Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MST1P2	11209	broad.mit.edu	37	1	16976875	16976875	+	RNA	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16976875C>T	uc010och.1	+	14		c.2596C>T			MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						atggtttttccccctacaagt	0.035													4	15	---	---	---	---	PASS
KIAA0090	23065	broad.mit.edu	37	1	19549914	19549914	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19549914G>A	uc001bbo.2	-	19	2395	c.2352C>T	c.(2350-2352)ATC>ATT	p.I784I	KIAA0090_uc001bbn.2_5'Flank|KIAA0090_uc001bbp.2_Silent_p.I783I|KIAA0090_uc001bbq.2_Silent_p.I783I|KIAA0090_uc001bbr.2_Silent_p.I762I	NM_015047	NP_055862	Q8N766	K0090_HUMAN	hypothetical protein LOC23065 precursor	784	DUF1620.|Extracellular (Potential).					integral to membrane	protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)		CTGAATGCACGATATGGACAG	0.537													8	281	---	---	---	---	PASS
CD52	1043	broad.mit.edu	37	1	26646892	26646892	+	3'UTR	SNP	C	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26646892C>A	uc001bmc.2	+	2					UBXN11_uc001bma.2_5'Flank	NM_001803	NP_001794	P31358	CD52_HUMAN	CD52 antigen precursor						elevation of cytosolic calcium ion concentration|respiratory burst	anchored to membrane|integral to plasma membrane|membrane fraction					0		all_cancers(24;5.02e-24)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.56e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0137)|READ - Rectum adenocarcinoma(331;0.0649)	Alemtuzumab(DB00087)	TGATGCCAGACATCACCAGGT	0.572													3	45	---	---	---	---	PASS
COL9A2	1298	broad.mit.edu	37	1	40766912	40766912	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40766912C>G	uc001cfh.1	-	32	2082	c.2012G>C	c.(2011-2013)GGA>GCA	p.G671A	COL9A2_uc001cfi.1_Missense_Mutation_p.G490A	NM_001852	NP_001843	Q14055	CO9A2_HUMAN	alpha 2 type IX collagen precursor	671	Nonhelical region 1 (NC1).				axon guidance|skeletal system development	collagen type IX				ovary(2)	2	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			GGCCGAAGCTCCAAGGCAGGC	0.677													22	34	---	---	---	---	PASS
SLC6A9	6536	broad.mit.edu	37	1	44474107	44474107	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44474107G>A	uc001cll.2	-	5	919	c.727C>T	c.(727-729)CGG>TGG	p.R243W	SLC6A9_uc009vxe.2_Missense_Mutation_p.R99W|SLC6A9_uc010okm.1_Missense_Mutation_p.R170W|SLC6A9_uc001clm.2_Missense_Mutation_p.R189W|SLC6A9_uc009vxd.2_RNA|SLC6A9_uc010okn.1_Missense_Mutation_p.R174W|SLC6A9_uc001cln.2_Missense_Mutation_p.R170W|SLC6A9_uc010oko.1_Missense_Mutation_p.R59W|SLC6A9_uc010okp.1_RNA	NM_201649	NP_964012	P48067	SC6A9_HUMAN	solute carrier family 6 member 9 isoform 2	243	Extracellular (Potential).					integral to plasma membrane|membrane fraction	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity				0	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	GCGGCTGGCCGAGAGCCATTG	0.642													15	111	---	---	---	---	PASS
HSPB11	51668	broad.mit.edu	37	1	54395807	54395807	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54395807G>A	uc001cwh.2	-	3	186	c.110C>T	c.(109-111)ACG>ATG	p.T37M	HSPB11_uc001cwi.1_Missense_Mutation_p.T37M	NM_016126	NP_057210	Q9Y547	HSB11_HUMAN	heat shock protein family B (small), member 11	37					cell adhesion|response to stress						0						GGTCCAAAACGTTTCTGGATT	0.284													49	76	---	---	---	---	PASS
UBE2U	148581	broad.mit.edu	37	1	64669723	64669723	+	5'UTR	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64669723C>T	uc001dbn.1	+	1						NM_152489	NP_689702	Q5VVX9	UBE2U_HUMAN	ubiquitin-conjugating enzyme E2U (putative)								ATP binding|protein binding|ubiquitin-protein ligase activity				0						TCAGACCCTCCGCTGCCTATC	0.463													14	48	---	---	---	---	PASS
TTLL7	79739	broad.mit.edu	37	1	84372185	84372185	+	Intron	SNP	T	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84372185T>A	uc001djc.2	-						TTLL7_uc001djb.2_RNA|TTLL7_uc001djd.2_Intron|TTLL7_uc001dje.2_Intron|TTLL7_uc001djf.2_Intron|TTLL7_uc001djg.2_Intron	NM_024686	NP_078962	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7						cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity			ovary(1)	1				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		GAGGGGGTCTTATTTCATTGT	0.308													10	49	---	---	---	---	PASS
GSTM5	2949	broad.mit.edu	37	1	110255736	110255736	+	Intron	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110255736C>G	uc001dyn.2	+						GSTM5_uc010ovu.1_5'UTR	NM_000851	NP_000842	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5						xenobiotic metabolic process	endoplasmic reticulum membrane	glutathione transferase activity			central_nervous_system(6)	6		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	TCTTCCCCACCACAGCTCCTG	0.572													5	43	---	---	---	---	PASS
GSTM5	2949	broad.mit.edu	37	1	110255737	110255737	+	Intron	SNP	A	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110255737A>G	uc001dyn.2	+						GSTM5_uc010ovu.1_5'UTR	NM_000851	NP_000842	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5						xenobiotic metabolic process	endoplasmic reticulum membrane	glutathione transferase activity			central_nervous_system(6)	6		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	CTTCCCCACCACAGCTCCTGA	0.572													5	44	---	---	---	---	PASS
PTPN22	26191	broad.mit.edu	37	1	114372254	114372254	+	Missense_Mutation	SNP	T	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114372254T>C	uc001eds.2	-	18	2340	c.2210A>G	c.(2209-2211)CAG>CGG	p.Q737R	PTPN22_uc009wgq.2_Missense_Mutation_p.Q682R|PTPN22_uc010owo.1_Missense_Mutation_p.Q493R|PTPN22_uc001edt.2_Intron|PTPN22_uc009wgr.2_Missense_Mutation_p.Q737R|PTPN22_uc009wgs.2_Missense_Mutation_p.Q610R	NM_015967	NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type	737					negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTTCAGTGTCTGTTTTGAAGA	0.368													3	169	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145209300	145209300	+	5'UTR	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145209300C>T	uc001emp.3	+	1					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_5'UTR|NOTCH2NL_uc001emm.3_5'UTR|NOTCH2NL_uc001emo.2_5'UTR|NOTCH2NL_uc010oyh.1_RNA	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CTATCGGGACCCCCTCCCCAT	0.567													2	1	---	---	---	---	PASS
ITGA10	8515	broad.mit.edu	37	1	145534100	145534100	+	Silent	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145534100C>G	uc001eoa.2	+	14	1681	c.1605C>G	c.(1603-1605)CTC>CTG	p.L535L	NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Silent_p.L404L|ITGA10_uc009wiw.2_Silent_p.L392L|ITGA10_uc010oyw.1_Silent_p.L480L	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor	535	Extracellular (Potential).|FG-GAP 6.				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TGCTGACCCTCCAAGGAACAC	0.532													43	175	---	---	---	---	PASS
S100A8	6279	broad.mit.edu	37	1	153362976	153362976	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153362976G>A	uc001fbs.2	-	2	91	c.36C>T	c.(34-36)ATC>ATT	p.I12I		NM_002964	NP_002955	P05109	S10A8_HUMAN	S100 calcium-binding protein A8	12	EF-hand 1.				chemotaxis	cytoplasm|cytoskeleton|plasma membrane	calcium ion binding|protein binding				0	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGACGTCGATGATAGAGTTCA	0.493													64	231	---	---	---	---	PASS
CCT3	7203	broad.mit.edu	37	1	156281973	156281973	+	Silent	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156281973C>G	uc001fol.1	-	11	1234	c.1014G>C	c.(1012-1014)CTG>CTC	p.L338L	CCT3_uc001fom.1_Silent_p.L337L|CCT3_uc001fon.1_Silent_p.L300L|CCT3_uc010phj.1_Silent_p.L292L|CCT3_uc010phk.1_Silent_p.L292L|CCT3_uc010phl.1_Silent_p.L292L	NM_005998	NP_005989	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 isoform a	338					'de novo' posttranslational protein folding	cytoskeleton|cytosol|plasma membrane	ATP binding|unfolded protein binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)					CATCTTCTCTCAGTTCCTCTG	0.478													31	78	---	---	---	---	PASS
NES	10763	broad.mit.edu	37	1	156647053	156647053	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156647053C>G	uc001fpq.2	-	1	137	c.4G>C	c.(4-6)GAG>CAG	p.E2Q		NM_006617	NP_006608	P48681	NEST_HUMAN	nestin	2	Head.				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ATGCAGCCCTCCATCCTGCTC	0.627													4	33	---	---	---	---	PASS
PVRL4	81607	broad.mit.edu	37	1	161047356	161047356	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161047356G>A	uc001fxo.2	-	3	916	c.617C>T	c.(616-618)TCA>TTA	p.S206L	PVRL4_uc010pjy.1_5'Flank|PVRL4_uc010pjz.1_5'Flank	NM_030916	NP_112178	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4 precursor	206	Ig-like C2-type 1.|Extracellular (Potential).				adherens junction organization|cell adhesion|cell junction assembly	adherens junction|extracellular region|integral to membrane				ovary(2)	2	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GTGGAACTCTGAGGTGACGGC	0.622													53	424	---	---	---	---	PASS
FMO2	2327	broad.mit.edu	37	1	171154946	171154946	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171154946G>C	uc001ghk.1	+	2	211	c.94G>C	c.(94-96)GAG>CAG	p.E32Q	FMO2_uc010pmd.1_Intron	NM_001460	NP_001451	Q99518	FMO2_HUMAN	flavin containing monooxygenase 2	32					drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CACTTGCTTTGAGAGAACTGA	0.463													43	157	---	---	---	---	PASS
C1orf9	51430	broad.mit.edu	37	1	172558229	172558229	+	Missense_Mutation	SNP	A	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172558229A>T	uc001giq.3	+	18	2304	c.1988A>T	c.(1987-1989)CAA>CTA	p.Q663L	C1orf9_uc010pmm.1_Missense_Mutation_p.Q663L|C1orf9_uc009wwd.2_Missense_Mutation_p.Q619L|C1orf9_uc010pmn.1_Intron|C1orf9_uc010pmo.1_RNA	NM_014283	NP_055098	Q9UBS9	OSPT_HUMAN	chromosome 1 open reading frame 9 protein	663					multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane				ovary(2)	2		Breast(1374;0.212)		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)		GTGTTAGCTCAACCACCCTTA	0.398													5	45	---	---	---	---	PASS
LAMC2	3918	broad.mit.edu	37	1	183209495	183209495	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183209495C>T	uc001gqa.2	+	22	3611	c.3297C>T	c.(3295-3297)CTC>CTT	p.L1099L	LAMC2_uc001gpz.3_Silent_p.L1099L|LAMC2_uc010poa.1_Silent_p.L799L	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor	1099	Domain II and I.				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						AAGACACACTCAACACATTAG	0.498													9	53	---	---	---	---	PASS
NVL	4931	broad.mit.edu	37	1	224492852	224492852	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224492852G>C	uc001hok.2	-	7	675	c.632C>G	c.(631-633)TCT>TGT	p.S211C	NVL_uc001hol.2_Missense_Mutation_p.S105C|NVL_uc010pvd.1_Missense_Mutation_p.S120C|NVL_uc010pve.1_5'UTR|NVL_uc010pvf.1_RNA	NM_002533	NP_002524	O15381	NVL_HUMAN	nuclear VCP-like isoform 1	211						aggresome|cytoplasm|nucleolus	ATP binding|nucleoside-triphosphatase activity			skin(2)	2				GBM - Glioblastoma multiforme(131;0.00501)		CTCCAAAAGAGAAGAATCTTT	0.318													29	60	---	---	---	---	PASS
SDCCAG8	10806	broad.mit.edu	37	1	243471361	243471361	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243471361C>G	uc001hzw.2	+	8	967	c.811C>G	c.(811-813)CTG>GTG	p.L271V	SDCCAG8_uc010pyk.1_Missense_Mutation_p.L126V|SDCCAG8_uc010pyl.1_Missense_Mutation_p.L83V|SDCCAG8_uc001hzx.2_Missense_Mutation_p.L83V	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	271	Potential.|Sufficient for homodimerization (By similarity).				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		AGAATTTCTTCTGGCTGCTAA	0.368													90	91	---	---	---	---	PASS
OR2T6	254879	broad.mit.edu	37	1	248551039	248551039	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248551039G>A	uc001iei.1	+	1	130	c.130G>A	c.(130-132)GTC>ATC	p.V44I		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	44	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGCTAATGGGGTCATGATCTT	0.468													20	82	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1652125	1652125	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1652125G>T	uc002qxa.2	-	17	3491	c.3427C>A	c.(3427-3429)CTG>ATG	p.L1143M		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	1143					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		ATGGAGAACAGCCGCTCCGTG	0.652													3	31	---	---	---	---	PASS
C2orf44	80304	broad.mit.edu	37	2	24253912	24253912	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24253912G>C	uc002rep.2	-	4	2188	c.2057C>G	c.(2056-2058)TCT>TGT	p.S686C	C2orf44_uc010eya.2_3'UTR	NM_025203	NP_079479	Q9H6R7	CB044_HUMAN	hypothetical protein LOC80304 isoform 1	686							protein binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGAGAAAAAGAGTCTCTGAA	0.473													14	64	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61415533	61415533	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61415533C>G	uc002sbe.2	-	80	10367	c.10345G>C	c.(10345-10347)GAA>CAA	p.E3449Q	USP34_uc002sbd.2_Missense_Mutation_p.E251Q	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	3449					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			TCTTTAAATTCTTTACAATCG	0.418													30	118	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61607465	61607465	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61607465G>A	uc002sbe.2	-	7	875	c.853C>T	c.(853-855)CGA>TGA	p.R285*		NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	285					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			GCACTCTGTCGTAACTCCTGA	0.368													8	74	---	---	---	---	PASS
MOGS	7841	broad.mit.edu	37	2	74690357	74690357	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74690357G>A	uc010ffj.2	-	3	899	c.736C>T	c.(736-738)CCA>TCA	p.P246S	MOGS_uc010ffh.2_5'UTR|MOGS_uc010yrt.1_Missense_Mutation_p.P127S|MOGS_uc010ffi.2_Missense_Mutation_p.P140S|MOGS_uc010yru.1_3'UTR	NM_006302	NP_006293	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase isoform 1	246	Lumenal (Potential).				oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|membrane fraction	mannosyl-oligosaccharide glucosidase activity				0						CTGGTTGGTGGCAAAAGTGTA	0.522													5	187	---	---	---	---	PASS
TANC1	85461	broad.mit.edu	37	2	160033027	160033027	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160033027C>A	uc002uag.2	+	13	2174	c.1900C>A	c.(1900-1902)CAG>AAG	p.Q634K	TANC1_uc010fol.1_Missense_Mutation_p.Q528K|TANC1_uc010zcm.1_Missense_Mutation_p.Q626K|TANC1_uc010fom.1_Missense_Mutation_p.Q440K|TANC1_uc002uai.1_RNA	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and	634						cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						AGCAAATTTTCAGGTAACAAA	0.323													16	55	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163279802	163279802	+	Intron	SNP	A	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163279802A>G	uc002uch.1	-						KCNH7_uc002uci.2_Missense_Mutation_p.I726T	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	GGCTATCACTATAATGCCTGC	0.418													4	162	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179616159	179616159	+	Silent	SNP	A	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179616159A>C	uc002unb.2	-	46	11192	c.10968T>G	c.(10966-10968)ACT>ACG	p.T3656T	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAAATGTATAGTTCTCATCA	0.348													6	121	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179622396	179622396	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179622396C>G	uc010zfi.1	-	44	10637	c.10413G>C	c.(10411-10413)GAG>GAC	p.E3471D	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc002unb.2_Intron	NM_133432	NP_597676	Q8WZ42	TITIN_HUMAN	titin isoform novex-1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCCTGTGGACTCCTCAAAAT	0.453													3	139	---	---	---	---	PASS
ITGA4	3676	broad.mit.edu	37	2	182359492	182359492	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182359492G>A	uc002unu.2	+	12	2055	c.1292G>A	c.(1291-1293)GGA>GAA	p.G431E		NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	431	FG-GAP 7.|Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	AGTATGTTTGGACAGTCTATA	0.308													5	148	---	---	---	---	PASS
ITGA4	3676	broad.mit.edu	37	2	182359515	182359515	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182359515G>A	uc002unu.2	+	12	2078	c.1315G>A	c.(1315-1317)GAT>AAT	p.D439N		NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	439	Potential.|FG-GAP 7.|Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	AGGACAAATTGATGCAGATAA	0.318													4	144	---	---	---	---	PASS
PMS1	5378	broad.mit.edu	37	2	190719590	190719590	+	Missense_Mutation	SNP	A	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190719590A>G	uc002urh.3	+	9	2121	c.1592A>G	c.(1591-1593)AAT>AGT	p.N531S	PMS1_uc010zga.1_Missense_Mutation_p.N492S|PMS1_uc010zgb.1_Missense_Mutation_p.N470S|PMS1_uc002urk.3_Missense_Mutation_p.N492S|PMS1_uc002uri.3_Missense_Mutation_p.N531S|PMS1_uc010zgc.1_Missense_Mutation_p.N355S|PMS1_uc010zgd.1_Missense_Mutation_p.N355S|PMS1_uc002urj.2_RNA|PMS1_uc010fry.1_Missense_Mutation_p.N492S|PMS1_uc010frz.2_Intron|PMS1_uc002url.2_Missense_Mutation_p.N316S|PMS1_uc002urm.2_RNA|PMS1_uc002urn.1_Missense_Mutation_p.N199S	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a	531					mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			GTAAGTAATAATAATTATCCA	0.284			Mis|N			colorectal|endometrial|ovarian		Direct_reversal_of_damage|MMR					33	33	---	---	---	---	PASS
SF3B1	23451	broad.mit.edu	37	2	198265453	198265453	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198265453C>T	uc002uue.2	-	18	2752	c.2704G>A	c.(2704-2706)GAA>AAA	p.E902K		NM_012433	NP_036565	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1 isoform 1	902					nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding			pancreas(3)|ovary(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GTAGTCTGTTCTTGGAAAGCA	0.318													87	37	---	---	---	---	PASS
SATB2	23314	broad.mit.edu	37	2	200137185	200137185	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200137185G>A	uc002uuy.1	-	11	2768	c.1951C>T	c.(1951-1953)CAG>TAG	p.Q651*	SATB2_uc010fsq.1_Nonsense_Mutation_p.Q533*|SATB2_uc002uuz.1_Nonsense_Mutation_p.Q651*|SATB2_uc002uva.1_Nonsense_Mutation_p.Q651*	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	651	Homeobox.					cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						AGATCCAGCTGAGCCGAAAGA	0.542													20	108	---	---	---	---	PASS
