q226R	GTF2H1_uc001moh.2_Missense_Mutation_p.Q226R|GTF2H1_uc009yhm.2_Missense_Mutation_p.Q110R	NM_001142307	NP_001135779	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1,	226	BSD 2.				mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding				0						CGTTTTTTCCAGTCCCATTAT	0.363								NER					14	72	---	---	---	---	PASS
ANO3	63982	broad.mit.edu	37	11	26663489	26663489	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26663489C>A	uc001mqt.3	+	22	2333	c.2188C>A	c.(2188-2190)CAT>AAT	p.H730N	ANO3_uc010rdr.1_Missense_Mutation_p.H714N|ANO3_uc010rds.1_Missense_Mutation_p.H569N|ANO3_uc010rdt.1_Missense_Mutation_p.H584N	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	730	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GCGGGGAATACATGATGCTTC	0.433													26	88	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	30915936	30915936	+	Intron	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30915936G>T	uc001mss.1	-						uc009yjk.1_Intron|uc009yjj.1_Intron					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		GCCGCCCTGAGGAAACAAGTC	0.488													28	43	---	---	---	---	PASS
CD44	960	broad.mit.edu	37	11	35227757	35227757	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35227757A>G	uc001mvu.2	+	11	1815	c.1381A>G	c.(1381-1383)ATG>GTG	p.M461V	CD44_uc001mvv.2_Missense_Mutation_p.M418V|CD44_uc001mvw.2_Intron|CD44_uc001mvx.2_Intron|CD44_uc001mvy.2_Intron|CD44_uc001mwc.3_Intron|CD44_uc010rer.1_Intron|CD44_uc009ykh.2_Intron|CD44_uc010res.1_Missense_Mutation_p.M25V|CD44_uc010ret.1_Intron|CD44_uc010reu.1_Intron	NM_000610	NP_000601	P16070	CD44_HUMAN	CD44 antigen isoform 1 precursor	461	Extracellular (Potential).|Stem.				cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)	CTCACACCCCATGGGACGAGG	0.453													42	74	---	---	---	---	PASS
ALX4	60529	broad.mit.edu	37	11	44286614	44286614	+	Silent	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44286614C>G	uc001myb.2	-	4	1130	c.1026G>C	c.(1024-1026)GGG>GGC	p.G342G		NM_021926	NP_068745	Q9H161	ALX4_HUMAN	aristaless-like homeobox 4	342					hair follicle development						0						CGCTGCTGGCCCCAGAGCCAG	0.687													26	29	---	---	---	---	PASS
PHF21A	51317	broad.mit.edu	37	11	45970972	45970972	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45970972C>T	uc001ncc.3	-	12	1829	c.1205G>A	c.(1204-1206)GGA>GAA	p.G402E	PHF21A_uc001ncb.3_Missense_Mutation_p.G403E|PHF21A_uc009ykx.2_Missense_Mutation_p.G403E|PHF21A_uc001nce.2_Missense_Mutation_p.G403E|PHF21A_uc001nca.1_Missense_Mutation_p.G138E	NM_001101802	NP_001095272	Q96BD5	PF21A_HUMAN	BRAF35/HDAC2 complex isoform a	402					blood coagulation|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2						AAAGACTGCTCCACTGTAGAC	0.463													57	123	---	---	---	---	PASS
OR5D14	219436	broad.mit.edu	37	11	55563689	55563689	+	Missense_Mutation	SNP	T	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55563689T>G	uc010rim.1	+	1	658	c.658T>G	c.(658-660)TAT>GAT	p.Y220D		NM_001004735	NP_001004735	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D,	220	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3		all_epithelial(135;0.196)				CCTCACTTCCTATGTTTTCAT	0.473													29	124	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55595037	55595037	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595037C>A	uc001nhy.1	+	1	343	c.343C>A	c.(343-345)CTG>ATG	p.L115M		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	115	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				GGTCTTCCTGCTGGCCGTGAT	0.512										HNSCC(27;0.073)			81	129	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55595193	55595193	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595193C>G	uc001nhy.1	+	1	499	c.499C>G	c.(499-501)CTC>GTC	p.L167V		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	167	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				TCTTAGGATCCTCTTCTATAG	0.478										HNSCC(27;0.073)			63	140	---	---	---	---	PASS
OR6Q1	219952	broad.mit.edu	37	11	57799212	57799212	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57799212A>T	uc010rjz.1	+	1	788	c.788A>T	c.(787-789)TAT>TTT	p.Y263F	OR9Q1_uc001nmj.2_Intron	NM_001005186	NP_001005186	Q8NGQ2	OR6Q1_HUMAN	olfactory receptor, family 6, subfamily Q,	263	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(1)	1		Breast(21;0.0707)|all_epithelial(135;0.142)				TTCTTTATGTATGTCCAGACC	0.507													48	166	---	---	---	---	PASS
MS4A6A	64231	broad.mit.edu	37	11	59945748	59945748	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59945748C>A	uc001nor.2	-	4	562	c.324G>T	c.(322-324)AGG>AGT	p.R108S	MS4A6A_uc001noq.2_Missense_Mutation_p.R108S|MS4A6A_uc001nos.3_Missense_Mutation_p.R136S|MS4A6A_uc009ymv.2_Missense_Mutation_p.R108S|MS4A6A_uc001not.2_Missense_Mutation_p.R108S|MS4A6A_uc010rla.1_Missense_Mutation_p.R136S|MS4A6A_uc010rlb.1_Missense_Mutation_p.R63S	NM_152852	NP_690591	Q9H2W1	M4A6A_HUMAN	membrane-spanning 4-domains, subfamily A, member	108	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						GCTTGGTTAACCTTTTCTCTG	0.388													31	48	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62301521	62301521	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62301521C>T	uc001ntl.2	-	5	668	c.368G>A	c.(367-369)CGC>CAC	p.R123H	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	123					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				GGTGTAGATGCGCTGGTACTC	0.602													23	14	---	---	---	---	PASS
C2CD3	26005	broad.mit.edu	37	11	73829418	73829418	+	Missense_Mutation	SNP	T	C	C	rs141826355		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73829418T>C	uc001ouu.2	-	9	1602	c.1375A>G	c.(1375-1377)ACC>GCC	p.T459A	C2CD3_uc001ouv.2_Missense_Mutation_p.T459A	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	459						centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					CTGATGCTGGTATCAGATTTC	0.408													41	80	---	---	---	---	PASS
PGM2L1	283209	broad.mit.edu	37	11	74054399	74054399	+	Silent	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74054399T>C	uc001ovb.1	-	10	1577	c.1281A>G	c.(1279-1281)AAA>AAG	p.K427K		NM_173582	NP_775853	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	427					glucose 1-phosphate metabolic process	cytosol	glucose-1,6-bisphosphate synthase activity|phosphoglucomutase activity			ovary(1)	1	Breast(11;3.32e-06)					AAAGGACTTCTTTCCCATTTT	0.333													16	107	---	---	---	---	PASS
PRCP	5547	broad.mit.edu	37	11	82564323	82564323	+	Intron	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82564323A>G	uc001ozs.2	-						PRCP_uc001ozr.2_Intron	NM_005040	NP_005031	P42785	PCP_HUMAN	prolylcarboxypeptidase isoform 1 preproprotein						blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1						ATGAACCCCTAAGAAGAGTTT	0.393													25	47	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85422208	85422208	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85422208G>A	uc010rth.1	-	11	2054	c.1778C>T	c.(1777-1779)CCG>CTG	p.P593L	SYTL2_uc010rtg.1_Missense_Mutation_p.P594L|SYTL2_uc010rti.1_Intron|SYTL2_uc010rtj.1_Missense_Mutation_p.P561L|SYTL2_uc001pav.2_Missense_Mutation_p.P35L|SYTL2_uc010rte.1_Intron|SYTL2_uc001pax.2_Missense_Mutation_p.P35L|SYTL2_uc001paz.2_Intron|SYTL2_uc001pba.2_Intron|SYTL2_uc001pay.2_Missense_Mutation_p.P24L|SYTL2_uc001paw.2_Intron|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Intron|SYTL2_uc001pbb.2_Missense_Mutation_p.P931L|SYTL2_uc001pbc.2_Missense_Mutation_p.P915L|SYTL2_uc010rtf.1_Intron	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	593	Ser-rich.				intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TAAAGAGCTCGGGCTCTTCTT	0.423													42	157	---	---	---	---	PASS
PRSS23	11098	broad.mit.edu	37	11	86519439	86519439	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86519439C>T	uc001pcb.2	+	2	970	c.754C>T	c.(754-756)CTC>TTC	p.L252F	PRSS23_uc001pcc.1_Intron|PRSS23_uc010rts.1_Missense_Mutation_p.L220F	NM_007173	NP_009104	O95084	PRS23_HUMAN	protease, serine, 23 precursor	252					proteolysis	extracellular region|nucleus	serine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CCTCCTGGAACTCAAAAAGCC	0.493													37	64	---	---	---	---	PASS
MAML2	84441	broad.mit.edu	37	11	95712801	95712801	+	Nonsense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95712801C>A	uc001pfw.1	-	5	4067	c.2782G>T	c.(2782-2784)GGA>TGA	p.G928*		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	928					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				CCAACAGATCCAGCTCCAAAA	0.413			T	MECT1|CRTC3	salivary gland mucoepidermoid								46	112	---	---	---	---	PASS
CWF19L2	143884	broad.mit.edu	37	11	107300080	107300080	+	Nonsense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107300080G>C	uc010rvp.1	-	8	908	c.878C>G	c.(877-879)TCA>TGA	p.S293*	CWF19L2_uc001pjh.3_RNA|CWF19L2_uc009yxo.2_RNA	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control	293							catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		TGCTTTATCTGAATATGTGGG	0.348													7	23	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117375666	117375666	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117375666G>T	uc001prh.1	-	10	2337	c.2335C>A	c.(2335-2337)CCC>ACC	p.P779T		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	719	Extracellular (Potential).|Ig-like C2-type 8.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		ATGACCTTGGGTGGGGGGTAG	0.592													27	52	---	---	---	---	PASS
GRIK4	2900	broad.mit.edu	37	11	120673570	120673570	+	Intron	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120673570C>T	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	GAAACCAGTACGTAGACTGGG	0.567											OREG0021427	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	26	47	---	---	---	---	PASS
OR10S1	219873	broad.mit.edu	37	11	123848389	123848389	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123848389G>A	uc001pzm.1	-	1	10	c.10C>T	c.(10-12)CGC>TGC	p.R4C		NM_001004474	NP_001004474	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S,	4	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CACACAGAGCGGCTAGTCATC	0.473													55	124	---	---	---	---	PASS
OR8B12	219858	broad.mit.edu	37	11	124413240	124413240	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124413240C>A	uc010sam.1	-	1	311	c.311G>T	c.(310-312)TGC>TTC	p.C104F		NM_001005195	NP_001005195	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B,	104	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		GACAAAGAAGCAGAAGAAGAA	0.473													20	60	---	---	---	---	PASS
ROBO4	54538	broad.mit.edu	37	11	124765505	124765505	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124765505G>A	uc001qbg.2	-	6	1024	c.884C>T	c.(883-885)GCT>GTT	p.A295V	ROBO4_uc010sas.1_Missense_Mutation_p.A150V|ROBO4_uc001qbh.2_Missense_Mutation_p.A185V|ROBO4_uc001qbi.2_5'Flank|ROBO4_uc010sat.1_5'Flank	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	295	Fibronectin type-III 1.				angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		TGCCCACGGAGCTCCCTGGCC	0.647													18	94	---	---	---	---	PASS
NCAPD3	23310	broad.mit.edu	37	11	134055385	134055385	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134055385C>A	uc001qhd.1	-	17	2688	c.2082G>T	c.(2080-2082)AAG>AAT	p.K694N	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	694					cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		ATTTTTCTTTCTTGGACCAGA	0.378													32	71	---	---	---	---	PASS
B4GALNT3	283358	broad.mit.edu	37	12	657444	657444	+	Silent	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:657444C>A	uc001qii.1	+	9	834	c.834C>A	c.(832-834)CTC>CTA	p.L278L	B4GALNT3_uc001qij.1_Silent_p.L180L	NM_173593	NP_775864	Q6L9W6	B4GN3_HUMAN	beta	278	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			ovary(1)|skin(1)	2	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			TTGACTCCCTCTCCCTGTCCC	0.562													4	66	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7647890	7647890	+	Nonsense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7647890C>A	uc001qsz.3	-	6	1335	c.1207G>T	c.(1207-1209)GGA>TGA	p.G403*	CD163_uc001qta.3_Nonsense_Mutation_p.G403*|CD163_uc009zfw.2_Nonsense_Mutation_p.G403*	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	403	SRCR 4.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						TCTTTCAGTCCCCAGCCTCTG	0.502													50	115	---	---	---	---	PASS
APOBEC1	339	broad.mit.edu	37	12	7803669	7803669	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7803669G>T	uc001qtb.2	-	4	545	c.511C>A	c.(511-513)CCA>ACA	p.P171T	APOBEC1_uc001qtc.2_Missense_Mutation_p.P126T|APOBEC1_uc010sgf.1_Missense_Mutation_p.P171T	NM_001644	NP_001635	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme	171					cytidine to uridine editing|DNA demethylation|lipid metabolic process|mRNA modification|mRNA processing|negative regulation of methylation-dependent chromatin silencing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0						CACAGAGGTGGGTATTGTGGC	0.438													7	157	---	---	---	---	PASS
TAS2R10	50839	broad.mit.edu	37	12	10978480	10978480	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10978480G>A	uc001qyy.1	-	1	389	c.389C>T	c.(388-390)CCC>CTC	p.P130L		NM_023921	NP_076410	Q9NYW0	T2R10_HUMAN	taste receptor, type 2, member 10	130	Helical; Name=4; (Potential).				sensory perception of taste	integral to membrane	taste receptor activity				0						TATCATGAAGGGAAGAACCAT	0.348													16	103	---	---	---	---	PASS
SLCO1B1	10599	broad.mit.edu	37	12	21327635	21327635	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21327635C>T	uc001req.3	+	4	455	c.351C>T	c.(349-351)TTC>TTT	p.F117F		NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family,	117	Helical; Name=3; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)	CACATTTCTTCATGGGATAGT	0.338													22	60	---	---	---	---	PASS
ARNTL2	56938	broad.mit.edu	37	12	27573381	27573381	+	Silent	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27573381C>G	uc001rht.1	+	17	1845	c.1827C>G	c.(1825-1827)GCC>GCG	p.A609A	ARNTL2_uc001rhw.2_Silent_p.A572A|ARNTL2_uc010sjp.1_Missense_Mutation_p.P536R|ARNTL2_uc001rhu.1_Silent_p.A595A|ARNTL2_uc009zji.1_Silent_p.A575A|ARNTL2_uc001rhv.1_Silent_p.A561A|uc001rhx.2_Intron	NM_020183	NP_064568	Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear	609					circadian rhythm|entrainment of circadian clock|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|skin(1)	2	Colorectal(261;0.0847)|Lung SC(9;0.184)					ATGACACAGCCATGGCTGCAT	0.453													57	99	---	---	---	---	PASS
DNM1L	10059	broad.mit.edu	37	12	32858792	32858792	+	Intron	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32858792C>G	uc001rld.2	+						DNM1L_uc010skf.1_Intron|DNM1L_uc010skg.1_Intron|DNM1L_uc001rle.2_Intron|DNM1L_uc001rlf.2_Intron|DNM1L_uc010skh.1_Missense_Mutation_p.S148C|DNM1L_uc001rlg.2_Missense_Mutation_p.S148C|DNM1L_uc001rlh.2_Intron|DNM1L_uc010ski.1_Missense_Mutation_p.L27V	NM_012062	NP_036192	O00429	DNM1L_HUMAN	dynamin 1-like isoform 1						cellular component disassembly involved in apoptosis|mitochondrial fragmentation involved in apoptosis|mitochondrial membrane organization|positive regulation of mitochondrial fission	cis-Golgi network|cytosol|endomembrane system|endoplasmic reticulum|mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					AGACACCTTTCTAAAGGTTTC	0.338													98	235	---	---	---	---	PASS
PDZRN4	29951	broad.mit.edu	37	12	41966568	41966568	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41966568G>C	uc010skn.1	+	10	1458	c.1390G>C	c.(1390-1392)GAG>CAG	p.E464Q	PDZRN4_uc001rmq.3_Missense_Mutation_p.E405Q|PDZRN4_uc009zjz.2_Missense_Mutation_p.E403Q|PDZRN4_uc001rmr.2_Missense_Mutation_p.E290Q	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2	663	Potential.						ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				AGAGGGAGTGGAGCATGAGCT	0.448													13	35	---	---	---	---	PASS
CSAD	51380	broad.mit.edu	37	12	53553951	53553951	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53553951G>A	uc001sby.2	-	13	1245	c.1119C>T	c.(1117-1119)GGC>GGT	p.G373G	CSAD_uc001sbw.2_Silent_p.G226G|CSAD_uc009zmt.2_Silent_p.G155G|CSAD_uc010snx.1_Silent_p.G400G|CSAD_uc001sbz.2_Silent_p.G373G|CSAD_uc009zmu.2_Silent_p.G226G|CSAD_uc001sca.3_RNA	NM_015989	NP_057073	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	373					carboxylic acid metabolic process		pyridoxal phosphate binding|sulfinoalanine decarboxylase activity			ovary(1)	1					L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	GCCCTTGATCGCCCTGTGCCT	0.637									Hereditary_Prostate_Cancer				10	43	---	---	---	---	PASS
