Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRDM16	63976	broad.mit.edu	37	1	3334507	3334507	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3334507C>T	uc001akf.2	+	11	2887	c.2807C>T	c.(2806-2808)CCC>CTC	p.P936L	PRDM16_uc001akc.2_Missense_Mutation_p.P935L|PRDM16_uc001akd.2_Missense_Mutation_p.P935L|PRDM16_uc001ake.2_Missense_Mutation_p.P936L|PRDM16_uc009vlh.2_Missense_Mutation_p.P636L	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1	936	Mediates interaction with SKI and regulation of TGF-beta signaling.|Interaction with CTBP1 and CTBP2 (By similarity).				brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		CGGTCCCCACCCCCAACGCTC	0.657			T	EVI1	MDS|AML								21	36	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16907273	16907273	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16907273C>T	uc009vos.1	-	16	2446	c.1558G>A	c.(1558-1560)GAT>AAT	p.D520N	NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Missense_Mutation_p.D249N	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	520	NBPF 2.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TGACATTCATCATGAGAGGAT	0.463													82	652	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16974549	16974549	+	RNA	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974549C>G	uc009vow.2	+	5		c.1359C>G			MST1P2_uc010ocg.1_RNA|MST1P2_uc010och.1_RNA|MST1P2_uc010oci.1_RNA|MST1P2_uc001azk.2_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA					Homo sapiens cDNA FLJ53774 complete cds, moderately similar to Hepatocyte growth factor-like protein precursor.												0						GGGCTGAGTGCAGCGCCTGCT	0.692													5	52	---	---	---	---	PASS
OSCP1	127700	broad.mit.edu	37	1	36904449	36904449	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36904449G>C	uc001cap.2	-	3	287	c.205C>G	c.(205-207)CAA>GAA	p.Q69E	OSCP1_uc001caq.2_Missense_Mutation_p.Q59E|OSCP1_uc001car.2_Missense_Mutation_p.Q59E	NM_145047	NP_659484	Q8WVF1	OSCP1_HUMAN	oxidored-nitro domain-containing protein isoform	69					transport	basal plasma membrane				ovary(2)|central_nervous_system(1)|pancreas(1)	4						TAGAGCTCTTGAGGCTTGAAT	0.468													15	50	---	---	---	---	PASS
DISP1	84976	broad.mit.edu	37	1	223178660	223178660	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223178660G>C	uc001hnu.1	+	8	4068	c.3921G>C	c.(3919-3921)CAG>CAC	p.Q1307H		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	1307					diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)		GCTTTGTCCAGATCCAAAACG	0.577													18	87	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1670223	1670223	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1670223C>G	uc002qxa.2	-	10	1118	c.1054G>C	c.(1054-1056)GAG>CAG	p.E352Q	PXDN_uc002qxb.1_Missense_Mutation_p.E352Q|PXDN_uc002qxc.1_Missense_Mutation_p.E169Q	NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	352	Ig-like C2-type 2.				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		ACCAGCACCTCTGTATTCTGT	0.532													6	17	---	---	---	---	PASS
NRBP1	29959	broad.mit.edu	37	2	27656553	27656553	+	Missense_Mutation	SNP	A	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27656553A>G	uc002rko.2	+	4	1056	c.224A>G	c.(223-225)AAT>AGT	p.N75S	NRBP1_uc002rkq.2_Missense_Mutation_p.N75S|NRBP1_uc002rkp.2_Missense_Mutation_p.N75S|NRBP1_uc002rkr.2_5'Flank	NM_013392	NP_037524	Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein	75	Protein kinase.				ER to Golgi vesicle-mediated transport|gene expression|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cell cortex|endomembrane system|lamellipodium|membrane|nucleoplasm	ATP binding|protein homodimerization activity|protein kinase activity			ovary(2)|lung(1)	3	Acute lymphoblastic leukemia(172;0.155)					AATCAACGGAATGTACCAGGT	0.418													9	80	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32694656	32694656	+	Silent	SNP	A	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32694656A>G	uc010ezu.2	+	30	6455	c.6321A>G	c.(6319-6321)GAA>GAG	p.E2107E		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	2107					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					ACAATTCGGAACAGCTTCTCA	0.388													20	167	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33500072	33500072	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33500072G>C	uc002ros.2	+	17	2787	c.2787G>C	c.(2785-2787)CAG>CAC	p.Q929H	LTBP1_uc002rot.2_Missense_Mutation_p.Q603H|LTBP1_uc002rou.2_Missense_Mutation_p.Q602H|LTBP1_uc002rov.2_Missense_Mutation_p.Q549H|LTBP1_uc010ymz.1_Missense_Mutation_p.Q602H|LTBP1_uc010yna.1_Missense_Mutation_p.Q549H	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	928	EGF-like 5; calcium-binding (Potential).				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TCTGCTCCCAGGGCCGCTGTG	0.438													24	84	---	---	---	---	PASS
C2orf42	54980	broad.mit.edu	37	2	70409093	70409093	+	Missense_Mutation	SNP	T	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70409093T>C	uc002sgh.2	-	3	353	c.25A>G	c.(25-27)AAA>GAA	p.K9E		NM_017880	NP_060350	Q9NWW7	CB042_HUMAN	hypothetical protein LOC54980	9											0						GCTGGGACTTTAGTCCTCAGA	0.438													13	46	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89442281	89442281	+	RNA	SNP	A	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89442281A>G	uc010ytr.1	-	33		c.4136T>C			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GCCCTGCAGGAGAGGGTGGCT	0.537													11	52	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100167951	100167951	+	Silent	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100167951G>A	uc002tag.2	-	24	3902	c.3666C>T	c.(3664-3666)AGC>AGT	p.S1222S	AFF3_uc002taf.2_Silent_p.S1247S	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	1222					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	p.G1222>V(1)		ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						ACAGGTGGGCGCTGTTCCGCA	0.612													7	20	---	---	---	---	PASS
GCC2	9648	broad.mit.edu	37	2	109102293	109102293	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109102293G>A	uc002tec.2	+	15	3875	c.3721G>A	c.(3721-3723)GAT>AAT	p.D1241N	GCC2_uc002ted.2_Missense_Mutation_p.D1140N	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	1241	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						ATAGGAAACTGATCACTTAAT	0.274													3	26	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168106607	168106607	+	Missense_Mutation	SNP	A	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168106607A>G	uc002udx.2	+	8	8723	c.8705A>G	c.(8704-8706)AAG>AGG	p.K2902R	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.K2727R|XIRP2_uc010fpq.2_Missense_Mutation_p.K2680R|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Missense_Mutation_p.K248R	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2727					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						CTCGAAGTCAAGGGCATACAA	0.378													12	30	---	---	---	---	PASS
SSB	6741	broad.mit.edu	37	2	170666827	170666827	+	Missense_Mutation	SNP	A	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170666827A>C	uc002ufk.2	+	9	811	c.704A>C	c.(703-705)AAA>ACA	p.K235T	SSB_uc002ufl.2_Missense_Mutation_p.K235T|SSB_uc002ufm.2_Missense_Mutation_p.K235T	NM_003142	NP_003133	P05455	LA_HUMAN	autoantigen La	235					histone mRNA metabolic process|tRNA modification	nucleus|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding|tRNA binding			skin(3)|pancreas(1)	4						TGCTTGCTGAAATTTTCGGGT	0.333													10	46	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098810	178098810	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098810C>T	uc002ulh.3	-	2	790	c.235G>A	c.(235-237)GAG>AAG	p.E79K	NFE2L2_uc002ulg.3_Missense_Mutation_p.E63K|NFE2L2_uc010zfa.1_Missense_Mutation_p.E63K|NFE2L2_uc002uli.3_Missense_Mutation_p.E63K|NFE2L2_uc010fra.2_Missense_Mutation_p.E63K|NFE2L2_uc010frb.2_Missense_Mutation_p.E63K	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	79					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TCACCTGTCTCTTCATCTAGT	0.443			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			23	44	---	---	---	---	PASS
CCDC108	255101	broad.mit.edu	37	2	219884302	219884302	+	Silent	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219884302C>T	uc002vjl.1	-	20	3483	c.3399G>A	c.(3397-3399)CTG>CTA	p.L1133L	CCDC108_uc002vjm.3_Silent_p.L18L	NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1	1133						integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TAAGCAGGTCCAGAGAGAAGA	0.622													8	42	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220337742	220337742	+	Silent	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220337742C>T	uc010fwg.2	+	16	4071	c.4071C>T	c.(4069-4071)TTC>TTT	p.F1357F		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	1357	Fibronectin type-III 1.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AGCACATCTTCCGGGTCCTCA	0.672													19	46	---	---	---	---	PASS
CCR5	1234	broad.mit.edu	37	3	46414642	46414642	+	Silent	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46414642C>T	uc003cpo.3	+	3	371	c.249C>T	c.(247-249)GTC>GTT	p.V83V	CCR5_uc010hjd.2_Silent_p.V83V	NM_001100168	NP_001093638	P51681	CCR5_HUMAN	chemokine (C-C motif) receptor 5	83	Helical; Name=2; (Potential).				cell-cell signaling|cellular defense response|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|entry into host cell|immune response|inflammatory response|initiation of viral infection	endosome|external side of plasma membrane|integral to plasma membrane	actin binding|C-C chemokine receptor activity|coreceptor activity|phosphatidylinositol phospholipase C activity			lung(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)	Maraviroc(DB04835)	TTCTTACTGTCCCCTTCTGGG	0.473													35	162	---	---	---	---	PASS
HYAL3	8372	broad.mit.edu	37	3	50331065	50331065	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50331065C>G	uc003czd.1	-	3	1255	c.982G>C	c.(982-984)GAG>CAG	p.E328Q	HYAL3_uc003czc.1_Intron|HYAL3_uc003cze.1_Missense_Mutation_p.E79Q|HYAL3_uc003czf.1_Intron|HYAL3_uc003czg.1_Intron|IFRD2_uc011bdp.1_5'Flank|IFRD2_uc003czb.2_5'Flank	NM_003549	NP_003540	O43820	HYAL3_HUMAN	hyaluronoglucosaminidase 3 precursor	328					carbohydrate metabolic process	extracellular region|lysosome	hyalurononglucosaminidase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		ATGATCACCTCAGAGCTGGAG	0.587													12	103	---	---	---	---	PASS
IGSF11	152404	broad.mit.edu	37	3	118624510	118624510	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118624510C>G	uc003ebw.2	-	5	883	c.636G>C	c.(634-636)TTG>TTC	p.L212F	IGSF11_uc011biv.1_Missense_Mutation_p.L212F|IGSF11_uc003ebx.2_Intron|IGSF11_uc003eby.2_Missense_Mutation_p.L211F|IGSF11_uc003ebz.2_Intron|IGSF11_uc010hqs.2_Missense_Mutation_p.L211F	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b	212	Ig-like C2-type.|Extracellular (Potential).				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0						CGCACTGGTACAAACCTGAAG	0.468													4	60	---	---	---	---	PASS
SRPRB	58477	broad.mit.edu	37	3	133524732	133524732	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133524732G>A	uc003epx.1	+	1	56	c.40G>A	c.(40-42)GGT>AGT	p.G14S		NM_021203	NP_067026	Q9Y5M8	SRPRB_HUMAN	signal recognition particle receptor, beta	14						endoplasmic reticulum membrane|integral to membrane	GTP binding|protein binding|receptor activity			ovary(1)	1						AGATGGCGGCGGTGCCGGGGG	0.672													14	49	---	---	---	---	PASS
WDR49	151790	broad.mit.edu	37	3	167249008	167249008	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167249008C>G	uc003fev.1	-	9	1363	c.1057G>C	c.(1057-1059)GAC>CAC	p.D353H	WDR49_uc003feu.1_Missense_Mutation_p.D178H|WDR49_uc011bpd.1_Missense_Mutation_p.D417H|WDR49_uc003few.1_Intron	NM_178824	NP_849146	Q8IV35	WDR49_HUMAN	WD repeat domain 49	353										large_intestine(1)|ovary(1)|skin(1)	3						GTAGAATGGTCTGCCATGGGG	0.433													4	26	---	---	---	---	PASS
GHSR	2693	broad.mit.edu	37	3	172166168	172166168	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172166168G>C	uc003fib.1	-	1	36	c.36C>G	c.(34-36)TTC>TTG	p.F12L	GHSR_uc011bpv.1_Missense_Mutation_p.F12L	NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a	12	Extracellular (Potential).				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			GTGTGAGGTTGAACCCCGGCT	0.697													11	23	---	---	---	---	PASS
CEP135	9662	broad.mit.edu	37	4	56885642	56885642	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56885642C>T	uc003hbi.2	+	23	3370	c.3136C>T	c.(3136-3138)CAT>TAT	p.H1046Y	CEP135_uc003hbj.2_Missense_Mutation_p.H752Y	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	1046					centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					TAAAGAATTTCATTCTCACTT	0.358													5	23	---	---	---	---	PASS
