Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PLEKHG5	57449	broad.mit.edu	37	1	6528318	6528318	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6528318G>A	uc001ano.1	-	21	2847	c.2746C>T	c.(2746-2748)CGC>TGC	p.R916C	PLEKHG5_uc001ann.1_Missense_Mutation_p.R897C|PLEKHG5_uc001anq.1_Intron|PLEKHG5_uc001anp.1_Missense_Mutation_p.R937C|TNFRSF25_uc001ana.2_5'Flank|TNFRSF25_uc001anb.2_5'Flank|TNFRSF25_uc001anc.2_5'Flank|TNFRSF25_uc001and.2_5'Flank|TNFRSF25_uc009vlz.2_5'Flank|TNFRSF25_uc001ane.2_5'Flank|TNFRSF25_uc001anf.2_5'Flank|TNFRSF25_uc001ang.2_5'Flank|TNFRSF25_uc001anh.2_5'Flank|TNFRSF25_uc001ani.1_5'Flank|PLEKHG5_uc001anj.1_Missense_Mutation_p.R421C|PLEKHG5_uc009vma.1_Missense_Mutation_p.R700C|PLEKHG5_uc010nzr.1_Missense_Mutation_p.R929C|PLEKHG5_uc001ank.1_Missense_Mutation_p.R860C|PLEKHG5_uc009vmb.1_Missense_Mutation_p.R860C|PLEKHG5_uc001anl.1_Missense_Mutation_p.R860C|PLEKHG5_uc001anm.1_Missense_Mutation_p.R860C|PLEKHG5_uc001anr.1_Missense_Mutation_p.R123C	NM_001042663	NP_001036128	O94827	PKHG5_HUMAN	pleckstrin homology domain containing family G	916					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		GGGGTGCGGCGGCGGAGACGG	0.677													5	10	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918783	16918783	+	5'UTR	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918783C>T	uc009vos.1	-	6					NBPF1_uc010oce.1_5'UTR	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GTGAGGTAGACTGTGGCCAGC	0.507													3	30	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16959762	16959762	+	Intron	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16959762C>T	uc001azf.2	-						CROCCL1_uc009vov.1_5'Flank|CROCCL1_uc001aze.2_5'Flank|CROCCL1_uc001azg.1_RNA|CROCCL1_uc001azi.1_RNA|uc001azj.1_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						TGGCTCGACCCGGCTCTCTGC	0.662													3	5	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16976675	16976675	+	RNA	SNP	T	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16976675T>G	uc010och.1	+	14		c.2396T>G			MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						CCAGCCGTCTTCACGCGTGTC	0.547													4	92	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39913530	39913530	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39913530G>C	uc010oiu.1	+	47	15388	c.15257G>C	c.(15256-15258)AGA>ACA	p.R5086T	MACF1_uc010ois.1_Missense_Mutation_p.R4584T	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	6652	Spectrin 15.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCTATTGAAAGAGGGCGATCA	0.448													15	46	---	---	---	---	PASS
LEPRE1	64175	broad.mit.edu	37	1	43215938	43215938	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43215938G>A	uc001chv.2	-	11	1752	c.1639C>T	c.(1639-1641)CGC>TGC	p.R547C	LEPRE1_uc001chw.2_Missense_Mutation_p.R547C|LEPRE1_uc001chx.3_Missense_Mutation_p.R547C	NM_022356	NP_071751	Q32P28	P3H1_HUMAN	leprecan 1 isoform 1	547					negative regulation of cell proliferation	endoplasmic reticulum|proteinaceous extracellular matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			ovary(3)|lung(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TCCATGATGCGCCGCACCTTC	0.582													8	28	---	---	---	---	PASS
HYI	81888	broad.mit.edu	37	1	43917930	43917930	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43917930C>G	uc001cjo.2	-	3	542	c.372G>C	c.(370-372)GAG>GAC	p.E124D	KIAA0467_uc001cjk.1_3'UTR|KIAA0467_uc001cjl.1_3'UTR|HYI_uc001cjm.2_Missense_Mutation_p.E51D|HYI_uc001cjn.2_Missense_Mutation_p.E124D|HYI_uc001cjp.2_Missense_Mutation_p.E51D	NM_031207	NP_112484	Q5T013	HYI_HUMAN	hydroxypyruvate isomerase homolog	124							hydroxypyruvate isomerase activity			ovary(1)	1	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CGGCCTCCATCTCAGCCTTGA	0.562													7	27	---	---	---	---	PASS
ZNF644	84146	broad.mit.edu	37	1	91406112	91406112	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91406112G>C	uc001dnw.2	-	3	941	c.799C>G	c.(799-801)CAA>GAA	p.Q267E	ZNF644_uc001dnv.2_Intron|ZNF644_uc001dnx.2_Intron|ZNF644_uc001dny.1_Missense_Mutation_p.Q267E	NM_201269	NP_958357	Q9H582	ZN644_HUMAN	zinc finger protein 644 isoform 1	267					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		ATAAGAAATTGAATGAACTCT	0.348													30	122	---	---	---	---	PASS
OVGP1	5016	broad.mit.edu	37	1	111969717	111969717	+	Intron	SNP	T	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111969717T>A	uc001eba.2	-						OVGP1_uc001eaz.2_5'Flank|OVGP1_uc010owb.1_5'UTR|OVGP1_uc010owc.1_Intron	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor						chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		ACCAGCCCTGTGAGAAACAAA	0.517													7	34	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118628687	118628687	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118628687C>G	uc001ehk.2	-	13	1688	c.1620G>C	c.(1618-1620)AAG>AAC	p.K540N		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	540						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GATCAAAATTCTTTTGGTCCT	0.423													27	60	---	---	---	---	PASS
HIST2H2BF	440689	broad.mit.edu	37	1	149783666	149783666	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149783666G>C	uc001esr.2	-	1	263	c.213C>G	c.(211-213)TTC>TTG	p.F71L	HIST2H2BF_uc010pbj.1_Missense_Mutation_p.F71L|HIST2H2BF_uc010pbk.1_Missense_Mutation_p.F71L	NM_001024599	NP_001019770	Q5QNW6	H2B2F_HUMAN	histone cluster 2, H2bf isoform a	71					nucleosome assembly	nucleosome|nucleus	DNA binding				0	Breast(34;0.0124)|all_hematologic(923;0.127)					CGATGCGCTCGAAGATGTCGT	0.627													41	262	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152276103	152276103	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152276103C>A	uc001ezu.1	-	3	11295	c.11259G>T	c.(11257-11259)GAG>GAT	p.E3753D		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3753	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTCCTGACCCTCTTGGGACG	0.617									Ichthyosis				113	726	---	---	---	---	PASS
ATP8B2	57198	broad.mit.edu	37	1	154321468	154321468	+	Silent	SNP	G	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154321468G>T	uc001fex.2	+	28	3546	c.3546G>T	c.(3544-3546)CTG>CTT	p.L1182L		NM_020452	NP_065185	P98198	AT8B2_HUMAN	ATPase, class I, type 8B, member 2 isoform a	1168	Cytoplasmic (Potential).				ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(1)|skin(1)	2	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			ACATGCGGCTGAGCTCTCTCG	0.647													24	101	---	---	---	---	PASS
OR10T2	128360	broad.mit.edu	37	1	158368889	158368889	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158368889C>A	uc010pih.1	-	1	368	c.368G>T	c.(367-369)CGC>CTC	p.R123L		NM_001004475	NP_001004475	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T,	123	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					TGCTACATAGCGATCATATCC	0.473													28	445	---	---	---	---	PASS
RCSD1	92241	broad.mit.edu	37	1	167666699	167666699	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167666699G>A	uc001gem.2	+	6	1025	c.838G>A	c.(838-840)GAG>AAG	p.E280K	RCSD1_uc010pli.1_Missense_Mutation_p.E250K	NM_052862	NP_443094	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1	280	RCSD.									ovary(2)|central_nervous_system(2)|skin(1)	5	all_hematologic(923;0.215)					GGCCCAAGAGGAGGTCCCGGA	0.612													10	69	---	---	---	---	PASS
RALGPS2	55103	broad.mit.edu	37	1	178753646	178753646	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178753646G>C	uc001glz.2	+	3	489	c.151G>C	c.(151-153)GAA>CAA	p.E51Q	RALGPS2_uc001gly.1_Missense_Mutation_p.E51Q|RALGPS2_uc010pnb.1_Missense_Mutation_p.E51Q	NM_152663	NP_689876	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2	51	Ras-GEF.				small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity|protein binding				0						GGTTACACCAGAAGAATATGC	0.393													17	77	---	---	---	---	PASS
RNASEL	6041	broad.mit.edu	37	1	182555244	182555244	+	Missense_Mutation	SNP	T	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182555244T>C	uc001gpj.1	-	1	865	c.698A>G	c.(697-699)AAT>AGT	p.N233S	RNASEL_uc009wxz.1_Missense_Mutation_p.N233S|RNASEL_uc001gpk.2_Missense_Mutation_p.N233S|RNASEL_uc009wya.1_Missense_Mutation_p.N233S	NM_021133	NP_066956	Q05823	RN5A_HUMAN	ribonuclease L	233	2-5A binding (P-loop) 1.|ANK 6.				mRNA processing|response to virus|type I interferon-mediated signaling pathway	mitochondrion	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|metal ion binding|protein kinase activity|RNA binding			ovary(4)|stomach(1)	5						TCCCCTCACATTGACATCAGC	0.517									Hereditary_Prostate_Cancer				36	136	---	---	---	---	PASS
NCF2	4688	broad.mit.edu	37	1	183532680	183532680	+	Missense_Mutation	SNP	A	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183532680A>T	uc001gqj.3	-	12	1342	c.1067T>A	c.(1066-1068)GTG>GAG	p.V356E	NCF2_uc010pod.1_Missense_Mutation_p.V311E|NCF2_uc010poe.1_Missense_Mutation_p.V275E|NCF2_uc001gqk.3_Missense_Mutation_p.V356E	NM_000433	NP_000424	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	356	OPR.				cellular defense response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex|nucleolus	electron carrier activity|protein C-terminus binding			ovary(3)	3						CTTGTAGTGCACCTTGAGTGT	0.547													45	384	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186092199	186092199	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186092199G>A	uc001grq.1	+	81	12575	c.12346G>A	c.(12346-12348)GGG>AGG	p.G4116R		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4116	Ig-like C2-type 40.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GCATAAAGATGGGCGTGCAAT	0.512													27	166	---	---	---	---	PASS
KCNH1	3756	broad.mit.edu	37	1	211276926	211276926	+	Silent	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211276926C>G	uc001hib.2	-	3	392	c.222G>C	c.(220-222)CTG>CTC	p.L74L	KCNH1_uc001hic.2_Silent_p.L74L	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	74	Cytoplasmic (Potential).|PAS.				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		CTTTATCAGTCAGCTCCCCAT	0.279													17	72	---	---	---	---	PASS
HIST3H2BB	128312	broad.mit.edu	37	1	228645991	228645991	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228645991G>A	uc001hsz.2	+	1	184	c.161G>A	c.(160-162)GGC>GAC	p.G54D	HIST3H2A_uc001hsy.2_5'Flank	NM_175055	NP_778225	Q8N257	H2B3B_HUMAN	histone cluster 3, H2bb	54					nucleosome assembly	nucleosome|nucleus	DNA binding			skin(1)	1		Prostate(94;0.183)				CCCGACACCGGCATCTCGTCC	0.587													4	223	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	237167710	237167710	+	RNA	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237167710G>A	uc001hyk.1	-	1		c.9C>T								Homo sapiens metallothionein 1H-like protein mRNA, complete cds.																		CAAGCGAGAAGAGAAGAGGCA	0.453													5	36	---	---	---	---	PASS
MAP1LC3C	440738	broad.mit.edu	37	1	242162328	242162328	+	5'UTR	SNP	T	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242162328T>A	uc001hzk.2	-	1						NM_001004343	NP_001004343	Q9BXW4	MLP3C_HUMAN	microtubule-associated protein 1 light chain 3						autophagy	autophagic vacuole membrane|cytoplasmic vesicle|endomembrane system|microtubule	protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(106;0.0188)			AGTAGCTGTGTCTGTTTTAAA	0.488											OREG0014354	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	35	45	---	---	---	---	PASS
MRPL35	51318	broad.mit.edu	37	2	86434448	86434448	+	Missense_Mutation	SNP	A	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86434448A>C	uc002srg.3	+	3	434	c.376A>C	c.(376-378)AAG>CAG	p.K126Q	MRPL35_uc002srf.3_Missense_Mutation_p.K126Q	NM_016622	NP_057706	Q9NZE8	RM35_HUMAN	mitochondrial ribosomal protein L35 isoform a	126					translation	mitochondrial ribosome	structural constituent of ribosome				0						GGTGAGGAGAAAGGTGAGTCT	0.294													20	56	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90008091	90008091	+	RNA	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90008091C>A	uc010fhm.2	+	9		c.1264C>A								Parts of antibodies, mostly variable regions.																		TCACTCTCACCATCAGCAGCC	0.493													16	107	---	---	---	---	PASS
RGPD3	653489	broad.mit.edu	37	2	107032392	107032392	+	Missense_Mutation	SNP	T	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107032392T>G	uc010ywi.1	-	21	5035	c.4978A>C	c.(4978-4980)AGT>CGT	p.S1660R		NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1660					intracellular transport		binding			ovary(1)	1						GTGGTGGAACTGAGCTTCTGA	0.383													3	215	---	---	---	---	PASS
IMP4	92856	broad.mit.edu	37	2	131103630	131103630	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131103630G>C	uc002tra.1	+	7	651	c.634G>C	c.(634-636)GAT>CAT	p.D212H		NM_033416	NP_219484	Q96G21	IMP4_HUMAN	IMP4, U3 small nucleolar ribonucleoprotein,	212	Brix.				rRNA processing|translation	nucleolus|ribonucleoprotein complex	aminoacyl-tRNA ligase activity|ATP binding|protein binding			central_nervous_system(2)	2	Colorectal(110;0.1)					CGTGCCCAAAGATGACAGCCA	0.592													18	89	---	---	---	---	PASS
TMEM163	81615	broad.mit.edu	37	2	135308215	135308215	+	Silent	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135308215G>A	uc002ttx.2	-	4	450	c.384C>T	c.(382-384)GAC>GAT	p.D128D	TMEM163_uc002tty.2_RNA	NM_030923	NP_112185	Q8TC26	TM163_HUMAN	transmembrane protein 163	128	Helical; (Potential).					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(221;0.154)		ATGACAGGACGTCCAGGATGG	0.502													11	76	---	---	---	---	PASS
NXPH2	11249	broad.mit.edu	37	2	139428760	139428760	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139428760G>A	uc002tvi.2	-	2	527	c.527C>T	c.(526-528)ACC>ATC	p.T176I		NM_007226	NP_009157	O95156	NXPH2_HUMAN	neurexophilin 2 precursor	176	IV (linker domain).				neuropeptide signaling pathway	extracellular region				ovary(3)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(221;0.101)		GGTCTCCAAGGTAGACTGGGG	0.468													9	39	---	---	---	---	PASS
NXPH2	11249	broad.mit.edu	37	2	139428761	139428761	+	Missense_Mutation	SNP	T	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139428761T>A	uc002tvi.2	-	2	526	c.526A>T	c.(526-528)ACC>TCC	p.T176S		NM_007226	NP_009157	O95156	NXPH2_HUMAN	neurexophilin 2 precursor	176	IV (linker domain).				neuropeptide signaling pathway	extracellular region				ovary(3)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(221;0.101)		GTCTCCAAGGTAGACTGGGGG	0.468													10	38	---	---	---	---	PASS
SCN3A	6328	broad.mit.edu	37	2	166003482	166003482	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166003482C>G	uc002ucx.2	-	12	1930	c.1438G>C	c.(1438-1440)GAG>CAG	p.E480Q	SCN3A_uc002ucy.2_Missense_Mutation_p.E480Q|SCN3A_uc002ucz.2_Missense_Mutation_p.E480Q|SCN3A_uc002uda.1_Missense_Mutation_p.E349Q|SCN3A_uc002udb.1_Missense_Mutation_p.E349Q	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	480						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	TCCAACAGCTCTCCTAACCCA	0.443													33	85	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179411904	179411904	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179411904G>A	uc010zfg.1	-	289	86868	c.86644C>T	c.(86644-86646)CGT>TGT	p.R28882C	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R22577C|TTN_uc010zfi.1_Missense_Mutation_p.R22510C|TTN_uc010zfj.1_Missense_Mutation_p.R22385C	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29809							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTGTATTACGTTCTTTCTTC	0.423													56	215	---	---	---	---	PASS
GTF3C3	9330	broad.mit.edu	37	2	197650253	197650253	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197650253G>C	uc002uts.2	-	7	1043	c.953C>G	c.(952-954)TCA>TGA	p.S318*	GTF3C3_uc010zgu.1_Nonsense_Mutation_p.S318*|GTF3C3_uc002utu.2_Nonsense_Mutation_p.S318*|GTF3C3_uc002utt.3_5'UTR	NM_012086	NP_036218	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide	318	TPR 5.					transcription factor TFIIIC complex	DNA binding|protein binding			ovary(3)|breast(3)|pancreas(1)	7						CTGGTGTTTTGAGAAAGCTTC	0.343													11	48	---	---	---	---	PASS