IKZF4	64375	broad.mit.edu	37	12	56420643	56420643	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56420643A>G	uc001sjb.1	+	5	524	c.365A>G	c.(364-366)AAG>AGG	p.K122R	IKZF4_uc010sqa.1_Missense_Mutation_p.K75R|IKZF4_uc001sjc.1_Missense_Mutation_p.K122R|IKZF4_uc001sjd.1_Missense_Mutation_p.K20R|IKZF4_uc009zoi.1_Missense_Mutation_p.K77R|IKZF4_uc001sje.1_Missense_Mutation_p.K81R	NM_022465	NP_071910	Q9H2S9	IKZF4_HUMAN	zinc finger protein, subfamily 1A, 4	122					negative regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (6;0.025)|OV - Ovarian serous cystadenocarcinoma(18;0.123)			CTCCTGGAAAAGGACGACAGC	0.592													24	21	---	---	---	---	PASS
CS	1431	broad.mit.edu	37	12	56667527	56667527	+	Silent	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56667527G>T	uc001sks.1	-	10	1264	c.1074C>A	c.(1072-1074)ACC>ACA	p.T358T	CS_uc010sql.1_Silent_p.T345T|CS_uc001skr.1_Silent_p.T292T|CS_uc001skt.1_Silent_p.T313T|CS_uc010sqm.1_3'UTR	NM_004077	NP_004068	O75390	CISY_HUMAN	citrate synthase precursor	358					cellular carbohydrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	citrate (Si)-synthase activity				0		Myeloproliferative disorder(1001;0.000374)		BRCA - Breast invasive adenocarcinoma(357;6.17e-07)		CTCGCTGACAGGTATATCGCG	0.438													23	128	---	---	---	---	PASS
KIF5A	3798	broad.mit.edu	37	12	57971825	57971825	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57971825A>G	uc001sor.1	+	22	2603	c.2395A>G	c.(2395-2397)AAG>GAG	p.K799E	KIF5A_uc010srr.1_Missense_Mutation_p.K710E	NM_004984	NP_004975	Q12840	KIF5A_HUMAN	kinesin family member 5A	799					blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3						CAACCTTCGCAAGCTGTTCGT	0.498													52	42	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	72863703	72863703	+	Intron	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72863703A>G	uc001sxa.2	+							NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme						cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						GTATGAGAAAAAGAATCAGGT	0.323													23	25	---	---	---	---	PASS
C12orf50	160419	broad.mit.edu	37	12	88388448	88388448	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88388448C>G	uc001tam.1	-	7	722	c.554G>C	c.(553-555)GGG>GCG	p.G185A	C12orf50_uc001tan.2_Missense_Mutation_p.G239A	NM_152589	NP_689802	Q8NA57	CL050_HUMAN	hypothetical protein LOC160419	185										skin(2)|ovary(1)	3						CTTTGGTTTCCCATGCAATGA	0.338													12	62	---	---	---	---	PASS
EPYC	1833	broad.mit.edu	37	12	91366688	91366688	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91366688G>T	uc001tbk.2	-	4	503	c.410C>A	c.(409-411)GCT>GAT	p.A137D		NM_004950	NP_004941	Q99645	EPYC_HUMAN	dermatan sulfate proteoglycan 3 precursor	137	LRRNT.				female pregnancy	proteinaceous extracellular matrix	glycosaminoglycan binding			skin(1)	1						CGGAGGAATAGCATCAAGTTC	0.358													41	62	---	---	---	---	PASS
SLC25A3	5250	broad.mit.edu	37	12	98993478	98993478	+	Intron	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98993478G>T	uc001tfo.2	+						SLC25A3_uc001tfm.2_Intron|SLC25A3_uc001tfn.2_Intron|SLC25A3_uc001tfp.2_Intron|SLC25A3_uc001tfq.2_Intron|SLC25A3_uc001tfr.2_Intron|SLC25A3_uc001tfs.2_Intron|SLC25A3_uc009ztn.2_Intron|SLC25A3_uc001tft.2_Intron|SNORA53_uc001tfu.1_RNA	NM_005888	NP_005879	Q00325	MPCP_HUMAN	solute carrier family 25 member 3 isoform a						generation of precursor metabolites and energy	integral to plasma membrane|mitochondrial inner membrane	phosphate carrier activity|symporter activity				0		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		TAAACTTCTTGTTTCTTGTGG	0.383													36	80	---	---	---	---	PASS
ACACB	32	broad.mit.edu	37	12	109702913	109702913	+	Splice_Site	SNP	A	G	G	rs113944047		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109702913A>G	uc001tob.2	+	51	7062	c.6943_splice	c.e51-2	p.D2315_splice	ACACB_uc001toc.2_Splice_Site_p.D2315_splice|ACACB_uc001tod.2_Splice_Site|ACACB_uc010sxm.1_Splice_Site_p.D981_splice	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	GCTCGTCCACAGGACATCCTG	0.652													32	36	---	---	---	---	PASS
CUX2	23316	broad.mit.edu	37	12	111744770	111744770	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111744770G>T	uc001tsa.1	+	11	1057	c.904G>T	c.(904-906)GCG>TCG	p.A302S		NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	302	Potential.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						GCTGGAGGCCGCGCTGGCCTC	0.637													24	76	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117658044	117658044	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117658044G>A	uc001twm.1	-	27	4692	c.4006C>T	c.(4006-4008)CTG>TTG	p.L1336L		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	1336					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	GACTCCGCCAGCTGCTCCTGC	0.542													58	57	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124848272	124848272	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124848272G>A	uc010tba.1	-	21	2998	c.2881C>T	c.(2881-2883)CTG>TTG	p.L961L	NCOR2_uc010tay.1_Silent_p.L961L|NCOR2_uc010taz.1_Silent_p.L944L|NCOR2_uc010tbb.1_Silent_p.L961L|NCOR2_uc010tbc.1_Silent_p.L943L|NCOR2_uc001ugj.1_Silent_p.L961L	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	961					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TTCAGGTCCAGTGGCTTCTGG	0.677													8	120	---	---	---	---	PASS
ATP12A	479	broad.mit.edu	37	13	25284996	25284996	+	Silent	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25284996C>A	uc001upp.2	+	21	3151	c.2964C>A	c.(2962-2964)CTC>CTA	p.L988L	ATP12A_uc010aaa.2_Silent_p.L994L	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A	988	Lumenal (Potential).				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	CCTATGGCCTCGGAAGTGTCA	0.498													15	52	---	---	---	---	PASS
CSNK1A1L	122011	broad.mit.edu	37	13	37678878	37678878	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37678878G>T	uc001uwm.1	-	1	924	c.516C>A	c.(514-516)CAC>CAA	p.H172Q		NM_145203	NP_660204	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	172	Protein kinase.				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)	1		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		TGTACGGTATGTGTTGCCTGG	0.453													24	96	---	---	---	---	PASS
POSTN	10631	broad.mit.edu	37	13	38161072	38161072	+	Intron	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38161072T>C	uc001uwo.3	-						POSTN_uc001uwp.3_Intron|POSTN_uc001uwr.2_Intron|POSTN_uc001uwq.2_Intron|POSTN_uc010teu.1_Intron|POSTN_uc010tev.1_Intron|POSTN_uc010tew.1_Intron|POSTN_uc010tex.1_Intron	NM_006475	NP_006466	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor isoform 1						cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding			ovary(2)	2		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		CAACCTATAATTATTTGGAAA	0.383													15	30	---	---	---	---	PASS
AKAP11	11215	broad.mit.edu	37	13	42877103	42877103	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42877103G>T	uc001uys.1	+	8	4396	c.4221G>T	c.(4219-4221)AAG>AAT	p.K1407N		NM_016248	NP_057332	Q9UKA4	AKA11_HUMAN	A-kinase anchor protein 11	1407					intracellular protein kinase cascade	microtubule organizing center	protein kinase A binding|protein phosphatase 1 binding			ovary(1)|central_nervous_system(1)	2		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		AAACAAACAAGGAACTGTTAA	0.368													13	34	---	---	---	---	PASS
AKAP11	11215	broad.mit.edu	37	13	42877104	42877104	+	Nonsense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42877104G>T	uc001uys.1	+	8	4397	c.4222G>T	c.(4222-4224)GAA>TAA	p.E1408*		NM_016248	NP_057332	Q9UKA4	AKA11_HUMAN	A-kinase anchor protein 11	1408					intracellular protein kinase cascade	microtubule organizing center	protein kinase A binding|protein phosphatase 1 binding			ovary(1)|central_nervous_system(1)	2		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		AACAAACAAGGAACTGTTAAT	0.363													11	35	---	---	---	---	PASS
UTP14C	9724	broad.mit.edu	37	13	52604567	52604567	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52604567C>T	uc001vgb.2	+	2	2162	c.1627C>T	c.(1627-1629)CGG>TGG	p.R543W	UTP14C_uc001vgc.2_RNA	NM_021645	NP_067677	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	543					cell differentiation|meiosis|multicellular organismal development|rRNA processing|spermatogenesis	nucleolus|small-subunit processome				ovary(3)|large_intestine(1)|breast(1)	5		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		CCCAAATAATCGGCCTGATGC	0.483													8	142	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70293558	70293558	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70293558C>A	uc001vip.2	-	9	2752	c.1958G>T	c.(1957-1959)GGA>GTA	p.G653V	KLHL1_uc010thm.1_Missense_Mutation_p.G592V	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	653	Kelch 5.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ATCATGACCTCCTACTGCATA	0.473													19	76	---	---	---	---	PASS
KLF5	688	broad.mit.edu	37	13	73636112	73636112	+	Silent	SNP	T	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73636112T>G	uc001vje.2	+	2	699	c.375T>G	c.(373-375)ACT>ACG	p.T125T	KLF5_uc001vjd.2_Silent_p.T34T	NM_001730	NP_001721	Q13887	KLF5_HUMAN	Kruppel-like factor 5	125					transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|pancreas(1)	3		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		AGTTCTTCACTGACACTGAAG	0.468													40	158	---	---	---	---	PASS
CLN5	1203	broad.mit.edu	37	13	77570026	77570026	+	Intron	SNP	T	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77570026T>G	uc001vkc.2	+							NM_006493	NP_006484	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5						brain development|cell death|lysosomal lumen acidification|neuron maturation|protein catabolic process	endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		ACATGTACTGTCTTTACACAG	0.388													14	40	---	---	---	---	PASS
GPR183	1880	broad.mit.edu	37	13	99948125	99948125	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99948125G>T	uc001vog.2	-	2	449	c.275C>A	c.(274-276)GCA>GAA	p.A92E	UBAC2_uc001voa.3_Intron|UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_004951	NP_004942	P32249	GP183_HUMAN	EBV-induced G protein-coupled receptor 2	92	Helical; Name=2; (Potential).				humoral immune response|mature B cell differentiation involved in immune response	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled				0						AAAGCCCATTGCATAGTAGGC	0.413													14	59	---	---	---	---	PASS
GPR183	1880	broad.mit.edu	37	13	99948126	99948126	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99948126C>T	uc001vog.2	-	2	448	c.274G>A	c.(274-276)GCA>ACA	p.A92T	UBAC2_uc001voa.3_Intron|UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_004951	NP_004942	P32249	GP183_HUMAN	EBV-induced G protein-coupled receptor 2	92	Helical; Name=2; (Potential).				humoral immune response|mature B cell differentiation involved in immune response	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled				0						AAGCCCATTGCATAGTAGGCT	0.408													13	59	---	---	---	---	PASS
LIG4	3981	broad.mit.edu	37	13	108863160	108863160	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108863160C>A	uc001vqn.2	-	2	730	c.457G>T	c.(457-459)GAC>TAC	p.D153Y	LIG4_uc001vqo.2_Missense_Mutation_p.D153Y|LIG4_uc010agg.1_Missense_Mutation_p.D86Y|LIG4_uc010agf.2_Missense_Mutation_p.D153Y|LIG4_uc001vqp.2_Missense_Mutation_p.D153Y	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	153					cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					GCAATTGAGTCTAAAAGGTCG	0.368								NHEJ					17	106	---	---	---	---	PASS
TNFSF13B	10673	broad.mit.edu	37	13	108955864	108955864	+	Silent	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108955864C>G	uc001vqr.2	+	5	924	c.657C>G	c.(655-657)GTC>GTG	p.V219V	TNFSF13B_uc010agj.2_Silent_p.V200V	NM_006573	NP_006564	Q9Y275	TN13B_HUMAN	tumor necrosis factor superfamily, member 13b	219	Extracellular (Potential).				cell proliferation|immune response|signal transduction	extracellular space|integral to membrane|plasma membrane|soluble fraction	cytokine activity|tumor necrosis factor receptor binding				0	all_lung(23;0.000396)|all_neural(89;0.00256)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00902)|Lung SC(71;0.104)		all cancers(43;0.184)|BRCA - Breast invasive adenocarcinoma(86;0.19)			AGGTCCATGTCTTTGGGGATG	0.368													33	68	---	---	---	---	PASS
COL4A2	1284	broad.mit.edu	37	13	111114723	111114723	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111114723G>T	uc001vqx.2	+	24	2057	c.1768G>T	c.(1768-1770)GGC>TGC	p.G590C		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	590	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			CGGCCTCCCAGGCCCTCCCGT	0.622													8	35	---	---	---	---	PASS
F10	2159	broad.mit.edu	37	13	113803481	113803481	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113803481C>A	uc001vsx.2	+	8	1174	c.1117C>A	c.(1117-1119)CAG>AAG	p.Q373K	F10_uc001vsy.2_3'UTR|F10_uc001vsz.2_3'UTR	NM_000504	NP_000495	P00742	FA10_HUMAN	coagulation factor X preproprotein	373	Peptidase S1.				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of cell migration|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|phospholipid binding|protein binding|serine-type endopeptidase activity			pancreas(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Heparin(DB01109)|Menadione(DB00170)|Reteplase(DB00015)|Tenecteplase(DB00031)	GAAGGGCCGGCAGTCCACCAG	0.642													19	39	---	---	---	---	PASS
RASA3	22821	broad.mit.edu	37	13	114758029	114758029	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114758029C>T	uc001vui.2	-	22	2308	c.2177G>A	c.(2176-2178)GGG>GAG	p.G726E	RASA3_uc010tkk.1_Missense_Mutation_p.G694E|RASA3_uc001vuj.2_Missense_Mutation_p.G343E	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	726					intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			CTCACGGTCCCCATCAATGTC	0.493													7	33	---	---	---	---	PASS
METTL3	56339	broad.mit.edu	37	14	21979304	21979304	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21979304C>A	uc001wbc.2	-	1	154	c.62G>T	c.(61-63)AGG>ATG	p.R21M	METTL3_uc010tlw.1_RNA|METTL3_uc010tlx.1_Missense_Mutation_p.R21M|METTL3_uc001wbd.1_Missense_Mutation_p.R21M	NM_019852	NP_062826	Q86U44	MTA70_HUMAN	methyltransferase like 3	21					gene expression	nuclear speck	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity|RNA binding			pancreas(1)|skin(1)	2	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		CCGCTGCAGCCTCTCCCGCAG	0.652													6	11	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23866020	23866020	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23866020G>A	uc001wjv.2	-	19	2242	c.2175C>T	c.(2173-2175)CGC>CGT	p.R725R		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	725	Myosin head-like.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GGTTCAGGATGCGATACCTGA	0.542													21	40	---	---	---	---	PASS
RNF31	55072	broad.mit.edu	37	14	24626791	24626791	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24626791A>T	uc001wmn.1	+	16	2920	c.2671A>T	c.(2671-2673)ACC>TCC	p.T891S	RNF31_uc001wml.1_Missense_Mutation_p.T740S|RNF31_uc010alg.1_Missense_Mutation_p.T650S|RNF31_uc001wmo.1_Missense_Mutation_p.T358S|RNF31_uc001wmp.2_RNA|RNF31_uc010alh.1_Missense_Mutation_p.T75S	NM_017999	NP_060469	Q96EP0	RNF31_HUMAN	ring finger protein 31	891	IBR-type 2.				CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(265;0.00861)		CTTTCACTGTACCCAGTGCCG	0.602													43	109	---	---	---	---	PASS
NYNRIN	57523	broad.mit.edu	37	14	24877435	24877435	+	Nonsense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24877435G>T	uc001wpf.3	+	3	877	c.559G>T	c.(559-561)GAG>TAG	p.E187*		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	187					DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						AGCGGTCCAGGAGCTGCTGCT	0.657													3	5	---	---	---	---	PASS
TRAPPC6B	122553	broad.mit.edu	37	14	39639306	39639306	+	5'UTR	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39639306C>T	uc001wut.1	-	1					TRAPPC6B_uc001wuu.1_5'UTR|TRAPPC6B_uc001wuv.1_RNA|TRAPPC6B_uc010tqd.1_5'UTR	NM_001079537	NP_001073005	Q86SZ2	TPC6B_HUMAN	trafficking protein particle complex 6B isoform						vesicle-mediated transport	endoplasmic reticulum|Golgi apparatus	guanylate cyclase activity|heme binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0128)		CCATTTCCTGCTAATTCTTCC	0.602													13	104	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47566248	47566248	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47566248G>A	uc001wwj.3	-	6	993	c.797C>T	c.(796-798)ACA>ATA	p.T266I	MDGA2_uc001wwi.3_Missense_Mutation_p.T37I|MDGA2_uc010ani.2_5'UTR	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	266	Ig-like 3.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						TCCTCCTGTTGTAACACATAC	0.443													25	87	---	---	---	---	PASS