CYP2U1	113612	broad.mit.edu	37	4	108866647	108866647	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108866647G>A	uc003hyp.2	+	2	1095	c.1012G>A	c.(1012-1014)GAT>AAT	p.D338N	CYP2U1_uc011cfi.1_Missense_Mutation_p.D129N	NM_183075	NP_898898	Q7Z449	CP2U1_HUMAN	cytochrome P450, family 2, subfamily U,	338					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000128)		CAGCAGTTTTGATGAAGAGTA	0.413													18	73	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153247289	153247289	+	Missense_Mutation	SNP	G	C	C	rs149680468		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153247289G>C	uc003ims.2	-	10	1662	c.1513C>G	c.(1513-1515)CGC>GGC	p.R505G	FBXW7_uc011cii.1_Missense_Mutation_p.R505G|FBXW7_uc003imt.2_Missense_Mutation_p.R505G|FBXW7_uc011cih.1_Missense_Mutation_p.R329G|FBXW7_uc003imq.2_Missense_Mutation_p.R425G|FBXW7_uc003imr.2_Missense_Mutation_p.R387G	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	505	WD 4.		R -> L (in an ovarian cancer cell line).		interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	p.R505C(36)|p.R505L(6)|p.R505G(4)|p.R425C(2)|p.R425G(2)|p.R266G(2)|p.R505H(2)|p.R505S(1)|p.R505P(1)|p.R266C(1)		haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGAACACAGCGGACTGCTGCA	0.468			Mis|N|D|F		colorectal|endometrial|T-ALL								6	41	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187540912	187540912	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187540912G>C	uc003izf.2	-	10	7016	c.6828C>G	c.(6826-6828)ATC>ATG	p.I2276M		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	2276	Extracellular (Potential).|Cadherin 20.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						GGTTATCATTGATGTCGTCTA	0.493										HNSCC(5;0.00058)			20	114	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11732250	11732250	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11732250G>T	uc003jfa.1	-	2	317	c.172C>A	c.(172-174)CAG>AAG	p.Q58K	CTNND2_uc011cmz.1_5'UTR|CTNND2_uc010itu.1_RNA	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	58	Potential.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						GTTTCTACCTGTTCTTTGACT	0.418													9	47	---	---	---	---	PASS
SV2C	22987	broad.mit.edu	37	5	75594618	75594618	+	Splice_Site	SNP	G	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75594618G>T	uc003kei.1	+	10	1637	c.1503_splice	c.e10-1	p.R501_splice		NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		GTGTTGGGCAGATTCATAGGG	0.383													7	111	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89969991	89969991	+	Missense_Mutation	SNP	A	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89969991A>C	uc003kju.2	+	23	5146	c.5050A>C	c.(5050-5052)AGC>CGC	p.S1684R	GPR98_uc003kjt.2_5'UTR|GPR98_uc010jba.1_RNA	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	1684	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CAGTGGTGCAAGCATAGATCC	0.423													6	27	---	---	---	---	PASS
SLCO4C1	353189	broad.mit.edu	37	5	101592818	101592818	+	Splice_Site	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101592818C>T	uc003knm.2	-	8	1756	c.1469_splice	c.e8+1	p.G490_splice		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,						cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		ATTGTATTTACCCATTATATG	0.323													10	43	---	---	---	---	PASS
PCDHAC1	56135	broad.mit.edu	37	5	140306514	140306514	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140306514G>A	uc003lih.2	+	1	213	c.37G>A	c.(37-39)GTT>ATT	p.V13I	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lig.1_Missense_Mutation_p.V13I	NM_018898	NP_061721	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1 isoform 1	13					homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGTTTGTGGGTTTCCTGCGG	0.632													5	50	---	---	---	---	PASS
PCDHB6	56130	broad.mit.edu	37	5	140531711	140531711	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140531711G>T	uc003lir.2	+	1	1873	c.1873G>T	c.(1873-1875)GCC>TCC	p.A625S	PCDHB6_uc011dah.1_Missense_Mutation_p.A489S	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	625	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGCGCACCGCCAGGCTGCT	0.687													11	45	---	---	---	---	PASS
GABRA1	2554	broad.mit.edu	37	5	161300148	161300148	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161300148G>A	uc010jiw.2	+	6	749	c.281G>A	c.(280-282)CGT>CAT	p.R94H	GABRA1_uc010jix.2_Missense_Mutation_p.R94H|GABRA1_uc010jiy.2_Missense_Mutation_p.R94H|GABRA1_uc003lyx.3_Missense_Mutation_p.R94H|GABRA1_uc010jiz.2_Missense_Mutation_p.R94H|GABRA1_uc010jja.2_Missense_Mutation_p.R94H|GABRA1_uc010jjb.2_Missense_Mutation_p.R94H	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	94	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	p.R94H(1)		ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)	GTATTTTTCCGTCAAAGCTGG	0.373													4	35	---	---	---	---	PASS
HIST1H1C	3006	broad.mit.edu	37	6	26056674	26056674	+	5'UTR	SNP	C	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26056674C>A	uc003nfw.2	-	1						NM_005319	NP_005310	P16403	H12_HUMAN	histone cluster 1, H1c						nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(3)|skin(2)	5						ATCAAAAACTCGGGTACAAGT	0.617													3	48	---	---	---	---	PASS
PSMB9	5698	broad.mit.edu	37	6	32827509	32827509	+	3'UTR	SNP	T	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32827509T>C	uc003sga.2	+	7						NM_148954	NP_683756	P28065	PSB9_HUMAN	proteasome beta 9 subunit isoform 2 proprotein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0						GGGACTAAACTAGAAATATAA	0.403													5	10	---	---	---	---	PASS
CUL9	23113	broad.mit.edu	37	6	43174208	43174208	+	Silent	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43174208C>T	uc003ouk.2	+	26	5247	c.5172C>T	c.(5170-5172)TTC>TTT	p.F1724F	CUL9_uc003oul.2_Silent_p.F1724F|CUL9_uc010jyk.2_Silent_p.F876F	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	1724					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						CCACAGAATTCTGTGATGCCC	0.542													22	96	---	---	---	---	PASS
ZNF318	24149	broad.mit.edu	37	6	43305865	43305865	+	Silent	SNP	A	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43305865A>T	uc003oux.2	-	10	5949	c.5871T>A	c.(5869-5871)GCT>GCA	p.A1957A	ZNF318_uc003ouw.2_Intron	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1957					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CATCCCAAACAGCCAACTCAT	0.428													11	83	---	---	---	---	PASS
SLC35B2	347734	broad.mit.edu	37	6	44223092	44223092	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44223092G>A	uc003oxd.2	-	4	786	c.650C>T	c.(649-651)GCC>GTC	p.A217V	SLC35B2_uc011dvt.1_Missense_Mutation_p.A120V|SLC35B2_uc011dvu.1_Missense_Mutation_p.A84V	NM_178148	NP_835361	Q8TB61	S35B2_HUMAN	solute carrier family 35, member B2	217					positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CACCTTAGAGGCCTTGGCCAG	0.562													20	100	---	---	---	---	PASS
ENPP3	5169	broad.mit.edu	37	6	131979502	131979502	+	Silent	SNP	A	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131979502A>G	uc003qcu.3	+	7	851	c.504A>G	c.(502-504)GGA>GGG	p.G168G	ENPP3_uc010kfn.1_RNA|ENPP3_uc011ecc.1_Silent_p.G134G|ENPP3_uc010kfo.1_RNA|ENPP3_uc010kfp.1_RNA|ENPP3_uc010kfq.2_RNA|ENPP3_uc003qcv.2_Silent_p.G168G	NM_005021	NP_005012	O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	168	Extracellular (Potential).|Phosphodiesterase.				immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity			ovary(3)|skin(1)	4	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		CTATGGATGGATTTAGAGCTG	0.338													3	23	---	---	---	---	PASS
GPR126	57211	broad.mit.edu	37	6	142725101	142725101	+	Silent	SNP	G	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142725101G>T	uc010khc.2	+	14	2529	c.2118G>T	c.(2116-2118)TCG>TCT	p.S706S	GPR126_uc010khd.2_Silent_p.S678S|GPR126_uc010khe.2_Silent_p.S706S|GPR126_uc010khf.2_Silent_p.S678S	NM_020455	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126 alpha 1	706	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		ATAATGAATCGTATTTCCAGG	0.313													3	47	---	---	---	---	PASS
SHPRH	257218	broad.mit.edu	37	6	146275906	146275906	+	Missense_Mutation	SNP	T	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146275906T>C	uc003qlf.2	-	2	952	c.553A>G	c.(553-555)ATG>GTG	p.M185V	SHPRH_uc003qld.2_Missense_Mutation_p.M185V|SHPRH_uc003qle.2_Missense_Mutation_p.M185V|SHPRH_uc003qlg.1_5'UTR|SHPRH_uc003qlj.1_Missense_Mutation_p.M74V|SHPRH_uc003qlk.1_Missense_Mutation_p.M185V	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase isoform a	185				M -> V (in Ref. 3; CAH18145).	DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)|kidney(1)|central_nervous_system(1)	3		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		TCTTCTAACATTTCACCACTG	0.363													19	46	---	---	---	---	PASS
ARID1B	57492	broad.mit.edu	37	6	157517418	157517418	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157517418C>T	uc003qqn.2	+	16	4080	c.3928C>T	c.(3928-3930)CAG>TAG	p.Q1310*	ARID1B_uc003qqo.2_Nonsense_Mutation_p.Q1270*|ARID1B_uc003qqp.2_Nonsense_Mutation_p.Q1257*	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1315					chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GCAGCGCCAGCAGTTTCCCTA	0.478													34	167	---	---	---	---	PASS
RBAK	57786	broad.mit.edu	37	7	5103941	5103941	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5103941G>C	uc010kss.1	+	6	1178	c.854G>C	c.(853-855)GGA>GCA	p.G285A	LOC389458_uc003snr.2_Intron|RBAK_uc003sns.1_Missense_Mutation_p.G285A	NM_021163	NP_066986	Q9NYW8	RBAK_HUMAN	RB-associated KRAB repressor	285					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(3)|kidney(1)|skin(1)	5		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		GCTCACACAGGAGAGAAACCT	0.418													10	39	---	---	---	---	PASS
FERD3L	222894	broad.mit.edu	37	7	19184848	19184848	+	Silent	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19184848G>A	uc003suo.1	-	1	197	c.138C>T	c.(136-138)CTC>CTT	p.L46L	uc003sun.1_RNA	NM_152898	NP_690862	Q96RJ6	FER3L_HUMAN	nephew of atonal 3	46					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			large_intestine(1)	1						TTCCCTCTCGGAGCGCAAGGG	0.453													4	44	---	---	---	---	PASS
NPVF	64111	broad.mit.edu	37	7	25264765	25264765	+	Silent	SNP	A	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25264765A>G	uc003sxo.2	-	3	614	c.567T>C	c.(565-567)GAT>GAC	p.D189D		NM_022150	NP_071433	Q9HCQ7	RFRP_HUMAN	neuropeptide VF precursor	189					neuropeptide signaling pathway	extracellular region|membrane	G-protein coupled receptor activity			ovary(1)	1						TCAATTCTGCATCATCTATTT	0.393													6	48	---	---	---	---	PASS
CDHR3	222256	broad.mit.edu	37	7	105603685	105603685	+	5'UTR	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105603685C>T	uc003vdl.3	+	1					CDHR3_uc003vdk.2_Intron|CDHR3_uc011kls.1_RNA|CDHR3_uc003vdm.3_5'UTR|CDHR3_uc011klt.1_5'UTR	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						TGAGTGGCTTCTGGAATAAAC	0.498													5	33	---	---	---	---	PASS
PAX4	5078	broad.mit.edu	37	7	127255466	127255466	+	Missense_Mutation	SNP	G	A	A	rs35155575	byFrequency	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127255466G>A	uc010lld.1	-	1	315	c.109C>T	c.(109-111)CGG>TGG	p.R37W	PAX4_uc003vmf.2_Translation_Start_Site|PAX4_uc003vmg.1_Missense_Mutation_p.R37W|PAX4_uc003vmh.2_Translation_Start_Site	NM_006193	NP_006184	O43316	PAX4_HUMAN	paired box 4	45	Paired.		R -> W (associated with PKD susceptbility).		cell differentiation|endocrine pancreas development|organ morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TTAAGGATCCGTGAGATGTCA	0.602													13	107	---	---	---	---	PASS
C7orf68	29923	broad.mit.edu	37	7	128097519	128097519	+	3'UTR	SNP	A	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128097519A>C	uc003vne.3	+	2					C7orf68_uc010lli.2_3'UTR|C7orf68_uc010llj.1_Intron	NM_013332	NP_037464	Q9Y5L2	HIG2_HUMAN	hypoxia-inducible protein 2						autocrine signaling|positive regulation of cell proliferation|response to stress	cell surface|extracellular space|integral to membrane|stored secretory granule	receptor binding				0						ATGTGATAAGACCTCCTTCCA	0.537													11	38	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151949162	151949162	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151949162C>G	uc003wla.2	-	11	1702	c.1483G>C	c.(1483-1485)GAG>CAG	p.E495Q		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	495	PHD-type 3.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TTGTCACACTCTAGGTGAACC	0.378			N		medulloblastoma								4	19	---	---	---	---	PASS
FLJ10661	286042	broad.mit.edu	37	8	8088411	8088411	+	RNA	SNP	A	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8088411A>G	uc011kwt.1	+	2		c.275A>G			FLJ10661_uc010lrq.2_RNA|FLJ10661_uc003wsf.3_RNA	NR_024362				Homo sapiens cDNA FLJ60033 complete cds, highly similar to Protein FAM86A.												0						GAGCTGCTGCAGGATATTTTG	0.488													5	34	---	---	---	---	PASS
RAB11FIP1	80223	broad.mit.edu	37	8	37730530	37730530	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37730530G>C	uc003xkm.1	-	4	1834	c.1790C>G	c.(1789-1791)TCT>TGT	p.S597C	RAB11FIP1_uc010lvz.1_Intron|RAB11FIP1_uc003xkn.1_Intron|RAB11FIP1_uc003xkl.1_5'UTR|RAB11FIP1_uc003xko.1_5'UTR|RAB11FIP1_uc003xkp.1_Intron	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3	597	Ser-rich.				protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			AGATGAGAGAGAGGAGAAGAC	0.547													17	98	---	---	---	---	PASS