VIL1	7429	broad.mit.edu	37	2	219290520	219290520	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219290520C>T	uc002via.2	+	4	398	c.333C>T	c.(331-333)TTC>TTT	p.F111F	VIL1_uc010zke.1_Intron|VIL1_uc002vib.2_Silent_p.F111F|VIL1_uc002vic.1_Silent_p.F111F	NM_007127	NP_009058	P09327	VILI_HUMAN	villin 1	111	Core.|Necessary for homodimerization.				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAGGCTACTTCAAGCAAGGCC	0.612													39	30	---	---	---	---	PASS
SLC23A3	151295	broad.mit.edu	37	2	220034109	220034109	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220034109G>C	uc010zks.1	-	3	451	c.340C>G	c.(340-342)CCA>GCA	p.P114A	NHEJ1_uc002vjq.3_RNA|SLC23A3_uc010zkr.1_Missense_Mutation_p.P114A|SLC23A3_uc010fwb.2_Missense_Mutation_p.P114A|SLC23A3_uc002vjs.1_5'Flank|SLC23A3_uc002vjt.1_5'UTR	NM_001144889	NP_001138361	Q6PIS1	S23A3_HUMAN	solute carrier family 23 (nucleobase	114	Cytoplasmic (Potential).				transmembrane transport	integral to membrane	protein binding|transporter activity				0		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCTAAGGATGGAGCCTGGACA	0.597													93	60	---	---	---	---	PASS
OBSL1	23363	broad.mit.edu	37	2	220422740	220422740	+	Missense_Mutation	SNP	G	A	A	rs143517287	by1000genomes	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220422740G>A	uc010fwk.2	-	11	3652	c.3595C>T	c.(3595-3597)CGG>TGG	p.R1199W	OBSL1_uc002vmh.1_Missense_Mutation_p.R190W|OBSL1_uc010zli.1_Missense_Mutation_p.R98W|OBSL1_uc010fwl.1_Missense_Mutation_p.R674W	NM_015311	NP_056126	O75147	OBSL1_HUMAN	obscurin-like 1	1199	Ig-like 10.				cardiac myofibril assembly	intercalated disc|M band|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity				0		Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		GCGCCAGCCCGGGACAGTTCA	0.667													11	15	---	---	---	---	PASS
UGT1A5	54579	broad.mit.edu	37	2	234656632	234656632	+	Intron	SNP	A	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234656632A>C	uc002vuw.2	+						UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron|UGT1A9_uc002vva.2_RNA	NM_019078	NP_061951	P35504	UD15_HUMAN	UDP glycosyltransferase 1 family, polypeptide A5						xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		GGCTGTTCCGAGGGGACTTTG	0.532													51	185	---	---	---	---	PASS
CAPN10	11132	broad.mit.edu	37	2	241536312	241536312	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241536312C>T	uc002vzk.1	+	9	1880	c.1696C>T	c.(1696-1698)CGG>TGG	p.R566W	CAPN10_uc002vzl.1_Intron|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_Missense_Mutation_p.R438W|CAPN10_uc002vzo.1_RNA|CAPN10_uc010fzg.1_Intron|CAPN10_uc002vzp.1_RNA|CAPN10_uc002vzq.1_Intron	NM_023083	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10 isoform a	566	Domain III 2.				actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		TCAGCACTGCCGGCCCAGTGA	0.647													27	25	---	---	---	---	PASS
CNTN6	27255	broad.mit.edu	37	3	1363500	1363500	+	Missense_Mutation	SNP	G	T	T	rs149799168	byFrequency	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1363500G>T	uc003boz.2	+	8	1195	c.928G>T	c.(928-930)GGT>TGT	p.G310C	CNTN6_uc011asj.1_Missense_Mutation_p.G238C|CNTN6_uc003bpa.2_Missense_Mutation_p.G310C	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	310					axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CCTTGCAAAGGGTCAACTCAT	0.358													21	98	---	---	---	---	PASS
EFHB	151651	broad.mit.edu	37	3	19938244	19938244	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19938244G>A	uc003cbl.3	-	9	1856	c.1660C>T	c.(1660-1662)CAC>TAC	p.H554Y	EFHB_uc003cbm.2_Missense_Mutation_p.H424Y	NM_144715	NP_653316	Q8N7U6	EFHB_HUMAN	EF hand domain family, member B	554					signal transduction	proteinaceous extracellular matrix	calcium ion binding				0						TTCTTCAGGTGATGCCGAACT	0.458													36	72	---	---	---	---	PASS
RAB5A	5868	broad.mit.edu	37	3	20019815	20019815	+	Missense_Mutation	SNP	A	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20019815A>C	uc003cbn.2	+	5	987	c.452A>C	c.(451-453)TAT>TCT	p.Y151S	RAB5A_uc010hey.2_RNA|RAB5A_uc011awg.1_Missense_Mutation_p.Y137S	NM_004162	NP_004153	P20339	RAB5A_HUMAN	RAB5A, member RAS oncogene family	151					blood coagulation|protein transport|receptor internalization|regulation of filopodium assembly|small GTPase mediated signal transduction	early endosome membrane|melanosome|plasma membrane	GDP binding|GTP binding|GTPase activity				0						GCACAGTCCTATGCAGATGAC	0.308													58	102	---	---	---	---	PASS
QARS	5859	broad.mit.edu	37	3	49135633	49135633	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49135633G>A	uc003cvx.2	-	22	2148	c.2143C>T	c.(2143-2145)CTG>TTG	p.L715L	QARS_uc011bcc.1_Silent_p.L168L|QARS_uc011bcd.1_Silent_p.L570L|QARS_uc003cvy.2_Silent_p.L570L|QARS_uc011bce.1_Silent_p.L704L	NM_005051	NP_005042	P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	715					glutaminyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|glutamine-tRNA ligase activity|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	ACCAGGTTCAGGTCACTTAAA	0.552													15	130	---	---	---	---	PASS
MST1	4485	broad.mit.edu	37	3	49721756	49721756	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49721756C>T	uc003cxg.2	-	17	2079	c.2007G>A	c.(2005-2007)GGG>GGA	p.G669G		NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	655	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCTCACAGGCCCCCACAGGGG	0.567													56	62	---	---	---	---	PASS
RNF123	63891	broad.mit.edu	37	3	49736242	49736242	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49736242C>G	uc003cxh.2	+	9	711	c.625C>G	c.(625-627)CTG>GTG	p.L209V	RNF123_uc010hky.1_5'Flank|RNF123_uc003cxi.2_5'Flank	NM_022064	NP_071347	Q5XPI4	RN123_HUMAN	ring finger protein 123	209	B30.2/SPRY.					cytoplasm	ligase activity|protein binding|zinc ion binding			kidney(3)|ovary(1)|lung(1)|breast(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		TGATGGCACTCTGTCCTTCTG	0.632													34	44	---	---	---	---	PASS
AMIGO3	386724	broad.mit.edu	37	3	49756064	49756064	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49756064G>C	uc003cxj.2	-	1	1175	c.835C>G	c.(835-837)CTT>GTT	p.L279V	RNF123_uc003cxh.2_Intron|RNF123_uc003cxi.2_Intron	NM_198722	NP_942015	Q86WK7	AMGO3_HUMAN	adhesion molecule with Ig-like domain 3	279	Extracellular (Potential).|Ig-like C2-type.				heterophilic cell-cell adhesion	integral to membrane				pancreas(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TCTAGGCCAAGAGCTGGGGCC	0.647													26	34	---	---	---	---	PASS
GNAT1	2779	broad.mit.edu	37	3	50231195	50231195	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50231195C>T	uc003cym.2	+	5	575	c.459C>T	c.(457-459)TCC>TCT	p.S153S	GNAT1_uc003cyl.2_Silent_p.S153S	NM_144499	NP_653082	P11488	GNAT1_HUMAN	rod-type transducin alpha subunit	153					detection of chemical stimulus involved in sensory perception of bitter taste|G-protein signaling, coupled to cAMP nucleotide second messenger|negative regulation of cyclic-nucleotide phosphodiesterase activity|rhodopsin mediated phototransduction|sensory perception of umami taste	heterotrimeric G-protein complex|photoreceptor inner segment|photoreceptor outer segment membrane	acyl binding|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GDP binding|GTP binding|GTPase activity|protein kinase binding|signal transducer activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GCTACCTCTCCGACCTGGAGC	0.512													7	16	---	---	---	---	PASS
CACNA2D2	9254	broad.mit.edu	37	3	50402325	50402325	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50402325G>T	uc003daq.2	-	38	3344	c.3306C>A	c.(3304-3306)AAC>AAA	p.N1102K	CACNA2D2_uc003dap.2_Missense_Mutation_p.N1095K|CACNA2D2_uc003dao.2_Missense_Mutation_p.N175K	NM_006030	NP_006021	Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha	1102	Extracellular (Potential).				energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)	TCACTGTCGCGTTGTAGTCGA	0.592													19	25	---	---	---	---	PASS
HEG1	57493	broad.mit.edu	37	3	124748215	124748215	+	Missense_Mutation	SNP	T	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124748215T>C	uc003ehs.3	-	2	502	c.434A>G	c.(433-435)CAG>CGG	p.Q145R	HEG1_uc011bke.1_Missense_Mutation_p.Q145R	NM_020733	NP_065784	Q9ULI3	HEG1_HUMAN	HEG homolog 1 precursor	145	Extracellular (Potential).					extracellular region|integral to membrane	calcium ion binding			ovary(2)	2						CCCAGAGGTCTGAACCATCAC	0.493													3	109	---	---	---	---	PASS
PLSCR4	57088	broad.mit.edu	37	3	145917695	145917695	+	Missense_Mutation	SNP	G	A	A	rs34036393		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145917695G>A	uc010huy.2	-	6	858	c.529C>T	c.(529-531)CGG>TGG	p.R177W	PLSCR4_uc010huz.2_Missense_Mutation_p.R177W|PLSCR4_uc003evt.3_Missense_Mutation_p.R177W|PLSCR4_uc010hva.2_Intron|PLSCR4_uc003evu.3_Intron	NM_001128305	NP_001121777	Q9NRQ2	PLS4_HUMAN	phospholipid scramblase 4 isoform a	177	Cytoplasmic (By similarity).				blood coagulation|phospholipid scrambling	integral to membrane	calcium ion binding|phospholipid scramblase activity|SH3 domain binding				0						TCAGTGACCCGGAGGACGAAG	0.483													6	71	---	---	---	---	PASS
ECE2	9718	broad.mit.edu	37	3	184009213	184009213	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184009213G>A	uc003fni.3	+	18	2499	c.2461G>A	c.(2461-2463)GTG>ATG	p.V821M	ECE2_uc011brh.1_3'UTR|ECE2_uc003fnl.3_Missense_Mutation_p.V749M|ECE2_uc003fnm.3_Missense_Mutation_p.V703M|ECE2_uc003fnk.3_Missense_Mutation_p.V674M|ECE2_uc011bri.1_Missense_Mutation_p.V736M	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A	821	Lumenal (Potential).|Endothelin-converting enzyme 2 region.				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCTCTTCTTCGTGGGATTTGC	0.587													21	85	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195477929	195477929	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195477929C>T	uc011bto.1	-	24	15778	c.15318G>A	c.(15316-15318)TCG>TCA	p.S5106S	MUC4_uc010hzq.2_Silent_p.S91S|MUC4_uc003fuz.2_Silent_p.S832S|MUC4_uc003fva.2_Silent_p.S714S|MUC4_uc003fvb.2_Silent_p.S750S|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_Silent_p.S750S|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_Silent_p.S714S|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_Silent_p.S798S|MUC4_uc011bti.1_Silent_p.S798S|MUC4_uc011btj.1_Silent_p.S975S|MUC4_uc011btk.1_Silent_p.S714S|MUC4_uc011btl.1_Silent_p.S743S|MUC4_uc011btm.1_Silent_p.S923S|MUC4_uc011btn.1_Silent_p.S714S|MUC4_uc003fvo.2_Silent_p.S998S|MUC4_uc003fvp.2_Silent_p.S947S	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1991					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGGAACTCCGAGATGACCA	0.652													11	91	---	---	---	---	PASS
POLN	353497	broad.mit.edu	37	4	2130948	2130948	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2130948C>A	uc003ger.2	-	16	1825	c.1825G>T	c.(1825-1827)GCC>TCC	p.A609S	POLN_uc010icg.1_Missense_Mutation_p.A57S|POLN_uc010ich.1_Missense_Mutation_p.A141S	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu	609					DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			ACAAACATGGCCCTCGGGGAG	0.403								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					37	61	---	---	---	---	PASS
NOP14	8602	broad.mit.edu	37	4	2943228	2943228	+	Intron	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2943228G>A	uc003ggj.1	-						C4orf10_uc003ggd.1_RNA|C4orf10_uc003gge.1_Intron|C4orf10_uc003ggg.1_RNA|C4orf10_uc003ggh.2_Intron|C4orf10_uc003ggi.1_Intron|NOP14_uc010icp.2_Intron|NOP14_uc003ggk.3_Intron|NOP14_uc003ggl.2_Intron	NM_003703	NP_003694	P78316	NOP14_HUMAN	probable nucleolar complex protein 14						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding			pancreas(1)	1						AGCATCAAATGACTGACTGCC	0.552													6	2	---	---	---	---	PASS
HGFAC	3083	broad.mit.edu	37	4	3451002	3451002	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3451002C>T	uc003ghc.2	+	14	1827	c.1824C>T	c.(1822-1824)GGC>GGT	p.G608G	HGFAC_uc010icw.2_Silent_p.G615G	NM_001528	NP_001519	Q04756	HGFA_HUMAN	HGF activator preproprotein	608	Peptidase S1.				proteolysis	extracellular space	protein binding|serine-type endopeptidase activity			central_nervous_system(2)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		AGAAGAACGGCGTGGCTTACC	0.677													32	70	---	---	---	---	PASS
CNGA1	1259	broad.mit.edu	37	4	47939675	47939675	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47939675G>A	uc003gxt.3	-	11	1102	c.836C>T	c.(835-837)TCT>TTT	p.S279F	uc003gxr.1_Intron|CNGA1_uc003gxu.2_Missense_Mutation_p.S348F	NM_000087	NP_000078	P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1 isoform	279	Extracellular (Potential).				response to stimulus|visual perception	integral to plasma membrane	cGMP binding|ion channel activity			ovary(2)	2						AAACATACGAGAGAACCGTAA	0.358													37	78	---	---	---	---	PASS
AASDH	132949	broad.mit.edu	37	4	57220797	57220797	+	Intron	SNP	C	T	T	rs76654050		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57220797C>T	uc003hbn.2	-						AASDH_uc010ihb.2_5'UTR|AASDH_uc011caa.1_Intron|AASDH_uc003hbo.2_Intron|AASDH_uc011cab.1_Intron|AASDH_uc010ihc.2_Intron|AASDH_uc003hbp.2_Intron	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase						fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				AAGAAAAAGACGAAAGGAATA	0.264													11	33	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66201800	66201800	+	Missense_Mutation	SNP	A	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66201800A>T	uc003hcy.2	-	16	2895	c.2702T>A	c.(2701-2703)ATG>AAG	p.M901K	EPHA5_uc003hcx.2_Missense_Mutation_p.M833K|EPHA5_uc003hcz.2_Missense_Mutation_p.M879K|EPHA5_uc011cah.1_Missense_Mutation_p.M902K|EPHA5_uc011cai.1_Missense_Mutation_p.M880K|EPHA5_uc003hda.2_Missense_Mutation_p.M902K	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	901	Cytoplasmic (Potential).|Protein kinase.				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						AGGACAATCCATGGGGCTTGG	0.448										TSP Lung(17;0.13)			4	66	---	---	---	---	PASS
USO1	8615	broad.mit.edu	37	4	76692248	76692248	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76692248G>C	uc003hiu.2	+	6	688	c.513G>C	c.(511-513)TTG>TTC	p.L171F	USO1_uc003hiv.2_Missense_Mutation_p.L6F|USO1_uc003hiw.2_Missense_Mutation_p.L6F	NM_003715	NP_003706	O60763	USO1_HUMAN	USO1 homolog, vesicle docking protein	171	Globular head.|ARM 3.				intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTTCAAGATTGATGGACTTAC	0.308													11	34	---	---	---	---	PASS
BMP2K	55589	broad.mit.edu	37	4	79763561	79763561	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79763561G>T	uc003hlk.2	+	4	592	c.426G>T	c.(424-426)ATG>ATT	p.M142I	BMP2K_uc010ijl.1_RNA|BMP2K_uc003hlj.2_Missense_Mutation_p.M142I	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN	BMP-2 inducible kinase isoform a	142	Protein kinase.					nucleus	ATP binding|protein serine/threonine kinase activity			lung(1)	1						TGAATCAAATGAATAAGAAGC	0.343													7	45	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114251495	114251495	+	Silent	SNP	T	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114251495T>C	uc003ibe.3	+	27	3094	c.2994T>C	c.(2992-2994)TGT>TGC	p.C998C	ANK2_uc003ibd.3_Silent_p.C989C|ANK2_uc003ibf.3_Silent_p.C998C|ANK2_uc011cgc.1_Silent_p.C207C|ANK2_uc003ibg.3_Silent_p.C26C|ANK2_uc003ibc.2_Silent_p.C974C|ANK2_uc011cgb.1_Silent_p.C1013C	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	998	ZU5.|Interaction with SPTBN1.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTCGGAAATGTACTGCTCCAA	0.537													5	60	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155160322	155160322	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155160322C>T	uc003inw.2	-	24	6127	c.6127G>A	c.(6127-6129)GGC>AGC	p.G2043S		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	2043	Cadherin 18.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AATAACTCACCATTCTTAGGA	0.368													6	45	---	---	---	---	PASS
GUCY1A3	2982	broad.mit.edu	37	4	156634276	156634276	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156634276C>G	uc003iov.2	+	8	1649	c.1113C>G	c.(1111-1113)ATC>ATG	p.I371M	GUCY1A3_uc010iqc.2_Missense_Mutation_p.I371M|GUCY1A3_uc003iow.2_Missense_Mutation_p.I371M|GUCY1A3_uc010iqd.2_Missense_Mutation_p.I370M|GUCY1A3_uc003iox.2_Missense_Mutation_p.I371M|GUCY1A3_uc003ioz.2_Missense_Mutation_p.I136M|GUCY1A3_uc003ioy.2_Missense_Mutation_p.I371M|GUCY1A3_uc010iqe.2_Missense_Mutation_p.I136M|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Missense_Mutation_p.I371M	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A	371					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GCCAAATGATCTACATTGTTG	0.423													28	68	---	---	---	---	PASS
MARCH1	55016	broad.mit.edu	37	4	164534483	164534483	+	Silent	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164534483G>T	uc003iqs.1	-	5	1202	c.225C>A	c.(223-225)TCC>TCA	p.S75S	MARCH1_uc003iqr.1_Silent_p.S58S	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I	75	RING-CH-type.				antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TGTCCTGAGTGGATGGACAGA	0.418													24	91	---	---	---	---	PASS
FBXO8	26269	broad.mit.edu	37	4	175158643	175158643	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175158643G>A	uc003itp.2	-	6	1730	c.880C>T	c.(880-882)CGC>TGC	p.R294C	FBXO8_uc003itq.2_Missense_Mutation_p.R253C	NM_012180	NP_036312	Q9NRD0	FBX8_HUMAN	F-box only protein 8	294					regulation of ARF protein signal transduction|ubiquitin-dependent protein catabolic process	cytoplasm|ubiquitin ligase complex	ARF guanyl-nucleotide exchange factor activity			breast(2)	2		Prostate(90;0.00201)|Melanoma(52;0.012)|Renal(120;0.0183)|all_neural(102;0.0887)|all_hematologic(60;0.107)		all cancers(43;7.29e-18)|Epithelial(43;1.85e-15)|OV - Ovarian serous cystadenocarcinoma(60;5.62e-09)|GBM - Glioblastoma multiforme(59;0.00115)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.1)		TGAGCAGCGCGACGGGTATTT	0.383													19	54	---	---	---	---	PASS