SMOC1	64093	broad.mit.edu	37	14	70444656	70444656	+	Nonsense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70444656T>A	uc001xls.1	+	5	753	c.500T>A	c.(499-501)TTG>TAG	p.L167*	SMOC1_uc001xlt.1_Nonsense_Mutation_p.L167*	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN	secreted modular calcium-binding protein 1	167					cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding			upper_aerodigestive_tract(1)|pancreas(1)	2				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		GACAAGCCCTTGAGCCAGGGT	0.433													19	50	---	---	---	---	PASS
ADAM20	8748	broad.mit.edu	37	14	70990987	70990987	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70990987C>A	uc001xme.2	-	2	883	c.638G>T	c.(637-639)AGT>ATT	p.S213I		NM_003814	NP_003805	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20 preproprotein	163					proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		TGTATCATCACTGTCTATCTT	0.378													16	64	---	---	---	---	PASS
ADAM20	8748	broad.mit.edu	37	14	70991078	70991078	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70991078G>C	uc001xme.2	-	2	792	c.547C>G	c.(547-549)CTT>GTT	p.L183V		NM_003814	NP_003805	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20 preproprotein	133					proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		AGCATTCCAAGAAAGCCCCCA	0.448													18	61	---	---	---	---	PASS
YLPM1	56252	broad.mit.edu	37	14	75276445	75276445	+	Silent	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75276445A>T	uc001xqj.3	+	7	5008	c.4884A>T	c.(4882-4884)CCA>CCT	p.P1628P	YLPM1_uc001xql.3_RNA|YLPM1_uc001xqm.1_Silent_p.P111P	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	1433					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TGGGTATGCCACCAATGTCCA	0.493													9	39	---	---	---	---	PASS
TSHR	7253	broad.mit.edu	37	14	81609986	81609986	+	Silent	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81609986C>A	uc001xvd.1	+	10	1740	c.1584C>A	c.(1582-1584)CGC>CGA	p.R528R		NM_000369	NP_000360	P16473	TSHR_HUMAN	thyroid stimulating hormone receptor isoform 1	528	Cytoplasmic (Potential).		R -> H.	R -> A (in Ref. 4; AAA70232).	cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	TCGCCATGCGCCTGGACCGGA	0.567			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						14	37	---	---	---	---	PASS
PTPN21	11099	broad.mit.edu	37	14	88934612	88934612	+	Intron	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88934612A>C	uc001xwv.3	-						PTPN21_uc010twc.1_Intron	NM_007039	NP_008970	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4						TCCAGCACCTAGGTTGAGAGA	0.517													23	98	---	---	---	---	PASS
SLC24A4	123041	broad.mit.edu	37	14	92949175	92949175	+	Nonsense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92949175C>A	uc001yak.2	+	13	1380	c.1356C>A	c.(1354-1356)TAC>TAA	p.Y452*	SLC24A4_uc001yai.2_Nonsense_Mutation_p.Y405*|SLC24A4_uc010twm.1_Nonsense_Mutation_p.Y450*|SLC24A4_uc001yaj.2_Nonsense_Mutation_p.Y433*|SLC24A4_uc010auj.2_Nonsense_Mutation_p.Y341*|SLC24A4_uc010twn.1_Nonsense_Mutation_p.Y225*|SLC24A4_uc001yan.2_Nonsense_Mutation_p.Y163*	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1	469	Helical; (Potential).					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		TGTTCTCCTACATCATGGTGT	0.433													12	33	---	---	---	---	PASS
TECPR2	9895	broad.mit.edu	37	14	102900620	102900620	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102900620G>C	uc001ylw.1	+	9	1614	c.1466G>C	c.(1465-1467)TGC>TCC	p.C489S	TECPR2_uc010awl.2_Missense_Mutation_p.C489S|TECPR2_uc010txx.1_Intron	NM_014844	NP_055659	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	489							protein binding			lung(1)|central_nervous_system(1)|skin(1)	3						TCGACACCCTGCTCCGAATTT	0.488													17	54	---	---	---	---	PASS
PLD4	122618	broad.mit.edu	37	14	105398141	105398141	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105398141G>A	uc001ypu.1	+	8	1116	c.975G>A	c.(973-975)CTG>CTA	p.L325L	PLD4_uc010tyl.1_Silent_p.L332L	NM_138790	NP_620145	Q96BZ4	PLD4_HUMAN	phospholipase D4	325					lipid catabolic process	integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity			central_nervous_system(1)|skin(1)	2		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)		Choline(DB00122)	AGGCGCTGCTGGCGGTGATGG	0.667													6	9	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105420486	105420486	+	Silent	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105420486G>T	uc010axc.1	-	7	1422	c.1302C>A	c.(1300-1302)GCC>GCA	p.A434A	AHNAK2_uc001ypx.2_Silent_p.A334A	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	434						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCTTCCTCTGGGCCACTGCTG	0.637													17	60	---	---	---	---	PASS
TUBGCP5	114791	broad.mit.edu	37	15	22868841	22868841	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22868841A>G	uc001yur.3	+	20	2843	c.2713A>G	c.(2713-2715)ATT>GTT	p.I905V	TUBGCP5_uc001yuq.2_Missense_Mutation_p.I905V	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	905					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		CTCTTCCAAGATTCTACACAG	0.388													18	40	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	26828552	26828552	+	Silent	SNP	C	G	G	rs143528720	byFrequency	TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26828552C>G	uc001zaz.2	-	5	613	c.471G>C	c.(469-471)ACG>ACC	p.T157T	GABRB3_uc010uae.1_Silent_p.T72T|GABRB3_uc001zba.2_Silent_p.T157T|GABRB3_uc001zbb.2_Silent_p.T213T	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	157	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	ATGCTGCTGTCGTGGTGATTC	0.473													35	40	---	---	---	---	PASS
TJP1	7082	broad.mit.edu	37	15	30058753	30058753	+	Intron	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30058753T>C	uc001zcr.2	-						TJP1_uc010azl.2_Intron|TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a						cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TGTCTGCAAGTTAAAAAGGTT	0.328													39	30	---	---	---	---	PASS
USP8	9101	broad.mit.edu	37	15	50786304	50786304	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50786304G>C	uc001zym.3	+	17	2985	c.2485G>C	c.(2485-2487)GAA>CAA	p.E829Q	USP8_uc001zyl.3_Missense_Mutation_p.E829Q|USP8_uc001zyn.3_Missense_Mutation_p.E829Q|USP8_uc010ufh.1_Missense_Mutation_p.E723Q|uc001zyo.1_RNA|USP8_uc001zyp.3_5'UTR	NM_001128611	NP_001122083	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	829					cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		AGTGGCAGAAGAATTTGGTAT	0.363													27	91	---	---	---	---	PASS
TMOD2	29767	broad.mit.edu	37	15	52098581	52098581	+	Missense_Mutation	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52098581A>C	uc002abk.2	+	9	1105	c.884A>C	c.(883-885)CAG>CCG	p.Q295P	TMOD2_uc002abl.3_Missense_Mutation_p.Q259P|TMOD2_uc010bfb.2_Missense_Mutation_p.Q251P	NM_014548	NP_055363	Q9NZR1	TMOD2_HUMAN	neuronal tropomodulin isoform a	295					nervous system development	cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(2)	2				all cancers(107;0.00435)		CAGAGGCAGCAGTTGGGAACA	0.488													19	22	---	---	---	---	PASS
AAGAB	79719	broad.mit.edu	37	15	67524205	67524205	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67524205C>T	uc002aqk.3	-	5	587	c.482G>A	c.(481-483)CGA>CAA	p.R161Q	AAGAB_uc002aql.2_Missense_Mutation_p.R52Q|AAGAB_uc010uju.1_Missense_Mutation_p.R52Q	NM_024666	NP_078942	Q6PD74	AAGAB_HUMAN	alpha- and gamma-adaptin-binding protein p34	161					protein transport	cytoplasm					0						TTGGACAATTCGCTTTACTCC	0.373													66	196	---	---	---	---	PASS
LRRC49	54839	broad.mit.edu	37	15	71272438	71272438	+	Splice_Site	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71272438A>T	uc002asw.2	+	10	1169	c.922_splice	c.e10-2	p.E308_splice	LRRC49_uc002asu.2_Splice_Site_p.E298_splice|LRRC49_uc002asx.2_Splice_Site_p.E264_splice|LRRC49_uc010ukf.1_Splice_Site_p.E313_splice|LRRC49_uc002asy.2_Splice_Site_p.E14_splice|LRRC49_uc002asz.2_Splice_Site_p.E280_splice	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49							cytoplasm|microtubule				ovary(1)	1						AATGTCTTTTAGGAAGAAGAA	0.343													44	41	---	---	---	---	PASS
TMEM202	338949	broad.mit.edu	37	15	72700065	72700065	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72700065G>T	uc002auq.2	+	5	653	c.653G>T	c.(652-654)AGA>ATA	p.R218I	TMEM202_uc002aur.2_RNA	NM_001080462	NP_001073931	A6NGA9	TM202_HUMAN	transmembrane protein 202	218						integral to membrane				central_nervous_system(1)|skin(1)	2						TTAACTTCCAGATCGCCTGCC	0.448													42	40	---	---	---	---	PASS
AGBL1	123624	broad.mit.edu	37	15	86807771	86807771	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86807771C>A	uc002blz.1	+	10	1311	c.1231C>A	c.(1231-1233)CCT>ACT	p.P411T	AGBL1_uc002bma.1_Missense_Mutation_p.P142T|AGBL1_uc002bmb.1_Missense_Mutation_p.P105T	NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	411					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						AAGTGAAATCCCTGACATTCA	0.458													50	58	---	---	---	---	PASS
AGBL1	123624	broad.mit.edu	37	15	86807907	86807907	+	Missense_Mutation	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86807907A>C	uc002blz.1	+	10	1447	c.1367A>C	c.(1366-1368)CAT>CCT	p.H456P	AGBL1_uc002bma.1_Missense_Mutation_p.H187P|AGBL1_uc002bmb.1_Missense_Mutation_p.H150P	NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	456					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						CTGCAGACACATCTGAAGCGT	0.448													44	138	---	---	---	---	PASS
ANPEP	290	broad.mit.edu	37	15	90349346	90349346	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90349346C>G	uc002bop.3	-	2	761	c.469G>C	c.(469-471)GAG>CAG	p.E157Q		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	157	Extracellular.|Metalloprotease.				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	TCGGTGGGCTCCACCAGCTCA	0.617													34	33	---	---	---	---	PASS
ASB7	140460	broad.mit.edu	37	15	101169888	101169888	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101169888C>T	uc002bwk.2	+	5	1227	c.458C>T	c.(457-459)CCG>CTG	p.P153L	ASB7_uc002bwj.2_Missense_Mutation_p.P153L	NM_198243	NP_937886	Q9H672	ASB7_HUMAN	ankyrin repeat and SOCS box-containing protein 7	153	ANK 5.				intracellular signal transduction					skin(1)	1	Lung NSC(78;0.00121)|all_lung(78;0.00152)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00168)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			GGTACCACACCGCTTCAGCTC	0.537													8	53	---	---	---	---	PASS
RAB11FIP3	9727	broad.mit.edu	37	16	569032	569032	+	Intron	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:569032G>A	uc002chf.2	+						RAB11FIP3_uc010uuf.1_Intron|RAB11FIP3_uc010uug.1_Intron	NM_014700	NP_055515	O75154	RFIP3_HUMAN	rab11-family interacting protein 3 isoform 1						cell cycle|cytokinesis|endocytic recycling|protein transport	centrosome|cleavage furrow|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding				0		Hepatocellular(16;0.0218)				GAGGTGAGCTGCCAACAGCCT	0.622													36	42	---	---	---	---	PASS
C16orf11	146325	broad.mit.edu	37	16	613551	613551	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:613551A>T	uc002chk.2	+	2	536	c.257A>T	c.(256-258)CAC>CTC	p.H86L		NM_145270	NP_660313	P0CG20	CP011_HUMAN	hypothetical protein LOC146325	86	Pro-rich.									central_nervous_system(1)	1						CCTAGGCCCCACGCACCCACC	0.701													9	16	---	---	---	---	PASS
C16orf42	115939	broad.mit.edu	37	16	1400241	1400241	+	Intron	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1400241G>A	uc002cll.2	-						GNPTG_uc002clm.2_5'Flank	NM_001001410	NP_001001410	Q9UJK0	TSR3_HUMAN	hypothetical protein LOC115939						rRNA processing						0		Hepatocellular(780;0.0893)				AAAGCCTGACGGTGTGAGAAA	0.582													16	21	---	---	---	---	PASS
NLRC3	197358	broad.mit.edu	37	16	3614973	3614973	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3614973G>T	uc010btn.2	-	4	476	c.65C>A	c.(64-66)GCC>GAC	p.A22D		NM_178844	NP_849172	Q7RTR2	NLRC3_HUMAN	NOD3 protein	22					I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						CACCTGCTCGGCTGGGGAGCC	0.682													26	16	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18893616	18893616	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18893616G>A	uc002dfm.2	-	10	1527	c.1164C>T	c.(1162-1164)GTC>GTT	p.V388V	SMG1_uc010bwb.2_Silent_p.V248V	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	388	Interaction with SMG8 and SMG9.				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						ATGGAGGAGGGACATCTTCAT	0.458													12	29	---	---	---	---	PASS
PDILT	204474	broad.mit.edu	37	16	20370847	20370847	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20370847G>A	uc002dhc.1	-	12	1772	c.1549C>T	c.(1549-1551)CTA>TTA	p.L517L		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	517					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						TCCTCAGCTAGCACTTCCTCT	0.368													11	122	---	---	---	---	PASS
PDILT	204474	broad.mit.edu	37	16	20396046	20396046	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20396046C>T	uc002dhc.1	-	3	553	c.330G>A	c.(328-330)CAG>CAA	p.Q110Q		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	110					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						CAAACTCCTGCTGAAGCTCCT	0.517													9	381	---	---	---	---	PASS
ACSM5	54988	broad.mit.edu	37	16	20429371	20429371	+	Intron	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20429371C>T	uc002dhe.2	+						ACSM5_uc002dhd.1_Intron	NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						CTGCCTGTACCACCATCTAGG	0.398													27	28	---	---	---	---	PASS
EARS2	124454	broad.mit.edu	37	16	23535723	23535723	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23535723C>T	uc002dlt.3	-	9	1573	c.1541G>A	c.(1540-1542)CGG>CAG	p.R514Q	EARS2_uc002dlr.3_RNA|EARS2_uc002dls.3_RNA	NM_001083614	NP_001077083	Q5JPH6	SYEM_HUMAN	glutamyl-tRNA synthetase 2 precursor	514					glutamyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|glutamate-tRNA ligase activity|RNA binding				0				GBM - Glioblastoma multiforme(48;0.0353)	L-Glutamic Acid(DB00142)	GATCCGTTCCCGTACTTCCTT	0.483													30	215	---	---	---	---	PASS
CCDC101	112869	broad.mit.edu	37	16	28601690	28601690	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28601690C>T	uc002dqf.2	+	7	678	c.493C>T	c.(493-495)CGG>TGG	p.R165W	uc010vct.1_Intron	NM_138414	NP_612423	Q96ES7	SGF29_HUMAN	coiled-coil domain containing 101	165	SGF29 C-terminal.				establishment of protein localization to chromatin|histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ada2/Gcn5/Ada3 transcription activator complex|SAGA-type complex	methylated histone residue binding			central_nervous_system(1)	1						GGTGGCTGCCCGGGTGAAGGC	0.637													5	31	---	---	---	---	PASS
SEZ6L2	26470	broad.mit.edu	37	16	29910346	29910346	+	5'UTR	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29910346C>T	uc002duq.3	-	1					uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_5'UTR|SEZ6L2_uc002dur.3_5'UTR|SEZ6L2_uc002dus.3_5'UTR|SEZ6L2_uc010vec.1_5'UTR|SEZ6L2_uc010ved.1_5'UTR|ASPHD1_uc002dut.2_5'Flank|ASPHD1_uc002duu.3_5'Flank|ASPHD1_uc010bzi.2_5'Flank	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform							endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						CCCATGGCGACTCACCCCGAT	0.527													7	13	---	---	---	---	PASS
VPS35	55737	broad.mit.edu	37	16	46697028	46697028	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46697028T>C	uc002eef.3	-	14	1793	c.1694A>G	c.(1693-1695)CAC>CGC	p.H565R	VPS35_uc002eed.2_Missense_Mutation_p.H386R|VPS35_uc002eee.2_Missense_Mutation_p.H526R	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35	565					protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				GATAGTCTGGTGGGCAAATGA	0.358													15	36	---	---	---	---	PASS
C16orf57	79650	broad.mit.edu	37	16	58054050	58054050	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58054050C>G	uc002emz.2	+	7	782	c.699C>G	c.(697-699)ATC>ATG	p.I233M	C16orf57_uc010vib.1_Missense_Mutation_p.I215M	NM_024598	NP_078874	Q9BQ65	CP057_HUMAN	hypothetical protein LOC79650	233											0						TTAAGGCAATCGTGGATGGGT	0.542													12	46	---	---	---	---	PASS
CMTM3	123920	broad.mit.edu	37	16	66643809	66643809	+	Silent	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66643809C>A	uc002epu.2	+	5	682	c.423C>A	c.(421-423)ATC>ATA	p.I141I	CMTM3_uc002epv.2_Silent_p.I141I|CMTM3_uc002epw.2_Silent_p.I141I|CMTM3_uc002epx.2_Silent_p.I141I|CMTM3_uc002epy.2_RNA	NM_001048251	NP_001041716	Q96MX0	CKLF3_HUMAN	chemokine-like factor superfamily 3	141	MARVEL.|Helical; (Potential).				chemotaxis	extracellular space|integral to membrane	cytokine activity			central_nervous_system(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0671)|Epithelial(162;0.164)		TTGCTACCATCGTGTTTGCAA	0.552													33	46	---	---	---	---	PASS