GPBAR1	151306	broad.mit.edu	37	2	219128531	219128531	+	3'UTR	SNP	A	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219128531A>C	uc010zjw.1	+	2					GPBAR1_uc010zjx.1_3'UTR|GPBAR1_uc010zjy.1_3'UTR	NM_170699	NP_733800	Q8TDU6	GPBAR_HUMAN	G protein-coupled bile acid receptor 1							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGATCAGAGACCCTGCCTCT	0.547													6	7	---	---	---	---	PASS
PFKFB4	5210	broad.mit.edu	37	3	48573763	48573763	+	Silent	SNP	G	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48573763G>T	uc003ctv.2	-	8	783	c.766C>A	c.(766-768)CGG>AGG	p.R256R	PFKFB4_uc003ctw.2_Silent_p.R65R|PFKFB4_uc010hkc.2_Silent_p.R256R|PFKFB4_uc003ctx.2_Silent_p.R213R|PFKFB4_uc010hkb.2_Silent_p.R256R|PFKFB4_uc011bbm.1_Silent_p.R245R|PFKFB4_uc011bbn.1_RNA	NM_004567	NP_004558	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,	256	Fructose-2,6-bisphosphatase.				fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		TCCCCGTGCCGGCAGAGGTAG	0.637													5	251	---	---	---	---	PASS
MAPKAPK3	7867	broad.mit.edu	37	3	50684226	50684226	+	Silent	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50684226C>A	uc003day.1	+	11	1481	c.885C>A	c.(883-885)ATC>ATA	p.I295I	MAPKAPK3_uc003daz.1_Silent_p.I295I|MAPKAPK3_uc003dba.1_Silent_p.I295I|MAPKAPK3_uc010hlr.1_Silent_p.I295I	NM_004635	NP_004626	Q16644	MAPK3_HUMAN	mitogen-activated protein kinase-activated	295	Protein kinase.				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.0188)|Kidney(197;0.0223)		GGCTGACCATCACTCAGTTCA	0.612													14	70	---	---	---	---	PASS
MAPKAPK3	7867	broad.mit.edu	37	3	50685381	50685381	+	Silent	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50685381C>T	uc003day.1	+	13	1649	c.1053C>T	c.(1051-1053)ATC>ATT	p.I351I	MAPKAPK3_uc003daz.1_Silent_p.I351I|MAPKAPK3_uc003dba.1_Silent_p.I351I|MAPKAPK3_uc010hlr.1_Silent_p.I351I	NM_004635	NP_004626	Q16644	MAPK3_HUMAN	mitogen-activated protein kinase-activated	351					activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.0188)|Kidney(197;0.0223)		AGGTGAAGATCAAGGACCTGA	0.552													42	147	---	---	---	---	PASS
SLMAP	7871	broad.mit.edu	37	3	57827025	57827025	+	Splice_Site	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57827025G>A	uc003dje.1	+	3	552	c.347_splice	c.e3-1	p.V116_splice	SLMAP_uc003djc.1_Splice_Site_p.V116_splice|SLMAP_uc003djd.1_Splice_Site_p.V116_splice|SLMAP_uc003djf.1_Splice_Site_p.V116_splice	NM_007159	NP_009090	Q14BN4	SLMAP_HUMAN	sarcolemma associated protein						muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		GTTTCAACCAGTTACCCATGG	0.318													51	20	---	---	---	---	PASS
CBLB	868	broad.mit.edu	37	3	105378062	105378062	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105378062C>T	uc003dwc.2	-	19	3023	c.2701G>A	c.(2701-2703)GCA>ACA	p.A901T	CBLB_uc003dwa.2_Missense_Mutation_p.A116T|CBLB_uc011bhi.1_Missense_Mutation_p.A879T	NM_170662	NP_733762	Q13191	CBLB_HUMAN	Cas-Br-M (murine) ecotropic retroviral	901	Pro-rich.|Interaction with SH3KBP1.				cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding			lung(4)|ovary(3)|breast(1)|skin(1)	9						CTGGCTGGTGCCTGTGAACCA	0.443			Mis S		AML								4	74	---	---	---	---	PASS
DNAJB11	51726	broad.mit.edu	37	3	186299223	186299223	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186299223G>C	uc003fqi.2	+	5	740	c.520G>C	c.(520-522)GAG>CAG	p.E174Q		NM_016306	NP_057390	Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	174					protein folding	endoplasmic reticulum lumen	heat shock protein binding			ovary(1)|lung(1)	2	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		TTGTCGGCAAGAGATGCGGAC	0.517													31	139	---	---	---	---	PASS
FAM193A	8603	broad.mit.edu	37	4	2692602	2692602	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2692602C>T	uc010icl.2	+	13	2186	c.1835C>T	c.(1834-1836)ACG>ATG	p.T612M	FAM193A_uc010ick.2_Missense_Mutation_p.T812M|FAM193A_uc003gfd.2_Missense_Mutation_p.T612M|FAM193A_uc011bvm.1_Missense_Mutation_p.T634M|FAM193A_uc011bvn.1_Missense_Mutation_p.T612M|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Missense_Mutation_p.T466M	NM_003704	NP_003695	P78312	F193A_HUMAN	hypothetical protein LOC8603	612										ovary(3)	3						GTCATGGCCACGTCATCAGCC	0.448													15	92	---	---	---	---	PASS
MUC7	4589	broad.mit.edu	37	4	71347033	71347033	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71347033C>T	uc011cat.1	+	4	860	c.572C>T	c.(571-573)GCC>GTC	p.A191V	MUC7_uc011cau.1_Missense_Mutation_p.A191V|MUC7_uc003hfj.2_Missense_Mutation_p.A191V|uc011cav.1_RNA	NM_001145006	NP_001138478	Q8TAX7	MUC7_HUMAN	mucin 7, secreted precursor	191	2.|Thr-rich.					extracellular region	protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4			Lung(101;0.211)			ACCACAGCTGCCCCACCCACA	0.587													6	165	---	---	---	---	PASS
AFM	173	broad.mit.edu	37	4	74363404	74363404	+	Silent	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74363404C>G	uc003hhb.2	+	10	1258	c.1227C>G	c.(1225-1227)CTC>CTG	p.L409L		NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor	409	Albumin 3.				vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGAAAAGCCTCAAGATGGTAC	0.338													13	29	---	---	---	---	PASS
SEC31A	22872	broad.mit.edu	37	4	83776177	83776177	+	Silent	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83776177G>A	uc003hnf.2	-	17	2051	c.1887C>T	c.(1885-1887)ATC>ATT	p.I629I	SEC31A_uc003hne.2_Silent_p.I362I|SEC31A_uc011ccl.1_Silent_p.I590I|SEC31A_uc003hnl.2_Silent_p.I590I|SEC31A_uc003hng.2_Silent_p.I629I|SEC31A_uc003hnh.2_Silent_p.I629I|SEC31A_uc003hni.2_Silent_p.I629I|SEC31A_uc003hnj.2_Silent_p.I590I|SEC31A_uc011ccm.1_Silent_p.I624I|SEC31A_uc011ccn.1_Silent_p.I629I|SEC31A_uc003hnk.2_Silent_p.I590I|SEC31A_uc003hnm.2_Silent_p.I629I|SEC31A_uc003hnn.1_Silent_p.I629I	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1	629					COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				CCACTGCAGTGATGAGCTTGA	0.348													7	34	---	---	---	---	PASS
MTTP	4547	broad.mit.edu	37	4	100532321	100532321	+	Silent	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100532321G>C	uc003hvc.3	+	14	2047	c.1791G>C	c.(1789-1791)CTG>CTC	p.L597L	MTTP_uc011cej.1_Silent_p.L624L	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large	597	Vitellogenin.				lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	GTCGAGTTCTGAAGGAAATGG	0.393													22	86	---	---	---	---	PASS
CENPE	1062	broad.mit.edu	37	4	104080302	104080302	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104080302G>C	uc003hxb.1	-	22	2556	c.2466C>G	c.(2464-2466)TTC>TTG	p.F822L	CENPE_uc003hxc.1_Missense_Mutation_p.F797L	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	822	Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		GAAGGGTTTTGAAATTTTGGA	0.348													11	71	---	---	---	---	PASS
CXXC4	80319	broad.mit.edu	37	4	105411974	105411974	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105411974C>T	uc003hxg.2	-	1	494	c.479G>A	c.(478-480)CGC>CAC	p.R160H	uc003hxh.1_5'Flank|CXXC4_uc010ilo.2_Intron	NM_025212	NP_079488	Q9H2H0	CXXC4_HUMAN	CXXC finger 4	160	CXXC-type.				negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway|zygotic specification of dorsal/ventral axis		DNA binding|PDZ domain binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)		TCCCGTTTTGCGGTTCCTGCA	0.507													4	155	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114290876	114290876	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114290876G>A	uc003ibe.3	+	43	11625	c.11525G>A	c.(11524-11526)CGG>CAG	p.R3842Q	ANK2_uc003ibd.3_Missense_Mutation_p.R1748Q|ANK2_uc003ibf.3_Missense_Mutation_p.R1757Q|ANK2_uc011cgc.1_Missense_Mutation_p.R933Q|ANK2_uc003ibg.3_Missense_Mutation_p.R741Q|ANK2_uc003ibh.3_Missense_Mutation_p.R431Q|ANK2_uc011cgd.1_Missense_Mutation_p.R1144Q	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	3809					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AGCTCTCCGCGGAAAACCAGC	0.532													11	68	---	---	---	---	PASS
SPATA5	166378	broad.mit.edu	37	4	123844277	123844277	+	5'UTR	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123844277C>A	uc003iez.3	+	1					SPATA5_uc003iey.2_5'UTR|NUDT6_uc003iew.2_5'Flank|NUDT6_uc003iex.2_5'Flank	NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5						cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0						TCTACTGCTTCGGCTAGGGTA	0.542													36	152	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126336800	126336800	+	Missense_Mutation	SNP	A	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126336800A>C	uc003ifj.3	+	5	6682	c.6682A>C	c.(6682-6684)ACT>CCT	p.T2228P	FAT4_uc011cgp.1_Missense_Mutation_p.T526P	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	2228	Cadherin 21.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						CTACCATTTAACTGTTCAGGC	0.438													25	121	---	---	---	---	PASS
FASTKD3	79072	broad.mit.edu	37	5	7867809	7867809	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7867809C>T	uc003jeb.2	-	2	525	c.388G>A	c.(388-390)GCA>ACA	p.A130T	FASTKD3_uc011cmp.1_Intron|FASTKD3_uc003jec.2_Intron|MTRR_uc010itn.1_5'Flank|MTRR_uc003jee.3_5'Flank|MTRR_uc003jed.2_5'Flank|MTRR_uc003jef.3_5'Flank|MTRR_uc003jeg.3_5'Flank|MTRR_uc010ito.2_5'Flank	NM_024091	NP_076996	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	130					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)|breast(1)|pancreas(1)	4						GCTCCTGCTGCCATAGTGTCA	0.418													14	61	---	---	---	---	PASS
ELOVL7	79993	broad.mit.edu	37	5	60083198	60083198	+	Silent	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60083198C>T	uc003jsi.3	-	3	227	c.27G>A	c.(25-27)AGG>AGA	p.R9R	ELOVL7_uc011cqo.1_5'UTR|ELOVL7_uc010iwk.2_Silent_p.R9R|ELOVL7_uc003jsj.3_5'UTR	NM_024930	NP_079206	A1L3X0	ELOV7_HUMAN	elongation of very long chain fatty acids-like	9					fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				GATGCACAGTCCTCGATGTAA	0.338													11	59	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89985850	89985850	+	Silent	SNP	A	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89985850A>T	uc003kju.2	+	30	6759	c.6663A>T	c.(6661-6663)GCA>GCT	p.A2221A	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2221	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TAACAGAGGCAGTCATTATTA	0.378													4	12	---	---	---	---	PASS
C5orf13	9315	broad.mit.edu	37	5	111091544	111091544	+	5'UTR	SNP	A	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111091544A>T	uc003kpl.2	-	1					C5orf13_uc011cvr.1_Intron|C5orf13_uc011cvs.1_Intron|C5orf13_uc003kpk.2_Intron|C5orf13_uc003kpm.2_Intron|C5orf13_uc011cvk.1_Intron|C5orf13_uc011cvl.1_Intron|C5orf13_uc011cvm.1_Intron|C5orf13_uc011cvn.1_Intron|C5orf13_uc011cvo.1_Intron|C5orf13_uc011cvp.1_Intron|C5orf13_uc011cvq.1_Intron	NM_001142483	NP_001135955	Q16612	NP311_HUMAN	neuronal protein 3.1 isoform a							cytoplasm				skin(1)	1		all_cancers(142;0.00597)|all_epithelial(76;0.000144)|Prostate(80;0.0115)|Colorectal(10;0.0446)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;5.45e-09)|Epithelial(69;2e-08)|all cancers(49;1.9e-06)|COAD - Colon adenocarcinoma(37;0.0514)|Colorectal(14;0.0629)		AATATGTTTAAATACAGTAGA	0.413													17	73	---	---	---	---	PASS
TRIM36	55521	broad.mit.edu	37	5	114469698	114469698	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114469698C>G	uc003kqs.2	-	8	1902	c.1393G>C	c.(1393-1395)GAG>CAG	p.E465Q	TRIM36_uc011cwc.1_Missense_Mutation_p.E453Q|TRIM36_uc003kqt.2_Missense_Mutation_p.E310Q	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN	tripartite motif-containing 36 isoform 1	465	Fibronectin type-III.					acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding			ovary(4)|lung(2)|breast(2)	8		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		ACTTCTATCTCATTCCATGAC	0.363													14	62	---	---	---	---	PASS
PCDHA1	56147	broad.mit.edu	37	5	140167231	140167231	+	Silent	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140167231G>A	uc003lhb.2	+	1	1356	c.1356G>A	c.(1354-1356)GCG>GCA	p.A452A	PCDHA1_uc003lha.2_Silent_p.A452A|PCDHA1_uc003lgz.2_Silent_p.A452A	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	452	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGACAACGCGCCTGCGTTCG	0.682													40	147	---	---	---	---	PASS
C6orf195	154386	broad.mit.edu	37	6	2624161	2624161	+	5'UTR	SNP	T	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2624161T>C	uc003mtw.2	-	3						NM_152554	NP_689767	Q96MT4	CF195_HUMAN	hypothetical protein LOC154386												0	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				ATTTCCATTGTTGATTTTCTG	0.378													9	18	---	---	---	---	PASS
HLA-A	3105	broad.mit.edu	37	6	29911314	29911314	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29911314C>T	uc003nol.2	+	3	613	c.613C>T	c.(613-615)CGC>TGC	p.R205C	HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_5'Flank|HLA-A_uc010jrq.2_Missense_Mutation_p.R84C|HLA-A_uc003nok.2_Missense_Mutation_p.R84C|HLA-A_uc003non.2_Missense_Mutation_p.R205C|HLA-A_uc003noo.2_Missense_Mutation_p.R205C|HLA-A_uc010jrr.2_Missense_Mutation_p.R205C|HLA-A_uc003nom.2_Missense_Mutation_p.R84C|HLA-A_uc010klp.2_Missense_Mutation_p.R177C|HLA-A_uc011dmc.1_Missense_Mutation_p.R84C|HLA-A_uc011dmd.1_Missense_Mutation_p.R84C	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A	205	Extracellular (Potential).|Alpha-2.				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2						GACGCTGCAGCGCACGGGTAC	0.652									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			8	80	---	---	---	---	PASS
FKBP5	2289	broad.mit.edu	37	6	35554818	35554818	+	Missense_Mutation	SNP	T	C	C	rs61753297		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35554818T>C	uc011dte.1	-	8	1036	c.833A>G	c.(832-834)TAC>TGC	p.Y278C	FKBP5_uc003okx.2_Missense_Mutation_p.Y278C|FKBP5_uc011dtf.1_Missense_Mutation_p.Y99C|FKBP5_uc003oky.2_Missense_Mutation_p.Y278C|FKBP5_uc003okz.2_Missense_Mutation_p.T248A	NM_001145776	NP_001139248	Q13451	FKBP5_HUMAN	FK506 binding protein 5 isoform 1	278	TPR 1.				protein folding	cytoplasm|membrane|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1						CACCTTGAAGTATACGGTTCC	0.408													95	91	---	---	---	---	PASS
POPDC3	64208	broad.mit.edu	37	6	105609536	105609536	+	Silent	SNP	T	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105609536T>C	uc003prb.2	-	2	651	c.249A>G	c.(247-249)GTA>GTG	p.V83V	uc003pqz.2_Intron|POPDC3_uc003pra.2_Intron	NM_022361	NP_071756	Q9HBV1	POPD3_HUMAN	popeye protein 3	83	Helical; (Potential).					integral to membrane				skin(3)|ovary(2)	5		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				TGACAAACAGTACAAAATTCC	0.433													90	100	---	---	---	---	PASS
T	6862	broad.mit.edu	37	6	166571980	166571980	+	Silent	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166571980C>A	uc003quu.1	-	9	1624	c.1131G>T	c.(1129-1131)CGG>CGT	p.R377R	T_uc003qut.1_Silent_p.R378R|T_uc003quv.1_Silent_p.R319R	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T	377					anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		CGGGGGAGCCCCGGAAGAACT	0.706									Chordoma_Familial_Clustering_of				16	51	---	---	---	---	PASS
FERD3L	222894	broad.mit.edu	37	7	19184975	19184975	+	Missense_Mutation	SNP	T	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19184975T>C	uc003suo.1	-	1	70	c.11A>G	c.(10-12)TAT>TGT	p.Y4C	uc003sun.1_RNA	NM_152898	NP_690862	Q96RJ6	FER3L_HUMAN	nephew of atonal 3	4					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			large_intestine(1)	1						GCTCTCCGGATAGGCCGCCAT	0.642													11	60	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31862705	31862705	+	Missense_Mutation	SNP	T	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31862705T>C	uc003tcm.1	-	14	2033	c.1564A>G	c.(1564-1566)AGG>GGG	p.R522G	PDE1C_uc003tcn.1_Missense_Mutation_p.R522G|PDE1C_uc003tco.1_Missense_Mutation_p.R582G|PDE1C_uc003tcr.2_Missense_Mutation_p.R522G|PDE1C_uc003tcs.2_Missense_Mutation_p.R522G	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	522					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			ACCTTGGCCCTCCATCTCTCC	0.458													35	170	---	---	---	---	PASS