HELT	391723	broad.mit.edu	37	4	185941788	185941788	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185941788G>A	uc011ckq.1	+	4	846	c.846G>A	c.(844-846)CCG>CCA	p.P282P	HELT_uc011cko.1_Silent_p.P197P|HELT_uc003ixa.3_Silent_p.P196P|HELT_uc011ckp.1_Silent_p.P140P	NM_001029887	NP_001025058	A6NFD8	HELT_HUMAN	HES/HEY-like transcription factor	282	Pro-rich.						DNA binding				0		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;8.92e-26)|Epithelial(43;3.02e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-11)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		CGCCAGTGCCGCTCGCTAGCC	0.741													4	32	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13865842	13865842	+	Silent	SNP	A	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13865842A>G	uc003jfd.2	-	27	4332	c.4290T>C	c.(4288-4290)TAT>TAC	p.Y1430Y		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1430	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AAAGAATATCATAATAGCTAT	0.313									Kartagener_syndrome				15	114	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32090257	32090257	+	Missense_Mutation	SNP	C	T	T	rs147353592		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32090257C>T	uc003jhl.2	+	20	7091	c.6703C>T	c.(6703-6705)CGG>TGG	p.R2235W	PDZD2_uc003jhm.2_Missense_Mutation_p.R2235W	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	2235					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CCATTTTGGACGGGAGGGTCA	0.632													10	612	---	---	---	---	PASS
MAST4	375449	broad.mit.edu	37	5	66462291	66462291	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66462291G>A	uc003jut.1	+	28	6785	c.6717G>A	c.(6715-6717)CCG>CCA	p.P2239P	MAST4_uc003juw.2_Silent_p.P2167P|MAST4_uc003jux.2_5'UTR	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	2431						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		AGAAGCCACCGACGGAGGCAG	0.652											OREG0016638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	4	---	---	---	---	PASS
SNCAIP	9627	broad.mit.edu	37	5	121786336	121786336	+	Silent	SNP	T	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121786336T>A	uc003ksw.1	+	10	2000	c.1794T>A	c.(1792-1794)CTT>CTA	p.L598L	SNCAIP_uc011cwl.1_Silent_p.L156L|SNCAIP_uc003ksx.1_Silent_p.L645L|SNCAIP_uc003ksy.1_Silent_p.L232L|SNCAIP_uc003ksz.1_Silent_p.L232L|SNCAIP_uc010jcu.2_Silent_p.L194L|SNCAIP_uc011cwm.1_Silent_p.L232L|SNCAIP_uc003kta.1_Silent_p.L230L|SNCAIP_uc010jcv.1_RNA|SNCAIP_uc010jcw.1_Silent_p.L292L|SNCAIP_uc010jcx.1_Silent_p.L538L|uc003ktb.1_RNA|SNCAIP_uc003ktc.1_Silent_p.L114L	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein	598					cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		TTCAGGTTCTTGGAAGCCTGT	0.478													5	144	---	---	---	---	PASS
PDLIM4	8572	broad.mit.edu	37	5	131607548	131607548	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131607548G>A	uc003kwn.2	+	6	812	c.735G>A	c.(733-735)CCG>CCA	p.P245P	uc003kwm.3_Intron|PDLIM4_uc003kwp.2_Intron|PDLIM4_uc003kwo.2_Silent_p.P353P	NM_003687	NP_003678	P50479	PDLI4_HUMAN	PDZ and LIM domain 4 isoform 1	245							protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGGGCGCTCCGCTGAGCGGCC	0.726													8	21	---	---	---	---	PASS
SEC24A	10802	broad.mit.edu	37	5	134041037	134041037	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134041037C>A	uc003kzs.2	+	17	2749	c.2461C>A	c.(2461-2463)CAT>AAT	p.H821N	SEC24A_uc011cxu.1_Missense_Mutation_p.H585N	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A	821					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AATTCGTGTTCATACTTTGTG	0.373													56	112	---	---	---	---	PASS
SEC24A	10802	broad.mit.edu	37	5	134041067	134041067	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134041067C>T	uc003kzs.2	+	17	2779	c.2491C>T	c.(2491-2493)CTG>TTG	p.L831L	SEC24A_uc011cxu.1_Silent_p.L595L	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A	831					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGTTTCGACTCTGAATGATGT	0.358													61	128	---	---	---	---	PASS
PCDHB1	29930	broad.mit.edu	37	5	140432966	140432966	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140432966G>T	uc003lik.1	+	1	1988	c.1911G>T	c.(1909-1911)ATG>ATT	p.M637I		NM_013340	NP_037472	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1 precursor	637	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGACCCCATGATGCAGAAAT	0.433													8	274	---	---	---	---	PASS
PCDHGA1	56114	broad.mit.edu	37	5	140712541	140712541	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140712541C>T	uc003lji.1	+	1	2290	c.2290C>T	c.(2290-2292)CGG>TGG	p.R764W	PCDHGA1_uc011dan.1_Missense_Mutation_p.R764W	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	764	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCGGACTCGCGGAAGAGCCA	0.582													7	222	---	---	---	---	PASS
PCDHGB2	56103	broad.mit.edu	37	5	140741617	140741617	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140741617C>T	uc003ljs.1	+	1	1915	c.1915C>T	c.(1915-1917)CGC>TGC	p.R639C	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Missense_Mutation_p.R639C|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	639	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACGCGGCCCGCCAGCGCCT	0.682													11	20	---	---	---	---	PASS
GPR151	134391	broad.mit.edu	37	5	145895383	145895383	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145895383C>T	uc003lod.1	-	1	294	c.294G>A	c.(292-294)GCG>GCA	p.A98A		NM_194251	NP_919227	Q8TDV0	GP151_HUMAN	G protein-coupled receptor 151	98	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTTTGGAGTACGCCGTAGCTC	0.512													31	99	---	---	---	---	PASS
ODZ2	57451	broad.mit.edu	37	5	167689593	167689593	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167689593G>C	uc010jjd.2	+	29	8076	c.8076G>C	c.(8074-8076)CAG>CAC	p.Q2692H	ODZ2_uc003lzr.3_Missense_Mutation_p.Q2462H|ODZ2_uc003lzt.3_Missense_Mutation_p.Q2065H|ODZ2_uc010jje.2_Missense_Mutation_p.Q1956H	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		AGGCGAGACAGAGGGCCCTGG	0.657													3	6	---	---	---	---	PASS
FGFR4	2264	broad.mit.edu	37	5	176522356	176522356	+	Silent	SNP	C	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176522356C>A	uc003mfl.2	+	12	1712	c.1545C>A	c.(1543-1545)GCC>GCA	p.A515A	FGFR4_uc003mfm.2_Silent_p.A515A|FGFR4_uc011dfu.1_Silent_p.A447A|FGFR4_uc003mfo.2_Silent_p.A475A	NM_002011	NP_002002	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4 isoform 1	515	Protein kinase.|Cytoplasmic (Potential).				insulin receptor signaling pathway|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity			lung(11)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|prostate(1)	16	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)	AGGACCTGGCCGACCTGGTCT	0.562										TSP Lung(9;0.080)			4	118	---	---	---	---	PASS
RIPK1	8737	broad.mit.edu	37	6	3104493	3104493	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3104493G>C	uc010jni.2	+	8	1182	c.950G>C	c.(949-951)AGA>ACA	p.R317T	RIPK1_uc003muv.3_Missense_Mutation_p.R154T|RIPK1_uc003muw.3_Missense_Mutation_p.R252T|RIPK1_uc011dhs.1_Missense_Mutation_p.R271T|RIPK1_uc003mux.2_Missense_Mutation_p.R317T	NM_003804	NP_003795	Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine	317	Interaction with SQSTM1.				activation of caspase activity|activation of JUN kinase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of necroptosis by extracellular signals|innate immune response|MyD88-independent toll-like receptor signaling pathway|positive regulation of anti-apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|protein autophosphorylation|regulation of ATP:ADP antiporter activity|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|death-inducing signaling complex|endosome membrane|mitochondrion|receptor complex	ATP binding|death domain binding|death receptor binding|protein serine/threonine kinase activity			large_intestine(3)|lung(1)|skin(1)	5	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				GTTGTGAAGAGAATGCAGTCT	0.338													56	51	---	---	---	---	PASS
FAM50B	26240	broad.mit.edu	37	6	3850910	3850910	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3850910G>A	uc003mvu.2	+	2	977	c.865G>A	c.(865-867)GCG>ACG	p.A289T		NM_012135	NP_036267	Q9Y247	FA50B_HUMAN	family with sequence similarity 50, member B	289						nucleus				pancreas(1)	1	Ovarian(93;0.0925)	all_hematologic(90;0.108)				CGAGTCGCACGCGGGCAAGGT	0.642													23	56	---	---	---	---	PASS
NUP153	9972	broad.mit.edu	37	6	17675597	17675597	+	Missense_Mutation	SNP	T	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17675597T>C	uc003ncd.1	-	4	786	c.586A>G	c.(586-588)ATA>GTA	p.I196V	NUP153_uc011dje.1_Missense_Mutation_p.I196V|NUP153_uc010jpl.1_Missense_Mutation_p.I196V	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	196					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			GAAACAGTTATATCTGAAACA	0.353													16	52	---	---	---	---	PASS
HIST1H3F	8968	broad.mit.edu	37	6	26250692	26250692	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26250692C>T	uc003nhg.1	-	1	144	c.142G>A	c.(142-144)GCC>ACC	p.A48T	HIST1H2BH_uc003nhh.2_5'Flank	NM_021018	NP_066298	P68431	H31_HUMAN	histone cluster 1, H3f	48					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0						TCACGGAGGGCGACAGTACCA	0.607													21	134	---	---	---	---	PASS
TRIM26	7726	broad.mit.edu	37	6	30154266	30154266	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30154266G>A	uc003npr.2	-	9	1216	c.1007C>T	c.(1006-1008)ACC>ATC	p.T336I	TRIM26_uc003nps.2_Missense_Mutation_p.T336I|TRIM26_uc010jry.2_Missense_Mutation_p.T66I|TRIM26_uc003npt.2_Missense_Mutation_p.T336I	NM_003449	NP_003440	Q12899	TRI26_HUMAN	tripartite motif-containing 26	336	B30.2/SPRY.						DNA binding|zinc ion binding			ovary(2)|lung(1)	3						GCTGGTGTAGGTCACGCACTT	0.577													4	87	---	---	---	---	PASS
NOTCH4	4855	broad.mit.edu	37	6	32169171	32169171	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32169171C>T	uc003obb.2	-	22	4001	c.3862G>A	c.(3862-3864)GAT>AAT	p.D1288N	NOTCH4_uc003oba.2_5'UTR|NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA	NM_004557	NP_004548	Q99466	NOTC4_HUMAN	notch4 preproprotein	1288	LNR 3.|Extracellular (Potential).				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity			lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						GGGTCCCCATCTTCAGGCCTG	0.627													20	45	---	---	---	---	PASS
TRERF1	55809	broad.mit.edu	37	6	42236137	42236137	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42236137G>A	uc003osd.2	-	5	1755	c.1192C>T	c.(1192-1194)CAG>TAG	p.Q398*	TRERF1_uc011duq.1_Nonsense_Mutation_p.Q398*|TRERF1_uc003osb.2_Nonsense_Mutation_p.Q237*|TRERF1_uc003osc.2_Nonsense_Mutation_p.Q237*|TRERF1_uc003ose.2_Nonsense_Mutation_p.Q398*	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	398	Gln-rich.				cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGCTGGTGCTGGGACAGGTGG	0.627													106	103	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43412531	43412531	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43412531C>T	uc003ouy.1	+	13	2910	c.2695C>T	c.(2695-2697)CGG>TGG	p.R899W	ABCC10_uc003ouz.1_Missense_Mutation_p.R871W|ABCC10_uc010jyo.1_Missense_Mutation_p.R5W	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	899	ABC transmembrane type-1 2.					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CCCAGCCACGCGGAACGCTGC	0.587													6	325	---	---	---	---	PASS
XPO5	57510	broad.mit.edu	37	6	43538336	43538336	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43538336C>A	uc003ovp.2	-	5	735	c.524G>T	c.(523-525)AGA>ATA	p.R175I		NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5	175					gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			GATGTCCCTTCTTCTTTGAGG	0.403													73	355	---	---	---	---	PASS
TFAP2D	83741	broad.mit.edu	37	6	50681755	50681755	+	5'UTR	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50681755C>T	uc003paf.2	+	1					TFAP2D_uc011dwt.1_RNA	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1								DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|breast(1)	7	Lung NSC(77;0.0334)					CGTAAGCTTTCGGAGAAACCC	0.353													18	133	---	---	---	---	PASS
LMBRD1	55788	broad.mit.edu	37	6	70386010	70386010	+	3'UTR	SNP	T	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70386010T>A	uc003pfa.2	-	16					LMBRD1_uc003pey.2_3'UTR|LMBRD1_uc003pez.2_3'UTR|LMBRD1_uc010kal.2_3'UTR|LMBRD1_uc003pfb.2_RNA	NM_018368	NP_060838	Q9NUN5	LMBD1_HUMAN	liver regeneration p-53 related protein						interspecies interaction between organisms|transport	integral to membrane|lysosomal membrane	cobalamin binding			ovary(1)	1						GCATAACAGATATTCAGTCAG	0.328													10	21	---	---	---	---	PASS
C6orf204	387119	broad.mit.edu	37	6	118786546	118786546	+	3'UTR	SNP	T	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118786546T>C	uc003pxz.1	-	13						NM_001042475	NP_001035940	Q5SZL2	CF204_HUMAN	chromosome 6 open reading frame 204 isoform a							centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)		CAGGTCATTATTGCTGTGGGA	0.403													66	96	---	---	---	---	PASS
MCM9	254394	broad.mit.edu	37	6	119232920	119232920	+	Silent	SNP	A	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119232920A>G	uc003pyh.2	-	7	1308	c.1045T>C	c.(1045-1047)TTA>CTA	p.L349L		NM_153255	NP_694987	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	349	MCM.				DNA replication		ATP binding|DNA binding|nucleoside-triphosphatase activity			ovary(1)	1		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		CCAACCAATAAAAGATGAGAT	0.368													31	50	---	---	---	---	PASS
PTPRK	5796	broad.mit.edu	37	6	128411080	128411080	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128411080G>A	uc003qbk.2	-	8	1587	c.1220C>T	c.(1219-1221)GCT>GTT	p.A407V	PTPRK_uc003qbj.2_Missense_Mutation_p.A407V|PTPRK_uc010kfc.2_Missense_Mutation_p.A407V|PTPRK_uc011ebu.1_Missense_Mutation_p.A407V|PTPRK_uc003qbl.1_Missense_Mutation_p.A277V|PTPRK_uc011ebv.1_Missense_Mutation_p.A407V	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	407	Extracellular (Potential).|Fibronectin type-III 2.				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CCAGTCCACAGCAATCCGTCT	0.418													9	78	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146350852	146350852	+	Missense_Mutation	SNP	T	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146350852T>A	uc010khw.1	+	2	669	c.199T>A	c.(199-201)TGT>AGT	p.C67S	GRM1_uc010khu.1_Missense_Mutation_p.C67S|GRM1_uc010khv.1_Missense_Mutation_p.C67S|GRM1_uc003qll.2_Missense_Mutation_p.C67S|GRM1_uc011edz.1_Missense_Mutation_p.C67S|GRM1_uc011eea.1_Missense_Mutation_p.C67S	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	67	Extracellular (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	CGAGAGGAAGTGTGGGGAGAT	0.592													3	74	---	---	---	---	PASS
C7orf27	221927	broad.mit.edu	37	7	2586960	2586960	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2586960G>A	uc003smi.2	-	3	322	c.280C>T	c.(280-282)CAG>TAG	p.Q94*	C7orf27_uc003smj.1_Nonsense_Mutation_p.Q94*	NM_152743	NP_689956	Q6PJG6	BRAT1_HUMAN	hypothetical protein LOC221927 precursor	94					response to ionizing radiation	nucleus	protein binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;2.91e-14)		AGGCTCACCTGAAGATACTGG	0.602													31	66	---	---	---	---	PASS
SDK1	221935	broad.mit.edu	37	7	3681698	3681698	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3681698G>C	uc003smx.2	+	4	813	c.674G>C	c.(673-675)TGG>TCG	p.W225S		NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	225	Ig-like C2-type 2.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CAAGTGACTTGGTTTAGAGAA	0.448													4	148	---	---	---	---	PASS
RADIL	55698	broad.mit.edu	37	7	4845343	4845343	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4845343C>G	uc003snj.1	-	10	2317	c.2144G>C	c.(2143-2145)AGC>ACC	p.S715T	RADIL_uc003sng.1_RNA|RADIL_uc003sni.1_Missense_Mutation_p.S220T|RADIL_uc011jwc.1_Missense_Mutation_p.S475T|RADIL_uc011jwd.1_RNA|RADIL_uc003snh.1_5'Flank	NM_018059	NP_060529	Q96JH8	RADIL_HUMAN	Rap GTPase interactor	715	Dilute.				cell adhesion|multicellular organismal development|signal transduction		protein binding			lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		GGCTGTCCAGCTCATCTGGGT	0.662													21	47	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20180451	20180451	+	3'UTR	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20180451C>G	uc003sus.3	-	7					MACC1_uc010kug.2_3'UTR	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						cacacacagacacacacacac	0.159													4	53	---	---	---	---	PASS
AUTS2	26053	broad.mit.edu	37	7	69583197	69583197	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69583197G>T	uc003tvw.3	+	3	1345	c.602G>T	c.(601-603)AGC>ATC	p.S201I	AUTS2_uc003tvv.3_Missense_Mutation_p.S201I|AUTS2_uc003tvx.3_Missense_Mutation_p.S201I	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1	201										ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CACCGGAGCAGCTCTCGGGAA	0.438													9	93	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94047865	94047865	+	Splice_Site	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94047865G>A	uc003ung.1	+	33	2496	c.2025_splice	c.e33+1	p.R675_splice	COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_Splice_Site	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor						axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGGTGCTCGTGTGAGTAGAAT	0.348										HNSCC(75;0.22)			40	75	---	---	---	---	PASS
C7orf58	79974	broad.mit.edu	37	7	120740100	120740100	+	Silent	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120740100G>T	uc003vjq.3	+	7	1317	c.870G>T	c.(868-870)TCG>TCT	p.S290S	C7orf58_uc003vjr.1_Silent_p.S290S|C7orf58_uc003vjs.3_Silent_p.S290S|C7orf58_uc003vjt.3_Silent_p.S70S|C7orf58_uc010lkk.1_Silent_p.S70S	NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1	290						endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					TCATTCATTCGACGGGCACAG	0.423													31	52	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131910975	131910975	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131910975C>T	uc003vra.3	-	8	2156	c.1927G>A	c.(1927-1929)GGC>AGC	p.G643S		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	643	Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						AAGGTCATGCCGGTCTCCTTT	0.557													90	149	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77776627	77776627	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77776627C>T	uc003yav.2	+	11	10929	c.10542C>T	c.(10540-10542)TGC>TGT	p.C3514C		NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	3510	Ser-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAAGTTTGTGCAGCACCTCAG	0.493										HNSCC(33;0.089)			4	152	---	---	---	---	PASS