BAG4	9530	broad.mit.edu	37	8	38065264	38065264	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38065264C>T	uc003xky.1	+	3	895	c.613C>T	c.(613-615)CCA>TCA	p.P205S	BAG4_uc003xkz.1_Missense_Mutation_p.P169S	NM_004874	NP_004865	O95429	BAG4_HUMAN	BCL2-associated athanogene 4	205					anti-apoptosis|apoptosis|protein folding	cytoplasm|nucleus	receptor signaling protein activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				GGGGCAGGTTCCAGGATATCC	0.478													13	78	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61769208	61769208	+	Missense_Mutation	SNP	A	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61769208A>T	uc003xue.2	+	34	7846	c.7369A>T	c.(7369-7371)AAT>TAT	p.N2457Y		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2457					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CTCTACCTCAAATTTTTCATC	0.428													17	98	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110460508	110460508	+	Missense_Mutation	SNP	T	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110460508T>A	uc003yne.2	+	39	6017	c.5913T>A	c.(5911-5913)GAT>GAA	p.D1971E		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1971	Extracellular (Potential).|IPT/TIG 12.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCGTGGGAGATCATGCTGGGG	0.408										HNSCC(38;0.096)			4	16	---	---	---	---	PASS
BNC2	54796	broad.mit.edu	37	9	16437456	16437456	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16437456G>A	uc003zml.2	-	6	876	c.736C>T	c.(736-738)CAG>TAG	p.Q246*	BNC2_uc011lmw.1_Nonsense_Mutation_p.Q151*|BNC2_uc003zmm.2_Nonsense_Mutation_p.Q204*|BNC2_uc003zmq.1_Nonsense_Mutation_p.Q260*|BNC2_uc003zmr.1_Nonsense_Mutation_p.Q283*|BNC2_uc003zmp.1_Nonsense_Mutation_p.Q274*|BNC2_uc010mij.1_Nonsense_Mutation_p.Q168*|BNC2_uc011lmv.1_Nonsense_Mutation_p.Q72*|BNC2_uc003zmo.1_Nonsense_Mutation_p.Q168*|BNC2_uc003zmj.2_Nonsense_Mutation_p.Q11*|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_Nonsense_Mutation_p.Q11*|BNC2_uc003zmn.1_Nonsense_Mutation_p.Q11*	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	246					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		AGAAACTGCTGAAGGGTGATG	0.498													6	37	---	---	---	---	PASS
LOC442421	442421	broad.mit.edu	37	9	66500808	66500808	+	RNA	SNP	T	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66500808T>G	uc004aed.1	+	3		c.901T>G								Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0						CCACCTACGGTCGGTTGTGTG	0.632													6	18	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117810616	117810616	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117810616C>T	uc004bjj.3	-	16	5137	c.4775G>A	c.(4774-4776)GGC>GAC	p.G1592D	TNC_uc010mvf.2_Intron	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	1592	Fibronectin type-III 11.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						ATAGCCAATGCCAGTTATGAG	0.498													15	42	---	---	---	---	PASS
NUP214	8021	broad.mit.edu	37	9	134026017	134026017	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134026017G>C	uc004cag.2	+	16	2253	c.2142G>C	c.(2140-2142)CAG>CAC	p.Q714H	NUP214_uc004cah.2_Missense_Mutation_p.Q704H|NUP214_uc004cai.2_Missense_Mutation_p.Q144H|NUP214_uc004caf.1_Missense_Mutation_p.Q703H|NUP214_uc010mzf.2_Missense_Mutation_p.Q12H	NM_005085	NP_005076	P35658	NU214_HUMAN	nucleoporin 214kDa	714	11 X 5 AA approximate repeats.				carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding			breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		CACACTTTCAGAAGGAGTTGG	0.458			T	DEK|SET|ABL1	AML|T-ALL								16	83	---	---	---	---	PASS
TTC18	118491	broad.mit.edu	37	10	75051185	75051185	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75051185G>C	uc009xrc.2	-	20	2369	c.2248C>G	c.(2248-2250)CAA>GAA	p.Q750E	TTC18_uc001jty.2_Missense_Mutation_p.Q750E|TTC18_uc001jtv.3_5'UTR|TTC18_uc001jtw.3_5'UTR|TTC18_uc001jtx.2_Missense_Mutation_p.Q131E	NM_145170	NP_660153	Q5T0N1	TTC18_HUMAN	tetratricopeptide repeat domain 18	750							binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)					TCATTGTTTTGAATTTCATAG	0.363													9	61	---	---	---	---	PASS
VDAC2	7417	broad.mit.edu	37	10	76980680	76980680	+	Missense_Mutation	SNP	A	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76980680A>C	uc001jwz.2	+	7	695	c.536A>C	c.(535-537)AAC>ACC	p.N179T	VDAC2_uc010qld.1_Missense_Mutation_p.N140T|VDAC2_uc001jxa.2_Missense_Mutation_p.N194T|VDAC2_uc010qle.1_Missense_Mutation_p.N140T	NM_003375	NP_003366	P45880	VDAC2_HUMAN	voltage-dependent anion channel 2	179	Beta stranded; (By similarity).					mitochondrial nucleoid|mitochondrial outer membrane|pore complex	nucleotide binding|porin activity|protein binding|voltage-gated anion channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.0642)|all_epithelial(25;0.00604)|Prostate(51;0.0112)|Ovarian(15;0.183)				Dihydroxyaluminium(DB01375)	ACAAGGAATAACTTTGCAGTG	0.473													11	55	---	---	---	---	PASS
NRG3	10718	broad.mit.edu	37	10	84745278	84745278	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84745278C>A	uc001kco.2	+	9	2035	c.2008C>A	c.(2008-2010)CTG>ATG	p.L670M	NRG3_uc010qlz.1_Missense_Mutation_p.L669M|NRG3_uc001kcp.2_Missense_Mutation_p.L473M|NRG3_uc001kcq.2_Missense_Mutation_p.L320M|NRG3_uc001kcr.2_Missense_Mutation_p.L344M	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1	694	Cytoplasmic (Potential).				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		CTTTCTCCCCCTGAGTCCCAC	0.483													8	41	---	---	---	---	PASS
IDE	3416	broad.mit.edu	37	10	94269887	94269887	+	Missense_Mutation	SNP	T	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94269887T>G	uc001kia.2	-	6	893	c.817A>C	c.(817-819)AAG>CAG	p.K273Q		NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor	273					beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding	p.K273Q(1)		ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GAAAATAACTTTACCACCAGA	0.343													24	84	---	---	---	---	PASS
CYP2C9	1559	broad.mit.edu	37	10	96707610	96707610	+	Missense_Mutation	SNP	C	T	T	rs150435881		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96707610C>T	uc001kka.3	+	4	581	c.556C>T	c.(556-558)CGT>TGT	p.R186C	CYP2C9_uc009xut.2_Missense_Mutation_p.R186C	NM_000771	NP_000762	P11712	CP2C9_HUMAN	cytochrome P450, family 2, subfamily C,	186					exogenous drug catabolic process|monocarboxylic acid metabolic process|monoterpenoid metabolic process|oxidative demethylation|steroid metabolic process|urea metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	(S)-limonene 6-monooxygenase activity|(S)-limonene 7-monooxygenase activity|4-hydroxyacetophenone monooxygenase activity|caffeine oxidase activity|drug binding|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(4)|ovary(2)	6		Colorectal(252;0.0902)		all cancers(201;6.93e-05)	Acenocoumarol(DB01418)|Alosetron(DB00969)|Amiodarone(DB01118)|Antihemophilic Factor(DB00025)|Aprepitant(DB00673)|Bosentan(DB00559)|Carprofen(DB00821)|Carvedilol(DB01136)|Celecoxib(DB00482)|Clomipramine(DB01242)|Dapsone(DB00250)|Delavirdine(DB00705)|Desloratadine(DB00967)|Desogestrel(DB00304)|Diclofenac(DB00586)|Esomeprazole(DB00736)|Etodolac(DB00749)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Gemfibrozil(DB01241)|Ginkgo biloba(DB01381)|Glibenclamide(DB01016)|Glimepiride(DB00222)|Glipizide(DB01067)|Guanfacine(DB01018)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Imipramine(DB00458)|Irbesartan(DB01029)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Losartan(DB00678)|Lumiracoxib(DB01283)|Marinol(DB00470)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mephenytoin(DB00532)|Metronidazole(DB00916)|Miconazole(DB01110)|Midazolam(DB00683)|Montelukast(DB00471)|Nateglinide(DB00731)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Oxymorphone(DB01192)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pravastatin(DB00175)|Quinidine(DB00908)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Sertraline(DB01104)|Sildenafil(DB00203)|Sulfamethoxazole(DB01015)|Suprofen(DB00870)|Tamoxifen(DB00675)|Tenoxicam(DB00469)|Terfenadine(DB00342)|Tolbutamide(DB01124)|Torasemide(DB00214)|Troleandomycin(DB01361)|Valdecoxib(DB00580)|Valsartan(DB00177)|Voriconazole(DB00582)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zileuton(DB00744)	TTTCCATAAACGTTTTGATTA	0.373													11	45	---	---	---	---	PASS
FANK1	92565	broad.mit.edu	37	10	127698119	127698119	+	3'UTR	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127698119G>A	uc001ljh.3	+	11					FANK1_uc009yan.2_3'UTR	NM_145235	NP_660278	Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains							cytoplasm|nucleus				ovary(1)	1		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				TTATTTAGTTGAAGATTCACT	0.408													4	12	---	---	---	---	PASS
C10orf90	118611	broad.mit.edu	37	10	128193175	128193175	+	Silent	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128193175G>A	uc001ljq.2	-	3	715	c.594C>T	c.(592-594)TTC>TTT	p.F198F	C10orf90_uc001ljp.2_Silent_p.F151F|C10orf90_uc010qum.1_Silent_p.F295F|C10orf90_uc009yao.2_Silent_p.F295F|C10orf90_uc001ljs.1_Silent_p.F151F	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611	198										ovary(1)|skin(1)	2		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TGTTTCTGGAGAACTCTGTGC	0.602											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	23	123	---	---	---	---	PASS
USP47	55031	broad.mit.edu	37	11	11954622	11954622	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11954622C>G	uc001mjq.1	+	16	2546	c.1783C>G	c.(1783-1785)CAA>GAA	p.Q595E	USP47_uc001mjr.2_Missense_Mutation_p.Q507E|USP47_uc001mjs.2_Missense_Mutation_p.Q575E	NM_017944	NP_060414	Q96K76	UBP47_HUMAN	ubiquitin specific protease 47	595					base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding			ovary(1)|skin(1)	2				Epithelial(150;0.000339)		GTTGGAAGAACAAGAAAAGAG	0.338													2	10	---	---	---	---	PASS
MRGPRX2	117194	broad.mit.edu	37	11	19077796	19077796	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19077796G>A	uc001mph.2	-	2	242	c.154C>T	c.(154-156)CTC>TTC	p.L52F		NM_054030	NP_473371	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	52	Helical; Name=1; (Potential).				sensory perception of pain|sleep	plasma membrane	G-protein coupled receptor activity|neuropeptide binding			ovary(1)	1						AGGAGCCAGAGCACAAACCCG	0.572													30	131	---	---	---	---	PASS
MS4A8B	83661	broad.mit.edu	37	11	60468502	60468502	+	Missense_Mutation	SNP	G	A	A	rs148191741	byFrequency	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60468502G>A	uc001npv.2	+	2	372	c.169G>A	c.(169-171)GTG>ATG	p.V57M	MS4A8B_uc009yne.1_Missense_Mutation_p.V57M	NM_031457	NP_113645	Q9BY19	M4A8B_HUMAN	membrane-spanning 4-domains, subfamily A, member	57	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						GGTGTCGAATGTGAATGGGCA	0.532													11	58	---	---	---	---	PASS
SART1	9092	broad.mit.edu	37	11	65729273	65729273	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65729273C>G	uc001ogl.2	+	1	114	c.22C>G	c.(22-24)CGC>GGC	p.R8G	SART1_uc009yqy.1_Missense_Mutation_p.R8G|SART1_uc010rot.1_Translation_Start_Site	NM_005146	NP_005137	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T	8					cell cycle arrest|induction of apoptosis by intracellular signals|positive regulation of cytotoxic T cell differentiation|spliceosomal snRNP assembly	Cajal body|catalytic step 2 spliceosome|cytosol				ovary(1)	1						CAAGAAGCATCGCGGAGAGAA	0.348													8	15	---	---	---	---	PASS
BBS1	582	broad.mit.edu	37	11	66282016	66282016	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66282016G>A	uc001oij.1	+	4	311	c.299G>A	c.(298-300)CGG>CAG	p.R100Q	BBS1_uc001oii.1_Missense_Mutation_p.R137Q|BBS1_uc010rpf.1_RNA|BBS1_uc010rpg.1_Missense_Mutation_p.R100Q|BBS1_uc001oik.1_Missense_Mutation_p.R24Q|BBS1_uc001oil.1_Missense_Mutation_p.R100Q	NM_024649	NP_078925	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	100					nonmotile primary cilium assembly|photoreceptor cell maintenance|response to stimulus|retina homeostasis	BBSome|cilium membrane|cytoplasm	protein binding			ovary(1)	1						CATGAGCCCCGGACCCCAGCT	0.562									Bardet-Biedl_syndrome				50	205	---	---	---	---	PASS
GPR152	390212	broad.mit.edu	37	11	67219578	67219578	+	Silent	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67219578G>C	uc001olm.2	-	1	623	c.618C>G	c.(616-618)CTC>CTG	p.L206L	uc009yrw.1_5'Flank|CABP4_uc001oln.2_5'Flank	NM_206997	NP_996880	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	206	Helical; Name=5; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			CGAGCAGCAGGAGGAAAGGCA	0.677													9	45	---	---	---	---	PASS
LRTOMT	220074	broad.mit.edu	37	11	71821294	71821294	+	3'UTR	SNP	T	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71821294T>C	uc010rqv.1	+	9					LRTOMT_uc010rqw.1_3'UTR|LRTOMT_uc001ors.3_3'UTR|C11orf51_uc009ytc.1_Intron|C11orf51_uc001orv.2_Intron|C11orf51_uc001orw.2_Intron	NM_001145309	NP_001138781	Q96E66	LRC51_HUMAN	leucine rich transmembrane and							cytoplasm					0						ACAGAGCCTGTAAGCCCTACA	0.373													44	242	---	---	---	---	PASS
CDON	50937	broad.mit.edu	37	11	125830804	125830804	+	3'UTR	SNP	G	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125830804G>T	uc009zbw.2	-	20					CDON_uc001qdb.3_3'UTR|CDON_uc001qdc.3_3'UTR	NM_016952	NP_058648	Q4KMG0	CDON_HUMAN	surface glycoprotein, Ig superfamily member						cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TTACCGGCTTGAAGTTGGAAC	0.463													7	49	---	---	---	---	PASS