CMTM4	146223	broad.mit.edu	37	16	66655990	66655990	+	Missense_Mutation	SNP	G	T	T	rs138396334		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66655990G>T	uc002epz.2	-	4	780	c.598C>A	c.(598-600)CGC>AGC	p.R200S	CMTM4_uc002eqa.2_Missense_Mutation_p.R200S	NM_178818	NP_848933	Q8IZR5	CKLF4_HUMAN	chemokine-like factor superfamily 4 isoform 1	200					chemotaxis	extracellular space|integral to membrane	cytokine activity			pancreas(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0811)|Epithelial(162;0.214)		ATCTCAGGGCGACTGTCCACA	0.592													6	12	---	---	---	---	PASS
TRADD	8717	broad.mit.edu	37	16	67188723	67188723	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67188723G>A	uc002eri.1	-	5	848	c.768C>T	c.(766-768)TAC>TAT	p.Y256Y	TRADD_uc002erh.1_Silent_p.Y196Y	NM_003789	NP_003780	Q15628	TRADD_HUMAN	TNFRSF1A-associated via death domain	256	Interaction with KRT14 and KRT18.|Death.				activation of caspase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|tumor necrosis factor-mediated signaling pathway	cytoskeleton|cytosol|receptor complex	binding, bridging|death domain binding|identical protein binding|kinase binding|signal transducer activity			lung(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		CCTCGCGCTCGTACTCGTAGG	0.726													3	7	---	---	---	---	PASS
RLTPR	146206	broad.mit.edu	37	16	67685325	67685325	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67685325G>T	uc002etn.2	+	24	2455	c.2335G>T	c.(2335-2337)GCT>TCT	p.A779S	RLTPR_uc010cel.1_Missense_Mutation_p.A772S|RLTPR_uc010vjr.1_Missense_Mutation_p.A743S|RLTPR_uc010vjs.1_5'Flank	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin	779										breast(1)	1		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		TCTATATGAAGCTGGAAGCTC	0.582													4	25	---	---	---	---	PASS
NFATC3	4775	broad.mit.edu	37	16	68156136	68156136	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68156136C>G	uc002evo.1	+	2	560	c.350C>G	c.(349-351)TCT>TGT	p.S117C	NFATC3_uc010vkl.1_5'UTR|NFATC3_uc010vkm.1_5'UTR|NFATC3_uc010vkn.1_5'UTR|NFATC3_uc010vko.1_5'UTR|NFATC3_uc010vkp.1_5'UTR|NFATC3_uc010vkq.1_5'UTR|NFATC3_uc002evl.2_Intron|NFATC3_uc002evk.2_Missense_Mutation_p.S117C|NFATC3_uc002evm.1_Missense_Mutation_p.S117C|NFATC3_uc002evn.1_Missense_Mutation_p.S117C|NFATC3_uc010vkr.1_5'UTR|NFATC3_uc010vks.1_5'UTR|NFATC3_uc010vkt.1_5'UTR|NFATC3_uc010vku.1_5'UTR|NFATC3_uc010vkv.1_5'UTR|NFATC3_uc010vkw.1_5'UTR|NFATC3_uc010vkx.1_5'UTR|NFATC3_uc010vky.1_5'UTR|NFATC3_uc010vkz.1_5'UTR|NFATC3_uc010vla.1_5'UTR|NFATC3_uc010vlb.1_5'UTR|NFATC3_uc010vlc.1_5'UTR	NM_173165	NP_775188	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells,	117					inflammatory response|transcription from RNA polymerase II promoter	nucleolus|plasma membrane	DNA binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		ACATCTATCTCTCCTAACTGT	0.383													18	74	---	---	---	---	PASS
IL34	146433	broad.mit.edu	37	16	70688511	70688511	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70688511G>A	uc002ezh.1	+	2	482	c.99G>A	c.(97-99)GAG>GAA	p.E33E	IL34_uc002ezi.1_Silent_p.E33E	NM_152456	NP_689669	Q6ZMJ4	IL34_HUMAN	interleukin 34 precursor	33					positive regulation of cell proliferation|positive regulation of protein phosphorylation	extracellular space	cytokine activity|growth factor activity|macrophage colony-stimulating factor receptor binding			central_nervous_system(1)|skin(1)	2						CGCAGAATGAGGAGTGCACTG	0.577											OREG0023916	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	39	69	---	---	---	---	PASS
PHLPP2	23035	broad.mit.edu	37	16	71715746	71715746	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71715746C>T	uc002fax.2	-	5	804	c.798G>A	c.(796-798)GAG>GAA	p.E266E	PHLPP2_uc002fav.2_RNA|PHLPP2_uc010cgf.2_Silent_p.E266E|PHLPP2_uc002fay.1_Silent_p.E266E	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	266	LRR 1.					cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						AGAAGAGATGCTCAGGAACCT	0.473													58	86	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72821618	72821618	+	Silent	SNP	A	G	G	rs112443847		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72821618A>G	uc002fck.2	-	10	11230	c.10557T>C	c.(10555-10557)GGT>GGC	p.G3519G	uc002fcj.1_RNA|ZFHX3_uc002fcl.2_Silent_p.G2605G	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	3519	Poly-Gly.				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				cgccgccgccaccgccgccgc	0.418													3	18	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72829353	72829353	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72829353T>C	uc002fck.2	-	9	7901	c.7228A>G	c.(7228-7230)ACA>GCA	p.T2410A	ZFHX3_uc002fcl.2_Missense_Mutation_p.T1496A	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	2410					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				GCCTCCGCTGTAAGCTGCAAG	0.557													22	100	---	---	---	---	PASS
TRPV1	7442	broad.mit.edu	37	17	3493612	3493612	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3493612C>T	uc010vrr.1	-	4	1206	c.679G>A	c.(679-681)GAC>AAC	p.D227N	TRPV1_uc010vro.1_Missense_Mutation_p.D227N|TRPV1_uc010vrp.1_Missense_Mutation_p.D227N|TRPV1_uc010vrq.1_Missense_Mutation_p.D225N|TRPV1_uc010vrs.1_Missense_Mutation_p.D227N|TRPV1_uc010vrt.1_Missense_Mutation_p.D227N|TRPV1_uc010vru.1_Missense_Mutation_p.D227N	NM_080706	NP_542437	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel,	227	ANK 3.|Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|chemosensory behavior|thermoception	cell junction|dendritic spine membrane|integral to plasma membrane|postsynaptic membrane	ATP binding|calcium channel activity|calmodulin binding			ovary(1)	1				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	GCCTGGACGTCTGCTCCGTTC	0.582													22	27	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578525	7578525	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578525G>C	uc002gim.2	-	5	599	c.405C>G	c.(403-405)TGC>TGG	p.C135W	TP53_uc002gig.1_Missense_Mutation_p.C135W|TP53_uc002gih.2_Missense_Mutation_p.C135W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.C3W|TP53_uc010cng.1_Missense_Mutation_p.C3W|TP53_uc002gii.1_Missense_Mutation_p.C3W|TP53_uc010cnh.1_Missense_Mutation_p.C135W|TP53_uc010cni.1_Missense_Mutation_p.C135W|TP53_uc002gij.2_Missense_Mutation_p.C135W|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.C42W|TP53_uc002gio.2_Missense_Mutation_p.C3W|TP53_uc010vug.1_Missense_Mutation_p.C96W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	135	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		C -> S (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation; decreased E6-mediated binding to E6-AP).|C -> T (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> F (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C135Y(49)|p.C135F(34)|p.C135W(19)|p.C135S(10)|p.C135fs*35(9)|p.0?(7)|p.C135*(7)|p.C135G(6)|p.C135R(6)|p.C135C(5)|p.C135fs*14(2)|p.N131fs*27(2)|p.Q136fs*13(2)|p.F134_T140>S(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.C135T(1)|p.V73fs*9(1)|p.C135fs*36(1)|p.C135fs*15(1)|p.Y126fs*11(1)|p.C135_A138delCQLA(1)|p.C135_T140delCQLAKT(1)|p.Q136*(1)|p.C135_Q136insXXXXXX(1)|p.C135_Q136insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TGGCCAGTTGGCAAAACATCT	0.567		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			15	23	---	---	---	---	PASS
KDM6B	23135	broad.mit.edu	37	17	7750709	7750709	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7750709G>C	uc002giw.1	+	10	1572	c.1196G>C	c.(1195-1197)AGC>ACC	p.S399T	KDM6B_uc002gix.2_5'Flank	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	399	Pro-rich.				inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2						ACCACCACcagcagcagcagt	0.587													10	63	---	---	---	---	PASS
MYH3	4621	broad.mit.edu	37	17	10544528	10544528	+	Intron	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10544528A>G	uc002gmq.1	-							NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,						muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						CCCTGGGAACAGAAGCGAGAT	0.517													24	52	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11725895	11725895	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11725895G>C	uc002gne.2	+	47	9059	c.8991G>C	c.(8989-8991)TTG>TTC	p.L2997F	DNAH9_uc010coo.2_Missense_Mutation_p.L2291F	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2997	AAA 4 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCCGCTTCTTGCAGAACACAG	0.527													47	63	---	---	---	---	PASS
ZNF624	57547	broad.mit.edu	37	17	16526311	16526311	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16526311T>C	uc010cpi.1	-	6	1972	c.1889A>G	c.(1888-1890)CAT>CGT	p.H630R		NM_020787	NP_065838	Q9P2J8	ZN624_HUMAN	zinc finger protein 624	630	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		AATTTTCTGATGCTCCTTGAG	0.383													6	185	---	---	---	---	PASS
ZNF624	57547	broad.mit.edu	37	17	16527678	16527678	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16527678C>T	uc010cpi.1	-	6	605	c.522G>A	c.(520-522)AGG>AGA	p.R174R		NM_020787	NP_065838	Q9P2J8	ZN624_HUMAN	zinc finger protein 624	174					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		ATCTCAATATCCTATCATTCC	0.363													44	48	---	---	---	---	PASS
C17orf66	256957	broad.mit.edu	37	17	34185239	34185239	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34185239G>T	uc002hke.1	-	11	1266	c.1117C>A	c.(1117-1119)CTG>ATG	p.L373M	C17orf66_uc010wck.1_RNA|C17orf66_uc010wcl.1_Missense_Mutation_p.L333M|C17orf66_uc010wcm.1_Missense_Mutation_p.L339M	NM_152781	NP_689994	A2RTY3	CQ066_HUMAN	hypothetical protein LOC256957	373							binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		CTCCTGAGCAGGTTAAATGTG	0.527													68	226	---	---	---	---	PASS
PLEKHM1	9842	broad.mit.edu	37	17	43552993	43552993	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43552993C>A	uc002ija.2	-	4	566	c.396G>T	c.(394-396)GAG>GAT	p.E132D	PLEKHM1_uc010wjm.1_Missense_Mutation_p.E104D|PLEKHM1_uc002ijb.2_5'UTR|PLEKHM1_uc010wjn.1_Missense_Mutation_p.E81D|hsa-mir-4315-1|MI0015844_5'Flank	NM_014798	NP_055613	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M	132	RUN.				intracellular signal transduction	cytoplasm	metal ion binding				0	Renal(3;0.0405)					TCAGGTAGCACTCCATCAGGC	0.622													4	44	---	---	---	---	PASS
OSBPL7	114881	broad.mit.edu	37	17	45885647	45885647	+	3'UTR	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45885647G>T	uc002ilx.1	-	23					OSBPL7_uc002ilw.1_3'UTR	NM_145798	NP_665741	Q9BZF2	OSBL7_HUMAN	oxysterol-binding protein-like protein 7						lipid transport		lipid binding				0						TCCTGCCCCCGGGGCCAGGGC	0.657													3	15	---	---	---	---	PASS
CDK5RAP3	80279	broad.mit.edu	37	17	46058879	46058879	+	3'UTR	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46058879G>T	uc002imr.2	+	14					CDK5RAP3_uc010wlc.1_3'UTR|CDK5RAP3_uc002imq.1_Intron|CDK5RAP3_uc002imu.2_3'UTR|CDK5RAP3_uc002ims.2_3'UTR|CDK5RAP3_uc002imv.2_3'UTR|CDK5RAP3_uc002imw.2_3'UTR|CDK5RAP3_uc002imx.2_3'UTR	NM_176096	NP_788276	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3						brain development|regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation		neuronal Cdc2-like kinase binding				0						CACCCTCCGTGTTCTTGCCTG	0.537													22	83	---	---	---	---	PASS
ITGA3	3675	broad.mit.edu	37	17	48165193	48165193	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48165193G>T	uc010dbl.2	+	24	3469	c.3005G>T	c.(3004-3006)GGG>GTG	p.G1002V	ITGA3_uc010dbm.2_Missense_Mutation_p.G1002V	NM_002204	NP_002195	P26006	ITA3_HUMAN	integrin alpha 3 isoform a precursor	1002	Helical; (Potential).				blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|leukocyte migration	cell surface|integrin complex	protein binding|receptor activity			ovary(2)|pancreas(1)	3						GTGGGTGCAGGGCTGCTGCTG	0.647													14	14	---	---	---	---	PASS
CACNA1G	8913	broad.mit.edu	37	17	48695256	48695256	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48695256C>T	uc002irk.1	+	30	5564	c.5192C>T	c.(5191-5193)GCG>GTG	p.A1731V	CACNA1G_uc002irj.1_Missense_Mutation_p.A1697V|CACNA1G_uc002irl.1_Missense_Mutation_p.A1708V|CACNA1G_uc002irm.1_Missense_Mutation_p.A1697V|CACNA1G_uc002irn.1_Missense_Mutation_p.A1690V|CACNA1G_uc002iro.1_Missense_Mutation_p.A1697V|CACNA1G_uc002irp.1_Missense_Mutation_p.A1731V|CACNA1G_uc002irq.1_Missense_Mutation_p.A1708V|CACNA1G_uc002irr.1_Missense_Mutation_p.A1731V|CACNA1G_uc002irs.1_Missense_Mutation_p.A1720V|CACNA1G_uc002irt.1_Missense_Mutation_p.A1713V|CACNA1G_uc002irv.1_Missense_Mutation_p.A1720V|CACNA1G_uc002irw.1_Missense_Mutation_p.A1708V|CACNA1G_uc002iru.1_Missense_Mutation_p.A1697V|CACNA1G_uc002irx.1_Missense_Mutation_p.A1644V|CACNA1G_uc002iry.1_Missense_Mutation_p.A1633V|CACNA1G_uc002irz.1_Missense_Mutation_p.A1644V|CACNA1G_uc002isa.1_Missense_Mutation_p.A1610V|CACNA1G_uc002isb.1_Missense_Mutation_p.A1651V|CACNA1G_uc002isc.1_Missense_Mutation_p.A1633V|CACNA1G_uc002isd.1_Missense_Mutation_p.A1626V|CACNA1G_uc002ise.1_Missense_Mutation_p.A1599V|CACNA1G_uc002isf.1_Missense_Mutation_p.A1626V|CACNA1G_uc002isg.1_Missense_Mutation_p.A1592V|CACNA1G_uc002ish.1_Missense_Mutation_p.A1599V|CACNA1G_uc002isi.1_Missense_Mutation_p.A1587V	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G	1731	IV.|Helical; Name=S4 of repeat IV; (Potential).				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GGCATGCGGGCGCTGCTGGAC	0.652													9	101	---	---	---	---	PASS
EPX	8288	broad.mit.edu	37	17	56280656	56280656	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56280656C>G	uc002ivq.2	+	11	2009	c.1923C>G	c.(1921-1923)TTC>TTG	p.F641L		NM_000502	NP_000493	P11678	PERE_HUMAN	eosinophil peroxidase preproprotein	641					hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding			ovary(2)	2						AGAACCAGTTCAGAAGAGCCC	0.512													25	45	---	---	---	---	PASS
TEX14	56155	broad.mit.edu	37	17	56682439	56682439	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56682439C>A	uc010dcz.1	-	11	1372	c.1254G>T	c.(1252-1254)CAG>CAT	p.Q418H	TEX14_uc002iwr.1_Missense_Mutation_p.Q412H|TEX14_uc002iws.1_Missense_Mutation_p.Q412H|TEX14_uc010dda.1_Missense_Mutation_p.Q192H	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a	418	Protein kinase.					cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGTTGTATAGCTGCGTAGGAA	0.493													10	54	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	76535873	76535873	+	IGR	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76535873A>C								DNAH17 (67017 upstream) : CYTH1 (134258 downstream)																							TGAACTGGTCAAATTCATCTA	0.373													33	45	---	---	---	---	PASS
TBC1D16	125058	broad.mit.edu	37	17	77923604	77923604	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77923604G>A	uc002jxj.2	-	7	1434	c.1318C>T	c.(1318-1320)CGC>TGC	p.R440C	TBC1D16_uc002jxh.2_Missense_Mutation_p.R78C|TBC1D16_uc002jxi.2_Missense_Mutation_p.R65C|TBC1D16_uc002jxk.1_Missense_Mutation_p.R78C	NM_019020	NP_061893	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	440	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			CTGTAATAGCGCAGCAGGAAG	0.587													28	98	---	---	---	---	PASS
C17orf101	79701	broad.mit.edu	37	17	80373349	80373349	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80373349G>A	uc002keu.1	-	2	330	c.229C>T	c.(229-231)CGT>TGT	p.R77C	C17orf101_uc002ket.1_Missense_Mutation_p.R77C|C17orf101_uc010dip.1_RNA|HEXDC_uc002kev.3_5'Flank|HEXDC_uc010diq.2_5'Flank	NM_024648	NP_078924	Q6PK18	CQ101_HUMAN	hypothetical protein LOC79701 isoform 1	77	Lumenal (Potential).					integral to membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(1)	1						ACCTCGCCACGGCGGGCCAGG	0.637													22	117	---	---	---	---	PASS
LPIN2	9663	broad.mit.edu	37	18	2921569	2921569	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2921569T>C	uc002klo.2	-	18	2643	c.2404A>G	c.(2404-2406)AAG>GAG	p.K802E		NM_014646	NP_055461	Q92539	LPIN2_HUMAN	lipin 2	802	C-LIP.				fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		AAGGGCTGCTTAGACGGGGCA	0.408													42	31	---	---	---	---	PASS
KIAA1012	22878	broad.mit.edu	37	18	29493400	29493400	+	Nonsense_Mutation	SNP	G	A	A	rs143546887		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29493400G>A	uc002kxc.3	-	5	1067	c.703C>T	c.(703-705)CGA>TGA	p.R235*	KIAA1012_uc002kxb.3_Nonsense_Mutation_p.R181*|KIAA1012_uc002kxd.3_RNA|KIAA1012_uc002kxe.2_Nonsense_Mutation_p.R235*	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878	235					ER to Golgi vesicle-mediated transport	cis-Golgi network					0						TCTGATGCTCGATTAGATGTT	0.318													20	53	---	---	---	---	PASS