ESRP1	54845	broad.mit.edu	37	8	95674784	95674784	+	Splice_Site	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95674784G>A	uc003ygq.3	+	6	827	c.644_splice	c.e6+1	p.C215_splice	ESRP1_uc003ygr.3_Splice_Site_p.C215_splice|ESRP1_uc003ygs.3_Splice_Site_p.C215_splice|ESRP1_uc003ygt.3_Splice_Site_p.C215_splice|ESRP1_uc003ygu.3_Splice_Site_p.C215_splice|ESRP1_uc003ygv.2_Splice_Site_p.C55_splice|ESRP1_uc003ygw.2_Splice_Site_p.C55_splice	NM_017697	NP_060167	Q6NXG1	ESRP1_HUMAN	RNA binding motif protein 35A isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	nucleus|plasma membrane	mRNA binding|nucleotide binding		ESRP1/RAF1(4)	prostate(4)	4						GTGGAACTTGGTAAGTGCTTG	0.229													14	25	---	---	---	---	PASS
TOPORS	10210	broad.mit.edu	37	9	32544237	32544237	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32544237C>T	uc003zrb.2	-	3	453	c.286G>A	c.(286-288)GAT>AAT	p.D96N	TOPORS_uc003zrc.2_Missense_Mutation_p.D29N	NM_005802	NP_005793	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich	96	E3 ubiquitin-protein ligase activity.|Required for DNA-binding.				DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		GGAGATGCATCAGCTGGTACT	0.388													7	91	---	---	---	---	PASS
TOPORS	10210	broad.mit.edu	37	9	32544239	32544239	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32544239G>A	uc003zrb.2	-	3	451	c.284C>T	c.(283-285)GCT>GTT	p.A95V	TOPORS_uc003zrc.2_Missense_Mutation_p.A28V	NM_005802	NP_005793	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich	95	E3 ubiquitin-protein ligase activity.|Required for DNA-binding.				DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		AGATGCATCAGCTGGTACTGT	0.388													7	90	---	---	---	---	PASS
ANKRD20A3	441425	broad.mit.edu	37	9	67938633	67938633	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67938633G>T	uc004aeu.2	+	6	880	c.768G>T	c.(766-768)AAG>AAT	p.K256N	ANKRD20A3_uc010mnn.2_Missense_Mutation_p.K256N	NM_001012419	NP_001012419	Q5VUR7	A20A3_HUMAN	ankyrin repeat domain 20 family, member A3	256											0						AACATAAAAAGAAGATACTTA	0.234													4	44	---	---	---	---	PASS
IPPK	64768	broad.mit.edu	37	9	95397569	95397569	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95397569G>A	uc004asl.1	-	10	1215	c.938C>T	c.(937-939)TCG>TTG	p.S313L	IPPK_uc004ask.1_Missense_Mutation_p.S12L	NM_022755	NP_073592	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	313					inositol or phosphatidylinositol phosphorylation	cytoplasm|nucleus	ATP binding|inositol pentakisphosphate 2-kinase activity			ovary(2)	2						CGGTAACCCCGAGCGCTCTGG	0.552											OREG0019315	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	70	---	---	---	---	PASS
GABBR2	9568	broad.mit.edu	37	9	101258739	101258739	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101258739C>T	uc004ays.2	-	4	844	c.688G>A	c.(688-690)GAG>AAG	p.E230K		NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor	230	Extracellular (Potential).				negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	GAGAAGCTCTCGGTGTCTGAA	0.542													9	73	---	---	---	---	PASS
IKBKAP	8518	broad.mit.edu	37	9	111679867	111679867	+	Missense_Mutation	SNP	T	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111679867T>C	uc004bdm.3	-	9	1344	c.824A>G	c.(823-825)CAT>CGT	p.H275R	IKBKAP_uc004bdl.2_5'UTR|IKBKAP_uc011lwc.1_Missense_Mutation_p.H161R|IKBKAP_uc010mtq.2_5'UTR	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene	275					immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						AAAGTGTCCATGAAGGAGTCC	0.413													20	132	---	---	---	---	PASS
ZNF483	158399	broad.mit.edu	37	9	114338695	114338695	+	3'UTR	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114338695G>C	uc004bfg.2	+	6					PTGR1_uc011lwr.1_Intron|PTGR1_uc004bfh.2_Intron|PTGR1_uc004bfi.3_Intron|PTGR1_uc004bfj.3_Intron|PTGR1_uc010mue.2_Intron	NM_001007169	NP_001007170	Q8TF39	ZN483_HUMAN	zinc finger protein 483 isoform b						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1						ggctgaataagaccatgctct	0.045													30	51	---	---	---	---	PASS
ZNF883	169834	broad.mit.edu	37	9	115759604	115759604	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115759604C>G	uc011lwy.1	-	5	2175	c.936G>C	c.(934-936)CAG>CAC	p.Q312H		NM_001101338	NP_001094808	P0CG24	ZN883_HUMAN	hypothetical protein LOC169834	312	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TATGCGTCCTCTGATGTCGAA	0.378													81	135	---	---	---	---	PASS
COL27A1	85301	broad.mit.edu	37	9	116931561	116931561	+	Missense_Mutation	SNP	A	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116931561A>G	uc011lxl.1	+	3	1726	c.1726A>G	c.(1726-1728)AGC>GGC	p.S576G	COL27A1_uc004bii.2_RNA|COL27A1_uc010mvd.1_Missense_Mutation_p.S426G	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor	576	Pro-rich.				cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						AACCAGGCCTAGCCCCAGACA	0.667													14	137	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117849019	117849019	+	Missense_Mutation	SNP	A	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117849019A>C	uc004bjj.3	-	3	1353	c.991T>G	c.(991-993)TAC>GAC	p.Y331D	TNC_uc010mvf.2_Missense_Mutation_p.Y331D	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	331	EGF-like 6.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						TCTTCGCAGTAGCAGGTGCCA	0.602													19	119	---	---	---	---	PASS
DBC1	1620	broad.mit.edu	37	9	121930487	121930487	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121930487C>A	uc004bkc.2	-	8	1617	c.1161G>T	c.(1159-1161)TGG>TGT	p.W387C		NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	387					cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						CCCTTGCAAGCCACTGCTGAA	0.517													6	22	---	---	---	---	PASS
CIZ1	25792	broad.mit.edu	37	9	130928556	130928556	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130928556G>A	uc004btt.2	-	17	2780	c.2617C>T	c.(2617-2619)CAG>TAG	p.Q873*	CIZ1_uc004btr.2_Nonsense_Mutation_p.Q845*|CIZ1_uc004bts.2_Nonsense_Mutation_p.Q844*|CIZ1_uc011maq.1_Nonsense_Mutation_p.Q812*|CIZ1_uc004btu.2_Nonsense_Mutation_p.Q793*|CIZ1_uc011mar.1_Nonsense_Mutation_p.Q772*|CIZ1_uc011mas.1_Nonsense_Mutation_p.Q929*|CIZ1_uc004btw.2_Nonsense_Mutation_p.Q817*|CIZ1_uc004btv.2_Nonsense_Mutation_p.Q873*	NM_001131016	NP_001124488	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1 isoform	873						nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4						GTTTTGTCCTGGGTGTTGGGC	0.662													5	9	---	---	---	---	PASS
CRAT	1384	broad.mit.edu	37	9	131860642	131860642	+	Missense_Mutation	SNP	T	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131860642T>C	uc004bxh.2	-	10	1496	c.1214A>G	c.(1213-1215)CAG>CGG	p.Q405R	CRAT_uc004bxg.2_Missense_Mutation_p.Q384R|CRAT_uc004bxk.3_Missense_Mutation_p.Q384R	NM_000755	NP_000746	P43155	CACP_HUMAN	carnitine acetyltransferase precursor	405					energy derivation by oxidation of organic compounds|fatty acid beta-oxidation using acyl-CoA oxidase|transport	endoplasmic reticulum|mitochondrial inner membrane|peroxisomal matrix	carnitine O-acetyltransferase activity			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	ATCCAGGTCCTGGATCATGCT	0.587													45	156	---	---	---	---	PASS
MED22	6837	broad.mit.edu	37	9	136210888	136210888	+	Intron	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136210888G>C	uc004cdc.2	-						MED22_uc004cdd.2_3'UTR	NM_133640	NP_598395	Q15528	MED22_HUMAN	mediator complex subunit 22 isoform b						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|mediator complex|soluble fraction	protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;1.14e-06)|Epithelial(140;8.2e-06)|all cancers(34;6.94e-05)		AGACCAGCAAGAATTTGAAAA	0.577													6	10	---	---	---	---	PASS
MED22	6837	broad.mit.edu	37	9	136211045	136211045	+	Silent	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136211045G>C	uc004cdc.2	-	4	582	c.348C>G	c.(346-348)CTC>CTG	p.L116L	MED22_uc004cdd.2_Silent_p.L116L	NM_133640	NP_598395	Q15528	MED22_HUMAN	mediator complex subunit 22 isoform b	116	Potential.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|mediator complex|soluble fraction	protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;1.14e-06)|Epithelial(140;8.2e-06)|all cancers(34;6.94e-05)		GCAGCGTGATGAGCTTCCGGT	0.577													46	75	---	---	---	---	PASS
KIAA1984	84960	broad.mit.edu	37	9	139702037	139702037	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139702037C>T	uc004cjf.2	+	14	1548	c.1500C>T	c.(1498-1500)TTC>TTT	p.F500F	C9orf86_uc004cjm.2_5'Flank|C9orf86_uc004cjh.2_5'Flank|C9orf86_uc004cjj.1_5'Flank|C9orf86_uc004cjk.1_5'Flank|C9orf86_uc004cji.1_5'Flank|C9orf86_uc010nbr.1_5'Flank|LOC100131193_uc004cjg.1_Intron	NM_001039374	NP_001034463	Q5T5S1	K1984_HUMAN	hypothetical protein LOC84960	500										ovary(1)	1	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		CCTTCCAGTTCCCCGACATGG	0.617													6	8	---	---	---	---	PASS
NDOR1	27158	broad.mit.edu	37	9	140109624	140109624	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140109624G>A	uc004clw.2	+	9	1254	c.1143G>A	c.(1141-1143)CCG>CCA	p.P381P	NDOR1_uc004clx.2_Silent_p.P381P|NDOR1_uc011mes.1_Silent_p.P381P|NDOR1_uc004cly.2_Silent_p.P347P	NM_014434	NP_055249	Q9UHB4	NDOR1_HUMAN	NADPH dependent diflavin oxidoreductase 1	381	FAD-binding FR-type.|FAD (By similarity).				cell death	cytosol|intermediate filament cytoskeleton|nucleus|perinuclear region of cytoplasm	flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding|oxidoreductase activity|protein binding				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		TTATCCGGCCGAGGGCCTTCT	0.647													23	25	---	---	---	---	PASS
EHMT1	79813	broad.mit.edu	37	9	140707963	140707963	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140707963G>A	uc011mfc.1	+	21	3198	c.3161G>A	c.(3160-3162)AGA>AAA	p.R1054K	EHMT1_uc004coe.2_5'Flank	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1054					DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		AACATCGACAGAAATATCACT	0.572													17	33	---	---	---	---	PASS
FAM23A	653567	broad.mit.edu	37	10	17813344	17813344	+	Silent	SNP	A	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17813344A>G	uc009xjx.2	+	2	338	c.294A>G	c.(292-294)ACA>ACG	p.T98T	FAM23A_uc010qcg.1_Silent_p.T24T	NM_001098844	NP_001092314	Q5W0B7	TM236_HUMAN	hypothetical protein LOC653567	98	Helical; (Potential).					integral to membrane					0						TCCTCACCACACTGCCCTGCC	0.393													40	97	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26455137	26455137	+	Intron	SNP	T	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26455137T>G	uc001isn.2	+						MYO3A_uc009xko.1_Missense_Mutation_p.N1047K|MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA						protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						TTCAGGAAAATAAATAATTAT	0.328													32	116	---	---	---	---	PASS
ANXA2P3	305	broad.mit.edu	37	10	66585666	66585666	+	RNA	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:66585666G>T	uc009xpm.1	+	1		c.382G>T				NR_001446				Human lipocortin (LIP) 2 pseudogene mRNA, complete cds-like region.												0						ATGCTTCTGAGCTAAAAGCTT	0.488													14	34	---	---	---	---	PASS
ADAMTS14	140766	broad.mit.edu	37	10	72520559	72520559	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72520559G>C	uc001jrh.2	+	22	3622	c.3622G>C	c.(3622-3624)GAC>CAC	p.D1208H	ADAMTS14_uc001jrg.2_Missense_Mutation_p.D1211H	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1208	Pro-rich.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						ACCTGGAGAAGACCTGAGACA	0.642													34	89	---	---	---	---	PASS
ADK	132	broad.mit.edu	37	10	76285071	76285071	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76285071G>A	uc001jwi.2	+	7	685	c.613G>A	c.(613-615)GAA>AAA	p.E205K	ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_Missense_Mutation_p.E188K|ADK_uc010qlc.1_Missense_Mutation_p.E170K|ADK_uc001jwl.2_5'UTR	NM_006721	NP_006712	P55263	ADK_HUMAN	adenosine kinase isoform b	205					purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)	CCATGCTTCTGAAAACAACAG	0.368													87	207	---	---	---	---	PASS
GALNTL4	374378	broad.mit.edu	37	11	11394086	11394086	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11394086G>A	uc001mjo.2	-	6	1489	c.1068C>T	c.(1066-1068)GGC>GGT	p.G356G		NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	356	Lumenal (Potential).|Catalytic subdomain B.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)		CCACATTCTCGCCCCCGTAGA	0.602													6	57	---	---	---	---	PASS
OR8H1	219469	broad.mit.edu	37	11	56058521	56058521	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56058521G>T	uc010rje.1	-	1	18	c.18C>A	c.(16-18)AAC>AAA	p.N6K		NM_001005199	NP_001005199	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H,	6	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	Esophageal squamous(21;0.00448)					GCACATTTGTGTTATTTCTTC	0.358													28	115	---	---	---	---	PASS
CCDC88B	283234	broad.mit.edu	37	11	64123092	64123092	+	Missense_Mutation	SNP	A	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64123092A>G	uc001nzy.2	+	26	4411	c.4367A>G	c.(4366-4368)AAC>AGC	p.N1456S	CCDC88B_uc001oaa.2_Missense_Mutation_p.T561A|CCDC88B_uc001oab.1_Missense_Mutation_p.N340S|CCDC88B_uc001oac.2_Missense_Mutation_p.T72A	NM_032251	NP_115627	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88	1456					microtubule cytoskeleton organization	cytoplasm	microtubule binding			ovary(3)|skin(1)	4						ACAGATGCCAACCGAGAGGGT	0.547													8	49	---	---	---	---	PASS
SIPA1	6494	broad.mit.edu	37	11	65417472	65417472	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65417472C>A	uc001ofb.2	+	13	2965	c.2798C>A	c.(2797-2799)TCG>TAG	p.S933*	SIPA1_uc010rom.1_Nonsense_Mutation_p.S831*|SIPA1_uc001ofd.2_Nonsense_Mutation_p.S933*	NM_006747	NP_006738	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated protein	933					cell proliferation|cytoskeleton organization|intracellular signal transduction|negative regulation of cell adhesion|negative regulation of cell cycle|negative regulation of cell growth	cytosol|endomembrane system|membrane|perinuclear region of cytoplasm	Rap GTPase activator activity				0						CAGGCCATCTCGGAGATTGCC	0.647													5	76	---	---	---	---	PASS
SART1	9092	broad.mit.edu	37	11	65746655	65746655	+	3'UTR	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65746655C>G	uc001ogl.2	+	20						NM_005146	NP_005137	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T						cell cycle arrest|induction of apoptosis by intracellular signals|positive regulation of cytotoxic T cell differentiation|spliceosomal snRNP assembly	Cajal body|catalytic step 2 spliceosome|cytosol				ovary(1)	1						ACCTGGCCATCAAATGACACA	0.552													8	3	---	---	---	---	PASS
TSKU	25987	broad.mit.edu	37	11	76506922	76506922	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76506922G>A	uc001oxt.2	+	2	434	c.262G>A	c.(262-264)GGC>AGC	p.G88S		NM_015516	NP_056331	Q8WUA8	TSK_HUMAN	tsukushin precursor	88	LRR 2.					extracellular region					0	Ovarian(111;0.112)					GACGTTGGCTGGCCTGGATCT	0.627													8	70	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105774631	105774631	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105774631G>C	uc001pix.2	+	8	1423	c.977G>C	c.(976-978)GGA>GCA	p.G326A	GRIA4_uc001piu.1_Missense_Mutation_p.G326A|GRIA4_uc001piw.2_Missense_Mutation_p.G326A|GRIA4_uc009yxk.1_Missense_Mutation_p.G326A	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	326	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	TCAAGGAGAGGAAATGCTGGG	0.443													45	68	---	---	---	---	PASS
SPATS2	65244	broad.mit.edu	37	12	49888683	49888683	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49888683G>A	uc001rud.2	+	7	1413	c.424G>A	c.(424-426)GAG>AAG	p.E142K	SPATS2_uc001rue.2_RNA|SPATS2_uc009zli.1_Missense_Mutation_p.E142K|SPATS2_uc001ruf.2_Missense_Mutation_p.E142K|SPATS2_uc001rug.2_Missense_Mutation_p.E142K	NM_023071	NP_075559	Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	142						cytoplasm				breast(1)	1						CAATGACACTGAGTCTGTGGA	0.468													21	57	---	---	---	---	PASS
SPATS2	65244	broad.mit.edu	37	12	49888713	49888713	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49888713G>A	uc001rud.2	+	7	1443	c.454G>A	c.(454-456)GAG>AAG	p.E152K	SPATS2_uc001rue.2_RNA|SPATS2_uc009zli.1_Missense_Mutation_p.E152K|SPATS2_uc001ruf.2_Missense_Mutation_p.E152K|SPATS2_uc001rug.2_Missense_Mutation_p.E152K	NM_023071	NP_075559	Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	152						cytoplasm				breast(1)	1						TGAAGGTTTGGAGACACTTTC	0.453													22	69	---	---	---	---	PASS
KRT1	3848	broad.mit.edu	37	12	53074144	53074144	+	5'UTR	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53074144G>C	uc001sau.1	-	1					KRT1_uc001sav.1_5'UTR	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1						complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)|skin(1)	2						TTGACTTAGAGAAAAGTAGGA	0.502													30	90	---	---	---	---	PASS
OR6C70	390327	broad.mit.edu	37	12	55863607	55863607	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55863607C>T	uc010spn.1	-	1	316	c.316G>A	c.(316-318)GGG>AGG	p.G106R		NM_001005499	NP_001005499	A6NIJ9	O6C70_HUMAN	olfactory receptor, family 6, subfamily C,	106	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TCTGTAACCCCCAAGAATATG	0.393													8	52	---	---	---	---	PASS
COQ10A	93058	broad.mit.edu	37	12	56661550	56661550	+	Intron	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56661550G>T	uc001sko.3	+						COQ10A_uc001skp.3_Intron|COQ10A_uc001skq.3_Missense_Mutation_p.R19L	NM_144576	NP_653177	Q96MF6	CQ10A_HUMAN	coenzyme Q10 homolog A isoform a							mitochondrial inner membrane				ovary(1)	1						AGAACTATACGGTTGGCTCCT	0.542													5	272	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57596297	57596297	+	Missense_Mutation	SNP	A	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57596297A>G	uc001snd.2	+	68	11154	c.10688A>G	c.(10687-10689)GAC>GGC	p.D3563G		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3563	LDL-receptor class A 26.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GATTGCGGTGACAACTCCGAT	0.652													3	43	---	---	---	---	PASS