DCPS	28960	broad.mit.edu	37	11	126215596	126215596	+	3'UTR	SNP	T	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126215596T>C	uc001qdp.2	+	6					uc001qdq.1_Intron	NM_014026	NP_054745	Q96C86	DCPS_HUMAN	mRNA decapping enzyme						deadenylation-dependent decapping of nuclear-transcribed mRNA|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	exoribonuclease activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		TTTCTAAAAATGTATTTTATA	0.468													10	42	---	---	---	---	PASS
OPCML	4978	broad.mit.edu	37	11	132527208	132527208	+	Silent	SNP	G	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132527208G>T	uc001qgs.2	-	2	224	c.174C>A	c.(172-174)ACC>ACA	p.T58T	OPCML_uc001qgu.2_Silent_p.T51T|OPCML_uc010sck.1_Silent_p.T58T|OPCML_uc001qgt.2_Silent_p.T58T|OPCML_uc010scl.1_Silent_p.T17T	NM_002545	NP_002536	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion	58	Ig-like C2-type 1.				cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		GGTCATCTATGGTACACCTGC	0.512													8	40	---	---	---	---	PASS
OPCML	4978	broad.mit.edu	37	11	132527209	132527209	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132527209G>T	uc001qgs.2	-	2	223	c.173C>A	c.(172-174)ACC>AAC	p.T58N	OPCML_uc001qgu.2_Missense_Mutation_p.T51N|OPCML_uc010sck.1_Missense_Mutation_p.T58N|OPCML_uc001qgt.2_Missense_Mutation_p.T58N|OPCML_uc010scl.1_Missense_Mutation_p.T17N	NM_002545	NP_002536	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion	58	Ig-like C2-type 1.				cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		GTCATCTATGGTACACCTGCA	0.512													9	39	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7635262	7635262	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7635262C>T	uc001qsz.3	-	14	3352	c.3224G>A	c.(3223-3225)CGA>CAA	p.R1075Q	CD163_uc001qta.3_Missense_Mutation_p.R1075Q|CD163_uc009zfw.2_Missense_Mutation_p.R1108Q	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	1075	Cytoplasmic (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						TCTCTGTCTTCGCTTTTTAGT	0.433													16	86	---	---	---	---	PASS
RIMKLB	57494	broad.mit.edu	37	12	8902643	8902643	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8902643G>A	uc001quu.2	+	3	612	c.361G>A	c.(361-363)GAG>AAG	p.E121K	RIMKLB_uc009zgf.1_RNA|RIMKLB_uc001qux.2_Missense_Mutation_p.E121K|RIMKLB_uc010sgl.1_Missense_Mutation_p.E121K|RIMKLB_uc001quw.2_Missense_Mutation_p.E121K	NM_020734	NP_065785	Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family	121	ATP-grasp.				protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0						GACATTTCAAGAGTTGGCTGG	0.433													7	66	---	---	---	---	PASS
FAM186B	84070	broad.mit.edu	37	12	49997129	49997129	+	Missense_Mutation	SNP	A	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49997129A>G	uc001ruo.2	-	3	517	c.344T>C	c.(343-345)ATT>ACT	p.I115T	FAM186B_uc010smk.1_Missense_Mutation_p.I25T	NM_032130	NP_115506	Q8IYM0	F186B_HUMAN	hypothetical protein LOC84070	115						protein complex				ovary(1)	1						CCTGGGCCCAATCTCATAGGT	0.557													11	53	---	---	---	---	PASS
PIP4K2C	79837	broad.mit.edu	37	12	57992888	57992888	+	Missense_Mutation	SNP	T	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57992888T>A	uc001sou.2	+	5	685	c.554T>A	c.(553-555)TTC>TAC	p.F185Y	PIP4K2C_uc001sot.2_Missense_Mutation_p.F185Y|PIP4K2C_uc010srs.1_Missense_Mutation_p.F167Y|PIP4K2C_uc010srt.1_Missense_Mutation_p.F137Y	NM_001146258	NP_001139730	Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type	185	PIPK.					cytoplasm|membrane	1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|identical protein binding			central_nervous_system(2)|lung(1)	3	Melanoma(17;0.122)					CTGCCCCAGTTCCTGGGGATG	0.517													14	80	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104160133	104160133	+	3'UTR	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104160133C>T	uc001tjw.2	+	69					STAB2_uc009zug.2_RNA	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						ACGGGAGATGCCAGCCATCAC	0.542													3	41	---	---	---	---	PASS
CAMKK2	10645	broad.mit.edu	37	12	121693608	121693608	+	Splice_Site	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121693608C>T	uc001tzu.2	-	8	921	c.797_splice	c.e8-1	p.V266_splice	CAMKK2_uc001tzt.2_Splice_Site_p.V266_splice|CAMKK2_uc001tzv.2_Splice_Site_p.V266_splice|CAMKK2_uc001tzw.2_Splice_Site_p.V266_splice|CAMKK2_uc001tzx.2_Splice_Site_p.V266_splice|CAMKK2_uc001tzy.2_Splice_Site_p.V266_splice|CAMKK2_uc001tzz.1_Splice_Site_p.V53_splice|CAMKK2_uc001uaa.1_Splice_Site_p.V266_splice|CAMKK2_uc001uab.2_Splice_Site_p.V266_splice|CAMKK2_uc001uac.2_Splice_Site_p.V266_splice	NM_006549	NP_006540	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase						calcium-mediated signaling|MAPKKK cascade|positive regulation of transcription, DNA-dependent|protein autophosphorylation|regulation of protein kinase activity	cytoplasm	ATP binding|calcium ion binding|calmodulin binding|calmodulin-dependent protein kinase activity|protein tyrosine kinase activity			lung(1)|large_intestine(1)|stomach(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AGTTCGAACACTGTAGGGAAG	0.527													6	30	---	---	---	---	PASS
KNTC1	9735	broad.mit.edu	37	12	123067479	123067479	+	Silent	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123067479G>C	uc001ucv.2	+	34	3373	c.3210G>C	c.(3208-3210)CTG>CTC	p.L1070L	KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	1070					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AGGCAGAGCTGACCTTGAGAG	0.488													3	23	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124416629	124416629	+	Silent	SNP	C	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124416629C>A	uc001uft.3	+	75	12941	c.12916C>A	c.(12916-12918)CGG>AGG	p.R4306R	DNAH10_uc001ufu.3_Silent_p.R219R	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4306					microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CTACTTCCTGCGGCGGTTCAG	0.532													12	71	---	---	---	---	PASS
MPHOSPH8	54737	broad.mit.edu	37	13	20224169	20224169	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20224169G>C	uc001umh.2	+	5	1354	c.1345G>C	c.(1345-1347)GAT>CAT	p.D449H	MPHOSPH8_uc001umg.2_Missense_Mutation_p.D449H|MPHOSPH8_uc001umi.2_Missense_Mutation_p.D146H	NM_017520	NP_059990	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	449					cell cycle	cytoplasm|nucleus					0		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		AAATGCATTTGATTTATTTAA	0.279													5	30	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39266204	39266204	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39266204G>A	uc001uwv.2	+	1	5032	c.4723G>A	c.(4723-4725)GTG>ATG	p.V1575M		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	1575	Extracellular (Potential).|CSPG 11.				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TATCACCCAGGTGCCTATTCA	0.418													16	103	---	---	---	---	PASS
KIAA0564	23078	broad.mit.edu	37	13	42442585	42442585	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42442585G>C	uc001uyj.2	-	10	1179	c.1109C>G	c.(1108-1110)TCT>TGT	p.S370C	KIAA0564_uc001uyk.2_Missense_Mutation_p.S370C	NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a	370						extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		AGGAAGTAGAGAGCTTCCTGA	0.368													11	62	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58208888	58208888	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58208888G>C	uc001vhq.1	+	1	3100	c.2208G>C	c.(2206-2208)GAG>GAC	p.E736D	PCDH17_uc010aec.1_Missense_Mutation_p.E736D	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	736	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		AGAACAAGGAGATCCGCACTT	0.552													6	49	---	---	---	---	PASS
COMMD6	170622	broad.mit.edu	37	13	76104396	76104396	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76104396C>G	uc001vjo.1	-	3	111	c.61G>C	c.(61-63)GAT>CAT	p.D21H	COMMD6_uc001vjn.1_Missense_Mutation_p.D21H|COMMD6_uc010aet.1_RNA|COMMD6_uc001vjp.1_Splice_Site	NM_203495	NP_987091	Q7Z4G1	COMD6_HUMAN	COMM domain containing 6 isoform b	21	COMM.					cytoplasm|nucleus	protein binding				0		Breast(118;0.0979)|Prostate(6;0.122)		GBM - Glioblastoma multiforme(99;0.0104)		CACTGAAAATCTACAAGCTTT	0.363													10	67	---	---	---	---	PASS
FOS	2353	broad.mit.edu	37	14	75747297	75747297	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75747297G>A	uc001xrn.2	+	3	633	c.428G>A	c.(427-429)CGA>CAA	p.R143Q	FOS_uc010tva.1_Intron|FOS_uc010asi.2_Missense_Mutation_p.R29Q|FOS_uc001xro.2_5'UTR	NM_005252	NP_005243	P01100	FOS_HUMAN	v-fos FBJ murine osteosarcoma viral oncogene	143	Basic motif.			SPEEEEKRRIRR -> ISRRRREKENPK (in Ref. 6; no nucleotide entry).	cellular response to reactive oxygen species|DNA methylation|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|SMAD protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter|transforming growth factor beta receptor signaling pathway		protein dimerization activity|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			lung(2)|ovary(1)	3		all_lung(585;0.0138)|all_epithelial(191;0.0263)|all_neural(303;0.112)		BRCA - Breast invasive adenocarcinoma(234;0.0117)		AGGAGAATCCGAAGGGAAAGG	0.468													6	40	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107170355	107170355	+	RNA	SNP	A	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107170355A>G	uc010tyt.1	-	37		c.2514T>C								Parts of antibodies, mostly variable regions.												0						AGGAACCTCCAGGTCCAGTCC	0.483													6	42	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25963405	25963405	+	Missense_Mutation	SNP	T	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25963405T>A	uc010ayu.2	-	8	1611	c.1505A>T	c.(1504-1506)CAC>CTC	p.H502L		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	502	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CGTGCGCCGGTGGGACTTGGT	0.687													4	22	---	---	---	---	PASS
ARHGAP11B	89839	broad.mit.edu	37	15	30938316	30938316	+	Splice_Site	SNP	G	A	A	rs112615235	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30938316G>A	uc010azv.1	+	11		c.1127_splice	c.e11-1		ARHGAP11B_uc001zeu.2_Splice_Site			Q3KRB8	RHGBB_HUMAN	Homo sapiens cDNA, FLJ17072.						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		TTCCTTGGCAGTGGATAAGTT	0.393													6	25	---	---	---	---	PASS
ARHGAP11B	89839	broad.mit.edu	37	15	30938483	30938483	+	RNA	SNP	T	C	C	rs145453249	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30938483T>C	uc010azv.1	+	11		c.1293T>C			ARHGAP11B_uc001zeu.2_RNA			Q3KRB8	RHGBB_HUMAN	Homo sapiens cDNA, FLJ17072.						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		CCACCAGGCTTCTCCTTTCCC	0.463													5	17	---	---	---	---	PASS
CATSPER2	117155	broad.mit.edu	37	15	43940187	43940187	+	Missense_Mutation	SNP	T	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43940187T>C	uc001zsh.2	-	2	288	c.73A>G	c.(73-75)ACT>GCT	p.T25A	CATSPER2_uc010bdm.2_RNA|CATSPER2_uc001zsi.2_Missense_Mutation_p.T25A|CATSPER2_uc001zsj.2_Missense_Mutation_p.T25A|CATSPER2_uc001zsk.2_Missense_Mutation_p.T25A|CATSPER2_uc001zsl.1_Intron	NM_172095	NP_742093	Q96P56	CTSR2_HUMAN	sperm-associated cation channel 2 isoform 2	25	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|protein binding|voltage-gated ion channel activity			ovary(1)	1		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		AGAGAGAAAGTATCGATGAGA	0.473													55	282	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	63970057	63970057	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63970057C>G	uc002amp.2	-	37	7205	c.7057G>C	c.(7057-7059)GAA>CAA	p.E2353Q		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	2353					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						ATAGTAATTTCTGCTTCATCC	0.458													26	104	---	---	---	---	PASS
IL16	3603	broad.mit.edu	37	15	81592687	81592687	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81592687C>G	uc002bgh.3	+	14	3396	c.3020C>G	c.(3019-3021)TCT>TGT	p.S1007C	IL16_uc010blq.1_Missense_Mutation_p.S961C|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Missense_Mutation_p.S1049C|IL16_uc002bgg.2_Missense_Mutation_p.S1007C|IL16_uc002bgi.1_Missense_Mutation_p.S397C|IL16_uc002bgj.2_Missense_Mutation_p.S501C|IL16_uc002bgk.2_Missense_Mutation_p.S306C|IL16_uc002bgl.1_Missense_Mutation_p.S306C|IL16_uc010unq.1_Missense_Mutation_p.S306C	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2	1007					immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						TGCCTTCCATCTTCTATCTCC	0.493													20	101	---	---	---	---	PASS
PCSK6	5046	broad.mit.edu	37	15	101906530	101906530	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101906530C>T	uc002bwy.2	-	14	2043	c.1729G>A	c.(1729-1731)GAT>AAT	p.D577N	PCSK6_uc010bpd.2_Missense_Mutation_p.D373N|PCSK6_uc010bpe.2_Missense_Mutation_p.D577N|PCSK6_uc002bxa.2_Missense_Mutation_p.D577N|PCSK6_uc002bxb.2_Missense_Mutation_p.D577N|PCSK6_uc002bxc.1_Missense_Mutation_p.D577N|PCSK6_uc002bxd.1_Missense_Mutation_p.D577N|PCSK6_uc002bxe.2_Missense_Mutation_p.D577N|PCSK6_uc002bxf.1_Missense_Mutation_p.D77N	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	577	Homo B/P.				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TTGGAAAGATCCAGCAACCTG	0.542													6	41	---	---	---	---	PASS