KLHL14	57565	broad.mit.edu	37	18	30254622	30254622	+	Nonstop_Mutation	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30254622A>C	uc002kxm.1	-	9	2273	c.1885T>G	c.(1885-1887)TAA>GAA	p.*629E	KLHL14_uc010dmd.1_Nonstop_Mutation_p.*178E	NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN	kelch-like 14	629						cytosol|endoplasmic reticulum membrane				ovary(1)	1						TCCTGGTGTTATTTGTTGTAT	0.438													98	107	---	---	---	---	PASS
SYT4	6860	broad.mit.edu	37	18	40854120	40854120	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40854120A>T	uc002law.2	-	2	643	c.274T>A	c.(274-276)TTG>ATG	p.L92M	SYT4_uc010dng.2_Intron|SYT4_uc010xcm.1_Missense_Mutation_p.L74M|SYT4_uc010dnh.2_Intron	NM_020783	NP_065834	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	92	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			skin(5)	5						TCCAGATGCAATGAATTCTTT	0.403													37	32	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42530710	42530710	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42530710A>G	uc010dni.2	+	4	1701	c.1405A>G	c.(1405-1407)AAA>GAA	p.K469E		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	469						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TAAGTTGAGTAAAATGATAGA	0.483									Schinzel-Giedion_syndrome				56	70	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42531632	42531632	+	Missense_Mutation	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42531632T>A	uc010dni.2	+	4	2623	c.2327T>A	c.(2326-2328)ATG>AAG	p.M776K		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	776						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CCAGCAGCTATGCACCCACTT	0.512									Schinzel-Giedion_syndrome				29	28	---	---	---	---	PASS
WDR7	23335	broad.mit.edu	37	18	54359060	54359060	+	Intron	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54359060G>T	uc002lgk.1	+						WDR7_uc010dpk.1_Intron|WDR7_uc002lgl.1_Intron	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1											ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		TAAAATTCTTGAGGTGTCATT	0.323													3	36	---	---	---	---	PASS
RAX	30062	broad.mit.edu	37	18	56939814	56939814	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56939814C>T	uc002lhx.2	-	2	509	c.322G>A	c.(322-324)GAG>AAG	p.E108K	RAX_uc010dpp.2_Intron	NM_013435	NP_038463	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	108					visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		GGCCGTGCCTCCCCGGGCTCC	0.701													18	16	---	---	---	---	PASS
CTDP1	9150	broad.mit.edu	37	18	77475422	77475422	+	Silent	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77475422G>C	uc002lnh.1	+	8	2109	c.1962G>C	c.(1960-1962)ACG>ACC	p.T654T	CTDP1_uc002lni.1_Silent_p.T654T|CTDP1_uc010drd.1_Silent_p.T654T	NM_004715	NP_004706	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,	654	BRCT.				positive regulation of viral transcription|protein dephosphorylation|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	CTD phosphatase activity|DNA-directed RNA polymerase activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		TAGAGAAGACGCGGGAGCATT	0.627													2	5	---	---	---	---	PASS
STAP2	55620	broad.mit.edu	37	19	4330043	4330043	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4330043C>A	uc002mab.2	-	5	467	c.370G>T	c.(370-372)GAC>TAC	p.D124Y	STAP2_uc002mac.2_Missense_Mutation_p.D124Y|STAP2_uc002mad.2_Missense_Mutation_p.D17Y	NM_001013841	NP_001013863	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	124	PH.					cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGGTCAAGTCGGTCGGGACA	0.617													12	19	---	---	---	---	PASS
MPND	84954	broad.mit.edu	37	19	4352936	4352936	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4352936G>C	uc002mae.2	+	4	641	c.574G>C	c.(574-576)GAG>CAG	p.E192Q	MPND_uc010dtx.2_RNA|MPND_uc002mag.2_Missense_Mutation_p.E192Q|MPND_uc002maf.2_Missense_Mutation_p.E192Q|MPND_uc002mah.2_Missense_Mutation_p.E80Q|MPND_uc002mai.2_Missense_Mutation_p.E80Q	NM_032868	NP_116257	Q8N594	MPND_HUMAN	MPN domain containing isoform 1	192	Poly-Glu.						peptidase activity			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		gctgatggaagaggaggagga	0.532													20	15	---	---	---	---	PASS
SMARCA4	6597	broad.mit.edu	37	19	11096082	11096082	+	Splice_Site	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11096082G>T	uc002mqf.3	+	3	639	c.355_splice	c.e3+1	p.G119_splice	SMARCA4_uc010dxp.2_Splice_Site_p.G119_splice|SMARCA4_uc010dxo.2_Splice_Site_p.G119_splice|SMARCA4_uc002mqg.1_Splice_Site_p.G119_splice|SMARCA4_uc010dxq.2_Splice_Site_p.G119_splice|SMARCA4_uc010dxr.2_Splice_Site_p.G119_splice|SMARCA4_uc002mqj.3_Splice_Site_p.G119_splice|SMARCA4_uc010dxs.2_Splice_Site_p.G119_splice|SMARCA4_uc002mqe.2_Splice_Site_p.G119_splice	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CACTCCCAAGGTACAGAACTG	0.592			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				19	8	---	---	---	---	PASS
EPOR	2057	broad.mit.edu	37	19	11489435	11489435	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11489435A>T	uc002mrj.1	-	7	983	c.847T>A	c.(847-849)TGG>AGG	p.W283R	EPOR_uc002mrh.2_5'UTR|EPOR_uc002mri.2_Missense_Mutation_p.W110R|EPOR_uc002mrk.1_Missense_Mutation_p.W110R|EPOR_uc002mrl.1_RNA|EPOR_uc010xlx.1_RNA|EPOR_uc010xly.1_Missense_Mutation_p.W110R	NM_000121	NP_000112	P19235	EPOR_HUMAN	erythropoietin receptor precursor	283	Cytoplasmic (Potential).|Box 1 motif.					extracellular region|integral to plasma membrane	erythropoietin receptor activity|identical protein binding			ovary(1)	1					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)	ATGCCAGGCCAGATCTTCTGC	0.517													28	35	---	---	---	---	PASS
WIZ	58525	broad.mit.edu	37	19	15535478	15535478	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15535478C>T	uc002nbc.2	-	6	2520	c.2497G>A	c.(2497-2499)GCC>ACC	p.A833T	WIZ_uc002nba.3_Missense_Mutation_p.A700T|WIZ_uc002nbb.3_Missense_Mutation_p.A659T	NM_021241	NP_067064	O95785	WIZ_HUMAN	widely-interspaced zinc finger motifs	1516						nucleus	zinc ion binding				0						GGCGGGCTGGCTGCCAGAGGC	0.736													4	14	---	---	---	---	PASS
CHERP	10523	broad.mit.edu	37	19	16634104	16634104	+	Intron	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16634104G>A	uc002nei.1	-						MED26_uc002nee.2_Intron|CHERP_uc010xpg.1_Intron	NM_006387	NP_006378	Q8IWX8	CHERP_HUMAN	calcium homeostasis endoplasmic reticulum						cellular calcium ion homeostasis|negative regulation of cell proliferation|nervous system development|RNA processing	endoplasmic reticulum|perinuclear region of cytoplasm	RNA binding			ovary(2)	2						CCCCATTTCTGCAAAACAGAG	0.647													8	79	---	---	---	---	PASS
MAST3	23031	broad.mit.edu	37	19	18256047	18256047	+	Intron	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18256047C>T	uc002nhz.3	+							NM_015016	NP_055831	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase								ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			large_intestine(2)|ovary(2)|stomach(1)	5						TGGGTGAGTGCCGAGTGGGAA	0.582													20	82	---	---	---	---	PASS
HOMER3	9454	broad.mit.edu	37	19	19042181	19042181	+	Nonsense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19042181C>A	uc002nku.2	-	8	1500	c.847G>T	c.(847-849)GAG>TAG	p.E283*	HOMER3_uc002nko.1_RNA|HOMER3_uc002nkp.1_RNA|HOMER3_uc010eby.2_Nonsense_Mutation_p.E247*|HOMER3_uc010ebz.2_Nonsense_Mutation_p.E283*|HOMER3_uc002nkw.2_Nonsense_Mutation_p.E283*|HOMER3_uc002nkv.2_Nonsense_Mutation_p.E283*	NM_004838	NP_004829	Q9NSC5	HOME3_HUMAN	Homer, neuronal immediate early gene, 3 isoform	283	Potential.				metabotropic glutamate receptor signaling pathway|protein targeting	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	protein binding				0			Epithelial(12;0.0107)			TCCAGGGCCTCGCGGGGCCCC	0.627													38	39	---	---	---	---	PASS
HAPLN4	404037	broad.mit.edu	37	19	19369455	19369455	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19369455C>T	uc002nmb.2	-	4	749	c.694G>A	c.(694-696)GGC>AGC	p.G232S	HAPLN4_uc002nmc.2_Missense_Mutation_p.G232S	NM_023002	NP_075378	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	232	Link 1.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			pancreas(1)	1			Epithelial(12;0.00575)			CCCCCCAGGCCGCCGCAGGGC	0.726													7	18	---	---	---	---	PASS
ZNF492	57615	broad.mit.edu	37	19	22836207	22836207	+	Missense_Mutation	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22836207A>C	uc002nqw.3	+	2	250	c.6A>C	c.(4-6)TTA>TTC	p.L2F		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	2	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				ATGTGATGTTAGAGAACTACA	0.393													58	80	---	---	---	---	PASS
DPY19L3	147991	broad.mit.edu	37	19	32930828	32930828	+	Intron	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32930828T>A	uc002ntg.2	+						DPY19L3_uc002nth.1_Intron|DPY19L3_uc002nti.1_Intron	NM_207325	NP_997208	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3							integral to membrane				ovary(4)	4	Esophageal squamous(110;0.162)					TGAGCTTTGCTTTCTTTTCTC	0.368													44	58	---	---	---	---	PASS
ATP4A	495	broad.mit.edu	37	19	36051408	36051408	+	Missense_Mutation	SNP	C	A	A	rs141192219		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36051408C>A	uc002oal.1	-	6	673	c.644G>T	c.(643-645)CGC>CTC	p.R215L	ATP4A_uc010eee.1_5'Flank	NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A	215	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)	CGCCAGGATGCGGATGTCGGC	0.632													25	23	---	---	---	---	PASS
RASGRP4	115727	broad.mit.edu	37	19	38916724	38916724	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38916724C>A	uc002oir.2	-	1	222	c.8G>T	c.(7-9)AGA>ATA	p.R3I	RASGRP4_uc010xua.1_Missense_Mutation_p.R3I|RASGRP4_uc010xub.1_Missense_Mutation_p.R3I|RASGRP4_uc010xuc.1_Missense_Mutation_p.R3I|RASGRP4_uc010xud.1_Missense_Mutation_p.R3I|RASGRP4_uc010xue.1_Missense_Mutation_p.R3I|RASGRP4_uc010egb.2_Missense_Mutation_p.R3I	NM_170604	NP_733749	Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4 isoform a	3					activation of phospholipase C activity|cell growth|cell proliferation|myeloid cell differentiation|positive regulation of Ras protein signal transduction|regulation of G-protein coupled receptor protein signaling pathway|response to extracellular stimulus|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|membrane fraction|plasma membrane|soluble fraction	diacylglycerol binding|GTP-dependent protein binding|metal ion binding|Ras guanyl-nucleotide exchange factor activity			pancreas(1)|lung(1)|skin(1)	3	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			ACTGTCTTTTCTGTTCATGCT	0.652													14	10	---	---	---	---	PASS
ERF	2077	broad.mit.edu	37	19	42752640	42752640	+	Missense_Mutation	SNP	A	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42752640A>C	uc002ote.3	-	4	1782	c.1624T>G	c.(1624-1626)TCC>GCC	p.S542A	ERF_uc002otd.3_Missense_Mutation_p.S273A	NM_006494	NP_006485	P50548	ERF_HUMAN	Ets2 repressor factor	542					cell proliferation|regulation of transcription from RNA polymerase II promoter	nucleus	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			lung(1)|kidney(1)|central_nervous_system(1)|skin(1)	4		Prostate(69;0.00682)				TGCTCCAGGGAGAGCTGGGCC	0.682													24	14	---	---	---	---	PASS
LIG1	3978	broad.mit.edu	37	19	48664717	48664717	+	Missense_Mutation	SNP	G	A	A	rs4987181	byFrequency	TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48664717G>A	uc002pia.1	-	4	275	c.155C>T	c.(154-156)CCG>CTG	p.P52L	LIG1_uc002phz.1_RNA|LIG1_uc002pib.1_RNA|LIG1_uc010xzf.1_Missense_Mutation_p.P52L|LIG1_uc010xzg.1_Missense_Mutation_p.P22L|LIG1_uc010xzh.1_RNA	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I	52					anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	CCTCTTCACCGGAGAGTCACT	0.627								NER					34	109	---	---	---	---	PASS
CCDC114	93233	broad.mit.edu	37	19	48807010	48807010	+	Silent	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48807010G>C	uc002pir.2	-	8	1457	c.774C>G	c.(772-774)ACC>ACG	p.T258T	CCDC114_uc002piq.2_Silent_p.T67T|CCDC114_uc002pio.2_Silent_p.T295T|CCDC114_uc002pis.1_5'Flank|CCDC114_uc002pit.1_Silent_p.T295T|CCDC114_uc002piu.1_Silent_p.T295T	NM_144577	NP_653178	Q96M63	CC114_HUMAN	coiled-coil domain containing 114 isoform 2	258										ovary(1)	1		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		TCTCCTGGGAGGTCTTCCAGA	0.622													38	53	---	---	---	---	PASS
TRPM4	54795	broad.mit.edu	37	19	49713957	49713957	+	Intron	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49713957G>A	uc002pmw.2	+						TRPM4_uc010emu.2_Intron|TRPM4_uc010yak.1_Intron|TRPM4_uc002pmx.2_Intron|TRPM4_uc010emv.2_Intron|TRPM4_uc010yal.1_Intron|TRPM4_uc002pmy.2_Intron	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,						dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		GACTCCGCCCGCCCCTGCAGG	0.617													42	32	---	---	---	---	PASS
MED25	81857	broad.mit.edu	37	19	50322430	50322430	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50322430A>G	uc002ppw.1	+	3	235	c.182A>G	c.(181-183)TAT>TGT	p.Y61C	MED25_uc010ybe.1_Intron|MED25_uc010enl.1_Missense_Mutation_p.Y61C	NM_030973	NP_112235	Q71SY5	MED25_HUMAN	mediator complex subunit 25	61	Interaction with the Mediator complex.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm				ovary(1)	1		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		CCCTCCCAGTATGGGGGGACC	0.373													27	27	---	---	---	---	PASS
KLK1	3816	broad.mit.edu	37	19	51322498	51322498	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51322498C>T	uc002ptk.1	-	5	780	c.741G>A	c.(739-741)GTG>GTA	p.V247V	KLK1_uc010ycg.1_RNA	NM_002257	NP_002248	P06870	KLK1_HUMAN	kallikrein 1 preproprotein	247	Peptidase S1.				proteolysis	nucleus	serine-type endopeptidase activity				0		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CATAAGACAGCACTCTGACGG	0.562													28	78	---	---	---	---	PASS
SIGLEC12	89858	broad.mit.edu	37	19	52004673	52004673	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52004673G>A	uc002pwx.1	-	1	371	c.315C>T	c.(313-315)ACC>ACT	p.T105T	SIGLEC12_uc002pww.1_5'Flank|SIGLEC12_uc010eoy.1_5'UTR	NM_053003	NP_443729	Q96PQ1	SIG12_HUMAN	sialic acid binding immunoglobulin-like	105	Ig-like V-type 1.|Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|skin(2)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TGATGCTCAGGGTACAATCCT	0.498													63	90	---	---	---	---	PASS
ZNF677	342926	broad.mit.edu	37	19	53740440	53740440	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53740440G>T	uc002qbf.1	-	5	1725	c.1540C>A	c.(1540-1542)CCT>ACT	p.P514T	ZNF677_uc002qbg.1_Missense_Mutation_p.P514T	NM_182609	NP_872415	Q86XU0	ZN677_HUMAN	zinc finger protein 677	514					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00352)		CATTTGTAAGGTTTCTCTCCA	0.348													19	41	---	---	---	---	PASS
KIR2DS4	3809	broad.mit.edu	37	19	55354367	55354367	+	Missense_Mutation	SNP	A	G	G	rs1130508		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55354367A>G	uc002qhm.1	+	6	755	c.709A>G	c.(709-711)AAA>GAA	p.K237E	KIR2DS4_uc010yfk.1_RNA|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_Intron|KIR2DS4_uc002qhn.1_Intron	NM_012314	NP_036446	P43632	KI2S4_HUMAN	killer cell immunoglobulin-like receptor, two	237	Extracellular (Potential).					integral to plasma membrane	receptor activity				0				GBM - Glioblastoma multiforme(193;0.0192)		ACCAAGCTCCAAAACCGGTGA	0.507													6	48	---	---	---	---	PASS
EPS8L1	54869	broad.mit.edu	37	19	55590382	55590382	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55590382A>G	uc002qis.3	+	4	178	c.74A>G	c.(73-75)TAC>TGC	p.Y25C	EPS8L1_uc010ess.1_Intron|EPS8L1_uc010est.1_Missense_Mutation_p.Y25C|EPS8L1_uc010yfr.1_Intron|EPS8L1_uc010esu.1_Intron|EPS8L1_uc002qiu.2_5'Flank|EPS8L1_uc002qiv.2_5'Flank|EPS8L1_uc002qiw.2_5'Flank	NM_133180	NP_573441	Q8TE68	ES8L1_HUMAN	epidermal growth factor receptor pathway	25						cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		AGGAAGCGTTACTCCACAGTT	0.403													41	47	---	---	---	---	PASS
FIZ1	84922	broad.mit.edu	37	19	56104586	56104586	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56104586C>A	uc002qli.3	-	3	811	c.721G>T	c.(721-723)GCG>TCG	p.A241S	FIZ1_uc002qlj.3_Missense_Mutation_p.A241S	NM_032836	NP_116225	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	241	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|protein kinase binding|receptor binding|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		TCCAGCAGCGCGGGCGCGTTG	0.582													3	4	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56423967	56423967	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56423967C>G	uc010ygg.1	-	5	1241	c.1216G>C	c.(1216-1218)GAG>CAG	p.E406Q		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	406	NACHT.						ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		AGGATTTTCTCAACTTCACTT	0.458													41	46	---	---	---	---	PASS