APPL2	55198	broad.mit.edu	37	12	105601773	105601773	+	Silent	SNP	C	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105601773C>A	uc001tlf.1	-	7	668	c.450G>T	c.(448-450)CTG>CTT	p.L150L	APPL2_uc010swt.1_Silent_p.L107L|APPL2_uc001tlg.1_5'UTR|APPL2_uc010swu.1_Silent_p.L156L|APPL2_uc009zuq.2_Silent_p.L107L	NM_018171	NP_060641	Q8NEU8	DP13B_HUMAN	adaptor protein, phosphotyrosine interaction, PH	150	Required for RAB5A binding (By similarity).				cell cycle|cell proliferation|signal transduction	early endosome membrane|nucleus	protein binding			upper_aerodigestive_tract(1)	1						TTTTCTTAGGCAGCCTGCTGT	0.403													4	184	---	---	---	---	PASS
TCP11L2	255394	broad.mit.edu	37	12	106712243	106712243	+	Splice_Site	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106712243G>A	uc001tln.2	+	4	588	c.414_splice	c.e4+1	p.E138_splice	TCP11L2_uc001tll.2_Splice_Site_p.E138_splice|TCP11L2_uc001tlm.2_Splice_Site_p.E138_splice	NM_152772	NP_689985	Q8N4U5	T11L2_HUMAN	t-complex 11 (mouse) like 2											ovary(3)	3						AATCAGAGAGGCAAGTTGCTT	0.294													9	128	---	---	---	---	PASS
GPN3	51184	broad.mit.edu	37	12	110906002	110906002	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110906002G>A	uc001tqr.2	-	1	63	c.7C>T	c.(7-9)CGG>TGG	p.R3W	GPN3_uc001tqs.2_Missense_Mutation_p.R3W|C12orf24_uc010sxz.1_5'Flank|C12orf24_uc009zvo.2_5'Flank|C12orf24_uc001tqt.2_5'Flank|C12orf24_uc001tqu.3_5'Flank|C12orf24_uc001tqv.3_5'Flank	NM_016301	NP_057385	Q9UHW5	GPN3_HUMAN	GPN-loop GTPase 3 isoform 1	3						protein complex	GTP binding				0						TGCGCATACCGAGGCATGTTG	0.637													26	88	---	---	---	---	PASS
C12orf52	84934	broad.mit.edu	37	12	113629658	113629658	+	3'UTR	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113629658G>A	uc001tur.1	+	4					C12orf52_uc009zwg.1_3'UTR|C12orf52_uc001tus.1_3'UTR|C12orf52_uc001tut.1_3'UTR	NM_032848	NP_116237	Q96K30	RITA_HUMAN	hypothetical protein LOC84934						negative regulation of Notch signaling pathway|negative regulation of transcription from RNA polymerase II promoter|neurogenesis|Notch signaling pathway|nuclear export	centrosome|nucleus	tubulin binding				0						GGGCCACGGCGACAGGTATGG	0.577													14	79	---	---	---	---	PASS
CLIP1	6249	broad.mit.edu	37	12	122825944	122825944	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122825944C>T	uc001ucg.1	-	10	1913	c.1807G>A	c.(1807-1809)GAG>AAG	p.E603K	CLIP1_uc001uch.1_Missense_Mutation_p.E592K|CLIP1_uc001uci.1_Missense_Mutation_p.E557K|CLIP1_uc001ucj.1_Missense_Mutation_p.E293K|CLIP1_uc009zxo.1_Missense_Mutation_p.E159K	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a	603	Potential.				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TTCAATGACTCGTTCTCTTTG	0.468													22	277	---	---	---	---	PASS
HIP1R	9026	broad.mit.edu	37	12	123342728	123342728	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123342728C>T	uc001udj.1	+	19	1954	c.1895C>T	c.(1894-1896)GCG>GTG	p.A632V	HIP1R_uc001udk.1_5'UTR	NM_003959	NP_003950	O75146	HIP1R_HUMAN	huntingtin interacting protein-1-related	632					receptor-mediated endocytosis	clathrin coated vesicle membrane|coated pit|perinuclear region of cytoplasm	actin binding|phosphatidylinositol binding			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		GCCGAGGCCGCGGGCATCCTG	0.687													38	19	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20041439	20041439	+	Silent	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20041439G>T	uc001umd.2	-	8	649	c.438C>A	c.(436-438)GCC>GCA	p.A146A	TPTE2_uc009zzk.2_Intron|TPTE2_uc009zzl.2_Intron|TPTE2_uc001ume.2_Intron|TPTE2_uc009zzm.2_Intron|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	146	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		TCACAATAATGGCAGTATCTA	0.313													7	51	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23929791	23929791	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23929791G>A	uc001uon.2	-	8	1549	c.960C>T	c.(958-960)GTC>GTT	p.V320V	SACS_uc001uoo.2_Silent_p.V173V|SACS_uc001uop.1_Silent_p.V107V|SACS_uc001uoq.1_Silent_p.V173V	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	320					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CAGCCTCTCGGACATATAAGG	0.443													16	55	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32914782	32914782	+	Missense_Mutation	SNP	C	T	T	rs80358866		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32914782C>T	uc001uub.1	+	11	6517	c.6290C>T	c.(6289-6291)ACG>ATG	p.T2097M		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	2097					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TATTCACCTACGTCTAGACAA	0.348			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			16	91	---	---	---	---	PASS
THSD1	55901	broad.mit.edu	37	13	52971455	52971455	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52971455C>T	uc001vgo.2	-	3	1478	c.933G>A	c.(931-933)GGG>GGA	p.G311G	THSD1_uc001vgp.2_Silent_p.G311G|THSD1_uc010tgz.1_Intron|THSD1_uc010aea.2_Intron	NM_018676	NP_061146	Q9NS62	THSD1_HUMAN	thrombospondin type I domain-containing 1	311	Extracellular (Potential).					extracellular region|integral to membrane|intracellular membrane-bounded organelle				ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		ACTTATTCTTCCCCATGTCAA	0.448													7	129	---	---	---	---	PASS
OLFM4	10562	broad.mit.edu	37	13	53624617	53624617	+	Missense_Mutation	SNP	T	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53624617T>G	uc001vhl.2	+	5	1244	c.1244T>G	c.(1243-1245)CTT>CGT	p.L415R	OLFM4_uc001vhk.1_3'UTR	NM_006418	NP_006409	Q6UX06	OLFM4_HUMAN	olfactomedin 4 precursor	415	Olfactomedin-like.				cell adhesion	extracellular space				skin(1)	1		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		GACACCACACTTCAGGTGCTA	0.428													32	140	---	---	---	---	PASS
GPC6	10082	broad.mit.edu	37	13	94197591	94197591	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94197591G>A	uc001vlt.2	+	2	868	c.236G>A	c.(235-237)AGC>AAC	p.S79N	GPC6_uc010tig.1_Missense_Mutation_p.S79N|GPC6_uc001vlu.1_Missense_Mutation_p.S9N	NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor	79						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				AGCCAACAAAGCAAACTCGAA	0.408													4	134	---	---	---	---	PASS
RNF113B	140432	broad.mit.edu	37	13	98828998	98828998	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98828998C>T	uc001vnk.2	-	1	524	c.493G>A	c.(493-495)GGC>AGC	p.G165S	FARP1_uc001vnh.2_Intron|FARP1_uc001vni.2_Intron|FARP1_uc001vnj.2_Intron	NM_178861	NP_849192	Q8IZP6	R113B_HUMAN	ring finger protein 113B	165							nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.13)			GAGGAGTTGCCCATGGACGTG	0.647													5	142	---	---	---	---	PASS
OR4L1	122742	broad.mit.edu	37	14	20528885	20528885	+	Missense_Mutation	SNP	A	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20528885A>C	uc001vwn.1	+	1	682	c.682A>C	c.(682-684)AAA>CAA	p.K228Q		NM_001004717	NP_001004717	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L,	228	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		TGTACCAAAAAAATCATCACA	0.448													5	143	---	---	---	---	PASS
GZMB	3002	broad.mit.edu	37	14	25101305	25101305	+	Missense_Mutation	SNP	C	A	A	rs144452134	byFrequency	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25101305C>A	uc001wps.2	-	4	425	c.359G>T	c.(358-360)CGG>CTG	p.R120L	GZMB_uc010ama.2_Missense_Mutation_p.R108L|GZMB_uc010amb.2_RNA	NM_004131	NP_004122	P10144	GRAB_HUMAN	granzyme B precursor	120	Peptidase S1.				activation of pro-apoptotic gene products|cleavage of lamin|cytolysis|induction of apoptosis by intracellular signals	cytosol|immunological synapse|nucleus	protein binding|serine-type endopeptidase activity				0				GBM - Glioblastoma multiforme(265;0.028)		AGCTCTGGTCCGCTTGGCCTT	0.632													3	73	---	---	---	---	PASS
ACTR10	55860	broad.mit.edu	37	14	58698862	58698862	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58698862C>A	uc001xdf.2	+	12	1052	c.949C>A	c.(949-951)CAC>AAC	p.H317N	C14orf37_uc010tro.1_Intron|ACTR10_uc001xdg.2_Missense_Mutation_p.H119N|ACTR10_uc001xdh.2_Missense_Mutation_p.H119N|ACTR10_uc010trp.1_RNA|ACTR10_uc010apc.2_Missense_Mutation_p.H107N	NM_018477	NP_060947	Q9NZ32	ARP10_HUMAN	uncharacterized hypothalamus protein HARP11	317						cytoplasm				central_nervous_system(1)	1						AGGATTTCTCCACAGATTGCT	0.378													5	170	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64514796	64514796	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64514796C>T	uc001xgm.2	+	46	7530	c.7300C>T	c.(7300-7302)CGG>TGG	p.R2434W	SYNE2_uc001xgl.2_Missense_Mutation_p.R2434W	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2434	Potential.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGAAGATGAGCGGAAAGTCAA	0.323													10	48	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64519446	64519446	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64519446G>C	uc001xgm.2	+	48	9045	c.8815G>C	c.(8815-8817)GAA>CAA	p.E2939Q	SYNE2_uc001xgl.2_Missense_Mutation_p.E2939Q	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2939	Potential.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TAATGAAGTGGAACACAAGAT	0.343													13	39	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65253698	65253698	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65253698C>T	uc001xht.2	-	15	3039	c.2985G>A	c.(2983-2985)AGG>AGA	p.R995R	SPTB_uc001xhr.2_Silent_p.R995R|SPTB_uc001xhs.2_Silent_p.R995R|SPTB_uc001xhu.2_Silent_p.R995R	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	995	Spectrin 7.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CTGACAACTTCCTCTGGATGG	0.607													29	82	---	---	---	---	PASS
SMOC1	64093	broad.mit.edu	37	14	70490103	70490103	+	Silent	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70490103G>T	uc001xls.1	+	11	1483	c.1230G>T	c.(1228-1230)CTG>CTT	p.L410L	SMOC1_uc001xlt.1_Silent_p.L410L	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN	secreted modular calcium-binding protein 1	410	2 (Potential).|EF-hand 2.				cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding			upper_aerodigestive_tract(1)|pancreas(1)	2				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		ACTGTGACCTGAACAAAGACA	0.517													113	127	---	---	---	---	PASS
C14orf43	91748	broad.mit.edu	37	14	74194193	74194193	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74194193C>T	uc001xot.2	-	5	2913	c.2130G>A	c.(2128-2130)GTG>GTA	p.V710V	C14orf43_uc001xos.2_5'UTR|C14orf43_uc001xou.2_Silent_p.V710V|C14orf43_uc010tud.1_Silent_p.V710V|C14orf43_uc010arw.2_RNA	NM_194278	NP_919254	Q6PJG2	CN043_HUMAN	hypothetical protein LOC91748	710					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00358)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)|OV - Ovarian serous cystadenocarcinoma(108;0.115)		CCTCCCCCATCACAGAGAGGA	0.607													10	40	---	---	---	---	PASS
SPTLC2	9517	broad.mit.edu	37	14	77978511	77978511	+	3'UTR	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77978511G>A	uc001xub.2	-	12						NM_004863	NP_004854	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base							integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups			upper_aerodigestive_tract(1)|ovary(1)	2			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	TTCAGTAGCTGAGGCAATGTC	0.463													18	18	---	---	---	---	PASS
OTUD7A	161725	broad.mit.edu	37	15	31795993	31795993	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31795993C>T	uc001zfq.2	-	7	994	c.901G>A	c.(901-903)GAG>AAG	p.E301K	OTUD7A_uc001zfr.2_Missense_Mutation_p.E308K	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A	301	OTU.|Catalytic (By similarity).|TRAF-binding (By similarity).					cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		TCCAGGCTCTCGTACACGGGG	0.493													52	69	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34105682	34105682	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34105682G>A	uc001zhi.2	+	74	10474	c.10404G>A	c.(10402-10404)TTG>TTA	p.L3468L	RYR3_uc010bar.2_Silent_p.L3463L	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	3468					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AACAGCCTTTGAGGTCCAAGA	0.532													26	97	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54306223	54306223	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54306223C>T	uc002ack.2	+	1	1123	c.1123C>T	c.(1123-1125)CGA>TGA	p.R375*		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	375					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TGCAAAGCCTCGACCCATACT	0.378													29	26	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54306931	54306931	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54306931C>T	uc002ack.2	+	1	1831	c.1831C>T	c.(1831-1833)CAG>TAG	p.Q611*		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	611					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TGGAGGTGTTCAGGGTATCCA	0.502													41	62	---	---	---	---	PASS
SNX22	79856	broad.mit.edu	37	15	64446670	64446670	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64446670C>G	uc002anc.1	+	7	604	c.545C>G	c.(544-546)GCG>GGG	p.A182G	SNX22_uc002amz.1_3'UTR|SNX22_uc002ana.1_3'UTR|SNX22_uc002anb.1_RNA	NM_024798	NP_079074	Q96L94	SNX22_HUMAN	sorting nexin 22	182					cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0						CAGCCAAAGGCGGCCTGTCAC	0.562													34	199	---	---	---	---	PASS
LBXCOR1	390598	broad.mit.edu	37	15	68121571	68121571	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68121571C>T	uc002aqy.1	+	4	2239	c.2239C>T	c.(2239-2241)CCC>TCC	p.P747S		NM_001031807	NP_001026977	P84550	SKOR1_HUMAN	transcriptional corepressor Corl1	791					negative regulation of BMP signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	cytoplasm|dendrite|neuronal cell body|nucleus	nucleotide binding|SMAD binding|transcription repressor activity				0						GGCGCTGGGGCCCGCGGCCTC	0.706													2	3	---	---	---	---	PASS
MYO9A	4649	broad.mit.edu	37	15	72338071	72338071	+	Silent	SNP	T	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72338071T>C	uc002atl.3	-	2	1307	c.834A>G	c.(832-834)GTA>GTG	p.V278V	MYO9A_uc010biq.2_Intron|MYO9A_uc002ato.2_Silent_p.V278V|MYO9A_uc002atn.1_Silent_p.V278V	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	278	Myosin head-like 1.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						TTACCTCAAGTACTGGTCCAG	0.303													35	43	---	---	---	---	PASS
MAN2A2	4122	broad.mit.edu	37	15	91448546	91448546	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91448546G>C	uc010bnz.2	+	3	313	c.198G>C	c.(196-198)GAG>GAC	p.E66D	MAN2A2_uc010boa.2_Missense_Mutation_p.E108D|MAN2A2_uc002bqc.2_Missense_Mutation_p.E66D|MAN2A2_uc010uql.1_5'Flank|MAN2A2_uc010uqm.1_5'Flank	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	66	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			AGAACCATGAGATTATCAGCC	0.552													69	65	---	---	---	---	PASS
TARSL2	123283	broad.mit.edu	37	15	102211921	102211921	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102211921C>T	uc002bxm.2	-	14	1874	c.1819G>A	c.(1819-1821)GAA>AAA	p.E607K	TARSL2_uc002bxl.2_Missense_Mutation_p.E152K|TARSL2_uc010usi.1_RNA	NM_152334	NP_689547	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	607					threonyl-tRNA aminoacylation	cytoplasm	ATP binding|threonine-tRNA ligase activity			ovary(2)	2	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TTCCACGGTTCTCCAAAGTCC	0.348													4	83	---	---	---	---	PASS
PTX4	390667	broad.mit.edu	37	16	1535988	1535988	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1535988G>A	uc010uvf.1	-	3	1374	c.1374C>T	c.(1372-1374)GGC>GGT	p.G458G		NM_001013658	NP_001013680	Q96A99	PTX4_HUMAN	neuronal pentraxin II-like	463	Pentaxin.					extracellular region	metal ion binding				0						GCACAAATCCGCCTGCTAGTG	0.657													3	33	---	---	---	---	PASS
CDR2	1039	broad.mit.edu	37	16	22385609	22385609	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22385609C>G	uc002dkn.2	-	1	330	c.22G>C	c.(22-24)GAG>CAG	p.E8Q		NM_001802	NP_001793	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2	8						nucleus	protein binding			skin(1)	1				GBM - Glioblastoma multiforme(48;0.0188)		TCAAACTCCTCTACCAGGTTT	0.547													22	22	---	---	---	---	PASS
LAT	27040	broad.mit.edu	37	16	28997204	28997204	+	Missense_Mutation	SNP	G	A	A	rs150635404	byFrequency	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28997204G>A	uc002dsd.2	+	3	510	c.158G>A	c.(157-159)CGG>CAG	p.R53Q	uc010vct.1_Intron|LAT_uc010vdj.1_Missense_Mutation_p.R89Q|LAT_uc002dsb.2_Missense_Mutation_p.R53Q|LAT_uc002dsc.2_Missense_Mutation_p.R53Q|LAT_uc010vdk.1_Missense_Mutation_p.R53Q|LAT_uc010vdl.1_Missense_Mutation_p.R53Q	NM_014387	NP_055202	O43561	LAT_HUMAN	linker for activation of T cells isoform a	53	Cytoplasmic (Potential).				calcium-mediated signaling|integrin-mediated signaling pathway|mast cell degranulation|platelet activation|Ras protein signal transduction|regulation of T cell activation|T cell receptor signaling pathway	immunological synapse|integral to membrane|intracellular|membrane raft	SH3/SH2 adaptor activity				0		Hepatocellular(780;0.244)				CAGTTCAAACGGCCTCGTGAG	0.607													107	174	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72984605	72984605	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72984605G>A	uc002fck.2	-	3	3652	c.2979C>T	c.(2977-2979)ACC>ACT	p.T993T	ZFHX3_uc002fcl.2_Silent_p.T79T	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	993	C2H2-type 7; atypical.				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				CCTTGAGCTGGGTGTTGTAGC	0.607													43	33	---	---	---	---	PASS
CLEC18B	497190	broad.mit.edu	37	16	74446298	74446298	+	Intron	SNP	G	T	T	rs148693963	by1000genomes	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74446298G>T	uc002fct.2	-						CLEC18B_uc002fcu.2_Intron|CLEC18B_uc010vmu.1_Silent_p.G202G|CLEC18B_uc010vmv.1_Intron	NM_001011880	NP_001011880	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B							extracellular region	sugar binding				0						TTGCTGGCACGCCTGGTGTCT	0.373													3	15	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10411687	10411687	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10411687C>T	uc002gmo.2	-	16	1984	c.1890G>A	c.(1888-1890)GCG>GCA	p.A630A	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	630	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TACCTGCTTCCGCTCCCGTTG	0.338													105	139	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11622799	11622799	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11622799G>T	uc002gne.2	+	27	5769	c.5701G>T	c.(5701-5703)GAT>TAT	p.D1901Y	DNAH9_uc010coo.2_Missense_Mutation_p.D1195Y	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	1901	AAA 1 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GGAGCAGATGGATTACAAGGT	0.612													14	76	---	---	---	---	PASS