SLC5A11	115584	broad.mit.edu	37	16	24920408	24920408	+	Silent	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24920408C>T	uc002dmu.2	+	14	1873	c.1641C>T	c.(1639-1641)TCC>TCT	p.S547S	SLC5A11_uc002dms.2_Silent_p.S483S|SLC5A11_uc010vcd.1_Silent_p.S512S|SLC5A11_uc002dmt.2_Silent_p.S391S|SLC5A11_uc010vce.1_Silent_p.S477S|SLC5A11_uc010bxt.2_Silent_p.S483S|SLC5A11_uc002dmv.2_Silent_p.S170S	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose	547	Cytoplasmic (Potential).			S -> P (in Ref. 5; BAC86105).	apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)		AGCCACCCTCCAAGGAGATGG	0.363													15	91	---	---	---	---	PASS
ATXN2L	11273	broad.mit.edu	37	16	28847397	28847397	+	Silent	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28847397C>G	uc002drc.2	+	22	3207	c.3039C>G	c.(3037-3039)CTC>CTG	p.L1013L	uc010vct.1_Intron|ATXN2L_uc002drb.2_Silent_p.L1013L|ATXN2L_uc002dqy.2_Silent_p.L1013L|ATXN2L_uc002dra.2_Silent_p.L1013L|ATXN2L_uc002dqz.2_Silent_p.L1013L|ATXN2L_uc010vdb.1_Silent_p.L1019L|ATXN2L_uc002dre.2_Silent_p.L1013L|ATXN2L_uc002drf.2_Silent_p.L422L|ATXN2L_uc002drg.2_Silent_p.L296L	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	1013						membrane				upper_aerodigestive_tract(1)|ovary(1)	2						TGCCTGCACTCTCAGCTTCCA	0.682													15	92	---	---	---	---	PASS
ATXN2L	11273	broad.mit.edu	37	16	28847414	28847414	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28847414C>T	uc002drc.2	+	22	3224	c.3056C>T	c.(3055-3057)TCA>TTA	p.S1019L	uc010vct.1_Intron|ATXN2L_uc002drb.2_Missense_Mutation_p.S1019L|ATXN2L_uc002dqy.2_Missense_Mutation_p.S1019L|ATXN2L_uc002dra.2_Missense_Mutation_p.S1019L|ATXN2L_uc002dqz.2_Missense_Mutation_p.S1019L|ATXN2L_uc010vdb.1_Missense_Mutation_p.S1025L|ATXN2L_uc002dre.2_Missense_Mutation_p.S1019L|ATXN2L_uc002drf.2_Missense_Mutation_p.S428L|ATXN2L_uc002drg.2_Missense_Mutation_p.S302L	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	1019						membrane				upper_aerodigestive_tract(1)|ovary(1)	2						TCCACACCCTCACCCTACCCC	0.647													21	93	---	---	---	---	PASS
CIAPIN1	57019	broad.mit.edu	37	16	57468081	57468081	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57468081C>T	uc002ell.1	-	5	602	c.431G>A	c.(430-432)CGA>CAA	p.R144Q	CIAPIN1_uc002elk.1_RNA|CIAPIN1_uc002elm.1_Missense_Mutation_p.R131Q|CIAPIN1_uc002eln.1_Missense_Mutation_p.R144Q|CIAPIN1_uc010cda.1_Missense_Mutation_p.R144Q|CIAPIN1_uc002elo.1_Missense_Mutation_p.R117Q|CIAPIN1_uc010vhm.1_Missense_Mutation_p.R144Q	NM_020313	NP_064709	Q6FI81	CPIN1_HUMAN	cytokine induced apoptosis inhibitor 1	144					anti-apoptosis|apoptosis	cytoplasm|nucleolus					0						AAGGTGTTCTCGAACAGACTG	0.448													25	158	---	---	---	---	PASS
CDH16	1014	broad.mit.edu	37	16	66944181	66944181	+	Missense_Mutation	SNP	G	A	A	rs140255974		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66944181G>A	uc002eql.2	-	15	2222	c.2149C>T	c.(2149-2151)CGC>TGC	p.R717C	CDH16_uc010cdy.2_Missense_Mutation_p.R695C|CDH16_uc002eqm.2_Missense_Mutation_p.R620C	NM_004062	NP_004053	O75309	CAD16_HUMAN	cadherin 16 precursor	717	Extracellular (Potential).|Ectodomain G.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|upper_aerodigestive_tract(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		GTCTGGAGGCGCCAATCCCGT	0.612													18	61	---	---	---	---	PASS
KLHL36	79786	broad.mit.edu	37	16	84684521	84684521	+	Silent	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84684521C>T	uc002fig.2	+	2	189	c.48C>T	c.(46-48)ATC>ATT	p.I16I	KLHL36_uc010chl.2_Silent_p.I15I	NM_024731	NP_079007	Q8N4N3	KLH36_HUMAN	kelch-like 36	16										skin(2)	2						CATACAAGATCAGCGAATCAT	0.438													12	83	---	---	---	---	PASS
FAM57A	79850	broad.mit.edu	37	17	641234	641234	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:641234C>G	uc002frp.2	+	3	396	c.355C>G	c.(355-357)CTC>GTC	p.L119V	FAM57A_uc002frq.2_Missense_Mutation_p.L119V|FAM57A_uc002frr.2_Missense_Mutation_p.L29V	NM_024792	NP_079068	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A	119	TLC.|Helical; (Potential).					integral to membrane|plasma membrane					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		TCGAAACCGCCTCATGATCAC	0.552													17	91	---	---	---	---	PASS
ASPA	443	broad.mit.edu	37	17	3402335	3402335	+	Missense_Mutation	SNP	A	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3402335A>T	uc010ckg.2	+	7	986	c.895A>T	c.(895-897)ACT>TCT	p.T299S	SPATA22_uc010vrg.1_Intron|ASPA_uc002fvq.2_Missense_Mutation_p.T299S	NM_001128085	NP_001121557	P45381	ACY2_HUMAN	aspartoacylase	299					aspartate catabolic process	cytoplasm|nucleus	aminoacylase activity|aspartoacylase activity|hydrolase activity, acting on ester bonds|metal ion binding				0					L-Aspartic Acid(DB00128)	TGCAAAGACAACTAAACTAAC	0.403													5	35	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10366440	10366440	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10366440G>C	uc002gmn.2	-	10	982	c.871C>G	c.(871-873)CAA>GAA	p.Q291E	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	291	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						GACAGGATTTGATAAAATATG	0.373													22	68	---	---	---	---	PASS
NUFIP2	57532	broad.mit.edu	37	17	27613535	27613535	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27613535G>C	uc002hdy.3	-	2	1566	c.1477C>G	c.(1477-1479)CAG>GAG	p.Q493E	NUFIP2_uc002hdx.3_Intron	NM_020772	NP_065823	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein	493						nucleus|polysomal ribosome	protein binding|RNA binding			skin(2)|ovary(1)|breast(1)	4			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			TGATCTGTCTGAGAGGGCAGA	0.438													12	62	---	---	---	---	PASS
SYNRG	11276	broad.mit.edu	37	17	35913327	35913327	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35913327G>C	uc002hoa.2	-	14	2581	c.2498C>G	c.(2497-2499)TCT>TGT	p.S833C	SYNRG_uc010wde.1_Missense_Mutation_p.S755C|SYNRG_uc010wdf.1_Missense_Mutation_p.S755C|SYNRG_uc002hoc.2_Missense_Mutation_p.S754C|SYNRG_uc002hoe.2_Missense_Mutation_p.S755C|SYNRG_uc002hod.2_Missense_Mutation_p.S755C|SYNRG_uc010wdg.1_Missense_Mutation_p.S672C|SYNRG_uc002hob.2_Missense_Mutation_p.S833C|SYNRG_uc002hof.2_Missense_Mutation_p.S545C|SYNRG_uc010cvd.1_Missense_Mutation_p.S633C	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1	833					endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						AAACTGAACAGAGAGTGCATC	0.463													12	72	---	---	---	---	PASS
SC65	10609	broad.mit.edu	37	17	39967426	39967426	+	Silent	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39967426G>A	uc002hxt.2	-	2	857	c.573C>T	c.(571-573)GTC>GTT	p.V191V	FKBP10_uc002hxv.2_5'Flank|SC65_uc002hxu.2_Silent_p.V282V	NM_006455	NP_006446	Q92791	SC65_HUMAN	synaptonemal complex protein SC65	191					synaptonemal complex assembly	nucleolus|synaptonemal complex	binding				0		Breast(137;0.000162)		BRCA - Breast invasive adenocarcinoma(366;0.149)		ACTCGTCGGCGACGTCCAGCA	0.627													38	227	---	---	---	---	PASS
TTC25	83538	broad.mit.edu	37	17	40093047	40093047	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40093047G>A	uc002hyj.3	+	5	581	c.492G>A	c.(490-492)ATG>ATA	p.M164I	TTC25_uc010cxt.2_RNA|TTC25_uc010cxs.1_Missense_Mutation_p.M164I	NM_031421	NP_113609	Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25	164						cytoplasm	protein binding			ovary(1)	1		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				CTCAGCCCATGAAACACCTCT	0.552													13	62	---	---	---	---	PASS
EFTUD2	9343	broad.mit.edu	37	17	42937868	42937868	+	Silent	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42937868G>A	uc002ihn.2	-	17	1912	c.1651C>T	c.(1651-1653)CTG>TTG	p.L551L	EFTUD2_uc010wje.1_Silent_p.L516L|EFTUD2_uc010wjf.1_Silent_p.L541L	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain	551						Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				CCTTCAATCAGAACCCAGTTG	0.478													16	89	---	---	---	---	PASS
SDK2	54549	broad.mit.edu	37	17	71398263	71398263	+	Silent	SNP	C	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71398263C>A	uc010dfm.2	-	19	2502	c.2502G>T	c.(2500-2502)CCG>CCT	p.P834P	SDK2_uc002jjt.3_5'UTR|SDK2_uc010dfn.2_Silent_p.P513P	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2	834	Fibronectin type-III 3.|Extracellular (Potential).				cell adhesion	integral to membrane				ovary(2)	2						CTTCCTGTTCCGGCTCCCAGG	0.602													3	41	---	---	---	---	PASS
CBX4	8535	broad.mit.edu	37	17	77809510	77809510	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77809510C>T	uc002jxe.2	-	4	344	c.181G>A	c.(181-183)GAA>AAA	p.E61K		NM_003655	NP_003646	O00257	CBX4_HUMAN	chromobox homolog 4	61	Chromo.|Interaction with BMI1.				anti-apoptosis|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|PcG protein complex	enzyme binding|transcription corepressor activity			skin(2)	2			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TCCTGCCGTTCCCTGGGTGGG	0.637											OREG0024799	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	10	---	---	---	---	PASS
B3GNTL1	146712	broad.mit.edu	37	17	81006556	81006556	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:81006556C>T	uc002kgg.1	-	2	180	c.166G>A	c.(166-168)GAT>AAT	p.D56N	B3GNTL1_uc002kgf.1_5'UTR	NM_001009905	NP_001009905	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal	56							transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			TTACTGGCATCATTGAAAACA	0.507													30	102	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21492790	21492790	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21492790C>G	uc002kuq.2	+	56	7360	c.7274C>G	c.(7273-7275)TCA>TGA	p.S2425*	LAMA3_uc002kur.2_Nonsense_Mutation_p.S2369*|LAMA3_uc002kus.3_Nonsense_Mutation_p.S816*|LAMA3_uc002kut.3_Nonsense_Mutation_p.S760*	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	2425	Laminin G-like 1.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGGCCCAACTCAAGAGAAAAT	0.388													16	87	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22642616	22642616	+	3'UTR	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22642616G>A	uc002kvk.2	-	8					ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_3'UTR|ZNF521_uc002kvl.2_3'UTR	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CGTGCAAAGAGTAAAACATGT	0.328			T	PAX5	ALL								5	41	---	---	---	---	PASS
KIAA1468	57614	broad.mit.edu	37	18	59855016	59855016	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59855016C>G	uc002lil.2	+	1	493	c.278C>G	c.(277-279)TCA>TGA	p.S93*	PIGN_uc002lii.3_5'Flank|PIGN_uc002lij.3_5'Flank|KIAA1468_uc002lik.1_Nonsense_Mutation_p.S93*|KIAA1468_uc010xel.1_Nonsense_Mutation_p.S93*	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614	93							binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				GCCCGATTATCAATTGATGCG	0.672													3	11	---	---	---	---	PASS
TRIP10	9322	broad.mit.edu	37	19	6744999	6744999	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6744999G>T	uc002mfs.2	+	9	1044	c.978G>T	c.(976-978)AAG>AAT	p.K326N	TRIP10_uc010dux.1_Missense_Mutation_p.K326N|TRIP10_uc002mfr.2_Missense_Mutation_p.K326N|TRIP10_uc010duy.2_RNA|TRIP10_uc010duz.2_Missense_Mutation_p.K145N	NM_004240	NP_004231	Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	326	Interaction with CDC42.|Interaction with PDE6G (By similarity).				actin cytoskeleton organization|cell communication|endocytosis|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell projection|cytoskeleton|cytosol|Golgi apparatus|lysosome|perinuclear region of cytoplasm|phagocytic cup	GTPase activator activity|identical protein binding|lipid binding			ovary(1)	1						TTGGCAAGAAGAACAAGGTGG	0.672													5	33	---	---	---	---	PASS
CD209	30835	broad.mit.edu	37	19	7810765	7810765	+	Silent	SNP	C	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7810765C>A	uc002mht.2	-	4	454	c.387G>T	c.(385-387)CGG>CGT	p.R129R	CD209_uc010xju.1_Intron|CD209_uc010dvp.2_Silent_p.R105R|CD209_uc002mhr.2_Silent_p.R105R|CD209_uc002mhs.2_Silent_p.R105R|CD209_uc002mhu.2_Silent_p.R129R|CD209_uc010dvq.2_Silent_p.R129R|CD209_uc002mhq.2_Silent_p.R129R|CD209_uc002mhv.2_Silent_p.R105R|CD209_uc002mhx.2_Silent_p.R85R|CD209_uc002mhw.2_Silent_p.R85R|CD209_uc010dvr.2_Intron	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1	129	Extracellular (Probable).|2.|7 X approximate tandem repeats.				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						CAGCCTTCAGCCGGGTCAGCT	0.567													40	164	---	---	---	---	PASS
C3P1	388503	broad.mit.edu	37	19	10169498	10169498	+	RNA	SNP	A	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10169498A>G	uc010dwx.1	+	18		c.2133A>G				NR_027300				Synthetic construct DNA, clone: pF1KB7402, Homo sapiens LOC388503 gene, without stop codon, in Flexi system.												0						TTTGATGGCCAGCATCGAGAG	0.567													9	56	---	---	---	---	PASS