AVL9	23080	broad.mit.edu	37	7	32956881	32956881	+	Intron	SNP	A	G	G	rs116875310	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32956881A>G	uc011kai.1	+						RP9P_uc003tdc.2_RNA|RP9P_uc003tdd.2_RNA|RP9P_uc011kaj.1_RNA	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						CTATCCTGCTACTTTCTCTGA	0.507													3	123	---	---	---	---	PASS
SFRP4	6424	broad.mit.edu	37	7	37955842	37955842	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37955842C>A	uc003tfo.3	-	1	684	c.298G>T	c.(298-300)GTG>TTG	p.V100L		NM_003014	NP_003005	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related  protein 4 precursor	100	FZ.				brain development|cell differentiation|decidualization|embryo development|epithelium development|gonad development|mammary gland involution|menstrual cycle phase|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell proliferation|negative regulation of JNK cascade|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of sodium-dependent phosphate transport|phosphate ion homeostasis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epidermal cell differentiation|positive regulation of gene expression|positive regulation of receptor internalization|vasculature development|Wnt receptor signaling pathway	cell surface|cytoplasm|extracellular space|nucleus	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(1)	1						CGTTGGCACACCGACTTGCAC	0.627													17	60	---	---	---	---	PASS
C7orf36	57002	broad.mit.edu	37	7	39612174	39612174	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39612174G>C	uc003thc.3	+	3	559	c.550G>C	c.(550-552)GAA>CAA	p.E184Q		NM_020192	NP_064577	Q9NRH1	CG036_HUMAN	hypothetical protein LOC57002	184											0						TTCATATGTAGAATGTTGTAG	0.393													20	92	---	---	---	---	PASS
SLC12A9	56996	broad.mit.edu	37	7	100458728	100458728	+	Intron	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100458728G>A	uc003uwp.2	+						SLC12A9_uc003uwq.2_Intron|SLC12A9_uc011kki.1_5'UTR|SLC12A9_uc003uwr.2_Intron|SLC12A9_uc003uws.2_5'UTR|SLC12A9_uc003uwt.2_Intron|SLC12A9_uc003uwv.2_5'UTR	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN	solute carrier family 12 (potassium/chloride							integral to membrane|plasma membrane	cation:chloride symporter activity				0	Lung NSC(181;0.041)|all_lung(186;0.0581)					TGGCACTTTGGAACAACGGCA	0.562													61	116	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126544099	126544099	+	Silent	SNP	T	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126544099T>A	uc003vlr.2	-	4	1256	c.945A>T	c.(943-945)ATA>ATT	p.I315I	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Silent_p.I315I|GRM8_uc010lkz.1_RNA|GRM8_uc003vlu.1_Silent_p.I36I	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	315	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	AGACAGGTGCTATTTTGGATC	0.403										HNSCC(24;0.065)			35	121	---	---	---	---	PASS
LRGUK	136332	broad.mit.edu	37	7	133812300	133812300	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133812300C>A	uc003vrm.1	+	1	196	c.180C>A	c.(178-180)TAC>TAA	p.Y60*		NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain	60							ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						CCTCCTCCTACCTGCTCCAGC	0.597													26	154	---	---	---	---	PASS
ARHGEF5	7984	broad.mit.edu	37	7	144062382	144062382	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144062382G>A	uc003wel.2	+	2	2738	c.2620G>A	c.(2620-2622)GGT>AGT	p.G874S	ARHGEF5_uc003wek.2_Missense_Mutation_p.G874S|ARHGEF5_uc003wem.2_5'Flank	NM_005435	NP_005426	Q12774	ARHG5_HUMAN	rho guanine nucleotide exchange factor 5	874					intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)					GAACTCAGGGGGTCATGCCAA	0.612													74	140	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151945220	151945220	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151945220C>G	uc003wla.2	-	14	2518	c.2299G>C	c.(2299-2301)GAG>CAG	p.E767Q		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	767					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		AATGATGACTCTGTCTCAGAT	0.413			N		medulloblastoma								5	205	---	---	---	---	PASS
MCPH1	79648	broad.mit.edu	37	8	6357451	6357451	+	Splice_Site	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6357451G>A	uc003wqi.2	+	12	2282	c.2214_splice	c.e12+1	p.P738_splice	ANGPT2_uc003wqj.3_3'UTR|ANGPT2_uc003wqk.3_3'UTR|ANGPT2_uc010lri.2_3'UTR	NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		TGCAGCTCCCGTAAGTCAGAT	0.428													15	50	---	---	---	---	PASS
KCNU1	157855	broad.mit.edu	37	8	36793051	36793051	+	Silent	SNP	A	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36793051A>T	uc010lvw.2	+	27	3150	c.3063A>T	c.(3061-3063)CCA>CCT	p.P1021P		NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	1021	Cytoplasmic (Potential).					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TCACCCGGCCAGCCAATGAGT	0.458													71	103	---	---	---	---	PASS
VCPIP1	80124	broad.mit.edu	37	8	67546694	67546694	+	3'UTR	SNP	T	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67546694T>C	uc003xwn.2	-	3						NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex						protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			AAATATTACATATTCACAATA	0.333													21	90	---	---	---	---	PASS
POP1	10940	broad.mit.edu	37	8	99168597	99168597	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99168597G>A	uc003yij.3	+	15	2477	c.2377G>A	c.(2377-2379)GAA>AAA	p.E793K	POP1_uc011lgv.1_Missense_Mutation_p.E793K|POP1_uc003yik.2_Missense_Mutation_p.E793K	NM_001145860	NP_001139332	Q99575	POP1_HUMAN	processing of precursor 1	793					tRNA 5'-leader removal|tRNA catabolic process	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease MRP activity|ribonuclease P activity			ovary(1)|breast(1)	2	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			GGAGGCCAGTGAAAACCATGT	0.512													35	216	---	---	---	---	PASS
ALDOB	229	broad.mit.edu	37	9	104192127	104192127	+	Silent	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104192127G>A	uc004bbk.2	-	3	316	c.234C>T	c.(232-234)ATC>ATT	p.I78I		NM_000035	NP_000026	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	78					fructose 1,6-bisphosphate metabolic process|fructose catabolic process|gluconeogenesis|glycolysis|NADH oxidation|positive regulation of ATPase activity|vacuolar proton-transporting V-type ATPase complex assembly	centriolar satellite|cytosol	ATPase binding|cytoskeletal protein binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding			skin(1)	1		Acute lymphoblastic leukemia(62;0.0559)				CGTGGAAAAGGATCACACCCC	0.517													151	95	---	---	---	---	PASS
DNM1	1759	broad.mit.edu	37	9	130984829	130984829	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130984829G>A	uc011mau.1	+	8	1169	c.1082G>A	c.(1081-1083)CGC>CAC	p.R361H	DNM1_uc010mxr.2_Missense_Mutation_p.R361H|DNM1_uc011mat.1_Missense_Mutation_p.R361H	NM_004408	NP_004399	Q05193	DYN1_HUMAN	dynamin 1 isoform 1	361					receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity			ovary(2)	2						GGGGGAGCCCGCATTAACCGA	0.592													4	162	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17142151	17142151	+	Missense_Mutation	SNP	A	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17142151A>G	uc001ioo.2	-	14	1670	c.1618T>C	c.(1618-1620)TCT>CCT	p.S540P		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	540	CUB 1.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AAAGCAGAAGAGGAATCTCCA	0.408													17	104	---	---	---	---	PASS
SVIL	6840	broad.mit.edu	37	10	29777621	29777621	+	Silent	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29777621G>A	uc001iut.1	-	23	5010	c.4257C>T	c.(4255-4257)AGC>AGT	p.S1419S	SVIL_uc010qdw.1_Silent_p.S333S|SVIL_uc001iuu.1_Silent_p.S993S|SVIL_uc009xlc.2_Silent_p.S211S	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	1419	Interaction with NEB.				cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				GGCTGACGTTGCTGAAGTTTT	0.507													10	35	---	---	---	---	PASS
LOC642826	642826	broad.mit.edu	37	10	47207813	47207813	+	RNA	SNP	T	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47207813T>C	uc001jei.2	-	12		c.1586A>G			uc009xnf.2_Missense_Mutation_p.H132R					Homo sapiens cDNA, FLJ99065.												0						TTTACTTACATGGTTTGTACA	0.294													4	43	---	---	---	---	PASS
TACC2	10579	broad.mit.edu	37	10	123843281	123843281	+	Silent	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123843281C>T	uc001lfv.2	+	4	1626	c.1266C>T	c.(1264-1266)CTC>CTT	p.L422L	TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Silent_p.L422L|TACC2_uc010qtv.1_Silent_p.L422L	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing	422						microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CTTCAAGCCTCGCTTCATTCC	0.557													42	109	---	---	---	---	PASS
SLC25A22	79751	broad.mit.edu	37	11	792032	792032	+	Silent	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:792032C>T	uc001lri.2	-	10	1197	c.855G>A	c.(853-855)CTG>CTA	p.L285L	CEND1_uc001lrh.1_5'Flank|SLC25A22_uc009yci.2_Silent_p.L285L|SLC25A22_uc001lrj.2_Silent_p.L285L	NM_024698	NP_078974	Q9H936	GHC1_HUMAN	mitochondrial glutamate carrier 1	285	Solcar 3.					integral to membrane|mitochondrial inner membrane|nucleus	L-glutamate transmembrane transporter activity|protein binding|symporter activity				0		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	L-Glutamic Acid(DB00142)	AGGCGCCCTTCAGGAAGGCCG	0.697													5	13	---	---	---	---	PASS
TRPM5	29850	broad.mit.edu	37	11	2439011	2439011	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2439011C>G	uc001lwm.3	-	7	964	c.955G>C	c.(955-957)GAG>CAG	p.E319Q	TRPM5_uc010qxl.1_Missense_Mutation_p.E319Q|TRPM5_uc009ydn.2_Missense_Mutation_p.E321Q	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,	319	Cytoplasmic (Potential).					integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		CCCTCCTGCTCGAAGTCATAC	0.662													5	18	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6662141	6662141	+	Missense_Mutation	SNP	C	T	T	rs143767864	byFrequency	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6662141C>T	uc001mem.1	-	2	1114	c.704G>A	c.(703-705)CGG>CAG	p.R235Q		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	235	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGGGCCCTCCGGGGGGGTGA	0.587													45	110	---	---	---	---	PASS
OR4C6	219432	broad.mit.edu	37	11	55433539	55433539	+	Silent	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55433539C>T	uc001nht.3	+	3	1162	c.897C>T	c.(895-897)CTC>CTT	p.L299L	OR4C6_uc010rik.1_Silent_p.L299L	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	299	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						TGAAGAAACTCTGGATGAAAT	0.423													29	55	---	---	---	---	PASS
OR5B21	219968	broad.mit.edu	37	11	58275356	58275356	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58275356C>T	uc010rki.1	-	1	223	c.223G>A	c.(223-225)GTA>ATA	p.V75I		NM_001005218	NP_001005218	A6NL26	OR5BL_HUMAN	olfactory receptor, family 5, subfamily B,	75	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TTGGGGGCTACAGCTGATGAG	0.512													15	71	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62288867	62288867	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62288867G>A	uc001ntl.2	-	5	13322	c.13022C>T	c.(13021-13023)CCT>CTT	p.P4341L	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4341					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				GTCAGCCTTAGGAAGGGTAAC	0.502													10	388	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62289475	62289475	+	Silent	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62289475C>G	uc001ntl.2	-	5	12714	c.12414G>C	c.(12412-12414)CTG>CTC	p.L4138L	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4138					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				TTGGACCTTTCAGATTCAGGT	0.517													45	329	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62296133	62296133	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62296133G>A	uc001ntl.2	-	5	6056	c.5756C>T	c.(5755-5757)GCC>GTC	p.A1919V	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	1919					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				GATCTTGGGGGCCTTGAAGTG	0.507													9	663	---	---	---	---	PASS
BRMS1	25855	broad.mit.edu	37	11	66105149	66105149	+	3'UTR	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66105149G>C	uc001ohp.1	-	10					RIN1_uc010roy.1_5'Flank|RIN1_uc009yrd.1_5'Flank|RIN1_uc001ohn.1_5'Flank|RIN1_uc010roz.1_5'Flank|RIN1_uc010rpa.1_5'Flank|BRMS1_uc001oho.1_Missense_Mutation_p.P288R	NM_015399	NP_056214	Q9HCU9	BRMS1_HUMAN	breast cancer metastasis suppressor 1 isoform 1						apoptosis|negative regulation of anti-apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of anoikis|positive regulation of protein deacetylation|transcription, DNA-dependent	cytoplasm|nucleus	NF-kappaB binding				0						TCAGCTCCACGGCCACAGCTG	0.662													13	17	---	---	---	---	PASS
LRP5	4041	broad.mit.edu	37	11	68207276	68207276	+	Silent	SNP	C	A	A	rs11574420	byFrequency	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68207276C>A	uc001ont.2	+	21	4455	c.4380C>A	c.(4378-4380)TCC>TCA	p.S1460S	LRP5_uc009ysg.2_Silent_p.S870S	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein	1460	Cytoplasmic (Potential).				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						TGATGAGCTCCGTGAGCCTGA	0.677													3	31	---	---	---	---	PASS
SAPS3	55291	broad.mit.edu	37	11	68331848	68331848	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68331848C>A	uc001onw.2	+	9	1190	c.923C>A	c.(922-924)GCC>GAC	p.A308D	SAPS3_uc001onv.2_Missense_Mutation_p.A308D|SAPS3_uc001ony.3_Missense_Mutation_p.A308D|SAPS3_uc001onx.2_Missense_Mutation_p.A308D|SAPS3_uc009ysh.2_Missense_Mutation_p.A308D|SAPS3_uc001onu.2_Missense_Mutation_p.A308D|SAPS3_uc010rqc.1_Intron|SAPS3_uc010rqd.1_Missense_Mutation_p.A15D	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6	308					regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			GTTCTAGAAGCCATCAGAGGA	0.458													9	240	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70172733	70172733	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70172733G>C	uc001opo.2	+	7	937	c.739G>C	c.(739-741)GAA>CAA	p.E247Q	PPFIA1_uc001opn.1_Missense_Mutation_p.E247Q|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	247					cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			AAGCCACGAGGAAGACCTTGC	0.398													291	384	---	---	---	---	PASS
LRTOMT	220074	broad.mit.edu	37	11	71821373	71821373	+	3'UTR	SNP	A	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71821373A>C	uc010rqv.1	+	9					LRTOMT_uc010rqw.1_3'UTR|LRTOMT_uc001ors.3_3'UTR|C11orf51_uc009ytc.1_Intron|C11orf51_uc001orv.2_Intron|C11orf51_uc001orw.2_Intron	NM_001145309	NP_001138781	Q96E66	LRC51_HUMAN	leucine rich transmembrane and							cytoplasm					0						ATGACCCCCTACCCCGACACT	0.562													27	163	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117321323	117321323	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117321323G>A	uc001prh.1	-	20	3832	c.3830C>T	c.(3829-3831)CCC>CTC	p.P1277L		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1217	Extracellular (Potential).|Fibronectin type-III 4.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CACCCCGTTGGGCTTGGTAGG	0.582													16	114	---	---	---	---	PASS