PIGW	284098	broad.mit.edu	37	17	34893433	34893433	+	Silent	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34893433C>G	uc002hmy.1	+	2	526	c.483C>G	c.(481-483)CTC>CTG	p.L161L	MYO19_uc002hmw.2_5'Flank|MYO19_uc010cuu.2_5'Flank|MYO19_uc010wcy.1_5'Flank|MYO19_uc010wcz.1_5'Flank|MYO19_uc010wda.1_5'Flank|MYO19_uc002hmx.2_5'Flank|PIGW_uc002hmz.1_Silent_p.L161L	NM_178517	NP_848612	Q7Z7B1	PIGW_HUMAN	phosphatidylinositol glycan, class W	161					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	O-acyltransferase activity				0		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AAACTGAGCTCTATGGGACAG	0.448													38	189	---	---	---	---	PASS
CNTNAP1	8506	broad.mit.edu	37	17	40837383	40837383	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40837383C>T	uc002iay.2	+	5	876	c.660C>T	c.(658-660)GGC>GGT	p.G220G	CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623	P78357	CNTP1_HUMAN	contactin associated protein 1 precursor	220	Laminin G-like 1.|Extracellular (Potential).				axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		GCGCCCAGGGCGACTACGTGA	0.662													39	39	---	---	---	---	PASS
NBR1	4077	broad.mit.edu	37	17	41342744	41342744	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41342744C>G	uc010czd.2	+	9	954	c.814C>G	c.(814-816)CAC>GAC	p.H272D	NBR1_uc010diz.2_Missense_Mutation_p.H272D|NBR1_uc010whu.1_Missense_Mutation_p.H272D|NBR1_uc010whv.1_Missense_Mutation_p.H272D|NBR1_uc010whw.1_Missense_Mutation_p.H251D|NBR1_uc010whx.1_Missense_Mutation_p.H81D	NM_031862	NP_114068	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	272					macroautophagy|protein oligomerization	autophagic vacuole|cytoplasmic vesicle|cytosol|late endosome|lysosome|sarcomere	ubiquitin binding|zinc ion binding			skin(1)	1		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		ACCGTTCTGTCACTCAAAGTA	0.483													38	30	---	---	---	---	PASS
RNFT1	51136	broad.mit.edu	37	17	58040312	58040312	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58040312G>A	uc002iya.2	-	2	483	c.390C>T	c.(388-390)GCC>GCT	p.A130A	uc002iye.1_5'Flank|RNFT1_uc002iyb.2_RNA|RNFT1_uc002iyc.2_5'UTR|RNFT1_uc010wop.1_Silent_p.A130A|RNFT1_uc002iyd.3_Silent_p.A130A	NM_016125	NP_057209	Q5M7Z0	RNFT1_HUMAN	PTD016 protein	130						integral to membrane	zinc ion binding				0	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			CAGATTCTGCGGCAGTATCAT	0.468													4	158	---	---	---	---	PASS
USP32	84669	broad.mit.edu	37	17	58308983	58308983	+	Intron	SNP	C	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58308983C>A	uc002iyo.1	-						USP32_uc002iyn.1_Intron|SCARNA20_uc002iyp.1_RNA	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32						protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			AACAGGGACCCCCCAAAGCCC	0.507													6	139	---	---	---	---	PASS
ARSG	22901	broad.mit.edu	37	17	66366656	66366656	+	Missense_Mutation	SNP	A	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66366656A>G	uc002jhc.2	+	8	1769	c.973A>G	c.(973-975)ACT>GCT	p.T325A	ARSG_uc002jhb.1_Missense_Mutation_p.T161A	NM_014960	NP_055775	Q96EG1	ARSG_HUMAN	Arylsulfatase G precursor	325					sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			ATTTTGGCAAACTCGTCAAGG	0.557													4	64	---	---	---	---	PASS
RPRD1A	55197	broad.mit.edu	37	18	33606928	33606928	+	Silent	SNP	G	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33606928G>T	uc002kzf.1	-	6	730	c.724C>A	c.(724-726)CGA>AGA	p.R242R	RPRD1A_uc002kze.1_Silent_p.R206R|RPRD1A_uc002kzg.2_Silent_p.R242R|RPRD1A_uc010dmw.2_Silent_p.R206R|RPRD1A_uc010dmx.2_Silent_p.R242R	NM_018170	NP_060640	Q96P16	RPR1A_HUMAN	regulation of nuclear pre-mRNA domain containing	242										ovary(1)|breast(1)	2						GCTAACATTCGAGTGAGTTGC	0.403													3	84	---	---	---	---	PASS
KIAA1468	57614	broad.mit.edu	37	18	59949606	59949606	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59949606C>G	uc002lil.2	+	25	3397	c.3182C>G	c.(3181-3183)TCT>TGT	p.S1061C	KIAA1468_uc010xel.1_Missense_Mutation_p.S1061C|KIAA1468_uc002lim.2_Missense_Mutation_p.S739C	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614	1061							binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				GACCAACATTCTTTGCATACA	0.393													72	78	---	---	---	---	PASS
LDLR	3949	broad.mit.edu	37	19	11224428	11224428	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11224428C>T	uc002mqk.3	+	10	1744	c.1576C>T	c.(1576-1578)CCT>TCT	p.P526S	LDLR_uc010xlk.1_Missense_Mutation_p.P526S|LDLR_uc010xll.1_Missense_Mutation_p.P485S|LDLR_uc010xlm.1_Missense_Mutation_p.P379S|LDLR_uc010xln.1_Missense_Mutation_p.P399S|LDLR_uc010xlo.1_Missense_Mutation_p.P358S	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	526	Extracellular (Potential).|LDL-receptor class B 3.		P -> S (in Cincinnati-3).		cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)	CGTGGTGGATCCTGTTCATGG	0.522													43	46	---	---	---	---	PASS
DNAJB1	3337	broad.mit.edu	37	19	14626877	14626877	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14626877C>G	uc002myz.1	-	3	938	c.898G>C	c.(898-900)GAA>CAA	p.E300Q	DNAJB1_uc010xnr.1_Missense_Mutation_p.E200Q	NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	300					chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)		GGGAGGCCTTCTCCAGGAACT	0.542													3	133	---	---	---	---	PASS
OR10H2	26538	broad.mit.edu	37	19	15839849	15839849	+	3'UTR	SNP	C	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15839849C>A	uc002nbm.2	+	1						NM_013939	NP_039227	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					GGATGACCATCAccttgtctg	0.249													3	12	---	---	---	---	PASS
PLAUR	5329	broad.mit.edu	37	19	44169567	44169567	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44169567C>G	uc002oxf.1	-	3	441	c.211G>C	c.(211-213)GAG>CAG	p.E71Q	PLAUR_uc002oxd.1_Missense_Mutation_p.E71Q|PLAUR_uc002oxe.1_Missense_Mutation_p.E66Q|PLAUR_uc002oxg.1_Missense_Mutation_p.E71Q	NM_002659	NP_002650	Q03405	UPAR_HUMAN	plasminogen activator, urokinase receptor	71	UPAR/Ly6 1.				attachment of GPI anchor to protein|blood coagulation|C-terminal protein lipidation|cellular component movement|chemotaxis|fibrinolysis|regulation of proteolysis	anchored to membrane|cell surface|endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region|extrinsic to membrane|integral to membrane|plasma membrane	enzyme binding|U-plasminogen activator receptor activity			ovary(1)	1		Prostate(69;0.0153)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Urokinase(DB00013)	TTGGTCTTCTCTGAGTGGGTA	0.547													27	82	---	---	---	---	PASS
PLAUR	5329	broad.mit.edu	37	19	44169588	44169588	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44169588C>G	uc002oxf.1	-	3	420	c.190G>C	c.(190-192)GAG>CAG	p.E64Q	PLAUR_uc002oxd.1_Missense_Mutation_p.E64Q|PLAUR_uc002oxe.1_Missense_Mutation_p.E59Q|PLAUR_uc002oxg.1_Missense_Mutation_p.E64Q	NM_002659	NP_002650	Q03405	UPAR_HUMAN	plasminogen activator, urokinase receptor	64	UPAR/Ly6 1.				attachment of GPI anchor to protein|blood coagulation|C-terminal protein lipidation|cellular component movement|chemotaxis|fibrinolysis|regulation of proteolysis	anchored to membrane|cell surface|endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region|extrinsic to membrane|integral to membrane|plasma membrane	enzyme binding|U-plasminogen activator receptor activity			ovary(1)	1		Prostate(69;0.0153)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Urokinase(DB00013)	CAGCTTTTCTCCACCAGCTCC	0.542													26	84	---	---	---	---	PASS
ZNF221	7638	broad.mit.edu	37	19	44471003	44471003	+	Missense_Mutation	SNP	A	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44471003A>G	uc002oxx.2	+	6	1677	c.1349A>G	c.(1348-1350)TAT>TGT	p.Y450C	ZNF221_uc010ejb.1_Missense_Mutation_p.Y450C|ZNF221_uc010xws.1_Missense_Mutation_p.Y450C	NM_013359	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	450	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Prostate(69;0.0352)				GAAAAGCCATATAACTGTGAG	0.423													10	83	---	---	---	---	PASS
CACNG8	59283	broad.mit.edu	37	19	54483190	54483190	+	Missense_Mutation	SNP	T	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54483190T>G	uc002qcs.1	+	3	540	c.434T>G	c.(433-435)GTG>GGG	p.V145G	MIR935_hsa-mir-935|MI0005757_5'Flank	NM_031895	NP_114101	Q8WXS5	CCG8_HUMAN	voltage-dependent calcium channel gamma-8	146	Helical; (Potential).				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic density|postsynaptic membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		GGTGTGTGCGTGGCGGCCTCC	0.647													4	21	---	---	---	---	PASS
GALP	85569	broad.mit.edu	37	19	56696705	56696705	+	3'UTR	SNP	T	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56696705T>A	uc002qmo.1	+	6					GALP_uc010eti.2_3'UTR	NM_033106	NP_149097	Q9UBC7	GALP_HUMAN	galanin-like peptide isoform 1 precursor						neuropeptide signaling pathway	extracellular region	hormone activity				0		Colorectal(82;0.000147)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0507)		AAACCTTTTCTAGGTACCCTA	0.403													10	25	---	---	---	---	PASS
GZF1	64412	broad.mit.edu	37	20	23351021	23351021	+	Silent	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23351021G>C	uc010gdb.2	+	7	2253	c.2079G>C	c.(2077-2079)CTG>CTC	p.L693L	GZF1_uc002wsy.2_Silent_p.L693L|GZF1_uc010zsq.1_Silent_p.L217L|GZF1_uc010zsr.1_Silent_p.L202L|GZF1_uc002wsz.2_Silent_p.L693L	NM_022482	NP_071927	Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	693					transcription, DNA-dependent	nucleolus|nucleoplasm	sequence-specific DNA binding|zinc ion binding			kidney(1)	1	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					TTAGCGAGCTGACCCCACAGA	0.547													40	95	---	---	---	---	PASS
MYH7B	57644	broad.mit.edu	37	20	33577935	33577935	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33577935C>T	uc002xbi.1	+	19	2104	c.2012C>T	c.(2011-2013)GCG>GTG	p.A671V	MIR499_hsa-mir-499|MI0003183_5'Flank	NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	629	Myosin head-like.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GAGAATTATGCGGGCTCCTGC	0.547													6	224	---	---	---	---	PASS
SRC	6714	broad.mit.edu	37	20	36012573	36012573	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36012573G>A	uc002xgx.2	+	4	466	c.17G>A	c.(16-18)AGC>AAC	p.S6N	SRC_uc002xgy.2_Missense_Mutation_p.S6N	NM_005417	NP_005408	P12931	SRC_HUMAN	proto-oncogene tyrosine-protein kinase SRC	6					axon guidance|bone resorption|cell junction assembly|cellular membrane organization|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular protein kinase cascade|leukocyte migration|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of integrin activation|Ras protein signal transduction|regulation of bone resorption|regulation of vascular permeability|response to interleukin-1|signal complex assembly|T cell costimulation	caveola|cytosol|mitochondrial inner membrane	ATP binding|heme binding|integrin binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|SH3/SH2 adaptor activity			large_intestine(10)|lung(1)|central_nervous_system(1)|endometrium(1)	13		Myeloproliferative disorder(115;0.00878)			Dasatinib(DB01254)	AGCAACAAGAGCAAGCCCAAG	0.701													10	10	---	---	---	---	PASS
LPIN3	64900	broad.mit.edu	37	20	39986944	39986944	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39986944C>T	uc002xjx.2	+	18	2351	c.2260C>T	c.(2260-2262)CTG>TTG	p.L754L	LPIN3_uc010ggh.2_Silent_p.L755L|LPIN3_uc010zwf.1_RNA	NM_022896	NP_075047	Q9BQK8	LPIN3_HUMAN	lipin 3	754	C-LIP.				fatty acid metabolic process	nucleus	phosphatidate phosphatase activity			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(115;0.000739)				GCAGCTGTTTCTGCCCCACGG	0.602													37	49	---	---	---	---	PASS
ZNF335	63925	broad.mit.edu	37	20	44579219	44579219	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44579219G>C	uc002xqw.2	-	21	3328	c.3205C>G	c.(3205-3207)CAC>GAC	p.H1069D	ZNF335_uc002xqv.2_Missense_Mutation_p.H181D|ZNF335_uc010zxk.1_Missense_Mutation_p.H914D	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	1069	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				AGGCTTGAGTGCTGTGCCATG	0.597													30	219	---	---	---	---	PASS
TCFL5	10732	broad.mit.edu	37	20	61490866	61490866	+	Missense_Mutation	SNP	A	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61490866A>C	uc002ydp.2	-	3	937	c.844T>G	c.(844-846)TCA>GCA	p.S282A	TCFL5_uc002ydo.2_Missense_Mutation_p.S55A|TCFL5_uc002ydq.2_Missense_Mutation_p.S282A	NM_006602	NP_006593	Q9UL49	TCFL5_HUMAN	transcription factor-like 5 protein	282					cell differentiation|multicellular organismal development|regulation of cell differentiation|regulation of cell proliferation|spermatogenesis|transcription from RNA polymerase II promoter		DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)	1	Breast(26;5.68e-08)					ACAGAACATGAGTTACTAGAA	0.368													17	99	---	---	---	---	PASS
DNAJC5	80331	broad.mit.edu	37	20	62551503	62551503	+	Intron	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62551503C>T	uc002yhf.2	+						DNAJC5_uc002yhg.1_Intron|DNAJC5_uc002yhh.2_RNA	NM_025219	NP_079495	Q9H3Z4	DNJC5_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5						neurotransmitter secretion|protein folding	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|melanosome|plasma membrane	heat shock protein binding|unfolded protein binding			pancreas(1)	1	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CAGGACAGCGCCACGGAAGAG	0.697													17	42	---	---	---	---	PASS
OPRL1	4987	broad.mit.edu	37	20	62724217	62724217	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62724217C>T	uc002yic.2	+	3	546	c.144C>T	c.(142-144)CTC>CTT	p.L48L	OPRL1_uc002yid.2_Silent_p.L48L|OPRL1_uc002yif.3_Silent_p.L48L	NM_182647	NP_872588	P41146	OPRX_HUMAN	opiate receptor-like 1	48	Extracellular (Potential).				elevation of cytosolic calcium ion concentration|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception	integral to plasma membrane	protein binding|X-opioid receptor activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					TCCTGCCCCTCGGGCTCAAGG	0.652													61	95	---	---	---	---	PASS
KRTAP21-1	337977	broad.mit.edu	37	21	32127524	32127524	+	Missense_Mutation	SNP	T	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32127524T>C	uc011adi.1	-	1	173	c.173A>G	c.(172-174)TAT>TGT	p.Y58C		NM_181619	NP_853650	Q3LI58	KR211_HUMAN	keratin associated protein 21-1	58						intermediate filament				breast(1)	1						GCCAGagccatatccacagcc	0.219													5	147	---	---	---	---	PASS
KRTAP12-3	386683	broad.mit.edu	37	21	46078007	46078007	+	Silent	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46078007C>T	uc002zft.2	+	1	159	c.111C>T	c.(109-111)CCC>CCT	p.P37P	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198697	NP_941970	P60328	KR123_HUMAN	keratin associated protein 12-3	37	5.|14 X 5 AA approximate repeats.					intermediate filament				central_nervous_system(1)	1						TGTGCATGCCCGTGAGCTGCA	0.652													16	220	---	---	---	---	PASS
RGL4	266747	broad.mit.edu	37	22	24036662	24036662	+	Intron	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24036662G>A	uc002zxn.2	+						LOC91316_uc002zxh.3_5'Flank|LOC91316_uc002zxi.3_5'Flank|LOC91316_uc002zxk.3_RNA|LOC91316_uc010gua.2_Intron|LOC91316_uc002zxl.3_Intron|LOC91316_uc011aiz.1_RNA|LOC91316_uc002zxm.3_RNA|RGL4_uc002zxo.2_Intron|RGL4_uc002zxp.1_Intron|RGL4_uc002zxq.2_Intron	NM_153615	NP_705843	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation						small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle	guanyl-nucleotide exchange factor activity			ovary(1)	1						CTCCATGGCAGCATCAGGGTT	0.592													3	32	---	---	---	---	PASS
FBXO7	25793	broad.mit.edu	37	22	32889255	32889255	+	Silent	SNP	G	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32889255G>A	uc003amq.2	+	7	1414	c.1131G>A	c.(1129-1131)CTG>CTA	p.L377L	FBXO7_uc003amr.2_Silent_p.L263L|FBXO7_uc003ams.2_Silent_p.L221L|FBXO7_uc003amt.2_Silent_p.L298L|FBXO7_uc003amu.2_Silent_p.L263L|FBXO7_uc003amv.2_Silent_p.L76L	NM_012179	NP_036311	Q9Y3I1	FBX7_HUMAN	F-box only protein 7 isoform 1	377					cell death|regulation of protein stability|ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(1)	1						TTTTATATCTGCGTGATTTTC	0.413													10	200	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38119996	38119996	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38119996G>C	uc003atr.2	+	7	1704	c.1433G>C	c.(1432-1434)AGA>ACA	p.R478T	TRIOBP_uc003atu.2_Missense_Mutation_p.R306T|TRIOBP_uc003atq.1_Missense_Mutation_p.R478T|TRIOBP_uc003ats.1_Missense_Mutation_p.R306T	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	478					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GACAACCCCAGAACATCCTGT	0.587													4	128	---	---	---	---	PASS
DCAF8L1	139425	broad.mit.edu	37	X	27999131	27999131	+	Missense_Mutation	SNP	C	T	T	rs148567837	byFrequency	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27999131C>T	uc004dbx.1	-	1	436	c.321G>A	c.(319-321)ATG>ATA	p.M107I		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	107	Glu-rich.									ovary(3)|skin(1)	4						cttcctcctccatctcttctt	0.393													22	44	---	---	---	---	PASS
FGD1	2245	broad.mit.edu	37	X	54496454	54496454	+	Missense_Mutation	SNP	C	A	A	rs140078362	by1000genomes	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54496454C>A	uc004dtg.2	-	4	1830	c.1096G>T	c.(1096-1098)GTG>TTG	p.V366L	FGD1_uc011moi.1_Missense_Mutation_p.V124L	NM_004463	NP_004454	P98174	FGD1_HUMAN	faciogenital dysplasia protein	366					actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|skin(2)|central_nervous_system(1)	6						AGTACCTCCACAGACTCCTGT	0.423													18	4	---	---	---	---	PASS
SATL1	340562	broad.mit.edu	37	X	84363234	84363234	+	Silent	SNP	G	A	A	rs111730253	byFrequency	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84363234G>A	uc011mqx.1	-	1	741	c.741C>T	c.(739-741)GAC>GAT	p.D247D	SATL1_uc004een.2_Silent_p.D247D	NM_001163541	NP_001157013	Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	60	Gln-rich.						N-acetyltransferase activity			breast(2)	2						ATTGGTTTGCGTCTGGTTGGC	0.473													43	97	---	---	---	---	PASS
DCAF12L1	139170	broad.mit.edu	37	X	125686549	125686549	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125686549C>T	uc004eul.2	-	1	294	c.43G>A	c.(43-45)GCG>ACG	p.A15T		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	15										skin(3)|ovary(1)	4						GCCTCGACCGCGGGCGCTTTC	0.512													6	26	---	---	---	---	PASS