ZBTB32	27033	broad.mit.edu	37	19	36206379	36206379	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36206379G>A	uc002oay.2	+	2	1061	c.851G>A	c.(850-852)GGA>GAA	p.G284E	ZBTB32_uc002oaz.2_RNA|MLL4_uc010eei.2_5'Flank	NM_014383	NP_055198	Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	284					DNA repair|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleoplasm	DNA binding|protein binding|transcription corepressor activity|zinc ion binding			ovary(1)|skin(1)	2	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCCACCACTGGAGCCTGGCAG	0.672													22	100	---	---	---	---	PASS
C19orf54	284325	broad.mit.edu	37	19	41248515	41248515	+	Silent	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41248515C>T	uc002oou.1	-	6	999	c.879G>A	c.(877-879)AAG>AAA	p.K293K	C19orf54_uc002oow.1_Silent_p.K121K|C19orf54_uc002oox.1_RNA|C19orf54_uc002ooy.1_Intron|C19orf54_uc010xvs.1_RNA	NM_198476	NP_940878	Q5BKX5	CS054_HUMAN	hypothetical protein LOC284325	293											0			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			AGTGCCAACTCTTGCCCTGCT	0.662													3	26	---	---	---	---	PASS
PPFIA3	8541	broad.mit.edu	37	19	49631556	49631556	+	Intron	SNP	T	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49631556T>C	uc002pmr.2	+						PPFIA3_uc010yai.1_Intron|PPFIA3_uc010emt.2_5'UTR|PPFIA3_uc010yaj.1_RNA|PPFIA3_uc002pms.2_5'Flank	NM_003660	NP_003651	O75145	LIPA3_HUMAN	PTPRF interacting protein alpha 3							cell surface|cytoplasm	protein binding			lung(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		AAACTTCCAGTCCCAGTGAAT	0.572													14	41	---	---	---	---	PASS
SIGLEC8	27181	broad.mit.edu	37	19	51958721	51958721	+	Silent	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51958721C>T	uc002pwt.2	-	4	1069	c.1002G>A	c.(1000-1002)CAG>CAA	p.Q334Q	SIGLEC8_uc010yda.1_Silent_p.Q225Q|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_Silent_p.Q241Q	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	334	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GCTGGGAGCCCTGAGCGTTCT	0.632													5	42	---	---	---	---	PASS
ZNF613	79898	broad.mit.edu	37	19	52448817	52448817	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52448817G>T	uc002pxz.1	+	6	2104	c.1681G>T	c.(1681-1683)GAT>TAT	p.D561Y	ZNF613_uc002pya.1_Missense_Mutation_p.D525Y	NM_001031721	NP_001026891	Q6PF04	ZN613_HUMAN	zinc finger protein 613 isoform 1	561					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		ACATACACGTGATCTCATACA	0.428													4	44	---	---	---	---	PASS
ZNF765	91661	broad.mit.edu	37	19	53912233	53912233	+	Silent	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53912233C>T	uc010ydx.1	+	6	1752	c.1425C>T	c.(1423-1425)TTC>TTT	p.F475F	ZNF765_uc002qbm.2_Silent_p.F475F|ZNF765_uc002qbn.2_Intron	NM_001040185	NP_001035275	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	475	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)		GCAAGACCTTCAGCCGGACGT	0.378													11	87	---	---	---	---	PASS
ZNF765	91661	broad.mit.edu	37	19	53912261	53912261	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53912261C>T	uc010ydx.1	+	6	1780	c.1453C>T	c.(1453-1455)CAT>TAT	p.H485Y	ZNF765_uc002qbm.2_Missense_Mutation_p.H485Y|ZNF765_uc002qbn.2_Intron	NM_001040185	NP_001035275	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	485	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)		TACATACCATCATAGACTTCA	0.373													6	81	---	---	---	---	PASS
PTPRA	5786	broad.mit.edu	37	20	3007825	3007825	+	Silent	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3007825G>A	uc010zqd.1	+	18	2117	c.1800G>A	c.(1798-1800)GTG>GTA	p.V600V	PTPRA_uc002whj.2_Silent_p.V589V|PTPRA_uc002whk.2_Silent_p.V580V|PTPRA_uc002whl.2_Silent_p.V580V|PTPRA_uc002whm.2_Silent_p.V356V|PTPRA_uc002whn.2_Silent_p.V580V|PTPRA_uc002who.2_Silent_p.V252V	NM_002836	NP_002827	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	589	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1						CAGACTATGTGAACGCATCCT	0.493													19	136	---	---	---	---	PASS
NINL	22981	broad.mit.edu	37	20	25481640	25481640	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25481640C>G	uc002wux.1	-	8	942	c.868G>C	c.(868-870)GAG>CAG	p.E290Q	NINL_uc010gdn.1_Missense_Mutation_p.E290Q|NINL_uc010gdo.1_Intron|NINL_uc010ztf.1_Missense_Mutation_p.E306Q	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like	290					G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						CCGCTCTCCTCTGGGACCTGC	0.607													6	17	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29623158	29623158	+	5'Flank	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29623158G>A	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						AAACTTTGGTGAAATTTCAGG	0.333													10	370	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10944672	10944672	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10944672G>A	uc002yip.1	-	11	930	c.562C>T	c.(562-564)CCC>TCC	p.P188S	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.P170S|TPTE_uc002yir.1_Missense_Mutation_p.P150S|TPTE_uc010gkv.1_Missense_Mutation_p.P50S	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	188					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TCATACCTGGGAATATTCCTA	0.284													9	173	---	---	---	---	PASS
ATP5O	539	broad.mit.edu	37	21	35276300	35276300	+	Missense_Mutation	SNP	T	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35276300T>A	uc002ytl.2	-	6	558	c.467A>T	c.(466-468)GAA>GTA	p.E156V	DONSON_uc002ysn.1_Intron	NM_001697	NP_001688	P48047	ATPO_HUMAN	mitochondrial ATP synthase, O subunit precursor	156					ATP catabolic process|mitochondrial ATP synthesis coupled proton transport|respiratory electron transport chain	mitochondrial proton-transporting ATP synthase complex|plasma membrane|proton-transporting ATP synthase complex, catalytic core F(1)	drug binding|hydrogen ion transporting ATP synthase activity, rotational mechanism			ovary(1)	1						AGTTTTTAATTCAGAGAGTGT	0.383													11	57	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	18844763	18844763	+	RNA	SNP	T	C	C			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18844763T>C	uc002zoe.2	+	4		c.2017T>C			uc002zof.2_5'Flank					Homo sapiens cDNA FLJ76361 complete cds.																		TCACAGCCTCTGAGGGCAGCA	0.562													4	15	---	---	---	---	PASS
RAB36	9609	broad.mit.edu	37	22	23501351	23501351	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23501351C>T	uc002zwv.1	+	9	768	c.728C>T	c.(727-729)TCA>TTA	p.S243L	RAB36_uc010gtw.1_Missense_Mutation_p.S221L	NM_004914	NP_004905	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family	243					protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		TTCTCCCAGTCAGGGGCCGCA	0.662													3	10	---	---	---	---	PASS
PMM1	5372	broad.mit.edu	37	22	41980593	41980593	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41980593C>G	uc003bal.2	-	3	282	c.220G>C	c.(220-222)GAT>CAT	p.D74H		NM_002676	NP_002667	Q92871	PMM1_HUMAN	phosphomannomutase 1	74					dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	metal ion binding|phosphomannomutase activity			ovary(1)	1						AACACATAATCAAACTTCTCA	0.547													20	107	---	---	---	---	PASS
VCX3B	425054	broad.mit.edu	37	X	8433508	8433508	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8433508G>A	uc010ndo.2	+	2	324	c.17G>A	c.(16-18)AGA>AAA	p.R6K	VCX3B_uc011mht.1_Missense_Mutation_p.R6K|VCX3B_uc004csd.1_Missense_Mutation_p.R6K	NM_001001888	NP_001001888	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	6						nucleolus					0						CCAAAGCCGAGAGCCTCGGGA	0.612													25	67	---	---	---	---	PASS
DDX3X	1654	broad.mit.edu	37	X	41204468	41204468	+	Missense_Mutation	SNP	A	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41204468A>T	uc004dfe.2	+	11	1916	c.1061A>T	c.(1060-1062)GAT>GTT	p.D354V	DDX3X_uc004dff.2_Missense_Mutation_p.D354V|DDX3X_uc011mkq.1_Missense_Mutation_p.D338V|DDX3X_uc011mkr.1_Missense_Mutation_p.D354V|DDX3X_uc011mks.1_Intron|DDX3X_uc004dfg.2_RNA|DDX3X_uc011mkt.1_RNA	NM_001356	NP_001347	O00571	DDX3X_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3	354	Necessary for interaction with XPO1.|Helicase ATP-binding.				interspecies interaction between organisms	cytoplasm|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding|RNA binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						CGGATGTTGGATATGGGGTTT	0.403										HNSCC(61;0.18)			39	176	---	---	---	---	PASS
RGN	9104	broad.mit.edu	37	X	46943918	46943918	+	Missense_Mutation	SNP	G	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46943918G>T	uc004dgz.1	+	4	1234	c.265G>T	c.(265-267)GTC>TTC	p.V89F	RGN_uc004dha.1_Missense_Mutation_p.V89F|RGN_uc010nho.1_Missense_Mutation_p.V36F|RGN_uc010nhp.1_Missense_Mutation_p.V89F	NM_152869	NP_690608	Q15493	RGN_HUMAN	regucalcin	89					cellular calcium ion homeostasis|positive regulation of ATPase activity|regulation of calcium-mediated signaling	cytoplasm|nucleus	calcium ion binding|enzyme regulator activity|gluconolactonase activity|zinc ion binding				0						ATCAGCAGTTGTCTTGGCCAC	0.502													3	23	---	---	---	---	PASS
TFE3	7030	broad.mit.edu	37	X	48895849	48895849	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48895849G>A	uc004dmb.3	-	4	891	c.653C>T	c.(652-654)CCA>CTA	p.P218L	TFE3_uc004dmc.3_Missense_Mutation_p.P113L|TFE3_uc004dme.1_RNA	NM_006521	NP_006512	P19532	TFE3_HUMAN	transcription factor E3	218					humoral immune response|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding		ASPSCR1/TFE3(161)|PRCC/TFE3(25)|SFPQ/TFE3(6)|NONO/TFE3(2)|CLTC/TFE3(2)	soft_tissue(120)|kidney(76)|central_nervous_system(1)	197						CCCCGGCGGTGGGGTGAGGGC	0.706			T	SFPQ|ASPSCR1|PRCC|NONO|CLTC	papillary renal|alveolar soft part sarcoma|renal								4	13	---	---	---	---	PASS
ZC3H12B	340554	broad.mit.edu	37	X	64708913	64708913	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64708913C>T	uc010nko.2	+	1	208	c.199C>T	c.(199-201)CGC>TGC	p.R67C		NM_001010888	NP_001010888	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	67							endonuclease activity|nucleic acid binding|zinc ion binding			lung(1)|kidney(1)|pancreas(1)	3						CAAGCCACACCGCCAGCTCTG	0.488													6	35	---	---	---	---	PASS
YIPF6	286451	broad.mit.edu	37	X	67741303	67741303	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67741303C>T	uc004dwy.2	+	5	421	c.398C>T	c.(397-399)ACC>ATC	p.T133I	YIPF6_uc011mph.1_Missense_Mutation_p.T90I	NM_173834	NP_776195	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6	133	Helical; (Potential).					endoplasmic reticulum|integral to membrane					0						GGTGCAGTTACCATCACCCTC	0.403													16	70	---	---	---	---	PASS
FAM127A	8933	broad.mit.edu	37	X	134166743	134166743	+	Silent	SNP	C	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134166743C>T	uc004eyd.2	+	1	411	c.330C>T	c.(328-330)GAC>GAT	p.D110D	uc004eye.1_RNA	NM_001078171	NP_001071639	A6ZKI3	F127A_HUMAN	family with sequence similarity 127, member A	110											0	Acute lymphoblastic leukemia(192;0.000127)					GGGAGGAGGACGAGGACTTCT	0.657													8	30	---	---	---	---	PASS
GDI1	2664	broad.mit.edu	37	X	153670438	153670438	+	Intron	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153670438G>A	uc004fli.3	+						GDI1_uc004flj.2_5'UTR|FAM50A_uc004fll.3_5'Flank	NM_001493	NP_001484	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1						protein transport|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|midbody	GTPase activator activity|protein binding				0	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGAGTTGACGGAGCTCTTCC	0.612													14	56	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	14259	14259	+	RNA	SNP	G	A	A			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:14259G>A	uc004cox.3	+	1		c.1923G>A			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		CGCACCAATAGGATCCTCCCG	0.423													7	4	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27094409	27094410	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27094409_27094410delAA	uc001bmv.1	+	11	3490_3491	c.3117_3118delAA	c.(3115-3120)ACAAATfs	p.T1039fs	ARID1A_uc001bmt.1_Frame_Shift_Del_p.T1039fs|ARID1A_uc001bmu.1_Frame_Shift_Del_p.T1039fs|ARID1A_uc001bmw.1_Frame_Shift_Del_p.T656fs	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1039_1040	ARID.				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TGGGCATGACAAATCTGCCTGC	0.535			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								98	69	---	---	---	---	
GLIS1	148979	broad.mit.edu	37	1	53975643	53975644	+	Frame_Shift_Ins	INS	-	G	G	rs149623150	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53975643_53975644insG	uc001cvr.1	-	8	1982_1983	c.1415_1416insC	c.(1414-1416)CCGfs	p.P472fs		NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1	472	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						GGGGCAGCGGCGGTGGCCCCAG	0.688													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148855840	148855842	+	IGR	DEL	GGT	-	-	rs60282471		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148855840_148855842delGGT								NBPF16 (97529 upstream) : LOC645166 (72444 downstream)																							aagccgcggcggtggcggcggag	0.335													5	5	---	---	---	---	