DYRK4	8798	broad.mit.edu	37	12	4708904	4708904	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4708904C>G	uc001qmx.2	+	8	891	c.731C>G	c.(730-732)GCC>GGC	p.A244G	DYRK4_uc009zeh.1_Missense_Mutation_p.A359G|DYRK4_uc001qmy.1_Missense_Mutation_p.A244G	NM_003845	NP_003836	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	244	Protein kinase.					Golgi apparatus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|skin(1)	3			Colorectal(7;0.103)			AAGGGCCAAGCCTCTGTTAAA	0.383													18	80	---	---	---	---	PASS
ANO6	196527	broad.mit.edu	37	12	45810576	45810576	+	Silent	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45810576C>T	uc001roo.2	+	17	2441	c.2106C>T	c.(2104-2106)GAC>GAT	p.D702D	ANO6_uc010sld.1_Silent_p.D702D|ANO6_uc010sle.1_Silent_p.D702D|ANO6_uc010slf.1_Silent_p.D723D|ANO6_uc010slg.1_Silent_p.D684D	NM_001025356	NP_001020527	Q4KMQ2	ANO6_HUMAN	anoctamin 6 isoform a	702	Cytoplasmic (Potential).				activation of blood coagulation via clotting cascade|phosphatidylserine exposure on blood platelet	chloride channel complex|plasma membrane	chloride channel activity			ovary(1)|kidney(1)	2						TAAGAGTGGACGCATGGAAAC	0.483													14	61	---	---	---	---	PASS
SLC38A2	54407	broad.mit.edu	37	12	46764360	46764360	+	Silent	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46764360C>G	uc001rpg.2	-	4	689	c.249G>C	c.(247-249)GCG>GCC	p.A83A	SLC38A2_uc001rph.2_Intron	NM_018976	NP_061849	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	83	Regulates protein turnover upon amino acid deprivation (By similarity).|Helical; (Potential).				cellular nitrogen compound metabolic process|glutamate secretion|neurotransmitter secretion|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			urinary_tract(1)|skin(1)	2	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		TGCCCACAATCGCATTGCTCA	0.393													24	105	---	---	---	---	PASS
SLC38A2	54407	broad.mit.edu	37	12	46765071	46765071	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46765071C>G	uc001rpg.2	-	2	446	c.6G>C	c.(4-6)AAG>AAC	p.K2N	SLC38A2_uc001rph.2_5'UTR	NM_018976	NP_061849	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	2	Cytoplasmic (Potential).|Regulates protein turnover upon amino acid deprivation (By similarity).				cellular nitrogen compound metabolic process|glutamate secretion|neurotransmitter secretion|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			urinary_tract(1)|skin(1)	2	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		TTTCGGCCTTCTTCATGCTAA	0.577													47	136	---	---	---	---	PASS
WIF1	11197	broad.mit.edu	37	12	65448985	65448985	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65448985C>T	uc001ssk.2	-	9	1076	c.931G>A	c.(931-933)GAG>AAG	p.E311K		NM_007191	NP_009122	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1 precursor	311	EGF-like 5.				multicellular organismal development|Wnt receptor signaling pathway	extracellular region	protein tyrosine kinase activity			ovary(2)|lung(1)|skin(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		CAGCCAGGCTCGCAGACAGCT	0.413			T	HMGA2	pleomorphic salivary gland adenoma								16	89	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101510560	101510560	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101510560C>A	uc010svm.1	+	25	3126	c.2554C>A	c.(2554-2556)CCT>ACT	p.P852T	ANO4_uc001thw.2_Missense_Mutation_p.P817T|ANO4_uc001thx.2_Missense_Mutation_p.P852T|ANO4_uc001thy.2_Missense_Mutation_p.P372T	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	852	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						CTCGGGGACTCCTCTTAAGTA	0.542										HNSCC(74;0.22)			23	144	---	---	---	---	PASS
COQ5	84274	broad.mit.edu	37	12	120966959	120966959	+	5'UTR	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120966959G>A	uc001tyn.2	-	1					COQ5_uc001tyo.2_5'UTR|COQ5_uc010szj.1_5'UTR	NM_032314	NP_115690	Q5HYK3	COQ5_HUMAN	coenzyme Q5 homolog, methyltransferase						ubiquinone biosynthetic process	mitochondrion	methyltransferase activity			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTAGTCGAGTGACAACGGCCA	0.632													5	30	---	---	---	---	PASS
EIF2B1	1967	broad.mit.edu	37	12	124109399	124109399	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124109399C>A	uc001ufm.2	-	7	705	c.562G>T	c.(562-564)GAG>TAG	p.E188*	EIF2B1_uc001ufn.2_Nonsense_Mutation_p.E186*	NM_001414	NP_001405	Q14232	EI2BA_HUMAN	eukaryotic translation initiation factor 2B,	188					cellular response to stimulus|oligodendrocyte development|regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex|membrane fraction|plasma membrane	protein binding|translation initiation factor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.67e-05)|Epithelial(86;0.000353)|all cancers(50;0.00489)		TCTGCTTTCTCCATGATGTAG	0.393													17	74	---	---	---	---	PASS
EP400NL	347918	broad.mit.edu	37	12	132589770	132589770	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132589770C>T	uc001ujv.2	+	1	1229	c.1205C>T	c.(1204-1206)CCA>CTA	p.P402L	EP400NL_uc001ujr.2_Missense_Mutation_p.P270L|EP400NL_uc001ujs.3_Missense_Mutation_p.P333L|EP400NL_uc009zyq.2_Missense_Mutation_p.P270L|EP400NL_uc001ujt.2_Missense_Mutation_p.P270L|EP400NL_uc001ujw.1_Missense_Mutation_p.P101L					RecName: Full=EP400 N-terminal-like protein;												0						CTGTATGGACCATTACAAGCA	0.378													44	27	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70314531	70314531	+	Silent	SNP	A	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70314531A>G	uc001vip.2	-	8	2591	c.1797T>C	c.(1795-1797)AAT>AAC	p.N599N	KLHL1_uc010thm.1_Silent_p.N538N	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	599	Kelch 3.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CTTACTTGCCATTCAATGCTG	0.318													10	27	---	---	---	---	PASS
DACH1	1602	broad.mit.edu	37	13	72049858	72049858	+	Missense_Mutation	SNP	T	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72049858T>A	uc010thn.1	-	10	2417	c.1994A>T	c.(1993-1995)GAT>GTT	p.D665V	DACH1_uc010tho.1_Missense_Mutation_p.D517V|DACH1_uc010thp.1_Missense_Mutation_p.D463V	NM_080759	NP_542937	Q9UI36	DACH1_HUMAN	dachshund homolog 1 isoform a	717	Potential.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		CCTGAGACTATCTGTTGAAGC	0.393													106	80	---	---	---	---	PASS
DOCK9	23348	broad.mit.edu	37	13	99520199	99520199	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99520199C>T	uc001vnt.2	-	29	3215	c.3160G>A	c.(3160-3162)GCT>ACT	p.A1054T	DOCK9_uc001vnw.2_Missense_Mutation_p.A1053T|DOCK9_uc001vnv.1_RNA|DOCK9_uc010tir.1_Missense_Mutation_p.A1054T|DOCK9_uc010tis.1_Missense_Mutation_p.A1053T|DOCK9_uc010tit.1_Missense_Mutation_p.A1054T|DOCK9_uc010tiq.1_Missense_Mutation_p.A18T|DOCK9_uc010afu.1_Missense_Mutation_p.A900T	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a	1054					blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TCTCCAGGAGCAAAACAGCTA	0.403													6	21	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23896042	23896042	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23896042C>T	uc001wjx.2	-	18	2094	c.1988G>A	c.(1987-1989)CGC>CAC	p.R663H		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	663	Myosin head-like.|Actin-binding.		R -> C (in CMH1).|R -> H (in CMH1).|R -> S (in CMH1).		adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		ATGGGTGGAGCGCAAGTTGGT	0.448													18	46	---	---	---	---	PASS
NKX2-8	26257	broad.mit.edu	37	14	37051677	37051677	+	5'UTR	SNP	G	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37051677G>T	uc001wtx.2	-	1						NM_014360	NP_055175	O15522	NKX28_HUMAN	NK2 homeobox 8						liver development|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Breast(36;0.143)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.0113)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0171)		GATGGGCGTGGGAGGCGCTCG	0.657													3	4	---	---	---	---	PASS
DLST	1743	broad.mit.edu	37	14	75369021	75369021	+	Silent	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75369021C>G	uc001xqv.2	+	15	1413	c.1350C>G	c.(1348-1350)CTC>CTG	p.L450L	DLST_uc001xqt.2_Silent_p.L366L|DLST_uc010tuw.1_Silent_p.L364L	NM_001933	NP_001924	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2	450					lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus	dihydrolipoyllysine-residue succinyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00698)		GAGTCCTCCTCCTGGATCTTT	0.547													9	43	---	---	---	---	PASS
DIO2	1734	broad.mit.edu	37	14	80677816	80677816	+	5'UTR	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80677816C>T	uc010tvq.1	-	2					uc001xuw.1_RNA|DIO2_uc010tvp.1_5'UTR|DIO2_uc001xut.2_RNA|DIO2_uc010asx.2_5'UTR|DIO2_uc010tvr.1_5'UTR|DIO2_uc010asy.2_5'UTR	NM_000793	NP_000784	Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II isoform a						hormone biosynthetic process|selenocysteine incorporation|thyroid hormone generation	integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|ubiquitin protein ligase binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0281)		GGATGCCCATCTTCTCTGCCT	0.527													4	13	---	---	---	---	PASS
FLRT2	23768	broad.mit.edu	37	14	86088847	86088847	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86088847C>T	uc001xvr.2	+	2	1756	c.989C>T	c.(988-990)TCA>TTA	p.S330L	FLRT2_uc010atd.2_Missense_Mutation_p.S330L	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	330	Extracellular (Potential).|LRRCT.				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TATATCCCTTCATCTCTCAAC	0.478													94	241	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105419822	105419822	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105419822G>A	uc010axc.1	-	7	2086	c.1966C>T	c.(1966-1968)CGC>TGC	p.R656C	AHNAK2_uc001ypx.2_Missense_Mutation_p.R556C	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	656						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTTTTTAAGCGTTTTTCATCG	0.403													74	350	---	---	---	---	PASS
NUDT14	256281	broad.mit.edu	37	14	105644073	105644073	+	Splice_Site	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105644073C>T	uc010tyn.1	-	2	196	c.82_splice	c.e2-1	p.N28_splice	NUDT14_uc001yqi.2_Splice_Site	NM_177533	NP_803877	O95848	NUD14_HUMAN	nudix-type motif 14							cytoplasm	metal ion binding|protein binding|UDP-sugar diphosphatase activity			skin(1)	1		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		GGGCACCATTCTAGAAGGGGC	0.617										HNSCC(42;0.11)			50	159	---	---	---	---	PASS
LOC646214	646214	broad.mit.edu	37	15	21938248	21938248	+	RNA	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21938248G>A	uc010tzj.1	-	1		c.2492C>T				NR_027053				Homo sapiens mRNA for p21-activated kinase 2 variant protein.												0						tagaccaatggaacagaacag	0.234													8	66	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	28900454	28900454	+	RNA	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28900454G>A	uc010uan.1	+	3		c.385G>A			uc010azc.2_RNA|uc010uao.1_RNA					Homo sapiens cDNA FLJ55955 complete cds, highly similar to HECT domain and RCC1-like domain-containing protein 2.																		CAGTCCTTCCGTCATGGGACA	0.438													3	35	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33872188	33872188	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33872188G>C	uc001zhi.2	+	13	1350	c.1280G>C	c.(1279-1281)CGC>CCC	p.R427P	RYR3_uc010bar.2_Missense_Mutation_p.R427P	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	427	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGAAACAATCGCACAGCTGCC	0.562													7	28	---	---	---	---	PASS
SCAPER	49855	broad.mit.edu	37	15	77025725	77025725	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77025725C>G	uc002bby.2	-	15	1926	c.1867G>C	c.(1867-1869)GTA>CTA	p.V623L	SCAPER_uc002bbx.2_Missense_Mutation_p.V377L|SCAPER_uc002bbz.1_Missense_Mutation_p.V494L|SCAPER_uc002bca.1_Missense_Mutation_p.V488L|SCAPER_uc002bcb.1_Missense_Mutation_p.V629L	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	622	Glu-rich.					endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						ATTTCATTTACCTTTAAAAAA	0.284													7	63	---	---	---	---	PASS
TELO2	9894	broad.mit.edu	37	16	1551483	1551483	+	Silent	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1551483C>T	uc002cly.2	+	10	1635	c.1344C>T	c.(1342-1344)GAC>GAT	p.D448D		NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog	448						chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)				CTGCGGGTGACGGCGCCTCGG	0.692													11	5	---	---	---	---	PASS
FAHD1	81889	broad.mit.edu	37	16	1877398	1877398	+	Silent	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1877398C>A	uc002cnc.1	+	1	174	c.168C>A	c.(166-168)GGC>GGA	p.G56G	HAGH_uc002cmz.2_5'Flank|HAGH_uc002cna.2_5'Flank|HAGH_uc010uvp.1_5'Flank|HAGH_uc002cnb.1_5'Flank|HAGH_uc010bry.1_5'Flank|FAHD1_uc002cnd.2_Silent_p.G56G|FAHD1_uc010brz.2_Silent_p.G56G	NM_031208	NP_112485	Q6P587	FAHD1_HUMAN	fumarylacetoacetate hydrolase domain containing	56						mitochondrion	hydrolase activity|metal ion binding|protein binding				0						CGCCCGAGGGCTCGCCCATCC	0.697													3	43	---	---	---	---	PASS
POLR3E	55718	broad.mit.edu	37	16	22337220	22337220	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22337220G>A	uc002dkk.2	+	18	1643	c.1487G>A	c.(1486-1488)CGG>CAG	p.R496Q	POLR3E_uc002dkj.1_Missense_Mutation_p.R496Q|POLR3E_uc002dkm.2_Missense_Mutation_p.R460Q|POLR3E_uc010vbr.1_Missense_Mutation_p.R496Q|POLR3E_uc002dkl.2_Missense_Mutation_p.R496Q|POLR3E_uc010vbs.1_Missense_Mutation_p.R460Q|POLR3E_uc010vbt.1_Missense_Mutation_p.R440Q	NM_018119	NP_060589	Q9NVU0	RPC5_HUMAN	RNA polymerase III polypeptide E	496					innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA-directed RNA polymerase activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.012)		CCCGGTGTGCGGATCAAGGAG	0.542													9	22	---	---	---	---	PASS
SCNN1B	6338	broad.mit.edu	37	16	23387131	23387131	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23387131C>T	uc002dln.2	+	8	1401	c.1225C>T	c.(1225-1227)CCC>TCC	p.P409S		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	409	Extracellular (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	GTACCCACTGCCCCGTGGGGA	0.617													4	169	---	---	---	---	PASS
TNRC6A	27327	broad.mit.edu	37	16	24816249	24816249	+	Intron	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24816249C>A	uc002dmm.2	+						TNRC6A_uc010bxs.2_Intron|TNRC6A_uc002dmn.2_Intron|TNRC6A_uc002dmo.2_Intron|TNRC6A_uc002dmp.2_Intron|TNRC6A_uc002dmq.2_Translation_Start_Site	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A						negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		CATGTAGTTACTGTGTTTAAA	0.343													18	204	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	28354353	28354353	+	Missense_Mutation	SNP	T	G	G	rs1794256	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28354353T>G	uc010vcq.1	-	7	852	c.799A>C	c.(799-801)ACT>CCT	p.T267P	uc010vcr.1_Missense_Mutation_p.T285P					SubName: Full=LOC728741 protein;																		AGACACTCAGTAGGTGTCTTG	0.507													3	117	---	---	---	---	PASS
FBXL19	54620	broad.mit.edu	37	16	30958453	30958453	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30958453C>A	uc002eab.2	+	11	2145	c.1987C>A	c.(1987-1989)CGC>AGC	p.R663S	FBXL19_uc002dzz.1_Missense_Mutation_p.R351S|FBXL19_uc002eaa.1_Missense_Mutation_p.R562S|ORAI3_uc002eac.2_5'Flank	NM_001099784	NP_001093254	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	663	LRR 6.						DNA binding|zinc ion binding			ovary(2)|lung(1)|breast(1)	4						GCGCTCCTGCCGCCAGCTCTC	0.687													3	23	---	---	---	---	PASS
ZNF668	79759	broad.mit.edu	37	16	31075213	31075213	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31075213G>A	uc010caf.2	-	2	925	c.568C>T	c.(568-570)CAC>TAC	p.H190Y	ZNF668_uc002eao.2_Missense_Mutation_p.H190Y|ZNF668_uc010cag.1_Missense_Mutation_p.H190Y	NM_024706	NP_078982	Q96K58	ZN668_HUMAN	zinc finger protein 668	190	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(4)	4						AGGCCAGCGTGAGTACGCCGG	0.657													9	14	---	---	---	---	PASS