RBMX	27316	broad.mit.edu	37	X	135957326	135957326	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135957326C>A	uc004fae.1	-	8	994	c.784G>T	c.(784-786)GAT>TAT	p.D262Y	RBMX_uc004fac.1_5'Flank|RBMX_uc011mwf.1_Silent_p.A153A|RBMX_uc004fad.1_Missense_Mutation_p.D262Y|RBMX_uc011mwg.1_Missense_Mutation_p.D223Y|RBMX_uc004faf.1_Missense_Mutation_p.D123Y|RBMX_uc010nsf.1_Missense_Mutation_p.D223Y|RBMX_uc004fag.1_Missense_Mutation_p.D134Y	NM_002139	NP_002130	P38159	HNRPG_HUMAN	RNA binding motif protein, X-linked isoform 1	262						catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					CCATCTCTATCGCTAAATTAA	0.388													4	139	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16974141	16974141	+	RNA	DEL	G	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974141delG	uc009vow.2	+	5		c.951delG			CROCCL1_uc001azg.1_5'Flank|CROCCL1_uc001azi.1_5'Flank|MST1P2_uc010ocg.1_RNA|MST1P2_uc010och.1_Intron|MST1P2_uc010oci.1_RNA|MST1P2_uc001azk.2_Intron|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_Intron|MST1P2_uc001azm.3_Intron					Homo sapiens cDNA FLJ53774 complete cds, moderately similar to Hepatocyte growth factor-like protein precursor.												0						TGGCTTGGCCGGGGAGGTCAG	0.667													7	4	---	---	---	---	
ARID1A	8289	broad.mit.edu	37	1	27099309	27099309	+	Frame_Shift_Del	DEL	C	-	-	rs138311127		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27099309delC	uc001bmv.1	+	14	3919	c.3546delC	c.(3544-3546)AGCfs	p.S1182fs	ARID1A_uc001bmt.1_Frame_Shift_Del_p.S1181fs|ARID1A_uc001bmu.1_Frame_Shift_Del_p.S1182fs|ARID1A_uc001bmw.1_Frame_Shift_Del_p.S799fs|ARID1A_uc001bmx.1_Frame_Shift_Del_p.S28fs|ARID1A_uc009vsm.1_5'UTR|ARID1A_uc009vsn.1_5'Flank	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1182					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GGAGCAGGAGCAATTCAGTTG	0.478			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								43	29	---	---	---	---	
CYP4Z1	199974	broad.mit.edu	37	1	47534211	47534211	+	Intron	DEL	C	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47534211delC	uc001cqu.1	+							NM_178134	NP_835235	Q86W10	CP4Z1_HUMAN	cytochrome P450 4Z1							endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			skin(1)	1						AGATCCTCAACTTAGCACATG	0.488													32	27	---	---	---	---	
RAB3B	5865	broad.mit.edu	37	1	52446101	52446102	+	Intron	INS	-	A	A	rs80211476		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52446101_52446102insA	uc001cth.2	-							NM_002867	NP_002858	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(1)	1						ctgtctctaccaaaaaaaaaaa	0.218													6	3	---	---	---	---	
TM2D1	83941	broad.mit.edu	37	1	62160525	62160526	+	Intron	INS	-	TA	TA	rs149200386	by1000genomes	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62160525_62160526insTA	uc001czz.1	-							NM_032027	NP_114416	Q9BX74	TM2D1_HUMAN	beta-amyloid binding protein precursor						apoptosis					ovary(1)	1						TAAACCATTATTATATATATAT	0.272													4	2	---	---	---	---	
KANK4	163782	broad.mit.edu	37	1	62712977	62712977	+	Intron	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62712977delT	uc001dah.3	-						KANK4_uc001dai.3_Intron|KANK4_uc001daf.3_Intron|KANK4_uc001dag.3_Intron	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38											ovary(3)|skin(2)|lung(1)	6						AAACAGCTACTtttttttttt	0.244													4	3	---	---	---	---	
TCTEX1D1	200132	broad.mit.edu	37	1	67242226	67242227	+	Intron	DEL	AT	-	-	rs72385752		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67242226_67242227delAT	uc001dcv.2	+						TCTEX1D1_uc009wau.2_Intron|TCTEX1D1_uc009wav.2_Intron	NM_152665	NP_689878	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1												0						CATATTCTACATATAtgtgtgt	0.248													6	4	---	---	---	---	
APOA1BP	128240	broad.mit.edu	37	1	156562641	156562642	+	Intron	INS	-	CA	CA	rs148811958	by1000genomes	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156562641_156562642insCA	uc001fph.2	+						APOA1BP_uc001fpg.2_Intron|APOA1BP_uc001fpi.2_Intron|APOA1BP_uc001fpj.2_Intron|APOA1BP_uc001fpk.2_Intron|APOA1BP_uc010php.1_Intron	NM_144772	NP_658985	Q8NCW5	AIBP_HUMAN	apolipoprotein A-I binding protein precursor							extracellular region	protein binding			central_nervous_system(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCCATGAGTCCCACACACCACC	0.495													4	4	---	---	---	---	
PTPRC	5788	broad.mit.edu	37	1	198648363	198648363	+	Intron	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198648363delT	uc001gur.1	+						PTPRC_uc001gus.1_Intron|PTPRC_uc001gut.1_Intron|PTPRC_uc001guq.2_Intron|PTPRC_uc009wze.1_Intron|PTPRC_uc009wzf.1_Intron|PTPRC_uc010ppg.1_Intron|PTPRC_uc001guu.1_Intron|PTPRC_uc001guv.1_Intron|PTPRC_uc001guw.1_Intron	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C						axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						GAGCTCGTACttttttttttt	0.299													4	2	---	---	---	---	
C1orf100	200159	broad.mit.edu	37	1	244542155	244542157	+	Intron	DEL	GGA	-	-	rs67899905		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244542155_244542157delGGA	uc001iah.2	+						C1orf100_uc001iai.2_Intron	NM_001012970	NP_001012988	Q5SVJ3	CA100_HUMAN	hypothetical protein LOC200159												0	all_cancers(71;3.94e-05)|all_epithelial(71;0.000138)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|all_lung(81;0.0736)|Ovarian(71;0.0761)|Lung NSC(105;0.103)		all cancers(7;8.19e-08)|GBM - Glioblastoma multiforme(7;2.05e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.000984)			GAGACTTCAGGGAGGATGGAAAT	0.399													1	6	---	---	---	---	
DHX57	90957	broad.mit.edu	37	2	39095714	39095714	+	Intron	DEL	A	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39095714delA	uc002rrf.2	-						DHX57_uc002rre.2_5'Flank|DHX57_uc002rrg.2_Intron	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				TGTTCCAGTGAAAAAATTTTA	0.333													3	4	---	---	---	---	
FIGN	55137	broad.mit.edu	37	2	164467360	164467361	+	Frame_Shift_Ins	INS	-	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164467360_164467361insA	uc002uck.1	-	3	1292_1293	c.981_982insT	c.(979-984)GGAGATfs	p.G327fs		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	327_328						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						GAGTCCATATCTCCTTGCCCTG	0.465													89	80	---	---	---	---	
SEPT2	4735	broad.mit.edu	37	2	242263616	242263616	+	Intron	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242263616delT	uc002wbc.2	+						SEPT2_uc002wbd.2_Intron|SEPT2_uc002wbe.1_Intron|SEPT2_uc002wbf.2_Intron|SEPT2_uc002wbg.2_Intron|SEPT2_uc002wbh.2_Intron|SEPT2_uc010zop.1_Intron	NM_001008491	NP_001008491	Q15019	SEPT2_HUMAN	septin 2						cell division|mitosis	actin cytoskeleton|cleavage furrow|condensed chromosome kinetochore|midbody|nucleolus|septin complex|spindle	GTP binding			central_nervous_system(1)	1		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		TGTCTGTGTGTTTTTTTTTTA	0.353													91	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	13246305	13246306	+	IGR	INS	-	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13246305_13246306insT								IQSEC1 (131688 upstream) : NUP210 (111431 downstream)																							atctttctttcttttttttttt	0.030													3	3	---	---	---	---	
CCR3	1232	broad.mit.edu	37	3	46306948	46306948	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46306948delT	uc003cpg.1	+	4	842	c.299delT	c.(298-300)GTTfs	p.V100fs	CCR3_uc003cpi.1_Frame_Shift_Del_p.V100fs|CCR3_uc003cpj.1_Frame_Shift_Del_p.V100fs|CCR3_uc003cpk.1_Frame_Shift_Del_p.V121fs|CCR3_uc010hjb.1_Frame_Shift_Del_p.V118fs|CCR3_uc003cpl.1_Frame_Shift_Del_p.V133fs	NM_178329	NP_847899	P51677	CCR3_HUMAN	CC chemokine receptor 3 isoform 1	100	Extracellular (Potential).				cell adhesion|cellular defense response|chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|inflammatory response|interspecies interaction between organisms|positive regulation of angiogenesis	integral to plasma membrane				ovary(3)|lung(3)|breast(1)|kidney(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		CATAACTGGGTTTTTGGCCAT	0.488													2457	10	---	---	---	---	
SLMAP	7871	broad.mit.edu	37	3	57893702	57893702	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57893702delA	uc003dje.1	+	16	1747	c.1542delA	c.(1540-1542)AGAfs	p.R514fs	SLMAP_uc003djd.1_Frame_Shift_Del_p.R497fs|SLMAP_uc003djf.1_Frame_Shift_Del_p.R476fs|SLMAP_uc003djg.1_Frame_Shift_Del_p.R108fs|SLMAP_uc011bez.1_Intron|SLMAP_uc011bfa.1_Frame_Shift_Del_p.R48fs|SLMAP_uc003djh.2_Intron|SLMAP_uc003dji.1_Frame_Shift_Del_p.R48fs|SLMAP_uc011bfb.1_Frame_Shift_Del_p.R48fs|SLMAP_uc011bfc.1_Intron	NM_007159	NP_009090	Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	514	Cytoplasmic (Potential).|Potential.				muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		AGCTAGCTAGAACAAGTAAAC	0.343													72	9	---	---	---	---	
PDZRN3	23024	broad.mit.edu	37	3	73433413	73433414	+	Frame_Shift_Ins	INS	-	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73433413_73433414insG	uc003dpl.1	-	10	2399_2400	c.2303_2304insC	c.(2302-2304)CCGfs	p.P768fs	PDZRN3_uc011bgh.1_Frame_Shift_Ins_p.P425fs|PDZRN3_uc010hoe.1_Frame_Shift_Ins_p.P466fs|PDZRN3_uc011bgf.1_Frame_Shift_Ins_p.P485fs|PDZRN3_uc011bgg.1_Frame_Shift_Ins_p.P488fs	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	768							ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CCAGGGTGAGCGGGGTGCTGCG	0.649													52	12	---	---	---	---	
GOLGB1	2804	broad.mit.edu	37	3	121409850	121409851	+	Frame_Shift_Ins	INS	-	TC	TC			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121409850_121409851insTC	uc003eei.3	-	14	8471_8472	c.8345_8346insGA	c.(8344-8346)GATfs	p.D2782fs	GOLGB1_uc010hrc.2_Frame_Shift_Ins_p.D2787fs|GOLGB1_uc003eej.3_Frame_Shift_Ins_p.D2748fs	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	2782	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		AAAGAAGAGCATCTCTCTCTCT	0.426													125	33	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180777959	180777960	+	IGR	DEL	GT	-	-	rs72190151		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180777959_180777960delGT								DNAJC19 (70429 upstream) : SOX2OT (503549 downstream)																							ACTCACCAGCgtgtgtgtgtgt	0.282													4	2	---	---	---	---	
UGDH	7358	broad.mit.edu	37	4	39505927	39505928	+	Intron	INS	-	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39505927_39505928insA	uc003guk.1	-						UGDH_uc011byp.1_Intron|UGDH_uc003gul.1_Intron	NM_003359	NP_003350	O60701	UGDH_HUMAN	UDP-glucose dehydrogenase						glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4					NADH(DB00157)	gactccatctcaaaaaaaaaaa	0.139													4	2	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48608293	48608294	+	Intron	INS	-	A	A	rs78643963		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48608293_48608294insA	uc003gyh.1	-						FRYL_uc003gyk.2_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						ctgtctcaaggaaaaaaaaaaa	0.109													4	2	---	---	---	---	
LRBA	987	broad.mit.edu	37	4	151642666	151642666	+	Intron	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151642666delT	uc010ipj.2	-						LRBA_uc003ilt.3_Intron|LRBA_uc003ilu.3_Intron	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					AAGAACTGGGTTTTTTTTTTT	0.284													5	3	---	---	---	---	
KIAA1430	57587	broad.mit.edu	37	4	186097219	186097220	+	Intron	INS	-	A	A	rs149317463	by1000genomes	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186097219_186097220insA	uc003ixf.3	-						KIAA1430_uc003ixg.2_Intron	NM_020827	NP_065878	Q9P2B7	K1430_HUMAN	hypothetical protein LOC57587												0		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;9.44e-26)|Epithelial(43;2.64e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.66e-11)|Colorectal(24;6.03e-05)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000331)|COAD - Colon adenocarcinoma(29;0.000427)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00924)|READ - Rectum adenocarcinoma(43;0.165)		CAGAAAAGAACAAAAAAAAAAG	0.257													5	7	---	---	---	---	
CYP4V2	285440	broad.mit.edu	37	4	187118942	187118945	+	Intron	DEL	TATG	-	-	rs144489932		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187118942_187118945delTATG	uc003iyw.3	+							NM_207352	NP_997235	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily v,						response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		acatctagattatgtagtaattta	0.093													3	3	---	---	---	---	
CDH18	1016	broad.mit.edu	37	5	19747498	19747499	+	Intron	INS	-	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19747498_19747499insT	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CTTTTCTGCAGTTTTTTTTTTT	0.287													4	5	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37349361	37349361	+	Intron	DEL	A	-	-	rs74712044		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37349361delA	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AAAGTAAGACAAAAAAAAAAA	0.279													6	3	---	---	---	---	
CEP120	153241	broad.mit.edu	37	5	122718019	122718020	+	Intron	INS	-	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122718019_122718020insA	uc003ktk.2	-						CEP120_uc011cwq.1_Intron|CEP120_uc010jcz.1_Intron	NM_153223	NP_694955	Q8N960	CE120_HUMAN	coiled-coil domain containing 100							centrosome				ovary(1)	1						TTTTTTATTCTaaaaaaaaaaa	0.322													7	4	---	---	---	---	
IK	3550	broad.mit.edu	37	5	140031161	140031161	+	Intron	DEL	A	-	-	rs75532104		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140031161delA	uc003lgq.2	+						IK_uc011czk.1_Intron	NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein						cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			actccgtctcaaaaaaaaaaa	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141208992	141208993	+	IGR	INS	-	A	A			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141208992_141208993insA								ARAP3 (147192 upstream) : PCDH1 (23690 downstream)																							cagactccgtcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
GEMIN5	25929	broad.mit.edu	37	5	154270615	154270616	+	Intron	INS	-	T	T	rs147642619		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154270615_154270616insT	uc003lvx.3	-						GEMIN5_uc011ddk.1_Intron	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5						ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			tgtgcccggGCTTTTTTTtttt	0.010													4	2	---	---	---	---	
SYCP2L	221711	broad.mit.edu	37	6	10964195	10964195	+	Intron	DEL	T	-	-	rs149829365		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10964195delT	uc003mzo.2	+						SYCP2L_uc010jow.2_Intron	NM_001040274	NP_001035364	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like							nucleus				ovary(1)|skin(1)	2	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			AACTTCTCCAttttttttttt	0.224													5	3	---	---	---	---	
UHRF1BP1	54887	broad.mit.edu	37	6	34840427	34840428	+	3'UTR	DEL	TG	-	-	rs10601787		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34840427_34840428delTG	uc003oju.3	+	21					UHRF1BP1_uc010jvm.1_Intron|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1											ovary(3)	3						CCCAGGAAACTGGGGCTTGCCC	0.500													1	7	---	---	---	---	
C6orf97	80129	broad.mit.edu	37	6	151917830	151917831	+	Intron	INS	-	T	T	rs145300000	by1000genomes	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151917830_151917831insT	uc003qol.2	+							NM_025059	NP_079335	Q8IYT3	CF097_HUMAN	hypothetical protein LOC80129												0		Ovarian(120;0.126)	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)		GCCTCCTCTGATTTTCTAGAAT	0.376													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	156062251	156062251	+	IGR	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156062251delT								NOX3 (285214 upstream) : MIR1202 (205680 downstream)																							cttcctttcctttccttcctt	0.070													5	5	---	---	---	---	
USP42	84132	broad.mit.edu	37	7	6175652	6175653	+	Intron	INS	-	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6175652_6175653insC	uc011jwo.1	+						USP42_uc011jwn.1_Intron|USP42_uc010kth.1_Intron|USP42_uc011jwp.1_Intron|USP42_uc011jwq.1_Intron|USP42_uc011jwr.1_Intron	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42						cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		tttttttttttcgagacagagt	0.114													4	2	---	---	---	---	
CDK14	5218	broad.mit.edu	37	7	90721001	90721004	+	Intron	DEL	GAAG	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90721001_90721004delGAAG	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4						gagaaaGGGAgaaggaaggaagga	0.044													4	5	---	---	---	---	
VPS13B	157680	broad.mit.edu	37	8	100847965	100847973	+	Splice_Site	DEL	AGGTCAGTG	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100847965_100847973delAGGTCAGTG	uc003yiv.2	+	54	10128	c.10017_splice	c.e54+1	p.Q3339_splice	VPS13B_uc003yiw.2_Splice_Site_p.Q3314_splice	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CAGGGAACACAGGTCAGTGAGCCATGTGT	0.402													112	26	---	---	---	---	
PTPLAD2	401494	broad.mit.edu	37	9	21029505	21029506	+	Intron	DEL	TG	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21029505_21029506delTG	uc010miq.1	-						PTPLAD2_uc003zoj.1_Intron|PTPLAD2_uc010mir.1_Intron	NM_001010915	NP_001010915	Q5VWC8	HACD4_HUMAN	protein tyrosine phosphatase-like A domain						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	lyase activity			skin(1)	1				Lung(24;6.02e-14)|LUSC - Lung squamous cell carcinoma(38;1.29e-10)		AAAAGAAAACTGTTTCATATCA	0.342													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	99258675	99258676	+	IGR	INS	-	ACC	ACC	rs142356622	by1000genomes	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99258675_99258676insACC								HABP4 (5058 upstream) : CDC14B (3721 downstream)																							GCGCTGTACTTaccaccaccac	0.515													4	2	---	---	---	---	
C9orf96	169436	broad.mit.edu	37	9	136249341	136249347	+	Intron	DEL	GTGGCAA	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136249341_136249347delGTGGCAA	uc004cdk.2	+						C9orf96_uc004cdl.2_Intron	NM_153710	NP_714921	Q8NE28	SGK71_HUMAN	hypothetical protein LOC169436								ATP binding|protein kinase activity			stomach(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GATGATGGAGGTggcaatgatggtggt	0.246													4	2	---	---	---	---	