GBA	2629	broad.mit.edu	37	1	155206381	155206382	+	Intron	INS	-	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155206381_155206382insT	uc001fjh.2	-						RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Intron|GBA_uc010pfx.1_Intron|GBA_uc001fji.2_Intron|GBA_uc001fjj.2_Intron|GBA_uc001fjk.2_Intron|GBA_uc001fjl.2_Intron|GBA_uc010pfy.1_Intron	NM_000157	NP_000148	P04062	GLCM_HUMAN	glucocerebrosidase precursor						carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding			ovary(1)|skin(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Alglucerase(DB00088)|Imiglucerase(DB00053)	GTTTGGGGAGAtttttttttgt	0.252									Gaucher_disease_type_I				4	2	---	---	---	---	
ATP1A4	480	broad.mit.edu	37	1	160143728	160143729	+	Intron	DEL	AA	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160143728_160143729delAA	uc001fve.3	+						ATP1A4_uc001fvf.3_Intron|ATP1A4_uc001fvg.2_Intron	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1						ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AGTGGTTGGCAAAAGTGTGGGG	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64602783	64602785	+	IGR	DEL	CAT	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64602783_64602785delCAT								PELI1 (231178 upstream) : HSPC159 (78542 downstream)																							ccaccatcaccatcaccatcacc	0.059													4	2	---	---	---	---	
CCDC36	339834	broad.mit.edu	37	3	49278972	49278973	+	Intron	DEL	AC	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49278972_49278973delAC	uc003cwk.2	+						CCDC36_uc003cwl.3_Intron|CCDC36_uc011bck.1_Intron	NM_178173	NP_835467	Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36											ovary(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		acacacacatacacacacacac	0.079													4	2	---	---	---	---	
ATP13A5	344905	broad.mit.edu	37	3	193069205	193069207	+	Intron	DEL	GAG	-	-	rs138530610		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193069205_193069207delGAG	uc011bsq.1	-							NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	ATPase type 13A5						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TATGCATTCAGAGCCATGCCCAC	0.286													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	9486267	9486267	+	IGR	DEL	A	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9486267delA								DEFB131 (34028 upstream) : MIR548I2 (71522 downstream)																							CCCCATGCTGAACCTTTTCAT	0.507													4	2	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21305673	21305692	+	Intron	DEL	AGAGAGAGAGAGAGAGAGAC	-	-	rs6858028	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21305673_21305692delAGAGAGAGAGAGAGAGAGAC	uc003gqh.1	-						KCNIP4_uc003gqf.1_5'Flank|KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				agagagagagagagagagagagagagagacagagagagag	0.223													4	2	---	---	---	---	
SHROOM3	57619	broad.mit.edu	37	4	77677558	77677559	+	Intron	INS	-	TCTCTC	TCTCTC	rs72663240	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77677558_77677559insTCTCTC	uc011cbx.1	+						SHROOM3_uc003hkg.2_Intron	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein						apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			cactctctctttctctctctct	0.267													6	3	---	---	---	---	
IRF1	3659	broad.mit.edu	37	5	131823862	131823863	+	Intron	INS	-	TG	TG	rs149828053	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131823862_131823863insTG	uc003kxa.2	-						IRF1_uc003kxd.2_Intron|IRF1_uc003kxb.2_Intron|IRF1_uc010jdt.1_Intron	NM_002198	NP_002189	P10914	IRF1_HUMAN	interferon regulatory factor 1						blood coagulation|cellular response to mechanical stimulus|interferon-gamma-mediated signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleoplasm					0		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		CTGGCTTGGACACCCATCTTGA	0.540													6	4	---	---	---	---	
MYOZ3	91977	broad.mit.edu	37	5	150052086	150052086	+	Intron	DEL	G	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150052086delG	uc003lss.2	+						MYOZ3_uc003lsr.2_Intron	NM_001122853	NP_001116325	Q8TDC0	MYOZ3_HUMAN	myozenin 3							sarcomere	protein binding			skin(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CGGGCAGCCCGGGGGACAGAC	0.478													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	177398373	177398396	+	IGR	DEL	AGGACGAAGAGCTGGAGAGCGCCA	-	-	rs145131557		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177398373_177398396delAGGACGAAGAGCTGGAGAGCGCCA								LOC728554 (87106 upstream) : PROP1 (20840 downstream)																							GTCCCCGGGGAGGACGAAGAGCTGGAGAGCGCCAAGGACGACGA	0.531													4	2	---	---	---	---	
MRS2	57380	broad.mit.edu	37	6	24416484	24416484	+	Intron	DEL	T	-	-	rs35657958		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24416484delT	uc003neb.2	+						MRS2_uc003nea.2_Intron|MRS2_uc011djl.1_Intron|MRS2_uc011djm.1_Intron|MRS2_uc011djn.1_Intron|MRS2_uc003nec.2_Intron	NM_020662	NP_065713	Q9HD23	MRS2_HUMAN	MRS2-like, magnesium homeostasis factor						ion transport	integral to membrane|mitochondrial inner membrane					0						AATACTCAACttttttttttt	0.139													6	3	---	---	---	---	
RUNX2	860	broad.mit.edu	37	6	45514577	45514577	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45514577delG	uc011dvx.1	+	9	1311	c.1101delG	c.(1099-1101)CTGfs	p.L367fs	RUNX2_uc011dvy.1_Frame_Shift_Del_p.L345fs|RUNX2_uc003oxt.2_Frame_Shift_Del_p.L353fs	NM_001024630	NP_001019801	Q13950	RUNX2_HUMAN	runt-related transcription factor 2 isoform a	367	Interaction with MYST3 (By similarity).|Pro/Ser/Thr-rich.				negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3						CTTCAGAACTGGGCCCTTTTT	0.393													80	15	---	---	---	---	
TNFRSF21	27242	broad.mit.edu	37	6	47220840	47220841	+	Intron	DEL	GT	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47220840_47220841delGT	uc003oyv.2	-							NM_014452	NP_055267	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily,						cellular lipid metabolic process	cytoplasm|integral to membrane	protein binding|receptor activity				0			Lung(136;0.189)			AGAAGGTAGGgtgtgtgtgtgt	0.144													4	2	---	---	---	---	
SUN3	256979	broad.mit.edu	37	7	48045447	48045448	+	Intron	INS	-	C	C	rs142156983	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48045447_48045448insC	uc003tof.2	-						SUN3_uc010kyq.2_Intron|SUN3_uc003tog.2_Intron|SUN3_uc011kcf.1_Intron	NM_152782	NP_689995	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 1							integral to membrane				central_nervous_system(1)	1						TTGATTAATTTCCCCCCCCCAA	0.342													10	6	---	---	---	---	
MGAM	8972	broad.mit.edu	37	7	141765753	141765753	+	Intron	DEL	G	-	-	rs77524472	byFrequency	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141765753delG	uc003vwy.2	+							NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase						polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	gtttttttttgttttgttttg	0.159													4	2	---	---	---	---	
EXT1	2131	broad.mit.edu	37	8	119108904	119108919	+	Intron	DEL	AGGAAGGAAGGGAGGG	-	-	rs72254367		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119108904_119108919delAGGAAGGAAGGGAGGG	uc003yok.1	-							NM_000127	NP_000118	Q16394	EXT1_HUMAN	exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			gaaggaaggaaggaaggaagggagggagggagggag	0.083			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				4	2	---	---	---	---	
RECQL4	9401	broad.mit.edu	37	8	145738582	145738582	+	Intron	DEL	G	-	-	rs67678060		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145738582delG	uc003zdj.2	-							NM_004260	NP_004251	O94761	RECQ4_HUMAN	RecQ protein-like 4						DNA duplex unwinding|DNA recombination|DNA repair	cytoplasm|nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|DNA strand annealing activity|zinc ion binding			breast(2)|lung(1)|skin(1)	4	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CTGGCAGTGTGGGGGGGGGGG	0.701			N|F|S			osteosarcoma|skin basal and sqamous cell		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	RAPADILINO_syndrome|Rothmund-Thomson_syndrome|Baller-Gerold_syndrome				6	3	---	---	---	---	
GLDC	2731	broad.mit.edu	37	9	6594803	6594804	+	Intron	INS	-	AAAGAAAG	AAAGAAAG			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6594803_6594804insAAAGAAAG	uc003zkc.2	-							NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	aaaaggaaataaaagaaagaaa	0.069													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68430022	68430025	+	IGR	DEL	CAAA	-	-	rs112735354		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68430022_68430025delCAAA								FAM27B (635833 upstream) : MIR1299 (572214 downstream)																							ctcctgggctcaaacaatcctcct	0.074													7	4	---	---	---	---	
IKBKAP	8518	broad.mit.edu	37	9	111666126	111666133	+	Intron	DEL	CACACACT	-	-	rs71492827		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111666126_111666133delCACACACT	uc004bdm.3	-						IKBKAP_uc004bdl.2_Intron|IKBKAP_uc011lwc.1_Intron|IKBKAP_uc010mtq.2_Intron	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene						immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						cacacacacacacacacTTATACACTTA	0.308													4	2	---	---	---	---	
NCS1	23413	broad.mit.edu	37	9	132985259	132985259	+	Intron	DEL	C	-	-	rs68053432		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132985259delC	uc004bzi.2	+						NCS1_uc010myz.1_Intron	NM_014286	NP_055101	P62166	NCS1_HUMAN	frequenin homolog isoform 1						negative regulation of calcium ion transport via voltage-gated calcium channel activity|regulation of neuron projection development	cell junction|Golgi cisterna membrane|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|protein binding				0						AAGAGGGGGGCGGCCCTCATC	0.657													6	5	---	---	---	---	
ANAPC2	29882	broad.mit.edu	37	9	140080911	140080912	+	Intron	DEL	CA	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140080911_140080912delCA	uc004clr.1	-						ANAPC2_uc004clq.1_Intron|SSNA1_uc004cls.2_5'Flank	NM_013366	NP_037498	Q9UJX6	ANC2_HUMAN	anaphase-promoting complex subunit 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cyclin catabolic process|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of cyclin-dependent protein kinase activity	anaphase-promoting complex|cytosol|nucleoplasm	ubiquitin protein ligase binding|ubiquitin-protein ligase activity			ovary(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		GTGCATGCAGcacacacacaca	0.540													4	3	---	---	---	---	
PTF1A	256297	broad.mit.edu	37	10	23482393	23482393	+	Intron	DEL	T	-	-	rs72117811		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23482393delT	uc001irp.2	+							NM_178161	NP_835455	Q7RTS3	PTF1A_HUMAN	pancreas specific transcription factor, 1a						endocrine pancreas development|exocrine pancreas development|regulation of transcription, DNA-dependent|tissue development|transcription, DNA-dependent	cytoplasm|transcription factor complex				pancreas(1)|skin(1)	2						GCGTTTCTCGttttttttttt	0.587													6	3	---	---	---	---	
DNA2	1763	broad.mit.edu	37	10	70228169	70228169	+	Intron	DEL	A	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70228169delA	uc001jof.2	-						DNA2_uc001jog.1_Intron|DNA2_uc001joh.1_Intron	NM_001080449	NP_001073918	P51530	DNA2L_HUMAN	DNA replication helicase 2 homolog						base-excision repair|DNA replication, removal of RNA primer|mitochondrial DNA repair|mitochondrial DNA replication|positive regulation of DNA replication|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	mitochondrial nucleoid|nucleoplasm	5'-flap endonuclease activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|site-specific endodeoxyribonuclease activity, specific for altered base				0						TCTGAAGAAGAAAAAAATATT	0.284													4	3	---	---	---	---	
PLCE1	51196	broad.mit.edu	37	10	96073190	96073193	+	Intron	DEL	ATGT	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96073190_96073193delATGT	uc001kjk.2	+						PLCE1_uc010qnx.1_Intron|PLCE1_uc001kjm.2_Intron|PLCE1_uc001kjp.2_Intron	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1						activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				AGATGTATGGATGTATGTGTGTGT	0.417													37	9	---	---	---	---	
DEAF1	10522	broad.mit.edu	37	11	654161	654163	+	Intron	DEL	CCC	-	-	rs66594327		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:654161_654163delCCC	uc001lqq.1	-						DEAF1_uc009ycf.1_Intron	NM_021008	NP_066288	O75398	DEAF1_HUMAN	deformed epidermal autoregulatory factor 1						embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding				0		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		CCCCATTGGACCCCCtttttttt	0.350													9	4	---	---	---	---	
CD6	923	broad.mit.edu	37	11	60785952	60785953	+	Intron	INS	-	AAGGGGAAAAGGAGAAAGG	AAGGGGAAAAGGAGAAAGG	rs144632420	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60785952_60785953insAAGGGGAAAAGGAGAAAGG	uc001nqq.2	+						CD6_uc001nqr.2_Intron|CD6_uc001nqs.2_Intron|CD6_uc001nqt.2_Intron	NM_006725	NP_006716	P30203	CD6_HUMAN	CD6 molecule precursor						cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1						TGCATTCGCTCAAGGGGAAAAG	0.391													4	3	---	---	---	---	
ANO2	57101	broad.mit.edu	37	12	5693297	5693298	+	Intron	INS	-	C	C	rs148573998	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5693297_5693298insC	uc001qnm.2	-							NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						TTTAATGAACACCCCCCCCCCG	0.460													4	3	---	---	---	---	