LRRC29	26231	broad.mit.edu	37	16	67242311	67242311	+	Silent	SNP	A	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67242311A>G	uc002esd.2	-	2	1086	c.189T>C	c.(187-189)TGT>TGC	p.C63C	LRRC29_uc002ese.2_Silent_p.C63C|LRRC29_uc002esf.2_Silent_p.C63C|LRRC29_uc002esg.2_Silent_p.C63C	NM_012163	NP_036295	Q8WV35	LRC29_HUMAN	F-box and leucine-rich repeat protein 9	63	LRR 2.										0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		GTGGCTCTGGACAGGCGTCCT	0.592													3	187	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76569457	76569457	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76569457G>A	uc002feu.1	+	20	3156	c.2771G>A	c.(2770-2772)AGA>AAA	p.R924K	CNTNAP4_uc002fev.1_Missense_Mutation_p.R788K|CNTNAP4_uc010chb.1_Missense_Mutation_p.R851K|CNTNAP4_uc002fex.1_Missense_Mutation_p.R927K	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	924	Extracellular (Potential).|Laminin G-like 3.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						ACGGCCACCAGACAGAGAGGC	0.483													18	77	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161902	90161902	+	3'UTR	SNP	A	G	G	rs6500471	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161902A>G	uc002fqp.2	+	3					uc002fqq.2_3'UTR					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		ATATGTTCCAAGACCCTAAAA	0.537													3	60	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	C	C	rs121912666		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578190T>C	uc002gim.2	-	6	853	c.659A>G	c.(658-660)TAT>TGT	p.Y220C	TP53_uc002gig.1_Missense_Mutation_p.Y220C|TP53_uc002gih.2_Missense_Mutation_p.Y220C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y88C|TP53_uc010cng.1_Missense_Mutation_p.Y88C|TP53_uc002gii.1_Missense_Mutation_p.Y88C|TP53_uc010cnh.1_Missense_Mutation_p.Y220C|TP53_uc010cni.1_Missense_Mutation_p.Y220C|TP53_uc002gij.2_Missense_Mutation_p.Y220C|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.Y127C|TP53_uc002gio.2_Missense_Mutation_p.Y88C|TP53_uc010vug.1_Missense_Mutation_p.Y181C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	220	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> N (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y220C(205)|p.Y220N(12)|p.Y220H(9)|p.Y220S(9)|p.0?(7)|p.Y220fs*27(4)|p.Y220*(3)|p.Y220D(2)|p.Y127C(2)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.?(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*1(1)|p.Y220fs*2(1)|p.V218fs*26(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AGGCGGCTCATAGGGCACCAC	0.557		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			31	17	---	---	---	---	PASS
USP43	124739	broad.mit.edu	37	17	9631804	9631804	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9631804G>T	uc010cod.2	+	15	2869	c.2869G>T	c.(2869-2871)GAG>TAG	p.E957*	USP43_uc002gma.3_Nonsense_Mutation_p.E646*|USP43_uc010vva.1_Nonsense_Mutation_p.E952*|USP43_uc010coe.2_Nonsense_Mutation_p.E754*|USP43_uc002gmc.3_Nonsense_Mutation_p.E469*	NM_153210	NP_694942	Q70EL4	UBP43_HUMAN	ubiquitin specific protease 43	957					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						GAACTGGAAGGAGAGCTTCCA	0.552													12	28	---	---	---	---	PASS
FLJ36000	284124	broad.mit.edu	37	17	21904125	21904125	+	RNA	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21904125G>A	uc002gza.2	+	1		c.64G>A				NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						ggagtcgcaaggggccgagca	0.000													7	79	---	---	---	---	PASS
FOXN1	8456	broad.mit.edu	37	17	26864522	26864522	+	3'UTR	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26864522G>A	uc010crm.2	+	9					FOXN1_uc002hbj.2_3'UTR	NM_003593	NP_003584	O15353	FOXN1_HUMAN	forkhead box N1						defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	Lung NSC(42;0.00431)					GCCCACATCGGGCTCACCTTA	0.612													4	23	---	---	---	---	PASS
SGK494	124923	broad.mit.edu	37	17	26939559	26939559	+	Intron	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26939559C>A	uc002hbr.1	-						SGK494_uc010waq.1_Intron|SGK494_uc010war.1_Intron|uc010crq.1_5'Flank|uc002hbs.1_RNA	NM_144610	NP_653211			uncharacterized serine/threonine-protein kinase												0						AAAGGCAGAACAAGCCAAAGA	0.532													11	18	---	---	---	---	PASS
CPD	1362	broad.mit.edu	37	17	28778804	28778804	+	Missense_Mutation	SNP	T	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28778804T>A	uc002hfb.1	+	14	3160	c.3145T>A	c.(3145-3147)TGT>AGT	p.C1049S	CPD_uc010wbo.1_Missense_Mutation_p.C802S|CPD_uc010wbp.1_Intron	NM_001304	NP_001295	O75976	CBPD_HUMAN	carboxypeptidase D precursor	1049	Extracellular (Potential).|Carboxypeptidase-like 3.				proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2						AGAGAAAGACTGTACTTCAAA	0.388													14	91	---	---	---	---	PASS
RARA	5914	broad.mit.edu	37	17	38510626	38510626	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38510626C>T	uc002huk.1	+	7	1335	c.880C>T	c.(880-882)CGG>TGG	p.R294W	RARA_uc002hul.3_Missense_Mutation_p.R294W|RARA_uc010wfe.1_Missense_Mutation_p.R197W|RARA_uc002hun.1_Missense_Mutation_p.R289W	NM_000964	NP_000955	P10276	RARA_HUMAN	retinoic acid receptor, alpha isoform 1	294	Ligand-binding.				apoptotic cell clearance|cellular response to estrogen stimulus|cellular response to retinoic acid|estrogen receptor signaling pathway|negative regulation of granulocyte differentiation|negative regulation of interferon-gamma production|negative regulation of tumor necrosis factor production|positive regulation of binding|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-5 production|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	cytoplasm|nucleoplasm	chromatin DNA binding|enzyme binding|protein domain specific binding|protein heterodimerization activity|receptor binding|retinoic acid binding|retinoic acid receptor activity|retinoic acid-responsive element binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	GACCCTGAACCGGACCCAGAT	0.642			T	PML|ZNF145|TIF1|NUMA1|NPM1	APL								21	93	---	---	---	---	PASS
C17orf57	124989	broad.mit.edu	37	17	45518103	45518103	+	3'UTR	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45518103G>C	uc002iln.2	+	25						NM_152347	NP_689560	Q8IY85	CQ057_HUMAN	hypothetical protein LOC124989								calcium ion binding			breast(1)|central_nervous_system(1)|skin(1)	3						GATAGTGCTAGAAAATTACTA	0.249													8	70	---	---	---	---	PASS
HOXB4	3214	broad.mit.edu	37	17	46654110	46654110	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46654110G>A	uc002inp.2	-	2	792	c.730C>T	c.(730-732)CCC>TCC	p.P244S	HOXB3_uc010wlm.1_Intron|HOXB3_uc010dbf.2_Intron|HOXB3_uc010dbg.2_Intron|HOXB3_uc002ino.2_5'Flank|HOXB3_uc010wlk.1_5'Flank|HOXB3_uc010wll.1_Intron	NM_024015	NP_076920	P17483	HXB4_HUMAN	homeobox B4	244						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CCTCCATTGGGCCGGCCAGGG	0.697													11	50	---	---	---	---	PASS
BCAS3	54828	broad.mit.edu	37	17	58952079	58952079	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58952079C>T	uc002iyv.3	+	9	750	c.641C>T	c.(640-642)ACG>ATG	p.T214M	BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Missense_Mutation_p.T214M|BCAS3_uc002iyw.3_Missense_Mutation_p.T210M	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1	214						nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			TGTACTTTCACGAAGAAATTC	0.328													10	51	---	---	---	---	PASS
CD300LF	146722	broad.mit.edu	37	17	72691301	72691301	+	Silent	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72691301G>A	uc002jlg.2	-	7	910	c.807C>T	c.(805-807)CTC>CTT	p.L269L	RAB37_uc002jlc.2_Intron|RAB37_uc010dfu.2_Intron|RAB37_uc002jld.2_Intron|CD300LF_uc002jlf.2_Silent_p.L272L|CD300LF_uc010dfw.2_RNA|CD300LF_uc002jlh.2_3'UTR|CD300LF_uc002jli.2_3'UTR|CD300LF_uc010wra.1_Silent_p.L284L	NM_139018	NP_620587	Q8TDQ1	CLM1_HUMAN	NK inhibitory receptor precursor	269	Cytoplasmic (Potential).					integral to membrane|plasma membrane	receptor activity			upper_aerodigestive_tract(1)	1						GGTGGCTACTGAGGTGGCCCA	0.602													26	90	---	---	---	---	PASS
CDH2	1000	broad.mit.edu	37	18	25593677	25593677	+	Silent	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25593677C>T	uc002kwg.2	-	3	828	c.369G>A	c.(367-369)CTG>CTA	p.L123L	CDH2_uc010xbn.1_Silent_p.L92L	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	123					adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						AGGTTGGCTTCAGGCTCAATT	0.418													51	205	---	---	---	---	PASS
TCF4	6925	broad.mit.edu	37	18	52946874	52946874	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52946874G>C	uc002lfz.2	-	9	1175	c.563C>G	c.(562-564)TCA>TGA	p.S188*	TCF4_uc002lfw.3_Nonsense_Mutation_p.S28*|TCF4_uc010xdu.1_Nonsense_Mutation_p.S58*|TCF4_uc010xdv.1_Nonsense_Mutation_p.S58*|TCF4_uc002lfx.2_Nonsense_Mutation_p.S117*|TCF4_uc010xdw.1_Nonsense_Mutation_p.S58*|TCF4_uc002lfy.2_Nonsense_Mutation_p.S146*|TCF4_uc010xdx.1_Nonsense_Mutation_p.S164*|TCF4_uc010dph.1_Nonsense_Mutation_p.S188*|TCF4_uc010xdy.1_Nonsense_Mutation_p.S164*|TCF4_uc002lga.2_Nonsense_Mutation_p.S290*|TCF4_uc002lgb.1_Nonsense_Mutation_p.S28*|TCF4_uc010dpi.2_Nonsense_Mutation_p.S194*|TCF4_uc002lgc.3_Nonsense_Mutation_p.S109*|TCF4_uc002lfv.2_Translation_Start_Site	NM_003199	NP_003190	P15884	ITF2_HUMAN	transcription factor 4 isoform b	188					positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		AGTGCTTGCTGATGGAGCATA	0.478													9	60	---	---	---	---	PASS
TCF4	6925	broad.mit.edu	37	18	52946899	52946899	+	Intron	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52946899G>C	uc002lfz.2	-						TCF4_uc002lfw.3_Intron|TCF4_uc010xdu.1_Intron|TCF4_uc010xdv.1_Intron|TCF4_uc002lfx.2_Intron|TCF4_uc010xdw.1_Intron|TCF4_uc002lfy.2_Intron|TCF4_uc010xdx.1_Intron|TCF4_uc010dph.1_Intron|TCF4_uc010xdy.1_Intron|TCF4_uc002lga.2_Intron|TCF4_uc002lgb.1_Intron|TCF4_uc010dpi.2_Missense_Mutation_p.L186V|TCF4_uc002lgc.3_Intron|TCF4_uc002lfv.2_5'Flank	NM_003199	NP_003190	P15884	ITF2_HUMAN	transcription factor 4 isoform b						positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		TGAGGAGAAAGAACCAACTGA	0.473													10	47	---	---	---	---	PASS
SERPINB13	5275	broad.mit.edu	37	18	61255985	61255985	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61255985C>G	uc002ljc.2	+	2	252	c.84C>G	c.(82-84)TTC>TTG	p.F28L	SERPINB13_uc002ljd.2_5'UTR|SERPINB13_uc010xep.1_Missense_Mutation_p.F28L|SERPINB13_uc010xeq.1_5'UTR|SERPINB13_uc010xer.1_5'UTR	NM_012397	NP_036529	Q9UIV8	SPB13_HUMAN	serine (or cysteine) proteinase inhibitor, clade	28					regulation of proteolysis|response to UV	cytoplasm|extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1						GCAACATCTTCTTTTCCCCTG	0.532													19	53	---	---	---	---	PASS
TMX3	54495	broad.mit.edu	37	18	66381117	66381117	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66381117C>T	uc002lkf.2	-	2	202	c.67G>A	c.(67-69)GTC>ATC	p.V23I	CCDC102B_uc002lkk.2_5'Flank|TMX3_uc010xez.1_5'UTR|TMX3_uc010xfa.1_Missense_Mutation_p.V23I|TMX3_uc002lkg.3_Missense_Mutation_p.V23I|CCDC102B_uc002lkh.2_5'Flank	NM_019022	NP_061895	Q96JJ7	TMX3_HUMAN	thioredoxin domain containing 10 precursor	23					cell redox homeostasis|glycerol ether metabolic process	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			skin(1)	1						CCTTTACAGACGACCATATCA	0.294													4	15	---	---	---	---	PASS
ZNF516	9658	broad.mit.edu	37	18	74153297	74153297	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74153297C>T	uc010dqx.1	-	2	1949	c.1714G>A	c.(1714-1716)GGC>AGC	p.G572S	ZNF516_uc002lme.2_RNA	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	572					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CAGGCGGAGCCAGGGCTGCTG	0.736													6	15	---	---	---	---	PASS
ZNF555	148254	broad.mit.edu	37	19	2852822	2852822	+	Silent	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2852822G>A	uc002lwo.2	+	4	848	c.759G>A	c.(757-759)GAG>GAA	p.E253E	ZNF555_uc002lwn.3_Silent_p.E252E	NM_152791	NP_690004	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	253					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACACCGGAGAGAAGCCATATA	0.413													12	64	---	---	---	---	PASS
OR2Z1	284383	broad.mit.edu	37	19	8842207	8842207	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8842207G>A	uc010xkg.1	+	1	817	c.817G>A	c.(817-819)GTG>ATG	p.V273M		NM_001004699	NP_001004699	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z,	273	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2						GCAGGATAACGTGGTTTCCCT	0.537													27	160	---	---	---	---	PASS
CARM1	10498	broad.mit.edu	37	19	11032381	11032381	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11032381C>A	uc002mpz.2	+	16	1901	c.1775C>A	c.(1774-1776)TCC>TAC	p.S592Y	CARM1_uc010dxn.2_RNA|CARM1_uc002mqa.2_Missense_Mutation_p.S352Y	NM_199141	NP_954592	Q86X55	CARM1_HUMAN	coactivator-associated arginine	592	Transactivation domain (By similarity).				cellular lipid metabolic process|histone H3-R2 methylation|interspecies interaction between organisms|pathogenesis|positive regulation of fat cell differentiation|regulation of estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleoplasm	beta-catenin binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-R17 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein-arginine omega-N asymmetric methyltransferase activity|transcription regulatory region DNA binding				0						CCCGCCATCTCCATGGCGTCG	0.652													34	156	---	---	---	---	PASS
EMR2	30817	broad.mit.edu	37	19	14847024	14847024	+	3'UTR	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14847024G>A	uc002mzp.1	-	21					EMR2_uc010dzs.1_3'UTR|EMR2_uc010xnw.1_3'UTR|EMR2_uc002mzo.1_3'UTR|EMR2_uc002mzq.1_3'UTR|EMR2_uc002mzr.1_3'UTR|EMR2_uc002mzs.1_3'UTR|EMR2_uc002mzt.1_3'UTR|EMR2_uc002mzu.1_3'UTR	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone						cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			lung(2)|ovary(1)|skin(1)	4						GGCAAAGAGGGAAGATCTTAT	0.259													20	45	---	---	---	---	PASS
CYP4F2	8529	broad.mit.edu	37	19	15989523	15989523	+	3'UTR	SNP	T	C	C	rs3952538		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15989523T>C	uc002nbs.1	-	13					CYP4F2_uc010xot.1_3'UTR	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,						leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						aattctaggcttcacttttga	0.259													4	62	---	---	---	---	PASS
ZNF714	148206	broad.mit.edu	37	19	21281118	21281118	+	Splice_Site	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21281118G>A	uc002npo.3	+	3	403	c.43_splice	c.e3+1	p.A15_splice	ZNF714_uc002npl.2_Splice_Site|ZNF714_uc010ecp.1_Splice_Site|ZNF714_uc002npn.2_Splice_Site	NM_182515	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTCTTCTTGGGTGAGAATAAC	0.328													22	65	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	22785606	22785606	+	RNA	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22785606C>G	uc002nqu.3	+	9		c.1613C>G								Homo sapiens cDNA FLJ60031 complete cds, moderately similar to Golgin subfamily A member 2.																		ACACTGCCCTCTCTCAGCCAG	0.667													8	22	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22939544	22939544	+	Missense_Mutation	SNP	A	C	C	rs58378942		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22939544A>C	uc010xrh.1	-	7	2627	c.2627T>G	c.(2626-2628)ATG>AGG	p.M876R		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CTTATGTTTCATAAGGGTTGA	0.343													3	69	---	---	---	---	PASS
RPSAP58	388524	broad.mit.edu	37	19	24010294	24010294	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24010294C>G	uc002nrn.2	+	4	754	c.331C>G	c.(331-333)CAG>GAG	p.Q111E		NM_002295	NP_002286			ribosomal protein SA												0						CTTCACTAACCAGATCCAGGC	0.567													4	56	---	---	---	---	PASS
ZNF780A	284323	broad.mit.edu	37	19	40578057	40578057	+	3'UTR	SNP	C	T	T	rs144951298	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40578057C>T	uc002omw.3	-	9						NM_001142579	NP_001136051	O75290	Z780A_HUMAN	zinc finger protein 780A isoform c						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					aaatctaccgcggacccctgg	0.000													4	31	---	---	---	---	PASS