LARP4B	23185	broad.mit.edu	37	10	910364	910364	+	Intron	DEL	A	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:910364delA	uc001ifs.1	-							NM_015155	NP_055970	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B								nucleotide binding|RNA binding			ovary(2)|central_nervous_system(1)	3						GTTCaaaattaaaaaaaaaaa	0.388													4	2	---	---	---	---	
NET1	10276	broad.mit.edu	37	10	5495688	5495688	+	Intron	DEL	A	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5495688delA	uc001iia.2	+						NET1_uc010qar.1_Intron|NET1_uc001iib.2_Intron|NET1_uc010qas.1_Intron	NM_001047160	NP_001040625	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming gene 1 isoform						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell growth|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	Rho guanyl-nucleotide exchange factor activity			breast(1)	1						CAGTCTGTTTAAAAAAAAAAA	0.328													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	50541060	50541060	+	IGR	DEL	G	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50541060delG								C10orf71 (5523 upstream) : DRGX (33102 downstream)																							CACCGCTTGTGGCCATCCTTC	0.552													4	2	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	55664679	55664680	+	Intron	DEL	TT	-	-	rs71004495		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55664679_55664680delTT	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				TTCAGAACTCTTAGAGTGACAG	0.297										HNSCC(58;0.16)			2	9	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73330468	73330469	+	Intron	DEL	TG	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73330468_73330469delTG	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc009xql.2_Intron	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						ggtgcaggtctgtgtgtgtgtg	0.297											OREG0020254	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
ZMIZ1	57178	broad.mit.edu	37	10	81066313	81066314	+	Intron	DEL	AG	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81066313_81066314delAG	uc001kaf.2	+						ZMIZ1_uc001kag.2_Intron|ZMIZ1_uc010qlq.1_Intron	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			GGTGGGAGATAGACTGCTGCCT	0.525													2	6	---	---	---	---	
FGFR2	2263	broad.mit.edu	37	10	123260330	123260330	+	Intron	DEL	C	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123260330delC	uc010qtk.1	-						FGFR2_uc010qtg.1_Intron|FGFR2_uc010qth.1_Intron|FGFR2_uc010qti.1_Intron|FGFR2_uc010qtj.1_Intron|FGFR2_uc010qtl.1_Intron|FGFR2_uc010qtm.1_Intron|FGFR2_uc001lfl.3_Intron|FGFR2_uc001lfm.2_Intron|FGFR2_uc001lfg.3_Intron	NM_000141	NP_000132	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 1						angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)	CCTCCCGCCTCCCCGCTCACC	0.562		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				227	30	---	---	---	---	
FOXRED1	55572	broad.mit.edu	37	11	126146195	126146195	+	Intron	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126146195delT	uc001qdi.2	+						FOXRED1_uc010sbn.1_Intron|FOXRED1_uc010sbo.1_Intron|FOXRED1_uc010sbp.1_Intron|FOXRED1_uc010sbq.1_Intron|FOXRED1_uc001qdj.2_Intron|FOXRED1_uc010sbr.1_Intron|FOXRED1_uc001qdk.2_Intron	NM_017547	NP_060017	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing							integral to membrane|mitochondrion	oxidoreductase activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		tgtgtgtgtgtgtgtgtgtgt	0.483													6	4	---	---	---	---	
C1RL	51279	broad.mit.edu	37	12	7249880	7249881	+	Intron	DEL	TT	-	-	rs71743195		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7249880_7249881delTT	uc001qsn.2	-						C1RL_uc009zft.2_Intron	NM_016546	NP_057630	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like						complement activation, classical pathway|innate immune response|proteolysis		serine-type endopeptidase activity			pancreas(1)	1						GATCAGGACGtttttttttttt	0.267													8	4	---	---	---	---	
MAGOHB	55110	broad.mit.edu	37	12	10763420	10763427	+	Intron	DEL	TAGACATG	-	-	rs140380366		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10763420_10763427delTAGACATG	uc001qyq.1	-						MAGOHB_uc001qyr.1_Intron	NM_018048	NP_060518	Q96A72	MGN2_HUMAN	mago-nashi homolog B						mRNA processing|mRNA transport|RNA splicing	nucleus	RNA binding			breast(1)	1						AGATCATTGCTAGACATGTAGACAATAA	0.312													4	10	---	---	---	---	
BCL2L14	79370	broad.mit.edu	37	12	12243579	12243580	+	Intron	DEL	AT	-	-	rs71913876		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12243579_12243580delAT	uc001rac.2	+						ETV6_uc001raa.1_Intron|BCL2L14_uc001raf.1_Intron|BCL2L14_uc001rad.2_Intron|BCL2L14_uc001rae.2_Intron	NM_138723	NP_620049	Q9BZR8	B2L14_HUMAN	BCL2-like 14 isoform 1						apoptosis|regulation of apoptosis	cytosol|endomembrane system|intracellular organelle|membrane	protein binding			skin(1)	1		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		aaaataaaaaataaaaaaaaaa	0.173													2	7	---	---	---	---	
SLC5A8	160728	broad.mit.edu	37	12	101552329	101552334	+	Intron	DEL	TCTCTC	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101552329_101552334delTCTCTC	uc001thz.3	-							NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),						apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						TAAATATGAGtctctctctctctctc	0.223													4	3	---	---	---	---	
CHMP4A	29082	broad.mit.edu	37	14	24684871	24684872	+	5'Flank	INS	-	TC	TC			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24684871_24684872insTC	uc001wni.2	-						TM9SF1_uc010tob.1_5'Flank|CHMP4A_uc010toc.1_5'Flank|CHMP4A_uc001wnj.2_5'UTR|MDP1_uc001wnk.1_Intron|CHMP4A_uc001wnm.1_Intron|MDP1_uc001wnl.1_Intron	NM_014169	NP_054888	Q9BY43	CHM4A_HUMAN	chromatin modifying protein 4A						cellular membrane organization|endosome transport|protein transport	cytoplasmic vesicle membrane|cytosol|late endosome membrane	lipid binding|protein binding			ovary(2)	2				GBM - Glioblastoma multiforme(265;0.0181)		TTCCATCACTGGAGAGGGCAAG	0.609											OREG0022620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	236	134	---	---	---	---	
PLEK2	26499	broad.mit.edu	37	14	67857988	67857989	+	Intron	INS	-	TG	TG	rs3784084		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67857988_67857989insTG	uc001xjh.1	-							NM_016445	NP_057529	Q9NYT0	PLEK2_HUMAN	pleckstrin 2						actin cytoskeleton organization|intracellular signal transduction	cytoplasm|cytoskeleton|lamellipodium membrane				ovary(1)|pancreas(1)	2				all cancers(60;0.000728)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.00953)		AGCAGCTGATAtgtgtgtgtgt	0.342													5	3	---	---	---	---	
HERC2	8924	broad.mit.edu	37	15	28517891	28517892	+	Intron	DEL	TA	-	-	rs75694916		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28517891_28517892delTA	uc001zbj.2	-						HERC2_uc001zbl.1_Intron	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GAAGAAAAGGTAAAGAGAGAGA	0.396													6	3	---	---	---	---	
TJP1	7082	broad.mit.edu	37	15	30020390	30020390	+	Intron	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30020390delT	uc001zcr.2	-						TJP1_uc010azl.2_Intron|TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a						cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CATACTTCCCTTTTTTTTTTT	0.164													4	2	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48054391	48054391	+	Intron	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48054391delT	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvx.1_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		ATACCTTTGGTTTCAGATGGG	0.458													89	31	---	---	---	---	
MAP2K1	5604	broad.mit.edu	37	15	66735771	66735778	+	Intron	DEL	GGAAGATG	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66735771_66735778delGGAAGATG	uc010bhq.2	+						MAP2K1_uc010ujp.1_Intron	NM_002755	NP_002746	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1						activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0						GGACAAGAGAGGAAGATGGGAAGTCAAT	0.351									Cardiofaciocutaneous_syndrome				16	11	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	21071848	21071848	+	Intron	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21071848delT	uc010vbe.1	-							NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		tttttttttcttttttttttt	0.209													7	4	---	---	---	---	
CBLN1	869	broad.mit.edu	37	16	49313637	49313638	+	Intron	INS	-	G	G	rs111507068		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49313637_49313638insG	uc002efq.2	-							NM_004352	NP_004343	P23435	CBLN1_HUMAN	cerebellin 1 precursor						nervous system development|synaptic transmission	cell junction|extracellular region|synapse					0		all_cancers(37;0.0766)|all_lung(18;0.24)				AGGTGGGGGGTGGGGGGGGCGA	0.629													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	60214732	60214735	+	IGR	DEL	TCTT	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60214732_60214735delTCTT								None (None upstream) : None (None downstream)																							ttcttctttctctttctttctttc	0.000													3	3	---	---	---	---	
B3GNT9	84752	broad.mit.edu	37	16	67184256	67184256	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67184256delC	uc002erf.2	-	2	454	c.133delG	c.(133-135)GCGfs	p.A45fs	uc002erg.1_3'UTR	NM_033309	NP_171608	Q6UX72	B3GN9_HUMAN	UDP-GlcNAc:betaGal	45	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity				0						CTCGGTGCCGCCCTCCCTCGC	0.766													4	2	---	---	---	---	
ST3GAL2	6483	broad.mit.edu	37	16	70422032	70422032	+	Intron	DEL	C	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70422032delC	uc002eyw.2	-						ST3GAL2_uc002eyx.2_Intron	NM_006927	NP_008858	Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase						amino sugar metabolic process	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity			ovary(1)	1		Ovarian(137;0.0694)				aaaaaaaaaacaaacaaaaaa	0.234													4	2	---	---	---	---	
USP6	9098	broad.mit.edu	37	17	5035457	5035457	+	Intron	DEL	G	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5035457delG	uc002gau.1	+						USP6_uc002gav.1_Intron|USP6_uc010ckz.1_Intron|USP6_uc002gaw.2_Intron|uc002gay.1_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6						protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						CCCCATGCCAGGGGCCCCAGT	0.637			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								3	3	---	---	---	---	
TMEM220	388335	broad.mit.edu	37	17	10619317	10619318	+	Intron	INS	-	GATA	GATA	rs146093202	by1000genomes	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10619317_10619318insGATA	uc002gmx.2	-						TMEM220_uc002gmy.2_Intron	NM_001004313	NP_001004313	Q6QAJ8	TM220_HUMAN	transmembrane protein 220							integral to membrane					0						tataCTGCCCTGACACAAAATG	0.203													9	6	---	---	---	---	
ADAM11	4185	broad.mit.edu	37	17	42852502	42852503	+	Intron	INS	-	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42852502_42852503insC	uc002ihh.2	+						ADAM11_uc010wjd.1_Intron|ADAM11_uc002ihi.2_5'Flank	NM_002390	NP_002381	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11 preproprotein						integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			pancreas(1)	1		Prostate(33;0.0959)				CCCCCAGTGTACCCCCTCCCCA	0.668											OREG0024464	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	64	11	---	---	---	---	
TAC4	255061	broad.mit.edu	37	17	47925054	47925055	+	Intron	INS	-	AC	AC	rs150685532	by1000genomes	TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47925054_47925055insAC	uc002ipo.1	-						TAC4_uc002ipp.1_Intron|TAC4_uc002ipq.1_Intron|TAC4_uc002ipr.1_Intron|TAC4_uc002ips.1_Intron|TAC4_uc002ipt.2_Intron|TAC4_uc002ipu.2_Intron	NM_170685	NP_733786	Q86UU9	TKN4_HUMAN	tachykinin 4 isoform alpha						regulation of blood pressure	extracellular region				breast(1)	1						cacacacacagacacacacaca	0.183													3	4	---	---	---	---	
RSAD1	55316	broad.mit.edu	37	17	48561913	48561914	+	Intron	INS	-	G	G			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48561913_48561914insG	uc002iqw.1	+						RSAD1_uc010wmq.1_RNA	NM_018346	NP_060816	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing						porphyrin biosynthetic process	mitochondrion	4 iron, 4 sulfur cluster binding|coproporphyrinogen oxidase activity|metal ion binding				0	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			ACAGGTGTGTTGGGGGGTGCCG	0.614													378	13	---	---	---	---	
C19orf44	84167	broad.mit.edu	37	19	16625197	16625198	+	Intron	INS	-	A	A	rs76201706		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16625197_16625198insA	uc002neh.1	+						MED26_uc002nee.2_Intron|C19orf44_uc002neg.2_Intron|C19orf44_uc010eai.1_Intron	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167												0						cctgtctccagaaaaaaaaaaa	0.282													3	3	---	---	---	---	
LRFN3	79414	broad.mit.edu	37	19	36431511	36431517	+	Frame_Shift_Del	DEL	CCAGCTG	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36431511_36431517delCCAGCTG	uc002oco.2	+	2	1636_1642	c.1184_1190delCCAGCTG	c.(1183-1191)ACCAGCTGTfs	p.T395fs		NM_024509	NP_078785	Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III	395_397	Extracellular (Potential).				cell adhesion	axon|cell junction|dendrite|integral to membrane|postsynaptic membrane|presynaptic membrane					0	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GCCAACAGCACCAGCTGTGACCCCCCG	0.671													68	36	---	---	---	---	
ZNF382	84911	broad.mit.edu	37	19	37118584	37118585	+	3'UTR	DEL	AC	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37118584_37118585delAC	uc002oek.2	+	5					ZNF382_uc010efa.2_3'UTR|ZNF382_uc010efb.2_3'UTR|ZNF382_uc002oel.2_3'UTR	NM_032825	NP_116214	Q96SR6	ZN382_HUMAN	zinc finger protein 382						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AGCCTGTAAAacacacacacac	0.198													4	2	---	---	---	---	
RYR1	6261	broad.mit.edu	37	19	39009568	39009568	+	Intron	DEL	A	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39009568delA	uc002oit.2	+						RYR1_uc002oiu.2_Intron|RYR1_uc002oiv.1_Intron|RYR1_uc010xuf.1_Intron	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	actctgtctcaaaaaaaaaaa	0.249													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	50223427	50223427	+	IGR	DEL	T	-	-	rs12979136		TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50223427delT								CPT1C (6439 upstream) : TSKS (19585 downstream)																							tttccttttcttttttttttt	0.229													6	3	---	---	---	---	
TPX2	22974	broad.mit.edu	37	20	30382555	30382556	+	Intron	INS	-	AT	AT			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30382555_30382556insAT	uc002wwp.1	+						TPX2_uc010gdv.1_Intron	NM_012112	NP_036244	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated protein homolog						activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			gtctctgtcgcatagtgtgtgt	0.050													4	2	---	---	---	---	
CBFA2T2	9139	broad.mit.edu	37	20	32161762	32161763	+	Intron	INS	-	T	T			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32161762_32161763insT	uc002wzg.1	+						CBFA2T2_uc010zug.1_Intron|CBFA2T2_uc002wze.1_Intron|CBFA2T2_uc002wzf.1_Intron|CBFA2T2_uc002wzh.1_Intron|CBFA2T2_uc002wzi.1_5'Flank	NM_005093	NP_005084	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit							nucleus	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)|skin(1)	2						aatttttcttattttttttttt	0.000													4	2	---	---	---	---	
CTCFL	140690	broad.mit.edu	37	20	56099187	56099187	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56099187delT	uc010gix.1	-	1	737	c.75delA	c.(73-75)AAAfs	p.K25fs	CTCFL_uc010giw.1_Frame_Shift_Del_p.K25fs|CTCFL_uc002xym.2_Frame_Shift_Del_p.K25fs|CTCFL_uc010giz.1_Intron|CTCFL_uc010giy.1_Intron|CTCFL_uc010gja.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gjb.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gjc.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gjd.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gje.2_Frame_Shift_Del_p.K25fs|CTCFL_uc010gjf.2_Intron|CTCFL_uc010gjg.2_Intron|CTCFL_uc010gjh.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gji.1_Intron|CTCFL_uc010gjj.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gjk.1_Frame_Shift_Del_p.K25fs|CTCFL_uc010gjl.1_Frame_Shift_Del_p.K25fs	NM_080618	NP_542185	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor-like protein	25					cell cycle|DNA methylation involved in gamete generation|histone methylation|positive regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|regulation of histone H3-K4 methylation|transcription, DNA-dependent	cytoplasm|nucleus	histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|skin(1)	4	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			CCTTCAGGCCTTTTTCCGGCA	0.502													723	7	---	---	---	---	
DPH3B	100132911	broad.mit.edu	37	20	61477003	61477004	+	5'UTR	INS	-	C	C			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61477003_61477004insC	uc011aan.1	+	1					TCFL5_uc002ydo.2_Intron|TCFL5_uc002ydp.2_Intron	NM_080750	NP_542788	Q9H4G8	DPH3B_HUMAN	DPH3B, KTI11 homolog B								metal ion binding				0						CCCTTCAGCAACCCCCGCTGAC	0.554													17	11	---	---	---	---	
IFNAR1	3454	broad.mit.edu	37	21	34725008	34725008	+	Intron	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34725008delT	uc002yrn.2	+						IFNAR1_uc011adv.1_Intron	NM_000629	NP_000620	P17181	INAR1_HUMAN	interferon-alpha receptor 1 precursor						JAK-STAT cascade|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	integral to plasma membrane	type I interferon receptor activity			central_nervous_system(1)|skin(1)	2					Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)	AAAGCACATATTCCCTGATTT	0.254													23	16	---	---	---	---	
CYTSA	23384	broad.mit.edu	37	22	24761815	24761815	+	Intron	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24761815delT	uc002zzw.2	+						CYTSA_uc002zzv.3_Intron|CYTSA_uc011ajq.1_Intron	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A						cell cycle|cell division						0						CAGCTGTATCTTTTTTTTTTT	0.343													4	2	---	---	---	---	
PHF6	84295	broad.mit.edu	37	X	133548080	133548080	+	Intron	DEL	T	-	-			TCGA-BL-A0C8-01	TCGA-BL-A0C8-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133548080delT	uc004exj.2	+						PHF6_uc004exk.2_Intron|PHF6_uc011mvk.1_Intron|PHF6_uc004exh.2_Intron|PHF6_uc010nrr.2_Intron|PHF6_uc004exi.2_Intron	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					GCCCAAATGATTTTTTTTTTA	0.303													340	10	---	---	---	---	