TRPV4	59341	broad.mit.edu	37	12	110230049	110230050	+	Intron	DEL	AA	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110230049_110230050delAA	uc001tpj.1	-						TRPV4_uc001tpg.1_Intron|TRPV4_uc001tph.1_Intron|TRPV4_uc001tpi.1_Intron|TRPV4_uc001tpk.1_Intron|TRPV4_uc001tpl.1_Intron	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,						actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						actccacctcaaaaaaaaaaaa	0.218													4	2	---	---	---	---	
GPR81	27198	broad.mit.edu	37	12	123201446	123201448	+	Intron	DEL	AAA	-	-	rs35024436		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123201446_123201448delAAA	uc001ucw.1	-						GPR109B_uc001ucy.3_5'Flank	NM_032554		Q9BXC0	HCAR1_HUMAN	G protein-coupled receptor 81						response to estradiol stimulus	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.14e-05)|Epithelial(86;3.25e-05)|BRCA - Breast invasive adenocarcinoma(302;0.197)		CGAAATCTCTAAAAAAAAAAAAA	0.399													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112850442	112850445	+	IGR	DEL	CCTC	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112850442_112850445delCCTC								SOX1 (124422 upstream) : C13orf28 (180224 downstream)																							cacctcccttcctcccttccttcc	0.000													4	3	---	---	---	---	
ATP5S	27109	broad.mit.edu	37	14	50789101	50789102	+	Intron	INS	-	ATAC	ATAC	rs148370941	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50789101_50789102insATAC	uc001wxw.1	+						ATP5S_uc001wxv.2_Intron|ATP5S_uc001wxx.1_Intron|ATP5S_uc010ant.1_Intron	NM_001003803	NP_001003803	Q99766	ATP5S_HUMAN	ATP synthase, H+ transporting, mitochondrial F0						ATP biosynthetic process	mitochondrial inner membrane|proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity			ovary(1)|skin(1)	2	all_epithelial(31;0.000636)|Breast(41;0.0102)			OV - Ovarian serous cystadenocarcinoma(311;0.0685)		GGATCTCACTAATTTATCTTCC	0.297													4	5	---	---	---	---	
ZFYVE26	23503	broad.mit.edu	37	14	68276126	68276128	+	Intron	DEL	TTT	-	-	rs72374056		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68276126_68276128delTTT	uc001xka.2	-						ZFYVE26_uc010tsz.1_Intron|ZFYVE26_uc001xkc.3_Intron|ZFYVE26_uc010tta.1_Intron	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26						cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TGAAGCACTCttttttttttttt	0.138													3	3	---	---	---	---	
ACOT2	10965	broad.mit.edu	37	14	74036674	74036675	+	Intron	INS	-	C	C	rs139052625	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74036674_74036675insC	uc001xon.3	+						ACOT1_uc010tuc.1_Intron|ACOT2_uc001xom.2_Intron	NM_006821	NP_006812	P49753	ACOT2_HUMAN	acyl-CoA thioesterase 2						acyl-CoA metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process	mitochondrion	carboxylesterase activity|palmitoyl-CoA hydrolase activity|protein binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)		TTATGTGTATgcccccccgccg	0.272													4	2	---	---	---	---	
MTA1	9112	broad.mit.edu	37	14	105905492	105905493	+	Intron	INS	-	T	T	rs140601392	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105905492_105905493insT	uc001yqx.2	+						MTA1_uc001yqy.2_Intron|MTA1_uc001yqz.1_Intron|MTA1_uc001yra.1_Intron	NM_004689	NP_004680	Q13330	MTA1_HUMAN	metastasis associated protein						signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		GAGCTCTGCCCCCACCCCTGAG	0.644													6	3	---	---	---	---	
SNORD115-1	338433	broad.mit.edu	37	15	25415774	25415774	+	5'Flank	DEL	A	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25415774delA	uc001yyq.1	+						IPW_uc001yyp.1_RNA|IPW_uc010aym.1_RNA|SNORD115-2_uc001yyr.1_5'Flank|uc001yys.1_5'Flank	NR_001291				Homo sapiens small nucleolar RNA, C/D box 115-1 (SNORD115-1), non-coding RNA.												0						GCTGAAGCTCAGGCCATTCCT	0.652													60	12	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15110963	15110989	+	Splice_Site	DEL	GTTTTTTCTTCCAGTGTGAATCTGGCA	-	-	rs3205773		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15110963_15110989delGTTTTTTCTTCCAGTGTGAATCTGGCA	uc002dda.3	+	10	1037	c.813_splice	c.e10-1	p.G271_splice	PDXDC1_uc010uzl.1_Splice_Site_p.G256_splice|PDXDC1_uc010uzm.1_Splice_Site_p.G180_splice|PDXDC1_uc002dcz.2_Splice_Site_p.G248_splice|PDXDC1_uc002ddb.3_Splice_Site_p.G244_splice|PDXDC1_uc010uzn.1_Splice_Site_p.G243_splice|PDXDC1_uc002ddc.2_Splice_Site_p.G271_splice	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TTGGACTGGTGTTTTTTCTTCCAGTGTGAATCTGGCAACATTGGCTC	0.348													702	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25767701	25767704	+	IGR	DEL	CCCC	-	-	rs57324148		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25767701_25767704delCCCC								WSB1 (127056 upstream) : KSR1 (31332 downstream)																							ttctttccctcccccccttccttc	0.025													4	2	---	---	---	---	
TBC1D16	125058	broad.mit.edu	37	17	77958420	77958423	+	Intron	DEL	GAAG	-	-	rs72322231		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77958420_77958423delGAAG	uc002jxj.2	-							NM_019020	NP_061893	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16							intracellular	Rab GTPase activator activity				0	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			gggagggagtgaaggaaggaagga	0.088													4	2	---	---	---	---	
ABCA7	10347	broad.mit.edu	37	19	1049471	1049472	+	Intron	INS	-	CA	CA	rs35986623		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1049471_1049472insCA	uc002lqw.3	+						ABCA7_uc010dsb.1_Intron	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7						phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGAGCCCCCCCACTCCCACC	0.510													8	6	---	---	---	---	
REEP6	92840	broad.mit.edu	37	19	1496536	1496537	+	Intron	INS	-	TTC	TTC			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1496536_1496537insTTC	uc002ltc.2	+							NM_138393	NP_612402	Q96HR9	REEP6_HUMAN	receptor accessory protein 6							integral to membrane					0		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTTTCTGACTTTGGCCGCCCC	0.658													8	5	---	---	---	---	
NFIC	4782	broad.mit.edu	37	19	3382392	3382392	+	Intron	DEL	G	-	-	rs67398944		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3382392delG	uc010xhi.1	+						NFIC_uc002lxo.2_Intron|NFIC_uc010xhh.1_Intron|NFIC_uc002lxp.2_Intron|NFIC_uc010xhj.1_Intron|NFIC_uc002lxq.1_Intron	NM_205843	NP_995315	P08651	NFIC_HUMAN	nuclear factor I/C isoform 2						DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		AGTGCCCAATGGGGGCGACAC	0.612													2	8	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153065	7153066	+	Intron	DEL	CA	-	-	rs113402674		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153065_7153066delCA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	cacacccccccacacacacaca	0.054													11	7	---	---	---	---	
MYO9B	4650	broad.mit.edu	37	19	17302113	17302114	+	Intron	DEL	CT	-	-	rs138603930		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17302113_17302114delCT	uc010eak.2	+						MYO9B_uc002nfi.2_Intron|MYO9B_uc002nfj.1_Intron	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1						actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						CCCAGGGCCACTCTCTGAAACA	0.634													2	4	---	---	---	---	
FCHO1	23149	broad.mit.edu	37	19	17888847	17888848	+	Intron	INS	-	A	A	rs34991275		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17888847_17888848insA	uc010ebb.2	+						FCHO1_uc002nhg.3_Intron|FCHO1_uc002nhh.2_Intron|FCHO1_uc010xpw.1_Intron|FCHO1_uc002nhi.2_5'Flank|FCHO1_uc002nhj.2_5'Flank	NM_001161358	NP_001154830	O14526	FCHO1_HUMAN	FCH domain only 1 isoform b											breast(1)	1						gactccgtctcaaaaaaaaaaa	0.109													11	5	---	---	---	---	
MAP3K10	4294	broad.mit.edu	37	19	40715323	40715324	+	Intron	INS	-	T	T			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40715323_40715324insT	uc002ona.2	+						MAP3K10_uc002onb.2_Intron	NM_002446	NP_002437	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|induction of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of JNK cascade|protein autophosphorylation|smoothened signaling pathway	cytoplasm	ATP binding|bHLH transcription factor binding|JUN kinase kinase kinase activity|protein homodimerization activity|transcription corepressor activity			ovary(2)|lung(2)|skin(1)|pancreas(1)	6						ttttttttttctttttttttgg	0.000													5	3	---	---	---	---	
C19orf61	56006	broad.mit.edu	37	19	44254290	44254291	+	Intron	DEL	AG	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44254290_44254291delAG	uc002oxj.2	-						C19orf61_uc002oxk.2_Intron|C19orf61_uc010eiy.1_Intron	NM_019108	NP_061981	Q9H0W8	SMG9_HUMAN	SMG9 protein						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	intracellular	protein binding				0		Prostate(69;0.0352)				aatttcactcagtgaaatacaa	0.045													49	11	---	---	---	---	
NAPA	8775	broad.mit.edu	37	19	47993903	47993904	+	Intron	INS	-	AAACA	AAACA	rs150585658	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47993903_47993904insAAACA	uc002pha.1	-						uc002pgz.1_Intron|NAPA_uc002phb.1_Intron|NAPA_uc002phc.1_Intron|NAPA_uc002phd.1_Intron	NM_003827	NP_003818	P54920	SNAA_HUMAN	N-ethylmaleimide-sensitive factor attachment						cellular membrane fusion|intra-Golgi vesicle-mediated transport|post-Golgi vesicle-mediated transport	cytosol					0		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000466)|all cancers(93;0.000739)|Epithelial(262;0.0168)|GBM - Glioblastoma multiforme(486;0.049)		CTCAAATGGCCaaacaaaacaa	0.317													4	2	---	---	---	---	
FCGRT	2217	broad.mit.edu	37	19	50029249	50029250	+	Intron	DEL	CT	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50029249_50029250delCT	uc002poe.2	+						FCGRT_uc002pod.2_RNA|FCGRT_uc002pog.2_Intron|FCGRT_uc002poi.2_Intron|RCN3_uc002poj.2_5'Flank	NM_001136019	NP_001129491	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha						antigen processing and presentation|female pregnancy|immune response	integral to membrane|MHC class I protein complex	IgG binding|receptor activity			ovary(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		TGACCTCTCCCTCTCTCTCTCT	0.550													270	8	---	---	---	---	
LILRA2	11027	broad.mit.edu	37	19	55087152	55087153	+	Intron	DEL	GC	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55087152_55087153delGC	uc002qgg.3	+						LILRA2_uc010ern.2_Intron|LILRA2_uc002qgf.2_Intron|LILRA2_uc010yfe.1_Intron|LILRA2_uc010yff.1_Intron|LILRA2_uc010ero.2_Intron|LILRA2_uc010yfg.1_Intron	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,						defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		caggggatgggcggggagggga	0.431													16	7	---	---	---	---	
C20orf96	140680	broad.mit.edu	37	20	259767	259770	+	Intron	DEL	GGTT	-	-	rs113750630		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:259767_259770delGGTT	uc002wde.1	-						C20orf96_uc002wdc.2_Intron|C20orf96_uc002wdd.2_Intron|C20orf96_uc010zpi.1_Intron|C20orf96_uc010zpj.1_Intron|C20orf96_uc010zpk.1_Intron	NM_153269	NP_695001	Q9NUD7	CT096_HUMAN	hypothetical protein LOC140680												0		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			gagggacggaggttgggacggagg	0.289													9	4	---	---	---	---	
STX16	8675	broad.mit.edu	37	20	57246532	57246536	+	Intron	DEL	ATTAA	-	-	rs145140305	by1000genomes	TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57246532_57246536delATTAA	uc002xzi.2	+						STX16_uc010zzq.1_Intron|STX16_uc002xzk.2_Intron|STX16_uc002xzm.2_Intron|STX16_uc002xzj.2_Intron|STX16_uc002xzl.2_Intron	NM_001001433	NP_001001433	O14662	STX16_HUMAN	syntaxin 16 isoform a						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|microsome|SNARE complex	SNAP receptor activity			ovary(1)	1	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			gtgtgtgtatattaatattaatcaa	0.215													9	5	---	---	---	---	
EDN3	1908	broad.mit.edu	37	20	57899654	57899654	+	Intron	DEL	C	-	-	rs111992101		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57899654delC	uc002yap.2	+						EDN3_uc002yaq.2_3'UTR|EDN3_uc002yar.2_3'UTR|EDN3_uc002yas.2_3'UTR	NM_000114	NP_000105	P14138	EDN3_HUMAN	endothelin 3 isoform 1 preproprotein						cell surface receptor linked signaling pathway|inositol phosphate-mediated signaling|neutrophil chemotaxis|peptide hormone secretion|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of leukocyte chemotaxis|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space|soluble fraction	endothelin B receptor binding|hormone activity			skin(1)	1	all_lung(29;0.0115)					CTTAACAATACCCCCCCCCCA	0.507													6	3	---	---	---	---	
MED15	51586	broad.mit.edu	37	22	20929656	20929656	+	Intron	DEL	T	-	-			TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20929656delT	uc002zsp.2	+						MED15_uc002zsq.2_Intron|MED15_uc010gso.2_Intron|MED15_uc002zsr.2_Intron|MED15_uc011ahs.1_Intron|MED15_uc002zss.2_Intron|MED15_uc011ahu.1_Intron|MED15_uc002zst.2_Intron	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			CCACAGTCCCTTTTTTTTTTT	0.433													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	122903812	122903815	+	IGR	DEL	GAAG	-	-	rs72254204		TCGA-BL-A13I-01	TCGA-BL-A13I-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122903812_122903815delGAAG								THOC2 (36908 upstream) : XIAP (89847 downstream)																							gagagagagagaaggaaggaagga	0.000													4	2	---	---	---	---	