ZNF780A	284323	broad.mit.edu	37	19	40578071	40578071	+	3'UTR	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40578071G>A	uc002omw.3	-	9						NM_001142579	NP_001136051	O75290	Z780A_HUMAN	zinc finger protein 780A isoform c						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					cccctggaccggcctgctagc	0.000													3	38	---	---	---	---	PASS
ARHGEF1	9138	broad.mit.edu	37	19	42410144	42410144	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42410144G>A	uc002orx.2	+	26	2567	c.2458G>A	c.(2458-2460)GAG>AAG	p.E820K	ARHGEF1_uc002ory.2_Missense_Mutation_p.E787K|ARHGEF1_uc002orz.2_Missense_Mutation_p.E658K|ARHGEF1_uc002osa.2_Missense_Mutation_p.E835K|ARHGEF1_uc002osb.2_Missense_Mutation_p.E802K|ARHGEF1_uc002osc.2_Missense_Mutation_p.E574K|ARHGEF1_uc002osd.2_Missense_Mutation_p.E479K|ARHGEF1_uc002ose.2_Missense_Mutation_p.E264K	NM_004706	NP_004697	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor 1 isoform	820					cell proliferation|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(3)|large_intestine(1)	4		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		ACCAGGCCCCGAGGGCCAGCT	0.512													26	125	---	---	---	---	PASS
ZNF285	26974	broad.mit.edu	37	19	44891096	44891096	+	Silent	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44891096G>A	uc002ozd.3	-	4	1398	c.1311C>T	c.(1309-1311)TTC>TTT	p.F437F	ZFP112_uc010xwz.1_Intron|ZNF285_uc010xxa.1_Silent_p.F444F	NM_152354	NP_689567	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	437	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(2)	4						TACATTGGCTGAAGCCCTTTC	0.473													21	109	---	---	---	---	PASS
ZNF813	126017	broad.mit.edu	37	19	53994369	53994369	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53994369G>T	uc002qbu.2	+	4	1011	c.883G>T	c.(883-885)GGA>TGA	p.G295*	ZNF813_uc010eqq.1_Intron	NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	295					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		ACTTCATACTGGAGAGAAACC	0.398													19	119	---	---	---	---	PASS
LILRA2	11027	broad.mit.edu	37	19	55085807	55085807	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55085807C>T	uc002qgg.3	+	3	199	c.110C>T	c.(109-111)TCT>TTT	p.S37F	LILRA2_uc010ern.2_Missense_Mutation_p.S37F|LILRA2_uc002qgf.2_Missense_Mutation_p.S37F|LILRA2_uc010yfe.1_Missense_Mutation_p.S37F|LILRA2_uc010yff.1_Missense_Mutation_p.S25F|LILRA2_uc010ero.2_Missense_Mutation_p.S25F|LILRA2_uc010yfg.1_Missense_Mutation_p.S37F	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	37	Extracellular (Potential).|Ig-like C2-type 1.				defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		GAGCCAGGCTCTGTGATCATC	0.542													99	157	---	---	---	---	PASS
NLRP2	55655	broad.mit.edu	37	19	55493697	55493697	+	Silent	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55493697C>T	uc002qij.2	+	6	717	c.631C>T	c.(631-633)CTG>TTG	p.L211L	NLRP2_uc010yfp.1_Silent_p.L188L|NLRP2_uc010esn.2_Silent_p.L187L|NLRP2_uc010eso.2_Silent_p.L208L|NLRP2_uc010esp.2_Silent_p.L189L	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	211	NACHT.				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		CACGGTGGTGCTGTATGGTCC	0.517													63	125	---	---	---	---	PASS
ZIM3	114026	broad.mit.edu	37	19	57647056	57647056	+	Missense_Mutation	SNP	G	C	C	rs150862431		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57647056G>C	uc002qnz.1	-	5	1035	c.649C>G	c.(649-651)CAC>GAC	p.H217D		NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	217	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCCTCTGCGTGAGTTTTCTGA	0.428													40	209	---	---	---	---	PASS
C20orf96	140680	broad.mit.edu	37	20	256641	256641	+	Silent	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:256641G>C	uc002wde.1	-	10	1138	c.999C>G	c.(997-999)GTC>GTG	p.V333V	C20orf96_uc002wdc.2_Silent_p.V280V|C20orf96_uc002wdd.2_Silent_p.V298V|C20orf96_uc010zpi.1_Silent_p.V280V|C20orf96_uc010zpj.1_3'UTR|C20orf96_uc010zpk.1_3'UTR	NM_153269	NP_695001	Q9NUD7	CT096_HUMAN	hypothetical protein LOC140680	333											0		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CCTCAAATATGACCTCTCGGG	0.512													18	80	---	---	---	---	PASS
SIRPB2	284759	broad.mit.edu	37	20	1459226	1459226	+	Missense_Mutation	SNP	A	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1459226A>C	uc002wfg.2	-	3	706	c.478T>G	c.(478-480)TGG>GGG	p.W160G	SIRPB2_uc002wfh.3_Missense_Mutation_p.W62G|SIRPB2_uc010zpr.1_Missense_Mutation_p.W22G	NM_001122962	NP_001116434	Q5JXA9	SIRB2_HUMAN	signal-regulatory protein beta 2 isoform 1	160	Ig-like V-type 2.|Extracellular (Potential).					integral to membrane					0						TGGATGATCCACAGGTCTGGT	0.443													10	76	---	---	---	---	PASS
CRNKL1	51340	broad.mit.edu	37	20	20026049	20026049	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20026049C>T	uc002wrs.2	-	7	1219	c.1187G>A	c.(1186-1188)CGG>CAG	p.R396Q		NM_016652	NP_057736	Q9BZJ0	CRNL1_HUMAN	crooked neck-like 1 protein	396	HAT 6.				spliceosome assembly	catalytic step 2 spliceosome|cytoplasm|nuclear speck	RNA binding			ovary(2)|large_intestine(1)	3						ATACACTTTCCGTGCATGGGC	0.418													44	190	---	---	---	---	PASS
ZNF341	84905	broad.mit.edu	37	20	32336848	32336848	+	Silent	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32336848G>A	uc002wzy.2	+	4	479	c.459G>A	c.(457-459)CAG>CAA	p.Q153Q	ZNF341_uc002wzx.2_Silent_p.Q153Q|ZNF341_uc010geq.2_Silent_p.Q63Q|ZNF341_uc010ger.2_RNA	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	153	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CCCTGGACCAGCCCATGCCCC	0.572													4	153	---	---	---	---	PASS
TGM2	7052	broad.mit.edu	37	20	36758657	36758657	+	Silent	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36758657C>T	uc002xhr.2	-	13	2128	c.2028G>A	c.(2026-2028)GTG>GTA	p.V676V	TGM2_uc002xhq.2_Silent_p.V277V|TGM2_uc010zvx.1_Silent_p.V595V|TGM2_uc010zvy.1_Silent_p.V616V	NM_004613	NP_004604	P21980	TGM2_HUMAN	transglutaminase 2 isoform a	676					apoptotic cell clearance|peptide cross-linking|positive regulation of cell adhesion		acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(1)|lung(1)|ovary(1)	3		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	GGAAGCCCTTCACAGCCTTCA	0.587													4	31	---	---	---	---	PASS
CDH22	64405	broad.mit.edu	37	20	44856245	44856245	+	Missense_Mutation	SNP	A	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44856245A>T	uc002xrm.2	-	3	973	c.572T>A	c.(571-573)ATG>AAG	p.M191K	CDH22_uc010ghk.1_Missense_Mutation_p.M191K	NM_021248	NP_067071	Q9UJ99	CAD22_HUMAN	cadherin 22 precursor	191	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				ATCCGAGGCCATCACCTGCAT	0.682													12	5	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57767955	57767955	+	Silent	SNP	G	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57767955G>T	uc002yan.2	+	1	1881	c.1881G>T	c.(1879-1881)ACG>ACT	p.T627T		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	627						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					GGGATGAGACGTTCAAAAGGA	0.592													11	85	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11038962	11038962	+	3'UTR	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11038962C>G	uc002yit.1	-	6					TPTE_uc002yis.1_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AATGATGACTCTGTCTCAGAT	0.413													18	797	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11039272	11039272	+	3'UTR	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11039272C>T	uc002yit.1	-	6					TPTE_uc002yis.1_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GTTGCTCTTGCTGCACAGTGA	0.398													26	589	---	---	---	---	PASS
TIAM1	7074	broad.mit.edu	37	21	32575277	32575277	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32575277C>T	uc002yow.1	-	13	2912	c.2440G>A	c.(2440-2442)GAA>AAA	p.E814K	TIAM1_uc011adk.1_Missense_Mutation_p.E814K|TIAM1_uc011adl.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	814	RBD.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						ATTTTGTTTTCTATTAGAAAT	0.378													26	207	---	---	---	---	PASS
ITSN1	6453	broad.mit.edu	37	21	35255954	35255954	+	Missense_Mutation	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35255954G>A	uc002yta.1	+	36	4923	c.4655G>A	c.(4654-4656)CGA>CAA	p.R1552Q	DONSON_uc002ysn.1_Intron|ITSN1_uc002ytb.1_Missense_Mutation_p.R1547Q|ITSN1_uc002ytj.2_Missense_Mutation_p.R1491Q|ITSN1_uc010gmm.1_RNA|ITSN1_uc010gmn.1_RNA|ITSN1_uc002ytk.1_Intron	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	1552	PH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						TATACTCTCCGAGCAGAAAGC	0.537													29	199	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40568278	40568278	+	Intron	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40568278C>T	uc002yxk.1	-						BRWD1_uc010goc.1_Intron|BRWD1_uc002yxl.2_Silent_p.T2239T	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CCTGATTTCTCGTTTTTATTT	0.393													67	483	---	---	---	---	PASS
MCM3AP	8888	broad.mit.edu	37	21	47674341	47674341	+	Silent	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47674341C>T	uc002zir.1	-	19	4137	c.4101G>A	c.(4099-4101)CCG>CCA	p.P1367P	MCM3AP_uc002zip.1_Silent_p.P108P|MCM3AP_uc002ziq.1_Silent_p.P294P	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	1367					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					CCTCTACATCCGGCAACACCA	0.617													9	153	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22664141	22664141	+	RNA	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22664141G>A	uc011aim.1	+	30		c.1998G>A			LOC96610_uc011aiq.1_RNA					Parts of antibodies, mostly variable regions.												0						AAATTTGAAGGTGCTGTGATT	0.448													4	137	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23011001	23011001	+	RNA	SNP	G	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23011001G>T	uc011aim.1	+	121		c.7687G>T								Parts of antibodies, mostly variable regions.												0						GGCCTCCTATGAGCTGACACA	0.557													77	260	---	---	---	---	PASS
UPB1	51733	broad.mit.edu	37	22	24909450	24909450	+	Missense_Mutation	SNP	C	A	A	rs138608016		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24909450C>A	uc003aaf.2	+	5	739	c.618C>A	c.(616-618)AAC>AAA	p.N206K	UPB1_uc003aae.2_Missense_Mutation_p.N138K|UPB1_uc011ajt.1_Missense_Mutation_p.N206K	NM_016327	NP_057411	Q9UBR1	BUP1_HUMAN	beta-ureidopropionase	206	CN hydrolase.				pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol	beta-ureidopropionase activity|metal ion binding	p.N206N(1)		ovary(2)	2	Colorectal(2;0.0339)					GTGATTTCAACGAGGTGAGCC	0.512													76	49	---	---	---	---	PASS
AP1B1	162	broad.mit.edu	37	22	29730359	29730359	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29730359G>C	uc003afj.2	-	17	2388	c.2204C>G	c.(2203-2205)TCA>TGA	p.S735*	AP1B1_uc003afi.2_Nonsense_Mutation_p.S728*|AP1B1_uc003afk.2_Nonsense_Mutation_p.S728*|AP1B1_uc003afl.2_Intron|AP1B1_uc003afh.2_5'Flank|AP1B1_uc011ako.1_Nonsense_Mutation_p.S288*|SNORD125_uc010gvn.1_5'Flank	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit	735					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						GAAGGTGCCTGAGATCTCCAG	0.617													13	37	---	---	---	---	PASS
REPS2	9185	broad.mit.edu	37	X	17080618	17080618	+	Missense_Mutation	SNP	C	A	A	rs147267823	byFrequency	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17080618C>A	uc004cxv.1	+	9	1343	c.1172C>A	c.(1171-1173)CCG>CAG	p.P391Q	REPS2_uc004cxw.1_Missense_Mutation_p.P390Q|REPS2_uc011miw.1_Missense_Mutation_p.P250Q	NM_004726	NP_004717	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	391					epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding			skin(2)|central_nervous_system(1)	3	Hepatocellular(33;0.183)					GAGTCACTGCCGGCAAATCAA	0.363													3	52	---	---	---	---	PASS
SLC7A3	84889	broad.mit.edu	37	X	70149567	70149567	+	Missense_Mutation	SNP	G	C	C			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70149567G>C	uc004dyn.2	-	2	439	c.281C>G	c.(280-282)TCT>TGT	p.S94C	SLC7A3_uc004dyo.2_Missense_Mutation_p.S94C	NM_032803	NP_116192	Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid	94	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process	integral to membrane|plasma membrane				ovary(1)|kidney(1)	2	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	TGCCGAACCAGAACGGGGAAC	0.542													10	16	---	---	---	---	PASS
PHKA1	5255	broad.mit.edu	37	X	71839145	71839145	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71839145C>T	uc004eax.3	-	20	2449	c.2148G>A	c.(2146-2148)ATG>ATA	p.M716I	PHKA1_uc004eay.3_Missense_Mutation_p.M716I|PHKA1_uc011mqi.1_Missense_Mutation_p.M657I	NM_002637	NP_002628	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle) isoform	716					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)|skin(1)	4	Renal(35;0.156)					TAGGAAGATACATGTGAACAT	0.388													10	4	---	---	---	---	PASS
MAGEE2	139599	broad.mit.edu	37	X	75003748	75003748	+	Missense_Mutation	SNP	A	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75003748A>G	uc004ecj.1	-	1	1324	c.1139T>C	c.(1138-1140)CTT>CCT	p.L380P		NM_138703	NP_619648	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	380	MAGE 2.									ovary(1)|skin(1)	2						TTGCTGGACAAGGAGGTAGAT	0.443													38	82	---	---	---	---	PASS
LOC442459	442459	broad.mit.edu	37	X	98976006	98976006	+	RNA	SNP	G	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:98976006G>A	uc011mrd.1	-	7		c.593C>T				NR_024608				Homo sapiens DNA repair protein mRNA, complete cds.												0						ACTCACCTTCGCTCTGAGATT	0.388													10	20	---	---	---	---	PASS
PAK3	5063	broad.mit.edu	37	X	110463610	110463610	+	Missense_Mutation	SNP	C	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110463610C>A	uc004epa.2	+	15	1642	c.1615C>A	c.(1615-1617)CCT>ACT	p.P539T	PAK3_uc010npt.1_Missense_Mutation_p.P524T|PAK3_uc010npu.1_Missense_Mutation_p.P524T|PAK3_uc004eoz.2_Missense_Mutation_p.P524T|PAK3_uc011mst.1_RNA|PAK3_uc010npv.1_Missense_Mutation_p.P560T|PAK3_uc010npw.1_Missense_Mutation_p.P545T	NM_001128173	NP_001121645	O75914	PAK3_HUMAN	p21-activated kinase 3 isoform d	539					multicellular organismal development		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding			lung(6)|ovary(3)|large_intestine(1)	10						ATTAGCCAAGCCTCTCTCCAG	0.418										TSP Lung(19;0.15)			9	16	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123200039	123200039	+	Missense_Mutation	SNP	C	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123200039C>T	uc004etz.3	+	21	2450	c.2111C>T	c.(2110-2112)TCA>TTA	p.S704L	STAG2_uc004eua.2_Missense_Mutation_p.S704L|STAG2_uc004eub.2_Missense_Mutation_p.S704L|STAG2_uc004euc.2_Missense_Mutation_p.S704L|STAG2_uc004eud.2_Missense_Mutation_p.S704L|STAG2_uc004eue.2_Missense_Mutation_p.S704L	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	704					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						CATGACCTTTCAAAGTGGGAT	0.289													19	51	---	---	---	---	PASS
F8	2157	broad.mit.edu	37	X	154124398	154124398	+	Missense_Mutation	SNP	C	G	G			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154124398C>G	uc004fmt.2	-	22	6554	c.6383G>C	c.(6382-6384)GGG>GCG	p.G2128A	F8_uc010nvi.1_3'UTR	NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	2128	F5/8 type C 1.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CCACTTCTTCCCATCAAGACT	0.413													62	92	---	---	---	---	PASS
NPHP4	261734	broad.mit.edu	37	1	5939838	5939839	+	Intron	DEL	CA	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5939838_5939839delCA	uc001alq.1	-						NPHP4_uc001als.1_Intron|NPHP4_uc009vlt.1_Intron|NPHP4_uc001alt.1_Intron	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin						actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		GAATGGTGCGcacacacacaca	0.292													4	2	---	---	---	---	