SRXN1	140809	broad.mit.edu	37	20	629441	629441	+	Nonsense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:629441C>A	uc002wea.2	-	2	392	c.331G>T	c.(331-333)GAG>TAG	p.E111*	SRXN1_uc002web.2_RNA	NM_080725	NP_542763	Q9BYN0	SRXN1_HUMAN	sulfiredoxin 1 homolog	111					response to oxidative stress	cytosol	antioxidant activity|ATP binding|DNA binding|sulfiredoxin activity			ovary(1)	1						GGGATGGTCTCTCGCTGCAGT	0.602													4	72	---	---	---	---	PASS
VPS16	64601	broad.mit.edu	37	20	2845948	2845948	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2845948G>A	uc002whe.2	+	21	2207	c.2159G>A	c.(2158-2160)CGC>CAC	p.R720H	VPS16_uc002whh.2_RNA|PTPRA_uc002whj.2_5'UTR|VPS16_uc002whf.2_Missense_Mutation_p.R576H|VPS16_uc002whd.2_RNA|VPS16_uc002whg.2_Missense_Mutation_p.R406H|VPS16_uc002whi.2_Missense_Mutation_p.R204H	NM_022575	NP_072097	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 isoform 1	720					intracellular protein transport	early endosome|HOPS complex|late endosome membrane|lysosomal membrane|recycling endosome				ovary(2)|pancreas(1)|skin(1)	4						CGTGACTTCCGCATCCCTGAC	0.602													3	27	---	---	---	---	PASS
CHGB	1114	broad.mit.edu	37	20	5905692	5905692	+	Silent	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5905692C>G	uc002wmg.2	+	5	2337	c.2031C>G	c.(2029-2031)GGC>GGG	p.G677G	CHGB_uc010zqz.1_Silent_p.G360G	NM_001819	NP_001810	P05060	SCG1_HUMAN	chromogranin B precursor	677						extracellular region	hormone activity			breast(3)|skin(2)|ovary(1)	6						GCCAAAGGGGCTGACTGTCAT	0.443													30	23	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20243735	20243735	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20243735G>T	uc002wru.2	+	21	2540	c.2464G>T	c.(2464-2466)GCA>TCA	p.A822S	C20orf26_uc010zse.1_Missense_Mutation_p.A802S|C20orf26_uc002wrw.2_RNA|C20orf26_uc002wrv.2_Missense_Mutation_p.A178S	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	822										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		TTGCTTTAAGGCACTGATTTG	0.453													46	60	---	---	---	---	PASS
TGIF2	60436	broad.mit.edu	37	20	35219734	35219734	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35219734C>T	uc002xfn.2	+	3	787	c.614C>T	c.(613-615)GCG>GTG	p.A205V	C20orf24_uc002xfo.2_Intron	NM_021809	NP_068581	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2	205	Repressive function.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)|skin(1)	2	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				GTGGAGGTGGCGCTACAGAGG	0.577													6	166	---	---	---	---	PASS
PPP1R16B	26051	broad.mit.edu	37	20	37535615	37535615	+	Intron	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37535615G>T	uc002xje.2	+						PPP1R16B_uc010ggc.2_Intron	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor						regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				TTCTTCCTGTGTTTCAGATGC	0.522													40	212	---	---	---	---	PASS
CDH22	64405	broad.mit.edu	37	20	44839103	44839103	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44839103C>A	uc002xrm.2	-	6	1530	c.1129G>T	c.(1129-1131)GAC>TAC	p.D377Y	CDH22_uc010ghk.1_Missense_Mutation_p.D377Y|CDH22_uc002xrn.1_Missense_Mutation_p.D128Y	NM_021248	NP_067071	Q9UJ99	CAD22_HUMAN	cadherin 22 precursor	377	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				ATCGCCTGGTCGCGGAACGTG	0.711													19	16	---	---	---	---	PASS
KCNG1	3755	broad.mit.edu	37	20	49626862	49626862	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49626862G>A	uc002xwa.3	-	2	309	c.14C>T	c.(13-15)CCG>CTG	p.P5L	KCNG1_uc002xwb.2_Missense_Mutation_p.P5L	NM_002237	NP_002228	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G,	5	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|central_nervous_system(1)	2						ATTGTCTCCCGGTAAGAGGGT	0.622													29	16	---	---	---	---	PASS
ATP9A	10079	broad.mit.edu	37	20	50342406	50342406	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50342406A>T	uc002xwg.1	-	3	279	c.279T>A	c.(277-279)TTT>TTA	p.F93L	ATP9A_uc010gih.1_Missense_Mutation_p.F78L	NM_006045	NP_006036	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	93	Extracellular (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4						TTTCGGGAACAAACTGAGAGC	0.423													18	111	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60887294	60887294	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60887294C>T	uc002ycq.2	-	69	9506	c.9439G>A	c.(9439-9441)GTC>ATC	p.V3147I		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	3147	Laminin G-like 3.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCGGAGTAGACGTTGCCAGTG	0.682													8	31	---	---	---	---	PASS
OGFR	11054	broad.mit.edu	37	20	61444298	61444298	+	Missense_Mutation	SNP	G	A	A	rs41310199		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61444298G>A	uc002ydj.2	+	7	1366	c.1331G>A	c.(1330-1332)CGC>CAC	p.R444H	OGFR_uc002ydk.2_Missense_Mutation_p.R427H|OGFR_uc002ydl.2_Missense_Mutation_p.R392H|uc011aam.1_Silent_p.G115G	NM_007346	NP_031372	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	444					regulation of cell growth	cytoplasm|membrane|nucleus	opioid receptor activity				0	Breast(26;3.65e-08)					CAGCCCTGCCGCCAACCCCTG	0.687													5	40	---	---	---	---	PASS
DIDO1	11083	broad.mit.edu	37	20	61527695	61527695	+	Missense_Mutation	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61527695T>C	uc002ydr.1	-	8	2368	c.2104A>G	c.(2104-2106)ATT>GTT	p.I702V	DIDO1_uc002yds.1_Missense_Mutation_p.I702V|DIDO1_uc002ydt.1_Missense_Mutation_p.I702V|DIDO1_uc002ydu.1_Missense_Mutation_p.I702V	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	702	TFIIS central.				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					TGGAGGGCAATTTTTCCTACT	0.358													9	67	---	---	---	---	PASS
KCNQ2	3785	broad.mit.edu	37	20	62038588	62038588	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62038588G>T	uc002yey.1	-	17	2205	c.2028C>A	c.(2026-2028)AGC>AGA	p.S676R	KCNQ2_uc002yez.1_Missense_Mutation_p.S645R|KCNQ2_uc002yfa.1_Missense_Mutation_p.S658R|KCNQ2_uc002yfb.1_Missense_Mutation_p.S648R	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein	676	Cytoplasmic (Potential).				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	CATGCTCCCGGCTGTCTTCCG	0.572													27	14	---	---	---	---	PASS
C20orf195	79025	broad.mit.edu	37	20	62187601	62187601	+	Silent	SNP	C	A	A	rs73598377		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62187601C>A	uc002yfj.2	+	2	677	c.585C>A	c.(583-585)ACC>ACA	p.T195T	C20orf195_uc002yfk.2_Silent_p.T195T	NM_024059	NP_076964	Q9BVV2	CT195_HUMAN	hypothetical protein LOC79025	195											0	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			TCAGTGCCACCAAGATCCCGC	0.642													121	57	---	---	---	---	PASS
TPD52L2	7165	broad.mit.edu	37	20	62505156	62505156	+	Nonsense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62505156C>T	uc002yhc.2	+	3	430	c.301C>T	c.(301-303)CAG>TAG	p.Q101*	TPD52L2_uc002ygy.2_Nonsense_Mutation_p.Q101*|TPD52L2_uc002ygz.2_Nonsense_Mutation_p.Q101*|TPD52L2_uc002yha.2_Nonsense_Mutation_p.Q101*|TPD52L2_uc002yhb.2_Nonsense_Mutation_p.Q101*|TPD52L2_uc002yhd.2_Nonsense_Mutation_p.Q101*|TPD52L2_uc011abk.1_Nonsense_Mutation_p.Q52*|TPD52L2_uc011abl.1_Nonsense_Mutation_p.Q78*|TPD52L2_uc002yhe.2_Silent_p.C3C	NM_003288	NP_003279	O43399	TPD54_HUMAN	tumor protein D52-like 2 isoform e	101					regulation of cell proliferation	perinuclear region of cytoplasm	protein binding|protein homodimerization activity			ovary(1)|skin(1)	2	all_cancers(38;1.3e-12)|all_epithelial(29;2.23e-14)|Lung NSC(23;5.92e-10)|all_lung(23;2.08e-09)					GCATGACGTGCAGGTCTCTAG	0.667													5	14	---	---	---	---	PASS
SOX18	54345	broad.mit.edu	37	20	62680665	62680665	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62680665G>A	uc002yhs.2	-	1	315	c.205C>T	c.(205-207)CTC>TTC	p.L69F		NM_018419	NP_060889	P35713	SOX18_HUMAN	SRY-box 18	69					angiogenesis|blood vessel endothelial cell migration|endocardial cell differentiation|endocardium formation|establishment of endothelial barrier|heart looping|lymphangiogenesis|lymphatic endothelial cell differentiation|negative regulation of transcription, DNA-dependent|outflow tract morphogenesis|positive regulation of transcription from RNA polymerase II promoter|vasculogenesis	nucleus	transcription regulatory region DNA binding				0	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					GCCGGGCTGAGGCCATAgcgc	0.378													23	15	---	---	---	---	PASS
PLAC4	191585	broad.mit.edu	37	21	42551398	42551398	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42551398G>C	uc002yyz.2	-	1	5769	c.158C>G	c.(157-159)TCT>TGT	p.S53C	BACE2_uc002yyw.2_Intron|BACE2_uc002yyx.2_Intron|BACE2_uc002yyy.2_Intron	NM_182832	NP_878252	Q8WY50	PLAC4_HUMAN	placenta-specific 4	53											0		Prostate(19;2.29e-06)				CCAGGGTGCAGAGTGAGGTGT	0.423													9	14	---	---	---	---	PASS
KRTAP10-1	386677	broad.mit.edu	37	21	45959496	45959496	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45959496G>T	uc002zfh.1	-	1	583	c.538C>A	c.(538-540)CAG>AAG	p.Q180K	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198691	NP_941964	P60331	KR101_HUMAN	keratin associated protein 10-1	180	24 X 5 AA repeats of C-C-X(3).					keratin filament				skin(1)	1						CAGGCCTGCTGGCAGGGGGAG	0.622													71	102	---	---	---	---	PASS
MED15	51586	broad.mit.edu	37	22	20939445	20939445	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20939445C>T	uc002zsp.2	+	16	2102	c.2022C>T	c.(2020-2022)ATC>ATT	p.I674I	MED15_uc002zsq.2_Silent_p.I634I|MED15_uc010gso.2_Silent_p.I617I|MED15_uc002zsr.2_Silent_p.I608I|MED15_uc011ahs.1_Silent_p.I608I|MED15_uc002zss.2_Silent_p.I553I|MED15_uc011ahu.1_Silent_p.I384I|MED15_uc002zst.2_Silent_p.I290I|MED15_uc002zsu.2_Silent_p.I279I	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a	674					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			GGCAGAGCATCCCCAGTGTGC	0.637													7	46	---	---	---	---	PASS
ZNF70	7621	broad.mit.edu	37	22	24086193	24086193	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24086193G>C	uc002zxs.2	-	2	1596	c.1135C>G	c.(1135-1137)CTG>GTG	p.L379V	ZNF70_uc002zxr.1_5'Flank	NM_021916	NP_068735	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	379	C2H2-type 9.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						TGCTGGATCAGCGCAGAGCTG	0.587													37	41	---	---	---	---	PASS
BPIL2	254240	broad.mit.edu	37	22	32828535	32828535	+	Intron	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32828535C>A	uc003amn.2	-						BPIL2_uc010gwo.2_Intron|BPIL2_uc011amb.1_Intron	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing							extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						TGCAATCTGCCCACATTCCGA	0.473													30	39	---	---	---	---	PASS
EIF3D	8664	broad.mit.edu	37	22	36907704	36907704	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36907704G>A	uc003apq.2	-	14	1595	c.1479C>T	c.(1477-1479)TGC>TGT	p.C493C	EIF3D_uc011amr.1_Silent_p.C320C|EIF3D_uc003apr.2_Silent_p.C493C|EIF3D_uc011ams.1_Silent_p.C396C|EIF3D_uc011amt.1_Silent_p.C444C	NM_003753	NP_003744	O15371	EIF3D_HUMAN	eukaryotic translation initiation factor 3	493						cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			pancreas(1)	1						TGTCAATGACGCAGCGTAAAA	0.552											OREG0026522	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	55	---	---	---	---	PASS
PLA2G6	8398	broad.mit.edu	37	22	38512212	38512212	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38512212C>G	uc003auy.1	-	13	1885	c.1749G>C	c.(1747-1749)ATG>ATC	p.M583I	PLA2G6_uc003auz.1_Missense_Mutation_p.M529I|PLA2G6_uc003ava.1_Missense_Mutation_p.M583I|PLA2G6_uc003avb.2_Missense_Mutation_p.M529I|PLA2G6_uc010gxk.1_RNA|PLA2G6_uc003aux.1_5'Flank	NM_003560	NP_003551	O60733	PA2G6_HUMAN	phospholipase A2, group VI isoform a	583					cardiolipin biosynthetic process|cell death|lipid catabolic process	centrosome|membrane				ovary(1)	1	Melanoma(58;0.045)				Quinacrine(DB01103)	TCCCTGTCAGCATCACCCTGG	0.597													18	19	---	---	---	---	PASS
CELSR1	9620	broad.mit.edu	37	22	46859807	46859807	+	Missense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46859807G>A	uc003bhw.1	-	2	3980	c.3980C>T	c.(3979-3981)TCC>TTC	p.S1327F		NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	1327	Extracellular (Potential).|EGF-like 1; calcium-binding.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GAAGGGCGCGGAGCTGTCGAA	0.662													5	31	---	---	---	---	PASS
BRD1	23774	broad.mit.edu	37	22	50187932	50187932	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50187932C>A	uc003biv.2	-	6	2596	c.2109G>T	c.(2107-2109)TTG>TTT	p.L703F	BRD1_uc011arf.1_Missense_Mutation_p.L298F|BRD1_uc011arg.1_Missense_Mutation_p.L752F|BRD1_uc011arh.1_Missense_Mutation_p.L703F|BRD1_uc003biu.3_Missense_Mutation_p.L703F	NM_014577	NP_055392	O95696	BRD1_HUMAN	bromodomain containing protein 1	703					histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CGGGGTCCAGCAACCTGTCCA	0.602													36	46	---	---	---	---	PASS
SHANK3	85358	broad.mit.edu	37	22	51117572	51117572	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51117572G>T	uc003bne.1	+	6	726	c.726G>T	c.(724-726)CAG>CAT	p.Q242H		NM_001080420	NP_001073889	F2Z3L0	F2Z3L0_HUMAN	SH3 and multiple ankyrin repeat domains 3	242										central_nervous_system(1)	1		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		ACCACGCTCAGCTGGGGATCA	0.667													5	5	---	---	---	---	PASS
ASMTL	8623	broad.mit.edu	37	X	1554621	1554621	+	Missense_Mutation	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1554621C>T	uc004cpx.1	-	4	415	c.304G>A	c.(304-306)GTG>ATG	p.V102M	ASMTL_uc011mhe.1_Intron|ASMTL_uc004cpy.1_Missense_Mutation_p.V86M|ASMTL_uc011mhf.1_Missense_Mutation_p.V44M	NM_004192	NP_004183	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	102	MAF-like.				melatonin biosynthetic process	cytoplasm	acetylserotonin O-methyltransferase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TGCTTGTCCACCGGCTTCTCC	0.617													19	49	---	---	---	---	PASS
CNKSR2	22866	broad.mit.edu	37	X	21609200	21609200	+	Missense_Mutation	SNP	G	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21609200G>C	uc004czx.1	+	15	1754	c.1718G>C	c.(1717-1719)TGT>TCT	p.C573S	CNKSR2_uc004czw.2_Missense_Mutation_p.C573S|CNKSR2_uc011mjn.1_Missense_Mutation_p.C524S|CNKSR2_uc011mjo.1_Missense_Mutation_p.C543S|CNKSR2_uc004czy.2_Missense_Mutation_p.C165S	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	573	PH.				regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2						CGTGGTGACTGTGAGGGCTGG	0.398													70	58	---	---	---	---	PASS
POLA1	5422	broad.mit.edu	37	X	24807052	24807052	+	Intron	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24807052C>T	uc004dbl.2	+							NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1						cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	AGTCGGCAGGCAGTGGGCTGG	0.517													4	86	---	---	---	---	PASS
DCAF8L1	139425	broad.mit.edu	37	X	27999094	27999094	+	Missense_Mutation	SNP	A	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27999094A>T	uc004dbx.1	-	1	473	c.358T>A	c.(358-360)TGT>AGT	p.C120S		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	120										ovary(3)|skin(1)	4						CATCGTGGACACATCCGAGGC	0.413													20	16	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	29973346	29973346	+	Silent	SNP	T	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29973346T>A	uc004dby.2	+	11	2008	c.1500T>A	c.(1498-1500)CTT>CTA	p.L500L		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	500	Cytoplasmic (Potential).|TIR.				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						GAAATATGCTTGTGACTGGAG	0.443													43	22	---	---	---	---	PASS
SYTL5	94122	broad.mit.edu	37	X	37965892	37965892	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37965892A>G	uc004ddu.2	+	12	1736	c.1202A>G	c.(1201-1203)TAT>TGT	p.Y401C	SYTL5_uc004ddv.2_Missense_Mutation_p.Y401C|SYTL5_uc004ddx.2_Missense_Mutation_p.Y423C	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	401					intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						ACGGGAGACTATGGCAACGTG	0.423													3	53	---	---	---	---	PASS