ACOT7	11332	broad.mit.edu	37	1	6390127	6390130	+	Intron	DEL	GTGT	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6390127_6390130delGTGT	uc001ams.2	-						ACOT7_uc010nzq.1_Intron|ACOT7_uc001amt.2_Intron|ACOT7_uc001amu.2_Intron|ACOT7_uc001amv.2_Intron|ACOT7_uc001amq.2_Intron|ACOT7_uc001amr.2_Intron	NM_181864	NP_863654	O00154	BACH_HUMAN	acyl-CoA thioesterase 7 isoform hBACHb							mitochondrion|nucleus	carboxylesterase activity|fatty-acyl-CoA binding|palmitoyl-CoA hydrolase activity				0	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		tgtgtgtgtggtgtgtgtgtgtgt	0.260													4	2	---	---	---	---	
KIF17	57576	broad.mit.edu	37	1	21039808	21039808	+	Intron	DEL	A	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21039808delA	uc001bdr.3	-						KIF17_uc001bds.3_Intron	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a						microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		ttttttaattaaaaaaaaaaa	0.259													4	2	---	---	---	---	
MCOLN2	255231	broad.mit.edu	37	1	85417779	85417779	+	Intron	DEL	G	-	-	rs679961	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85417779delG	uc001dkm.2	-						MCOLN2_uc001dkn.2_Intron	NM_153259	NP_694991	Q8IZK6	MCLN2_HUMAN	mucolipin 2							integral to membrane	ion channel activity			ovary(3)|upper_aerodigestive_tract(1)	4				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		tagaaaaaaagaaaaGAGTAT	0.159													4	2	---	---	---	---	
FAM102B	284611	broad.mit.edu	37	1	109167068	109167069	+	Intron	INS	-	AC	AC	rs78911235		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109167068_109167069insAC	uc010ouy.1	+							NM_001010883	NP_001010883	Q5T8I3	F102B_HUMAN	hypothetical protein LOC284611											large_intestine(1)	1		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)		AAAAAAAAAAAAAACCCTTTTC	0.356													4	6	---	---	---	---	
CTSK	1513	broad.mit.edu	37	1	150778140	150778141	+	Intron	DEL	GG	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150778140_150778141delGG	uc001evp.1	-						CTSK_uc001evq.1_Intron	NM_000396	NP_000387	P43235	CATK_HUMAN	cathepsin K preproprotein						proteolysis	lysosome	cysteine-type endopeptidase activity|protein binding			skin(1)	1	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			aaaaaaaaaaggaaaagaaaaa	0.099													31	7	---	---	---	---	
SOAT1	6646	broad.mit.edu	37	1	179310672	179310672	+	Intron	DEL	T	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179310672delT	uc001gml.2	+						SOAT1_uc010pni.1_Intron|SOAT1_uc001gmm.2_Intron|SOAT1_uc010pnj.1_Intron|SOAT1_uc010pnk.1_Intron	NM_003101	NP_003092	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			central_nervous_system(1)|skin(1)	2					Ezetimibe(DB00973)|Hesperetin(DB01094)	TACGTTGAACttttttttttt	0.149													6	3	---	---	---	---	
WDR43	23160	broad.mit.edu	37	2	29145663	29145664	+	Intron	INS	-	TTT	TTT	rs61402912		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29145663_29145664insTTT	uc002rmo.2	+							NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43							nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					TTCTTGCTGTGTTTTTTTTTTT	0.342													4	3	---	---	---	---	
DYNC2LI1	51626	broad.mit.edu	37	2	44032037	44032038	+	Intron	INS	-	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44032037_44032038insA	uc002rtk.2	+						DYNC2LI1_uc002rtj.2_Intron|DYNC2LI1_uc002rtl.2_Intron|DYNC2LI1_uc010ynz.1_Intron	NM_016008	NP_057092	Q8TCX1	DC2L1_HUMAN	dynein 2 light intermediate chain isoform 1							apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CTGTGGGGGTTAAAAAAAAAAA	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	58479808	58479808	+	IGR	DEL	A	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58479808delA								FANCL (11293 upstream) : None (None downstream)																							TTTGtaaattaaaaaaaaaaa	0.234													2	6	---	---	---	---	
C2orf68	388969	broad.mit.edu	37	2	85838764	85838764	+	Intron	DEL	G	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85838764delG	uc002sqc.2	-						USP39_uc002sqb.2_Intron|USP39_uc010ysu.1_5'Flank|USP39_uc010ysv.1_5'Flank|C2orf68_uc002sqd.2_Frame_Shift_Del_p.Q85fs	NM_001013649	NP_001013671	Q2NKX9	CB068_HUMAN	hypothetical protein LOC388969											central_nervous_system(1)	1						CGCGCGGGCTGGAGGCAGGCG	0.662													4	2	---	---	---	---	
REV1	51455	broad.mit.edu	37	2	100017907	100017907	+	Intron	DEL	A	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100017907delA	uc002tad.2	-						REV1_uc002tac.2_Intron	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1						DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						TGACTTTGGCAAAAAAAAAAA	0.184								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					10	5	---	---	---	---	
RGPD5	84220	broad.mit.edu	37	2	113127926	113127926	+	Intron	DEL	G	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113127926delG	uc002ths.1	-						RGPD8_uc010fkk.1_Intron	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform						intracellular transport	cytoplasm	binding				0						CTTTTTTGGTGGGGGGGGGGG	0.189													4	2	---	---	---	---	
SERPINE2	5270	broad.mit.edu	37	2	224866712	224866716	+	Intron	DEL	CAGAT	-	-	rs145573218	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224866712_224866716delCAGAT	uc002vnu.2	-						SERPINE2_uc002vnt.2_Intron|SERPINE2_uc010zlr.1_Intron|SERPINE2_uc002vnv.2_Intron	NM_006216	NP_006207	P07093	GDN_HUMAN	plasminogen activator inhibitor type 1, member 2						negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		ttttttcccccagatagagactcgt	0.132													4	3	---	---	---	---	
VGLL4	9686	broad.mit.edu	37	3	11685143	11685144	+	Intron	INS	-	A	A	rs34152653		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11685143_11685144insA	uc003bwf.2	-						VGLL4_uc010hdx.1_5'UTR|VGLL4_uc003bwg.2_Intron	NM_014667	NP_055482	Q14135	VGLL4_HUMAN	vestigial like 4 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		ATGCAAAAGTTAAAAAAAAAAA	0.406													6	4	---	---	---	---	
ALDH1L1	10840	broad.mit.edu	37	3	125842954	125842963	+	Intron	DEL	ACACACACAC	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125842954_125842963delACACACACAC	uc003eim.1	-						ALDH1L1_uc010hse.1_Intron|ALDH1L1_uc011bki.1_Intron	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1						10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GGGCGCGCGGacacacacacacacacacac	0.400													5	5	---	---	---	---	
NMD3	51068	broad.mit.edu	37	3	160953120	160953121	+	Intron	INS	-	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160953120_160953121insA	uc003feb.1	+						NMD3_uc003fec.2_Intron|NMD3_uc003fed.1_Intron|NMD3_uc010hwh.2_Intron	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			tttctgttaggaaaaaaaaaaa	0.079													3	3	---	---	---	---	
WDR19	57728	broad.mit.edu	37	4	39280429	39280429	+	Intron	DEL	T	-	-	rs5857667		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39280429delT	uc003gtv.2	+						WDR19_uc011byi.1_Intron	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						TTTTGATGTATTTTTTTTAAT	0.388													5	4	---	---	---	---	
CCNH	902	broad.mit.edu	37	5	86704952	86704953	+	Intron	INS	-	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86704952_86704953insA	uc003kjb.2	-						CCNH_uc003kiy.1_5'Flank|CCNH_uc003kiz.1_Intron|CCNH_uc003kja.2_Intron	NM_001239	NP_001230	P51946	CCNH_HUMAN	cyclin H						G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	cyclin-dependent protein kinase activating kinase holoenzyme complex|holo TFIIH complex	protein kinase binding			ovary(2)|kidney(1)	3		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		AAGTTCTGAATAAAAAAAAAAA	0.228								Direct_reversal_of_damage|NER					6	3	---	---	---	---	
AFF4	27125	broad.mit.edu	37	5	132227765	132227766	+	Intron	INS	-	TT	TT			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132227765_132227766insTT	uc003kyd.2	-						AFF4_uc011cxk.1_Intron|AFF4_uc003kye.1_3'UTR	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	ALL1 fused gene from 5q31						transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTACTGAGATGTTACAATAATT	0.381													29	12	---	---	---	---	
CDC23	8697	broad.mit.edu	37	5	137548486	137548486	+	Intron	DEL	C	-	-	rs17234695		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137548486delC	uc003lcl.2	-						CDC23_uc003lcm.1_Intron	NM_004661	NP_004652	Q9UJX2	CDC23_HUMAN	cell division cycle protein 23						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1 phase of mitotic cell cycle|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase plate congression|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of exit from mitosis	anaphase-promoting complex|cytosol|nucleoplasm	binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AATAAGAGCACCACCAAGTCT	0.294													3	3	---	---	---	---	
SYCP2L	221711	broad.mit.edu	37	6	10964194	10964195	+	Intron	INS	-	T	T	rs149829365		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10964194_10964195insT	uc003mzo.2	+						SYCP2L_uc010jow.2_Intron	NM_001040274	NP_001035364	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like							nucleus				ovary(1)|skin(1)	2	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			GAACTTCTCCAttttttttttt	0.228													6	3	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38424703	38424703	+	Intron	DEL	A	-	-	rs72507353		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38424703delA	uc003tgu.2	-						AMPH_uc003tgv.2_Intron|AMPH_uc003tgt.2_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						GTTGTTAGTTaaaaaaaaaaa	0.318													4	2	---	---	---	---	
CAMK2B	816	broad.mit.edu	37	7	44260400	44260400	+	Intron	DEL	C	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44260400delC	uc003tkq.2	-						CAMK2B_uc003tkp.2_Intron|CAMK2B_uc003tkx.2_Intron|CAMK2B_uc010kyd.2_Intron|CAMK2B_uc003tkr.2_Intron|CAMK2B_uc003tks.2_Intron|CAMK2B_uc003tku.2_Intron|CAMK2B_uc003tkv.2_Intron|CAMK2B_uc003tkt.2_Intron|CAMK2B_uc003tkw.2_Intron|CAMK2B_uc010kyc.2_Intron|CAMK2B_uc003tkn.2_Intron	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2						TCCTGCACAGCCCCCCCCCAG	0.632													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142223659	142223659	+	Intron	DEL	A	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142223659delA	uc011krp.1	+						uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		ATGTTTTAAGAAAATAGTTCA	0.388													13	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49826831	49826831	+	IGR	DEL	A	-	-	rs141577976		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49826831delA								EFCAB1 (178961 upstream) : SNAI2 (3408 downstream)																							ggaaaaaggcaaaaaaaAAAa	0.070													6	4	---	---	---	---	
CA1	759	broad.mit.edu	37	8	86250862	86250889	+	Intron	DEL	TTTCTTTCTTTCTTTCTTTCTTTCTTTC	-	-	rs56255763	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86250862_86250889delTTTCTTTCTTTCTTTCTTTCTTTCTTTC	uc003ydh.2	-						CA13_uc003ydf.1_Intron|CA1_uc010mae.1_Intron|CA1_uc003ydi.2_Intron	NM_001738	NP_001729	P00915	CAH1_HUMAN	carbonic anhydrase I						one-carbon metabolic process	Golgi apparatus	carbonate dehydratase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dichlorphenamide(DB01144)|Ethinamate(DB01031)|Ethoxzolamide(DB00311)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Levetiracetam(DB01202)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Verapamil(DB00661)|Zonisamide(DB00909)	tttccttctttttctttctttctttctttctttctttctttctttctt	0.092													7	4	---	---	---	---	
FAM75A2	642265	broad.mit.edu	37	9	39361282	39361283	+	Frame_Shift_Ins	INS	-	T	T			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39361282_39361283insT	uc004abm.2	+	4	3549_3550	c.3520_3521insT	c.(3520-3522)ATTfs	p.I1174fs		NM_001040065	NP_001035154	Q5RGS2	F75A2_HUMAN	hypothetical protein LOC642265	1174						integral to membrane					0				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TTTTCAGTGGATTTTTTCAAAG	0.446													19	32	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68455229	68455230	+	IGR	INS	-	AC	AC			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68455229_68455230insAC								FAM27B (661040 upstream) : MIR1299 (547009 downstream)																							GGGAGACTTCTGTGCAGAGGCT	0.584													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	27620447	27620448	+	IGR	INS	-	TT	TT	rs142562667	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27620447_27620448insTT								LOC387646 (79212 upstream) : PTCHD3 (66669 downstream)																							ACTCAGGCTTCTTTCCGCCAAG	0.465													4	2	---	---	---	---	
MKX	283078	broad.mit.edu	37	10	27964498	27964498	+	Intron	DEL	A	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27964498delA	uc001ity.3	-						MKX_uc001itx.3_Intron	NM_173576	NP_775847	Q8IYA7	MKX_HUMAN	mohawk homeobox						muscle organ development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						AAAGAAAAGCAAAAATTCAAT	0.363													47	10	---	---	---	---	
PPRC1	23082	broad.mit.edu	37	10	103909487	103909487	+	Intron	DEL	A	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103909487delA	uc001kum.2	+						PPRC1_uc001kun.2_Intron|PPRC1_uc010qqj.1_Intron|PPRC1_uc009xxa.2_Intron|NOLC1_uc001kuo.2_5'Flank|NOLC1_uc001kup.2_5'Flank|NOLC1_uc001kuq.2_5'Flank|NOLC1_uc009xxb.1_5'Flank|NOLC1_uc001kur.2_5'Flank	NM_015062	NP_055877	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		agactgtctcaaaaaaaaaaa	0.204													6	3	---	---	---	---	
EBF3	253738	broad.mit.edu	37	10	131760658	131760659	+	Intron	INS	-	T	T	rs141360240	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131760658_131760659insT	uc001lki.1	-						EBF3_uc010qur.1_3'UTR	NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN	early B-cell factor 3						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding			central_nervous_system(1)|pancreas(1)	2		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		TTCTCGCTTAATTTTTTTTTTC	0.470													4	3	---	---	---	---	
PAMR1	25891	broad.mit.edu	37	11	35462851	35462851	+	Intron	DEL	A	-	-	rs79736526		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35462851delA	uc001mwg.2	-						PAMR1_uc001mwf.2_Intron|PAMR1_uc010rew.1_Intron|PAMR1_uc010rex.1_Intron	NM_001001991	NP_001001991	Q6UXH9	PAMR1_HUMAN	regeneration associated muscle protease isoform						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2						TCTTGAGGTCAAAAAAAAAAA	0.393													5	3	---	---	---	---	
TRPC6	7225	broad.mit.edu	37	11	101362567	101362567	+	Intron	DEL	C	-	-	rs111367906		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101362567delC	uc001pgk.3	-						TRPC6_uc009ywy.2_Intron|TRPC6_uc009ywz.1_Intron	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,						axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		GAGAAACAttctttttttttt	0.149													5	3	---	---	---	---	
LRP6	4040	broad.mit.edu	37	12	12317062	12317063	+	Intron	INS	-	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12317062_12317063insA	uc001rah.3	-						BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Intron	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein						cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				agacaccgtttaaaaaaaaaaa	0.178													6	3	---	---	---	---	
SRRM4	84530	broad.mit.edu	37	12	119560098	119560105	+	Intron	DEL	AGGAAGGA	-	-	rs146974381	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119560098_119560105delAGGAAGGA	uc001txa.1	+							NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						gcaggaaggcaggaaggaaggaaggaag	0.197													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	120706716	120706717	+	IGR	INS	-	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120706716_120706717insA								PXN (3153 upstream) : NME2P1 (13223 downstream)																							gagactctgtcaaaaaaaaaaa	0.030													4	2	---	---	---	---	
C14orf21	161424	broad.mit.edu	37	14	24772593	24772593	+	Intron	DEL	T	-	-	rs112529240		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24772593delT	uc001wol.1	+						C14orf21_uc001wom.1_Intron	NM_174913	NP_777573	Q86U38	CN021_HUMAN	hypothetical protein LOC161424								RNA binding			breast(2)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(265;0.0185)		ACCCAGCTAAttttttttttt	0.313													10	5	---	---	---	---	
EIF5	1983	broad.mit.edu	37	14	103807218	103807218	+	Intron	DEL	C	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103807218delC	uc001ymq.2	+						EIF5_uc001ymr.2_Intron|EIF5_uc001yms.2_Intron|EIF5_uc001ymt.2_Intron|EIF5_uc001ymu.2_Intron	NM_001969	NP_001960	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5						regulation of translational initiation|RNA metabolic process	cytosol	GTP binding|GTPase activity|translation initiation factor activity			pancreas(1)|breast(1)|skin(1)	3		Melanoma(154;0.155)	Epithelial(46;0.182)			GCAGTTTCCTCCTCTGTGACC	0.383													6	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22691260	22691260	+	IGR	DEL	T	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22691260delT								MIR1268 (177980 upstream) : GOLGA8DP (11025 downstream)																							GGTTGCTTCATCTAGGAGAAG	0.473													3	5	---	---	---	---	
BNIP2	663	broad.mit.edu	37	15	59972354	59972354	+	Intron	DEL	T	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59972354delT	uc010uhc.1	-						BNIP2_uc010uhb.1_Intron	NM_004330	NP_004321	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 2						anti-apoptosis|apoptosis|positive regulation of muscle cell differentiation	nuclear envelope|perinuclear region of cytoplasm	calcium ion binding|GTPase activator activity|protein binding			ovary(1)	1						AAAACTCAAGTTTTTTTTTTT	0.299													6	3	---	---	---	---	
PTPN9	5780	broad.mit.edu	37	15	75816478	75816478	+	Intron	DEL	C	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75816478delC	uc002bal.2	-							NM_002833	NP_002824	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type							cytoplasmic part	non-membrane spanning protein tyrosine phosphatase activity|protein binding			lung(1)|skin(1)	2						aaaaaaaaaaCAAAGTCCAAA	0.204													50	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	76072941	76072941	+	Intron	DEL	C	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76072941delC	uc010umm.1	+						uc002bba.1_5'Flank					SubName: Full=cDNA FLJ59077, highly similar to Golgin subfamily A member 6;																		ATCTCGGCCTCCCCCTAGTAA	0.537													71	72	---	---	---	---	
TBC1D2B	23102	broad.mit.edu	37	15	78316386	78316386	+	Intron	DEL	T	-	-	rs1992470	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78316386delT	uc002bcy.3	-						TBC1D2B_uc010bla.2_Intron	NM_144572	NP_653173	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B isoform a							intracellular	protein binding|Rab GTPase activator activity			ovary(1)|large_intestine(1)|breast(1)	3						GGAAAAAAAATAAGTGTGCAG	0.483													8	4	---	---	---	---	
MCTP2	55784	broad.mit.edu	37	15	94927462	94927462	+	Intron	DEL	T	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94927462delT	uc002btj.2	+						MCTP2_uc002bti.2_Intron|MCTP2_uc010boj.2_Intron|MCTP2_uc010bok.2_Intron|MCTP2_uc002btk.3_Intron|MCTP2_uc002btl.2_Intron	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			AATTTTATTGTTTTTTTCTTT	0.358													4	2	---	---	---	---	
SCNN1B	6338	broad.mit.edu	37	16	23383255	23383255	+	Intron	DEL	G	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23383255delG	uc002dln.2	+							NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta						excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	CCGGGTTTATGGGGCCAAGGC	0.642													65	19	---	---	---	---	
SLC5A11	115584	broad.mit.edu	37	16	24869749	24869750	+	Intron	INS	-	TGAA	TGAA	rs140546428	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24869749_24869750insTGAA	uc002dmu.2	+						SLC5A11_uc002dms.2_Intron|SLC5A11_uc010vcd.1_Intron|SLC5A11_uc002dmt.2_Intron|SLC5A11_uc010vce.1_Intron|SLC5A11_uc010bxt.2_Intron	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose						apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)		TGAATATGTGTtgaatgaatga	0.302													1	5	---	---	---	---	
EDC4	23644	broad.mit.edu	37	16	67911712	67911712	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67911712delC	uc002eur.2	+	7	1024	c.858delC	c.(856-858)ATCfs	p.I286fs	EDC4_uc010cer.2_5'UTR|EDC4_uc010vkg.1_Frame_Shift_Del_p.I218fs|EDC4_uc010ces.1_Frame_Shift_Del_p.I129fs|EDC4_uc002eus.2_Frame_Shift_Del_p.I16fs	NM_014329	NP_055144	Q6P2E9	EDC4_HUMAN	autoantigen RCD8	286					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|central_nervous_system(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		TTAGCCAGATCAAGCAGGGCT	0.582													86	55	---	---	---	---	
ADAMTS18	170692	broad.mit.edu	37	16	77318083	77318098	+	Intron	DEL	TGTGATCTCCGCTCAC	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77318083_77318098delTGTGATCTCCGCTCAC	uc002ffc.3	-							NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						agtggtgtggtgtgatctccgctcactgcaatctct	0.060													4	2	---	---	---	---	
HSDL1	83693	broad.mit.edu	37	16	84165089	84165092	+	Intron	DEL	TCTA	-	-	rs36192181	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84165089_84165092delTCTA	uc002fhk.2	-						HSDL1_uc010vnv.1_Intron	NM_031463	NP_113651	Q3SXM5	HSDL1_HUMAN	hydroxysteroid dehydrogenase like 1 isoform a							mitochondrion	oxidoreductase activity|protein binding				0						ACAGTTTCAGtctatctatctatc	0.206													4	2	---	---	---	---	
FANCA	2175	broad.mit.edu	37	16	89845035	89845036	+	Intron	INS	-	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89845035_89845036insA	uc002fou.1	-						FANCA_uc010vpn.1_Intron	NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform						DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		agactccaactaaaaaaaaaaa	0.114			D|Mis|N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	2	---	---	---	---	
RPH3AL	9501	broad.mit.edu	37	17	69293	69294	+	Intron	INS	-	TTTCT	TTTCT	rs146351269	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69293_69294insTTTCT	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		cggccTAATAGTTTCATTTCTT	0.099													3	3	---	---	---	---	
PLSCR3	57048	broad.mit.edu	37	17	7307104	7307104	+	Intron	DEL	C	-	-	rs71383487		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7307104delC	uc002ggr.1	-						PLSCR3_uc010cmg.1_Intron|C17orf61_uc002ggs.2_Intron	NM_020360	NP_065093	Q9NRY6	PLS3_HUMAN	phospholipid scramblase 3						phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|calcium-dependent protein binding|phospholipid scramblase activity|SH3 domain binding				0		Prostate(122;0.173)				AGAAAGGGCACCCCCCCCCCC	0.627													4	2	---	---	---	---	
DHX8	1659	broad.mit.edu	37	17	41597447	41597454	+	Intron	DEL	CACTGGCT	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41597447_41597454delCACTGGCT	uc002idu.1	+						DHX8_uc010wig.1_Intron	NM_004941	NP_004932	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8							catalytic step 2 spliceosome	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|pancreas(1)	4		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		CACATGCTGACACTGGCTAGACTGACCC	0.481													99	37	---	---	---	---	
TLK2	11011	broad.mit.edu	37	17	60654328	60654328	+	Intron	DEL	T	-	-	rs72108433		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60654328delT	uc010ddp.2	+						TLK2_uc002izx.3_Intron|TLK2_uc002izz.3_Intron|TLK2_uc002jaa.3_Intron|TLK2_uc010wpd.1_Intron	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						tttcttcttcttttttttttt	0.179													3	4	---	---	---	---	
KIAA0195	9772	broad.mit.edu	37	17	73467794	73467795	+	Intron	INS	-	A	A	rs148275503		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73467794_73467795insA	uc002jnz.3	+							NM_014738	NP_055553	Q12767	K0195_HUMAN	hypothetical protein LOC9772						ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism			ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			gactccgtctcaaaaaaaaaaa	0.188													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	112402	112405	+	Intron	DEL	AACC	-	-	rs111811281		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:112402_112405delAACC	uc002kke.2	+											Homo sapiens Rho-associated, coiled-coil containing protein kinase 1, mRNA (cDNA clone IMAGE:5269982), complete cds.																		CCCTGCCCCGAACCACCCGACCCC	0.711													10	5	---	---	---	---	
PHLPP1	23239	broad.mit.edu	37	18	60562283	60562283	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60562283delT	uc002lis.2	+	6	748	c.570delT	c.(568-570)CATfs	p.H190fs		NM_194449	NP_919431	O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein	702	LRR 3.				apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity				0						CCAATAATCATTTAGGGGACT	0.438													28	18	---	---	---	---	
LMNB2	84823	broad.mit.edu	37	19	2433666	2433666	+	Intron	DEL	C	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2433666delC	uc002lvy.2	-						LMNB2_uc002lwa.1_Intron	NM_032737	NP_116126	Q03252	LMNB2_HUMAN	lamin B2							nuclear inner membrane	structural molecule activity			large_intestine(1)|ovary(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCCTGATCACCCCCATCAGC	0.677													6	3	---	---	---	---	
ICAM3	3385	broad.mit.edu	37	19	10449990	10449991	+	Intron	DEL	GT	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10449990_10449991delGT	uc002mob.2	-						ICAM3_uc010dxd.1_Intron|ICAM3_uc010xlf.1_Intron	NM_002162	NP_002153	P32942	ICAM3_HUMAN	intercellular adhesion molecule 3 precursor						cell-cell adhesion|regulation of immune response	integral to plasma membrane	integrin binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)			AGCATGAGGGGTGTGTGTGTGT	0.376													3	4	---	---	---	---	
GADD45GIP1	90480	broad.mit.edu	37	19	13067472	13067473	+	Intron	INS	-	AAAC	AAAC			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13067472_13067473insAAAC	uc002mwb.2	-							NM_052850	NP_443082	Q8TAE8	G45IP_HUMAN	growth arrest and DNA-damage-inducible, gamma						cell cycle|interspecies interaction between organisms	nucleus	protein binding			ovary(1)|skin(1)	2						ttgtctccaaaaaacaaacaaa	0.153													5	3	---	---	---	---	
ANKRD27	84079	broad.mit.edu	37	19	33108660	33108660	+	Intron	DEL	T	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33108660delT	uc002ntn.1	-							NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)						early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					TCTGATTTAGttttttttttt	0.109													4	3	---	---	---	---	
BBC3	27113	broad.mit.edu	37	19	47724914	47724917	+	3'UTR	DEL	CCCC	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47724914_47724917delCCCC	uc002pgf.3	-	4					BBC3_uc010xyl.1_3'UTR|BBC3_uc010eky.2_3'UTR|BBC3_uc010ekz.2_3'UTR	NM_014417	NP_055232	Q9BXH1	BBC3_HUMAN	BCL2 binding component 3 isoform 4						activation of caspase activity|activation of pro-apoptotic gene products|cellular response to hypoxia|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|negative regulation of growth|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria|positive regulation of thymocyte apoptosis|protein insertion into mitochondrial membrane involved in induction of apoptosis|reduction of endoplasmic reticulum calcium ion concentration|release of cytochrome c from mitochondria|release of sequestered calcium ion into cytosol	cytosol|mitochondrial outer membrane	protein binding|protein binding				0		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.000179)|OV - Ovarian serous cystadenocarcinoma(262;0.00029)|Epithelial(262;0.0103)|GBM - Glioblastoma multiforme(486;0.0234)		GGAGTGGCTGCCCCGGCCCGCCCC	0.691													5	3	---	---	---	---	
LAIR1	3903	broad.mit.edu	37	19	54872240	54872241	+	Intron	INS	-	A	A			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54872240_54872241insA	uc002qfk.1	-						LAIR1_uc002qfl.1_Intron|LAIR1_uc002qfm.1_Intron|LAIR1_uc002qfn.1_Intron|LAIR1_uc010yex.1_Intron|LAIR1_uc002qfo.2_Intron	NM_002287	NP_002278	Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like							integral to membrane|plasma membrane	protein binding|receptor activity			ovary(4)	4	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		TGGGAACCCACTCCCCACCCAG	0.599													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	2056544	2056545	+	IGR	DEL	AC	-	-	rs72165579		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2056544_2056545delAC								PDYN (81841 upstream) : STK35 (25983 downstream)																							AAAAAAAAATacacacacacac	0.178													11	5	---	---	---	---	
C20orf70	140683	broad.mit.edu	37	20	31767238	31767238	+	Intron	DEL	A	-	-	rs77930653		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31767238delA	uc002wyo.1	+							NM_080574	NP_542141	Q96DR5	SPLC2_HUMAN	chromosome 20 open reading frame 70 precursor							extracellular region	lipid binding			ovary(1)|central_nervous_system(1)	2						tctgtctcagaaaaaaaaaaa	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	42043712	42043712	+	IGR	DEL	A	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42043712delA								PTPRT (225155 upstream) : SFRS6 (42792 downstream)																							ttcaatatggaaaaaaaaaaa	0.005													4	2	---	---	---	---	
STX16	8675	broad.mit.edu	37	20	57246534	57246536	+	Intron	DEL	TAA	-	-	rs142197104		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57246534_57246536delTAA	uc002xzi.2	+						STX16_uc010zzq.1_Intron|STX16_uc002xzk.2_Intron|STX16_uc002xzm.2_Intron|STX16_uc002xzj.2_Intron|STX16_uc002xzl.2_Intron	NM_001001433	NP_001001433	O14662	STX16_HUMAN	syntaxin 16 isoform a						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|microsome|SNARE complex	SNAP receptor activity			ovary(1)	1	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			gtgtgtatattaatattaatcaa	0.207													6	4	---	---	---	---	
UMODL1	89766	broad.mit.edu	37	21	43538995	43538995	+	Intron	DEL	G	-	-	rs71986414		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43538995delG	uc002zaf.1	+						UMODL1_uc002zad.1_Intron|UMODL1_uc002zae.1_Intron|UMODL1_uc002zag.1_Intron|UMODL1_uc002zal.1_5'Flank	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor							cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						TTACTGGTTTGGGGGGGGAAA	0.567													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44756915	44756916	+	IGR	INS	-	CAC	CAC	rs145388929		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44756915_44756916insCAC								CRYAA (164002 upstream) : SIK1 (77482 downstream)																							accaccaccatcaccaccacca	0.000													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44757198	44757200	+	IGR	DEL	CAC	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44757198_44757200delCAC								CRYAA (164285 upstream) : SIK1 (77198 downstream)																							ccatcaccatcaccaccaccacc	0.000													4	2	---	---	---	---	
COL6A1	1291	broad.mit.edu	37	21	47407704	47407704	+	Intron	DEL	G	-	-	rs66929103		TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47407704delG	uc002zhu.1	+							NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	AGGGGACGGCGGGGGTCCAGA	0.716													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20151725	20151726	+	IGR	INS	-	ACC	ACC	rs138268702	by1000genomes	TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151725_20151726insACC								ZDHHC8 (16196 upstream) : LOC150197 (42129 downstream)																							ccaccatcactaccaccaccac	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28776859	28776859	+	IGR	DEL	G	-	-			TCGA-BL-A13J-01	TCGA-BL-A13J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28776859delG								None (None upstream) : None (None downstream)																							GCACTACACTGGGAAAAAATC	0.318													4	2	---	---	---	---	