RPGR	6103	broad.mit.edu	37	X	38164003	38164003	+	Missense_Mutation	SNP	C	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38164003C>A	uc004ded.1	-	8	987	c.819G>T	c.(817-819)CAG>CAT	p.Q273H	RPGR_uc004deb.2_Missense_Mutation_p.Q273H|RPGR_uc004dea.2_RNA|RPGR_uc004dec.2_RNA|RPGR_uc004dee.1_5'UTR	NM_001034853	NP_001030025	Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator isoform C	273	RCC1 5.				intracellular protein transport|response to stimulus|visual perception	Golgi apparatus|photoreceptor outer segment	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						CAAGACCCAGCTGACCAAATT	0.388													14	6	---	---	---	---	PASS
RIBC1	158787	broad.mit.edu	37	X	53455274	53455274	+	Silent	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53455274G>A	uc004dsk.2	+	5	396	c.243G>A	c.(241-243)GAG>GAA	p.E81E	RIBC1_uc004dsj.1_Silent_p.E81E|RIBC1_uc011mog.1_Intron	NM_001031745	NP_001026915	Q8N443	RIBC1_HUMAN	RIB43A domain with coiled-coils 1 isoform 1	81											0						AGATGTTAGAGAAGGAAGAGG	0.532													20	43	---	---	---	---	PASS
TSIX	9383	broad.mit.edu	37	X	73042695	73042695	+	RNA	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73042695C>T	uc004ebn.2	+	1		c.30656C>T			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0						TCCTTAGTATCGAACATATCA	0.348													27	17	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91090520	91090520	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91090520G>T	uc004efk.1	+	1	862	c.17G>T	c.(16-18)GGG>GTG	p.G6V	PCDH11X_uc004efl.1_Missense_Mutation_p.G6V|PCDH11X_uc004efo.1_Missense_Mutation_p.G6V|PCDH11X_uc010nmv.1_Missense_Mutation_p.G6V|PCDH11X_uc004efm.1_Missense_Mutation_p.G6V|PCDH11X_uc004efn.1_Missense_Mutation_p.G6V|PCDH11X_uc004efh.1_Missense_Mutation_p.G6V|PCDH11X_uc004efj.1_Missense_Mutation_p.G6V	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	6					homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						TTGTTGTCCGGGACGTACATT	0.483													47	31	---	---	---	---	PASS
MORF4L2	9643	broad.mit.edu	37	X	102931868	102931868	+	Nonsense_Mutation	SNP	G	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102931868G>A	uc004ekw.2	-	4	1320	c.88C>T	c.(88-90)CAG>TAG	p.Q30*	MORF4L2_uc004ela.2_Nonsense_Mutation_p.Q30*|MORF4L2_uc004ekx.2_Nonsense_Mutation_p.Q30*|MORF4L2_uc004elb.2_Nonsense_Mutation_p.Q30*|MORF4L2_uc004eky.2_Nonsense_Mutation_p.Q30*|MORF4L2_uc010nos.2_Nonsense_Mutation_p.Q30*|MORF4L2_uc004ekz.2_Nonsense_Mutation_p.Q30*|MORF4L2_uc011mry.1_Nonsense_Mutation_p.Q30*|MORF4L2_uc011mrz.1_Nonsense_Mutation_p.Q30*|MORF4L2_uc004elc.2_Nonsense_Mutation_p.Q30*|MORF4L2_uc004elf.2_Nonsense_Mutation_p.Q30*|MORF4L2_uc004ele.2_Nonsense_Mutation_p.Q30*|MORF4L2_uc011msa.1_Nonsense_Mutation_p.Q30*|MORF4L2_uc011msb.1_Nonsense_Mutation_p.Q30*|MORF4L2_uc011msc.1_Nonsense_Mutation_p.Q30*|MORF4L2_uc011msd.1_Nonsense_Mutation_p.Q30*|MORF4L2_uc004eld.2_Nonsense_Mutation_p.Q30*	NM_012286	NP_036418	Q15014	MO4L2_HUMAN	mortality factor 4 like 2	30					chromatin modification|DNA repair|regulation of cell growth|transcription, DNA-dependent	nucleolus	protein binding				0						TTACTTCTCTGCATGTTGCTT	0.478													5	119	---	---	---	---	PASS
PRPS1	5631	broad.mit.edu	37	X	106888416	106888416	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106888416C>T	uc004ene.3	+	5	745	c.540C>T	c.(538-540)TCC>TCT	p.S180S	PRPS1_uc010npg.2_Silent_p.S147S|PRPS1_uc011msj.1_5'UTR	NM_002764	NP_002755	P60891	PRPS1_HUMAN	phosphoribosyl pyrophosphate synthetase 1	180					5-phosphoribose 1-diphosphate biosynthetic process|hypoxanthine biosynthetic process|nervous system development|nucleoside metabolic process|purine nucleotide biosynthetic process|pyrimidine nucleotide biosynthetic process|ribonucleoside monophosphate biosynthetic process|urate biosynthetic process	cytosol	ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity			breast(3)|large_intestine(1)	4						GAGTGACCTCCATTGCAGACA	0.393													67	116	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117809915	117809915	+	Missense_Mutation	SNP	A	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117809915A>G	uc004eqp.2	+	47	5279	c.5216A>G	c.(5215-5217)TAT>TGT	p.Y1739C	DOCK11_uc004eqq.2_Missense_Mutation_p.Y1518C	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1739	DHR-2.				blood coagulation	cytosol	GTP binding			ovary(3)	3						ACTCAAGTTTATAGAACTCTT	0.289													22	11	---	---	---	---	PASS
GRIA3	2892	broad.mit.edu	37	X	122537353	122537353	+	Missense_Mutation	SNP	G	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122537353G>T	uc004etq.3	+	10	1569	c.1276G>T	c.(1276-1278)GTA>TTA	p.V426L	GRIA3_uc004etr.3_Missense_Mutation_p.V426L|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Missense_Mutation_p.V410L	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	426	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	TCGGACCATAGTAGTGACTAC	0.438													96	47	---	---	---	---	PASS
AFF2	2334	broad.mit.edu	37	X	147743938	147743938	+	Missense_Mutation	SNP	C	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147743938C>G	uc004fcp.2	+	3	1169	c.690C>G	c.(688-690)TTC>TTG	p.F230L	AFF2_uc004fco.2_Missense_Mutation_p.F226L|AFF2_uc004fcq.2_Missense_Mutation_p.F226L|AFF2_uc004fcr.2_Missense_Mutation_p.F226L|AFF2_uc011mxb.1_Missense_Mutation_p.F230L|AFF2_uc004fcs.2_Missense_Mutation_p.F226L	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	230					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					AAGATGCTTTCAAAGAAATCT	0.468													115	65	---	---	---	---	PASS
ARHGAP4	393	broad.mit.edu	37	X	153178148	153178148	+	Intron	SNP	T	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153178148T>C	uc004fjk.1	-						ARHGAP4_uc004fjj.1_5'Flank|ARHGAP4_uc011mzf.1_Intron|ARHGAP4_uc004fjl.1_Intron|ARHGAP4_uc010nup.1_Intron	NM_001666	NP_001657	P98171	RHG04_HUMAN	Rho GTPase activating protein 4 isoform 2						apoptosis|cytoskeleton organization|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|Rho protein signal transduction	cytosol|focal adhesion|nucleus	Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			central_nervous_system(1)	1	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGGCAAAGCTAGTACCTGGA	0.567													74	26	---	---	---	---	PASS
PCDH11Y	83259	broad.mit.edu	37	Y	5605740	5605740	+	Silent	SNP	C	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:5605740C>T	uc004fqo.2	+	5	4514	c.3780C>T	c.(3778-3780)CTC>CTT	p.L1260L		NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	1260	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						TTATTGCCCTCCATCGTAGTC	0.547													70	119	---	---	---	---	PASS
USP24	23358	broad.mit.edu	37	1	55609729	55609729	+	Intron	DEL	T	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55609729delT	uc001cyg.3	-							NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24						ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						ATTATAACACTTTTTTTTTTG	0.348													10	5	---	---	---	---	
KLHL20	27252	broad.mit.edu	37	1	173702733	173702733	+	Intron	DEL	A	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173702733delA	uc001gjc.2	+						KLHL20_uc010pmr.1_Intron|KLHL20_uc009wwf.2_Intron|KLHL20_uc001gjd.2_Intron	NM_014458	NP_055273	Q9Y2M5	KLH20_HUMAN	kelch-like 20						cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity			ovary(1)	1						caaaaaatttaaaaaAAAAAT	0.154													7	6	---	---	---	---	
FMOD	2331	broad.mit.edu	37	1	203225511	203225513	+	Intron	DEL	AAA	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203225511_203225513delAAA	uc010pqi.1	-						CHIT1_uc001gzm.1_Intron	NM_002023		Q06828	FMOD_HUMAN	fibromodulin precursor						transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix				ovary(2)|breast(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.171)			AGAATCCTTCaaaaaaaaaaaaa	0.310													5	3	---	---	---	---	
EDARADD	128178	broad.mit.edu	37	1	236645415	236645415	+	Intron	DEL	A	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236645415delA	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			actccatctcaaaaaaaaaaa	0.129													6	3	---	---	---	---	
ATAD2B	54454	broad.mit.edu	37	2	24103433	24103433	+	Intron	DEL	A	-	-	rs75314008		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24103433delA	uc002rek.3	-						ATAD2B_uc010yki.1_Intron|ATAD2B_uc010exx.1_Intron	NM_017552	NP_060022	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					actctgtctcaaaaaaaaaaa	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	26372631	26372632	+	IGR	DEL	TC	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26372631_26372632delTC								RAB10 (12309 upstream) : HADHA (40873 downstream)																							GCttttcatttctttttttttt	0.228													5	3	---	---	---	---	
OTOF	9381	broad.mit.edu	37	2	26697367	26697367	+	Intron	DEL	C	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26697367delC	uc002rhk.2	-						OTOF_uc010yla.1_5'Flank|OTOF_uc002rhh.2_Intron|OTOF_uc002rhi.2_Intron|OTOF_uc002rhj.2_Intron	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a						cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					agccccTCTTCCCTGCAGTCC	0.328													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	30410441	30410441	+	IGR	DEL	A	-	-	rs79540423		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30410441delA								YPEL5 (27043 upstream) : LBH (43956 downstream)																							TTTTTGGGTTAAAAAAAAAAA	0.259													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	45224046	45224046	+	IGR	DEL	A	-	-	rs34239087		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45224046delA								SIX3 (51656 upstream) : SIX2 (8279 downstream)																							TTATTTGTTTAAAAAAAAAAA	0.224													4	3	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54163034	54163035	+	Intron	INS	-	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54163034_54163035insT	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TGTTCAAAATGttttttttttt	0.153													5	3	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	88025476	88025476	+	Frame_Shift_Del	DEL	A	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88025476delA	uc002srs.3	+	6	1196	c.301delA	c.(301-303)ACAfs	p.T101fs				Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;	Error:Variant_position_missing_in_Q9H871_after_alignment										ovary(1)|skin(1)	2						TCCTCGGAACACAACAGTAGA	0.453													12	6	---	---	---	---	
NCK2	8440	broad.mit.edu	37	2	106509301	106509302	+	Intron	INS	-	A	A	rs111320888		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106509301_106509302insA	uc002tdg.2	+						NCK2_uc002tdh.2_Intron|NCK2_uc002tdi.2_Intron	NM_003581	NP_003572	O43639	NCK2_HUMAN	NCK adaptor protein 2 isoform A						axon guidance|epidermal growth factor receptor signaling pathway|negative regulation of cell proliferation|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of epidermal growth factor receptor activity|regulation of translation|signal complex assembly|T cell activation	cytosol|endoplasmic reticulum	cytoskeletal adaptor activity|receptor signaling complex scaffold activity			ovary(1)|lung(1)	2						aactccatctcaaaaaaaaaaa	0.213													4	3	---	---	---	---	
MYO7B	4648	broad.mit.edu	37	2	128394875	128394876	+	Intron	INS	-	A	A	rs139192837	by1000genomes	TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128394875_128394876insA	uc002top.2	+						MYO7B_uc002tos.1_Frame_Shift_Ins_p.P322fs|MYO7B_uc002tot.2_Intron	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB							apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CTCTGACCCCCCCGTCCCCTGT	0.624													4	2	---	---	---	---	
ACVR1C	130399	broad.mit.edu	37	2	158399086	158399087	+	Intron	DEL	AG	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158399086_158399087delAG	uc002tzk.3	-						ACVR1C_uc002tzl.3_Intron|ACVR1C_uc010fof.2_Intron|ACVR1C_uc010foe.2_Intron	NM_145259	NP_660302	Q8NER5	ACV1C_HUMAN	activin A receptor, type IC isoform 1						apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7						TCAGTGACCCAGAGAAGACTTC	0.490													10	11	---	---	---	---	
DNAJC13	23317	broad.mit.edu	37	3	132179281	132179281	+	Intron	DEL	T	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132179281delT	uc003eor.2	+						DNAJC13_uc010htq.1_Intron	NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13								heat shock protein binding			ovary(1)|breast(1)	2						ACGTGGATGATTTTTTTTTTT	0.323													11	5	---	---	---	---	
DHX36	170506	broad.mit.edu	37	3	154010602	154010602	+	Intron	DEL	T	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154010602delT	uc003ezy.3	-						DHX36_uc010hvq.2_Intron|DHX36_uc003ezz.3_Intron	NM_020865	NP_065916	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36							cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTTCAGAGCATTTTTTTTTTA	0.249													10	5	---	---	---	---	
PGM2	55276	broad.mit.edu	37	4	37851992	37851992	+	Frame_Shift_Del	DEL	G	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37851992delG	uc011byb.1	+	12	1673	c.1600delG	c.(1600-1602)GCTfs	p.A534fs	PGM2_uc011byc.1_Frame_Shift_Del_p.A374fs	NM_018290	NP_060760	Q96G03	PGM2_HUMAN	phosphoglucomutase 2	534					glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity|phosphopentomutase activity			ovary(1)	1						TGATAAAAAAGCTGTAAGTAA	0.289													14	8	---	---	---	---	
KDR	3791	broad.mit.edu	37	4	55974019	55974019	+	Frame_Shift_Del	DEL	C	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55974019delC	uc003has.2	-	10	1599	c.1297delG	c.(1297-1299)GATfs	p.D433fs	KDR_uc003hat.1_Frame_Shift_Del_p.D433fs|KDR_uc011bzx.1_Frame_Shift_Del_p.D433fs	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	433	Ig-like C2-type 5.|Extracellular (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	TGGTAGGAATCCACAGGAGAG	0.473			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			56	51	---	---	---	---	
UBA6	55236	broad.mit.edu	37	4	68531131	68531132	+	Intron	INS	-	T	T	rs72340884		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68531131_68531132insT	uc003hdg.3	-						UBA6_uc003hdi.2_Intron|UBA6_uc003hdj.2_Intron	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN	ubiquitin-activating enzyme E1-like 2						protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0						CCAGCATAGTGtttttttttgt	0.243													5	4	---	---	---	---	
IGJ	3512	broad.mit.edu	37	4	71521932	71521932	+	3'UTR	DEL	A	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71521932delA	uc003hfn.3	-	4					IGJ_uc010ihz.2_3'UTR	NM_144646	NP_653247	P01591	IGJ_HUMAN	immunoglobulin J chain						immune response	extracellular region	antigen binding				0			Lung(101;0.235)			TACATCACCCAAAAAAAAAAA	0.308													5	3	---	---	---	---	
SEC31A	22872	broad.mit.edu	37	4	83792991	83792991	+	Intron	DEL	A	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83792991delA	uc003hnf.2	-						SEC31A_uc003hne.2_5'UTR|SEC31A_uc011ccl.1_Intron|SEC31A_uc003hnl.2_Intron|SEC31A_uc003hng.2_Intron|SEC31A_uc003hnh.2_Intron|SEC31A_uc003hni.2_Intron|SEC31A_uc003hnj.2_Intron|SEC31A_uc011ccm.1_Intron|SEC31A_uc011ccn.1_Intron|SEC31A_uc003hnk.2_Intron|SEC31A_uc003hnm.2_Intron|SEC31A_uc003hnn.1_Intron|SEC31A_uc003hno.2_Intron	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1						COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				aactccatctaaaaaaaaaaG	0.104													7	4	---	---	---	---	
C4orf29	80167	broad.mit.edu	37	4	128938586	128938587	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128938586_128938587delCT	uc003ifr.2	+	9	857_858	c.539_540delCT	c.(538-540)GCTfs	p.A180fs	C4orf29_uc003ifs.2_Frame_Shift_Del_p.A74fs|C4orf29_uc003ift.2_Frame_Shift_Del_p.A11fs|C4orf29_uc003ifu.2_Frame_Shift_Del_p.A11fs|C4orf29_uc010inz.2_Intron|C4orf29_uc003ifv.2_Frame_Shift_Del_p.A11fs	NM_001039717	NP_001034806	Q0P651	CD029_HUMAN	hypothetical protein LOC80167 precursor	180						extracellular region				ovary(1)	1						GAATCTGCAGCTCTCTTGCACT	0.411													13	27	---	---	---	---	
TRIML1	339976	broad.mit.edu	37	4	189067770	189067770	+	Intron	DEL	C	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189067770delC	uc003izm.1	+						TRIML1_uc003izn.1_Intron	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1						multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		caccatgttgcccaggctggt	0.015													10	8	---	---	---	---	
PCDHA2	56146	broad.mit.edu	37	5	140176148	140176148	+	Frame_Shift_Del	DEL	C	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140176148delC	uc003lhd.2	+	1	1705	c.1599delC	c.(1597-1599)TTCfs	p.F533fs	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Frame_Shift_Del_p.F533fs|PCDHA2_uc011czy.1_Frame_Shift_Del_p.F533fs	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	533	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTGCAGTTCCAGGTGAGCG	0.677													54	40	---	---	---	---	
NFYA	4800	broad.mit.edu	37	6	41057863	41057863	+	Intron	DEL	T	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41057863delT	uc003opo.2	+						NFYA_uc003opp.2_Intron|NFYA_uc003opq.2_Intron	NM_002505	NP_002496	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha isoform 1						transcription from RNA polymerase II promoter	CCAAT-binding factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(28;0.0418)|Colorectal(47;0.196)					aaaaaaataattttttttttt	0.179													18	8	---	---	---	---	
XPO5	57510	broad.mit.edu	37	6	43538049	43538050	+	Intron	DEL	AA	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43538049_43538050delAA	uc003ovp.2	-							NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5						gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			cctccgtctcaaaaaaaaaaaa	0.099													4	2	---	---	---	---	
LRRC1	55227	broad.mit.edu	37	6	53787794	53787794	+	3'UTR	DEL	T	-	-	rs67155925		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53787794delT	uc003pcd.1	+	14						NM_018214	NP_060684	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1							cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		CCCGGTGTGATTTTTTTTTTT	0.458													4	3	---	---	---	---	
ZAN	7455	broad.mit.edu	37	7	100334425	100334425	+	Intron	DEL	C	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100334425delC	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGCTCTGCCTCCCCCAGAGGG	0.657													4	2	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110460728	110460728	+	Intron	DEL	G	-	-	rs1673406		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110460728delG	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AATTTCTAGTGttttttttgt	0.129										HNSCC(38;0.096)			3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	120492839	120492839	+	IGR	DEL	T	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120492839delT								NOV (56161 upstream) : ENPP2 (76480 downstream)																							GAGGGATGTGTTCGTGGAACT	0.483													42	27	---	---	---	---	
ENPP2	5168	broad.mit.edu	37	8	120613134	120613134	+	Intron	DEL	T	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120613134delT	uc003yot.1	-						ENPP2_uc003yos.1_Intron|ENPP2_uc010mdd.1_Intron	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein						cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CATGAAAAACTTTTTTTTTTT	0.308													3	3	---	---	---	---	
LYPD2	137797	broad.mit.edu	37	8	143833668	143833669	+	Intron	INS	-	GG	GG	rs140886582	by1000genomes	TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143833668_143833669insGG	uc003ywz.2	-							NM_205545	NP_991108	Q6UXB3	LYPD2_HUMAN	LY6/PLAUR domain containing 2 precursor							anchored to membrane|plasma membrane					0	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CTCCTTATGGCGGGGGGGCCAC	0.703													4	2	---	---	---	---	
ZCCHC6	79670	broad.mit.edu	37	9	88957837	88957837	+	Intron	DEL	A	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88957837delA	uc004aoq.2	-						ZCCHC6_uc011ltf.1_Intron|ZCCHC6_uc004aor.2_Intron|ZCCHC6_uc004aos.2_Intron|ZCCHC6_uc004aot.2_Intron|ZCCHC6_uc004aou.2_Intron|ZCCHC6_uc004aov.2_Intron|ZCCHC6_uc004aow.2_Intron	NM_024617	NP_078893	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6						RNA 3'-end processing		nucleic acid binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)	2						GCAGAGTATTAAAAAAAAAAG	0.313													4	2	---	---	---	---	
ERP44	23071	broad.mit.edu	37	9	102822307	102822308	+	Intron	INS	-	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102822307_102822308insT	uc004bam.2	-						ERP44_uc010msy.2_Intron|ERP44_uc010msz.2_Intron	NM_015051	NP_055866	Q9BS26	ERP44_HUMAN	thioredoxin domain containing 4 (endoplasmic						cell redox homeostasis|glycoprotein metabolic process|protein folding|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|ER-Golgi intermediate compartment	protein binding|protein disulfide isomerase activity				0						ATTTTATTGGGTTTTTTTTTTG	0.287													4	3	---	---	---	---	
ANKRD26	22852	broad.mit.edu	37	10	27367840	27367841	+	Intron	DEL	AA	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27367840_27367841delAA	uc001ith.2	-						ANKRD26_uc001itg.2_Intron|ANKRD26_uc009xku.1_Intron	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26							centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						TTACCAAAGTAAAAAAAAAAAA	0.302													3	3	---	---	---	---	
POLR3A	11128	broad.mit.edu	37	10	79770063	79770063	+	Intron	DEL	A	-	-	rs3832673		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79770063delA	uc001jzn.2	-							NM_007055	NP_008986	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide						innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding				0	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			aaaaaaaaagaaaaaaaaaaa	0.179													4	2	---	---	---	---	
PNLIPRP2	5408	broad.mit.edu	37	10	118396278	118396279	+	Intron	INS	-	T	T	rs11197776	by1000genomes	TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118396278_118396279insT	uc001lcq.2	+						PNLIPRP2_uc009xyv.1_Intron	NM_005396	NP_005387	P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2						galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity			large_intestine(1)	1				all cancers(201;0.015)		ACAAATTATGGTTTTTTTTTTC	0.337													6	3	---	---	---	---	
IFITM2	10581	broad.mit.edu	37	11	308885	308886	+	Intron	INS	-	C	C	rs5789178		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:308885_308886insC	uc001lox.3	+							NM_006435	NP_006426	Q01629	IFM2_HUMAN	interferon induced transmembrane protein 2						response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane	protein binding				0		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;5.73e-28)|Epithelial(43;3.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.14e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0328)|LUSC - Lung squamous cell carcinoma(625;0.122)		GAGAGTCTGAGCCGGGTGAGGA	0.639													2	5	---	---	---	---	
MUC2	4583	broad.mit.edu	37	11	1099123	1099124	+	Intron	INS	-	G	G			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1099123_1099124insG	uc001lsx.1	+							NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor							inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCTCCGTGTGTGGGGCACTGGG	0.649													14	7	---	---	---	---	
KLHL35	283212	broad.mit.edu	37	11	75134961	75134961	+	Intron	DEL	C	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75134961delC	uc001owm.1	-							NM_001039548	NP_001034637	Q6PF15	KLH35_HUMAN	kelch-like 35												0						AGACTCACCGCCCCCCCCAAC	0.512													4	4	---	---	---	---	
IFLTD1	160492	broad.mit.edu	37	12	25672736	25672736	+	Intron	DEL	T	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25672736delT	uc001rgs.2	-						IFLTD1_uc001rgt.1_Intron|IFLTD1_uc010sji.1_Intron|IFLTD1_uc010sjj.1_Intron|IFLTD1_uc009zjc.2_Intron	NM_152590	NP_689803	Q8N9Z9	ILFT1_HUMAN	intermediate filament tail domain containing 1							intermediate filament	structural molecule activity			ovary(2)|central_nervous_system(1)	3	all_lung(3;2.75e-22)|Lung NSC(3;1.77e-21)|all_hematologic(7;0.00656)|Colorectal(261;0.0847)					TCCCACATGCTTAGTTACTAA	0.333													30	14	---	---	---	---	
LMBR1L	55716	broad.mit.edu	37	12	49494516	49494516	+	Intron	DEL	T	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49494516delT	uc001rth.3	-						LMBR1L_uc001rtg.3_Intron|LMBR1L_uc001rti.3_Intron	NM_018113	NP_060583	Q6UX01	LMBRL_HUMAN	lipocalin-interacting membrane receptor						endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1						AGCCCACttcttttttttttt	0.229													4	3	---	---	---	---	
XPOT	11260	broad.mit.edu	37	12	64808876	64808876	+	Intron	DEL	T	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64808876delT	uc001ssb.2	+						XPOT_uc009zqm.1_Intron	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin						intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		ATTTTATGACTTTTTTTTTTT	0.284													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80650276	80650277	+	IGR	INS	-	CAAA	CAAA	rs147846753	by1000genomes	TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80650276_80650277insCAAA								PPP1R12A (321041 upstream) : PTPRQ (187849 downstream)																							TTTCTTTACATcaaacaaacaa	0.322													4	2	---	---	---	---	
ATP2B1	490	broad.mit.edu	37	12	90010464	90010464	+	Intron	DEL	A	-	-	rs113951213		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90010464delA	uc001tbh.2	-						ATP2B1_uc001tbg.2_Intron|ATP2B1_uc001tbf.2_Intron	NM_001682	NP_001673	P20020	AT2B1_HUMAN	plasma membrane calcium ATPase 1 isoform 1b						ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						GTTCACACAGAAAAAAAAAAA	0.343													3	3	---	---	---	---	
RIMBP2	23504	broad.mit.edu	37	12	130912803	130912805	+	In_Frame_Del	DEL	TCG	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130912803_130912805delTCG	uc001uil.2	-	12	2444_2446	c.2280_2282delCGA	c.(2278-2283)GACGAG>GAG	p.D760del		NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	760						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CAGCTCCTCCTCGTCCTCCTCCA	0.616													50	22	---	---	---	---	
PARP4	143	broad.mit.edu	37	13	25000864	25000864	+	Intron	DEL	A	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25000864delA	uc001upl.2	-							NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		catctctgctaaaaaaaaaaa	0.104													3	7	---	---	---	---	
MYO16	23026	broad.mit.edu	37	13	109700758	109700758	+	Intron	DEL	T	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109700758delT	uc001vqt.1	+						MYO16_uc010agk.1_Intron|MYO16_uc001vqu.1_Intron|MYO16_uc010tjh.1_Intron	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			AGGTGTCAGATTTTttttttt	0.174													11	7	---	---	---	---	
USP7	7874	broad.mit.edu	37	16	8994680	8994680	+	Intron	DEL	A	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8994680delA	uc002czl.2	-						USP7_uc010uyk.1_Intron|USP7_uc002czj.2_Intron|USP7_uc010uyj.1_Intron|USP7_uc002czk.2_Intron	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7						interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						TACAACAGGTAAAAAAAAAAA	0.318													4	2	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11520921	11520922	+	Frame_Shift_Ins	INS	-	A	A			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11520921_11520922insA	uc002gne.2	+	5	1166_1167	c.1098_1099insA	c.(1096-1101)TGCAACfs	p.C366fs		NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	366_367	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGGAGATTTGCAACCTTCTCAT	0.609													40	18	---	---	---	---	
ELAC2	60528	broad.mit.edu	37	17	12920063	12920063	+	Intron	DEL	A	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12920063delA	uc002gnz.3	-						ELAC2_uc010vvp.1_Intron|ELAC2_uc010vvq.1_Intron|ELAC2_uc010vvr.1_Intron	NM_018127	NP_060597	Q9BQ52	RNZ2_HUMAN	elaC homolog 2 isoform 1						tRNA processing	nucleus	endonuclease activity|metal ion binding|protein binding				0						cgccactgACaaaaaaaaaaa	0.214									Hereditary_Prostate_Cancer				6	3	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	32366387	32366387	+	Intron	DEL	C	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32366387delC	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	CAGAGGCCAGCTCCCCTTTGC	0.537													33	17	---	---	---	---	
CRHR1	1394	broad.mit.edu	37	17	43912267	43912268	+	3'UTR	INS	-	G	G	rs140399885	by1000genomes	TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43912267_43912268insG	uc010dap.2	+	14					CRHR1_uc010wjx.1_3'UTR|CRHR1_uc002ijp.2_3'UTR|CRHR1_uc002ijm.2_3'UTR|CRHR1_uc002ijn.2_3'UTR|CRHR1_uc010dar.2_3'UTR|CRHR1_uc010dao.2_3'UTR|CRHR1_uc010daq.2_3'UTR	NM_001145146	NP_001138618	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1						female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		ACTGACAGCCTGGGGGGGCCGC	0.678													4	5	---	---	---	---	
UTP18	51096	broad.mit.edu	37	17	49350960	49350960	+	Intron	DEL	T	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49350960delT	uc002its.2	+							NM_016001	NP_057085	Q9Y5J1	UTP18_HUMAN	UTP18, small subunit processome component						rRNA processing	nucleolus					0			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			TATGTTATTGTTTTTTTTTTT	0.234													3	3	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80525803	80525808	+	Intron	DEL	TTTTTT	-	-	rs5822539		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80525803_80525808delTTTTTT	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			ATTCTCTTCCtttttttttttttttt	0.325													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	68097784	68097784	+	IGR	DEL	G	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68097784delG								SOCS6 (100350 upstream) : None (None downstream)																							CCTCTCTCAAGGACGAGGTTT	0.537													4	3	---	---	---	---	
CLPP	8192	broad.mit.edu	37	19	6364743	6364743	+	Intron	DEL	T	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6364743delT	uc002mem.1	+						CLPP_uc002men.1_5'Flank	NM_006012	NP_006003	Q16740	CLPP_HUMAN	caseinolytic peptidase, ATP-dependent,						proteolysis	mitochondrial matrix	ATP binding|protein binding|serine-type endopeptidase activity			ovary(1)	1						GGAGGGGATGttttttttttt	0.313													6	4	---	---	---	---	
MARCH2	51257	broad.mit.edu	37	19	8495419	8495419	+	Intron	DEL	A	-	-	rs74326673		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8495419delA	uc002mjv.2	+						MARCH2_uc002mjw.2_Intron|MARCH2_uc002mjx.2_Intron	NM_016496	NP_057580	Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2						endocytosis	cytoplasmic vesicle|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						aatctgtctcaaaaaaaaaaa	0.249													4	2	---	---	---	---	
CCDC124	115098	broad.mit.edu	37	19	18054605	18054605	+	3'UTR	DEL	G	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18054605delG	uc010xpz.1	+	5					CCDC124_uc002nhs.2_3'UTR	NM_001136203	NP_001129675	Q96CT7	CC124_HUMAN	coiled-coil domain containing 124								DNA binding				0						TCAGCTGCGAGGGTCACAGAG	0.682													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	20442506	20442507	+	IGR	INS	-	T	T			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20442506_20442507insT								LOC284441 (72003 upstream) : ZNF826 (8571 downstream)																							GGCAGCTCGtgttttttttttg	0.307													4	2	---	---	---	---	
NCCRP1	342897	broad.mit.edu	37	19	39691221	39691221	+	Intron	DEL	G	-	-			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39691221delG	uc002okq.1	+							NM_001001414	NP_001001414	Q6ZVX7	NCRP1_HUMAN	non-specific cytotoxic cell receptor protein 1						protein catabolic process					ovary(1)	1						TCCTCAAAAAGGGCTCCTCCC	0.607													55	49	---	---	---	---	
PSG9	5678	broad.mit.edu	37	19	43763205	43763206	+	Frame_Shift_Ins	INS	-	C	C			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43763205_43763206insC	uc002owd.3	-	4	890_891	c.791_792insG	c.(790-792)CCTfs	p.P264fs	PSG9_uc002owe.3_Intron|PSG9_uc010xwm.1_Frame_Shift_Ins_p.P171fs|PSG9_uc002owf.3_Intron|PSG9_uc002owg.2_Intron|PSG9_uc002owh.2_Intron	NM_002784	NP_002775	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	264	Ig-like C2-type 2.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				TCTCACTCTTAGGTTCACAGGT	0.495													170	140	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19804031	19804031	+	IGR	DEL	G	-	-	rs35040175		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19804031delG								SLC24A3 (100491 upstream) : RIN2 (66179 downstream)																							TGCTCTGCCTGCTTTTTTTTT	0.393													5	4	---	---	---	---	
FAM83D	81610	broad.mit.edu	37	20	37555322	37555323	+	In_Frame_Ins	INS	-	GCG	GCG			TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37555322_37555323insGCG	uc002xjg.2	+	1	368_369	c.327_328insGCG	c.(325-330)insGCG	p.116_117insA	FAM83D_uc002xjf.2_In_Frame_Ins_p.116_117insA	NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN	hypothetical protein LOC81610	86_87					cell division|mitosis	cytoplasm|spindle pole				ovary(3)	3		Myeloproliferative disorder(115;0.00878)				GAGAGGAGGGCgcggcggcggc	0.619													3	3	---	---	---	---	
SAMM50	25813	broad.mit.edu	37	22	44385220	44385220	+	Intron	DEL	T	-	-	rs72408712		TCGA-85-6560-01	TCGA-85-6560-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44385220delT	uc003bej.2	+						SAMM50_uc011aqd.1_Intron|SAMM50_uc003bek.2_Intron	NM_015380	NP_056195	Q9Y512	SAM50_HUMAN	sorting and assembly machinery component 50						protein import into mitochondrial outer membrane	integral to membrane|integral to membrane of membrane fraction|mitochondrial sorting and assembly machinery complex	protein binding			skin(1)	1		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				GGTGTCTGTCttttttttttt	0.189													11	5	---	---	---	---	
